Monitoring internal organ motion with continuous wave radar in CT

International Nuclear Information System (INIS)

Pfanner, Florian; Maier, Joscha; Allmendinger, Thomas; Flohr, Thomas; Kachelrieß, Marc

2013-01-01

Purpose: To avoid motion artifacts in medical imaging or to minimize the exposure of healthy tissues in radiation therapy, medical devices are often synchronized with the patient's respiratory motion. Today's respiratory motion monitors require additional effort to prepare the patients, e.g., mounting a motion belt or placing an optical reflector on the patient's breast. Furthermore, they are not able to measure internal organ motion without implanting markers. An interesting alternative to assess the patient's organ motion is continuous wave radar. The aim of this work is to design, implement, and evaluate such a radar system focusing on application in CT.Methods: The authors designed a radar system operating in the 860 MHz band to monitor the patient motion. In the intended application of the radar system, the antennas are located close to the patient's body inside the table of a CT system. One receive and four transmitting antennas are used to avoid the requirement of exact patient positioning. The radar waves propagate into the patient's body and are reflected at tissue boundaries, for example at the borderline between muscle and adipose tissue, or at the boundaries of organs. At present, the authors focus on the detection of respiratory motion. The radar system consists of the hardware mentioned above as well as of dedicated signal processing software to extract the desired information from the radar signal. The system was evaluated using simulations and measurements. To simulate the radar system, a simulation model based on radar and wave field equations was designed and 4D respiratory-gated CT data sets were used as input. The simulated radar signals and the measured data were processed in the same way. The radar system hardware and the signal processing algorithms were tested with data from ten volunteers. As a reference, the respiratory motion signal was recorded using a breast belt simultaneously with the radar measurements.Results: Concerning the

Rectal Balloon for the Immobilization of the Prostate Internal Motion

International Nuclear Information System (INIS)

Lee, Sang Kyu; Beak, Jong Geal; Kim, Joo Ho; Jeon, Byong Chul; Cho, Jeong Hee; Kim, Dong Wook; Song, Tae Soo; Cho, Jae Ho; Na, Soo Kyong

2005-01-01

The using of endo-rectal balloon has proposed as optimal method that minimized the motion of prostate and the dose of rectum wall volume for treated prostate cancer patients, so we make the customized rectal balloon device. In this study, we analyzed the efficiency of the Self-customized rectal balloon in the aspects of its reproducibility. In 5 patients, for treatment planning, each patient was acquired CT slice images in state of with and without rectal balloon. Also they had CT scanning same repeated third times in during radiation treatment (IMRT). In each case, we analyzed the deviation of rectal balloon position and verified the isodose distribution of rectum wall at closed prostate. Using the rectal balloon, we minimized the planning target volume (PTV) by decreased the internal motion of prostate and overcome the dose limit of radiation therapy in prostate cancer by increased the gap between the rectum wall and high dose region. The using of rectal balloon, although, was reluctant to treat by patients. View a point of immobilization of prostate internal motion and dose escalation of GTV (gross tumor volume), its using consider large efficient for treated prostate cancer patients.

A unified internal model theory to resolve the paradox of active versus passive self-motion sensation.

Science.gov (United States)

Laurens, Jean; Angelaki, Dora E

2017-10-18

Brainstem and cerebellar neurons implement an internal model to accurately estimate self-motion during externally generated ('passive') movements. However, these neurons show reduced responses during self-generated ('active') movements, indicating that predicted sensory consequences of motor commands cancel sensory signals. Remarkably, the computational processes underlying sensory prediction during active motion and their relationship to internal model computations during passive movements remain unknown. We construct a Kalman filter that incorporates motor commands into a previously established model of optimal passive self-motion estimation. The simulated sensory error and feedback signals match experimentally measured neuronal responses during active and passive head and trunk rotations and translations. We conclude that a single sensory internal model can combine motor commands with vestibular and proprioceptive signals optimally. Thus, although neurons carrying sensory prediction error or feedback signals show attenuated modulation, the sensory cues and internal model are both engaged and critically important for accurate self-motion estimation during active head movements.

Internal friction due to domain-wall motion in martensitically transformed A15 compounds

International Nuclear Information System (INIS)

Snead, C.L. Jr.; Welch, D.O.

1985-01-01

A lattice instability in A15 materials in some cases leads to a cubic-to-tetragonal martensitic transformation at low temperatures. The transformed material orients in lamellae with c axes alternately aligned along the directions producing domain walls between the lamellae. An internal-friction (delta) feature below T/sub m/ is attributed to stress-induced domain-wall motion. The magnitude of the friction increases as temperature is lowered below T/sub m/ as (1-c/a) increases, and behaves as (1-c/a) 2 from T/sub m/ down to the superconducting critical temperature where the increasing tetragonality is inhibited. The effect of strain in the lattice is to decrease the domain-wall internal friction, but not affect T/sub m/. Neutron-induced disorder and the addition of some third-elements in alloying decrease both delta and T/sub m/, with some elements reducing only the former. Less than 1 at. % H is seen to completely suppress both delta and T/sub m. Martensitically transformed V 2 Zr demonstrates low-temperature internal-friction and modulus behavior consists with easy β/m wall motion relative to the easy m/m motion of the A15's. For the V 2 Zr, a peak in delta is observed, qualitatively in agreement with expected β/m wall motion

SU-E-J-235: Audiovisual Biofeedback Improves the Correlation Between Internal and External Respiratory Motion

Energy Technology Data Exchange (ETDEWEB)

Lee, D; Pollock, S; Keall, P [Radiation Physics Laboratory, Sydney Medical School, The University of Sydney, NSW (Australia); Greer, P [School of Mathematical and Physical Sciences, The University of Newcastle, Newcastle, NSW (Australia); Department of Radiation Oncology, Calvary Mater Newcastle, Newcastle, NSW (Australia); Ludbrook, J [Department of Radiation Oncology, Calvary Mater Newcastle, Newcastle, NSW (Australia); Paganelli, C [Dipartimento di Elettronica, Informazione e Bioingegneria, Politecnico di Milano, Milano (Italy); Kim, T [Radiation Physics Laboratory, Sydney Medical School, The University of Sydney, NSW (Australia); Department of Radiation Oncology, University of Virginia Health System, Charlottesville, NC (United States)

2015-06-15

Purpose: External respiratory surrogates are often used to predict internal lung tumor motion for beam gating but the assumption of correlation between external and internal surrogates is not always verified resulting in amplitude mismatch and time shift. To test the hypothesis that audiovisual (AV) biofeedback improves the correlation between internal and external respiratory motion, in order to improve the accuracy of respiratory-gated treatments for lung cancer radiotherapy. Methods: In nine lung cancer patients, 2D coronal and sagittal cine-MR images were acquired across two MRI sessions (pre- and mid-treatment) with (1) free breathing (FB) and (2) AV biofeedback. External anterior-posterior (AP) respiratory motions of (a) chest and (b) abdomen were simultaneously acquired with physiological measurement unit (PMU, 3T Skyra, Siemens Healthcare Erlangen, Germany) and real-time position management (RPM) system (Varian, Palo Alto, USA), respectively. Internal superior-inferior (SI) respiratory motions of (c) lung tumor (i.e. centroid of auto-segmented lung tumor) and (d) diaphragm (i.e. upper liver dome) were measured from individual cine-MR images across 32 dataset. The four respiratory motions were then synchronized with the cine-MR image acquisition time. Correlation coefficients were calculated in the time variation of two nominated respiratory motions: (1) chest-abdomen, (2) abdomen-diaphragm and (3) diaphragm-lung tumor. The three combinations were compared between FB and AV biofeedback. Results: Compared to FB, AV biofeedback improved chest-abdomen correlation by 17% (p=0.005) from 0.75±0.23 to 0.90±0.05 and abdomen-diaphragm correlation by 4% (p=0.058) from 0.91±0.11 to 0.95±0.05. Compared to FB, AV biofeedback improved diaphragm-lung tumor correlation by 12% (p=0.023) from 0.65±0.21 to 0.74±0.16. Conclusions: Our results demonstrated that AV biofeedback significantly improved the correlation of internal and external respiratory motion, thus

SU-E-J-235: Audiovisual Biofeedback Improves the Correlation Between Internal and External Respiratory Motion

International Nuclear Information System (INIS)

Lee, D; Pollock, S; Keall, P; Greer, P; Ludbrook, J; Paganelli, C; Kim, T

2015-01-01

Purpose: External respiratory surrogates are often used to predict internal lung tumor motion for beam gating but the assumption of correlation between external and internal surrogates is not always verified resulting in amplitude mismatch and time shift. To test the hypothesis that audiovisual (AV) biofeedback improves the correlation between internal and external respiratory motion, in order to improve the accuracy of respiratory-gated treatments for lung cancer radiotherapy. Methods: In nine lung cancer patients, 2D coronal and sagittal cine-MR images were acquired across two MRI sessions (pre- and mid-treatment) with (1) free breathing (FB) and (2) AV biofeedback. External anterior-posterior (AP) respiratory motions of (a) chest and (b) abdomen were simultaneously acquired with physiological measurement unit (PMU, 3T Skyra, Siemens Healthcare Erlangen, Germany) and real-time position management (RPM) system (Varian, Palo Alto, USA), respectively. Internal superior-inferior (SI) respiratory motions of (c) lung tumor (i.e. centroid of auto-segmented lung tumor) and (d) diaphragm (i.e. upper liver dome) were measured from individual cine-MR images across 32 dataset. The four respiratory motions were then synchronized with the cine-MR image acquisition time. Correlation coefficients were calculated in the time variation of two nominated respiratory motions: (1) chest-abdomen, (2) abdomen-diaphragm and (3) diaphragm-lung tumor. The three combinations were compared between FB and AV biofeedback. Results: Compared to FB, AV biofeedback improved chest-abdomen correlation by 17% (p=0.005) from 0.75±0.23 to 0.90±0.05 and abdomen-diaphragm correlation by 4% (p=0.058) from 0.91±0.11 to 0.95±0.05. Compared to FB, AV biofeedback improved diaphragm-lung tumor correlation by 12% (p=0.023) from 0.65±0.21 to 0.74±0.16. Conclusions: Our results demonstrated that AV biofeedback significantly improved the correlation of internal and external respiratory motion, thus

Predictive piston motion control in a free-piston internal combustion engine

Energy Technology Data Exchange (ETDEWEB)

Mikalsen, R.; Jones, E.; Roskilly, A.P. [Sir Joseph Swan Institute for Energy Research, Newcastle University, Newcastle upon Tyne, NE1 7RU England (United Kingdom)

2010-05-15

A piston motion controller for a free-piston internal combustion engine is presented. To improve dynamic performance in the control of the piston motion and engine compression ratio, the controller response is determined from a prediction of engine top dead centre error rather than the measured value from the previous cycle. The proposed control approach showed superior performance compared with that of standard PI feedback control known from the literature due to a reduced control action time delay. The manipulation of fuel injection timing to reduce in-cylinder pressure peaks and cycle-to-cycle variations was also studied, indicating that with the piston motion estimation, the injection timing is a powerful control variable for this purpose. (author)

Motion of air bubbles in stagnant water condition

International Nuclear Information System (INIS)

Bezdegumeli, U.; Ozdemir, S.; Yesin, O.

2004-01-01

Full text: In this study, air bubble motion in stagnant water condition in a vertical pipe is investigated experimentally. For this purpose, a test set-up was designed and constructed. Motions of single bubbles, having different diameters in the range of 3.0-4.8 mm, were recorded by using a monochrome camera, an image capture card and a PC. Recorded video images were processed to analyse bubble motion and to obtain the necessary data. The purpose of the study is to determine the variation of bubble axial velocity and bubble drag coefficient as a function of equivalent bubble diameter and bubble Reynolds number, Re b . Therefore, detailed information for this range of bubble diameters was obtained. The results have shown good consistency with the previous studies found in the literature

Motion of air bubbles in stagnant water condition

International Nuclear Information System (INIS)

Bezdegumeli, U.; Ozdemir, S.; Yesin, O.

2004-01-01

In this study, air bubble motion in stagnant water condition in a vertical pipe of 4.6 cm diameter is investigated experimentally. For this purpose, a test set-up was designed and constructed. Motions of single bubbles, having different diameters in the range of 3.0-4.8 mm, were recorded by using a monochrome camera, an image capture card and a PC. Recorded video images were processed to analyse bubble motion and to obtain the necessary data. The purpose of the study is to determine the variation of bubble axial velocity and bubble drag coefficient as a function of equivalent bubble diameter and bubble Reynolds number, Re b . Therefore, detailed information for this range of bubble diameters was obtained. The results have shown good consistency with the previous studies found in the literature. (author)

Features of internal water supply and water disposal of shopping centers

Directory of Open Access Journals (Sweden)

Orlov Evgeniy Vladimirovich

2014-01-01

Full Text Available Pipeline from an external system should be inlet in the part of the building where a large number of water folding devices will be concentrated. As a rule, for shopping centers with a lot of water consumers it is necessary to make not less than three inputs, each of them should be connected to different areas of an external ring water supply system in order to make the work of the system more reliable.The places for water folding fittings in shopping centers are the following. The water folding devices: mixers are placed in sanitary cabins of shopping centers. Usually, for for water saving in buildings with a big pass-through capacity per hour it is reasonable to use contactless mixers, which are turned on upon raising a hand with a help of motion sensor or light sensor. Another important argument in favor of such mixers is prevention of infections spread for the reason that the consumer doesn't touch the device, so, the risk of bacteria transmission via the device decreases. Such mixer supplies water with a demanded expense and temperature. As a rule, water for such mixers moves from the centralized internal water supply system of hot water, mixing up with cold water. If there is no centralized hot water supply system, it is possible to use hot water storage heaters in case of a small number of visitors or to reject mixers at all in favor of the cranes giving water of only one temperature (cold, which is also practiced.For the branch of economic and household the water receivers are used, which are present in sanitary cabins in most cases by toilet bowls, wash basins, urinals.

Theoretical and experimental investigation into structural and fluid motions at low frequencies in water distribution pipes

Science.gov (United States)

Gao, Yan; Liu, Yuyou

2017-06-01

Vibrational energy is transmitted in buried fluid-filled pipes in a variety of wave types. Axisymmetric (n = 0) waves are of practical interest in the application of acoustic techniques for the detection of leaks in underground pipelines. At low frequencies n = 0 waves propagate longitudinally as fluid-dominated (s = 1) and shell-dominated (s = 2) waves. Whilst sensors such as hydrophones and accelerometers are commonly used to detect leaks in water distribution pipes, the mechanism governing the structural and fluid motions is not well documented. In this paper, the low-frequency behaviour of the pipe wall and the contained fluid is investigated. For most practical pipework systems, these two waves are strongly coupled; in this circumstance the ratios of the radial pipe wall displacements along with the internal pressures associated with these two wave types are obtained. Numerical examples show the relative insensitivity of the structural and fluid motions to the s = 2 wave for both metallic and plastic pipes buried in two typical soils. It is also demonstrated that although both acoustic and vibration sensors at the same location provide the identical phase information of the transmitted signals, pressure responses have significantly higher levels than acceleration responses, and thus hydrophones are better suited in a low signal-to-noise ratio (SNR) environment. This is supported by experimental work carried out at a leak detection facility. Additional pressure measurements involved excitation of the fluid and the pipe fitting (hydrant) on a dedicated water pipe. This work demonstrates that the s = 1 wave is mainly responsible for the structural and fluid motions at low frequencies in water distribution pipes as a result of water leakage and direct pipe excitation.

The use of CT density changes at internal tissue interfaces to correlate internal organ motion with an external surrogate

Energy Technology Data Exchange (ETDEWEB)

Gaede, Stewart; Yu, Edward; Van Dyk, Jake; Battista, Jerry [Radiation Oncology Program, London Regional Cancer Program, London, Ontario (Canada); Carnes, Gregory; Lee, Ting-Yim [Department of Medical Biophysics, University of Western Ontario, London, Ontario (Canada)

2009-01-21

The purpose of this paper is to describe a non-invasive method to monitor the motion of internal organs affected by respiration without using external markers or spirometry, to test the correlation with external markers, and to calculate any time shift between the datasets. Ten lung cancer patients were CT scanned with a GE LightSpeed Plus 4-Slice CT scanner operating in a cine mode. We retrospectively reconstructed the raw CT data to obtain consecutive 0.5 s reconstructions at 0.1 s intervals to increase image sampling. We defined regions of interest containing tissue interfaces, including tumour/lung interfaces that move due to breathing on multiple axial slices and measured the mean CT number versus respiratory phase. Tumour motion was directly correlated with external marker motion, acquired simultaneously, using the sample coefficient of determination, r{sup 2}. Only three of the ten patients showed correlation higher than r{sup 2} = 0.80 between tumour motion and external marker position. However, after taking into account time shifts (ranging between 0 s and 0.4 s) between the two data sets, all ten patients showed correlation better than r{sup 2} = 0.8. This non-invasive method for monitoring the motion of internal organs is an effective tool that can assess the use of external markers for 4D-CT imaging and respiratory-gated radiotherapy on a patient-specific basis.

Field theory of the spinning electron: Internal motions

OpenAIRE

Salesi, Giovanni; Recami, Erasmo

1996-01-01

We present here a field theory of the spinning electron, by writing down a new equation for the 4-velocity field v^mu (different from that of Dirac theory), which allows a classically intelligible description of the electron. Moreover, we make explicit the noticeable kinematical properties of such velocity field (which also result different from the ordinary ones). At last, we analyze the internal zitterbewegung (zbw) motions, for both time-like and light-like speeds. We adopt in this paper t...

33 CFR 2.24 - Internal waters.

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Internal waters. 2.24 Section 2.24 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY GENERAL JURISDICTION Jurisdictional Terms § 2.24 Internal waters. (a) With respect to the United States, internal waters means the...

Molecular dynamics simulation of nonlinear spectroscopies of intermolecular motions in liquid water.

Science.gov (United States)

Yagasaki, Takuma; Saito, Shinji

2009-09-15

Water is the most extensively studied of liquids because of both its ubiquity and its anomalous thermodynamic and dynamic properties. The properties of water are dominated by hydrogen bonds and hydrogen bond network rearrangements. Fundamental information on the dynamics of liquid water has been provided by linear infrared (IR), Raman, and neutron-scattering experiments; molecular dynamics simulations have also provided insights. Recently developed higher-order nonlinear spectroscopies open new windows into the study of the hydrogen bond dynamics of liquid water. For example, the vibrational lifetimes of stretches and a bend, intramolecular features of water dynamics, can be accurately measured and are found to be on the femtosecond time scale at room temperature. Higher-order nonlinear spectroscopy is expressed by a multitime correlation function, whereas traditional linear spectroscopy is given by a one-time correlation function. Thus, nonlinear spectroscopy yields more detailed information on the dynamics of condensed media than linear spectroscopy. In this Account, we describe the theoretical background and methods for calculating higher order nonlinear spectroscopy; equilibrium and nonequilibrium molecular dynamics simulations, and a combination of both, are used. We also present the intermolecular dynamics of liquid water revealed by fifth-order two-dimensional (2D) Raman spectroscopy and third-order IR spectroscopy. 2D Raman spectroscopy is sensitive to couplings between modes; the calculated 2D Raman signal of liquid water shows large anharmonicity in the translational motion and strong coupling between the translational and librational motions. Third-order IR spectroscopy makes it possible to examine the time-dependent couplings. The 2D IR spectra and three-pulse photon echo peak shift show the fast frequency modulation of the librational motion. A significant effect of the translational motion on the fast frequency modulation of the librational motion is

Globalisation of water resources: International virtual water flows in relation to international crop trade

NARCIS (Netherlands)

Hoekstra, Arjen Ysbert; Hung, P.Q.

2005-01-01

The water that is used in the production process of a commodity is called the ‘virtual water’ contained in the commodity. International trade of commodities brings along international flows of virtual water. The objective of this paper is to quantify the volumes of virtual water flows between

Motion behavior of water droplets driven by triboelectric nanogenerator

Science.gov (United States)

Nie, Jinhui; Jiang, Tao; Shao, Jiajia; Ren, Zewei; Bai, Yu; Iwamoto, Mitsumasa; Chen, Xiangyu; Wang, Zhong Lin

2018-04-01

By integrating a triboelectric nanogenerator (TENG) and a simple circuit board, the motion of water droplets can be controlled by the output of the TENG, which demonstrates a self-powered microfluidic system toward various practical applications in the fields of microfluidic system and soft robotics. This paper describes a method to construct a physical model for this self-powered system on the basis of electrostatic induction theory. The model can precisely simulate the detailed motion behavior of the droplet under driving of TENG, and it can also reveal the influences of surface hydrophobicity on the motion of the droplet, which can help us to better understand the key parameters that decide the performance of the system. The experimental observation of the dynamic performance of the droplet has also been done with a high speed camera system. A comparison between simulation results and real measurements confirms that the proposed model can predict the velocity and position of the water droplet driven by high voltage source as well as TENG. Hence, the proposed model in this work could serve as a guidance for optimizing the self-powered systems in future studies.

Contact angle hysteresis and motion behaviors of a water nano-droplet on suspended graphene under temperature gradient

Science.gov (United States)

Foroutan, Masumeh; Fatemi, S. Mahmood; Esmaeilian, Farshad; Fadaei Naeini, Vahid; Baniassadi, Majid

2018-05-01

In the present work, the effect of temperature gradient on the behavior of a water nano-droplet resting on a suspended graphene was studied based on a non-equilibrium molecular dynamics simulation. The acquired results indicate that the applied temperature gradient to the suspended graphene drives the water nano-droplet to the colder region. The droplet accelerates its motion toward the cold reservoir as the temperature gradient is increased. In addition to the translational motion of the nano-droplet, the vortical motion of the water molecules was also observed. Contact angle analysis was also utilized to describe the directional motion of the nano-droplet. The translational motion of the droplet leads to the estimation of contact angle hysteresis through advancing and receding contact angles while the rotational motion resulted in the advancing and receding fronts being switched with one another through the simulation. The average displacement vector of the water molecules shows that parts of the droplet seem to stagnate while other parts rotate around them. The reason behind this particular behavior was studied based on interaction energy contours between a water molecule and the suspended graphene. The obtained data indicate that the rotational motion is in agreement with the migration of the water molecules to low interaction energy regions in order to avoid high interaction energy areas.

Wetting and motion behaviors of water droplet on graphene under thermal-electric coupling field

Science.gov (United States)

Zhang, Zhong-Qiang; Dong, Xin; Ye, Hong-Fei; Cheng, Guang-Gui; Ding, Jian-Ning; Ling, Zhi-Yong

2015-02-01

Wetting dynamics and motion behaviors of a water droplet on graphene are characterized under the electric-thermal coupling field using classical molecular dynamics simulation method. The water droplet on graphene can be driven by the temperature gradient, while the moving direction is dependent on the electric field intensity. Concretely, the water droplet on graphene moves from the low temperature region to the high temperature region for the relatively weak electric field intensity. The motion acceleration increases with the electric field intensity on graphene, whereas the moving direction switches when the electric field intensity increases up to a threshold. The essence is the change from hydrophilic to hydrophobic for the water droplet on graphene at a threshold of the electric field intensity. Moreover, the driven force of the water droplet caused by the overall oscillation of graphene has important influence on the motion behaviors. The results are helpful to control the wettability of graphene and further develop the graphene-based fluidic nanodevices.

Sloshing of water in annular pressure-suppression pool of boiling water reactors under earthquake ground motions

International Nuclear Information System (INIS)

Aslam, M.; Godden, W.G.; Scalise, D.T.

1979-10-01

This report presents an analytical investigation of the sloshing response of water in annular-circular as well as simple-circular tanks under horizontal earthquake ground motions, and the results are verified with tests. This study was motivated because of the use of annular tanks for pressure-suppression pools in Boiling Water Reactors. Such a pressure-suppression pool would typically have 80 ft and 120 ft inside and outside diameters and a water depth of 20 ft. The analysis was based upon potential flow theory and a computer program was written to obtain time-history plots of sloshing displacements of water and the dynamic pressures. Tests were carried out on 1/80th and 1/15th scale models under sinusoidal as well as simulated earthquake ground motions. Tests and analytical results regarding the natural frequencies, surface water displacements, and dynamic pressures were compared and a good agreement was found for relatively small displacements. The computer program gave satisfactory results as long as the maximum water surface displacements were less than 30 in., which is roughly the value obtained under full intensity of El Centro earthquake

SU-C-BRF-05: Design and Geometric Validation of An Externally and Internally Deformable, Programmable Lung Motion Phantom

International Nuclear Information System (INIS)

Cheung, Y; Sawant, A

2014-01-01

Purpose: Most clinically-deployed strategies for respiratory motion management in lung radiotherapy (e.g., gating, tracking) use external markers that serve as surrogates for tumor motion. However, typical lung phantoms used to validate these strategies are rigid-exterior+rigid-interior or rigid-exterior+deformable-interior. Neither class adequately represents the human anatomy, which is deformable internally as well as externally. We describe the construction and experimental validation of a more realistic, externally- and internally-deformable, programmable lung phantom. Methods: The outer shell of a commercially-available lung phantom (RS- 1500, RSD Inc.) was used. The shell consists of a chest cavity with a flexible anterior surface, and embedded vertebrae, rib-cage and sternum. A 3-axis platform was programmed with sinusoidal and six patient-recorded lung tumor trajectories. The platform was used to drive a rigid foam ‘diaphragm’ that compressed/decompressed the phantom interior. Experimental characterization comprised of mapping the superior-inferior (SI) and anterior-posterior (AP) trajectories of external and internal radioopaque markers with kV x-ray fluoroscopy and correlating these with optical surface monitoring using the in-room VisionRT system. Results: The phantom correctly reproduced the programmed motion as well as realistic effects such as hysteresis. The reproducibility of marker trajectories over multiple runs for sinusoidal as well as patient traces, as characterized by fluoroscopy, was within 0.4 mm RMS error for internal as well as external markers. The motion trajectories of internal and external markers as measured by fluoroscopy were found to be highly correlated (R=0.97). Furthermore, motion trajectories of arbitrary points on the deforming phantom surface, as recorded by the VisionRT system also showed a high correlation with respect to the fluoroscopically-measured trajectories of internal markers (R=0.92). Conclusion: We have

Simulation and experimental research on trans-media vehicle water-entry motion characteristics at low speed.

Science.gov (United States)

Yang, Jian; Li, Yongli; Feng, Jinfu; Hu, Junhua; Liu, An

2017-01-01

The motion characteristics of trans-media vehicles during the water-entry process were explored in this study in an effort to obtain the optimal water-entry condition of the vehicle for developing a novel, single control strategy integrating underwater non-control and in-air control. A water-entry dynamics model is established by combining the water-entry motion characteristics of the vehicle in uncontrolled conditions at low speed with time-varying parameters (e.g. buoyancy, added mass). A water-entry experiment is designed to confirm the effectiveness of the established model. After that, by comparing the experimental results with the simulated results, the model is further modified to more accurately reflect water-entry motion. The change laws of the vehicle's attitude and position during the water-entry process are also obtained by analyzing the simulation of the modified model under different velocity, angle, and angle of attack conditions. The results presented here have guiding significance for the future realization of reaching the stable underwater navigation state of the vehicle after water-entry process.

Simulation and experimental research on trans-media vehicle water-entry motion characteristics at low speed.

Directory of Open Access Journals (Sweden)

Jian Yang

Full Text Available The motion characteristics of trans-media vehicles during the water-entry process were explored in this study in an effort to obtain the optimal water-entry condition of the vehicle for developing a novel, single control strategy integrating underwater non-control and in-air control. A water-entry dynamics model is established by combining the water-entry motion characteristics of the vehicle in uncontrolled conditions at low speed with time-varying parameters (e.g. buoyancy, added mass. A water-entry experiment is designed to confirm the effectiveness of the established model. After that, by comparing the experimental results with the simulated results, the model is further modified to more accurately reflect water-entry motion. The change laws of the vehicle's attitude and position during the water-entry process are also obtained by analyzing the simulation of the modified model under different velocity, angle, and angle of attack conditions. The results presented here have guiding significance for the future realization of reaching the stable underwater navigation state of the vehicle after water-entry process.

International Water Center

Science.gov (United States)

The urban district of Nancy and the Town of Nancy, France, have taken the initiative of creating an International Center of Water (Centre International de l'Eau à Nancy—NAN.C.I.E.) in association with two universities, six engineering colleges, the Research Centers of Nancy, the Rhine-Meuse Basin Agency, and the Chamber of Commerce and Industry. The aim of this center is to promote research and technology transfer in the areas of water and sanitation. In 1985 it will initiate a research program drawing on the experience of 350 researchers and engineers of various disciplines who have already been assigned to research in these fields. The research themes, the majority of which will be multidisciplinary, concern aspects of hygiene and health, the engineering of industrial processes, water resources, and the environment and agriculture. A specialist training program offering five types of training aimed at university graduates, graduates of engineering colleges, or experts, will start in October 1984.

A Dynamic Model for Roll Motion of Ships Due to Flooding

DEFF Research Database (Denmark)

Xia, Jinzhu; Jensen, Jørgen Juncher; Pedersen, Preben Terndrup

1997-01-01

A dynamic model is presented of the roll motion of damaged RoRo vessels which couples the internal cross-flooding flow and the air action in the equalizing compartment. The cross flooding flow and the air motion are modelled by a modified Bernoulli equation, where artificial damping is introduced...... to avoid modal instability based on the original Bernoulli equation. The fluid action of the flooded water on the ship is expressed by its influence on the moment of inertia of the ship and the heeling moment, which is a couple created by the gravitational force of the flooded water and the change...... of buoyancy of the ship.Two limiting flooding cases are examined in the present analysis: The sudden ingress of a certain amount of water to the damaged compartment with no further water exchange between the sea and the flooded compartment during the roll motion, and the continuous ingress of water through...

Sloshing of water in torus pressure-suppression pool of boiling water reactors under earthquake ground motions

International Nuclear Information System (INIS)

Aslam, M.; Godden, W.G.; Scalise, D.T.

1978-08-01

This report presents an analytical and experimental investigation into the sloshing of water in torus tanks under horizontal earthquake ground motions. This study was motivated because of the use of torus tanks for pressure-suppression pools in Boiling Water Reactors. Such a pressure-suppression pool would typically have 80 ft and 140 ft inside and outside diameters, a 30 ft diameter section, and a water depth of 15 ft. A general finite element analysis was developed for all axisymmetric tanks and a computer program was written to obtain time-history plots of sloshing displacements of water and dynamic pressures. Tests were carried out on a 1/60th scale model under sinusoidal as well as simulated earthquake ground motions. Tests and analytical results regarding natural frequencies, surface water displacements, and dynamic pressures were compared and a good agreement was found within the range of displacements studied. The computer program gave satisfactory results within a maximum range of sloshing displacements in the full-size prototype of 30 in. which is greater than the value obtained under the full intensity of the El Centro earthquake (N-S component 1940). The range of linear behavior was studied experimentally by subjecting the torus model to increasing intensities of the El Centro earthquake

Electron spin echo studies of the internal motion of radicals in crystals: Phase memory vs correlation time

International Nuclear Information System (INIS)

Kispert, L.D.; Bowman, M.K.; Norris, J.R.; Brown, M.S.

1982-01-01

An electron spin echo (ESE) study of the internal motion of the CH 2 protons in irradiated zinc acetate dihydrate crystals shows that quantitative measurements of the motional correlation time can be obtained quite directly from pulsed measurements. In the slow motional limit, the motional correlation time is equal to the phase memory time determined by ESE. In the fast motional limit, the motional correlation time is proportional to the no motion spectral second moment divided by the ESE phase memory time. ESE offers a convenient method of studying motion, electron transfer, conductivity, etc. in a variety of systems too complicated for study by ordinary EPR. New systems for study by ESE include biological samples, organic polymers, liquid solutions of radicals with unresolved hyperfine, etc. When motion modulates large anisotropic hyperfine couplings, ESE measurements of the phase memory time are sensitive to modulation of pseudosecular hyperfine interactions

Understanding the Origins of Dipolar Couplings and Correlated Motion in the Vibrational Spectrum of Water.

Science.gov (United States)

Heyden, Matthias; Sun, Jian; Forbert, Harald; Mathias, Gerald; Havenith, Martina; Marx, Dominik

2012-08-16

The combination of vibrational spectroscopy and molecular dynamics simulations provides a powerful tool to obtain insights into the molecular details of water structure and dynamics in the bulk and in aqueous solutions. Applying newly developed approaches to analyze correlations of charge currents, molecular dipole fluctuations, and vibrational motion in real and k-space, we compare results from nonpolarizable water models, widely used in biomolecular modeling, to ab initio molecular dynamics. For the first time, we unfold the infrared response of bulk water into contributions from correlated fluctuations in the three-dimensional, anisotropic environment of an average water molecule, from the OH-stretching region down to the THz regime. Our findings show that the absence of electronic polarizability in the force field model not only results in differences in dipolar couplings and infrared absorption but also induces artifacts into the correlated vibrational motion between hydrogen-bonded water molecules, specifically at the intramolecular bending frequency. Consequently, vibrational motion is partially ill-described with implications for the accuracy of non-self-consistent, a posteriori methods to add polarizability.

Techniques for internal water curing of concrete

DEFF Research Database (Denmark)

Jensen, Ole Mejlhede; Pietro, Lura

2003-01-01

This paper gives an overview of different techniques for incorporation of internal curing water in concrete. Internal curing can be used to mitigate self-desiccation and self-desiccation shrinkage. Some concretes may need 50 kg/m3 of internal curing water for this purpose. The price of the internal...

A Prospective Cohort Study of Gated Stereotactic Liver Radiation Therapy Using Continuous Internal Electromagnetic Motion Monitoring

DEFF Research Database (Denmark)

Worm, Esben S; Høyer, Morten; Hansen, Rune

2018-01-01

PURPOSE: Intrafraction motion can compromise the treatment accuracy in liver stereotactic body radiation therapy (SBRT). Respiratory gating can improve treatment delivery; however, gating based on external motion surrogates is inaccurate. The present study reports the use of Calypso-based internal...... electromagnetic motion monitoring for gated liver SBRT. METHODS AND MATERIALS: Fifteen patients were included in a study of 3-fraction respiratory gated liver SBRT guided by 3 implanted electromagnetic transponders. The planning target volume was created by a 5-mm axial and 7-mm (n = 12) or 10-mm (n = 3...

Laser spectroscopic visualization of hydrogen bond motions in liquid water

Science.gov (United States)

Bratos, S.; Leicknam, J.-Cl.; Pommeret, S.; Gallot, G.

2004-12-01

Ultrafast pump-probe experiments are described permitting a visualization of molecular motions in diluted HDO/D 2O solutions. The experiments were realized in the mid-infrared spectral region with a time resolution of 150 fs. They were interpreted by a careful theoretical analysis, based on the correlation function approach of statistical mechanics. Combining experiment and theory, stretching motions of the OH⋯O bonds as well as HDO rotations were 'filmed' in real time. It was found that molecular rotations are the principal agent of hydrogen bond breaking and making in water. Recent literatures covering the subject, including molecular dynamics simulations, are reviewed in detail.

Internal models and prediction of visual gravitational motion.

Science.gov (United States)

Zago, Myrka; McIntyre, Joseph; Senot, Patrice; Lacquaniti, Francesco

2008-06-01

Baurès et al. [Baurès, R., Benguigui, N., Amorim, M.-A., & Siegler, I. A. (2007). Intercepting free falling objects: Better use Occam's razor than internalize Newton's law. Vision Research, 47, 2982-2991] rejected the hypothesis that free-falling objects are intercepted using a predictive model of gravity. They argued instead for "a continuous guide for action timing" based on visual information updated till target capture. Here we show that their arguments are flawed, because they fail to consider the impact of sensori-motor delays on interception behaviour and the need for neural compensation of such delays. When intercepting a free-falling object, the delays can be overcome by a predictive model of the effects of gravity on target motion.

Internal friction of flux motion in Hg-system high-Tc superconductors

International Nuclear Information System (INIS)

Tian, W.; Zhu, J.S.; Shao, H.M.; Li, J.; Wang, Y.N.

1996-01-01

The internal friction(IF) and modulus as functions of temperature were measured for several Hg-system high-Tc superconductors(Hg1201, Hg1223, Hg1223 doped with Fe and Pb), under the applied magnetic field, with vibrating reed technique. An IF peak associated with flux motion can be found below Tc for all samples. The temperature of the IF peak increases with reducing vibrating amplitude. This amplitude dependence of IF indicates that the flux motion is characterized by nonlinear behavior. No apparent shift of IF peak position can be detected by varying the frequency in the range from 10 2 Hz to 10 3 Hz. Furthermore, the IF peak height satisfies a scaling law Q -1 ∝ω -n . This may be originated from phase transition of flux line lattice(FLL) rather than a thermally activated diffusion process. (orig.)

Motion detection and correction for dynamic 15O-water myocardial perfusion PET studies

International Nuclear Information System (INIS)

Naum, Alexandru; Laaksonen, Marko S.; Oikonen, Vesa; Teraes, Mika; Jaervisalo, Mikko J.; Knuuti, Juhani; Tuunanen, Helena; Nuutila, Pirjo; Kemppainen, Jukka

2005-01-01

Patient motion during dynamic PET studies is a well-documented source of errors. The purpose of this study was to investigate the incidence of frame-to-frame motion in dynamic 15 O-water myocardial perfusion PET studies, to test the efficacy of motion correction methods and to study whether implementation of motion correction would have an impact on the perfusion results. We developed a motion detection procedure using external radioactive skin markers and frame-to-frame alignment. To evaluate motion, marker coordinates inside the field of view were determined in each frame for each study. The highest number of frames with identical spatial coordinates during the study were defined as ''non-moved''. Movement was considered present if even one marker changed position, by one pixel/frame compared with reference, in one axis, and such frames were defined as ''moved''. We tested manual, in-house-developed motion correction software and an automatic motion correction using a rigid body point model implemented in MIPAV (Medical Image Processing, Analysis and Visualisation) software. After motion correction, remaining motion was re-analysed. Myocardial blood flow (MBF) values were calculated for both non-corrected and motion-corrected datasets. At rest, patient motion was found in 18% of the frames, but during pharmacological stress the fraction increased to 45% and during physical exercise it rose to 80%. Both motion correction algorithms significantly decreased (p<0.006) the number of moved frames and the amplitude of motion (p<0.04). Motion correction significantly increased MBF results during bicycle exercise (p<0.02). At rest or during adenosine infusion, the motion correction had no significant effects on MBF values. Significant motion is a common phenomenon in dynamic cardiac studies during adenosine infusion but especially during exercise. Applying motion correction for the data acquired during exercise clearly changed the MBF results, indicating that motion

Vertical motion and elastic light-scattering of a laser-levitated water droplet

International Nuclear Information System (INIS)

Chan, C. W.; Lee, W. K.

2001-01-01

We report the vertical motion and elastic scattered light of a single laser-levitated water microdroplet as it slowly evaporated. The vertical displacement as a function of time exhibited peaks of a variety of widths. Morphology-dependent resonances (MDRs) that induced the displacement peaks were identified. We found that the Stokes equation is adequate to describe the vertical motions driven by broad MDRs. For motions driven by relatively narrow MDRs, significant deviations from results predicted by the Stokes equation were found. The elastic scattered light intensity as a function of the size of the droplet showed sudden increases attributable to deformations of the droplet as its size parameter scanned through narrow MDRs. Copyright 2001 Optical Society of America

Internal fuel motion as an inherent shutdown mechanism for LMFBR accidents: PINEX-3, PINEX-2, and HUT 5-2A experiments

International Nuclear Information System (INIS)

Ferrell, P.C.; Porten, D.R.; Martin, F.J.

1981-01-01

The PINEX-2 experiment verified the concept of axial internal molten fuel motion within annular fuel, representing an inherent shutdown mechanism for hypothetical transient overpower excursions on the order of 5$/s. The PINEX-3 experiment, simulating a 50 cents/s transient overpower, showed that limitations on the effectiveness of fuel motion may arise from freezing of the fuel and blockage of the internal movement. Analysis of these experiments was performed to assess the physical processes that dominate fuel relocation potential and to apply them to prototypic LMFBR pin conditions. Results indicate that internal fuel motion should be reliable as a shutdown mechanism in LMFBR's for a range of reactivity insertion rates beyond presently available experimental data

Flow effects due to valve and piston motion in an internal combustion engine exhaust port

International Nuclear Information System (INIS)

Semlitsch, Bernhard; Wang, Yue; Mihăescu, Mihai

2015-01-01

Highlights: • Flow regime identification depending on the valve lift during the exhaust stroke. • Analysis of the valve motion effect onto the flow development in the exhaust port. • Physical interpretation of commonly used discharge and flow coefficient formulations. • Illustration of flow effects in junction regions with pulsatile flow. - Abstract: Performance optimization regarding e.g. exhaust valve strategies in an internal combustion engine is often performed based on one-dimensional simulation investigation. Commonly, a discharge coefficient is used to describe the flow behavior in complex geometries, such as the exhaust port. This discharge coefficient for an exhaust port is obtained by laboratory experiments at fixed valve lifts, room temperatures, and low total pressure drops. The present study investigates the consequences of the valve and piston motion onto the energy losses and the discharge coefficient. Therefore, Large Eddy Simulations are performed in a realistic internal combustion geometry using three different modeling strategies, i.e. fixed valve lift and fixed piston, moving piston and fixed valve lift, and moving piston and moving valve, to estimate the energy losses. The differences in the flow field development with the different modeling approaches is delineated and the dynamic effects onto the primary quantities, e.g. discharge coefficient, are quantified. Considering the motion of piston and valves leads to negative total pressure losses during the exhaust cycle, which cannot be observed at fixed valve lifts. Additionally, the induced flow structures develop differently when valve motion is taken into consideration, which leads to a significant disparity of mass flow rates evolving through the two individual valve ports. However, accounting for piston motion and limited valve motion, leads to a minor discharge coefficient alteration of about one to two percent

Experimental investigation of single small bubble motion in linear shear flow in water

International Nuclear Information System (INIS)

Li, Zhongchun; Zhao, Yang; Song, Xiaoming; Yu, Hongxing; Jiang, Shengyao; Ishii, Mamoru

2016-01-01

Highlights: • The bubble motion in simple linear shear flow was experimentally investigated. • The bubble trajectories, bubble velocity and drag and lift force were obtained using image process routine. • The bubble trajectory was coupled with a zigzag motion and incline path. • The lift force was kept negative and it decreased when bubble diameter and shear flow magnitude increased. - Abstract: The motion of small bubble in a simple shear flow in water was experimental studied. Stable shear flow with low turbulence level was achieved with curved screen and measured using LDV. The bubbles were captured by high speed camera and the captured images were processed with digital image routine. The bubble was released from a capillary tube. The instantaneous bubble position, bubble velocity and forces were obtained based on the captured parameters. The quasi-steady lift coefficient was determined by the linear fitting of the bubble trajectory of several cycles. The results indicated that the lateral migration was coupled with the zigzag motion of bubble in the present experiment. The bubble migrated to the left side and its quasi-steady lift coefficient was negative. Good repeatable results were observed by measurements of 18 bubbles. The bubble motion in shear flow in water was first experimental studied and negative lift force was observed in the present study condition. The lift coefficient decreased when shear stress magnitude or bubble diameter increased in the present experiment condition.

The effect of internal and external fields of view on visually induced motion sickness

NARCIS (Netherlands)

Bos, J.E.; Vries, S.C. de; Emmerik, M.L. van; Groen, E.L.

2010-01-01

Field of view (FOV) is said to affect visually induced motion sickness. FOV, however, is characterized by an internal setting used by the graphics generator (iFOV) and an external factor determined by screen size and viewing distance (eFOV). We hypothesized that especially the incongruence between

On connection of rotation and internal motion in deformed nuclei

International Nuclear Information System (INIS)

Krutov, V.A.

1979-01-01

In the semiphenomenological nuclear madel (SPNM) the problem of ''overestimate of Coriolis interaction'' is shown to be easily solved. The rotation and internal motion coupling operator H(rot/in) is used. Overdetermination of the operator H(rot/in) has been generalized and extended into schemes of strong and weak coupling. In this case both schemes of coupling are transformed from approximate into precise ones and become applicable for any nuclear deformation. As examples of application of the theory considered are the matrix elements of the E2-transitions and inertia parameters of a 235 U nucleus

Correlation of glenohumeral internal rotation deficit and total rotational motion to shoulder injuries in professional baseball pitchers.

Science.gov (United States)

Wilk, Kevin E; Macrina, Leonard C; Fleisig, Glenn S; Porterfield, Ronald; Simpson, Charles D; Harker, Paul; Paparesta, Nick; Andrews, James R

2011-02-01

Glenohumeral internal rotation deficit (GIRD) indicates a 20° or greater loss of internal rotation of the throwing shoulder compared with the nondominant shoulder. To determine whether GIRD and a deficit in total rotational motion (external rotation + internal rotation) compared with the nonthrowing shoulder correlate with shoulder injuries in professional baseball pitchers. Case series; Level of evidence, 4. Over 3 competitive seasons (2005 to 2007), passive range of motion measurements were evaluated on the dominant and nondominant shoulders for 170 pitcher-seasons. This included 122 professional pitchers during the 3 seasons of data collection, in which some pitchers were measured during multiple seasons. Ranges of motion were measured with a bubble goniometer during the preseason, by the same examiner each year. External and internal rotation of the glenohumeral joint was assessed with the participant supine and the arm abducted 90° in the plane of the scapula, with the scapula stabilized anteriorly at the coracoid process. The reproducibility of the test methods had an intraclass correlation coefficient of .81. Days in which the player was unable to participate because of injury or surgery were recorded during the season by the medical staff of the team and defined as an injury. Pitchers with GIRD (n = 40) were nearly twice as likely to be injured as those without but without statistical significance (P = .17). Pitchers with total rotational motion deficit greater than 5° had a higher rate of injury. Minor league pitchers were more likely than major league pitchers to be injured. However, when players were injured, major league pitchers missed a significantly greater number of games than minor league pitchers. Compared with pitchers without GIRD, pitchers with GIRD appear to be at a higher risk for injury and shoulder surgery.

Determination of capillary motion of water in bricks using neutron radiography

International Nuclear Information System (INIS)

Czachor, A.; Abd El-Ghany El-Abd; Milczarek, J.J.

2002-01-01

Vertical migration of water in several porous materials has been directly observed and recorded with the recently installed neutron and gamma radiography facility at Maria reactor of Institute of Atomic Energy, Swierk. The density profiles of water in samples were obtained from the optical density of digitalised images. A simple model (representing the porous material as a collection of capillary tubes of various radii) has been introduced to describe the liquid transport in porous materials in terms of capillary motion. The equation for viscous movement of water in porous material in presence of the gravitation is proposed. A good agreement of the calculated density profiles for vertical water migration with the data collected for siliceous bricks suggests that the thinnest capillary tubes determine the upper edge of the water density profile. (author)

Impact of quasar proper motions on the alignment between the International Celestial Reference Frame and the Gaia reference frame

Science.gov (United States)

Liu, J.-C.; Malkin, Z.; Zhu, Z.

2018-03-01

The International Celestial Reference Frame (ICRF) is currently realized by the very long baseline interferometry (VLBI) observations of extragalactic sources with the zero proper motion assumption, while Gaia will observe proper motions of these distant and faint objects to an accuracy of tens of microarcseconds per year. This paper investigates the difference between VLBI and Gaia quasar proper motions and it aims to understand the impact of quasar proper motions on the alignment of the ICRF and Gaia reference frame. We use the latest time series data of source coordinates from the International VLBI Service analysis centres operated at Goddard Space Flight Center (GSF2017) and Paris observatory (OPA2017), as well as the Gaia auxiliary quasar solution containing 2191 high-probability optical counterparts of the ICRF2 sources. The linear proper motions in right ascension and declination of VLBI sources are derived by least-squares fits while the proper motions for Gaia sources are simulated taking into account the acceleration of the Solar system barycentre and realistic uncertainties depending on the source brightness. The individual and global features of source proper motions in GSF2017 and OPA2017 VLBI data are found to be inconsistent, which may result from differences in VLBI observations, data reduction and analysis. A comparison of the VLBI and Gaia proper motions shows that the accuracies of the components of rotation and glide between the two systems are 2-4 μas yr- 1 based on about 600 common sources. For the future alignment of the ICRF and Gaia reference frames at different wavelengths, the proper motions of quasars must necessarily be considered.

Techniques and materials for internal water curing of concrete

DEFF Research Database (Denmark)

Jensen, Ole Mejlhede; Lura, Pietro

2006-01-01

This paper gives an overview of different techniques for incorporation of internal curing water in concrete. Internal water curing can be used to mitigate self-desiccation and selfdesiccation shrinkage. Some concretes may need 50 kg/m3 of internal curing water for this purpose. The price...

SU-E-J-79: Internal Tumor Volume Motion and Volume Size Assessment Using 4D CT Lung Data

Energy Technology Data Exchange (ETDEWEB)

Jurkovic, I [University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Stathakis, S; Li, Y; Patel, A; Vincent, J; Papanikolaou, N; Mavroidis, P [Cancer Therapy and Research Center University of Texas Health Sciences Center at San Antonio, San Antonio, TX (United States)

2014-06-01

Purpose: To assess internal tumor volume change through breathing cycle and associated tumor motion using the 4DCT data. Methods: Respiration induced volume change through breathing cycle and associated motion was analyzed for nine patients that were scanned during the different respiratory phases. The examined datasets were the maximum and average intensity projections (MIP and AIP) and the 10 phases of the respiratory cycle. The internal target volume (ITV) was delineated on each of the phases and the planning target volume (PTV) was then created by adding setup margins to the ITV. Tumor motion through the phases was assessed using the acquired 4DCT dataset, which was then used to determine if the margins used for the ITV creation successfully encompassed the tumor in three dimensions. Results: Results showed that GTV motion along the superior inferior axes was the largest in all the cases independent of the tumor location and/or size or the use of abdomen compression. The extent of the tumor motion was found to be connected with the size of the GTV. The smallest GTVs exhibited largest motion vector independent of the tumor location. The motion vector size varied through the phases depending on the tumor size and location and it was smallest for phases 20 and 30. The smaller the volume of the delineated GTV, the greater its volume difference through the different respiratory phases was. The average GTV volume change was largest for the phases 60 and 70. Conclusion: Even if GTV is delineated using both AIP and MIP datasets, its motion extent will exceed the used margins especially for the very small GTV volumes. When the GTV size is less than 10 cc it is recommended to use fusion of the GTVs through all the phases to create the planning ITV.

The effect of internal and external fields of view on visually induced motion sickness.

Science.gov (United States)

Bos, Jelte E; de Vries, Sjoerd C; van Emmerik, Martijn L; Groen, Eric L

2010-07-01

Field of view (FOV) is said to affect visually induced motion sickness. FOV, however, is characterized by an internal setting used by the graphics generator (iFOV) and an external factor determined by screen size and viewing distance (eFOV). We hypothesized that especially the incongruence between iFOV and eFOV would lead to sickness. To that end we used a computer game environment with different iFOV and eFOV settings, and found the opposite effect. We speculate that the relative large differences between iFOV and eFOV used in this experiment caused the discrepancy, as may be explained by assuming an observer model controlling body motion. Copyright 2009 Elsevier Ltd. All rights reserved.

33 CFR 165.1192 - Security Zones; Waters surrounding San Francisco International Airport and Oakland International...

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Security Zones; Waters..., California. 165.1192 Section 165.1192 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... Security Zones; Waters surrounding San Francisco International Airport and Oakland International Airport...

Virtual water embodied in international trade of soybean

DEFF Research Database (Denmark)

Caro, Dario; Thomsen, Marianne

This study focuses on hidden water flows embodied in the international trade of soybean. The virtual water content embedded in soybean imported and exported by 174 countries during the period 2000-2013 is estimated.......This study focuses on hidden water flows embodied in the international trade of soybean. The virtual water content embedded in soybean imported and exported by 174 countries during the period 2000-2013 is estimated....

Water permeation through the internal water pathway in activated GPCR rhodopsin.

Directory of Open Access Journals (Sweden)

Katsufumi Tomobe

Full Text Available Rhodopsin is a light-driven G-protein-coupled receptor that mediates signal transduction in eyes. Internal water molecules mediate activation of the receptor in a rhodopsin cascade reaction and contribute to conformational stability of the receptor. However, it remains unclear how internal water molecules exchange between the bulk and protein inside, in particular through a putative solvent pore on the cytoplasmic. Using all-atom molecular dynamics simulations, we identified the solvent pore on cytoplasmic side in both the Meta II state and the Opsin. On the other hand, the solvent pore does not exist in the dark-adapted rhodopsin. We revealed two characteristic narrow regions located within the solvent pore in the Meta II state. The narrow regions distinguish bulk and the internal hydration sites, one of which is adjacent to the conserved structural motif "NPxxY". Water molecules in the solvent pore diffuse by pushing or sometimes jumping a preceding water molecule due to the geometry of the solvent pore. These findings revealed a total water flux between the bulk and the protein inside in the Meta II state, and suggested that these pathways provide water molecules to the crucial sites of the activated rhodopsin.

Experimental observation of internal water curing of concrete

DEFF Research Database (Denmark)

Lura, Pietro; Jensen, Ole Mejlhede

2007-01-01

Internal water curing has a significant effect on concrete. In addition to affecting hydration and moisture distribution, it influences most concrete properties, such as strength, shrinkage, cracking, and durability. The following paper is an overview of experimental methods to study internal water...... curing of concrete and its consequences. The special techniques needed to study internal water curing are dealt with along with the consequences of this process. Examples of applications are given and new measuring techniques that may potentially be applied to this field are addressed....

Respiratory gating based on internal electromagnetic motion monitoring during stereotactic liver radiation therapy: First results.

Science.gov (United States)

Poulsen, Per Rugaard; Worm, Esben Schjødt; Hansen, Rune; Larsen, Lars Peter; Grau, Cai; Høyer, Morten

2015-01-01

Intrafraction motion may compromise the target dose in stereotactic body radiation therapy (SBRT) of tumors in the liver. Respiratory gating can improve the treatment delivery, but gating based on an external surrogate signal may be inaccurate. This is the first paper reporting on respiratory gating based on internal electromagnetic monitoring during liver SBRT. Two patients with solitary liver metastases were treated with respiratory-gated SBRT guided by three implanted electromagnetic transponders. The treatment was delivered in end-exhale with beam-on when the centroid of the three transponders deviated less than 3 mm [left-right (LR) and anterior-posterior (AP) directions] and 4mm [cranio-caudal (CC)] from the planned position. For each treatment fraction, log files were used to determine the transponder motion during beam-on in the actual gated treatments and in simulated treatments without gating. The motion was used to reconstruct the dose to the clinical target volume (CTV) with and without gating. The reduction in D95 (minimum dose to 95% of the CTV) relative to the plan was calculated for both treatment courses. With gating the maximum course mean (standard deviation) geometrical error in any direction was 1.2 mm (1.8 mm). Without gating the course mean error would mainly increase for Patient 1 [to -2.8 mm (1.6 mm) (LR), 7.1 mm (5.8 mm) (CC), -2.6 mm (2.8mm) (AP)] due to a large systematic cranial baseline drift at each fraction. The errors without gating increased only slightly for Patient 2. The reduction in CTV D95 was 0.5% (gating) and 12.1% (non-gating) for Patient 1 and 0.3% (gating) and 1.7% (non-gating) for Patient 2. The mean duty cycle was 55%. Respiratory gating based on internal electromagnetic motion monitoring was performed for two liver SBRT patients. The gating added robustness to the dose delivery and ensured a high CTV dose even in the presence of large intrafraction motion.

Internal motion time scales of a small, highly stable and disulfide-rich protein: A 15N, 13C NMR and molecular dynamics study

International Nuclear Information System (INIS)

Guenneugues, Marc; Gilquin, Bernard; Wolff, Nicolas; Menez, Andre; Zinn-Justin, Sophie

1999-01-01

Motions of the backbone CαHα and threonine CβHβ bonds of toxin α were investigated using natural abundance 13C NMR and molecular dynamics. Measurement of the 13C longitudinal and transverse relaxation rates employed ACCORDION techniques together with coherence selection by pulsed field gradients and sensitivity enhancement through the use of preservation of equivalent pathway, thus allowing a considerable reduction of the required spectrometer time. 13C R1, R2, 1H → 13C NOE were obtained, as well as the variations of R1ρ(90 deg.) as a function of the rf field strength. These data were compared to those recorded by 1H and 15N NMR on a labelled sample of the toxin [Guenneugues et al. (1997) Biochemistry, 36, 16097-16108]. Both sets of data showed that picosecond to nanosecond time scale motions are well correlated to the secondary structure of the protein. This was further reinforced by the analysis of a 1 ns molecular dynamics simulation in water. Several CαHα and threonine CβHβ experimentally exhibit fast motions with a correlation time longer than 500 ps, that cannot be sampled along the simulation. In addition, the backbone exhibits motions on the microsecond to millisecond time scale on more than half of its length. Thus, toxin α, a highly stable protein (Tm=75 deg. C at acidic pH) containing 61 amino acids and 4 disulfides, shows important internal motions on time scales ranging from 0.1-0.5 ps, to 10-100 ps, 1 ns, and about 30 μs to 10 ms

Fluid-structure-interaction of the pressurized water reactor core internals during blowdown - numerical simulation with a homogenization model

International Nuclear Information System (INIS)

Benner, J.

1984-03-01

A method for the numerical simulation of the Pressurized Water Reactor (PWR) core internal's behaviour during a blowdown accident is described, by which the motion of the reactor core and the interaction of the fuel elements with the core barrel and the coolant medium is calculated. Furthermore, some simple models for the support columns, lower and upper core support and the grid plate are provided. All these models have been implemented into the code Flux-4. For the solution of the very complex, coupled equations of motions for fluid and fuel rods an efficient numerical solution technique has been developed. With the new code-version Flux-5 the PWR-blowdown is parametically investigated. The calculated core barrel loadings are compared with Flux-4 results, simulating the core's inertia by a mass ring of HDR type. (orig.) [de

Water confinement effects on fuel assembly motion and damping

International Nuclear Information System (INIS)

Brenneman, B.; Shah, S.J.; Williams, G.T.; Strumpell, J.H.

2003-01-01

It has been established by other authors that the accelerations of the water confined by the reactor core baffle plates has a significant effect on the responses of all the fuel assemblies during LOCA or seismic transients. This particular effect is a consequence of the water being essentially incompressible, and thus experiencing the same horizontal accelerations as the imposed baffle plate motions. These horizontal accelerations of the fluid induce lateral pressure gradients that cause horizontal buoyancy forces on any submerged structures. These forces are in the same direction as the baffle accelerations and, for certain frequencies at least, tend to reduce the relative displacements between the fuel and baffle plates. But there is another confinement effect - the imposed baffle plate velocities must also be transmitted to the water. If the fuel assembly grid strips are treated as simple hydro-foils, these horizontal velocity components change the fluid angle of attack on each strip, and thus may induce large horizontal lift forces on each grid in the same direction as the baffle plate velocity. There is a similar horizontal lift due to inclined flow over the rods when axial flow is present. These combined forces appear to always reduce the relative displacements between the fuel and baffle plates for any significant axial flow velocity. Modeling this effect is very simple. It was shown in previous papers that the mechanism for the large fuel assembly damping due to axial flow may be the hydrodynamic forces on the grid strips, and that this is very well represented by discrete viscous dampers at each grid elevation. To include the imposed horizontal water velocity effects, on both the grids and rods, these dampers are simply attached to the baffle plate rather than 'ground'. The large flow-induced damping really acts in a relative reference frame rather than an absolute or inertial reference frame, and thus it becomes a flow-induced coupling between the fuel

Investigating the significance of zero-point motion in small molecular clusters of sulphuric acid and water

International Nuclear Information System (INIS)

Stinson, Jake L.; Ford, Ian J.; Kathmann, Shawn M.

2014-01-01

The nucleation of particles from trace gases in the atmosphere is an important source of cloud condensation nuclei, and these are vital for the formation of clouds in view of the high supersaturations required for homogeneous water droplet nucleation. The methods of quantum chemistry have increasingly been employed to model nucleation due to their high accuracy and efficiency in calculating configurational energies; and nucleation rates can be obtained from the associated free energies of particle formation. However, even in such advanced approaches, it is typically assumed that the nuclei have a classical nature, which is questionable for some systems. The importance of zero-point motion (also known as quantum nuclear dynamics) in modelling small clusters of sulphuric acid and water is tested here using the path integral molecular dynamics method at the density functional level of theory. The general effect of zero-point motion is to distort the mean structure slightly, and to promote the extent of proton transfer with respect to classical behaviour. In a particular configuration of one sulphuric acid molecule with three waters, the range of positions explored by a proton between a sulphuric acid and a water molecule at 300 K (a broad range in contrast to the confinement suggested by geometry optimisation at 0 K) is clearly affected by the inclusion of zero point motion, and similar effects are observed for other configurations

19 CFR 210.15 - Motions.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 3 2010-04-01 2010-04-01 false Motions. 210.15 Section 210.15 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Motions § 210.15 Motions. (a) Presentation and disposition. (1) During the period...

19 CFR 210.26 - Other motions.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 3 2010-04-01 2010-04-01 false Other motions. 210.26 Section 210.26 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Motions § 210.26 Other motions. Motions pertaining to discovery shall be filed in...

Boiling-Water Reactor internals aging degradation study

International Nuclear Information System (INIS)

Luk, K.H.

1993-09-01

This report documents the results of an aging assessment study for boiling water reactor (BWR) internals. Major stressors for BWR internals are related to unsteady hydrodynamic forces generated by the primary coolant flow in the reactor vessel. Welding and cold-working, dissolved oxygen and impurities in the coolant, applied loads and exposures to fast neutron fluxes are other important stressors. Based on results of a component failure information survey, stress corrosion cracking (SCC) and fatigue are identified as the two major aging-related degradation mechanisms for BWR internals. Significant reported failures include SCC in jet-pump holddown beams, in-core neutron flux monitor dry tubes and core spray spargers. Fatigue failures were detected in feedwater spargers. The implementation of a plant Hydrogen Water Chemistry (HWC) program is considered as a promising method for controlling SCC problems in BWR. More operating data are needed to evaluate its effectiveness for internal components. Long-term fast neutron irradiation effects and high-cycle fatigue in a corrosive environment are uncertainty factors in the aging assessment process. BWR internals are examined by visual inspections and the method is access limited. The presence of a large water gap and an absence of ex-core neutron flux monitors may handicap the use of advanced inspection methods, such as neutron noise vibration measurements, for BWR

Wave energy conversion utilizing vertical motion of water in the array of water chambers aligned in the direction of wave propagation

Directory of Open Access Journals (Sweden)

Kesayoshi Hadano

2017-05-01

Full Text Available As a new technical approach, wave energy converter by using vertical motion of water in the multiple water chambers were developed to realize actual wave power generation as eco-environmental renewable energy. And practical use of wave energy converter was actually to require the following conditions: (1 setting up of the relevant device and its application to wave power generation in case that severe wave loading is avoided; (2 workability in installation and maintenance operations; (3 high energy conversion potential; and (4 low cost. In this system, neither the wall(s of the chambers nor the energy conversion device(s are exposed to the impulsive load due to water wave. Also since this system is profitable when set along the jetty or along a long floating body, installation and maintenance are done without difficulty and the cost is reduced. In this paper, we describe the system which consists of a float, a shaft connected with another shaft, a rack and pinion arrangement, a ratchet mechanism, and rotary type generator(s. Then, we present the dynamics model for evaluating the output electric power, and the results of numerical calculation including the effect of the phase shift of up/down motion of the water in the array of water chambers aligned along the direction of wave propagation.

Contributions from the Second and Third Internal Gravity Modes for the Vertical Motion Response.

Directory of Open Access Journals (Sweden)

Julio Buchmann

2008-07-01

Full Text Available In earlier papers of a series of real data integrations of the National Center for Atmospheric Research Community ClimateModel with tropical heat anomalies display regions of pronounced subsidence and drying located several thousand kilometers westwardpoleward of the heating for cases of tropical Atlantic heating and tropical east Pacifi c heating. This highly predictable sinking responseis established within the fi rst fi ve days of these integrations. The normal-modes of a set of adiabatic primitive equations linearizedabout a basic state at rest are used to partition model response into gravity-inertia and Rossby modes. The most important contributionfor the vertical motion response comes from the gravity modes added for all vertical modes. The principal emphasis is given upon thecontributions of the second and third internal vertical modes (with equivalent depths on the order of a fews hundred meters for thevertical motion response.

Growing controversy over "wise international water governance".

Science.gov (United States)

Trondalen, J M

2004-01-01

This article takes the perspective that when political relationships are strained, there seem to be few examples of wise international water resources governance. The Middle East is a striking example. Much effort has been put into policy development and the design of international principles, but very little into the translation of those into concrete and lasting governance. One of the theses of the article is that politics--whether domestic or international--in most cases overrides these principles and standards. Moreover readymade regional co-operation models of water managements are not directly applicable to every geographical, political, economic and social setting. Certain factors are often under-estimated in international water negotiations, such as: the complexity of any hydro-political negotiations, and need to develop commonly accepted standards; the difficulty of translating policy--either politically or legally--into an operational and realistic negotiations strategy; the format of the procedures and meetings; recognition that third parties should have a long-term perspective on any conflict they get involved in. With reservations, the lessons learned indicate that the following factors have an impact on grid locked situations, such as: new substantive information; new trade-offs between the parties; and changed political climate or relationship with external power-brokers.

Atypical anticlockwise internal tidal motions in the deep ocean

NARCIS (Netherlands)

van Haren, H.

2015-01-01

In the ocean, horizontal motions associated with freely propagating semidiurnal tidal inertia-gravity waves mainly describe an ellipse that is traversed in a clockwise direction in the Northern Hemisphere. In this article, rare observations of anticlockwise polarised semidiurnal motions are

Near field fluid coupling between internal motion of the organ of Corti and the basilar membrane

Energy Technology Data Exchange (ETDEWEB)

Elliott, Stephen J.; Ni, Guangjian [Institute of Sound and Vibration Research, University of Southampton, Southampton (United Kingdom)

2015-12-31

The pressure distribution in each of the fluid chambers of the cochlea can be decomposed into a 1D, or plane wave, component and a near field component, which decays rapidly away from the excitation point. The transverse motion of the basilar membrane, BM, for example, generates both a 1D pressure field, which couples into the slow wave, and a local near field pressure, proportional to the BM acceleration, that generates an added mass on the BM due to the fluid motion. When the organ of Corti, OC, undergoes internal motion, due for example to outer hair cell activity, this motion will not itself generate any 1D pressure if the OC is incompressible and the BM is constrained not to move volumetrically, and so will not directly couple into the slow wave. This motion will, however, generate a near field pressure, proportional to the OC acceleration, which will act on the OC and thus increases its effective mass. The near field pressure due to this OC motion will also act on the BM, generating a force on the BM proportional to the acceleration of the OC, and thus create a “coupling mass” effect. By reciprocity, this coupling mass is the same as that acting on the OC due to the motion of the BM. This near field fluid coupling is initially observed in a finite element model of a slice of the cochlea. These simulations suggest a simple analytical formulation for the fluid coupling, using higher order beam modes across the width of the cochlear partition. It is well known that the added mass due to the near field pressure dominates the overall mass of the BM, and thus significantly affects the micromechanical dynamics. This work not only quantifies the added mass of the OC due its own motion in the fluid, and shows that this is important, but also demonstrates that the coupling mass effect between the BM and OC significantly affects the dynamics of simple micromechanical models.

Free-breathing volumetric fat/water separation by combining radial sampling, compressed sensing, and parallel imaging.

Science.gov (United States)

Benkert, Thomas; Feng, Li; Sodickson, Daniel K; Chandarana, Hersh; Block, Kai Tobias

2017-08-01

Conventional fat/water separation techniques require that patients hold breath during abdominal acquisitions, which often fails and limits the achievable spatial resolution and anatomic coverage. This work presents a novel approach for free-breathing volumetric fat/water separation. Multiecho data are acquired using a motion-robust radial stack-of-stars three-dimensional GRE sequence with bipolar readout. To obtain fat/water maps, a model-based reconstruction is used that accounts for the off-resonant blurring of fat and integrates both compressed sensing and parallel imaging. The approach additionally enables generation of respiration-resolved fat/water maps by detecting motion from k-space data and reconstructing different respiration states. Furthermore, an extension is described for dynamic contrast-enhanced fat-water-separated measurements. Uniform and robust fat/water separation is demonstrated in several clinical applications, including free-breathing noncontrast abdominal examination of adults and a pediatric subject with both motion-averaged and motion-resolved reconstructions, as well as in a noncontrast breast exam. Furthermore, dynamic contrast-enhanced fat/water imaging with high temporal resolution is demonstrated in the abdomen and breast. The described framework provides a viable approach for motion-robust fat/water separation and promises particular value for clinical applications that are currently limited by the breath-holding capacity or cooperation of patients. Magn Reson Med 78:565-576, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

MERLIN observations of water maser proper motions in VY Canis Majoris

Science.gov (United States)

Richards, A. M. S.; Yates, J. A.; Cohen, R. J.

1998-09-01

MERLIN observations of the 22-GHz water masers in the circumstellar envelope of the supergiant VY CMa show an ellipsoidal distribution with a maximum extent of 700 mas east-west and 400 mas north-south. Comparison with observations made nine years earlier shows that the majority of maser features have survived and show proper motions throughout the region. The mean change in position is 28 mas and the proper motions are generally directed away from the assumed stellar position, and tend to be larger for features at greater projected distances. If the H_2O maser region is modelled as a partially filled thick spherical shell, and VY CMa is at a distance of 1.5 kpc, then the proper motion velocities in the direction of expansion are between 8kms^-1 at a distance of 75 mas from the assumed stellar position and 32kms^-1 at 360 mas. These velocities are consistent with the H_2O maser spectral line velocities which correspond to a maximum expansion velocity of 36kms^-1 at 400 mas from the assumed stellar position. These observations are consistent with radiation pressure on dust providing the force to accelerate the stellar wind as it passes through the H_2O maser shell. The H_2O maser region is elongated in the same direction as the dusty nebula around VY CMa. The water masers illuminate the small-scale dynamics and clumpiness which show the role of dust in driving the outflow. The overall ellipsoidal shape may be due to properties of the dust, such as its behaviour in the stellar magnetic field, or to interaction between the wind and circumstellar material. Maser monitoring also shows the difference between changes on the time-scale of stellar variability (a few years) and possible stages in the evolution of VY CMa to its likely fate as a supernova.

Assessing Respiration-Induced Tumor Motion and Internal Target Volume Using Four-Dimensional Computed Tomography for Radiotherapy of Lung Cancer

International Nuclear Information System (INIS)

Liu, H. Helen; Balter, Peter; Tutt, Teresa; Choi, Bum; Zhang, Joy; Wang, Catherine; Chi, Melinda; Luo Dershan; Pan Tinsu; Hunjan, Sandeep; Starkschall, George; Rosen, Isaac; Prado, Karl; Liao Zhongxing; Chang, Joe; Komaki, Ritsuko; Cox, James D.; Mohan, Radhe; Dong Lei

2007-01-01

Purpose: To assess three-dimensional tumor motion caused by respiration and internal target volume (ITV) for radiotherapy of lung cancer. Methods and Materials: Respiration-induced tumor motion was analyzed for 166 tumors from 152 lung cancer patients, 57.2% of whom had Stage III or IV non-small-cell lung cancer. All patients underwent four-dimensional computed tomography (4DCT) during normal breathing before treatment. The expiratory phase of 4DCT images was used as the reference set to delineate gross tumor volume (GTV). Gross tumor volumes on other respiratory phases and resulting ITVs were determined using rigid-body registration of 4DCT images. The association of GTV motion with various clinical and anatomic factors was analyzed statistically. Results: The proportions of tumors that moved >0.5 cm along the superior-inferior (SI), lateral, and anterior-posterior (AP) axes during normal breathing were 39.2%, 1.8%, and 5.4%, respectively. For 95% of the tumors, the magnitude of motion was less than 1.34 cm, 0.40 cm, and 0.59 cm along the SI, lateral, and AP directions. The principal component of tumor motion was in the SI direction, with only 10.8% of tumors moving >1.0 cm. The tumor motion was found to be associated with diaphragm motion, the SI tumor location in the lung, size of the GTV, and disease T stage. Conclusions: Lung tumor motion is primarily driven by diaphragm motion. The motion of locally advanced lung tumors is unlikely to exceed 1.0 cm during quiet normal breathing except for small lesions located in the lower half of the lung

Experimental investigation of the sloshing motion of the water free surface in the draft tube of a Francis turbine operating in synchronous condenser mode

Science.gov (United States)

Vagnoni, Elena; Favrel, Arthur; Andolfatto, Loïc; Avellan, François

2018-06-01

Hydropower units may be required to operate in condenser mode to supply reactive power. In this operating mode, the water level in the turbine or pump-turbine is decreased below the runner by closing the guide vanes and injecting pressurized air. While operating in condenser mode the machine experiences power losses due to several air-water interaction phenomena which cause air losses. One of such phenomena is the sloshing motion of the water free surface below the runner in the draft tube cone of a Francis turbine. The objective of the present work is to experimentally investigate the sloshing motion of the water free surface in the draft tube cone of a reduced scale physical model of a Francis turbine operating in condenser mode. Images acquisition and simultaneous pressure fluctuation measurements are performed and an image processing method is developed to investigate amplitude and frequency of the sloshing motion of the free surface. It is found that this motion is excited at the natural frequency of the water volume and corresponds to the azimuthal wavenumber m = 1 of a rotating gravity wave. The amplitude of the motion is perturbed by wave breaking and it decreases by increasing the densimetric Froude number. The sloshing frequency slightly increases with respect to the natural frequency of the water volume by increasing the densimetric Froude number. Moreover, it results that this resonant phenomenon is not related to the torque perturbation.

Near-surface energy transfers from internal tide beams to smaller vertical scale motions

Science.gov (United States)

Chou, S.; Staquet, C.; Carter, G. S.; Luther, D. S.

2016-02-01

Mechanical energy capable of causing diapycnal mixing in the ocean is transferred to the internal wave field when barotropic tides pass over underwater topography and generate internal tides. The resulting internal tide energy is confined in vertically limited structures, or beams. As internal tide beams (ITBs) propagate through regions of non-uniform stratification in the upper ocean, wave energy can be scattered through multiple reflections and refractions, be vertically trapped, or transferred to non-tidal frequencies through different nonlinear processes. Various observations have shown that ITBs are no longer detectable in horizontal kinetic energy beyond the first surface reflection. Importantly, this implies that some of the internal tide energy no longer propagates in to the abyssal ocean and consequently will not be available to maintain the density stratification. Using the NHM, a nonlinear and nonhydrostatic model based on the MITgcm, simulations of an ITB propagating up to the sea surface are examined in order to quantify the transformation of ITB energy to other motions. We compare and contrast the transformations enabled by idealized, smoothly-varying stratification with transformations enabled by realistic stratification containing a broad-band vertical wavenumber spectrum of variations. Preliminary two-dimensional results show that scattering due to small-scale structure in realistic stratification profiles from Hawaii can lead to energy being vertically trapped near the surface. Idealized simulations of "locally" generated internal solitary waves are analyzed in terms of energy flux transfers from the ITB to solitary waves, higher harmonics, and mean flow. The amount of internal tide energy which propagates back down after near-surface reflection of the ITB in different environments is quantified.

Neural correlates of sensory prediction errors in monkeys: evidence for internal models of voluntary self-motion in the cerebellum.

Science.gov (United States)

Cullen, Kathleen E; Brooks, Jessica X

2015-02-01

During self-motion, the vestibular system makes essential contributions to postural stability and self-motion perception. To ensure accurate perception and motor control, it is critical to distinguish between vestibular sensory inputs that are the result of externally applied motion (exafference) and that are the result of our own actions (reafference). Indeed, although the vestibular sensors encode vestibular afference and reafference with equal fidelity, neurons at the first central stage of sensory processing selectively encode vestibular exafference. The mechanism underlying this reafferent suppression compares the brain's motor-based expectation of sensory feedback with the actual sensory consequences of voluntary self-motion, effectively computing the sensory prediction error (i.e., exafference). It is generally thought that sensory prediction errors are computed in the cerebellum, yet it has been challenging to explicitly demonstrate this. We have recently addressed this question and found that deep cerebellar nuclei neurons explicitly encode sensory prediction errors during self-motion. Importantly, in everyday life, sensory prediction errors occur in response to changes in the effector or world (muscle strength, load, etc.), as well as in response to externally applied sensory stimulation. Accordingly, we hypothesize that altering the relationship between motor commands and the actual movement parameters will result in the updating in the cerebellum-based computation of exafference. If our hypothesis is correct, under these conditions, neuronal responses should initially be increased--consistent with a sudden increase in the sensory prediction error. Then, over time, as the internal model is updated, response modulation should decrease in parallel with a reduction in sensory prediction error, until vestibular reafference is again suppressed. The finding that the internal model predicting the sensory consequences of motor commands adapts for new

Inter-fraction variations in respiratory motion models

Energy Technology Data Exchange (ETDEWEB)

McClelland, J R; Modat, M; Ourselin, S; Hawkes, D J [Centre for Medical Image Computing, University College London (United Kingdom); Hughes, S; Qureshi, A; Ahmad, S; Landau, D B, E-mail: j.mcclelland@cs.ucl.ac.uk [Department of Oncology, Guy' s and St Thomas' s Hospitals NHS Trust, London (United Kingdom)

2011-01-07

Respiratory motion can vary dramatically between the planning stage and the different fractions of radiotherapy treatment. Motion predictions used when constructing the radiotherapy plan may be unsuitable for later fractions of treatment. This paper presents a methodology for constructing patient-specific respiratory motion models and uses these models to evaluate and analyse the inter-fraction variations in the respiratory motion. The internal respiratory motion is determined from the deformable registration of Cine CT data and related to a respiratory surrogate signal derived from 3D skin surface data. Three different models for relating the internal motion to the surrogate signal have been investigated in this work. Data were acquired from six lung cancer patients. Two full datasets were acquired for each patient, one before the course of radiotherapy treatment and one at the end (approximately 6 weeks later). Separate models were built for each dataset. All models could accurately predict the respiratory motion in the same dataset, but had large errors when predicting the motion in the other dataset. Analysis of the inter-fraction variations revealed that most variations were spatially varying base-line shifts, but changes to the anatomy and the motion trajectories were also observed.

The initial safe range of motion of the ankle joint after three methods of internal fixation of simulated fractures of the medial malleolus.

Science.gov (United States)

Shimamura, Yoshio; Kaneko, Kazuo; Kume, Kazuhiko; Maeda, Mutsuhiro; Iwase, Hideaki

2006-07-01

Previous studies have demonstrated the safe passive range of ankle motion for inter-bone stiffness after internal fixation under load but there is a lack of information about the safe range of ankle motion for early rehabilitation in the absence of loading. The present study was designed to assess the effect of ankle movement on inter-bone displacement characteristics of medial malleolus fractures following three types of internal fixation to determine the safe range of motion. Five lower legs obtained during autopsy were used to assess three types of internal fixation (two with Kirschner-wires alone; two with Kirschner-wires plus tension band wiring; and, one with an AO/ASIF malleolar screw alone). Following a simulated fracture by sawing through the medial malleolus the displacement between the fractured bone ends was measured during a passive range of movement with continuous monitoring using omega (Omega) shaped transducers and a biaxial flexible goniometer. Statistical analysis was performed with repeated measures analysis of variance. Inter-bone displacement was not proportional to the magnitude of movement throughout the range of ankle motion as, when separation exceeded 25 microm, there was increasingly wide separation as plantar-flexion or dorsal-flexion was increased. There was no statistical significant difference between the small amount of inter-bone displacement observed with three types of fixation within the safe range of dorsal-flexion and plantar-flexion for early rehabilitation. However the inter-bone separation when fixation utilized two Kirschner-wires alone tended to be greater than when using the other two types of fixation during dorsal-flexion and eversion. The present study revealed a reproducible range of ankle motion for early rehabilitation which was estimated to be within the range of 20 degrees of dorsal-flexion and 10 degrees of plantar-flexion without eversion. Also, internal fixation with two Kirschner-wires alone does not seem to

IT-Tools Concept for Simulation and Design of Water Hydraulic Mechatronic Test Facilities for Motion Control and Operation in Environmentally Sensitive Application Areas

DEFF Research Database (Denmark)

Conrad, Finn; Pobedza, J.; Sobczyk, A.

2004-01-01

This paper presents a proposed IT-Tools concept for modeling, simulation, analysis and design of water hydraulic actuators for motion control of machines, lifts, cranes and robots. The designed test rigs have tap water hydraulic components of the Danfoss Nessie® product family and equipped...... with a measurement and data acquisition system. Results of the mathematical modeling, simulation and design of the motion control test rigs are presented. Furthermore, the paper presents selected experimental and identifying test results for the water hydraulic test rigs....

On the coupling of cyclotron motion to ion internal degrees of freedom

International Nuclear Information System (INIS)

Dunbar, R.C.

1979-01-01

A possibility of significant coupling between gas-phase ion cyclotron motion and two internal angular momentum terms is explored. The first case, coupling with ion spin, is treated via the relativistic Hamiltonian, and found to produce only relativistic perturbations which are entirely negligible. The second case, coupling with ion rotation, is developed via its equivalence to a Stark effect. Small shifts in the cyclotron resonances frequency , ωsub(c) and the appearance of a weak cyclotron resonance at 2ωsub(c) are predicted, but these effects are negligible in general. If the cyclotron frequency is near an ion rotational transition, however, a shift of 10 -5 in cyclotron frequency may be observed, and could provide a means of investigating low-frequency rotational transitions of ions. (Auth.)

Internal friction of hydrated soda-lime-silicate glasses.

Science.gov (United States)

Reinsch, S; Müller, R; Deubener, J; Behrens, H

2013-11-07

The internal friction of hydrated soda-lime-silica glasses with total water content (C(W)) up to 1.9 wt. % was studied by dynamic mechanical analysis (DMA) using temperature-frequency sweeps from 723 K to 273 K and from 1 s(-1) to 50 s(-1). Total water content and concentrations of H2O molecules (C(H2O)) and OH groups (C(OH)) in the DMA specimens were determined by infrared spectroscopy. For low water contents (C(W) ≈ C(OH) friction peaks below the glass transition (α relaxation) were assigned to the low-temperature motion of alkali ions (γ relaxation) and cooperative movements of dissimilar mobile species under participation of OH at higher temperature (β(OH) relaxation). For large water contents (C(W) > 1 wt. %), where significant amounts of molecular water are evident (C(H2O) > 0.15 wt. %), however, internal friction spectra change unexpectedly: the β(OH) peak heights saturate and a low temperature shoulder appears on the β-relaxation peak. This emerging relaxation mode (β(H2O) relaxation) was assigned to the motions of H2O molecules. β(H2O) relaxation was found to be faster than β(OH) but slower than γ relaxation. Activation energy of the different relaxation modes increased in the order γ < β(H2O) < β(OH) < α.

Three-dimensional intrafractional internal target motions in accelerated partial breast irradiation using three-dimensional conformal external beam radiotherapy.

Science.gov (United States)

Hirata, Kimiko; Yoshimura, Michio; Mukumoto, Nobutaka; Nakamura, Mitsuhiro; Inoue, Minoru; Sasaki, Makoto; Fujimoto, Takahiro; Yano, Shinsuke; Nakata, Manabu; Mizowaki, Takashi; Hiraoka, Masahiro

2017-07-01

We evaluated three-dimensional intrafractional target motion, divided into respiratory-induced motion and baseline drift, in accelerated partial breast irradiation (APBI). Paired fluoroscopic images were acquired simultaneously using orthogonal kV X-ray imaging systems at pre- and post-treatment for 23 patients who underwent APBI with external beam radiotherapy. The internal target motion was calculated from the surgical clips placed around the tumour cavity. The peak-to-peak respiratory-induced motions ranged from 0.6 to 1.5mm in all directions. A systematic baseline drift of 1.5mm towards the posterior direction and a random baseline drift of 0.3mm in the lateral-medial and cranial-caudal directions were observed. The baseline for an outer tumour cavity drifted towards the lateral and posterior directions, and that for an upper tumour cavity drifted towards the cranial direction. Moderate correlations were observed between the posterior baseline drift and the patients' physical characteristics. The posterior margin for intrafractional uncertainties was larger than 5mm in patients with greater fat thickness due to the baseline drift. The magnitude of the intrafractional motion was not uniform according to the direction, patients' physical characteristics, or tumour cavity location due to the baseline drift. Therefore, the intrafractional systematic movement should be properly managed. Copyright © 2017 Elsevier B.V. All rights reserved.

ROBUST MOTION SEGMENTATION FOR HIGH DEFINITION VIDEO SEQUENCES USING A FAST MULTI-RESOLUTION MOTION ESTIMATION BASED ON SPATIO-TEMPORAL TUBES

OpenAIRE

Brouard , Olivier; Delannay , Fabrice; Ricordel , Vincent; Barba , Dominique

2007-01-01

4 pages; International audience; Motion segmentation methods are effective for tracking video objects. However, objects segmentation methods based on motion need to know the global motion of the video in order to back-compensate it before computing the segmentation. In this paper, we propose a method which estimates the global motion of a High Definition (HD) video shot and then segments it using the remaining motion information. First, we develop a fast method for multi-resolution motion est...

Influence of different breathing maneuvers on internal and external organ motion: Use of fiducial markers in dynamic MRI

International Nuclear Information System (INIS)

Plathow, Christian; Zimmermann, Hendrik; Fink, Christian; Umathum, Reiner; Schoebinger, Max; Huber, Peter; Zuna, Ivan; Debus, Juergen; Schlegel, Wolfgang; Meinzer, Hans-Peter; Semmler, Wolfhard; Kauczor, Hans-Ulrich; Bock, Michael

2005-01-01

Purpose: To investigate, with dynamic magnetic resonance imaging (dMRI) and a fiducial marker, the influence of different breathing maneuvers on internal organ and external chest wall motion. Methods and materials: Lung and chest wall motion of 16 healthy subjects (13 male, 3 female) were examined with real-time trueFISP (true fast imaging with steady-state precession) dMRI and a small inductively coupled marker coil on either the abdomen or thorax. Three different breathing maneuvers were performed (predominantly 'abdominal breathing,' 'thoracic breathing,' and unspecific 'normal breathing'). The craniocaudal (CC), anteroposterior (AP), and mediolateral (ML) lung distances were correlated (linear regression coefficient) with marker coil position during forced and quiet breathing. Results: Differences of the CC distance between maximum forced inspiration and expiration were significant between abdominal and thoracic breathing (p < 0.05). The correlation between CC distance and coil position was best for forced abdominal breathing and a marker coil in the abdominal position (r 0.89 ± 0.04); for AP and ML distance, forced thoracic breathing and a coil in the thoracic position was best (r = 0.84 ± 0.03 and 0.82 ± 0.03, respectively). In quiet breathing, a lower correlation was found. Conclusion: A fiducial marker coil external to the thorax in combination with dMRI is a new technique to yield quantitative information on the correlation of internal organ and external chest wall motion. Correlations are highly dependent on the breathing maneuver

Altered Gravity Simulated by Parabolic Flight and Water Immersion Leads to Decreased Trunk Motion.

Directory of Open Access Journals (Sweden)

Peiliang Wang

Full Text Available Gravity is one of the important environmental factors that influence the physiologies and behaviors of animals and humans, and changes in gravity elicit a variety of physiological and behavioral alterations that include impaired movement coordination, vertigo, spatial disorientation, and perceptual illusions. To elucidate the effects of gravity on human physiology and behavior, we examined changes in wrist and trunk activities and heart rate during parabolic flight and the activity of wrist and trunk in water immersion experiments. Data from 195 person-time parabolas performed by eight subjects revealed that the trunk motion counts decreased by approximately half during ascending legs (hypergravity, relative to the data acquired before the parabolic flights. In contrast, the wrist activity remained unchanged. The results from the water immersion experiments demonstrated that in the underwater condition, both the wrist and trunk activities were significantly decreased but the latter decreased to a much lower level. Together, these data suggest that gravitational alterations can result in differential influences on the motions of the wrist and the trunk. These findings might be important for understanding the degeneration of skeleton and muscular system and performance of astronauts in microgravity.

Altered Gravity Simulated by Parabolic Flight and Water Immersion Leads to Decreased Trunk Motion

Science.gov (United States)

Tian, Yu; Li, Fan; Zhang, Shaoyao; Zhang, Lin; Guo, Yaoyu; Liu, Weibo; Wang, Chunhui; Chen, Shanguang; Guo, Jinhu

2015-01-01

Gravity is one of the important environmental factors that influence the physiologies and behaviors of animals and humans, and changes in gravity elicit a variety of physiological and behavioral alterations that include impaired movement coordination, vertigo, spatial disorientation, and perceptual illusions. To elucidate the effects of gravity on human physiology and behavior, we examined changes in wrist and trunk activities and heart rate during parabolic flight and the activity of wrist and trunk in water immersion experiments. Data from 195 person-time parabolas performed by eight subjects revealed that the trunk motion counts decreased by approximately half during ascending legs (hypergravity), relative to the data acquired before the parabolic flights. In contrast, the wrist activity remained unchanged. The results from the water immersion experiments demonstrated that in the underwater condition, both the wrist and trunk activities were significantly decreased but the latter decreased to a much lower level. Together, these data suggest that gravitational alterations can result in differential influences on the motions of the wrist and the trunk. These findings might be important for understanding the degeneration of skeleton and muscular system and performance of astronauts in microgravity. PMID:26208253

Experimental and numerical study on coupled motion responses of a floating crane vessel and a lifted subsea manifold in deep water

Directory of Open Access Journals (Sweden)

B.W. Nam

2017-09-01

Full Text Available The floating crane vessel in waves gives rise to the motion of the lifted object which is connected to the hoisting wire. The dynamic tension induced by the lifted object also affects the motion responses of the floating crane vessel in return. In this study, coupled motion responses of a floating crane vessel and a lifted subsea manifold during deep-water installation operations were investigated by both experiments and numerical calculations. A series of model tests for the deep-water lifting operation were performed at Ocean Engineering Basin of KRISO. For the model test, the vessel with a crane control system and a typical subsea manifold were examined. To validate the experimental results, a frequency-domain motion analysis method is applied. The coupled motion equations of the crane vessel and the lifted object are solved in the frequency domain with an additional linear stiffness matrix due to the hoisting wire. The hydrodynamic coefficients of the lifted object, which is a significant factor to affect the coupled dynamics, are estimated based on the perforation value of the structure and the CFD results. The discussions were made on three main points. First, the motion characteristics of the lifted object as well as the crane vessel were studied by comparing the calculation results. Second, the dynamic tension of the hoisting wire were evaluated under the various wave conditions. Final discussion was made on the effect of passive heave compensator on the motion and tension responses.

Infrared and Raman study of the fast internal motions of non-rigid molecules in condensed state: method of selective deuteration

International Nuclear Information System (INIS)

Lascombe, J.; Cavagnat, D.; Lassegues, J.C.; Rafilipomanana, C.

1983-01-01

The dynamical behaviour of non-rigid molecules in the gas state is now well known but very little information is available on these molecules in condensed state. The authors present a method of study based on the analysis of the infrared and Raman spectra of selectively deuterated molecules. It is applied to the nitromethane and cyclopentene molecules which provide respectively characteristic examples of methyl internal rotation and ring-puckering motion. In each case, an isolated -C0 or -CD oscillator is modulated by the internal motion and several γ(CH) or γ(CD) bands are observed as a result of the dependence of the vibrational frequency of the oscillator on its conformational situation. Moreover, in the case of crystalline nitromethane a detailed study of the temperature dependence of the band profiles allows the main mechanism of relaxation of the -CH oscillator to be deduced. (orig.)

Leaks in the internal water supply piping systems

OpenAIRE

Orlov Evgeniy Vladimirovich; Komarov Anatoliy Sergeevich; Mel’nikov Fedor Alekseevich; Serov Aleksandr Evgen’evich

2015-01-01

Great water losses in the internal plumbing of a building lead to the waste of money for a fence, purification and supply of water volumes in excess. This does not support the concept of water conservation and resource saving lying today in the basis of any building’s construction having plumbing. Leakage means unplanned of water losses systems in domestic water supply systems (hot or cold) as a result of impaired integrity, complicating the operation of a system and leading to high costs of ...

Virtual water trade: an assessment of water use efficiency in the international food trade

Directory of Open Access Journals (Sweden)

H. Yang

2006-01-01

Full Text Available Amid an increasing water scarcity in many parts of the world, virtual water trade as both a policy instrument and practical means to balance the local, national and global water budget has received much attention in recent years. Building upon the knowledge of virtual water accounting in the literature, this study assesses the efficiency of water use embodied in the international food trade from the perspectives of exporting and importing countries and at the global and country levels. The investigation reveals that the virtual water flows primarily from countries of high crop water productivity to countries of low crop water productivity, generating a global saving in water use. Meanwhile, the total virtual water trade is dominated by green virtual water, which constitutes a low opportunity cost of water use as opposed to blue virtual water. A sensitivity analysis, however, suggests high uncertainties in the virtual water accounting and the estimation of the scale of water saving. The study also raises awareness of the limited effect of water scarcity on the global virtual water trade and the negative implications of the global water saving for the water use efficiency and food security in importing countries and the environment in exporting countries. The analysis shows the complexity in evaluating the efficiency gains in the international virtual water trade. The findings of the study, nevertheless, call for a greater emphasis on rainfed agriculture to improve the global food security and environmental sustainability.

Pumice aggregates for internal water curing

DEFF Research Database (Denmark)

Pietro, Lura; Bentz, Dale P.; Lange, David A.

2004-01-01

without pumice and mixes with 4% and 8% pumice by volume of mortar. By addition of pumice, mortars with improved strength, enhanced degree of hydration and reduced autogenous shrinkage were obtained. An important obstacle to the application of this kind of pumice for actual concrete production......A novel concept in internal curing of High Performance Concrete is based on dispersing very small, saturated lightweight aggregates (LWA) in the concrete, containing sufficient water to counteract self-desiccation. With this approach, the amount of water in the LWA can be minimized, thus...... water absorption, but they release a greater percentage of their absorbed water at the equilibrium relative humidity of practical interest in early-age concrete, above 90%. Additionally, early-age properties of mortars with different contents of saturated pumice were investigated: a reference mix...

Audiovisual biofeedback improves diaphragm motion reproducibility in MRI

Science.gov (United States)

Kim, Taeho; Pollock, Sean; Lee, Danny; O’Brien, Ricky; Keall, Paul

2012-01-01

Purpose: In lung radiotherapy, variations in cycle-to-cycle breathing results in four-dimensional computed tomography imaging artifacts, leading to inaccurate beam coverage and tumor targeting. In previous studies, the effect of audiovisual (AV) biofeedback on the external respiratory signal reproducibility has been investigated but the internal anatomy motion has not been fully studied. The aim of this study is to test the hypothesis that AV biofeedback improves diaphragm motion reproducibility of internal anatomy using magnetic resonance imaging (MRI). Methods: To test the hypothesis 15 healthy human subjects were enrolled in an ethics-approved AV biofeedback study consisting of two imaging sessions spaced ∼1 week apart. Within each session MR images were acquired under free breathing and AV biofeedback conditions. The respiratory signal to the AV biofeedback system utilized optical monitoring of an external marker placed on the abdomen. Synchronously, serial thoracic 2D MR images were obtained to measure the diaphragm motion using a fast gradient-recalled-echo MR pulse sequence in both coronal and sagittal planes. The improvement in the diaphragm motion reproducibility using the AV biofeedback system was quantified by comparing cycle-to-cycle variability in displacement, respiratory period, and baseline drift. Additionally, the variation in improvement between the two sessions was also quantified. Results: The average root mean square error (RMSE) of diaphragm cycle-to-cycle displacement was reduced from 2.6 mm with free breathing to 1.6 mm (38% reduction) with the implementation of AV biofeedback (p-value biofeedback (p-value biofeedback (p-value = 0.012). The diaphragm motion reproducibility improvements with AV biofeedback were consistent with the abdominal motion reproducibility that was observed from the external marker motion variation. Conclusions: This study was the first to investigate the potential of AV biofeedback to improve the motion

A nuclear magnetic relaxation study on internal motion of polyelectrolytes in solution

International Nuclear Information System (INIS)

Schriever, J.

1977-01-01

The aim of this thesis is to investigate the significance and the amount of information which can be extracted from the study of frequency dependence of magnetic relaxation rates in solutions of a synthetic macromolecule. Solutions of poly(methacrylic acid), PMA, in water were chosen as the object of the present work. A short survey of nuclear magnetic relaxation in solutions of simple macromolecules is presented. Results obtained by continuous wave experiments on PMA solutions are shown (viz. the information about the transverse relaxation from line width analysis of 60 MHz proton spectra). Water enriched in 17 O is used in magnetic relaxation studies; the results of the determination of hydrogen lifetimes in aqueous solutions of acetic acid and poly(methacrylic acid) are given. The possibility of obtaining information about the dynamics of deuterons in the acid side groups of weak polyacids by measuring deuteron relaxation in heavy water solutions of those acids is considered. The use of deuteron relaxation rate experiments on solutions of selectively methylene deuterated poly(methacrylic acid), [-CD 2 -CCH 3 COOH-]n, is demonstrated and the backbone methylene C-atom motion is charachterized. The magne-tic relaxation of nuclei in the side groups of methylene deuterated PMA, viz. protons in the methyland deuterons in the acid side groups is presented

Mental imagery of gravitational motion.

Science.gov (United States)

Gravano, Silvio; Zago, Myrka; Lacquaniti, Francesco

2017-10-01

There is considerable evidence that gravitational acceleration is taken into account in the interaction with falling targets through an internal model of Earth gravity. Here we asked whether this internal model is accessed also when target motion is imagined rather than real. In the main experiments, naïve participants grasped an imaginary ball, threw it against the ceiling, and caught it on rebound. In different blocks of trials, they had to imagine that the ball moved under terrestrial gravity (1g condition) or under microgravity (0g) as during a space flight. We measured the speed and timing of the throwing and catching actions, and plotted ball flight duration versus throwing speed. Best-fitting duration-speed curves estimate the laws of ball motion implicit in the participant's performance. Surprisingly, we found duration-speed curves compatible with 0g for both the imaginary 0g condition and the imaginary 1g condition, despite the familiarity with Earth gravity effects and the added realism of performing the throwing and catching actions. In a control experiment, naïve participants were asked to throw the imaginary ball vertically upwards at different heights, without hitting the ceiling, and to catch it on its way down. All participants overestimated ball flight durations relative to the durations predicted by the effects of Earth gravity. Overall, the results indicate that mental imagery of motion does not have access to the internal model of Earth gravity, but resorts to a simulation of visual motion. Because visual processing of accelerating/decelerating motion is poor, visual imagery of motion at constant speed or slowly varying speed appears to be the preferred mode to perform the tasks. Copyright © 2017 Elsevier Ltd. All rights reserved.

A Fast Algorithm to Simulate Droplet Motions in Oil/Water Two Phase Flow

KAUST Repository

Zhang, Tao

2017-06-09

To improve the research methods in petroleum industry, we develop a fast algorithm to simulate droplet motions in oil and water two phase flow, using phase field model to describe the phase distribution in the flow process. An efficient partial difference equation solver—Shift-Matrix method is applied here, to speed up the calculation coding in high-level language, i.e. Matlab and R. An analytical solution of order parameter is derived, to define the initial condition of phase distribution. The upwind scheme is applied in our algorithm, to make it energy decay stable, which results in the fast speed of calculation. To make it more clear and understandable, we provide the specific code for forming the coefficient matrix used in Shift-Matrix Method. Our algorithm is compared with other methods in different scales, including Front Tracking and VOSET method in macroscopic and LBM method using RK model in mesoscopic scale. In addition, we compare the result of droplet motion under gravity using our algorithm with the empirical formula common used in industry. The result proves the high efficiency and robustness of our algorithm and it’s then used to simulate the motions of multiple droplets under gravity and cross-direction forces, which is more practical in industry and can be extended to wider application.

Evaluation of hip internal and external rotation range of motion as an injury risk factor for hip, abdominal and groin injuries in professional baseball players

Directory of Open Access Journals (Sweden)

Xinning Li

2015-12-01

Full Text Available Normal hip range of motion (ROM is essential in running and transfer of energy from lower to upper extremities during overhead throwing. Dysfunctional hip ROM may alter lower extremity kinematics and predispose athletes to hip and groin injuries. The purpose of this study is characterize hip internal/external ROM (Arc and its effect on the risk of hip, hamstring, and groin injuries in professional baseball players. Bilateral hip internal and external ROM was measured on all baseball players (N=201 in one professional organization (major and minor league during spring training. Players were organized according to their respective positions. All injuries were documented prospectively for an entire MLB season (2010 to 2011. Data was analyzed according to position and injuries during the season. Total number of players (N=201 with an average age of 24±3.6 (range=17-37. Both pitchers (N=93 and catchers (N=22 had significantly decreased mean hip internal rotation and overall hip arc of motion compared to the positional players (N=86. Players with hip, groin, and hamstring injury also had decreased hip rotation arc when compared to the normal group. Overall, there is a correlation between decreased hip internal rotation and total arc of motion with hip, hamstring, and groin injuries.

Wave excited motion of a body floating on water confined between two semi-infinite ice sheets

Science.gov (United States)

Ren, K.; Wu, G. X.; Thomas, G. A.

2016-12-01

The wave excited motion of a body floating on water confined between two semi-infinite ice sheets is investigated. The ice sheet is treated as an elastic thin plate and water is treated as an ideal and incompressible fluid. The linearized velocity potential theory is adopted in the frequency domain and problems are solved by the method of matched eigenfunctions expansion. The fluid domain is divided into sub-regions and in each sub-region the velocity potential is expanded into a series of eigenfunctions satisfying the governing equation and the boundary conditions on horizontal planes including the free surface and ice sheets. Matching is conducted at the interfaces of two neighbouring regions to ensure the continuity of the pressure and velocity, and the unknown coefficients in the expressions are obtained as a result. The behaviour of the added mass and damping coefficients of the floating body with the effect of the ice sheets and the excitation force are analysed. They are found to vary oscillatorily with the wave number, which is different from that for a floating body in the open sea. The motion of the body confined between ice sheets is investigated, in particular its resonant behaviour with extremely large motion found to be possible under certain conditions. Standing waves within the polynya are also observed.

Static and Dynamic Water Motion-Induced Instability in Oxide Thin-Film Transistors and Its Suppression by Using Low-k Fluoropolymer Passivation.

Science.gov (United States)

Choi, Seungbeom; Jo, Jeong-Wan; Kim, Jaeyoung; Song, Seungho; Kim, Jaekyun; Park, Sung Kyu; Kim, Yong-Hoon

2017-08-09

Here, we report static and dynamic water motion-induced instability in indium-gallium-zinc-oxide (IGZO) thin-film transistors (TFTs) and its effective suppression with the use of a simple, solution-processed low-k (ε ∼ 1.9) fluoroplastic resin (FPR) passivation layer. The liquid-contact electrification effect, in which an undesirable drain current modulation is induced by a dynamic motion of a charged liquid such as water, can cause a significant instability in IGZO TFTs. It was found that by adopting a thin (∼44 nm) FPR passivation layer for IGZO TFTs, the current modulation induced by the water-contact electrification was greatly reduced in both off- and on-states of the device. In addition, the FPR-passivated IGZO TFTs exhibited an excellent stability to static water exposure (a threshold voltage shift of +0.8 V upon 3600 s of water soaking), which is attributed to the hydrophobicity of the FPR passivation layer. Here, we discuss the origin of the current instability caused by the liquid-contact electrification as well as various static and dynamic stability tests for IGZO TFTs. On the basis of our findings, we believe that the use of a thin, solution-processed FPR passivation layer is effective in suppressing the static and dynamic water motion-induced instabilities, which may enable the realization of high-performance and environment-stable oxide TFTs for emerging wearable and skin-like electronics.

Tsunami generation and associated waves in the water column and seabed due to an asymmetric earthquake motion within an anisotropic substratum

Science.gov (United States)

Bagheri, Amirhossein; Greenhalgh, Stewart; Khojasteh, Ali; Rahimian, Mohammad; Attarnejad, Reza

2016-10-01

In this paper, closed-form integral expressions are derived to describe how surface gravity waves (tsunamis) are generated when general asymmetric ground displacement (due to earthquake rupturing), involving both horizontal and vertical components of motion, occurs at arbitrary depth within the interior of an anisotropic subsea solid beneath the ocean. In addition, we compute the resultant hydrodynamic pressure within the seawater and the elastic wavefield within the seabed at any position. The method of potential functions and an integral transform approach, accompanied by a special contour integration scheme, are adopted to handle the equations of motion and produce the numerical results. The formulation accounts for any number of possible acoustic-gravity modes and is valid for both shallow and deep water situations as well as for any focal depth of the earthquake source. Phase and group velocity dispersion curves are developed for surface gravity (tsunami mode), acoustic-gravity, Rayleigh, and Scholte waves. Several asymptotic cases which arise from the general analysis are discussed and compared to existing solutions. The role of effective parameters such as hypocenter location and frequency of excitation is examined and illustrated through several figures which show the propagation pattern in the vertical and horizontal directions. Attention is directed to the unexpected contribution from the horizontal ground motion. The results have important application in several fields such as tsunami hazard prediction, marine seismology, and offshore and coastal engineering. In a companion paper, we examine the effect of ocean stratification on the appearance and character of internal and surface gravity waves.

19 CFR 210.57 - Amendment of the motion.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 3 2010-04-01 2010-04-01 false Amendment of the motion. 210.57 Section 210.57 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Temporary Relief § 210.57 Amendment of the motion. A motion for...

Water motion and movement without sticking, weight loss and cross-contaminant in superhydrophobic glass tube.

Science.gov (United States)

Yuan, Jian-Jun; Jin, Ren-Hua

2010-02-10

We report that a simple fabrication of a superhydrophobic nanosurface consisted of a grass-like silica thin film on the inner wall of a glass tube and its feature in water motion and water movement. The glass tube with a superhydrophobic inner wall can make the water flow with friction-drag reduction and completely preventing water sticking. Transferring water by this tube did not cause weight loss at all. Therefore, aqueous solutions containing high content metal ions were cross-moved without washing the tube used and no cross-contamination occurred after cross-movement. Furthermore, in an inside diameter of 6.0 mm glass tube where the half-length of the inner surface is covered by superhydrophobic nanograss and the other half is an unmodified hydrophilic surface, the water droplets flowing down from the hydrophilic side can be stopped spontaneously at the hydrophilic-superhydrophobic boundary as if there is an invisible flow-stopping fence built inside the glass tube.

Motion compensation for MRI-guided radiotherapy

NARCIS (Netherlands)

Glitzner, M.

2017-01-01

Radiotherapy aims to deliver a lethal radiation dose to cancer cells immersed in the body using a high energetic photon beam. Due to physiologic motion of the human anatomy (e.g. caused by filling of internal organs or breathing), the target volume is under permanent motion during irradiation,

Field theory of the spinning electron: I - Internal motions

International Nuclear Information System (INIS)

Salesi, Giovanni; Recami, Erasmo; Universidade Estadual de Campinas, SP

1994-05-01

One of the most satisfactory picture of spinning particles is the Barut-Zanghi (BZ) classical theory for the relativistic electron, that relates the electron spin with the so-called Zitterbewegung (zbw). The BZ theory has been recently studied in the Lagrangian and Hamiltonian symplectic formulations, both in flat and in curved space-time. The BZ motion equations constituted the starting point for two recent works about spin and electron structure, co-authored by us, which adopted the Clifford algebra formalism. In this letter, by employing on the contrary the ordinary tensorial language, we first write down a meaningful (real) equation of motion, describing particle classical paths, quite different from the corresponding (complex) equation of the standard Dirac theory. As a consequence, we succeed in regarding the electron as an extended-type object with a classically intelligible structure (thus overcoming some long-standing, well-known problems). Second, we make explicit the kinematical properties of the 4-velocity field v μ , which also result to be quite different from the ordinary ones, valid for scalar particles. At last, we analyze the inner zbw motions, both time-like and light-like, as functions of the initial conditions (in particular, for the case of classical uniform motions, the z component of spin s is shown to be quantized). In so doing, we make explicit the strict correlation existing between electron polarization and zbw kinematics. (author). 9 refs

Field theory of the spinning electron: I - Internal motions

Energy Technology Data Exchange (ETDEWEB)

Salesi, Giovanni [Universita Statale di Catania (Italy). Dipt. di Fisica; Recami, Erasmo [Universita Statale di Bergamo, Dalmine, BG (Italy). Facolta di Ingegneria]|[Universidade Estadual de Campinas, SP (Brazil). Dept. de Matematica Aplicada

1994-05-01

One of the most satisfactory picture of spinning particles is the Barut-Zanghi (BZ) classical theory for the relativistic electron, that relates the electron spin with the so-called Zitterbewegung (zbw). The BZ theory has been recently studied in the Lagrangian and Hamiltonian symplectic formulations, both in flat and in curved space-time. The BZ motion equations constituted the starting point for two recent works about spin and electron structure, co-authored by us, which adopted the Clifford algebra formalism. In this letter, by employing on the contrary the ordinary tensorial language, we first write down a meaningful (real) equation of motion, describing particle classical paths, quite different from the corresponding (complex) equation of the standard Dirac theory. As a consequence, we succeed in regarding the electron as an extended-type object with a classically intelligible structure (thus overcoming some long-standing, well-known problems). Second, we make explicit the kinematical properties of the 4-velocity field v{sup {mu}}, which also result to be quite different from the ordinary ones, valid for scalar particles. At last, we analyze the inner zbw motions, both time-like and light-like, as functions of the initial conditions (in particular, for the case of classical uniform motions, the z component of spin s is shown to be quantized). In so doing, we make explicit the strict correlation existing between electron polarization and zbw kinematics. (author). 9 refs.

Evaluating oil/water separators

International Nuclear Information System (INIS)

Murdoch, M.A.

1993-01-01

Four commercially available oil/water separators were tested at an oil refinery test facility. The separators were the Alfa-Laval OFPX 413 disk-stack centrifuge, the Conoco Vortoil hydrocyclone system, International Separation Technology's Intr-Septor 250, and a modified Flo Trend gravity separator. Each machine was tested against mixtures of salt water and crude oil, and mixtures of salt water and a water-in-oil emulsion. The impact on separator performance from simulated sea motion, and from the addition of emulsion breakers and debris to the influent, were also evaluated. The test equipment, instrumentation, analysis facilities, test plans, and procedures to conduct the tests are described, but test results are not reported. Recommendations for improved test procedures are included. The inability to accurately monitor flow rates was found to have the greatest negative impact on test performance and results. Aspects of the test program that worked well included the use of flexible and semi-rigid hoses for customizing the test setups, the use of modular and leased tanks, and the sea motion simulator swing table design. 3 refs., 2 tabs

Experimental-based Modelling and Simulation of Water Hydraulic Mechatronics Test Facilities for Motion Control and Operation in Environmental Sensitive Applications` Areas

DEFF Research Database (Denmark)

Conrad, Finn; Pobedza, J.; Sobczyk, A.

2003-01-01

The paper presents experimental-based modelling, simulation, analysis and design of water hydraulic actuators for motion control of machines, lifts, cranes and robots. The contributions includes results from on-going research projects on fluid power and mechatronics based on tap water hydraulic...

Seabed Motion During Sediment Density Flows as Recorded by Displaced Man-Made Motion-Recording Boulders and a Heavy Instrument Platform

Science.gov (United States)

Gwiazda, R.; Paull, C. K.; Kieft, B.; Bird, L.; Klimov, D.; Herlien, R.; Sherman, A.; McCann, M. P.; Sumner, E.; Talling, P.; Xu, J.; Parsons, D. R.; Maier, K. L.; Barry, J.

2017-12-01

Over a period of 18 months the Coordinated Canyon Experiment documented the passage of at least 15 sediment density flows in Monterey Canyon, offshore California, with an array of moorings and sensors placed from 200 m to 1,850 m water depths. Free-standing `smart' boulders (Benthic Event Detectors, BED) and a 1,000 Kg tripod with an Acoustic Monitoring Transponder (AMT) and a BED attached to it were deployed in the upper canyon to detect seabed motions during sediment density flows. BEDs consist of spheres made of a combination of metal, plastic and syntactic foam ballasted to 2.1 g/cm3 density, containing accelerometers along three orthogonal axes, a time recorder, and a pressure sensor inside a pressure case rated to 500 m water depth. Acceleration of ≥ 0.008 G triggers data collection at a recording rate of 50 Hz until motion stops. Built-in acoustic beacons and modems allow for BEDs to be relocated, and data to be downloaded, even when BEDs are buried in sediment to depths of >1 m. Over the course of the study, depth changes and velocities of 24 BED movements during 9 events were recorded. BEDs moved at the velocity of the propagation of the flows down canyon, as documented by the time of arrival of the flow at successive sensors, but sometimes travelled at lower speeds. Seven movements of the AMT tripod were also recorded. In the largest of these, the heavy AMT tripod was transported over a distance of 4.1 Km. For at least four of these seven motions the AMT temperature record indicates that the movements were initiated while the tripod was buried. In one particular event simultaneous movements of five BEDs over a 100 m depth range indicate that the entire seabed was in motion at the same time over a canyon distance of 3.5 Km. Reconstructions of instrument motions in this event from their internally recorded acceleration data show that the AMT displacement was at the front of the event and had no rotational component. In contrast, free standing BEDs at the

Motion Sickness: First Aid

Science.gov (United States)

... com. Accessed July 29, 2017. Priesol AJ. Motion sickness. https://www.uptodate.com/content/search. Accessed July 29, 2017. Brunette GW, et al. CDC Health Information for International Travel 2018. New York, N. ...

Electrostatic Model Applied to ISS Charged Water Droplet Experiment

Science.gov (United States)

Stevenson, Daan; Schaub, Hanspeter; Pettit, Donald R.

2015-01-01

The electrostatic force can be used to create novel relative motion between charged bodies if it can be isolated from the stronger gravitational and dissipative forces. Recently, Coulomb orbital motion was demonstrated on the International Space Station by releasing charged water droplets in the vicinity of a charged knitting needle. In this investigation, the Multi-Sphere Method, an electrostatic model developed to study active spacecraft position control by Coulomb charging, is used to simulate the complex orbital motion of the droplets. When atmospheric drag is introduced, the simulated motion closely mimics that seen in the video footage of the experiment. The electrostatic force's inverse dependency on separation distance near the center of the needle lends itself to analytic predictions of the radial motion.

Adaptive motion of animals and machines

National Research Council Canada - National Science Library

Kimura, Hiroshi

2006-01-01

... single function in a control system and mechanism. That is, adaptation in motion is induced at every level from the central nervous system to the musculoskeletal system. Thus, we organized the International Symposium on Adaptive Motion in Animals and Machines (AMAM) for scientists and engineers concerned with adaptation on various levels to be broug...

NASA's Impacts Towards Improving International Water Management Using Satellites

Science.gov (United States)

Toll, D. L.; Doorn, B.; Searby, N. D.; Entin, J. K.; Lawford, R. G.; Mohr, K. I.; Lee, C. M.

2013-12-01

Key objectives of the NASA's Water Resources and Capacity Building Programs are to discover and demonstrate innovative uses and practical benefits of NASA's advanced system technologies for improved water management. This presentation will emphasize NASA's water research, applications, and capacity building activities using satellites and models to contribute to water issues including water availability, transboundary water, flooding and droughts to international partners, particularly developing countries. NASA's free and open exchange of Earth data observations and products helps engage and improve integrated observation networks and enables national and multi-national regional water cycle research and applications that are especially useful in data sparse regions of most developing countries. NASA satellite and modeling products provide a huge volume of valuable data extending back over 50 years across a broad range of spatial (local to global) and temporal (hourly to decadal) scales and include many products that are available in near real time (see earthdata.nasa.gov). To further accomplish these objectives NASA works to actively partner with public and private groups (e.g. federal agencies, universities, NGO's, and industry) in the U.S. and internationally to ensure the broadest use of its satellites and related information and products and to collaborate with regional end users who know the regions and their needs best. The event will help demonstrate the strong partnering and the use of satellite data to provide synoptic and repetitive spatial coverage helping water managers' deal with complex issues. This presentation will outline and describe NASA's international water related research, applications and capacity building programs' efforts to address developing countries critical water challenges in Asia, African and Latin America. This will specifically highlight impacts and case studies from NASA's programs in Water Resources (e.g., drought, snow

Context analysis : sky, water and motion

NARCIS (Netherlands)

Javanbakhti, S.; Zinger, S.; With, de P.H.N.

2011-01-01

Interpreting the events present in the video is a complex task, and the same gesture or motion can be understood in several ways depending on the context of the event and/or the scene. Therefore the context of the scene can contribute to the semantic understanding of the video. In this paper, we

Asynchronous partial contact motion due to internal resonance in multiple degree-of-freedom rotordynamics.

Science.gov (United States)

Shaw, A D; Champneys, A R; Friswell, M I

2016-08-01

Sudden onset of violent chattering or whirling rotor-stator contact motion in rotational machines can cause significant damage in many industrial applications. It is shown that internal resonance can lead to the onset of bouncing-type partial contact motion away from primary resonances. These partial contact limit cycles can involve any two modes of an arbitrarily high degree-of-freedom system, and can be seen as an extension of a synchronization condition previously reported for a single disc system. The synchronization formula predicts multiple drivespeeds, corresponding to different forms of mode-locked bouncing orbits. These results are backed up by a brute-force bifurcation analysis which reveals numerical existence of the corresponding family of bouncing orbits at supercritical drivespeeds, provided the damping is sufficiently low. The numerics reveal many overlapping families of solutions, which leads to significant multi-stability of the response at given drive speeds. Further, secondary bifurcations can also occur within each family, altering the nature of the response and ultimately leading to chaos. It is illustrated how stiffness and damping of the stator have a large effect on the number and nature of the partial contact solutions, illustrating the extreme sensitivity that would be observed in practice.

Technical Note: Intrafractional changes in time lag relationship between anterior–posterior external and superior–inferior internal motion signals in abdominal tumor sites

Science.gov (United States)

Regmi, Rajesh; Lovelock, D. Michael; Zhang, Pengpeng; Pham, Hai; Xiong, Jianping; Yorke, Ellen D.; Goodman, Karyn A.; Wu, Abraham J.; Mageras, Gig S.

2015-01-01

Purpose: To investigate constancy, within a treatment session, of the time lag relationship between implanted markers in abdominal tumors and an external motion surrogate. Methods: Six gastroesophageal junction and three pancreatic cancer patients (IRB-approved protocol) received two cone-beam CTs (CBCT), one before and one after treatment. Time between scans was less than 30 min. Each patient had at least one implanted fiducial marker near the tumor. In all scans, abdominal displacement (Varian RPM) was recorded as the external motion signal. Purpose-built software tracked fiducials, representing internal signal, in CBCT projection images. Time lag between superior–inferior (SI) internal and anterior–posterior external signals was found by maximizing the correlation coefficient in each breathing cycle and averaging over all cycles. Time-lag-induced discrepancy between internal SI position and that predicted from the external signal (external prediction error) was also calculated. Results: Mean ± standard deviation time lag, over all scans and patients, was 0.10 ± 0.07 s (range 0.01–0.36 s). External signal lagged the internal in 17/18 scans. Change in time lag between pre- and post-treatment CBCT was 0.06 ± 0.07 s (range 0.01–0.22 s), corresponding to 3.1% ± 3.7% (range 0.6%–10.8%) of gate width (range 1.6–3.1 s). In only one patient, change in time lag exceeded 10% of the gate width. External prediction error over all scans of all patients varied from 0.1 ± 0.1 to 1.6 ± 0.4 mm. Conclusions: Time lag between internal motion along SI and external signals is small compared to the treatment gate width of abdominal patients examined in this study. Change in time lag within a treatment session, inferred from pre- to post-treatment measurements is also small, suggesting that a single measurement of time lag at the session start is adequate. These findings require confirmation in a larger number of patients. PMID:26127033

Technical Note: Intrafractional changes in time lag relationship between anterior-posterior external and superior-inferior internal motion signals in abdominal tumor sites.

Science.gov (United States)

Regmi, Rajesh; Lovelock, D Michael; Zhang, Pengpeng; Pham, Hai; Xiong, Jianping; Yorke, Ellen D; Goodman, Karyn A; Wu, Abraham J; Mageras, Gig S

2015-06-01

To investigate constancy, within a treatment session, of the time lag relationship between implanted markers in abdominal tumors and an external motion surrogate. Six gastroesophageal junction and three pancreatic cancer patients (IRB-approved protocol) received two cone-beam CTs (CBCT), one before and one after treatment. Time between scans was less than 30 min. Each patient had at least one implanted fiducial marker near the tumor. In all scans, abdominal displacement (Varian RPM) was recorded as the external motion signal. Purpose-built software tracked fiducials, representing internal signal, in CBCT projection images. Time lag between superior-inferior (SI) internal and anterior-posterior external signals was found by maximizing the correlation coefficient in each breathing cycle and averaging over all cycles. Time-lag-induced discrepancy between internal SI position and that predicted from the external signal (external prediction error) was also calculated. Mean ± standard deviation time lag, over all scans and patients, was 0.10 ± 0.07 s (range 0.01-0.36 s). External signal lagged the internal in 17/18 scans. Change in time lag between pre- and post-treatment CBCT was 0.06 ± 0.07 s (range 0.01-0.22 s), corresponding to 3.1% ± 3.7% (range 0.6%-10.8%) of gate width (range 1.6-3.1 s). In only one patient, change in time lag exceeded 10% of the gate width. External prediction error over all scans of all patients varied from 0.1 ± 0.1 to 1.6 ± 0.4 mm. Time lag between internal motion along SI and external signals is small compared to the treatment gate width of abdominal patients examined in this study. Change in time lag within a treatment session, inferred from pre- to post-treatment measurements is also small, suggesting that a single measurement of time lag at the session start is adequate. These findings require confirmation in a larger number of patients.

Modeling Water Motion near Seismic Waves Propagating across a Graded Seabed, as Generated by Man-Made Impacts

Directory of Open Access Journals (Sweden)

Richard A. Hazelwood

2016-08-01

Full Text Available Seismic interface waves generated by seabed impacts are believed to have biological importance. Various wave types are of interest to seismologists, who can minimize the unwanted, but often dominant, ground roll waves with suitable instrumentation. Waves made by dredging and piling have been measured using geophones and found to be of this interface type, which propagate much more slowly than the pressure waves in the water column above. Short interface wavelets of a few cycles were modeled using transient finite element analysis (FEA. Wavelets with low losses have been modeled using graded sediment data from the literature. They do not radiate energy away from the interface because the evanescent acoustic pressures they generate decay rapidly with distance from the seabed. Associated water particle velocities are much greater than would be expected from similar acoustic pressure measurements in a free field. This motion is significant to aquatic life which is dependent on inertial sensors (otoliths, etc. to respond to the environment. Additional amplification of the horizontal seabed motion of the adjacent water is predicted for a short seismic wavelet modeled in a graded solid seabed. Further recent analysis studied the distribution of the energy flux within the sediment layers.

Visualization of the collective vortex-like motions in liquid argon and water: Molecular dynamics simulation

Science.gov (United States)

Anikeenko, A. V.; Malenkov, G. G.; Naberukhin, Yu. I.

2018-03-01

We propose a new measure of collectivity of molecular motion in the liquid: the average vector of displacement of the particles, ⟨ΔR⟩, which initially have been localized within a sphere of radius Rsph and then have executed the diffusive motion during a time interval Δt. The more correlated the motion of the particles is, the longer will be the vector ⟨ΔR⟩. We visualize the picture of collective motions in molecular dynamics (MD) models of liquids by constructing the ⟨ΔR⟩ vectors and pinning them to the sites of the uniform grid which divides each of the edges of the model box into equal parts. MD models of liquid argon and water have been studied by this method. Qualitatively, the patterns of ⟨ΔR⟩ vectors are similar for these two liquids but differ in minor details. The most important result of our research is the revealing of the aggregates of ⟨ΔR⟩ vectors which have the form of extended flows which sometimes look like the parts of vortices. These vortex-like clusters of ⟨ΔR⟩ vectors have the mesoscopic size (of the order of 10 nm) and persist for tens of picoseconds. Dependence of the ⟨ΔR⟩ vector field on parameters Rsph, Δt, and on the model size has been investigated. This field in the models of liquids differs essentially from that in a random-walk model.

On the roto-translatory internal motions of a three layer non-isobarycentric Earth model: a Lagrangian system approach

Science.gov (United States)

Escapa, Alberto; Fukushima, Toshio

2010-05-01

The internal structure of numerous celestial bodies are well approximated by means of a three layer model composed of a solid external layer, which encloses a fluid layer containing a solid body. An analysis of the inner dynamics of this model can provide some constrains on its rheological characteristics; an information that in many situations is only accessible through this indirect way. In addition, the understanding of this kind of motions, especially of those associated with a rigid displacement (a rotation or a relative translation) of the solid layers, is of primary importance to establish with enough accuracy the definition of the terrestrial reference frames. In the Earth case, most approaches to this formidable problem rely on the numerical solution of the respective elastic field equations, once they have been projected on a set of spherical harmonics functions of a given degree. Due to its intrinsic nature these numerical methods do not provide by themselves much insight into the internal dynamics, hence the interest to develop simpler dynamical models that reproduces the main characteristics of the motion and allows obtaining analytical approximate solutions of the problem. To this aim, and as a first stage, we have considered the internal dynamics of a simple Earth model made up of a spherical rigid mantle, an inviscid, homogeneous fluid outer core and a spherical rigid inner core. Initially the barycenters of all the constituents are located at the same point (isobarycentric model) and the whole system rotates with constant angular velocity around the figure axis. When this situation is perturbed both the motions of the fluid and of the solid layers depart from the reference uniform rotation. However, following Busse (1974) we have assumed that the motion of the mantle is the same as in the unperturbed state, and that the inner core dynamics only suffers a variation of oscillatory nature in the translational motion of its barycenter. As a consequence

Motion-based, high-yielding, and fast separation of different charged organics in water.

Science.gov (United States)

Xuan, Mingjun; Lin, Xiankun; Shao, Jingxin; Dai, Luru; He, Qiang

2015-01-12

We report a self-propelled Janus silica micromotor as a motion-based analytical method for achieving fast target separation of polyelectrolyte microcapsules, enriching different charged organics with low molecular weights in water. The self-propelled Janus silica micromotor catalytically decomposes a hydrogen peroxide fuel and moves along the direction of the catalyst face at a speed of 126.3 μm s(-1) . Biotin-functionalized Janus micromotors can specifically capture and rapidly transport streptavidin-modified polyelectrolyte multilayer capsules, which could effectively enrich and separate different charged organics in water. The interior of the polyelectrolyte multilayer microcapsules were filled with a strong charged polyelectrolyte, and thus a Donnan equilibrium is favorable between the inner solution within the capsules and the bulk solution to entrap oppositely charged organics in water. The integration of these self-propelled Janus silica micromotors and polyelectrolyte multilayer capsules into a lab-on-chip device that enables the separation and analysis of charged organics could be attractive for a diverse range of applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

TU-AB-BRA-06: BEST IN PHYSICS (JOINT IMAGING-THERAPY): An MRI Compatible Externally and Internally Deformable Lung Motion Phantom for Multi-Modality IGRT

Energy Technology Data Exchange (ETDEWEB)

Sabouri, P; Sawant, A [University of Texas Southwestern Medical Center, Dallas, TX (United States); Arai, T [University of Maryland School of Medicine, Baltimore, MD (United States)

2016-06-15

Purpose: MRI has become an attractive tool for tumor motion management. Current MR-compatible phantoms are only capable of reproducing translational motion. This study describes the construction and validation of a more realistic, MRI-compatible lung phantom that is deformable internally as well as externally. We demonstrate a radiotherapy application of this phantom by validating the geometric accuracy of the open-source deformable image registration software NiftyReg (UCL, UK). Methods: The outer shell of a commercially-available dynamic breathing torso phantom was filled with natural latex foam with eleven water tubes. A rigid foam cut-out served as the diaphragm. A high-precision programmable, in-house, MRI-compatible motion platform was used to drive the diaphragm. The phantom was imaged on a 3T scanner (Philips, Ingenia). Twenty seven tumor traces previously recorded from lung cancer patients were programmed into the phantom and 2D+t image sequences were acquired using a sparse-sampling sequence k-t BLAST (accn=3, resolution=0.66×0.66×5mm3; acquisition-time=110ms/slice). The geometric fidelity of the MRI-derived trajectories was validated against those obtained via fluoroscopy using the on board kV imager on a Truebeam linac. NiftyReg was used to perform frame by frame deformable image registration. The location of each marker predicted by using NiftyReg was compared with the values calculated by intensity-based segmentation on each frame. Results: In all cases, MR trajectories were within 1 mm of corresponding fluoroscopy trajectories. RMSE between centroid positions obtained from segmentation with those obtained by NiftyReg varies from 0.1 to 0.21 mm in the SI direction and 0.08 to 0.13 mm in the LR direction showing the high accuracy of deformable registration. Conclusion: We have successfully designed and demonstrated a phantom that can accurately reproduce deformable motion under a variety of imaging modalities including MRI, CT and x-ray fluodoscopy

Analyses of impacts of China's international trade on its water resources and uses

Science.gov (United States)

Zhang, Z. Y.; Yang, H.; Shi, M. J.; Zehnder, A. J. B.; Abbaspour, K. C.

2011-04-01

This study provides an insight into the impact of China's international trade of goods and services on its water resources and uses. Virtual water flows associated with China's international trade are quantified in an input-output framework. The analysis is scaled down to the sectoral and provincial levels to trace the origins and destinations of virtual water flows associated with the international trade. The results reveal that China is a net virtual water exporter of 4.7 × 1010 m3 year-1, accounting for 2.1% of its total water resources and 8.9% of the total water use. Water scarce regions tend to have higher percentages of virtual water export relative to their water resources and water uses. In the water scarce Huang-Huai-Hai region, the net virtual water export accounts for 7.9% of the region's water resources and 11.2% of its water uses. For individual sectors, major net virtual water exporters are those where agriculture provides raw materials in the initial process of the production chain and/or pollution intensity is high. The results suggest that China's economic gains from being a world "manufacture factory" have come at a high cost to its water resources and through pollution to its environment.

Surface and Internal Waves due to a Moving Load on a Very Large Floating Structure

Directory of Open Access Journals (Sweden)

Taro Kakinuma

2012-01-01

Full Text Available Interaction of surface/internal water waves with a floating platform is discussed with nonlinearity of fluid motion and flexibility of oscillating structure. The set of governing equations based on a variational principle is applied to a one- or two-layer fluid interacting with a horizontally very large and elastic thin plate floating on the water surface. Calculation results of surface displacements are compared with the existing experimental data, where a tsunami, in terms of a solitary wave, propagates across one-layer water with a floating thin plate. We also simulate surface and internal waves due to a point load, such as an airplane, moving on a very large floating structure in shallow water. The wave height of the surface or internal mode is amplified when the velocity of moving point load is equal to the surface- or internal-mode celerity, respectively.

Realizing Conflict, Negotiation, and Cooperation Concepts in the Context of International Water Courses

Science.gov (United States)

Dinar, Ariel; McKinney, Daene

2010-01-01

In this paper we offer a negotiation and cooperative game theory application to international water in the classroom. A simulation game was developed for the Aral Sea water dispute as part of a textbook prepared for teaching a diverse group of students a graduate-level International Water course. A condensed version of the Aral Sea Basin water…

Internal waves and temperature fronts on slopes

Directory of Open Access Journals (Sweden)

S. A. Thorpe

Full Text Available Time series measurements from an array of temperature miniloggers in a line at constant depth along the sloping boundary of a lake are used to describe the `internal surf zone' where internal waves interact with the sloping boundary. More small positive temperature time derivatives are recorded than negative, but there are more large negative values than positive, giving the overall distribution of temperature time derivatives a small negative skewness. This is consistent with the internal wave dynamics; fronts form during the up-slope phase of the motion, bringing cold water up the slope, and the return flow may become unstable, leading to small advecting billows and weak warm fronts. The data are analysed to detect `events', periods in which the temperature derivatives exceed a set threshold. The speed and distance travelled by `events' are described. The motion along the slope may be a consequence of (a instabilities advected by the flow (b internal waves propagating along-slope or (c internal waves approaching the slope from oblique directions. The propagation of several of the observed 'events' can only be explained by (c, evidence that the internal surf zone has some, but possibly not all, the characteristics of the conventional 'surface wave' surf zone, with waves steepening as they approach the slope at oblique angles.

Key words. Oceanography: general (benthic boundary layers; limnology, Oceanography: physical (internal and inertial waves

International Conference on water reuse and desalination

International Nuclear Information System (INIS)

1984-01-01

The International conference on water reuse and desalination was held on the 13 November 1984 in Johannesburg, South Africa. Papers delivered on this conference covered the following aspects: desalination technology, industrial effluent control, economics of desalination of wastewaters, consumable supplies in desalination, the world market for seawater desalination equipment, reverse osmosis, evaporation and ultrafiltration, treatment of hazardous wastes, role of reverse osmosis in waste water treatment, as well as the desalination, recovery and recycle of water with high efficiency. A paper was also delivered on the mechanical vapour compression process applied to seawater desalination - as an example the paper presents the largest unit so far constructed by SIDEM using this process: a 1,500 mz/day unit installed in the Nuclear power plant of Flamanville in France

13th International Conference on Motion and Vibration Control (MOVIC 2016) and the 12th International Conference on Recent Advances in Structural Dynamics (RASD 2016)

International Nuclear Information System (INIS)

2016-01-01

This volume contains the papers presented at the Thirteenth International Conference on Motion and Vibration Control (MoViC), together with the Twelfth International Conference on Recent Advances in Structural Dynamics (RASD). MoViC is an event that started in Yokohama, Japan in 1992 and has been organised every two years alternating between Japan, USA and Europe. The eleven previous RASD conferences have been held every three years or so since 1980 primarily in Southampton, UK. The idea of joining the two conferences came quite naturally because of the common ground of the two conferences and the chances of cross-pollination between two otherwise separate research groups. This joint conference is devoted to theoretical, numerical and experimental developments in motion/vibration/structural dynamics, their control and application to all types of structures and dynamical systems. The conference reflects the state-of-the- art in these topics, and is an excellent opportunity to exchange scientific, technical and experimental ideas. The Conference Proceedings include over 250 papers by authors from over 20 countries, forty technical sessions and five plenary presentations. The five invited speakers are Professor Roger Goodall (Loughborough University, UK) presenting “Motion and vibration control for railway vehicles”, Professor Takeshi Mizuno (Saitama University, Japan) presenting “Recent advances in magnetic suspension technology”, Professor Kevin Murphy (University of Louisville, USA) presenting “Dynamics of Passive Balancing Rings for Rotating Systems”, Professor David Wagg (University of Sheffield, UK) presenting “Reducing vibrations in structures using structural control”, and Professor Kon-Well Wang (University of Michigan, USA) presenting “From Muscles to Plants - Nature-Inspired Adaptive Metastructures for Structural Dynamics Enhancement”. I would like to thank members of the Organising Committee for their help, over the last year or so, in

Autoregressive harmonic analysis of the earth's polar motion using homogeneous international latitude service data

Science.gov (United States)

Fong Chao, B.

1983-12-01

The homogeneous set of 80-year-long (1900-1979) International Latitude Service (ILS) polar motion data is analyzed using the autoregressive method (Chao and Gilbert, 1980) which resolves and produces estimates for the complex frequency (or frequency and Q) and complex amplitude (or amplitude and phase) of each harmonic component in the data. Principal conclusion of this analysis are that (1) the ILS data support the multiple-component hypothesis of the Chandler wobble (it is found that the Chandler wobble can be adequately modeled as a linear combination of four (coherent) harmonic components, each of which represents a steady, nearly circular, prograte motion, a behavior that is inconsistent with the hypothesis of a single Chandler period excited in a temporally and/or spatially random fashion). (2) the four-component Chandler wobble model ``explains'' the apparent phase reversal during 1920-1940 and the pre-1950 empirical period-amplitude relation, (3) the annual wobble is shown to be rather stationary over the years both in amplitude and in phase and no evidence is found to support the large variations reported by earlier investigations. (4) the Markowitz wobble is found to support the large variations reported by earlier investigations. (4) the Markowitz wobble is found to be marginally retrograde and appears to have a complicated behavior which cannot be resolved because of the shortness of the data set.

Axial and radial water transport and internal water storage in tropical forest canopy trees.

Science.gov (United States)

Shelley A. James; Frederick C. Meinzer; Guillermo Goldstein; David Woodruff; Timothy Jones; Teresa Restom; Monica Mejia; Michael Clearwater; Paula. Campanello

2003-01-01

Heat and stable isotope tracers were used to study axial and radial water transport in relation to sapwood anatomical characteristics and internal water storage in four canopy tree species of a seasonally dry tropical forest in Panama. Anatomical characteristics of the wood and radial profiles of sap flow were measured at the base, upper trunk, and crown of a single...

Temporomandibular joint motion

International Nuclear Information System (INIS)

Maeda, M.; Kawamura, Y.; Matsuda, T.; Itou, S.; Odori, T.; Ishii, Y.; Torizuka, K.

1990-01-01

This paper evaluates MR imaging with the therapeutic effect after splint therapy in internal derangement of the temporomandibular joint (TMJ). Fifteen patients (19 TMJs) with internal derangement of the TMJ and five normal volunteers (10 TMJs) were examined with sagittal T1-weighted spin-echo and gradient recalled acquisition in a steady state (GRASS) MR imaging. MR studies of the patients undergoing splint therapy were performed with an without splints. Pseudodynamic images of TMJ motion provide information that was not available from spin-echo T1-weighted images

Numerical simulation of high Reynolds number bubble motion

Energy Technology Data Exchange (ETDEWEB)

McLaughlin, J.B. [Clarkson Univ., Potsdam, NY (United States)

1995-12-31

This paper presents the results of numerical simulations of bubble motion. All the results are for single bubbles in unbounded fluids. The liquid phase is quiescent except for the motion created by the bubble, which is axisymmetric. The main focus of the paper is on bubbles that are of order 1 mm in diameter in water. Of particular interest is the effect of surfactant molecules on bubble motion. Results for the {open_quotes}insoluble surfactant{close_quotes} model will be presented. These results extend research by other investigators to finite Reynolds numbers. The results indicate that, by assuming complete coverage of the bubble surface, one obtains good agreement with experimental observations of bubble motion in tap water. The effect of surfactant concentration on the separation angle is discussed.

Communication: Isotopic effects on tunneling motions in the water trimer

International Nuclear Information System (INIS)

Videla, Pablo E.; Rossky, Peter J.; Laria, D.

2016-01-01

We present results of ring polymer molecular dynamics simulations that shed light on the effects of nuclear quantum fluctuations on tunneling motions in cyclic [H 2 O] 3 and [D 2 O] 3 , at the representative temperature of T = 75 K. In particular, we focus attention on free energies associated with two key isomerization processes: The first one corresponds to flipping transitions of dangling OH bonds, between up and down positions with respect to the O–O–O plane of the cluster; the second involves the interchange between connecting and dangling hydrogen bond character of the H-atoms in a tagged water molecule. Zero point energy and tunneling effects lead to sensible reductions of the free energy barriers. Due to the lighter nature of the H nuclei, these modifications are more marked in [H 2 O] 3 than in [D 2 O] 3 . Estimates of the characteristic time scales describing the flipping transitions are consistent with those predicted based on standard transition-state-approximation arguments

19 CFR 210.53 - Motion filed after complaint.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 3 2010-04-01 2010-04-01 false Motion filed after complaint. 210.53 Section 210.53 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Temporary Relief § 210.53 Motion filed after complaint. (a) A...

Estimating network effect in geocenter motion: Theory

Science.gov (United States)

Zannat, Umma Jamila; Tregoning, Paul

2017-10-01

Geophysical models and their interpretations of several processes of interest, such as sea level rise, postseismic relaxation, and glacial isostatic adjustment, are intertwined with the need to realize the International Terrestrial Reference Frame. However, this realization needs to take into account the geocenter motion, that is, the motion of the center of figure of the Earth surface, due to, for example, deformation of the surface by earthquakes or hydrological loading effects. Usually, there is also a discrepancy, known as the network effect, between the theoretically convenient center of figure and the physically accessible center of network frames, because of unavoidable factors such as uneven station distribution, lack of stations in the oceans, disparity in the coverage between the two hemispheres, and the existence of tectonically deforming zones. Here we develop a method to estimate the magnitude of the network effect, that is, the error introduced by the incomplete sampling of the Earth surface, in measuring the geocenter motion, for a network of space geodetic stations of a fixed size N. For this purpose, we use, as our proposed estimate, the standard deviations of the changes in Helmert parameters measured by a random network of the same size N. We show that our estimate scales as 1/√N and give an explicit formula for it in terms of the vector spherical harmonics expansion of the displacement field. In a complementary paper we apply this formalism to coseismic displacements and elastic deformations due to surface water movements.

Emerging risks from ballast water treatment: The run-up to the International Ballast Water Management Convention

NARCIS (Netherlands)

Werschkun, B.; Banerji, S.; Basurko, O.C.; David, M.; Fuhr, F; Gollasch, S.; Grummt, T.; Haarich, M.; Jha, A.N.; Kacan, S.; Kehrer, A.; Linders, J.; Mesbahi, E.; Pughiuc, D.; Richardson, S.D.; Schwarz-Schulz, B.; Shah, A.; Theobald, N.; von Gunten, U.; Wieck, S.; Hofer, T.

2014-01-01

Uptake and discharge of ballast water by ocean-going ships contribute to the worldwide spread of aquatic invasive species, with negative impacts on the environment, economies, and public health. The International Ballast Water Management Convention aims at a global answer. The agreed standards for

Angry Birds realized: water balloon launcher for teaching projectile motion with drag

International Nuclear Information System (INIS)

Edwards, Boyd F; Sam, David D; Christiansen, Michael A; Booth, William A; Jessup, Leslie O

2014-01-01

A simple, collapsible design for a large water balloon slingshot launcher features a fully adjustable initial velocity vector and a balanced launch platform. The design facilitates quantitative explorations of the dependence of the balloon range and time of flight on the initial speed, launch angle, and projectile mass, in an environment where quadratic air drag is important. Presented are theory and experiments that characterize this drag, and theory and experiments that characterize the nonlinear elastic energy and hysteresis of the latex tubing used in the slingshot. The experiments can be carried out with inexpensive and readily available tools and materials. The launcher provides an engaging way to teach projectile motion and elastic energy to students of a wide variety of ages. (paper)

Motion-insensitive rapid configuration relaxometry.

Science.gov (United States)

Nguyen, Damien; Bieri, Oliver

2017-08-01

Triple echo steady state (TESS) uses the lowest steady state configuration modes for rapid relaxometry. Due to its unbalanced gradient scheme, however, TESS is inherently motion-sensitive. The purpose of this work is to merge TESS with a balanced acquisition scheme for motion-insensitive rapid configuration relaxometry, termed MIRACLE. The lowest order steady state free precession (SSFP) configurations are retrieved by Fourier transformation of the frequency response of N frequency-shifted balanced SSFP (bSSFP) scans and subsequently processed for relaxometry, as proposed with TESS. Accuracy of MIRACLE is evaluated from simulations, phantom studies as well as in vivo brain and cartilage imaging at 3T. Simulations and phantom results revealed no conceptual flaw, and artifact-free configuration imaging was achieved in vivo. Overall, relaxometry results were accurate in phantoms and in good agreement for cartilage and for T2 in the brain, but apparent low T1 values were observed for brain white matter; reflecting asymmetries in the bSSFP profile. Rapid T1 and T2 mapping with MIRACLE offers analogous properties as TESS while successfully mitigating its motion-sensitivity. As a result of the Fourier transformation, relaxometry becomes sensitive to the voxel frequency distribution, which may contain useful physiologic information, such as structural brain integrity. © 2016 International Society for Magnetic Resonance in Medicine. Magn Reson Med 78:518-526, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

Mobile technology and telemedicine for shoulder range of motion: validation of a motion-based machine-learning software development kit.

Science.gov (United States)

Ramkumar, Prem N; Haeberle, Heather S; Navarro, Sergio M; Sultan, Assem A; Mont, Michael A; Ricchetti, Eric T; Schickendantz, Mark S; Iannotti, Joseph P

2018-03-07

Mobile technology offers the prospect of delivering high-value care with increased patient access and reduced costs. Advances in mobile health (mHealth) and telemedicine have been inhibited by the lack of interconnectivity between devices and software and inability to process consumer sensor data. The objective of this study was to preliminarily validate a motion-based machine learning software development kit (SDK) for the shoulder compared with a goniometer for 4 arcs of motion: (1) abduction, (2) forward flexion, (3) internal rotation, and (4) external rotation. A mobile application for the SDK was developed and "taught" 4 arcs of shoulder motion. Ten subjects without shoulder pain or prior shoulder surgery performed the arcs of motion for 5 repetitions. Each motion was measured by the SDK and compared with a physician-measured manual goniometer measurement. Angular differences between SDK and goniometer measurements were compared with univariate and power analyses. The comparison between the SDK and goniometer measurement detected a mean difference of less than 5° for all arcs of motion (P > .05), with a 94% chance of detecting a large effect size from a priori power analysis. Mean differences for the arcs of motion were: abduction, -3.7° ± 3.2°; forward flexion, -4.9° ± 2.5°; internal rotation, -2.4° ± 3.7°; and external rotation -2.6° ± 3.4°. The SDK has the potential to remotely substitute for a shoulder range of motion examination within 5° of goniometer measurements. An open-source motion-based SDK that can learn complex movements, including clinical shoulder range of motion, from consumer sensors offers promise for the future of mHealth, particularly in telemonitoring before and after orthopedic surgery. Copyright © 2018 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

Internal water curing with Liapor aggregates

DEFF Research Database (Denmark)

Lura, Pietro

2005-01-01

Internal water curing is a very efficient way to counteract self-desiccation and autogenous shrinkage in high performance concrete, thereby reducing the likelihood of early-age cracking. This paper deals with early-age volume changes and moisture transport in lightweight aggregate concrete realized...... with wet lightweight aggregates. Lightweight aggregate concrete mixtures with different degree of saturation and different particle size of the lightweight aggregates were studied and compared to normal weight concrete. Autogenous deformations, selfinduced stresses in fully restrained conditions, elastic...

Laws of motion for interacting Yang-Mills particles

International Nuclear Information System (INIS)

Fuchs, H.

1988-01-01

Our recent Lagrangian approach to the equations of motion for test particles with internal structure can be enlarged to the laws of motion for interacting particles, at least in principle. As an example we consider the interaction of point particles endowed with a pole-dipole structure of the non-abelian charge. (author)

Cleaning the feed-water pipeline internal surfaces

International Nuclear Information System (INIS)

Podkopaev, V.A.

1984-01-01

The procedure of cleaning the feed-water pipeline internal surfaces at the Chernobylsk-4 power unit is described. Cleaning was conducted in five stages. Pipelines were cleaned from mechanical impurities at the first stage. At the second stage the pipelines were washing by water heated up to 80 deg C. At the third stage nitric acid was added to 95-100 deg C water the acid concentration in the circuit = 60 mg/l, purification period = 14 h. At the fourth stage hydrogen peroxide was added to the circuit at 95-100 deg C (the solution concentration was equal to 5-6 mg/l, the solution stayed in the circuit for 1 h 20 min). At the fifth stage sodium nitrite concentrated to 20 mg/l was introduced to the circuit in 75 minutes; this promoted strengthening of the oxide layer in the circuit on the base of nitric acid and hydrogen peroxide. Data on the water acidity in the circuit, water electric conductivity and iron concentration after the fourth stage and on completion of the circuit cleaning are presented. The described method of cleaning enables to save scarce reagents and use cheaper ones

Cleaning the feed-water pipeline internal surfaces

Energy Technology Data Exchange (ETDEWEB)

Podkopaev, V.A.

1984-12-01

The procedure of cleaning the feed-water pipeline internal surfaces at the Chernobylsk-4 power unit is described. Cleaning was conducted in five stages. Pipelines were cleaned from mechanical impurities at the first stage. At the second stage the pipelines were washed by water heated up to 80 deg C. At the third stage nitric acid was added to 95-100 deg C water with the acid concentration in the circuit = 60 mg/l, purification period = 14 h. At the fourth stage hydrogen peroxide was added to the circuit at 95-100 deg C (the solution concentration was equal to 5-6 mg/l, the solution stayed in the circuit for 1 h 20 min). At the fifth stage sodium nitrite concentrated to 20 mg/l was introduced to the circuit in 75 minutes; this promoted strengthening of the oxide layer in the circuit on the base of nitric acid and hydrogen peroxide. Data on the water acidity in the circuit, water electric conductivity and iron concentration after the fourth stage and on completion of the circuit cleaning are presented. The described method of cleaning enables to save scarce reagents and use cheaper ones.

Water Balances in the Eastern Mediterranean | IDRC - International ...

International Development Research Centre (IDRC) Digital Library (Canada)

As a result, the importance of fresh water to economic development, quality of life, ... Case studies from Lebanon, Israel, Palestine, Jordan, Turkey, and North ... balances and propose methods for regional cooperation in the management of ... An IDRC delegation will join international delegates and city representatives at the ...

Experimental Investigation of the Self-Propelled Motion of a Sodium Oleate Tablet and Boat at an Oil-Water Interface.

Science.gov (United States)

Watahiki, Yasuhito; Nomoto, Tomonori; Chiari, Luca; Toyota, Taro; Fujinami, Masanori

2018-05-15

The self-propelled behaviors of macroscopic inanimate objects at surfaces and interfaces are ubiquitous phenomena of fundamental interest in interface science. However, given the existence of a large variety of systems with their own inherent chemical properties, the kinematics of the self-propelled motion and the dynamics of the forces driving these systems often remain largely unknown. Here, we experimentally investigate the spontaneous motion of a sodium oleate tablet at a water-nitrobenzene interface, under nonequilibrium and global isothermal conditions, through measurements of the interfacial tension with the noninvasive, quasi-elastic laser scattering method. The sodium oleate tablet was self-propelled due to an imbalance in the interfacial tension induced by the inhomogeneous adsorption of oleate/oleic acid molecules. The kinetics of the self-propelled motion of a boat-shaped plastic sheet bearing sodium oleate tablets at a sodium oleate aqueous solution-nitrobenzene interface was also studied. The interfacial tension difference between the front and rear of the boat was quantitatively identified as the force pushing the boat forward, although the Marangoni flow due to the uneven distribution of the interfacial tension behind the boat tended to decelerate the motion.

Acoustic Measurement Of Periodic Motion Of Levitated Object

Science.gov (United States)

Watkins, John L.; Barmatz, Martin B.

1992-01-01

Some internal vibrations, oscillations in position, and rotations of acoustically levitated object measured by use of microphone already installed in typical levitation chamber for tuning chamber to resonance and monitoring operation. Levitating acoustic signal modulated by object motion of lower frequency. Amplitude modulation detected and analyzed spectrally to determine amplitudes and frequencies of motions.

Measurement of Intervertebral Motion Using Quantitative Fluoroscopy: Report of an International Forum and Proposal for Use in the Assessment of Degenerative Disc Disease in the Lumbar Spine

Directory of Open Access Journals (Sweden)

Alan C. Breen

2012-01-01

Full Text Available Quantitative fluoroscopy (QF is an emerging technology for measuring intervertebral motion patterns to investigate problem back pain and degenerative disc disease. This International Forum was a networking event of three research groups (UK, US, Hong Kong, over three days in San Francisco in August 2009. Its aim was to reach a consensus on how best to record, analyse, and communicate QF information for research and clinical purposes. The Forum recommended that images should be acquired during regular trunk motion that is controlled for velocity and range, in order to minimise externally imposed variability as well as to correlate intervertebral motion with trunk motion. This should be done in both the recumbent passive and weight bearing active patient configurations. The main recommended outputs from QF were the true ranges of intervertebral rotation and translation, neutral zone laxity and the consistency of shape of the motion patterns. The main clinical research priority should initially be to investigate the possibility of mechanical subgroups of patients with chronic, nonspecific low back pain by comparing their intervertebral motion patterns with those of matched healthy controls.

Compensating for Quasi-periodic Motion in Robotic Radiosurgery

CERN Document Server

Ernst, Floris

2012-01-01

Compensating for Quasi-periodic Motion in Robotic Radiosurgery outlines the techniques needed to accurately track and compensate for respiratory and pulsatory motion during robotic radiosurgery. The algorithms presented within the book aid in the treatment of tumors that move during respiration. In Chapters 1 and 2,  the book introduces the concept of stereotactic body radiation therapy, motion compensation strategies and the clinical state-of-the-art. In Chapters 3 through 5, the author describes and evaluates new methods for motion prediction, for correlating external motion to internal organ motion, and for the evaluation of these algorithms’ output based on an unprecedented amount of real clinical data. Finally, Chapter 6 provides a brief introduction into currently investigated, open questions and further fields of research. Compensating for Quasi-periodic Motion in Robotic Radiosurgery targets researchers working in the related fields of surgical oncology, artificial intelligence, robotics and more. ...

International Cooperation for the Training of Water Managers from Developing Countries

Science.gov (United States)

Aswathanarayana, U.

2007-12-01

Water is the key to the well being of a community. On one hand, water security is linked to food security, as food cannot be grown without water. On the other hand, water security is linked to environmental security, as water is needed to maintain the health of a community. International cooperation is proposed for the training in Hyderabad, India, with international faculty, of ~ 300 water managers from the developing countries at an estimated cost of ~USD 3300/- per candidate (including ~ USD 1800/- for international travel), through ten interactive and customized training programmes during the period of five years, to enable them to address two crucial issues affecting the poor in the developing countries, namely, access to affordable water and coping with water scarcity. Ways of Good governance and geographical targeting of poverty alleviation programmes are built into each training programme. Each training programme will be for about three weeks (inclusive of field work). Each course will have a component common to all, plus a component customized to the biophysical and socioeconomic situation in a candidate's country. Ten course manuals will be produced. which can later be published commercially as low-cost volumes, for the benefit of the readership in the Developing countries . Each candidate will be provided his own computer, and software, and individual faculty adviser. On the basis of the training received, a candidate should be able to carry with him at the end of the course a draft outline of techno-socio-economic action plan for his country/area in respect of the theme of the course, prepared by himself/herself. A copy of this outline would be provided to the World Bank, and relevant organizations for follow- up activity

Sustainable access to safe drinking water: fundamental human right in the international and national scene

Directory of Open Access Journals (Sweden)

Celso Maran de Oliveira

2017-12-01

Full Text Available Access to potable water is absolutely essential to the maintenance of life, as well as to provide regular exercise of other human rights. The lack of access to water in sufficient quantity or access to non-potable water may cause serious and irreparable damage to people. This paper investigates the evolution of international and national recognition of this fundamental human right, whether implicit or explicit. This was accomplished by the study of international human rights treaties, bibliographic information on water resources and their corresponding legal systems, national and international. The results suggest that sustainable access to drinking water is a fundamental human right in the context of international relations and the State. Further, even without explicitly stating this right in the Constitution of 1988, Brazil has incorporated the main international provisions on the subject, but this right must be acknowledged according to the principles of non-typical fundamental rights and the dignity of the human person. This right should be universally guaranteed by the Government in sufficient quantity and quality, regardless of the economic resources of individuals.

Molecular dynamics simulations of protein-tyrosine phosphatase 1B. I. Ligand-induced changes in the protein motions

DEFF Research Database (Denmark)

Peters, Günther H. J.; Frimurer, T.M.; Andersen, J.N.

1999-01-01

Activity of enzymes, such as protein tyrosine phosphatases (PTPs), is often associated with structural changes in the enzyme, resulting in selective and stereospecific reactions with the substrate. To investigate the effect of a substrate on the motions occurring in PTPs, we have performed...... molecular dynamics simulations of PTP1B and PTP1B complexed with a high-affinity peptide DADEpYL, where pY stands for phosphorylated tyrosine. The peptide sequence is derived from the epidermal growth factor receptor (EGFR(988-993)). Simulations were performed in water for 1 ns, and the concerted motions...... in the protein were analyzed using the essential dynamics technique. Our results indicate that the predominately internal motions in PTP1B occur in a subspace of only a few degrees of freedom. Upon substrate binding, the flexibility of the protein is reduced by similar to 10%. The largest effect is found...

Dry deposition of submicron atmospheric aerosol over water surfaces in motion

International Nuclear Information System (INIS)

Nevenick, Calec

2013-01-01

Whether by chronic or accidental releases, the impact of a nuclear installation on the environment mainly depends on atmospheric transfers; and as the accidents at Chernobyl and Fukushima show, affect the contamination of surfaces and impacts in the medium and long-term on the environment and the population. In this context, this work focuses on the characterization and modeling of dry deposition of submicron aerosols on liquid surfaces in motion such as rivers. Unlike wet deposition which is conditioned by washout and rainout (rain and clouds), dry deposition is a phenomenon that depends entirely on the characteristics of aerosols, receiving surfaces, and air flow. In practice, the evaluation of dry deposition is based on the estimation of flux modeling as the product of particle concentration and deposition velocity which can vary over several orders of magnitude depending on the receiving surfaces (forest, snow, urban, grassland...). This topic is motivated by the virtual non-existence of studies on the mechanisms of dry deposition on continental water systems such as rivers; and respect for submicron aerosols. They have the lowest deposition efficiencies and filtration and the longer residence time in the atmosphere. In addition, they are potentially the most dangerous to living beings because they can penetrate deeper into the airway. Due to the lack of data on the dry deposition of submicron aerosols on a liquid surface in motion, the approach was based on two axes: 1) the acquisition of experimental deposition velocities and 2) the analysis and interpretation of results through modeling. The experiments were performed with uranine aerosols released into the IOA wind tunnel (Interface Ocean Atmosphere) of the Institute for Research on Non Equilibrium Phenomena which is configured to study the coupling between the air flow and water. These experiments have given many dry deposition velocities for different configurations characterized according to wind

Dry deposition of submicron atmospheric aerosol over water surfaces in motion

International Nuclear Information System (INIS)

Calec, Nevenick

2013-01-01

Whether by chronic or accidental releases, the impact of a nuclear installation on the environment mainly depends on atmospheric transfers; and as the accidents at Chernobyl and Fukushima show, affect the contamination of surfaces and impacts in the medium and long-term on the environment and the population. In this context, this work focuses on the characterization and modeling of dry deposition of submicron aerosols on liquid surfaces in motion such as rivers. Unlike wet deposition which is conditioned by washout and rainout (rain and clouds), dry deposition is a phenomenon that depends entirely on the characteristics of aerosols, receiving surfaces, and air flow. In practice, the evaluation of dry deposition is based on the estimation of flux modeling as the product of particle concentration and deposition velocity which can vary over several orders of magnitude depending on the receiving surfaces (forest, snow, urban, grassland..). This topic is motivated by the virtual non-existence of studies on the mechanisms of dry deposition on continental water systems such as rivers; and respect for submicron aerosols. They have the lowest deposition efficiencies and filtration and the longer residence time in the atmosphere. In addition, they are potentially the most dangerous to living beings because they can penetrate deeper into the airway. Due to the lack of data on the dry deposition of submicron aerosols on a liquid surface in motion, the approach was based on two axes: 1) the acquisition of experimental deposition velocities and 2) the analysis and interpretation of results through modeling. The experiments were performed with uranine aerosols released into the IOA wind tunnel (Interface Ocean Atmosphere) of the Institute for Research on Non Equilibrium Phenomena which is configured to study the coupling between the air flow and water. These experiments have given many dry deposition velocities for different configurations characterized according to wind

Subtle Motion Analysis and Spotting using the Riesz Pyramid

OpenAIRE

Arango , Carlos ,; Alata , Olivier; Emonet , Rémi; Legrand , Anne-Claire; Konik , Hubert

2018-01-01

International audience; Analyzing and temporally spotting motions which are almost invisible to the human eye might reveal interesting information about the world. However, detecting these events is difficult due to their short duration and low intensities. Taking inspiration from video magnification techniques, we design a workflow for analyzing and temporally spotting subtle motions based on the Riesz pyramid. In addition, we propose a filtering and masking scheme that segments motions of i...

Quantized motion of trapped ions

International Nuclear Information System (INIS)

Steinbach, J.

1999-01-01

This thesis is concerned with a theoretical and numerical study of the preparation and coherent manipulation of quantum states in the external and internal degrees of freedom of trapped ions. In its first part, this thesis proposes and investigates schemes for generating several nonclassical states for the quantized vibrational motion of a trapped ion. Based on dark state preparation specific laser excitation configurations are presented which, given appropriately chosen initial states, realize the desired motional states in the steady-state, indicated by the cessation of the fluorescence emitted by the ion. The focus is on the SU(1,1) intelligent states in both their single- and two-mode realization, corresponding to one- and two-dimensional motion of the ion. The presented schemes are also studied numerically using a Monte-Carlo state-vector method. The second part of the thesis describes how two vibrational degrees of freedom of a single trapped ion can be coupled through the action of suitably chosen laser excitation. Concentrating on a two-dimensional ion trap with dissimilar vibrational frequencies a variety of quantized two-mode couplings are derived. The focus is on a linear coupling that takes excitations from one mode to another. It is demonstrated how this can result in a state rotation, in which it is possible to coherently transfer the motional state of the ion between orthogonal directions without prior knowledge of that motional state. The third part of this thesis presents a new efficient method for generating maximally entangled internal states of a collection of trapped ions. The method is deterministic and independent of the number of ions in the trap. As the essential element of the scheme a mechanism for the realization of a controlled NOT operation that can operate on multiple ions is proposed. The potential application of the scheme for high-precision frequency standards is explored. (author)

Representation of visual gravitational motion in the human vestibular cortex.

Science.gov (United States)

Indovina, Iole; Maffei, Vincenzo; Bosco, Gianfranco; Zago, Myrka; Macaluso, Emiliano; Lacquaniti, Francesco

2005-04-15

How do we perceive the visual motion of objects that are accelerated by gravity? We propose that, because vision is poorly sensitive to accelerations, an internal model that calculates the effects of gravity is derived from graviceptive information, is stored in the vestibular cortex, and is activated by visual motion that appears to be coherent with natural gravity. The acceleration of visual targets was manipulated while brain activity was measured using functional magnetic resonance imaging. In agreement with the internal model hypothesis, we found that the vestibular network was selectively engaged when acceleration was consistent with natural gravity. These findings demonstrate that predictive mechanisms of physical laws of motion are represented in the human brain.

Communication: Isotopic effects on tunneling motions in the water trimer

Energy Technology Data Exchange (ETDEWEB)

Videla, Pablo E. [Departamento de Química Inorgánica Analítica y Química-Física e INQUIMAE, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, Pabellón II, 1428 Buenos Aires (Argentina); Rossky, Peter J. [Department of Chemistry, Rice University, Houston, Texas 77251-1892 (United States); Laria, D., E-mail: dhlaria@cnea.gov.ar [Departamento de Química Inorgánica Analítica y Química-Física e INQUIMAE, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, Pabellón II, 1428 Buenos Aires (Argentina); Departamento de Física de la Materia Condensada, Comisión Nacional de Energía Atómica, Avenida Libertador 8250, 1429 Buenos Aires (Argentina)

2016-02-14

We present results of ring polymer molecular dynamics simulations that shed light on the effects of nuclear quantum fluctuations on tunneling motions in cyclic [H{sub 2}O]{sub 3} and [D{sub 2}O]{sub 3}, at the representative temperature of T = 75 K. In particular, we focus attention on free energies associated with two key isomerization processes: The first one corresponds to flipping transitions of dangling OH bonds, between up and down positions with respect to the O–O–O plane of the cluster; the second involves the interchange between connecting and dangling hydrogen bond character of the H-atoms in a tagged water molecule. Zero point energy and tunneling effects lead to sensible reductions of the free energy barriers. Due to the lighter nature of the H nuclei, these modifications are more marked in [H{sub 2}O]{sub 3} than in [D{sub 2}O]{sub 3}. Estimates of the characteristic time scales describing the flipping transitions are consistent with those predicted based on standard transition-state-approximation arguments.

On a PCA-based lung motion model

Energy Technology Data Exchange (ETDEWEB)

Li Ruijiang; Lewis, John H; Jia Xun; Jiang, Steve B [Department of Radiation Oncology and Center for Advanced Radiotherapy Technologies, University of California San Diego, 3855 Health Sciences Dr, La Jolla, CA 92037-0843 (United States); Zhao Tianyu; Wuenschel, Sara; Lamb, James; Yang Deshan; Low, Daniel A [Department of Radiation Oncology, Washington University School of Medicine, 4921 Parkview Pl, St. Louis, MO 63110-1093 (United States); Liu Weifeng, E-mail: sbjiang@ucsd.edu [Amazon.com Inc., 701 5th Ave. Seattle, WA 98104 (United States)

2011-09-21

Respiration-induced organ motion is one of the major uncertainties in lung cancer radiotherapy and is crucial to be able to accurately model the lung motion. Most work so far has focused on the study of the motion of a single point (usually the tumor center of mass), and much less work has been done to model the motion of the entire lung. Inspired by the work of Zhang et al (2007 Med. Phys. 34 4772-81), we believe that the spatiotemporal relationship of the entire lung motion can be accurately modeled based on principle component analysis (PCA) and then a sparse subset of the entire lung, such as an implanted marker, can be used to drive the motion of the entire lung (including the tumor). The goal of this work is twofold. First, we aim to understand the underlying reason why PCA is effective for modeling lung motion and find the optimal number of PCA coefficients for accurate lung motion modeling. We attempt to address the above important problems both in a theoretical framework and in the context of real clinical data. Second, we propose a new method to derive the entire lung motion using a single internal marker based on the PCA model. The main results of this work are as follows. We derived an important property which reveals the implicit regularization imposed by the PCA model. We then studied the model using two mathematical respiratory phantoms and 11 clinical 4DCT scans for eight lung cancer patients. For the mathematical phantoms with cosine and an even power (2n) of cosine motion, we proved that 2 and 2n PCA coefficients and eigenvectors will completely represent the lung motion, respectively. Moreover, for the cosine phantom, we derived the equivalence conditions for the PCA motion model and the physiological 5D lung motion model (Low et al 2005 Int. J. Radiat. Oncol. Biol. Phys. 63 921-9). For the clinical 4DCT data, we demonstrated the modeling power and generalization performance of the PCA model. The average 3D modeling error using PCA was within 1

On a PCA-based lung motion model.

Science.gov (United States)

Li, Ruijiang; Lewis, John H; Jia, Xun; Zhao, Tianyu; Liu, Weifeng; Wuenschel, Sara; Lamb, James; Yang, Deshan; Low, Daniel A; Jiang, Steve B

2011-09-21

Respiration-induced organ motion is one of the major uncertainties in lung cancer radiotherapy and is crucial to be able to accurately model the lung motion. Most work so far has focused on the study of the motion of a single point (usually the tumor center of mass), and much less work has been done to model the motion of the entire lung. Inspired by the work of Zhang et al (2007 Med. Phys. 34 4772-81), we believe that the spatiotemporal relationship of the entire lung motion can be accurately modeled based on principle component analysis (PCA) and then a sparse subset of the entire lung, such as an implanted marker, can be used to drive the motion of the entire lung (including the tumor). The goal of this work is twofold. First, we aim to understand the underlying reason why PCA is effective for modeling lung motion and find the optimal number of PCA coefficients for accurate lung motion modeling. We attempt to address the above important problems both in a theoretical framework and in the context of real clinical data. Second, we propose a new method to derive the entire lung motion using a single internal marker based on the PCA model. The main results of this work are as follows. We derived an important property which reveals the implicit regularization imposed by the PCA model. We then studied the model using two mathematical respiratory phantoms and 11 clinical 4DCT scans for eight lung cancer patients. For the mathematical phantoms with cosine and an even power (2n) of cosine motion, we proved that 2 and 2n PCA coefficients and eigenvectors will completely represent the lung motion, respectively. Moreover, for the cosine phantom, we derived the equivalence conditions for the PCA motion model and the physiological 5D lung motion model (Low et al 2005 Int. J. Radiat. Oncol. Biol. Phys. 63 921-9). For the clinical 4DCT data, we demonstrated the modeling power and generalization performance of the PCA model. The average 3D modeling error using PCA was within 1

On a PCA-based lung motion model

International Nuclear Information System (INIS)

Li Ruijiang; Lewis, John H; Jia Xun; Jiang, Steve B; Zhao Tianyu; Wuenschel, Sara; Lamb, James; Yang Deshan; Low, Daniel A; Liu Weifeng

2011-01-01

Respiration-induced organ motion is one of the major uncertainties in lung cancer radiotherapy and is crucial to be able to accurately model the lung motion. Most work so far has focused on the study of the motion of a single point (usually the tumor center of mass), and much less work has been done to model the motion of the entire lung. Inspired by the work of Zhang et al (2007 Med. Phys. 34 4772-81), we believe that the spatiotemporal relationship of the entire lung motion can be accurately modeled based on principle component analysis (PCA) and then a sparse subset of the entire lung, such as an implanted marker, can be used to drive the motion of the entire lung (including the tumor). The goal of this work is twofold. First, we aim to understand the underlying reason why PCA is effective for modeling lung motion and find the optimal number of PCA coefficients for accurate lung motion modeling. We attempt to address the above important problems both in a theoretical framework and in the context of real clinical data. Second, we propose a new method to derive the entire lung motion using a single internal marker based on the PCA model. The main results of this work are as follows. We derived an important property which reveals the implicit regularization imposed by the PCA model. We then studied the model using two mathematical respiratory phantoms and 11 clinical 4DCT scans for eight lung cancer patients. For the mathematical phantoms with cosine and an even power (2n) of cosine motion, we proved that 2 and 2n PCA coefficients and eigenvectors will completely represent the lung motion, respectively. Moreover, for the cosine phantom, we derived the equivalence conditions for the PCA motion model and the physiological 5D lung motion model (Low et al 2005 Int. J. Radiat. Oncol. Biol. Phys. 63 921-9). For the clinical 4DCT data, we demonstrated the modeling power and generalization performance of the PCA model. The average 3D modeling error using PCA was within 1

Motion correction options in PET/MRI.

Science.gov (United States)

Catana, Ciprian

2015-05-01

Subject motion is unavoidable in clinical and research imaging studies. Breathing is the most important source of motion in whole-body PET and MRI studies, affecting not only thoracic organs but also those in the upper and even lower abdomen. The motion related to the pumping action of the heart is obviously relevant in high-resolution cardiac studies. These two sources of motion are periodic and predictable, at least to a first approximation, which means certain techniques can be used to control the motion (eg, by acquiring the data when the organ of interest is relatively at rest). Additionally, nonperiodic and unpredictable motion can also occur during the scan. One obvious limitation of methods relying on external devices (eg, respiratory bellows or the electrocardiogram signal to monitor the respiratory or cardiac cycle, respectively) to trigger or gate the data acquisition is that the complex motion of internal organs cannot be fully characterized. However, detailed information can be obtained using either the PET or MRI data (or both) allowing the more complete characterization of the motion field so that a motion model can be built. Such a model and the information derived from simple external devices can be used to minimize the effects of motion on the collected data. In the ideal case, all the events recorded during the PET scan would be used to generate a motion-free or corrected PET image. The detailed motion field can be used for this purpose by applying it to the PET data before, during, or after the image reconstruction. Integrating all these methods for motion control, characterization, and correction into a workflow that can be used for routine clinical studies is challenging but could potentially be extremely valuable given the improvement in image quality and reduction of motion-related image artifacts. Copyright © 2015 Elsevier Inc. All rights reserved.

Vertical pressure gradient and particle motions in wave boundary layers

DEFF Research Database (Denmark)

Jensen, Karsten Lindegård

. The experiment is conducted in a oscillating water tunnel, for both smooth bed and rough bed. The particle motion is determined by utilizing particle tracking base on a video recording of the particle motion in the flow. In the oscillatory flow, in contrast to steady current, the particle motion is a function...

The Effects of International Trade on Water Use.

Science.gov (United States)

Kagohashi, Kazuki; Tsurumi, Tetsuya; Managi, Shunsuke

2015-01-01

The growing scarcity of water resources worldwide is conditioned not only by precipitation changes but also by changes to water use patterns; the latter is driven by social contexts such as capital intensity, trade openness, and income. This study explores the determinants of water use by focusing on the effect of trade openness on the degree to which water is withdrawn and consumed. Previous studies have conducted analyses on the determinants of water use but have ignored the endogeneity of trade openness. To deal with this endogeneity problem, we adopt instrumental variable estimation and clarify the determinants of water use. The determinants of water use are divided into scale, technique, and composition effects. Calculating each trade-induced effect, we examine how trade openness affects the degree of water use. Our results show that while trade has a positive effect on water withdrawal/consumption through trade-induced scale effects and direct composition effects, the trade-induced technique and the indirect composition effect, both of which exhibit a negative sign, counteract the scale effect and the direct composition effect, resulting in reduced water withdrawal/consumption. The overall effect induced by trade is calculated as being in the range of -1.00 to -1.52; this means that the overall effect of a 1% increase in the intensity of trade openness reduces the degree of water withdrawal/consumption by roughly 1.0-1.5%, on average. This result indicates that international bilateral trade would promote efficient water use through the diffusion of water-saving technologies and the reformation of industry composition.

Molecular water motions of skim milk powder solutions during acidification studied by 17O and 1H nuclear magnetic resonance and rheology

DEFF Research Database (Denmark)

Møller, S M; Whittaker, A. K.; Stokes, J. R.

2011-01-01

The molecular motion of water was studied in glucono-δ-lactone-acidified skim milk powder (SMP) solutions with various pH values and dry matter contents. NMR relaxometry measurements revealed that lowering the pH in SMP solutions affected 17O and 1HT2 relaxation rates almost identically. Conseque......The molecular motion of water was studied in glucono-δ-lactone-acidified skim milk powder (SMP) solutions with various pH values and dry matter contents. NMR relaxometry measurements revealed that lowering the pH in SMP solutions affected 17O and 1HT2 relaxation rates almost identically...... could contribute to the initial decrease in 17O and 1Hrelaxation rate in the pH range between 6.6 and 5.5 for 15% SMP and in the pH range between 6.6 and 5.9 for 25% SMP. However, below pH 5.5 the viscosity and 17Oand 1HNMRrelaxation rates did not correlate, revealing that the aggregation of casein...... micelles, which increases viscosity below pH 5.5, does not involve major repartitioning of water....

78 FR 70076 - Aging Management of Internal Surfaces, Fire Water Systems, Atmospheric Storage Tanks, and...

Science.gov (United States)

2013-11-22

... Systems, Atmospheric Storage Tanks, and Corrosion Under Insulation AGENCY: Nuclear Regulatory Commission... Internal Surfaces, Fire Water Systems, Atmospheric Storage Tanks, and Corrosion Under Insulation.'' This LR... related to internal surface aging effects, fire water systems, atmospheric storage tanks, and corrosion...

Illusory Motion Reproduced by Deep Neural Networks Trained for Prediction.

Science.gov (United States)

Watanabe, Eiji; Kitaoka, Akiyoshi; Sakamoto, Kiwako; Yasugi, Masaki; Tanaka, Kenta

2018-01-01

The cerebral cortex predicts visual motion to adapt human behavior to surrounding objects moving in real time. Although the underlying mechanisms are still unknown, predictive coding is one of the leading theories. Predictive coding assumes that the brain's internal models (which are acquired through learning) predict the visual world at all times and that errors between the prediction and the actual sensory input further refine the internal models. In the past year, deep neural networks based on predictive coding were reported for a video prediction machine called PredNet. If the theory substantially reproduces the visual information processing of the cerebral cortex, then PredNet can be expected to represent the human visual perception of motion. In this study, PredNet was trained with natural scene videos of the self-motion of the viewer, and the motion prediction ability of the obtained computer model was verified using unlearned videos. We found that the computer model accurately predicted the magnitude and direction of motion of a rotating propeller in unlearned videos. Surprisingly, it also represented the rotational motion for illusion images that were not moving physically, much like human visual perception. While the trained network accurately reproduced the direction of illusory rotation, it did not detect motion components in negative control pictures wherein people do not perceive illusory motion. This research supports the exciting idea that the mechanism assumed by the predictive coding theory is one of basis of motion illusion generation. Using sensory illusions as indicators of human perception, deep neural networks are expected to contribute significantly to the development of brain research.

TU-F-BRB-02: Motion Artifacts and Suppression in MRI

International Nuclear Information System (INIS)

Zhong, X.

2015-01-01

The current clinical standard of organ respiratory imaging, 4D-CT, is fundamentally limited by poor soft-tissue contrast and imaging dose. These limitations are potential barriers to beneficial “4D” radiotherapy methods which optimize the target and OAR dose-volume considering breathing motion but rely on a robust motion characterization. Conversely, MRI imparts no known radiation risk and has excellent soft-tissue contrast. MRI-based motion management is therefore highly desirable and holds great promise to improve radiotherapy of moving cancers, particularly in the abdomen. Over the past decade, MRI techniques have improved significantly, making MR-based motion management clinically feasible. For example, cine MRI has high temporal resolution up to 10 f/s and has been used to track and/or characterize tumor motion, study correlation between external and internal motions. New MR technologies, such as 4D-MRI and MRI hybrid treatment machines (i.e. MR-linac or MR-Co60), have been recently developed. These technologies can lead to more accurate target volume determination and more precise radiation dose delivery via direct tumor gating or tracking. Despite all these promises, great challenges exist and the achievable clinical benefit of MRI-based tumor motion management has yet to be fully explored, much less realized. In this proposal, we will review novel MR-based motion management methods and technologies, the state-of-the-art concerning MRI development and clinical application and the barriers to more widespread adoption. Learning Objectives: Discuss the need of MR-based motion management for improving patient care in radiotherapy. Understand MR techniques for motion imaging and tumor motion characterization. Understand the current state of the art and future steps for clinical integration. Henry Ford Health System holds research agreements with Philips Healthcare. Research sponsored in part by a Henry Ford Health System Internal Mentored Grant

TU-F-BRB-00: MRI-Based Motion Management for RT

International Nuclear Information System (INIS)

2015-01-01

The current clinical standard of organ respiratory imaging, 4D-CT, is fundamentally limited by poor soft-tissue contrast and imaging dose. These limitations are potential barriers to beneficial “4D” radiotherapy methods which optimize the target and OAR dose-volume considering breathing motion but rely on a robust motion characterization. Conversely, MRI imparts no known radiation risk and has excellent soft-tissue contrast. MRI-based motion management is therefore highly desirable and holds great promise to improve radiotherapy of moving cancers, particularly in the abdomen. Over the past decade, MRI techniques have improved significantly, making MR-based motion management clinically feasible. For example, cine MRI has high temporal resolution up to 10 f/s and has been used to track and/or characterize tumor motion, study correlation between external and internal motions. New MR technologies, such as 4D-MRI and MRI hybrid treatment machines (i.e. MR-linac or MR-Co60), have been recently developed. These technologies can lead to more accurate target volume determination and more precise radiation dose delivery via direct tumor gating or tracking. Despite all these promises, great challenges exist and the achievable clinical benefit of MRI-based tumor motion management has yet to be fully explored, much less realized. In this proposal, we will review novel MR-based motion management methods and technologies, the state-of-the-art concerning MRI development and clinical application and the barriers to more widespread adoption. Learning Objectives: Discuss the need of MR-based motion management for improving patient care in radiotherapy. Understand MR techniques for motion imaging and tumor motion characterization. Understand the current state of the art and future steps for clinical integration. Henry Ford Health System holds research agreements with Philips Healthcare. Research sponsored in part by a Henry Ford Health System Internal Mentored Grant

TU-F-BRB-00: MRI-Based Motion Management for RT

Energy Technology Data Exchange (ETDEWEB)

NONE

2015-06-15

The current clinical standard of organ respiratory imaging, 4D-CT, is fundamentally limited by poor soft-tissue contrast and imaging dose. These limitations are potential barriers to beneficial “4D” radiotherapy methods which optimize the target and OAR dose-volume considering breathing motion but rely on a robust motion characterization. Conversely, MRI imparts no known radiation risk and has excellent soft-tissue contrast. MRI-based motion management is therefore highly desirable and holds great promise to improve radiotherapy of moving cancers, particularly in the abdomen. Over the past decade, MRI techniques have improved significantly, making MR-based motion management clinically feasible. For example, cine MRI has high temporal resolution up to 10 f/s and has been used to track and/or characterize tumor motion, study correlation between external and internal motions. New MR technologies, such as 4D-MRI and MRI hybrid treatment machines (i.e. MR-linac or MR-Co60), have been recently developed. These technologies can lead to more accurate target volume determination and more precise radiation dose delivery via direct tumor gating or tracking. Despite all these promises, great challenges exist and the achievable clinical benefit of MRI-based tumor motion management has yet to be fully explored, much less realized. In this proposal, we will review novel MR-based motion management methods and technologies, the state-of-the-art concerning MRI development and clinical application and the barriers to more widespread adoption. Learning Objectives: Discuss the need of MR-based motion management for improving patient care in radiotherapy. Understand MR techniques for motion imaging and tumor motion characterization. Understand the current state of the art and future steps for clinical integration. Henry Ford Health System holds research agreements with Philips Healthcare. Research sponsored in part by a Henry Ford Health System Internal Mentored Grant.

TU-F-BRB-02: Motion Artifacts and Suppression in MRI

Energy Technology Data Exchange (ETDEWEB)

Zhong, X. [Siemens (Germany)

2015-06-15

The current clinical standard of organ respiratory imaging, 4D-CT, is fundamentally limited by poor soft-tissue contrast and imaging dose. These limitations are potential barriers to beneficial “4D” radiotherapy methods which optimize the target and OAR dose-volume considering breathing motion but rely on a robust motion characterization. Conversely, MRI imparts no known radiation risk and has excellent soft-tissue contrast. MRI-based motion management is therefore highly desirable and holds great promise to improve radiotherapy of moving cancers, particularly in the abdomen. Over the past decade, MRI techniques have improved significantly, making MR-based motion management clinically feasible. For example, cine MRI has high temporal resolution up to 10 f/s and has been used to track and/or characterize tumor motion, study correlation between external and internal motions. New MR technologies, such as 4D-MRI and MRI hybrid treatment machines (i.e. MR-linac or MR-Co60), have been recently developed. These technologies can lead to more accurate target volume determination and more precise radiation dose delivery via direct tumor gating or tracking. Despite all these promises, great challenges exist and the achievable clinical benefit of MRI-based tumor motion management has yet to be fully explored, much less realized. In this proposal, we will review novel MR-based motion management methods and technologies, the state-of-the-art concerning MRI development and clinical application and the barriers to more widespread adoption. Learning Objectives: Discuss the need of MR-based motion management for improving patient care in radiotherapy. Understand MR techniques for motion imaging and tumor motion characterization. Understand the current state of the art and future steps for clinical integration. Henry Ford Health System holds research agreements with Philips Healthcare. Research sponsored in part by a Henry Ford Health System Internal Mentored Grant.

International Virtual Observatory System for Water Resources Information

Science.gov (United States)

Leinenweber, Lewis; Bermudez, Luis

2013-04-01

Sharing, accessing, and integrating hydrologic and climatic data have been identified as a critical need for some time. The current state of data portals, standards, technologies, activities, and expertise can be leverage to develop an initial operational capability for a virtual observatory system. This system will allow to link observations data with stream networks and models, and to solve semantic inconsistencies among communities. Prototyping a virtual observatory system is an inter-disciplinary, inter-agency and international endeavor. The Open Geospatial Consortium (OGC) within the OGC Interoperability Program provides the process and expertise to run such collaborative effort. The OGC serves as a global forum for the collaboration of developers and users of spatial data products and services, and to advance the development of international standards for geospatial interoperability. The project coordinated by OGC that is advancing an international virtual observatory system for water resources information is called Climatology-Hydrology Information Sharing Pilot, Phase 1 (CHISP-1). It includes observations and forecasts in the U.S. and Canada levering current networks and capabilities. It is designed to support the following use cases: 1) Hydrologic modeling for historical and near-future stream flow and groundwater conditions. Requires the integration of trans-boundary stream flow and groundwater well data, as well as national river networks (US NHD and Canada NHN) from multiple agencies. Emphasis will be on time series data and real-time flood monitoring. 2) Modeling and assessment of nutrient load into the lakes. Requires accessing water-quality data from multiple agencies and integrating with stream flow information for calculating loads. Emphasis on discrete sampled water quality observations, linking those to specific NHD stream reaches and catchments, and additional metadata for sampled data. The key objectives of these use cases are: 1) To link

Age-related degradation of boiling water reactor vessel internals

International Nuclear Information System (INIS)

Ware, A.G.; Shah, V.N.

1992-01-01

Researchers at the Idaho National Engineering Laboratory performed an assessment of the aging of the reactor internals in boiling water reactors (BWRs), and identified the unresolved technical issues related to the degradation of these components. The overall life-limiting mechanism is intergranular stress corrosion cracking (IGSCC). Irradiation-assisted stress corrosion cracking, fatigue, and thermal aging embrittlement are other potential degradation mechanisms. Several failures in BWR internals have been caused by a combination of factors such as environment, high residual or preload stresses, and flow-induced vibration. The ASME Code Section XI in-service inspection requirements are insufficient for detecting aging-related degradation at many locations in reactor internals. Many of the potential locations for IGSCC or fatigue are not accessible for inspection. (orig.)

19 CFR 210.54 - Service of motion by the complainant.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 3 2010-04-01 2010-04-01 false Service of motion by the complainant. 210.54 Section 210.54 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Temporary Relief § 210.54 Service of motion by the...

Mid-Ventilation Concept for Mobile Pulmonary Tumors: Internal Tumor Trajectory Versus Selective Reconstruction of Four-Dimensional Computed Tomography Frames Based on External Breathing Motion

International Nuclear Information System (INIS)

Guckenberger, Matthias; Wilbert, Juergen; Krieger, Thomas; Richter, Anne; Baier, Kurt; Flentje, Michael

2009-01-01

Purpose: To evaluate the accuracy of direct reconstruction of mid-ventilation and peak-phase four-dimensional (4D) computed tomography (CT) frames based on the external breathing signal. Methods and Materials: For 11 patients with 15 pulmonary targets, a respiration-correlated CT study (4D CT) was acquired for treatment planning. After retrospective time-based sorting of raw projection data and reconstruction of eight CT frames equally distributed over the breathing cycle, mean tumor position (P mean ), mid-ventilation frame, and breathing motion were evaluated based on the internal tumor trajectory. Analysis of the external breathing signal (pressure sensor around abdomen) with amplitude-based sorting of projections was performed for direct reconstruction of the mid-ventilation frame and frames at peak phases of the breathing cycle. Results: On the basis of the eight 4D CT frames equally spaced in time, tumor motion was largest in the craniocaudal direction, with 12 ± 7 mm on average. Tumor motion between the two frames reconstructed at peak phases was not different in the craniocaudal and anterior-posterior directions but was systematically smaller in the left-right direction by 1 mm on average. The 3-dimensional distance between P mean and the tumor position in the mid-ventilation frame based on the internal tumor trajectory was 1.2 ± 1 mm. Reconstruction of the mid-ventilation frame at the mean amplitude position of the external breathing signal resulted in tumor positions 2.0 ± 1.1 mm distant from P mean . Breathing-induced motion artifacts in mid-ventilation frames caused negligible changes in tumor volume and shape. Conclusions: Direct reconstruction of the mid-ventilation frame and frames at peak phases based on the external breathing signal was reliable. This makes the reconstruction of only three 4D CT frames sufficient for application of the mid-ventilation technique in clinical practice.

Deep eye-CU (DECU): Summarization of patient motion in the ICU

OpenAIRE

Torres, C; Fried, JC; Rose, K; Manjunath, BS

2016-01-01

© Springer International Publishing Switzerland 2016. Healthcare professionals speculate about the effects of poses and pose manipulation in healthcare. Anecdotal observations indicate that patient poses and motion affect recovery. Motion analysis using human observers puts strain on already taxed healthcare workforce requiring staff to record motion. Automated algorithms and systems are unable to monitor patients in hospital environments without disrupting patients or the existing standards ...

Ecosystem Services and International Water Law: towards a more ...

African Journals Online (AJOL)

While key principles of international water law, for example, equitable and reasonable utilisation, are not in conflict with an ecosystem services approach; significant challenges remain in its implementation. However, as the methods and tools used to identify ecosystem services improve, it is likely that such an approach will ...

The UN Convention on International Watercourses and integrated water management: A bridge built

Science.gov (United States)

Tzatzaki, Vasiliki-Maria

2008-11-01

The UN Convention on the Law of the Non Navigational Uses of International Watercourses incorporates principles regarding the management of international water resources. The most important principles are the duty of the riparian states to cooperate, not to cause significant harm, to protect the aquatic environment and to utilize the watercourses reasonably and equitably. The lack of hierarchy between these principles signifies that the necessary step for the sound management of shared natural resources is an integrated approach, which takes into account economic development, human needs and environmental protection. Moreover, the UN Convention proved to be useful for the International Court of Justice (hereinafter ICJ) in the settlement of the Gabcikovo- Nagymaros dispute between Hungary and Slovakia for the Danube River. The Court highlighted the importance of the Convention by reminding the riparian states of their obligation to abide by its principles. On the other hand, the ICJ has used the principles of the Convention in the pending case of Pulp Mills between Uruguay and Argentina. This paper is going to show that the UN Convention is an international legal framework with general guidelines in order to create regional conventions, which promotes integrated water management as a solution to the emerging challenges of international water law and potential future conflicts.

The UN Convention on International Watercourses and integrated water management: A bridge built

International Nuclear Information System (INIS)

Tzatzaki, Vasiliki-Maria

2008-01-01

The UN Convention on the Law of the Non Navigational Uses of International Watercourses incorporates principles regarding the management of international water resources. The most important principles are the duty of the riparian states to cooperate, not to cause significant harm, to protect the aquatic environment and to utilize the watercourses reasonably and equitably. The lack of hierarchy between these principles signifies that the necessary step for the sound management of shared natural resources is an integrated approach, which takes into account economic development, human needs and environmental protection. Moreover, the UN Convention proved to be useful for the International Court of Justice (hereinafter ICJ) in the settlement of the Gabcikovo- Nagymaros dispute between Hungary and Slovakia for the Danube River. The Court highlighted the importance of the Convention by reminding the riparian states of their obligation to abide by its principles. On the other hand, the ICJ has used the principles of the Convention in the pending case of Pulp Mills between Uruguay and Argentina. This paper is going to show that the UN Convention is an international legal framework with general guidelines in order to create regional conventions, which promotes integrated water management as a solution to the emerging challenges of international water law and potential future conflicts.

Robot Motion and Control 2011

CERN Document Server

2012-01-01

Robot Motion Control 2011 presents very recent results in robot motion and control. Forty short papers have been chosen from those presented at the sixth International Workshop on Robot Motion and Control held in Poland in June 2011. The authors of these papers have been carefully selected and represent leading institutions in this field. The following recent developments are discussed: • Design of trajectory planning schemes for holonomic and nonholonomic systems with optimization of energy, torque limitations and other factors. • New control algorithms for industrial robots, nonholonomic systems and legged robots. • Different applications of robotic systems in industry and everyday life, like medicine, education, entertainment and others. • Multiagent systems consisting of mobile and flying robots with their applications The book is suitable for graduate students of automation and robotics, informatics and management, mechatronics, electronics and production engineering systems as well as scientists...

Cone-Beam Computed Tomography Internal Motion Tracking Should Be Used to Validate 4-Dimensional Computed Tomography for Abdominal Radiation Therapy Patients

Energy Technology Data Exchange (ETDEWEB)

Rankine, Leith; Wan, Hanlin; Parikh, Parag; Maughan, Nichole [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States); Poulsen, Per [Department of Oncology, Aarhus University Hospital, Aarhus (Denmark); DeWees, Todd; Klein, Eric [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States); Santanam, Lakshmi, E-mail: lsantanam@radonc.wustl.edu [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States)

2016-06-01

Purpose: To demonstrate that fiducial tracking during pretreatment Cone-Beam CT (CBCT) can accurately measure tumor motion and that this method should be used to validate 4-dimensional CT (4DCT) margins before each treatment fraction. Methods and Materials: For 31 patients with abdominal tumors and implanted fiducial markers, tumor motion was measured daily with CBCT and fluoroscopy for 202 treatment fractions. Fiducial tracking and maximum-likelihood algorithms extracted 3-dimensional fiducial trajectories from CBCT projections. The daily internal margin (IM) (ie, range of fiducial motion) was calculated for CBCT and fluoroscopy as the 5th-95th percentiles of displacement in each cardinal direction. The planning IM from simulation 4DCT (IM{sub 4DCT}) was considered adequate when within ±1.2 mm (anterior–posterior, left–right) and ±3 mm (superior–inferior) of the daily measured IM. We validated CBCT fiducial tracking as an accurate predictive measure of intrafraction motion by comparing the daily measured IM{sub CBCT} with the daily IM measured by pretreatment fluoroscopy (IM{sub pre-fluoro}); these were compared with pre- and posttreatment fluoroscopy (IM{sub fluoro}) to identify those patients who could benefit from imaging during treatment. Results: Four-dimensional CT could not accurately predict intrafractional tumor motion for ≥80% of fractions in 94% (IM{sub CBCT}), 97% (IM{sub pre-fluoro}), and 100% (IM{sub fluoro}) of patients. The IM{sub CBCT} was significantly closer to IM{sub pre-fluoro} than IM{sub 4DCT} (P<.01). For patients with median treatment time t < 7.5 minutes, IM{sub CBCT} was in agreement with IM{sub fluoro} for 93% of fractions (superior–inferior), compared with 63% for the t > 7.5 minutes group, demonstrating the need for patient-specific intratreatment imaging. Conclusions: Tumor motion determined from 4DCT simulation does not accurately predict the daily motion observed on CBCT or fluoroscopy. Cone-beam CT could

Illusory Motion Reproduced by Deep Neural Networks Trained for Prediction

Directory of Open Access Journals (Sweden)

Eiji Watanabe

2018-03-01

Full Text Available The cerebral cortex predicts visual motion to adapt human behavior to surrounding objects moving in real time. Although the underlying mechanisms are still unknown, predictive coding is one of the leading theories. Predictive coding assumes that the brain's internal models (which are acquired through learning predict the visual world at all times and that errors between the prediction and the actual sensory input further refine the internal models. In the past year, deep neural networks based on predictive coding were reported for a video prediction machine called PredNet. If the theory substantially reproduces the visual information processing of the cerebral cortex, then PredNet can be expected to represent the human visual perception of motion. In this study, PredNet was trained with natural scene videos of the self-motion of the viewer, and the motion prediction ability of the obtained computer model was verified using unlearned videos. We found that the computer model accurately predicted the magnitude and direction of motion of a rotating propeller in unlearned videos. Surprisingly, it also represented the rotational motion for illusion images that were not moving physically, much like human visual perception. While the trained network accurately reproduced the direction of illusory rotation, it did not detect motion components in negative control pictures wherein people do not perceive illusory motion. This research supports the exciting idea that the mechanism assumed by the predictive coding theory is one of basis of motion illusion generation. Using sensory illusions as indicators of human perception, deep neural networks are expected to contribute significantly to the development of brain research.

A dual-Kinect approach to determine torso surface motion for respiratory motion correction in PET

International Nuclear Information System (INIS)

Heß, Mirco; Büther, Florian; Dawood, Mohammad; Schäfers, Klaus P.; Gigengack, Fabian

2015-01-01

Purpose: Respiratory gating is commonly used to reduce blurring effects and attenuation correction artifacts in positron emission tomography (PET). Established clinically available methods that employ body-attached hardware for acquiring respiration signals rely on the assumption that external surface motion and internal organ motion are well correlated. In this paper, the authors present a markerless method comprising two Microsoft Kinects for determining the motion on the whole torso surface and aim to demonstrate its validity and usefulness—including the potential to study the external/internal correlation and to provide useful information for more advanced correction approaches. Methods: The data of two Kinects are used to calculate 3D representations of a patient’s torso surface with high spatial coverage. Motion signals can be obtained for any position by tracking the mean distance to a virtual camera with a view perpendicular to the surrounding surface. The authors have conducted validation experiments including volunteers and a moving high-precision platform to verify the method’s suitability for providing meaningful data. In addition, the authors employed it during clinical 18 F-FDG-PET scans and exemplarily analyzed the acquired data of ten cancer patients. External signals of abdominal and thoracic regions as well as data-driven signals were used for gating and compared with respect to detected displacement of present lesions. Additionally, the authors quantified signal similarities and time shifts by analyzing cross-correlation sequences. Results: The authors’ results suggest a Kinect depth resolution of approximately 1 mm at 75 cm distance. Accordingly, valid signals could be obtained for surface movements with small amplitudes in the range of only few millimeters. In this small sample of ten patients, the abdominal signals were better suited for gating the PET data than the thoracic signals and the correlation of data-driven signals was found

A dual-Kinect approach to determine torso surface motion for respiratory motion correction in PET

Energy Technology Data Exchange (ETDEWEB)

Heß, Mirco, E-mail: mirco.hess@uni-muenster.de; Büther, Florian; Dawood, Mohammad; Schäfers, Klaus P. [European Institute for Molecular Imaging, University of Münster, Münster 48149 (Germany); Gigengack, Fabian [European Institute for Molecular Imaging, University of Münster, Münster 48149, Germany and Department of Mathematics and Computer Science, University of Münster, Münster 48149 (Germany)

2015-05-15

Purpose: Respiratory gating is commonly used to reduce blurring effects and attenuation correction artifacts in positron emission tomography (PET). Established clinically available methods that employ body-attached hardware for acquiring respiration signals rely on the assumption that external surface motion and internal organ motion are well correlated. In this paper, the authors present a markerless method comprising two Microsoft Kinects for determining the motion on the whole torso surface and aim to demonstrate its validity and usefulness—including the potential to study the external/internal correlation and to provide useful information for more advanced correction approaches. Methods: The data of two Kinects are used to calculate 3D representations of a patient’s torso surface with high spatial coverage. Motion signals can be obtained for any position by tracking the mean distance to a virtual camera with a view perpendicular to the surrounding surface. The authors have conducted validation experiments including volunteers and a moving high-precision platform to verify the method’s suitability for providing meaningful data. In addition, the authors employed it during clinical {sup 18}F-FDG-PET scans and exemplarily analyzed the acquired data of ten cancer patients. External signals of abdominal and thoracic regions as well as data-driven signals were used for gating and compared with respect to detected displacement of present lesions. Additionally, the authors quantified signal similarities and time shifts by analyzing cross-correlation sequences. Results: The authors’ results suggest a Kinect depth resolution of approximately 1 mm at 75 cm distance. Accordingly, valid signals could be obtained for surface movements with small amplitudes in the range of only few millimeters. In this small sample of ten patients, the abdominal signals were better suited for gating the PET data than the thoracic signals and the correlation of data-driven signals was

Oscillation of a rigid catenary riser due to the internal two-phase flow

Energy Technology Data Exchange (ETDEWEB)

Bordalo, Sergio N.; Morooka, Celso K.; Cavalcante, Cesar C.P. [Universidade Estadual de Campinas (UNICAMP), SP (Brazil); Matt, Cyntia G.C.; Franciss, Ricardo [PETROBRAS, Rio de Janeiro, RJ (Brazil). Centro de Pesquisas

2008-07-01

Production of petroleum reservoirs from deep and ultra-deep waters is of paramount importance in Brazil, and several researches are necessary to develop appropriated equipment and risers for those operational conditions. Risers are suspended pipes used to transport the petroleum fluids between the seabed and the floating production unit. The structural flexibility of riser's lines is conferred by its length when compared with the diameter, characterizing it as a slender body. The risers are submitted to large static and dynamic loads originated from its own weight, waves, currents, platform motions and the internal flow. These loadings may threaten, by fatigue, the structural integrity of the system, compromising its useful life, and so they must be considered in the riser's project. There is a large amount of knowledge in the literature about the effects of external loadings on these systems, but the effect of the internal flow remains vastly unexplored. The variation of the flow mass and momentum inside the riser causes a dynamic loading on this system, originating an oscillatory motion. Furthermore, the gas-liquid two-phase flow may assume several flow patterns (bubble, slug, intermittent or annular), each one possessing completely different characteristics. In this work, the influence of the internal flow on the oscillatory motion (whipping motion) of catenary risers is analyzed. To provide a better understanding of this physical phenomenon, a scaled apparatus was designed and built. The material used to manufacture the riser's model was a flexible silicone tube, and air and water were used to simulate the two-phase flow. The instrumentation used to measure the fluids flow rates and the sustaining force at the top of the model was installed in the apparatus. A video acquisition system was used to determine the displacements, and frequency spectrum, of color targets positioned throughout the model, under several flow conditions. The flow patterns

Drop detachment and motion on fuel cell electrode materials.

Science.gov (United States)

Gauthier, Eric; Hellstern, Thomas; Kevrekidis, Ioannis G; Benziger, Jay

2012-02-01

Liquid water is pushed through flow channels of fuel cells, where one surface is a porous carbon electrode made up of carbon fibers. Water drops grow on the fibrous carbon surface in the gas flow channel. The drops adhere to the superficial fiber surfaces but exhibit little penetration into the voids between the fibers. The fibrous surfaces are hydrophobic, but there is a substantial threshold force necessary to initiate water drop motion. Once the water drops begin to move, however, the adhesive force decreases and drops move with minimal friction, similar to motion on superhydrophobic materials. We report here studies of water wetting and water drop motion on typical porous carbon materials (carbon paper and carbon cloth) employed in fuel cells. The static coefficient of friction on these textured surfaces is comparable to that for smooth Teflon. But the dynamic coefficient of friction is several orders of magnitude smaller on the textured surfaces than on smooth Teflon. Carbon cloth displays a much smaller static contact angle hysteresis than carbon paper due to its two-scale roughness. The dynamic contact angle hysteresis for carbon paper is greatly reduced compared to the static contact angle hysteresis. Enhanced dynamic hydrophobicity is suggested to result from the extent to which a dynamic contact line can track topological heterogeneities of the liquid/solid interface.

Auditory motion capturing ambiguous visual motion

Directory of Open Access Journals (Sweden)

Arjen eAlink

2012-01-01

Full Text Available In this study, it is demonstrated that moving sounds have an effect on the direction in which one sees visual stimuli move. During the main experiment sounds were presented consecutively at four speaker locations inducing left- or rightwards auditory apparent motion. On the path of auditory apparent motion, visual apparent motion stimuli were presented with a high degree of directional ambiguity. The main outcome of this experiment is that our participants perceived visual apparent motion stimuli that were ambiguous (equally likely to be perceived as moving left- or rightwards more often as moving in the same direction than in the opposite direction of auditory apparent motion. During the control experiment we replicated this finding and found no effect of sound motion direction on eye movements. This indicates that auditory motion can capture our visual motion percept when visual motion direction is insufficiently determinate without affecting eye movements.

Designing Dual-functionalized Gels for Self-reconfiguration and Autonomous Motion

Science.gov (United States)

Kuksenok, Olga; Balazs, Anna C.

2015-04-01

Human motion is enabled by the concerted expansion and contraction of interconnected muscles that are powered by inherent biochemical reactions. One of the challenges in the field of biomimicry is eliciting this form of motion from purely synthetic materials, which typically do not generate internalized reactions to drive mechanical action. Moreover, for practical applications, this bio-inspired motion must be readily controllable. Herein, we develop a computational model to design a new class of polymer gels where structural reconfigurations and internalized reactions are intimately linked to produce autonomous motion, which can be directed with light. These gels contain both spirobenzopyran (SP) chromophores and the ruthenium catalysts that drive the oscillatory Belousov-Zhabotinsky (BZ) reaction. Importantly, both the SP moieties and the BZ reaction are photosensitive. When these dual-functionalized gels are exposed to non-uniform illumination, the localized contraction of the gel (due to the SP moieties) in the presence of traveling chemical waves (due to the BZ reaction) leads to new forms of spontaneous, self-sustained movement, which cannot be achieved by either of the mono-functionalized networks.

TU-F-BRB-03: Clinical Implementation of MR-Based Motion Management

International Nuclear Information System (INIS)

Glide-Hurst, C.

2015-01-01

The current clinical standard of organ respiratory imaging, 4D-CT, is fundamentally limited by poor soft-tissue contrast and imaging dose. These limitations are potential barriers to beneficial “4D” radiotherapy methods which optimize the target and OAR dose-volume considering breathing motion but rely on a robust motion characterization. Conversely, MRI imparts no known radiation risk and has excellent soft-tissue contrast. MRI-based motion management is therefore highly desirable and holds great promise to improve radiotherapy of moving cancers, particularly in the abdomen. Over the past decade, MRI techniques have improved significantly, making MR-based motion management clinically feasible. For example, cine MRI has high temporal resolution up to 10 f/s and has been used to track and/or characterize tumor motion, study correlation between external and internal motions. New MR technologies, such as 4D-MRI and MRI hybrid treatment machines (i.e. MR-linac or MR-Co60), have been recently developed. These technologies can lead to more accurate target volume determination and more precise radiation dose delivery via direct tumor gating or tracking. Despite all these promises, great challenges exist and the achievable clinical benefit of MRI-based tumor motion management has yet to be fully explored, much less realized. In this proposal, we will review novel MR-based motion management methods and technologies, the state-of-the-art concerning MRI development and clinical application and the barriers to more widespread adoption. Learning Objectives: Discuss the need of MR-based motion management for improving patient care in radiotherapy. Understand MR techniques for motion imaging and tumor motion characterization. Understand the current state of the art and future steps for clinical integration. Henry Ford Health System holds research agreements with Philips Healthcare. Research sponsored in part by a Henry Ford Health System Internal Mentored Grant

TU-F-BRB-03: Clinical Implementation of MR-Based Motion Management

Energy Technology Data Exchange (ETDEWEB)

Glide-Hurst, C. [Henry Ford Health System (United States)

2015-06-15

The current clinical standard of organ respiratory imaging, 4D-CT, is fundamentally limited by poor soft-tissue contrast and imaging dose. These limitations are potential barriers to beneficial “4D” radiotherapy methods which optimize the target and OAR dose-volume considering breathing motion but rely on a robust motion characterization. Conversely, MRI imparts no known radiation risk and has excellent soft-tissue contrast. MRI-based motion management is therefore highly desirable and holds great promise to improve radiotherapy of moving cancers, particularly in the abdomen. Over the past decade, MRI techniques have improved significantly, making MR-based motion management clinically feasible. For example, cine MRI has high temporal resolution up to 10 f/s and has been used to track and/or characterize tumor motion, study correlation between external and internal motions. New MR technologies, such as 4D-MRI and MRI hybrid treatment machines (i.e. MR-linac or MR-Co60), have been recently developed. These technologies can lead to more accurate target volume determination and more precise radiation dose delivery via direct tumor gating or tracking. Despite all these promises, great challenges exist and the achievable clinical benefit of MRI-based tumor motion management has yet to be fully explored, much less realized. In this proposal, we will review novel MR-based motion management methods and technologies, the state-of-the-art concerning MRI development and clinical application and the barriers to more widespread adoption. Learning Objectives: Discuss the need of MR-based motion management for improving patient care in radiotherapy. Understand MR techniques for motion imaging and tumor motion characterization. Understand the current state of the art and future steps for clinical integration. Henry Ford Health System holds research agreements with Philips Healthcare. Research sponsored in part by a Henry Ford Health System Internal Mentored Grant.

A finite state model for respiratory motion analysis in image guided radiation therapy

International Nuclear Information System (INIS)

Wu Huanmei; Sharp, Gregory C; Salzberg, Betty; Kaeli, David; Shirato, Hiroki; Jiang, Steve B

2004-01-01

Effective image guided radiation treatment of a moving tumour requires adequate information on respiratory motion characteristics. For margin expansion, beam tracking and respiratory gating, the tumour motion must be quantified for pretreatment planning and monitored on-line. We propose a finite state model for respiratory motion analysis that captures our natural understanding of breathing stages. In this model, a regular breathing cycle is represented by three line segments, exhale, end-of-exhale and inhale, while abnormal breathing is represented by an irregular breathing state. In addition, we describe an on-line implementation of this model in one dimension. We found this model can accurately characterize a wide variety of patient breathing patterns. This model was used to describe the respiratory motion for 23 patients with peak-to-peak motion greater than 7 mm. The average root mean square error over all patients was less than 1 mm and no patient has an error worse than 1.5 mm. Our model provides a convenient tool to quantify respiratory motion characteristics, such as patterns of frequency changes and amplitude changes, and can be applied to internal or external motion, including internal tumour position, abdominal surface, diaphragm, spirometry and other surrogates

A finite state model for respiratory motion analysis in image guided radiation therapy

Energy Technology Data Exchange (ETDEWEB)

Wu Huanmei [College of Computer and Information Science, Northeastern University, Boston, MA 02115 (United States); Sharp, Gregory C [Department of Radiation Oncology, Massachusetts General Hospital and Harvard Medical School, Boston, MA 02114 (United States); Salzberg, Betty [College of Computer and Information Science, Northeastern University, Boston, MA 02115 (United States); Kaeli, David [Department of Electrical and Computer Engineering, Northeastern University, Boston, MA 02115 (United States); Shirato, Hiroki [Department of Radiation Medicine, Hokkaido University School of Medicine, Sapporo (Japan); Jiang, Steve B [Department of Radiation Oncology, Massachusetts General Hospital and Harvard Medical School, Boston, MA 02114 (United States)

2004-12-07

Effective image guided radiation treatment of a moving tumour requires adequate information on respiratory motion characteristics. For margin expansion, beam tracking and respiratory gating, the tumour motion must be quantified for pretreatment planning and monitored on-line. We propose a finite state model for respiratory motion analysis that captures our natural understanding of breathing stages. In this model, a regular breathing cycle is represented by three line segments, exhale, end-of-exhale and inhale, while abnormal breathing is represented by an irregular breathing state. In addition, we describe an on-line implementation of this model in one dimension. We found this model can accurately characterize a wide variety of patient breathing patterns. This model was used to describe the respiratory motion for 23 patients with peak-to-peak motion greater than 7 mm. The average root mean square error over all patients was less than 1 mm and no patient has an error worse than 1.5 mm. Our model provides a convenient tool to quantify respiratory motion characteristics, such as patterns of frequency changes and amplitude changes, and can be applied to internal or external motion, including internal tumour position, abdominal surface, diaphragm, spirometry and other surrogates.

Hip strength and range of motion

DEFF Research Database (Denmark)

Mosler, Andrea B.; Crossley, Kay M.; Thorborg, Kristian

2017-01-01

Objectives To determine the normal profiles for hip strength and range of motion (ROM) in a professional football league in Qatar, and examine the effect of leg dominance, age, past history of injury, and ethnicity on these profiles. Design Cross-sectional cohort study. Methods Participants...... values are documented for hip strength and range of motion that can be used as reference profiles in the clinical assessment, screening, and management of professional football players. Leg dominance, recent past injury history and ethnicity do not need to be accounted for when using these profiles...... included 394 asymptomatic, male professional football players, aged 18–40 years. Strength was measured using a hand held dynamometer with an eccentric test in side-lying for hip adduction and abduction, and the squeeze test in supine with 45° hip flexion. Range of motion measures included: hip internal...

Communication: Mode bifurcation of droplet motion under stationary laser irradiation

Energy Technology Data Exchange (ETDEWEB)

Takabatake, Fumi [Department of Physics, Graduate School of Science, Kyoto University, Kyoto 606-8502 (Japan); Department of Bioengineering and Robotics, Graduate School of Engineering, Tohoku University, Sendai, Miyagi 980-8579 (Japan); Yoshikawa, Kenichi [Faculty of Life and Medical Sciences, Doshisha University, Kyotanabe, Kyoto 610-0394 (Japan); Ichikawa, Masatoshi, E-mail: ichi@scphys.kyoto-u.ac.jp [Department of Physics, Graduate School of Science, Kyoto University, Kyoto 606-8502 (Japan)

2014-08-07

The self-propelled motion of a mm-sized oil droplet floating on water, induced by a local temperature gradient generated by CW laser irradiation is reported. The circular droplet exhibits two types of regular periodic motion, reciprocal and circular, around the laser spot under suitable laser power. With an increase in laser power, a mode bifurcation from rectilinear reciprocal motion to circular motion is caused. The essential aspects of this mode bifurcation are discussed in terms of spontaneous symmetry-breaking under temperature-induced interfacial instability, and are theoretically reproduced with simple coupled differential equations.

19 CFR 210.59 - Responses to the motion and the complaint.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 3 2010-04-01 2010-04-01 false Responses to the motion and the complaint. 210.59 Section 210.59 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Temporary Relief § 210.59 Responses to the motion and...

The influence of motion control shoes on the running gait of mature and young females.

Science.gov (United States)

Lilley, Kim; Stiles, Vicky; Dixon, Sharon

2013-03-01

This study compared the running gait of mature and young females, and investigated the effect of a motion control shoe. First, it was hypothesised that in a neutral shoe, mature females would display significantly greater rearfoot eversion, knee internal rotation and external adductor moments when compared to a younger group. Secondly, the motion control shoe would reduce rearfoot eversion and knee internal rotation in both groups. Thirdly it was hypothesised that the motion control shoe would increase knee external adductor moment, through an increase in knee varus and moment arm. 15 mature (40-60 years) and 15 young (18-25 years) females performed 10 running trials at 3.5ms(-1)±5% over a force platform. Two shoes were tested, the Adidas Supernova Glide (neutral), and the Adidas Supernova Sequence (motion control). Ankle and knee joint dynamics were analysed for the right leg, and the mean of ten trials was calculated. Joint moments were calculated using inverse dynamics. In the neutral condition, mature females presented greater peak rearfoot eversion, knee internal rotation, and external adductor moments than young females (p<0.05). A motion control shoe significantly reduced peak rearfoot eversion and knee internal rotation among both groups (p<0.05). No between shoe differences in knee external adductor moment were observed. A motion control shoe is recommended to reduce risk of injury associated with rearfoot eversion and knee internal rotation in mature females. However since the knee external adductor moment is a variable commonly associated with medial knee loading it is suggested that alternative design features are required to influence this moment. Copyright © 2012 Elsevier B.V. All rights reserved.

Motion Segments Decomposition of RGB-D Sequences for Human Behavior Understanding

OpenAIRE

Devanne , Maxime; Berretti , Stefano; Pala , Pietro; Wannous , Hazem; Daoudi , Mohamed; Bimbo , Alberto ,

2017-01-01

International audience; In this paper, we propose a framework for analyzing and understanding human behavior from depth videos. The proposed solution first employs shape analysis of the human pose across time to decompose the full motion into short temporal segments representing elementary motions. Then, each segment is characterized by human motion and depth appearance around hand joints to describe the change in pose of the body and the interaction with objects. Finally , the sequence of te...

Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

International Nuclear Information System (INIS)

Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

2005-01-01

We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

Using an external surrogate for predictor model training in real-time motion management of lung tumors

Energy Technology Data Exchange (ETDEWEB)

Rottmann, Joerg; Berbeco, Ross [Brigham and Women’s Hospital, Dana-Farber Cancer Institute and Harvard Medical School, Boston, Massachusetts 02115 (United States)

2014-12-15

Purpose: Precise prediction of respiratory motion is a prerequisite for real-time motion compensation techniques such as beam, dynamic couch, or dynamic multileaf collimator tracking. Collection of tumor motion data to train the prediction model is required for most algorithms. To avoid exposure of patients to additional dose from imaging during this procedure, the feasibility of training a linear respiratory motion prediction model with an external surrogate signal is investigated and its performance benchmarked against training the model with tumor positions directly. Methods: The authors implement a lung tumor motion prediction algorithm based on linear ridge regression that is suitable to overcome system latencies up to about 300 ms. Its performance is investigated on a data set of 91 patient breathing trajectories recorded from fiducial marker tracking during radiotherapy delivery to the lung of ten patients. The expected 3D geometric error is quantified as a function of predictor lookahead time, signal sampling frequency and history vector length. Additionally, adaptive model retraining is evaluated, i.e., repeatedly updating the prediction model after initial training. Training length for this is gradually increased with incoming (internal) data availability. To assess practical feasibility model calculation times as well as various minimum data lengths for retraining are evaluated. Relative performance of model training with external surrogate motion data versus tumor motion data is evaluated. However, an internal–external motion correlation model is not utilized, i.e., prediction is solely driven by internal motion in both cases. Results: Similar prediction performance was achieved for training the model with external surrogate data versus internal (tumor motion) data. Adaptive model retraining can substantially boost performance in the case of external surrogate training while it has little impact for training with internal motion data. A minimum

Leaks in the internal water supply piping systems

Directory of Open Access Journals (Sweden)

Orlov Evgeniy Vladimirovich

2015-03-01

Full Text Available Great water losses in the internal plumbing of a building lead to the waste of money for a fence, purification and supply of water volumes in excess. This does not support the concept of water conservation and resource saving lying today in the basis of any building’s construction having plumbing. Leakage means unplanned of water losses systems in domestic water supply systems (hot or cold as a result of impaired integrity, complicating the operation of a system and leading to high costs of repair and equipment restoration. A large number of leaks occur in old buildings, where the regulatory service life of pipelines has come to an end, and the scheduled repair for some reason has not been conducted. Steel pipelines are used in the systems without any protection from corrosion and they get out of order. Leakages in new houses are also not uncommon. They usually occur as a result of low-quality adjustment of the system by workers. It also important to note the absence of certain skills of plumbers, who don’t conduct the inspections of in-house systems in time. Sometimes also the residents themselves forget to keep their pipeline systems and water fittings in their apartment in good condition. Plumbers are not systematically invited for preventive examinations to detect possible leaks in the domestic plumbing. The amount of unproductive losses increases while simultaneous use of valve tenants, and at the increase of the number of residents in the building. Water leaks in the system depend on the amount of water system piping damages, and damages of other elements, for example, water valves, connections, etc. The pressure in the leak area also plays an important role.

Motion characteristic of a free piston linear engine

Energy Technology Data Exchange (ETDEWEB)

Xiao, Jin; Li, Qingfeng; Huang, Zhen [Key Laboratory for Power Machinery and Engineering of Ministry of Education, Shanghai Jiao Tong University, Shanghai, 200240 (China)

2010-04-15

A mathematical model of a free piston linear engine is established. The motion characteristics as well as the natural frequency map of the free piston are established. Then, its motion characteristics are successfully explained from the oscillation point. The full simulation model is built up in Matlab/Simulink for a better understanding of its motion features. The results show that the free piston system is a forced vibration system with variable damping coefficient and stiffness. Its steady-state response of periodical excitation is convergent which means that the system is stable under the periodical combustion. Furthermore, it has some unique features which are different from those of traditional Internal Combustion (IC) engines. (author)

Auditory Motion Elicits a Visual Motion Aftereffect.

Science.gov (United States)

Berger, Christopher C; Ehrsson, H Henrik

2016-01-01

The visual motion aftereffect is a visual illusion in which exposure to continuous motion in one direction leads to a subsequent illusion of visual motion in the opposite direction. Previous findings have been mixed with regard to whether this visual illusion can be induced cross-modally by auditory stimuli. Based on research on multisensory perception demonstrating the profound influence auditory perception can have on the interpretation and perceived motion of visual stimuli, we hypothesized that exposure to auditory stimuli with strong directional motion cues should induce a visual motion aftereffect. Here, we demonstrate that horizontally moving auditory stimuli induced a significant visual motion aftereffect-an effect that was driven primarily by a change in visual motion perception following exposure to leftward moving auditory stimuli. This finding is consistent with the notion that visual and auditory motion perception rely on at least partially overlapping neural substrates.

Auditory Motion Elicits a Visual Motion Aftereffect

Directory of Open Access Journals (Sweden)

Christopher C. Berger

2016-12-01

Full Text Available The visual motion aftereffect is a visual illusion in which exposure to continuous motion in one direction leads to a subsequent illusion of visual motion in the opposite direction. Previous findings have been mixed with regard to whether this visual illusion can be induced cross-modally by auditory stimuli. Based on research on multisensory perception demonstrating the profound influence auditory perception can have on the interpretation and perceived motion of visual stimuli, we hypothesized that exposure to auditory stimuli with strong directional motion cues should induce a visual motion aftereffect. Here, we demonstrate that horizontally moving auditory stimuli induced a significant visual motion aftereffect—an effect that was driven primarily by a change in visual motion perception following exposure to leftward moving auditory stimuli. This finding is consistent with the notion that visual and auditory motion perception rely on at least partially overlapping neural substrates.

Changes in the Characteristics of Water-in-Oil-based High Internal ...

African Journals Online (AJOL)

HP

Pharmacy, Faculty of Pharmacy and Alternative Medicine, the Islamia University of Bahawalpur 63100, ... and water-in-oil (W/O) systems with internal .... stresses were applied on the samples, and shear rates and .... Curr Opin Colloid Interfac.

Utilize target motion to cover clinical target volume (ctv) - a novel and practical treatment planning approach to manage respiratory motion

International Nuclear Information System (INIS)

Jin Jianyue; Ajlouni, Munther; Kong Fengming; Ryu, Samuel; Chetty, Indrin J.; Movsas, Benjamin

2008-01-01

Purpose: To use probability density function (PDF) to model motion effects and incorporate this information into treatment planning for lung cancers. Material and methods: PDFs were calculated from the respiratory motion traces of 10 patients. Motion effects were evaluated by convolving static dose distributions with various PDFs. Based on a differential dose prescription with relatively lower dose to the clinical target volume (CTV) than to the gross tumor volume (GTV), two approaches were proposed to incorporate PDFs into treatment planning. The first approach uses the GTV-based internal target volume (ITV) as the planning target volume (PTV) to ensure full dose to the GTV, and utilizes the motion-induced dose gradient to cover the CTV. The second approach employs an inhomogeneous static dose distribution within a minimized PTV to best match the prescription dose gradient. Results: Motion effects on dose distributions were minimal in the anterior-posterior (AP) and lateral directions: a 10-mm motion only induced about 3% of dose reduction in the peripheral target region. The motion effect was remarkable in the cranial-caudal direction. It varied with the motion amplitude, but tended to be similar for various respiratory patterns. For the first approach, a 10-15 mm motion would adequately cover the CTV (presumed to be 60-70% of the GTV dose) without employing the CTV in planning. For motions 15-mm. An example of inhomogeneous static dose distribution in a reduced PTV was given, and it showed significant dose reduction in the normal tissue without compromising target coverage. Conclusions: Respiratory motion-induced dose gradient can be utilized to cover the CTV and minimize the lung dose without the need for more sophisticated technologies

The open quantum Brownian motions

International Nuclear Information System (INIS)

Bauer, Michel; Bernard, Denis; Tilloy, Antoine

2014-01-01

Using quantum parallelism on random walks as the original seed, we introduce new quantum stochastic processes, the open quantum Brownian motions. They describe the behaviors of quantum walkers—with internal degrees of freedom which serve as random gyroscopes—interacting with a series of probes which serve as quantum coins. These processes may also be viewed as the scaling limit of open quantum random walks and we develop this approach along three different lines: the quantum trajectory, the quantum dynamical map and the quantum stochastic differential equation. We also present a study of the simplest case, with a two level system as an internal gyroscope, illustrating the interplay between the ballistic and diffusive behaviors at work in these processes. Notation H z : orbital (walker) Hilbert space, C Z in the discrete, L 2 (R) in the continuum H c : internal spin (or gyroscope) Hilbert space H sys =H z ⊗H c : system Hilbert space H p : probe (or quantum coin) Hilbert space, H p =C 2 ρ t tot : density matrix for the total system (walker + internal spin + quantum coins) ρ-bar t : reduced density matrix on H sys : ρ-bar t =∫dxdy ρ-bar t (x,y)⊗|x〉 z 〈y| ρ-hat t : system density matrix in a quantum trajectory: ρ-hat t =∫dxdy ρ-hat t (x,y)⊗|x〉 z 〈y|. If diagonal and localized in position: ρ-hat t =ρ t ⊗|X t 〉 z 〈X t | ρ t : internal density matrix in a simple quantum trajectory X t : walker position in a simple quantum trajectory B t : normalized Brownian motion ξ t , ξ t † : quantum noises (paper)

The Analysis of Motion Dynamics and Resistance of the Multipurpose Boat Operating in Shallow Water

Directory of Open Access Journals (Sweden)

Jan Kulczyk

2014-09-01

Full Text Available Polish market of small boats has been developed very dynamically in recent years. Market competition forces the shipyards to build new more efficient hull forms and to cut the cost of production as well. This is why modern computer simulation programs are used more often by naval architects. Another trend is to design more universal ships that may be used by larger number of diversified customers. This paper presents project proposal of multipurpose boat hull form. The boat was design to fulfil the requirements imposed by public services like water police, fire brigades, and border guards. It is supposed to be operated on unexplored floodplains and other type shallow waters. The analysis of boat’s motion was based on computer simulations. The resistance curve was evaluated with two methods: comparison study of model test results of similar ships and CFD methods. The results obtained from Ansys Fluent and FINE/Marine systems were compared in this paper. It was shown that taking into consideration dynamic trim and sinkage has a significant impact on free surface capture and resistance values.

Cervical range of motion, cervical and shoulder strength in senior versus age-grade Rugby Union International front-row forwards.

Science.gov (United States)

Davies, Mark; Moore, Isabel S; Moran, Patrick; Mathema, Prabhat; Ranson, Craig A

2016-05-01

To provide normative values for cervical range of motion (CROM), isometric cervical and shoulder strength for; International Senior professional, and International Age-grade Rugby Union front-row forwards. Cross-sectional population study. All international level front-row players within a Rugby Union Tier 1 Nation. Nineteen Senior and 21 Age-grade front-row forwards underwent CROM, cervical and shoulder strength testing. CROM was measured using the CROM device and the Gatherer System was used to measure multi-directional isometric cervical and shoulder strength. The Age-grade players had significantly lower; cervical strength (26-57% deficits), cervical flexion to extension strength ratios (0.5 vs. 0.6), and shoulder strength (2-36% deficits) than the Senior players. However, there were no differences between front-row positions within each age group. Additionally, there were no differences between age groups or front-row positions in the CROM measurements. Senior Rugby Union front-row forwards have greater cervical and shoulder strength than Age-grade players, with the biggest differences being in cervical strength, highlighting the need for age specific normative values. Importantly, Age-grade players should be evaluated to ensure they have developed sufficient cervical strength prior to entering professional level Rugby Union. Copyright © 2015 Elsevier Ltd. All rights reserved.

Kinematics and Dynamics of Motion Control Based on Acceleration Control

Science.gov (United States)

Ohishi, Kiyoshi; Ohba, Yuzuru; Katsura, Seiichiro

The first IEEE International Workshop on Advanced Motion Control was held in 1990 pointed out the importance of physical interpretation of motion control. The software servoing technology is now common in machine tools, robotics, and mechatronics. It has been intensively developed for the numerical control (NC) machines. Recently, motion control in unknown environment will be more and more important. Conventional motion control is not always suitable due to the lack of adaptive capability to the environment. A more sophisticated ability in motion control is necessary for compliant contact with environment. Acceleration control is the key technology of motion control in unknown environment. The acceleration control can make a motion system to be a zero control stiffness system without losing the robustness. Furthermore, a realization of multi-degree-of-freedom motion is necessary for future human assistance. A human assistant motion will require various control stiffness corresponding to the task. The review paper focuses on the modal coordinate system to integrate the various control stiffness in the virtual axes. A bilateral teleoperation is a good candidate to consider the future human assistant motion and integration of decentralized systems. Thus the paper reviews and discusses the bilateral teleoperation from the control stiffness and the modal control design points of view.

Estimating tropical vertical motion profile shapes from satellite observations

Science.gov (United States)

Back, L. E.; Handlos, Z.

2013-12-01

The vertical structure of tropical deep convection strongly influences interactions with larger scale circulations and climate. This research focuses on investigating this vertical structure and its relationship with mesoscale tropical weather states. We test the hypothesis that vertical motion shape varies in association with weather state type. We estimate mean state vertical motion profile shapes for six tropical weather states defined using cloud top pressure and optical depth properties from the International Satellite Cloud Climatology Project. The relationship between vertical motion and the dry static energy budget are utilized to set up a regression analysis that empirically determines two modes of variability in vertical motion from reanalysis data. We use these empirically determined modes, this relationship and surface convergence to estimate vertical motion profile shape from observations of satellite retrievals of rainfall and surface convergence. We find that vertical motion profile shapes vary systematically between different tropical weather states. The "isolated systems" regime exhibits a more ''bottom-heavy'' profile shape compared to the convective/thick cirrus and vigorous deep convective regimes, with maximum upward vertical motion occurring in the lower troposphere rather than the middle to upper troposphere. The variability we observe with our method does not coincide with that expected based on conventional ideas about how stratiform rain fraction and vertical motion are related.

Neutronographic measurements of the motion of hydrogen and hydrogeneous substances in liquids and solids

International Nuclear Information System (INIS)

Zeilinger, A.; Pochman, W.A.; Rauch, H.; Suleiman, M.

1976-01-01

Earlier measurements of hydrogen motion in liquids by neutron radiography have been extended to obtain additional parameters of governing the mixing behavior of light and heavy water. Furthermore motion of water in concrete was measured leading to a determination of (1) the vapor diffusion coefficient of water in concrete, (2) the porosity of the concrete, and (3) the mass transfer coefficient of vapor from the concrete to the environment. Recently the ability of neutron radiography to measure the hydrogen motion in metals was demonstrated and the diffusion coefficients of hydrogen in V, Ta, Nb and beta-Ti was determined. In addition, some work on resolution measurements of neutron radiography will be reported. (author)

Solid state engine with alternating motion

Science.gov (United States)

Golestaneh, Ahmad A.

1982-01-01

Heat energy is converted to mechanical motion utilizing apparatus including a cylinder, a piston having openings therein reciprocable in the cylinder, inlet and outlet ports for warm water at one end of the cylinder, inlet and outlet ports for cool water at the other end of the cylinder, gates movable with the piston and slidably engaging the cylinder wall to alternately open and close the warm and cool water ports, a spring bearing against the warm water side of the piston and a double helix of a thermal shape memory material attached to the cool end of the cylinder and to the piston. The piston is caused to reciprocate by alternately admitting cool water and warm water to the cylinder.

Galileo and the Problems of Motion

Science.gov (United States)

Hooper, Wallace Edd

Galileo's science of motion changed natural philosophy. His results initiated a broad human awakening to the intricate new world of physical order found in the midst of familiar operations of nature. His thinking was always based squarely on the academic traditions of the spiritual old world. He advanced physics by new standards of judgment drawn from mechanics and geometry, and disciplined observation of the world. My study first determines the order of composition of the earliest essays on motion and physics, ca. 1588 -1592, from internal evidence, and bibliographic evidence. There are clear signs of a Platonist critique of Aristotle, supported by Archimedes, in the Ten Section Version of On Motion, written ca. 1588, and probably the earliest of his treatises on motion or physics. He expanded upon his opening Platonic -Archimedean position by investigating the ideas of scholastic critics of Aristotle, including the Doctores Parisienses, found in his readings of the Jesuit Professors at the Collegio Romano. Their influences surfaced clearly in Galileo's Memoranda on Motion and the Dialogue on Motion, and in On Motion, which followed, ca. 1590-1592. At the end of his sojourn in Pisa, Galileo opened the road to the new physics by solving an important problem in the mechanics of Pappus, concerning motion along inclined planes. My study investigates why Galileo gave up attempts to establish a ratio between speed and weight, and why he began to seek the ratios of time and distance and speed, by 1602. It also reconstructs Galileo's development of the 1604 principle, seeking to outline its invention, elaboration, and abandonment. Then, I try to show that we have a record of Galileo's moment of recognition of the direct relation between the time of fall and the accumulated speed of motion--that great affinity between time and motion and the key to the new science of motion established before 1610. Evidence also ties the discovery of the time affinity directly to Galileo

A Dynamic Model for Roll Motion of Ships due to Flooding

DEFF Research Database (Denmark)

Xia, Jinzhu; Jensen, Jørgen Juncher; Pedersen, Preben Terndrup

1999-01-01

Because of the large undivided deck spaces, RoRo vessels are often sensitive to rapid capsizing due to sudden ingress of water. Following a high-energy damage, a rapidly increasing heeling moment is induced by the ingress of water, which generates a roll motion of the damaged vessel. If, addition......Because of the large undivided deck spaces, RoRo vessels are often sensitive to rapid capsizing due to sudden ingress of water. Following a high-energy damage, a rapidly increasing heeling moment is induced by the ingress of water, which generates a roll motion of the damaged vessel. If......, additionally, the car deck is flooded and/or the cargo is shifted, the heeling moment may exceed the residual restoring moment, which results in capsizing....

The International Center for Integrated Water Resources Management (ICIWaRM): The United States' Contribution to UNESCO IHP's Global Network of Water Centers

Science.gov (United States)

Logan, W. S.

2015-12-01

The concept of a "category 2 center"—i.e., one that is closely affiliated with UNESCO, but not legally part of UNESCO—dates back many decades. However, only in the last decade has the concept been fully developed. Within UNESCO, the International Hydrological Programme (IHP) has led the way in creating a network of regional and global water-related centers.ICIWaRM—the International Center for Integrated Water Resources Management—is one member of this network. Approved by UNESCO's General Conference, the center has been operating since 2009. It was designed to fill a niche in the system for a center that was backed by an institution with on-the-ground water management experience, but that also had strong connections to academia, NGOs and other governmental agencies. Thus, ICIWaRM is hosted by the US Army Corps of Engineers' Institute for Water Resources (IWR), but established with an internal network of partner institutions. Three main factors have contributed to any success that ICIWaRM has achieved in its global work: A focus on practical science and technology which can be readily transferred. This includes the Corps' own methodologies and models for planning and water management, and those of our university and government partners. Collaboration with other UNESCO Centers on joint applied research, capacity-building and training. A network of centers needs to function as a network, and ICIWaRM has worked together with UNESCO-affiliated centers in Chile, Brazil, Paraguay, the Dominican Republic, Japan, China, and elsewhere. Partnering with and supporting existing UNESCO-IHP programs. ICIWaRM serves as the Global Technical Secretariat for IHP's Global Network on Water and Development Information in Arid Lands (G-WADI). In addition to directly supporting IHP, work through G-WADI helps the center to frame, prioritize and integrate its activities. With the recent release of the United Nation's 2030 Agenda for Sustainable Development, it is clear that

Analysis on traditional fishing grounds in Indonesia`s Natuna waters under International Law

Science.gov (United States)

Kurniaty, R.; Ikaningtyas; Ruslijanto, P. A.

2018-04-01

This paper examines the boundary tension between Indonesia and China regarding traditional fishing ground in Natuna. Indonesia`s Natuna island is claimed by the China government as its traditional fishing zone/ground. The inclusion of Natuna territory into China`s traditional fishing zone brings new problems to Indonesia, especially with the Chinese ships docked and entered Indonesia`s exclusive economic zone, as well as several cases of illegal fishing over the territorial waters of Indonesia. Claims on traditional fishing zones have the potential to threaten the sovereignty of the Indonesian territory. This study aims to analyze the claims of the traditional fishing rights of China over the waters of the Natuna Islands under international law, especially UNCLOS 1982. This study revealed that the china`s argument of traditional fishing ground in Natuna to the nine dash line map is a unilateral claim, there is no international legal norm that can be used as the legal basis. Indonesia and some ASEAN countries have Internationally validated bilateral agreement on the continental shelf (i.e. Indonesia-Vietnam and Indonesia-Malaysia) thus the inclusion of Natuna into China`s nine dash line map rejects the legal status of Indonesian water under UNCLOS 1982.

Various anti-motion sickness drugs and core body temperature changes.

Science.gov (United States)

Cheung, Bob; Nakashima, Ann M; Hofer, Kevin D

2011-04-01

Blood flow changes and inactivity associated with motion sickness appear to exacerbate the rate of core temperature decrease during subsequent body cooling. We investigated the effects of various classes of anti-motion sickness drugs on core temperature changes. There were 12 healthy male and female subjects (20-35 yr old) who were given selected classes of anti-motion sickness drugs prior to vestibular Coriolis cross coupling induced by graded yaw rotation and periodic pitch-forward head movements in the sagittal plane. All subjects were then immersed in water at 18 degrees C for a maximum of 90 min or until their core temperature reached 35 degrees C. Double-blind randomized trials were administered, including a placebo, a non-immersion control with no drug, and six anti-motion sickness drugs: meclizine, dimenhydrinate, chlorpheniramine, promethazine + dexamphetamine, promethazine + caffeine, and scopolamine + dexamphetamine. A 7-d washout period was observed between trials. Core temperature and the severity of sickness were monitored throughout each trial. A repeated measures design was performed on the severity of sickness and core temperature changes prior to motion provocation, immediately after the motion sickness end point, and throughout the period of cold-water immersion. The most effective anti-motion sickness drugs, promethazine + dexamphetamine (with a sickness score/duration of 0.65 +/- 0.17) and scopolamine + dexamphetamine (with a sickness score/duration of 0.79 +/- 0.17), significantly attenuated the decrease in core temperature. The effect of this attenuation was lower in less effective drugs. Our results suggest that the two most effective anti-motion sickness drugs are also the most effective in attenuating the rate of core temperature decrease.

Active motions of Brownian particles in a generalized energy-depot model

International Nuclear Information System (INIS)

Zhang Yong; Koo Kim, Chul; Lee, Kong-Ju-Bock

2008-01-01

We present a generalized energy-depot model in which the rate of conversion of the internal energy into motion can be dependent on the position and velocity of a particle. When the conversion rate is a general function of the velocity, the active particle exhibits diverse patterns of motion, including a braking mechanism and a stepping motion. The phase trajectories of the motion are investigated in a systematic way. With a particular form of the conversion rate dependent on the position and velocity, the particle shows a spontaneous oscillation characterizing a negative stiffness. These types of active behaviors are compared with similar phenomena observed in biology, such as the stepping motion of molecular motors and amplification in the hearing mechanism. Hence, our model can provide a generic understanding of the active motion related to the energy conversion and also a new control mechanism for nano-robots. We also investigate the effect of noise, especially on the stepping motion, and observe random walk-like behavior as expected.

Changes in the Characteristics of Water-in-Oil-based High Internal ...

African Journals Online (AJOL)

Changes in the Characteristics of Water-in-Oil-based High Internal Phase Emulsion Containing Moringa Leaves Extract at Various Storage Conditions. ... Conclusion: Moringa HIPE showed stability and can be guided exclusively to protect skin against ultraviolet radiation-mediated oxidative damage. Keywords: Moringa ...

Effect of motion-induced PET-CT misalignment on cardiac function and myocardial blood flow measured using dynamic 15O-water PET

DEFF Research Database (Denmark)

Lubberink, Mark; Ebrahimi, M; Harms, Hans

-CT misalignment on MBF, transmural MBF (MBFt), perfusable tissue fraction (PTF), cardiac output (CO), stroke volume (SV) and left-ventricular ejection fraction (LVEF) based on dynamic 15O-water scans. Methods: 10 patients underwent 6 min PET scans after injection of 400 MBq 15O-water at rest and during adenosine......Aim: Motion-induced PET-CT misalignment artifacts are common in myocardial blood flow (MBF) measurements with 82Rb and 13N-ammonia. For 15O-water, MBF is based on the clearance rate rather than uptake of the tracer. The clearance rate is determined by the shape of the time-activity curve, not its...... amplitude, and is thus not affected by attenuation correction errors. Hence, misalignment is hypothesized not to affect 15O-water-based MBF to any large extent, but it may affect cardiac function measures derived from 15O-water scans. The aim of the present work was to assess the effect of PET...

The effect of dynamic femoroacetabular impingement on pubic symphysis motion: a cadaveric study.

Science.gov (United States)

Birmingham, Patrick M; Kelly, Bryan T; Jacobs, Robert; McGrady, Linda; Wang, Mei

2012-05-01

A link between femoroacetabular impingement and athletic pubalgia has been reported clinically. One proposed origin of athletic pubalgia is secondary to repetitive loading of the pubic symphysis, leading to instability and parasymphyseal tendon and ligament injury. Hypothesis/ The purpose of this study was to investigate the effect of simulated femoral-based femoroacetabular impingement on rotational motion at the pubic symphysis. The authors hypothesize that the presence of a cam lesion leads to increased relative symphyseal motion. Controlled laboratory study. Twelve hips from 6 fresh-frozen human cadaveric pelvises were used to simulate cam-type femoroacetabular impingement. The hips were held in a custom jig and maximally internally rotated at 90° of flexion and neutral adduction. Three-dimensional motion of the pubic symphysis was measured by a motion-tracking system for 2 states: native and simulated cam. Load-displacement plots were generated between the internal rotational torque applied to the hip and the responding motion in 3 anatomic planes of the pubic symphysis. As the hip was internally rotated, the motion at the pubic symphysis increased proportionally with the degrees of the rotation as well as the applied torque measured at the distal femur for both states. The primary rotation of the symphysis was in the transverse plane and on average accounted for more than 60% of the total rotation. This primary motion caused the anterior aspect of the symphyseal joint to open or widen, whereas the posterior aspect narrowed. At the torque level of 18.0 N·m, the mean transverse rotation in degrees was 0.89° ± 0.35° for the native state and 1.20° ± 0.41° for cam state. The difference between cam and the native groups was statistically significant (P pubalgia.

Dominant-limb range-of-motion and humeral-retrotorsion adaptation in collegiate baseball and softball position players.

Science.gov (United States)

Hibberd, Elizabeth E; Oyama, Sakiko; Tatman, Justin; Myers, Joseph B

2014-01-01

Biomechanically, the motions used by baseball and softball pitchers differ greatly; however, the throwing motions of position players in both sports are strikingly similar. Although the adaptations to the dominant limb from overhead throwing have been well documented in baseball athletes, these adaptations have not been clearly identified in softball players. This information is important in order to develop and implement injury-prevention programs specific to decreasing the risk of upper extremity injury in softball athletes. To compare range-of-motion and humeral-retrotorsion characteristics of collegiate baseball and softball position players and of baseball and softball players to sex-matched controls. Cross-sectional study. Research laboratories and athletic training rooms at the University of North Carolina at Chapel Hill. Fifty-three collegiate baseball players, 35 collegiate softball players, 25 male controls (nonoverhead athletes), and 19 female controls (nonoverhead athletes). Range of motion and humeral retrotorsion were measured using a digital inclinometer and diagnostic ultrasound. Glenohumeral internal-rotation deficit, external-rotation gain, total glenohumeral range of motion, and humeral retrotorsion. Baseball players had greater glenohumeral internal-rotation deficit, total-range-of-motion, and humeral-retrotorsion difference than softball players and male controls. There were no differences between glenohumeral internal-rotation deficit, total-range-of-motion, and humeral-retrotorsion difference in softball players and female controls. Few differences were evident between softball players and female control participants, although range-of-motion and humeral-retrotorsion adaptations were significantly different than baseball players. The throwing motions are similar between softball and baseball, but the athletes adapt to the demands of the sport differently; thus, stretching/strengthening programs designed for baseball may not be the most

TH-CD-207A-03: A Surface Deformation Driven Respiratory Model for Organ Motion Tracking in Lung Cancer Radiotherapy

International Nuclear Information System (INIS)

Chen, H; Zhen, X; Zhou, L; Gu, X

2016-01-01

Purpose: To propose and validate a novel real-time surface-mesh-based internal organ-external surface motion and deformation tracking method for lung cancer radiotherapy. Methods: Deformation vector fields (DVFs) which characterizes the internal and external motion are obtained by registering the internal organ and tumor contours and external surface meshes to a reference phase in the 4D CT images using a recent developed local topology preserved non-rigid point matching algorithm (TOP). A composite matrix is constructed by combing the estimated internal and external DVFs. Principle component analysis (PCA) is then applied on the composite matrix to extract principal motion characteristics and finally yield the respiratory motion model parameters which correlates the internal and external motion and deformation. The accuracy of the respiratory motion model is evaluated using a 4D NURBS-based cardiac-torso (NCAT) synthetic phantom and three lung cancer cases. The center of mass (COM) difference is used to measure the tumor motion tracking accuracy, and the Dice’s coefficient (DC), percent error (PE) and Housdourf’s distance (HD) are used to measure the agreement between the predicted and ground truth tumor shape. Results: The mean COM is 0.84±0.49mm and 0.50±0.47mm for the phantom and patient data respectively. The mean DC, PE and HD are 0.93±0.01, 0.13±0.03 and 1.24±0.34 voxels for the phantom, and 0.91±0.04, 0.17±0.07 and 3.93±2.12 voxels for the three lung cancer patients, respectively. Conclusions: We have proposed and validate a real-time surface-mesh-based organ motion and deformation tracking method with an internal-external motion modeling. The preliminary results conducted on a synthetic 4D NCAT phantom and 4D CT images from three lung cancer cases show that the proposed method is reliable and accurate in tracking both the tumor motion trajectory and deformation, which can serve as a potential tool for real-time organ motion and deformation

TH-CD-207A-03: A Surface Deformation Driven Respiratory Model for Organ Motion Tracking in Lung Cancer Radiotherapy

Energy Technology Data Exchange (ETDEWEB)

Chen, H; Zhen, X; Zhou, L [Southern Medical University, Guangzhou, Guangdong (China); Gu, X [UT Southwestern Medical Center, Dallas, TX (United States)

2016-06-15

Purpose: To propose and validate a novel real-time surface-mesh-based internal organ-external surface motion and deformation tracking method for lung cancer radiotherapy. Methods: Deformation vector fields (DVFs) which characterizes the internal and external motion are obtained by registering the internal organ and tumor contours and external surface meshes to a reference phase in the 4D CT images using a recent developed local topology preserved non-rigid point matching algorithm (TOP). A composite matrix is constructed by combing the estimated internal and external DVFs. Principle component analysis (PCA) is then applied on the composite matrix to extract principal motion characteristics and finally yield the respiratory motion model parameters which correlates the internal and external motion and deformation. The accuracy of the respiratory motion model is evaluated using a 4D NURBS-based cardiac-torso (NCAT) synthetic phantom and three lung cancer cases. The center of mass (COM) difference is used to measure the tumor motion tracking accuracy, and the Dice’s coefficient (DC), percent error (PE) and Housdourf’s distance (HD) are used to measure the agreement between the predicted and ground truth tumor shape. Results: The mean COM is 0.84±0.49mm and 0.50±0.47mm for the phantom and patient data respectively. The mean DC, PE and HD are 0.93±0.01, 0.13±0.03 and 1.24±0.34 voxels for the phantom, and 0.91±0.04, 0.17±0.07 and 3.93±2.12 voxels for the three lung cancer patients, respectively. Conclusions: We have proposed and validate a real-time surface-mesh-based organ motion and deformation tracking method with an internal-external motion modeling. The preliminary results conducted on a synthetic 4D NCAT phantom and 4D CT images from three lung cancer cases show that the proposed method is reliable and accurate in tracking both the tumor motion trajectory and deformation, which can serve as a potential tool for real-time organ motion and deformation

Motion of the esophagus due to cardiac motion.

Directory of Open Access Journals (Sweden)

Jacob Palmer

Full Text Available When imaging studies (e.g. CT are used to quantify morphological changes in an anatomical structure, it is necessary to understand the extent and source of motion which can give imaging artifacts (e.g. blurring or local distortion. The objective of this study was to assess the magnitude of esophageal motion due to cardiac motion. We used retrospective electrocardiogram-gated contrast-enhanced computed tomography angiography images for this study. The anatomic region from the carina to the bottom of the heart was taken at deep-inspiration breath hold with the patients' arms raised above their shoulders, in a position similar to that used for radiation therapy. The esophagus was delineated on the diastolic phase of cardiac motion, and deformable registration was used to sequentially deform the images in nearest-neighbor phases among the 10 cardiac phases, starting from the diastolic phase. Using the 10 deformation fields generated from the deformable registration, the magnitude of the extreme displacements was then calculated for each voxel, and the mean and maximum displacement was calculated for each computed tomography slice for each patient. The average maximum esophageal displacement due to cardiac motion for all patients was 5.8 mm (standard deviation: 1.6 mm, maximum: 10.0 mm in the transverse direction. For 21 of 26 patients, the largest esophageal motion was found in the inferior region of the heart; for the other patients, esophageal motion was approximately independent of superior-inferior position. The esophagus motion was larger at cardiac phases where the electrocardiogram R-wave occurs. In conclusion, the magnitude of esophageal motion near the heart due to cardiac motion is similar to that due to other sources of motion, including respiratory motion and intra-fraction motion. A larger cardiac motion will result into larger esophagus motion in a cardiac cycle.

TU-F-BRB-01: Resolving and Characterizing Breathing Motion for Radiotherapy with MRI

Energy Technology Data Exchange (ETDEWEB)

Tryggestad, E. [Mayo Clinic (United States)

2015-06-15

The current clinical standard of organ respiratory imaging, 4D-CT, is fundamentally limited by poor soft-tissue contrast and imaging dose. These limitations are potential barriers to beneficial “4D” radiotherapy methods which optimize the target and OAR dose-volume considering breathing motion but rely on a robust motion characterization. Conversely, MRI imparts no known radiation risk and has excellent soft-tissue contrast. MRI-based motion management is therefore highly desirable and holds great promise to improve radiotherapy of moving cancers, particularly in the abdomen. Over the past decade, MRI techniques have improved significantly, making MR-based motion management clinically feasible. For example, cine MRI has high temporal resolution up to 10 f/s and has been used to track and/or characterize tumor motion, study correlation between external and internal motions. New MR technologies, such as 4D-MRI and MRI hybrid treatment machines (i.e. MR-linac or MR-Co60), have been recently developed. These technologies can lead to more accurate target volume determination and more precise radiation dose delivery via direct tumor gating or tracking. Despite all these promises, great challenges exist and the achievable clinical benefit of MRI-based tumor motion management has yet to be fully explored, much less realized. In this proposal, we will review novel MR-based motion management methods and technologies, the state-of-the-art concerning MRI development and clinical application and the barriers to more widespread adoption. Learning Objectives: Discuss the need of MR-based motion management for improving patient care in radiotherapy. Understand MR techniques for motion imaging and tumor motion characterization. Understand the current state of the art and future steps for clinical integration. Henry Ford Health System holds research agreements with Philips Healthcare. Research sponsored in part by a Henry Ford Health System Internal Mentored Grant.

TU-F-BRB-01: Resolving and Characterizing Breathing Motion for Radiotherapy with MRI

International Nuclear Information System (INIS)

Tryggestad, E.

2015-01-01

The current clinical standard of organ respiratory imaging, 4D-CT, is fundamentally limited by poor soft-tissue contrast and imaging dose. These limitations are potential barriers to beneficial “4D” radiotherapy methods which optimize the target and OAR dose-volume considering breathing motion but rely on a robust motion characterization. Conversely, MRI imparts no known radiation risk and has excellent soft-tissue contrast. MRI-based motion management is therefore highly desirable and holds great promise to improve radiotherapy of moving cancers, particularly in the abdomen. Over the past decade, MRI techniques have improved significantly, making MR-based motion management clinically feasible. For example, cine MRI has high temporal resolution up to 10 f/s and has been used to track and/or characterize tumor motion, study correlation between external and internal motions. New MR technologies, such as 4D-MRI and MRI hybrid treatment machines (i.e. MR-linac or MR-Co60), have been recently developed. These technologies can lead to more accurate target volume determination and more precise radiation dose delivery via direct tumor gating or tracking. Despite all these promises, great challenges exist and the achievable clinical benefit of MRI-based tumor motion management has yet to be fully explored, much less realized. In this proposal, we will review novel MR-based motion management methods and technologies, the state-of-the-art concerning MRI development and clinical application and the barriers to more widespread adoption. Learning Objectives: Discuss the need of MR-based motion management for improving patient care in radiotherapy. Understand MR techniques for motion imaging and tumor motion characterization. Understand the current state of the art and future steps for clinical integration. Henry Ford Health System holds research agreements with Philips Healthcare. Research sponsored in part by a Henry Ford Health System Internal Mentored Grant

Evaluation of cardiac motion and function by cine magnetic resonance imaging

International Nuclear Information System (INIS)

Kondo, Takeshi; Kurokawa, Hiroshi; Anno, Hirofumi

1992-01-01

Cardiac cine magnetic resonance imaging (MRI) was studied to evaluate the cardiac motion and function, and a water-stream phantom study was performed to clarify whether it was possible to quantitatively assess the valvular regurgitation flow by the size of the flow void. In normal subjects, the left ventricular (LV) epicardial apex swung up to the base only a few millimeters, and the mitral annulus ring moved about 14 mm as mean value toward the apex during systole. Those motions of mitral annulus ring may contribute to the left atrial filling. The LV longitudinal shortening and torsions were shown by the tagging method. This tagging method was the best method for estimating cardiac motions. Cardiac cine MRI using software including a modified Simpson's method program and a wall motion analysis program was useful for routine LV volumetry and wall motion analysis because it was a simple and reliable method. Our water-stream phantom studies demonstrated that it might be difficult to perform quantitative evaluation of valvular regurgitation flow by using only the size of the flow void without acquiring information relating to the orifice area. (author)

Influence of Visual Motion, Suggestion, and Illusory Motion on Self-Motion Perception in the Horizontal Plane.

Science.gov (United States)

Rosenblatt, Steven David; Crane, Benjamin Thomas

2015-01-01

A moving visual field can induce the feeling of self-motion or vection. Illusory motion from static repeated asymmetric patterns creates a compelling visual motion stimulus, but it is unclear if such illusory motion can induce a feeling of self-motion or alter self-motion perception. In these experiments, human subjects reported the perceived direction of self-motion for sway translation and yaw rotation at the end of a period of viewing set visual stimuli coordinated with varying inertial stimuli. This tested the hypothesis that illusory visual motion would influence self-motion perception in the horizontal plane. Trials were arranged into 5 blocks based on stimulus type: moving star field with yaw rotation, moving star field with sway translation, illusory motion with yaw, illusory motion with sway, and static arrows with sway. Static arrows were used to evaluate the effect of cognitive suggestion on self-motion perception. Each trial had a control condition; the illusory motion controls were altered versions of the experimental image, which removed the illusory motion effect. For the moving visual stimulus, controls were carried out in a dark room. With the arrow visual stimulus, controls were a gray screen. In blocks containing a visual stimulus there was an 8s viewing interval with the inertial stimulus occurring over the final 1s. This allowed measurement of the visual illusion perception using objective methods. When no visual stimulus was present, only the 1s motion stimulus was presented. Eight women and five men (mean age 37) participated. To assess for a shift in self-motion perception, the effect of each visual stimulus on the self-motion stimulus (cm/s) at which subjects were equally likely to report motion in either direction was measured. Significant effects were seen for moving star fields for both translation (p = 0.001) and rotation (pperception was shifted in the direction consistent with the visual stimulus. Arrows had a small effect on self-motion

The Southern Proper Motion Program. IV. The SPM4 Catalog

Science.gov (United States)

Girard, Terrence M.; van Altena, William F.; Zacharias, Norbert; Vieira, Katherine; Casetti-Dinescu, Dana I.; Castillo, Danilo; Herrera, David; Lee, Young Sun; Beers, Timothy C.; Monet, David G.; López, Carlos E.

2011-07-01

We present the fourth installment of the Yale/San Juan Southern Proper Motion Catalog, SPM4. The SPM4 contains absolute proper motions, celestial coordinates, and B, V photometry for over 103 million stars and galaxies between the south celestial pole and -20° declination. The catalog is roughly complete to V = 17.5 and is based on photographic and CCD observations taken with the Yale Southern Observatory's double astrograph at Cesco Observatory in El Leoncito, Argentina. The proper-motion precision, for well-measured stars, is estimated to be 2-3 mas yr-1, depending on the type of second-epoch material. At the bright end, proper motions are on the International Celestial Reference System by way of Hipparcos Catalog stars, while the faint end is anchored to the inertial system using external galaxies. Systematic uncertainties in the absolute proper motions are on the order of 1 mas yr-1.

Basic philosophy of the safety design of the Toshiba boiling water reactor

International Nuclear Information System (INIS)

Sato, T.

1992-01-01

This paper discusses the safety design of the Toshiba Boiling Water Reactor (TOSBWR) which was created ∼8 years ago. The design concept is intermediate between conventional boiling water reactors (BWRs) and the advanced BWR (ABWR). It utilizes internal pumps and fine motion control rod drive, but the emergency core cooling system (ECCS) configuration is different from both conventional BWRs and the ABWR. The plant output is 1350 MW (electric). The design is based on two important philosophies: the positive cost reduction philosophy and the constant risk philosophy

Evaluation of feature detection algorithms for structure from motion

CSIR Research Space (South Africa)

Govender, N

2009-11-01

Full Text Available technique with an application to stereo vision,” in International Joint Conference on Artificial Intelligence, April 1981. [17] C.Tomasi and T.Kanade, “Detection and tracking of point fetaures,” Carnegie Mellon, Tech. Rep., April 1991. [18] P. Torr... Algorithms for Structure from Motion Natasha Govender Mobile Intelligent Autonomous Systems CSIR Pretoria Email: ngovender@csir.co.za Abstract—Structure from motion is a widely-used technique in computer vision to perform 3D reconstruction. The 3D...

Surface EMG signals based motion intent recognition using multi-layer ELM

Science.gov (United States)

Wang, Jianhui; Qi, Lin; Wang, Xiao

2017-11-01

The upper-limb rehabilitation robot is regard as a useful tool to help patients with hemiplegic to do repetitive exercise. The surface electromyography (sEMG) contains motion information as the electric signals are generated and related to nerve-muscle motion. These sEMG signals, representing human's intentions of active motions, are introduced into the rehabilitation robot system to recognize upper-limb movements. Traditionally, the feature extraction is an indispensable part of drawing significant information from original signals, which is a tedious task requiring rich and related experience. This paper employs a deep learning scheme to extract the internal features of the sEMG signals using an advanced Extreme Learning Machine based auto-encoder (ELMAE). The mathematical information contained in the multi-layer structure of the ELM-AE is used as the high-level representation of the internal features of the sEMG signals, and thus a simple ELM can post-process the extracted features, formulating the entire multi-layer ELM (ML-ELM) algorithm. The method is employed for the sEMG based neural intentions recognition afterwards. The case studies show the adopted deep learning algorithm (ELM-AE) is capable of yielding higher classification accuracy compared to the Principle Component Analysis (PCA) scheme in 5 different types of upper-limb motions. This indicates the effectiveness and the learning capability of the ML-ELM in such motion intent recognition applications.

Influence of Visual Motion, Suggestion, and Illusory Motion on Self-Motion Perception in the Horizontal Plane.

Directory of Open Access Journals (Sweden)

Steven David Rosenblatt

Full Text Available A moving visual field can induce the feeling of self-motion or vection. Illusory motion from static repeated asymmetric patterns creates a compelling visual motion stimulus, but it is unclear if such illusory motion can induce a feeling of self-motion or alter self-motion perception. In these experiments, human subjects reported the perceived direction of self-motion for sway translation and yaw rotation at the end of a period of viewing set visual stimuli coordinated with varying inertial stimuli. This tested the hypothesis that illusory visual motion would influence self-motion perception in the horizontal plane. Trials were arranged into 5 blocks based on stimulus type: moving star field with yaw rotation, moving star field with sway translation, illusory motion with yaw, illusory motion with sway, and static arrows with sway. Static arrows were used to evaluate the effect of cognitive suggestion on self-motion perception. Each trial had a control condition; the illusory motion controls were altered versions of the experimental image, which removed the illusory motion effect. For the moving visual stimulus, controls were carried out in a dark room. With the arrow visual stimulus, controls were a gray screen. In blocks containing a visual stimulus there was an 8s viewing interval with the inertial stimulus occurring over the final 1s. This allowed measurement of the visual illusion perception using objective methods. When no visual stimulus was present, only the 1s motion stimulus was presented. Eight women and five men (mean age 37 participated. To assess for a shift in self-motion perception, the effect of each visual stimulus on the self-motion stimulus (cm/s at which subjects were equally likely to report motion in either direction was measured. Significant effects were seen for moving star fields for both translation (p = 0.001 and rotation (p0.1 for both. Thus, although a true moving visual field can induce self-motion, results of this

Mathematical Model and Analysis of the Water-Lubricated Hydrostatic Journal Bearings considering the Translational and Tilting Motions

Directory of Open Access Journals (Sweden)

Hui-Hui Feng

2014-01-01

Full Text Available The water-lubricated bearings have been paid attention for their advantages to reduce the power loss and temperature rise and increase load capacity at high speed. To fully study the complete dynamic coefficients of two water-lubricated, hydrostatic journal bearings used to support a rigid rotor, a four-degree-of-freedom model considering the translational and tilting motion is presented. The effects of tilting ratio, rotary speed, and eccentricity ratio on the static and dynamic performances of the bearings are investigated. The bulk turbulent Reynolds equation is adopted. The finite difference method and a linear perturbation method are used to calculate the zeroth- and first-order pressure fields to obtain the static and dynamic coefficients. The results suggest that when the tilting ratio is smaller than 0.4 or the eccentricity ratio is smaller than 0.1, the static and dynamic characteristics are relatively insensitive to the tilting and eccentricity ratios; however, for larger tilting or eccentricity ratios, the tilting and eccentric effects should be fully considered. Meanwhile, the rotary speed significantly affects the performance of the hydrostatic, water-lubricated bearings.

Allocation of Internal Medicine Resident Time in a Swiss Hospital: A Time and Motion Study of Day and Evening Shifts.

Science.gov (United States)

Wenger, Nathalie; Méan, Marie; Castioni, Julien; Marques-Vidal, Pedro; Waeber, Gérard; Garnier, Antoine

2017-04-18

Little current evidence documents how internal medicine residents spend their time at work, particularly with regard to the proportions of time spent in direct patient care versus using computers. To describe how residents allocate their time during day and evening hospital shifts. Time and motion study. Internal medicine residency at a university hospital in Switzerland, May to July 2015. 36 internal medicine residents with an average of 29 months of postgraduate training. Trained observers recorded the residents' activities using a tablet-based application. Twenty-two activities were categorized as directly related to patients, indirectly related to patients, communication, academic, nonmedical tasks, and transition. In addition, the presence of a patient or colleague and use of a computer or telephone during each activity was recorded. Residents were observed for a total of 696.7 hours. Day shifts lasted 11.6 hours (1.6 hours more than scheduled). During these shifts, activities indirectly related to patients accounted for 52.4% of the time, and activities directly related to patients accounted for 28.0%. Residents spent an average of 1.7 hours with patients, 5.2 hours using computers, and 13 minutes doing both. Time spent using a computer was scattered throughout the day, with the heaviest use after 6:00 p.m. The study involved a small sample from 1 institution. At this Swiss teaching hospital, internal medicine residents spent more time at work than scheduled. Activities indirectly related to patients predominated, and about half the workday was spent using a computer. Information Technology Department and Department of Internal Medicine of Lausanne University Hospital.

Rotational Spectrum of the Methyl Salicylate-Water Complex: the Missing Conformer and the Tunneling Motions

Science.gov (United States)

Ghosh, Supriya; Thomas, Javix; Xu, Yunjie; Jäger, Wolfgang

2015-06-01

Methyl salicylate is a naturally occurring organic ester produced by wintergreen and other plants. It is also found in many over-the-counter remedies, such as muscle ache creams. The rotational spectrum of the methyl salicylate monomer was reported previously, where the most stable, dominant conformer was identified. The methyl salicylate-water complex was first studied using fluorescence-detected infrared spectroscopy; only one monohydrate conformer was found in that work. In the present study, we employed both broadband chirped and cavity based Fourier transform microwave spectroscopy to examine the competition between intra- and intermolecular hydrogen-bonding interactions and possible large amplitude motions associated with the methyl group and the water subunit. In contrast to the previous infrared study, two monohydrate conformers were identified, with carbonyl O or hydroxyl O as the hydrogen bond acceptors. Detailed analyses of the observed hyperfine structures will be presented, as well as our efforts to extend the study to larger methyl salicylate hydration clusters. S. Melandri, B. M. Giuliano, A. Maris, L. B. Favero, P. Ottaviani, B. Velino, W. Caminati, J. Phys. Chem. A. 2007, 111, 9076. A. Mitsuzuka, A. Fujii, T. Ebata, N. Mikami, J. Phys. Chem. A 1998, 102, 9779.

IGS polar motion measurement accuracy

Directory of Open Access Journals (Sweden)

Jim Ray

2017-11-01

Full Text Available We elaborate an error budget for the long-term accuracy of IGS (International Global Navigation Satellite System Service polar motion estimates, concluding that it is probably about 25–30 μas (1-sigma overall, although it is not possible to quantify possible contributions (mainly annual that might transfer directly from aliases of subdaily rotational tide errors. The leading sources are biases arising from the need to align daily, observed terrestrial frames, within which the pole coordinates are expressed and which are continuously deforming, to the secular, linear international reference frame. Such biases are largest over spans longer than about a year. Thanks to the very large number of IGS tracking stations, the formal covariance errors are much smaller, around 5 to 10 μas. Large networks also permit the systematic frame-related errors to be more effectively minimized but not eliminated. A number of periodic errors probably also influence polar motion results, mainly at annual, GPS (Global Positioning System draconitic, and fortnightly periods, but their impact on the overall error budget is unlikely to be significant except possibly for annual tidal aliases. Nevertheless, caution should be exercised in interpreting geophysical excitations near any of the suspect periods.

Ice crystallization in ultrafine water-salt aerosols: nucleation, ice-solution equilibrium, and internal structure.

Science.gov (United States)

Hudait, Arpa; Molinero, Valeria

2014-06-04

Atmospheric aerosols have a strong influence on Earth's climate. Elucidating the physical state and internal structure of atmospheric aqueous aerosols is essential to predict their gas and water uptake, and the locus and rate of atmospherically important heterogeneous reactions. Ultrafine aerosols with sizes between 3 and 15 nm have been detected in large numbers in the troposphere and tropopause. Nanoscopic aerosols arising from bubble bursting of natural and artificial seawater have been identified in laboratory and field experiments. The internal structure and phase state of these aerosols, however, cannot yet be determined in experiments. Here we use molecular simulations to investigate the phase behavior and internal structure of liquid, vitrified, and crystallized water-salt ultrafine aerosols with radii from 2.5 to 9.5 nm and with up to 10% moles of ions. We find that both ice crystallization and vitrification of the nanodroplets lead to demixing of pure water from the solutions. Vitrification of aqueous nanodroplets yields nanodomains of pure low-density amorphous ice in coexistence with vitrified solute rich aqueous glass. The melting temperature of ice in the aerosols decreases monotonically with an increase of solute fraction and decrease of radius. The simulations reveal that nucleation of ice occurs homogeneously at the subsurface of the water-salt nanoparticles. Subsequent ice growth yields phase-segregated, internally mixed, aerosols with two phases in equilibrium: a concentrated water-salt amorphous mixture and a spherical cap-like ice nanophase. The surface of the crystallized aerosols is heterogeneous, with ice and solution exposed to the vapor. Free energy calculations indicate that as the concentration of salt in the particles, the advance of the crystallization, or the size of the particles increase, the stability of the spherical cap structure increases with respect to the alternative structure in which a core of ice is fully surrounded by

Human Perception of Ambiguous Inertial Motion Cues

Science.gov (United States)

Zhang, Guan-Lu

2010-01-01

Human daily activities on Earth involve motions that elicit both tilt and translation components of the head (i.e. gazing and locomotion). With otolith cues alone, tilt and translation can be ambiguous since both motions can potentially displace the otolithic membrane by the same magnitude and direction. Transitions between gravity environments (i.e. Earth, microgravity and lunar) have demonstrated to alter the functions of the vestibular system and exacerbate the ambiguity between tilt and translational motion cues. Symptoms of motion sickness and spatial disorientation can impair human performances during critical mission phases. Specifically, Space Shuttle landing records show that particular cases of tilt-translation illusions have impaired the performance of seasoned commanders. This sensorimotor condition is one of many operational risks that may have dire implications on future human space exploration missions. The neural strategy with which the human central nervous system distinguishes ambiguous inertial motion cues remains the subject of intense research. A prevailing theory in the neuroscience field proposes that the human brain is able to formulate a neural internal model of ambiguous motion cues such that tilt and translation components can be perceptually decomposed in order to elicit the appropriate bodily response. The present work uses this theory, known as the GIF resolution hypothesis, as the framework for experimental hypothesis. Specifically, two novel motion paradigms are employed to validate the neural capacity of ambiguous inertial motion decomposition in ground-based human subjects. The experimental setup involves the Tilt-Translation Sled at Neuroscience Laboratory of NASA JSC. This two degree-of-freedom motion system is able to tilt subjects in the pitch plane and translate the subject along the fore-aft axis. Perception data will be gathered through subject verbal reports. Preliminary analysis of perceptual data does not indicate that

Descriptive profile of hip rotation range of motion in elite tennis players and professional baseball pitchers.

Science.gov (United States)

Ellenbecker, Todd S; Ellenbecker, Gail A; Roetert, E Paul; Silva, Rogerio Teixeira; Keuter, Greg; Sperling, Fabio

2007-08-01

Repetitive loading to the hip joint in athletes has been reported as a factor in the development of degenerative joint disease and intra-articular injury. Little information is available on the bilateral symmetry of hip rotational measures in unilaterally dominant upper extremity athletes. Side-to-side differences in hip joint range of motion may be present because of asymmetrical loading in the lower extremities of elite tennis players and professional baseball pitchers. Cohort (cross-sectional) study (prevalence); Level of evidence, 1. Descriptive measures of hip internal and external rotation active range of motion were taken in the prone position of 64 male and 83 female elite tennis players and 101 male professional baseball pitchers using digital photos and computerized angle calculation software. Bilateral differences in active range of motion between the dominant and nondominant hip were compared using paired t tests and Bonferroni correction for hip internal, external, and total rotation range of motion. A Pearson correlation test was used to test the relationship between years of competition and hip rotation active range of motion. No significant bilateral difference (P > .005) was measured for mean hip internal or external rotation for the elite tennis players or the professional baseball pitchers. An analysis of the number of subjects in each group with a bilateral difference in hip rotation greater than 10 degrees identified 17% of the professional baseball pitchers with internal rotation differences and 42% with external rotation differences. Differences in the elite male tennis players occurred in only 15% of the players for internal rotation and 9% in external rotation. Female subjects had differences in 8% and 12% of the players for internal and external rotation, respectively. Statistical differences were found between the mean total arc of hip range of internal and external rotation in the elite tennis players with the dominant side being greater

Automatic online and real-time tumour motion monitoring during stereotactic liver treatments on a conventional linac by combined optical and sparse monoscopic imaging with kilovoltage x-rays (COSMIK)

DEFF Research Database (Denmark)

Bertholet, Jenny; Toftegaard, Jakob; Hansen, Rune

2018-01-01

during the CBCT is estimated from the auto-segmented positions in the projections and used to optimize an external correlation model (ECM) of internal motion as a function of external motion. During treatment, the ECM estimates the internal motion from the external motion at 20 Hz. KV images are acquired...... every 3 s, auto-segmented, and used to update the ECM for baseline shifts between internal and external motion. The COSMIK method was validated using Calypso-recorded internal tumour motion with simultaneous camera-recorded external motion for 15 liver stereotactic body radiotherapy (SBRT) patients....... The validation included phantom experiments and simulations hereof for 12 fractions and further simulations for 42 fractions. The simulations compared the accuracy of COSMIK with ECM-based monitoring without model updates and with model updates based on stereoscopic imaging as well as continuous kilovoltage...

19 CFR 210.52 - Motions for temporary relief.

Science.gov (United States)

2010-04-01

....52 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Temporary Relief § 210.52 Motions for temporary relief... issuance of temporary relief, the Commission will be guided by practice under Rule 65 of the Federal Rules...

Prediction of Critical Heat Flux under Rolling Motion

Energy Technology Data Exchange (ETDEWEB)

Hwang, Jinseok; Lee, Yeongun; Park, Gooncherl [Seoul National Univ., Seoul (Korea, Republic of)

2013-05-15

The aim to this paper may be summarized as follows: identify the flow regime compare with existing void-quality relationship and void fraction at OAF derived from the vapor superficial velocity obtained by the churn-to annular flow criterion, develop and evaluate the correlation for accurate prediction of CHF ratio under rolling motion. Experimentally measured CHF results from the previous study were not well-predicted by existing CHF correlations developed for wide range of pressure under rolling motion in vertical tube. Specifically, existing correlations do not account for the dynamic motion parameter, such as tangential and centrifugal force. This study reviewed some existing correlation and experimental studies related to reduction and enhancement of CHF and heat transfer and flow behavior under heaving and rolling motion, and developed a CHF ratio correlation for upward flow vertical tube under rolling motion. Based upon dimensionless groups, equations and interpolation factor, an empirical CHF correlation has been developed which is consistent with experimental data for uniformly heated tubes internally cooled by R-134 under rolling motion. Flow regime was determined through the prediction method for annular flow. Non-dimensional number and function were decided by CHF mechanism of each region. Interaction of LFD and DNB regions is taken into account by means of power interpolation which is reflected void fraction at OAF. The suggested correlation predicted the CHF Ratio with reasonable accuracy, showing an average error of -0.59 and 2.51% for RMS. Rolling motion can affect bubble motion and liquid film behavior complexly by combination of tangential and centrifugal forces and mass flow than heaving motion. Through a search of literature and a comparison of previous CHF ratio results, this work can contribute to the study of boiling heat transfer and CHF for the purpose of enhancement or reduction the CHF of dynamic motion system, such as marine reactor.

Cross-shelf transport into nearshore waters due to shoaling internal tides in San Pedro Bay, CA

Science.gov (United States)

Noble, Marlene A.; Burt Jones,; Peter Hamilton,; Xu, Jingping; George Robertson,; Rosenfeld, Leslie; John Largier,

2009-01-01

In the summer of 2001, a coastal ocean measurement program in the southeastern portion of San Pedro Bay, CA, was designed and carried out. One aim of the program was to determine the strength and effectiveness of local cross-shelf transport processes. A particular objective was to assess the ability of semidiurnal internal tidal currents to move suspended material a net distance across the shelf. Hence, a dense array of moorings was deployed across the shelf to monitor the transport patterns associated with fluctuations in currents, temperature and salinity. An associated hydrographic program periodically monitored synoptic changes in the spatial patterns of temperature, salinity, nutrients and bacteria. This set of measurements show that a series of energetic internal tides can, but do not always, transport subthermocline water, dissolved and suspended material from the middle of the shelf into the surfzone. Effective cross-shelf transport occurs only when (1) internal tides at the shelf break are strong and (2) subtidal currents flow strongly downcoast. The subtidal downcoast flow causes isotherms to tilt upward toward the coast, which allows energetic, nonlinear internal tidal currents to carry subthermocline waters into the surfzone. During these events, which may last for several days, the transported water remains in the surfzone until the internal tidal current pulses and/or the downcoast subtidal currents disappear. This nonlinear internal tide cross-shelf transport process was capable of carrying water and the associated suspended or dissolved material from the mid-shelf into the surfzone, but there were no observation of transport from the shelf break into the surfzone. Dissolved nutrients and suspended particulates (such as phytoplankton) transported from the mid-shelf into the nearshore region by nonlinear internal tides may contribute to nearshore algal blooms, including harmful algal blooms that occur off local beaches.

Cooperation at different scales: challenges for local and international water resource governance in South Africa

CSIR Research Space (South Africa)

Mirumachi, N

2010-03-01

Full Text Available . This paper examines how the cooperative principle has influenced stakeholder interaction at the local and international scales of water governance in South Africa. Water policies and initiatives have been set up to promote multi-level governance...

The Cross-fertilization between the Sustainable Development Goals and International Water Law

NARCIS (Netherlands)

Spijkers, O.

2016-01-01

Are the main principles of international water law, as reflected in the Watercourses Convention, sufficiently equipped to motivate States to sustainably manage their freshwater resources? This article suggests that a more pronounced sustainable approach to these principles is desirable. The

The Role of Motion Concepts in Understanding Non-Motion Concepts

Directory of Open Access Journals (Sweden)

Omid Khatin-Zadeh

2017-12-01

Full Text Available This article discusses a specific type of metaphor in which an abstract non-motion domain is described in terms of a motion event. Abstract non-motion domains are inherently different from concrete motion domains. However, motion domains are used to describe abstract non-motion domains in many metaphors. Three main reasons are suggested for the suitability of motion events in such metaphorical descriptions. Firstly, motion events usually have high degrees of concreteness. Secondly, motion events are highly imageable. Thirdly, components of any motion event can be imagined almost simultaneously within a three-dimensional space. These three characteristics make motion events suitable domains for describing abstract non-motion domains, and facilitate the process of online comprehension throughout language processing. Extending the main point into the field of mathematics, this article discusses the process of transforming abstract mathematical problems into imageable geometric representations within the three-dimensional space. This strategy is widely used by mathematicians to solve highly abstract and complex problems.

Low internal pressure in femtoliter water capillary bridges reduces evaporation rates.

Science.gov (United States)

Cho, Kun; Hwang, In Gyu; Kim, Yeseul; Lim, Su Jin; Lim, Jun; Kim, Joon Heon; Gim, Bopil; Weon, Byung Mook

2016-03-01

Capillary bridges are usually formed by a small liquid volume in a confined space between two solid surfaces. They can have a lower internal pressure than the surrounding pressure for volumes of the order of femtoliters. Femtoliter capillary bridges with relatively rapid evaporation rates are difficult to explore experimentally. To understand in detail the evaporation of femtoliter capillary bridges, we present a feasible experimental method to directly visualize how water bridges evaporate between a microsphere and a flat substrate in still air using transmission X-ray microscopy. Precise measurements of evaporation rates for water bridges show that lower water pressure than surrounding pressure can significantly decrease evaporation through the suppression of vapor diffusion. This finding provides insight into the evaporation of ultrasmall capillary bridges.

Low internal pressure in femtoliter water capillary bridges reduces evaporation rates

Science.gov (United States)

Cho, Kun; Hwang, In Gyu; Kim, Yeseul; Lim, Su Jin; Lim, Jun; Kim, Joon Heon; Gim, Bopil; Weon, Byung Mook

2016-01-01

Capillary bridges are usually formed by a small liquid volume in a confined space between two solid surfaces. They can have a lower internal pressure than the surrounding pressure for volumes of the order of femtoliters. Femtoliter capillary bridges with relatively rapid evaporation rates are difficult to explore experimentally. To understand in detail the evaporation of femtoliter capillary bridges, we present a feasible experimental method to directly visualize how water bridges evaporate between a microsphere and a flat substrate in still air using transmission X-ray microscopy. Precise measurements of evaporation rates for water bridges show that lower water pressure than surrounding pressure can significantly decrease evaporation through the suppression of vapor diffusion. This finding provides insight into the evaporation of ultrasmall capillary bridges. PMID:26928329

CRDM motion analysis using machine learning technique

International Nuclear Information System (INIS)

Nishimura, Takuya; Nakayama, Hiroyuki; Saitoh, Mayumi; Yaguchi, Seiji

2017-01-01

Magnetic jack type Control Rod Drive Mechanism (CRDM) for pressurized water reactor (PWR) plant operates control rods in response to electrical signals from a reactor control system. CRDM operability is evaluated by quantifying armature's response of closed/opened time which means interval time between coil energizing/de-energizing points and armature closed/opened points. MHI has already developed an automatic CRDM motion analysis and applied it to actual plants so far. However, CRDM operational data has wide variation depending on their characteristics such as plant condition, plant, etc. In the existing motion analysis, there is an issue of analysis accuracy for applying a single analysis technique to all plant conditions, plants, etc. In this study, MHI investigated motion analysis using machine learning (Random Forests) which is flexibly accommodated to CRDM operational data with wide variation, and is improved analysis accuracy. (author)

Aging considerations for PWR [pressurized water reactor] control rod drive mechanisms and reactor internals

International Nuclear Information System (INIS)

Ware, A.G.

1988-01-01

This paper describes age-related degradation mechanisms affecting life extension of pressurized water reactor control rod drive mechanisms and reactor internals. The major sources of age-related degradation for control rod drive mechanisms are thermal transients such as plant heatups and cooldowns, latchings and unlatchings, long-term aging effects on electrical insulation, and the high temperature corrosive environment. Flow induced loads, the high-temperature corrosive environment, radiation exposure, and high tensile stresses in bolts all contribute to aging related degradation of reactor internals. Another problem has been wear and fretting of instrument guide tubes. The paper also discusses age-related failures that have occurred to date in pressurized water reactors

Effects of five hindfoot arthrodeses on foot and ankle motion: Measurements in cadaver specimens

Science.gov (United States)

Zhang, Kun; Chen, Yanxi; Qiang, Minfei; Hao, Yini

2016-01-01

Single, double, and triple hindfoot arthrodeses are used to correct hindfoot deformities and relieve chronic pain. However, joint fusion may lead to dysfunction in adjacent articular surfaces. We compared range of motion in adjacent joints before and after arthrodesis to determine the effects of each procedure on joint motion. The theory of moment of couple, bending moment and balanced loading was applied to each of 16 fresh cadaver feet to induce dorsiflexion, plantarflexion, internal rotation, external rotation, inversion, and eversion. Range of motion was measured with a 3-axis coordinate measuring machine in a control foot and in feet after subtalar, talonavicular, calcaneocuboid, double, or triple arthrodesis. All arthrodeses restricted mainly internal-external rotation and inversion-eversion. The restriction in a double arthrodesis was more than that in a single arthrodesis, but that in a calcaneocuboid arthrodesis was relatively low. After triple arthrodeses, the restriction on dorsiflexion and plantarflexion movements was substantial, and internal-external rotation and inversion-eversion were almost lost. Considering that different arthrodesis procedures cause complex, three-dimensional hindfoot motion reductions, we recommend talonavicular or calcaneocuboid arthrodesis for patients with well-preserved functions of plantarflexion/dorsiflexion before operation, subtalar or calcaneocuboid arthrodesis for patients with well-preserved abduction/adduction, and talonavicular arthrodesis for patients with well-preserved eversion/inversion. PMID:27752084

Diagram of the Water Recovery and Management for the International Space Station

Science.gov (United States)

2000-01-01

This diagram shows the flow of water recovery and management in the International Space Station (ISS). The Environmental Control and Life Support System (ECLSS) Group of the Flight Projects Directorate at the Marshall Space Flight Center is responsible for the regenerative ECLSS hardware, as well as providing technical support for the rest of the system. The regenerative ECLSS, whose main components are the Water Recovery System (WRS), and the Oxygen Generation System (OGS), reclaims and recycles water oxygen. The ECLSS maintains a pressurized habitation environment, provides water recovery and storage, maintains and provides fire detection/ suppression, and provides breathable air and a comfortable atmosphere in which to live and work within the ISS. The ECLSS hardware will be located in the Node 3 module of the ISS.

Multiple scattering of light by water cloud droplets with external and internal mixing of black carbon aerosols

International Nuclear Information System (INIS)

Wang Hai-Hua; Sun Xian-Ming

2012-01-01

The mixture of water cloud droplets with black carbon impurities is modeled by external and internal mixing models. The internal mixing model is modeled with a two-layered sphere (water cloud droplets containing black carbon (BC) inclusions), and the single scattering and absorption characteristics are calculated at the visible wavelength of 0.55 μm by using the Lorenz—Mie theory. The external mixing model is developed assuming that the same amount of BC particles are mixed with the water droplets externally. The multiple scattering characteristics are computed by using the Monte Carlo method. The results show that when the size of the BC aerosol is small, the reflection intensity of the internal mixing model is bigger than that of the external mixing model. However, if the size of the BC aerosol is big, the absorption of the internal mixing model will be larger than that of the external mixing model. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

Coordinated Resolved Motion Control of Dual-Arm Manipulators with Closed Chain

Directory of Open Access Journals (Sweden)

Tianliang Liu

2016-05-01

Full Text Available When applied to some tasks, such as payload handling, assembling, repairing and so on, the two arms of a humanoid robot will form a closed kinematic chain. It makes the motion planning and control for dual-arm coordination very complex and difficult. In this paper, we present three types of resolved motion control methods for a humanoid robot during coordinated manipulation. They are, respectively, position-level, velocity-level and acceleration-level resolved motion control methods. The desired pose, velocity and acceleration of each end-effector are then resolved according to the desired motion of the payload and the constraints on the closed-chain system without consideration of the internal force. Corresponding to the three cases above, the joint variables of each arm are then calculated using the inverse kinematic equations, at position-level, velocity-level or acceleration-level. Finally, a dynamic modelling and simulation platform is established based on ADAMS and Matlab software. The proposed methods are verified by typical cases. The simulation results show that the proposed control strategy can realize the dual-arm coordinated operation and the internal force of the closed chain during the operation is controlled in a reasonable range at the same time.

Pressure control of a proton beam-irradiated water target through an internal flow channel-induced thermosyphon.

Science.gov (United States)

Hong, Bong Hwan; Jung, In Su

2017-07-01

A water target was designed to enhance cooling efficiency using a thermosyphon, which is a system that uses natural convection to induce heat exchange. Two water targets were fabricated: a square target without any flow channel and a target with a flow channel design to induce a thermosyphon mechanism. These two targets had the same internal volume of 8 ml. First, visualization experiments were performed to observe the internal flow by natural convection. Subsequently, an experiment was conducted to compare the cooling performance of both water targets by measuring the temperature and pressure. A 30-MeV proton beam with a beam current of 20 μA was used to irradiate both targets. Consequently, the target with an internal flow channel had a lower mean temperature and a 50% pressure drop compared to the target without a flow channel during proton beam irradiation. Copyright © 2017 Elsevier Ltd. All rights reserved.

Effects of temperature gradient induced nanoparticle motion on conduction and convection of fluid

International Nuclear Information System (INIS)

Zhou Leping; Peterson, George P.; Yoda, Minani; Wang Buxuan

2012-01-01

The role of temperature gradient induced nanoparticle motion on conduction and convection was investigated. Possible mechanisms for variations resulting from variations in the thermophysical properties are theoretically and experimentally discussed. The effect of the nanoparticle motion on conduction is demonstrated through thermal conductivity measurement of deionized water with suspended CuO nanoparticles (50 nm in diameter) and correlated with the contributions of Brownian diffusion, thermophoresis, etc. The tendencies observed is that the magnitude of and the variation in the thermal conductivity increases with increasing volume fraction for a given temperature, which is due primarily to the Brownian diffusion of the nanoparticles. Using dimensional analysis, the thermal conductivity is correlated and both the interfacial thermal resistance and near-field radiation are found to be essentially negligible. A modification term that incorporates the contributions of Brownian motion and thermophoresis is proposed. The effect of nanoscale convection is illustrated through an experimental investigation that utilized fluorescent polystyrene nanoparticle tracers (200 nm in diameter) and multilayer nanoparticle image velocimetry. The results indicate that both the magnitude and the deviation of the fluid motion increased with increasing heat flux in the near-wall region. Meanwhile, the fluid motion tended to decrease with the off-wall distance for a given heating power. A corresponding numerical study of convection of pure deionized water shows that the velocity along the off-wall direction is several orders of magnitude lower than that of deionized water, which indicates that Brownian motion in the near-wall region is crucial for fluid with suspended nanoparticles in convection.

Internal conversion mediated by specific nuclear motions

DEFF Research Database (Denmark)

Klein, Liv Bærenholdt; Sølling, Theis Ivan

2014-01-01

the excitation energies, and the excitation in all cases is by a 200 nm photon, the S1 density-of-states in the Franck-Condon region will be high for the more N-alkylated amine. This, according to standard models, should lead to faster internal conversion. The experimental results are in contrast to this...

International symposium on isotope hydrology and integrated water resources management. Book of extended synopses

Energy Technology Data Exchange (ETDEWEB)

NONE

2003-07-01

Scarcity of freshwater, degradation of its quality, and increasing demand has motivated ongoing concern in the international community for more effective utilization of freshwater resources. The IAEA's symposia on the use of isotope techniques in water resources development and management have become a recurrent event held every four years. They have provided an international forum for a comprehensive review of the present state-of-the-art and recent advances made in this specific field as well as a basis for delineation of further research and development needs. The year 2003 marks the 40th anniversary of the first IAEA water resources symposium. Increasing use of isotope techniques over the past four decades, in part due to efforts of IAEA, has enhanced availability and effective use of isotopes to address water resources management issues. The Symposium covers a multi-disciplinary spectrum of research and applications of isotope techniques. The participation of isotope specialists, hydrologists, hydrogeologists, geochemists, environmental scientists and water managers is welcomed. The Organizers further encourage the participation and contribution of graduate students in these fields. The major areas covered include: Water cycle processes in the atmosphere and hydrosphere, including surface water, groundwater, and watershed-based studies, age dating of young groundwaters, water, carbon and nutrient cycling processes at the land-ocean-atmosphere interface, recent advances in analytical techniques for isotope hydrology and field applications of isotopes in groundwater or surface water resources management. This book of synopses covers oral presentations and poster sessions.

Evaluation of tumor motion effect in canine model for diagnostic and radiotherapy

Energy Technology Data Exchange (ETDEWEB)

Woo, Sangkeun; Nam, Taewon; Kim, Kyeongmin [Molecular Imaging Research Center, Seoul (Korea, Republic of); Park, Seungwoo; Han, Suchul; Ji, Younghoon [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of); Park, Nohwon; Eom, Kidong [Konkuk Univ., Seoul (Korea, Republic of)

2013-05-15

The internal organs move up to 35mm maximum and it provides information and uncertainty that has been distorted in the diagnosis and treatment. Previous most studies for the effect of respiration have been performed with external monitoring systems but it cannot represent internal organ motion such as liver, pancreas, and lung. Positron emission tomography (PET) is more influenced by motion than computed tomography (CT) and magnetic resonance imaging (MRI) since measurement time for image acquisition is longer than CT and MRI. Thus, count of tumor is to be underestimated and region of tumor is to be overestimated. The first aim of this study was developing the artificial pulmonary nodule which can be performed non-invasive transplant into thorax of dogs and second is to assess the effect of respiratory motion on PET image with evaluating the applicability of the artificial model using dogs for diagnosis and treatment. The developed artificial pulmonary nodule showed reproducibility and motion effect as respiratory cycle and it was verified in PET images. Radiation dose estimated was not changed and was reduced slightly of 10 rpm and 15 rpm, respectively, in both of glass dosimeter and ion chamber. The developed artificial pulmonary nodule will be useful tool for evaluating respiratory motion and better research performance for diagnosis and treatment will be expected with performing simulated experiment using the nodule conducted in this study.

Near-Field Ground Motion Modal versus Wave Propagation Analysis

Directory of Open Access Journals (Sweden)

Artur Cichowicz

2010-01-01

Full Text Available The response spectrum generally provides a good estimate of the global displacement and acceleration demand of far-field ground motion on a structure. However, it does not provide accurate information on the local shape or internal deformation of the response of the structure. Near-field pulse-like ground motion will propagate through the structure as waves, causing large, localized deformation. Therefore, the response spectrum alone is not a sufficient representation of near-field ground motion features. Results show that the drift-response technique based on a continuous shear-beam model has to be employed here to estimate structure-demand parameters when structure is exposed to the pulse like ground motion. Conduced modeling shows limited applicability of the drift spectrum based on the SDOF approximation. The SDOF drift spectrum approximation can only be applied to structures with smaller natural periods than the dominant period of the ground motion. For periods larger than the dominant period of ground motion the SDOF drift spectra model significantly underestimates maximum deformation. Strong pulse-type motions are observed in the near-source region of large earthquakes; however, there is a lack of waveforms collected from small earthquakes at very close distances that were recorded underground in mines. The results presented in this paper are relevant for structures with a height of a few meters, placed in an underground excavation. The strong ground motion sensors recorded mine-induced earthquakes in a deep gold mine, South Africa. The strongest monitored horizontal ground motion was caused by an event of magnitude 2 at a distance of 90 m with PGA 123 m/s2, causing drifts of 0.25%–0.35%. The weak underground motion has spectral characteristics similar to the strong ground motion observed on the earth's surface; the drift spectrum has a maximum value less than 0.02%.

International symposium and field seminar on karst waters and environmental impacts. Abstracts

Energy Technology Data Exchange (ETDEWEB)

Gunay, G; Tezcan, L; Atilla, A O [comps.

1996-12-31

The international symposium and field seminar on karst waters and environmental impacts was held on 10-20 September 1995 in Beldibi,Antalya, Turkey. The specialists discussed COST Action 65, Environmental Impact sand Legal Aspects, Engineering and Environmental Impacts of Karst, Research Methods, Tracing Techniques, Hydro chemistry, Environmental Isotopes in Karst, Transport Processing, Modeling and Flow Systems, Karst Morphology and Paleoenvironment, Regional Karst Systems, James F. Quinlay Pollution Control and Karst Water Protection Session and Hydrology. Almost 140 papers were presented in the meeting.

International symposium and field seminar on karst waters and environmental impacts. Abstracts

International Nuclear Information System (INIS)

Gunay, G.; Tezcan, L.; Atilla, A.O.

1995-01-01

The international symposium and field seminar on karst waters and environmental impacts was held on 10-20 September 1995 in Beldibi,Antalya, Turkey. The specialists discussed COST Action 65, Environmental Impact sand Legal Aspects, Engineering and Environmental Impacts of Karst, Research Methods, Tracing Techniques, Hydro chemistry, Environmental Isotopes in Karst, Transport Processing, Modeling and Flow Systems, Karst Morphology and Paleoenvironment, Regional Karst Systems, James F. Quinlay Pollution Control and Karst Water Protection Session and Hydrology. Almost 140 papers were presented in the meeting

Experimental motion behavior of submerged fuel racks

International Nuclear Information System (INIS)

Ellingson, F.J.; Wachter, W.; Moscardini, R.L.

1989-01-01

The design of submerged nuclear storage racks for light water reactor nuclear fuel has undergone a change from fixed position to a free-standing arrangement. Seismic analysis of the motion of the free-standing racks requires three-dimensional computer modeling that uses past studies of hydrodynamic mass and hydraulic coupling for rigid flat plates. This paper describes the results of experiments that show a reduced value for hydrodynamic mass and coupling forces when flexible elements are involved. To support this work, experiments were run with two full-scale welded box sections submerged in a water tank. The preliminary results indicate reduction in hydrodynamic mass due to box wall flexibility, a lack of impacting of box wall to box wall over the entire frequency range, and large hydrodynamic coupling forces under all test conditions. It is hypothesized that the coupling forces are sufficiently strong to prevent rotational motion of one rack when surrounded by adjacent racks

Gravitational attraction until relativistic equipartition of internal and translational kinetic energies

Science.gov (United States)

Bulyzhenkov, I. E.

2018-02-01

Translational ordering of the internal kinematic chaos provides the Special Relativity referents for the geodesic motion of warm thermodynamical bodies. Taking identical mathematics, relativistic physics of the low speed transport of time-varying heat-energies differs from Newton's physics of steady masses without internal degrees of freedom. General Relativity predicts geodesic changes of the internal heat-energy variable under the free gravitational fall and the geodesic turn in the radial field center. Internal heat variations enable cyclic dynamics of decelerated falls and accelerated takeoffs of inertial matter and its structural self-organization. The coordinate speed of the ordered spatial motion takes maximum under the equipartition of relativistic internal and translational kinetic energies. Observable predictions are discussed for verification/falsification of the principle of equipartition as a new basic for the ordered motion and self-organization in external fields, including gravitational, electromagnetic, and thermal ones.

Multi-frequency response of a cylinder subjected to vortex shedding and support motions

Energy Technology Data Exchange (ETDEWEB)

Vikestad, Kyrre

1998-12-31

This thesis deals with an experimental investigation of vortex induced vibrations of a circular cylinder. The purpose of the experiment was to identify the influence from a controlled disturbance of the cylinder motions on the response caused by vortex shedding. The cylinder investigated is 2 m long and the diameter is 10 cm. The cylinder is elastically mounted in an apparatus using springs, where the foundation of one of the springs can have a harmonic motion. The apparatus is placed on a carriage in a 25 m long towing tank. Towing velocities are varied between 0.140 m/s and 0.655 m/s corresponding to reduced velocity range from 2.8 to 13.2. The still water natural frequency is 0.497 Hz, and the natural frequency in air is 0.634 Hz. The cylinder is only able to oscillate in the cross-flow direction. The support motion frequency was varied between 0.26 Hz and 1.01 Hz, and the force motion amplitude was varied using 2, 4 and 6 cm support amplitudes. Three sets of experiments were carried out: (1) Still water oscillations due to harmonic support motion excitation, support amplitude and frequencies varied, (2) Towing tests with no support motion, the velocity is varied, (3) Combined excitation: Towing tests with support motion. All possible combinations of experiments (1) and (2) are carried out. The two first experiments provide reference values for the combined excitation experiments and for verification purposes. The results reveal the ability of the external disturbance to influence the vortex shedding process both regarding frequency and the resulting response amplitudes. Results for added mass, in-line drag and damping are also obtained. The work may be of use in deep water floating petroleum production. 81 refs., 73 figs., 6 tabs.

Effect of Leaf Water Potential on Internal Humidity and CO2 Dissolution: Reverse Transpiration and Improved Water Use Efficiency under Negative Pressure.

Science.gov (United States)

Vesala, Timo; Sevanto, Sanna; Grönholm, Tiia; Salmon, Yann; Nikinmaa, Eero; Hari, Pertti; Hölttä, Teemu

2017-01-01

The pull of water from the soil to the leaves causes water in the transpiration stream to be under negative pressure decreasing the water potential below zero. The osmotic concentration also contributes to the decrease in leaf water potential but with much lesser extent. Thus, the surface tension force is approximately balanced by a force induced by negative water potential resulting in concavely curved water-air interfaces in leaves. The lowered water potential causes a reduction in the equilibrium water vapor pressure in internal (sub-stomatal/intercellular) cavities in relation to that over water with the potential of zero, i.e., over the flat surface. The curved surface causes a reduction also in the equilibrium vapor pressure of dissolved CO 2 , thus enhancing its physical solubility to water. Although the water vapor reduction is acknowledged by plant physiologists its consequences for water vapor exchange at low water potential values have received very little attention. Consequences of the enhanced CO 2 solubility to a leaf water-carbon budget have not been considered at all before this study. We use theoretical calculations and modeling to show how the reduction in the vapor pressures affects transpiration and carbon assimilation rates. Our results indicate that the reduction in vapor pressures of water and CO 2 could enhance plant water use efficiency up to about 10% at a leaf water potential of -2 MPa, and much more when water potential decreases further. The low water potential allows for a direct stomatal water vapor uptake from the ambient air even at sub-100% relative humidity values. This alone could explain the observed rates of foliar water uptake by e.g., the coastal redwood in the fog belt region of coastal California provided the stomata are sufficiently open. The omission of the reduction in the water vapor pressure causes a bias in the estimates of the stomatal conductance and leaf internal CO 2 concentration based on leaf gas exchange

The effect of postoperative passive motion on rotator cuff healing in a rat model.

Science.gov (United States)

Peltz, Cathryn D; Dourte, Leann M; Kuntz, Andrew F; Sarver, Joseph J; Kim, Soung-Yon; Williams, Gerald R; Soslowsky, Louis J

2009-10-01

Surgical repairs of torn rotator cuff tendons frequently fail. Immobilization has been shown to improve tissue mechanical properties in an animal model of rotator cuff repair, and passive motion has been shown to improve joint mechanics in animal models of flexor tendon repair. Our objective was to determine if daily passive motion would improve joint mechanics in comparison with continuous immobilization in a rat rotator cuff repair model. We hypothesized that daily passive motion would result in improved passive shoulder joint mechanics in comparison with continuous immobilization initially and that there would be no differences in passive joint mechanics or insertion site mechanical properties after four weeks of remobilization. A supraspinatus injury was created and was surgically repaired in sixty-five Sprague-Dawley rats. Rats were separated into three postoperative groups (continuous immobilization, passive motion protocol 1, and passive motion protocol 2) for two weeks before all underwent a remobilization protocol for four weeks. Serial measurements of passive shoulder mechanics (internal and external range of motion and joint stiffness) were made before surgery and at two and six weeks after surgery. After the animals were killed, collagen organization and mechanical properties of the tendon-to-bone insertion site were determined. Total range of motion for both passive motion groups (49% and 45% of the pre-injury values) was less than that for the continuous immobilization group (59% of the pre-injury value) at two weeks and remained significantly less following four weeks of remobilization exercise. Joint stiffness at two weeks was increased for both passive motion groups in comparison with the continuous immobilization group. At both two and six weeks after repair, internal range of motion was significantly decreased whereas external range of motion was not. There were no differences between the groups in terms of collagen organization or mechanical

On development and improvement of evaluation techniques for strong ground motion

Energy Technology Data Exchange (ETDEWEB)

NONE

2012-08-15

Issues regarding evaluation of active fault and ground motion for formulation of design basis ground motion (Ss) were identified during NISA and NSC seismic safety reviewing activities, which have been conducted in the light of the revision of the relevant seismic regulatory guide in 2006 and the experiences of the Niigataken Chuetsu-oki Earthquake in 2007 and the 2011 off the Pacific Coast of Tohoku Earthquake. In this theme following four subjects were investigated to resolve the important problems for ground motion evaluation, (1) advanced evaluation of ground motion using fault model and uncertainty; (2) improving evaluation of ground motion using attenuation relation of response spectrum; (3) development of advanced technique for ground motion observation and observation tool in deep borehole; (4) improving the evaluation of site effect and seismic wave propagation characteristics. Obtained results will be incorporated into the national safety review and also in the safety standard guidelines of the International Atomic Energy Agency (IAEA) using its Extra-Budgetary Program (IAEA EBP), thereby contributing to technical cooperation in global nuclear seismic safety. (author)

On development and improvement of evaluation techniques for seismic ground motion

Energy Technology Data Exchange (ETDEWEB)

NONE

2013-08-15

Issues regarding evaluation of active fault and ground motion for formulation of design basis ground motion (Ss) were prescribed in 'NSC seismic and tsunami safety reviewing manual' in 2012. Moreover, Nuclear Regulation Authority (NRA) is establishing the new seismic safety guideline. In this theme following four subjects were investigated to resolve the important problems for ground motion evaluation, (1) advanced evaluation of ground motion using fault model and uncertainty; (2) improving evaluation of ground motion using attenuation relation of response spectrum; (3) development of advanced and generic techniques for ground motion observation and observation tool in deep borehole; (4) improving the evaluation of site effect and seismic wave propagation characteristics. In addition as emergency requirements from NRA following two subjects were also investigated; (5) hazard evaluation development on fault displacement; (6) ground motion evaluation at near-by source location. Obtained results will be reflected not only in the domestic guideline established by NRA but in the national safety review and also in the safety standard guidelines of the International Atomic Energy Agency (IAEA) through its Extra-Budgetary Program (EBP), thereby contributing to technical cooperation in global nuclear seismic safety. (author)

Mitigation of sliding motion of a cask-canister by fluid-structure interaction in an annular region - 59208

International Nuclear Information System (INIS)

Ito, Tomohiro; Fujiwara, Yoshihiro; Shintani, Atsuhiko; Nakagaw, Chihiro; Furuta, Kazuhisa

2012-01-01

The cask-canister system is a coaxial circular cylindrical structure in which several spent fuels are installed. This system is a free-standing structure thus, it is very important to reduce sliding motion for very large seismic excitations. In this study, we propose a mitigation method for sliding motion. Water is installed in an annular region between a cask and a canister. The equations of motion are derived taking fluid-structure interaction into consideration for nonlinear sliding motion analyses. Based on these equations, mitigation effects of sliding motions are studied analytically. Furthermore, a fundamental test model of a cask-canister system is fabricated and shaking table tests are conducted. From the analytical and test results, sliding motion mitigation effects are investigated. In this paper, the sliding motion of the cask-canister system subjected to a horizontal base excitation is studied and the effectiveness of water filled in the annular region between the cask and the canister is evaluated. This water brings inertia force coupling effect which is proportional to acceleration of the cask and the canister. Therefore, due to this fluid coupling, the cask and canister system couples through 3 types of forces, i.e., spring force, damping force and inertia force of the liquid. Equations of motion for the sliding motion are derived based on the fluid-structure coupling effects formulated by Fritz. Based on these equations of motion, nonlinear sliding motion of the cask-canister system is analyzed and the sliding suppression effects are investigated numerically. Furthermore, a fundamental test model of a cask-canister system is fabricated and the shaking table tests are conducted. From these analytical and test results, the sliding motion suppression effects due to fluid-structure coupling effects are investigated. As a result, it is confirmed that the inertia coupling effects due to water filled in the annular region are relatively large, and the

Internal hydraulic control in the Little Belt, Denmark - observations of flow configurations and water mass formation

Science.gov (United States)

Holtegaard Nielsen, Morten; Vang, Torben; Chresten Lund-Hansen, Lars

2017-12-01

Internal hydraulic control, which occurs when stratified water masses are forced through an abrupt constriction, plays an enormous role in nature on both large and regional scales with respect to dynamics, circulation, and water mass formation. Despite a growing literature on this subject surprisingly few direct observations have been made that conclusively show the existence of and the circumstances related to internal hydraulic control in nature. In this study we present observations from the Little Belt, Denmark, one of three narrow straits connecting the Baltic Sea and the North Sea. The observations (comprised primarily of along-strait, detailed transects of salinity and temperature; continuous observations of flow velocity, salinity, and temperature at a permanent station; and numerous vertical profiles of salinity, temperature, fluorescence, and flow velocity in various locations) show that internal hydraulic control is a frequently occurring phenomenon in the Little Belt. The observations, which are limited to south-going flows of approximately two-layered water masses, show that internal hydraulic control may take either of two configurations, i.e. the lower or the upper layer being the active, accelerating one. This is connected to the depth of the pycnocline on the upstream side and the topography, which is both deepening and contracting toward the narrow part of the Little Belt. The existence of two possible flow configurations is known from theoretical and laboratory studies, but we believe that this has never been observed in nature and reported before. The water masses formed by the intense mixing, which is tightly connected with the presence of control, may be found far downstream of the point of control. The observations show that these particular water masses are associated with chlorophyll concentrations that are considerably higher than in adjacent water masses, showing that control has a considerable influence on the primary production and

Reconstructing 3D Tree Models Using Motion Capture and Particle Flow

Directory of Open Access Journals (Sweden)

Jie Long

2013-01-01

Full Text Available Recovering tree shape from motion capture data is a first step toward efficient and accurate animation of trees in wind using motion capture data. Existing algorithms for generating models of tree branching structures for image synthesis in computer graphics are not adapted to the unique data set provided by motion capture. We present a method for tree shape reconstruction using particle flow on input data obtained from a passive optical motion capture system. Initial branch tip positions are estimated from averaged and smoothed motion capture data. Branch tips, as particles, are also generated within a bounding space defined by a stack of bounding boxes or a convex hull. The particle flow, starting at branch tips within the bounding volume under forces, creates tree branches. The forces are composed of gravity, internal force, and external force. The resulting shapes are realistic and similar to the original tree crown shape. Several tunable parameters provide control over branch shape and arrangement.

Motion robust high resolution 3D free-breathing pulmonary MRI using dynamic 3D image self-navigator.

Science.gov (United States)

Jiang, Wenwen; Ong, Frank; Johnson, Kevin M; Nagle, Scott K; Hope, Thomas A; Lustig, Michael; Larson, Peder E Z

2018-06-01

To achieve motion robust high resolution 3D free-breathing pulmonary MRI utilizing a novel dynamic 3D image navigator derived directly from imaging data. Five-minute free-breathing scans were acquired with a 3D ultrashort echo time (UTE) sequence with 1.25 mm isotropic resolution. From this data, dynamic 3D self-navigating images were reconstructed under locally low rank (LLR) constraints and used for motion compensation with one of two methods: a soft-gating technique to penalize the respiratory motion induced data inconsistency, and a respiratory motion-resolved technique to provide images of all respiratory motion states. Respiratory motion estimation derived from the proposed dynamic 3D self-navigator of 7.5 mm isotropic reconstruction resolution and a temporal resolution of 300 ms was successful for estimating complex respiratory motion patterns. This estimation improved image quality compared to respiratory belt and DC-based navigators. Respiratory motion compensation with soft-gating and respiratory motion-resolved techniques provided good image quality from highly undersampled data in volunteers and clinical patients. An optimized 3D UTE sequence combined with the proposed reconstruction methods can provide high-resolution motion robust pulmonary MRI. Feasibility was shown in patients who had irregular breathing patterns in which our approach could depict clinically relevant pulmonary pathologies. Magn Reson Med 79:2954-2967, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

Water uptake and motion in highly densified bentonite

International Nuclear Information System (INIS)

Kahr, G.; Mueller-Vonmoos, F.; Kraehenbuehl, F.; Stoeckli, H.F.

1986-07-01

Water uptake by the bentonites MX-80 and Montigel was investigated according to the classical method of determination of the heat immersion and the adsorption-desorption isotherms. In addition, the layer expansion of the montmorillonite was measured as a function of the water content. The evaluation of the adsorption isotherms according to Dubinin-Radushkevich and the stratification distances determined by x-ray confirmed gradual water uptake. Up to 10% water content, the water is adsorbed as a monolayer, up to 20%, as a bimolecular layer around the interlayer cations. The partial specific entropy could be determined from the approximative calculation of the partial specific enthalpy from the heats of immersion and the free enthalpy from the adsorption isotherms. From this it is evident that the interlayer water shows a high degree of order. In this condition, the mobility of the water molecules is considerably lower than in free water. From the adsorption isotherm and the layer expansion observed, it can be assumed that water can appear in the pore space only from approximately 25% water content. The spaces outwith the interlayer space and the surfaces of the montmorillonite particles are considered as pore space. If free swelling is prevented and with dry densities greater than 1.8 Mg/m/sup 3/ for the highly compacted bentonites, water uptake causes a drastic reduction of the original pore space so that practically all the water is in the interlayer space. Calculation of the swelling pressure from the adsorption isotherms gives a good approximation of the measured swelling pressures. A montmorillonite surface of ca. 750 m/sup 2//g for both bentonites can be derived from a Dubinin-Radushkevich analysis of the adsorption isotherm. Water uptake into the compacted unsaturated bentonites can be described as diffusion with a diffusion coefficient of the order of magnitude of 3.10/sup -10/ m/sup 2//s. (author)

Cabri - water loop a new IPSN-OECD international research program

International Nuclear Information System (INIS)

Anon.

2001-01-01

In 1993, the Institut de Protection et de Surete Nucleaire (IPSN, the French Nuclear Safety and Radiation Protection Institute) working with EDF (electric utilities) and backed by the NRC (Nuclear Regulatory Commission, USA) launched a research program, dubbed Cabri REP Na addressing uranium oxide-based fuels and MOX fuels. So far twelve tests have been conducted including eight on UO 2 fuel and four on MOX fuel. More testing is now required to determine fuel performance at higher specific burn-up levels in typical PWR (Pressurized Water Reactor) conditions, the purpose being to determine the acceptance criteria for tomorrow's fuels. IPSN has defined a new research program for the Cabri reactor. The OECD's Nuclear Energy Agency is quarterbacking the international program called 'Cabri-Water Loop'. (authors)

Mode pattern of internal flow in a water droplet on a vibrating hydrophobic surface.

Science.gov (United States)

Kim, Hun; Lim, Hee-Chang

2015-06-04

The objective of this study is to understand the mode pattern of the internal flow in a water droplet placed on a hydrophobic surface that periodically and vertically vibrates. As a result, a water droplet on a vibrating hydrophobic surface has a typical shape that depends on each resonance mode, and, additionally, we observed a diversified lobe size and internal flows in the water droplet. The size of each lobe at the resonance frequency was relatively greater than that at the neighboring frequencies, and the internal flow of the nth order mode was also observed in the flow visualization. In general, large symmetrical flow streams were generated along the vertical axis in each mode, with a large circulating movement from the bottom to the top, and then to the triple contact line along the droplet surface. In contrast, modes 2 and 4 generated a Y-shaped flow pattern, in which the flow moved to the node point in the lower part of the droplet, but modes 6 and 8 had similar patterns, with only a little difference. In addition, as a result of the PIV measurement, while the flow velocity of mode 4 was faster than that of model 2, those of modes 6 and 8 were almost similar.

Influence of internal tides on Antarctic Bottom Water propagation through abyssal channels

Science.gov (United States)

Morozov, Eugene

2010-05-01

Antarctic Bottom Water (AABW) propagates in the Atlantic Ocean from the Weddell Sea to the north through narrow passages in submarine ridges. Submarine ridges are regions of strong internal tide generation in the ocean that causes mixing and eventually AABW loses its distinguishing properties such as low temperature and salinity. The Vema Fracture Zone (11 N) and Romanche Fracture Zone (equator) in the Mid-Atlantic Ridge (MAR) are pathways for AABW to the Northeast Atlantic. The deep basin of the Northeast Atlantic (Canary Basin and Gambia Abyssal Plain) are filled with the bottom water propagating through the Vema FZ rather than through the equatorial fracture zones because strong internal tides and mixing over the slopes of the MAR near the equator cause warming of AABW and decrease of its density. Further propagation of AABW through the Kane Gap is low. Recent field measurements in the fracture zones confirm this concept based on modeling results. Results of recent cruises are presented.

Gravity Cues Embedded in the Kinematics of Human Motion Are Detected in Form-from-Motion Areas of the Visual System and in Motor-Related Areas.

Science.gov (United States)

Cignetti, Fabien; Chabeauti, Pierre-Yves; Menant, Jasmine; Anton, Jean-Luc J J; Schmitz, Christina; Vaugoyeau, Marianne; Assaiante, Christine

2017-01-01

The present study investigated the cortical areas engaged in the perception of graviceptive information embedded in biological motion (BM). To this end, functional magnetic resonance imaging was used to assess the cortical areas active during the observation of human movements performed under normogravity and microgravity (parabolic flight). Movements were defined by motion cues alone using point-light displays. We found that gravity modulated the activation of a restricted set of regions of the network subtending BM perception, including form-from-motion areas of the visual system (kinetic occipital region, lingual gyrus, cuneus) and motor-related areas (primary motor and somatosensory cortices). These findings suggest that compliance of observed movements with normal gravity was carried out by mapping them onto the observer's motor system and by extracting their overall form from local motion of the moving light points. We propose that judgment on graviceptive information embedded in BM can be established based on motor resonance and visual familiarity mechanisms and not necessarily by accessing the internal model of gravitational motion stored in the vestibular cortex.

Development of Urban Inundation Warning Model at Cyclic Artificial Water Way in Song-do International City, Republic of Korea

Science.gov (United States)

Lee, T.; Lee, C.; Kim, H.

2016-12-01

Abstract Song-do international city was constructed by reclaiming land from the coastal waters of Yeonsu-gu, Incheon Metropolitan City, Republic of Korea. The □-shaped cyclic artificial water way has been considered for improving water quality, waterfront and internal drainage in Song-do international city. By improving water quality, various marine facilities, such as marina, artificial beach, marine terminal, and so on, will be set up around the artificial water way for the waterfront. Since the water stage of the artificial water way changes depending on water gates operations, it is necessary to develop an urban inundation warning model to evaluate safeties of the waterfront facilities and its passengers. By considering characteristics of urban watershed, we calculate discharge flowing into the water way using XP-SWMM model. As a result of estimating 100-year flood frequency, although there are slight differences in drainage sections, the maximum flood discharge occurs in 90-min rainfall duration. In order to consider impacts of tide and hydraulic structure, we establish Inland drainage plans through the analysis of unsteady flow using HEC-RAS. The urban inundation warning model is configured to issue a warning when the water plain elevation exceeds EL. 1.5m which is usually managed at EL. 1.0m. In this study, the design flood stage of artificial water way and urban inundation warning model are developed for Song-do international city, and therefore it is expected that a reliability of management and operation of the waterfront facilities is improved. Keywords : Artificial Water Way; Waterfront; Urban Inundation Warning Model. Acknowlegement This research was supported by a grant [MPSS-NH-2015-79] through the Disaster and Safety Management Institute funded by Ministry of Public Safety and Security of Korean government.

Merging constitutional and motional covalent dynamics in reversible imine formation and exchange processes.

Science.gov (United States)

Kovaříček, Petr; Lehn, Jean-Marie

2012-06-06

The formation and exchange processes of imines of salicylaldehyde, pyridine-2-carboxaldehyde, and benzaldehyde have been studied, showing that the former has features of particular interest for dynamic covalent chemistry, displaying high efficiency and fast rates. The monoimines formed with aliphatic α,ω-diamines display an internal exchange process of self-transimination type, inducing a local motion of either "stepping-in-place" or "single-step" type by bond interchange, whose rate decreases rapidly with the distance of the terminal amino groups. Control of the speed of the process over a wide range may be achieved by substituents, solvent composition, and temperature. These monoimines also undergo intermolecular exchange, thus merging motional and constitutional covalent behavior within the same molecule. With polyamines, the monoimines formed execute internal motions that have been characterized by extensive one-dimensional, two-dimensional, and EXSY proton NMR studies. In particular, with linear polyamines, nondirectional displacement occurs by shifting of the aldehyde residue along the polyamine chain serving as molecular track. Imines thus behave as simple prototypes of systems displaying relative motions of molecular moieties, a subject of high current interest in the investigation of synthetic and biological molecular motors. The motional processes described are of dynamic covalent nature and take place without change in molecular constitution. They thus represent a category of dynamic covalent motions, resulting from reversible covalent bond formation and dissociation. They extend dynamic covalent chemistry into the area of molecular motions. A major further step will be to achieve control of directionality. The results reported here for imines open wide perspectives, together with other chemical groups, for the implementation of such features in multifunctional molecules toward the design of molecular devices presenting a complex combination of

Correlation between hip function and knee kinematics evaluated by three-dimensional motion analysis during lateral and medial side-hopping.

Science.gov (United States)

Itoh, Hiromitsu; Takiguchi, Kohei; Shibata, Yohei; Okubo, Satoshi; Yoshiya, Shinichi; Kuroda, Ryosuke

2016-09-01

[Purpose] Kinematic and kinetic characteristics of the limb during side-hopping and hip/knee interaction during this motion have not been clarified. The purposes of this study were to examine the biomechanical parameters of the knee during side hop and analyze its relationship with clinical measurements of hip function. [Subjects and Methods] Eleven male college rugby players were included. A three-dimensional motion analysis system was used to assess motion characteristics of the knee during side hop. In addition, hip range of motion and muscle strength were evaluated. Subsequently, the relationship between knee motion and the clinical parameters of the hip was analyzed. [Results] In the lateral touchdown phase, the knee was positioned in an abducted and externally rotated position, and increasing abduction moment was applied to the knee. An analysis of the interaction between knee motion and hip function showed that range of motion for hip internal rotation was significantly correlated with external rotation angle and external rotation/abduction moments of the knee during the lateral touchdown phase. [Conclusion] Range of motion for hip internal rotation should be taken into consideration for identifying the biomechanical characteristics in the side hop test results.

Internal models of target motion: expected dynamics overrides measured kinematics in timing manual interceptions.

Science.gov (United States)

Zago, Myrka; Bosco, Gianfranco; Maffei, Vincenzo; Iosa, Marco; Ivanenko, Yuri P; Lacquaniti, Francesco

2004-04-01

Prevailing views on how we time the interception of a moving object assume that the visual inputs are informationally sufficient to estimate the time-to-contact from the object's kinematics. Here we present evidence in favor of a different view: the brain makes the best estimate about target motion based on measured kinematics and an a priori guess about the causes of motion. According to this theory, a predictive model is used to extrapolate time-to-contact from expected dynamics (kinetics). We projected a virtual target moving vertically downward on a wide screen with different randomized laws of motion. In the first series of experiments, subjects were asked to intercept this target by punching a real ball that fell hidden behind the screen and arrived in synchrony with the visual target. Subjects systematically timed their motor responses consistent with the assumption of gravity effects on an object's mass, even when the visual target did not accelerate. With training, the gravity model was not switched off but adapted to nonaccelerating targets by shifting the time of motor activation. In the second series of experiments, there was no real ball falling behind the screen. Instead the subjects were required to intercept the visual target by clicking a mousebutton. In this case, subjects timed their responses consistent with the assumption of uniform motion in the absence of forces, even when the target actually accelerated. Overall, the results are in accord with the theory that motor responses evoked by visual kinematics are modulated by a prior of the target dynamics. The prior appears surprisingly resistant to modifications based on performance errors.

19 CFR 210.58 - Provisional acceptance of the motion.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 3 2010-04-01 2010-04-01 false Provisional acceptance of the motion. 210.58 Section 210.58 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Temporary Relief § 210.58 Provisional acceptance of...

Deficient Biological Motion Perception in Schizophrenia: Results from a Motion Noise Paradigm

Directory of Open Access Journals (Sweden)

Jejoong eKim

2013-07-01

Full Text Available Background: Schizophrenia patients exhibit deficient processing of perceptual and cognitive information. However, it is not well understood how basic perceptual deficits contribute to higher level cognitive problems in this mental disorder. Perception of biological motion, a motion-based cognitive recognition task, relies on both basic visual motion processing and social cognitive processing, thus providing a useful paradigm to evaluate the potentially hierarchical relationship between these two levels of information processing. Methods: In this study, we designed a biological motion paradigm in which basic visual motion signals were manipulated systematically by incorporating different levels of motion noise. We measured the performances of schizophrenia patients (n=21 and healthy controls (n=22 in this biological motion perception task, as well as in coherent motion detection, theory of mind, and a widely used biological motion recognition task. Results: Schizophrenia patients performed the biological motion perception task with significantly lower accuracy than healthy controls when perceptual signals were moderately degraded by noise. A more substantial degradation of perceptual signals, through using additional noise, impaired biological motion perception in both groups. Performance levels on biological motion recognition, coherent motion detection and theory of mind tasks were also reduced in patients. Conclusion: The results from the motion-noise biological motion paradigm indicate that in the presence of visual motion noise, the processing of biological motion information in schizophrenia is deficient. Combined with the results of poor basic visual motion perception (coherent motion task and biological motion recognition, the association between basic motion signals and biological motion perception suggests a need to incorporate the improvement of visual motion perception in social cognitive remediation.

The Non-Ergodic Nature of Internal Conversion

DEFF Research Database (Denmark)

Sølling, Theis I.; Kuhlman, Thomas Scheby; Stephansen, Anne B.

2014-01-01

The absorption of light by molecules can induce ultrafast dynamics and coupling of electronic and nuclear vibrational motion. The ultrafast nature in many cases rests on the importance of several potential energy surfaces in guiding the nuclear motion—a concept of central importance in many aspects...... of chemical reaction dynamics. This Minireview focuses on the non-ergodic nature of internal conversion, that is, on the concept that the nuclear dynamics only sample a reduced phase space, potentially resulting in localization of the dynamics in real space. A series of results that highlight...... it takes to reach it. 2) Localization of energy into a single reactive mode, which is dictated by the internal conversion process. 3) Initiation of the internal conversion by activation of a single complex motion, which then specifically couples to a reactive mode. 4) Nonstatistical internal conversion...

Is the fresh water fish consumption a significant determinant of the internal exposure to perfluoroalkylated substances (PFAS)?

Science.gov (United States)

Denys, Sébastien; Fraize-Frontier, Sandrine; Moussa, Oumar; Le Bizec, Bruno; Veyrand, Bruno; Volatier, Jean-Luc

2014-12-01

PFAS are man-made compounds that are highly spread in the environment. Human dietary exposure to such contaminants is of high concern as they may accumulate in the food chain. Different studies already demonstrated the importance of the fish consumption in the dietary exposure of these molecules and the potential increase of internal doses of PFAS following the consumption of PFAS. However, so far few study aimed to study the link between the consumption of fresh water fishes and the internal exposure to PFAS. Objectives of this study were (i) to estimate the internal exposure of populations that are potentially high consumers of fresh water fishes and (ii) to determine whether the consumption of fish caught from fresh water is a significant determinant of the internal exposure of PFAS. In this work, a large sample of adult freshwater anglers from the French metropolitan population (478 individuals) was constituted randomly from participants lists of anglers associations. Questionnaires provided social and demographic information and diet information for each subject. In addition, analyses of blood serum samples provided the internal concentration of 14 PFAS. The survey design allowed to extrapolate the data obtained on the 478 individuals to the freshwater angler population. Descriptive data regarding internal levels of PFAS were discussed at the population level, whereas identification of the determinants were done at the 478 individuals level as sufficient contrast was required in terms of fresh water fish consumption. Only molecules for which the detection frequency were above 80% in blood were considered, i.e., PFOS, PFOA, PFHxS, PFNA, PFHpS, and PFDA. Distribution profiles showed log-normal distribution and PFOS and PFOA were the main contributors of the PFAS sum. For PFOS, the results obtained on the 478 individuals showed that upper percentiles were higher as compared to upper percentiles obtained on occidental general population. This confirmed an over

Estimation of organ motion for gated PET imaging in small animal using artificial tumor

Energy Technology Data Exchange (ETDEWEB)

Woo, Sang Keun; Yu, Jung Woo; Lee, Yong Jin [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

2011-10-15

The image quality is lowered by reducing of contrast and signal due to breathing and heart motion when acquire Positron Emission Tomography (PET) image of small animal tumor. Therefore motion correction is required for betterment of quantitative estimation of tumor. The gated PET using external monitoring device is commonly used for motion correction. But that method has limitation by reason of detection from the outside. Therefore, we had devised the in-vivo motion assessment. In-vivo motion has been demonstrated in lung, liver and abdomen region of rats by coated molecular sieve. In PET image analysis, count and SNR were drawn in the target region. The motion compensation PET image for optimal gate number was confirmed by FWHM. Artificial motion evaluation of tumor using molecular sieve suggests possibility of motion correction modeling without external monitoring devices because it estimates real internal motion of lung, liver, and abdomen. The purpose of this study was to assess the optimal gates number for each region and to improve quantitative estimation of tumor

Polar Motion Studies and NOAA's Legacy of International Scientific Cooperation: Ukiah and Gaithersburg Latitude Observatories

Science.gov (United States)

Caccamise, D. J., II; Stone, W. A.

2017-12-01

In 1895, the International Geodetic Association invited the United States Coast and Geodetic Survey (USC&GS) to join in an unprecedented international effort to observe and measure the earth's polar motion. This effort was in response to the American astronomer Seth C. Chandler Jr. announcing his 1891 discovery that the earth's axis of rotation—and hence the direction of true north—wobbles within the earth with a period of about 14 months, varying latitude everywhere on the globe. In 1899, two astro-geodetic observatories were built in Gaithersburg, Maryland and Ukiah, California with three others in Caloforte, Italy; Kitab, Russia (now Uzbekistan); and Mizusawa, Japan. (A sixth station was located and operated at an astronomical observatory in Cincinnati, Ohio until 1916 using instruments loaned by USC&GS). All five observatories were located along the same parallel - approximately 35 degrees - 8 minutes. The observatories were decommissioned in 1982, and subsequently, NOAA deeded the two remaining U.S. observatories to the cities of Gaithersburg and Ukiah. The observatories and adjacent property were to be used as parkland. Both cities have restored the observatories and opened public parks. Recently, Gaithersburg (Ukiah in progress) has had its latitude observatory dedicated as a National Historic Landmark. In 2014-15, the National Geodetic Survey (NGS, the present-day NOAA successor to the USC&GS) loaned the original zenith telescopes to the communities, returning the observatories to their original configuration. The contribution of NOAA observers and the data collected is still important to astronomers and geophysicists and has practical applications in spacecraft navigation and geospatial positioning. This poster will bring to fruition this multiyear effort among partners by providing examples of NOAA's mission and contribution to science, service, and stewardship at both geodetic observatories, through programs and historic exhibits for students and the

Quantum dissipative effects in moving imperfect mirrors: Sidewise and normal motions

International Nuclear Information System (INIS)

Fosco, Cesar D.; Lombardo, Fernando C.; Mazzitelli, Francisco D.

2011-01-01

We extend our previous work on the functional approach to the dynamical Casimir effect, to compute dissipative effects due to the relative motion of two flat, parallel, imperfect mirrors in vacuum. The interaction between the internal degrees of freedom of the mirrors and the vacuum field is modeled with a nonlocal term in the vacuum field action. We consider two different situations: either the motion is 'normal', i.e., the mirrors advance or recede changing the distance a(t) between them; or it is 'parallel', namely, a remains constant, but there is a relative sliding motion of the mirrors' planes. For the latter, we show explicitly that there is a nonvanishing frictional force, even for a constant shifting speed.

Response of Voronezh reactor type to horizontal ground motion

International Nuclear Information System (INIS)

Pecinka, L.

1983-01-01

For the purposes of vibration monitoring of PWR's the well known 'double pendulum model' has been developed and experimentally verified. It is shown, that this model is possible to use for response calculations of Voronezh reactor pressure vessel and its internals to horizontal ground motion. The equation of motion is given in usual matrix form, the damping matrix is calculated by Rayleigh formula. Driving force is given by vector of ground motion in horizontal direction. For the numerical integration of equation of motion is possible to use following methods - matrix exponential in state space; - modal analysis; - one-step direct integration. For our purposes the last one has been chosen and related computer code TRANS has been developed. The results of calculations are given in the graphically form using generalized angular coordinates and its second derivatives, which describes the displacement or acceleration of reactor pressure vessel to ground and the core barrel to reactor pressure vessel. The driving vector is given in the form of artificially generated accelerogram. (orig./HP)

Dust devil dynamics in the internal vortex region

International Nuclear Information System (INIS)

Onishchenko, O G; Pokhotelov, O A; Horton, W

2015-01-01

A hydrodynamic model for dust devil dynamics in the internal vortex region is analyzed. It is shown that the results concerning the growing plumes investigated by Onishchenko et al (2014) for the short time domain can be applied to the study of vortex motion in the internal region for longer times. It is demonstrated that these convective plumes in an atmosphere with weak, large-scale toroidal motion inhomogeneity in the vertical direction can be a subject for further exponential growth over time. (invited comment)

A heuristic mathematical model for the dynamics of sensory conflict and motion sickness

Science.gov (United States)

Oman, C. M.

1982-01-01

By consideration of the information processing task faced by the central nervous system in estimating body spatial orientation and in controlling active body movement using an internal model referenced control strategy, a mathematical model for sensory conflict generation is developed. The model postulates a major dynamic functional role for sensory conflict signals in movement control, as well as in sensory-motor adaptation. It accounts for the role of active movement in creating motion sickness symptoms in some experimental circumstance, and in alleviating them in others. The relationship between motion sickness produced by sensory rearrangement and that resulting from external motion disturbances is explicitly defined. A nonlinear conflict averaging model is proposed which describes dynamic aspects of experimentally observed subjective discomfort sensation, and suggests resulting behaviours. The model admits several possibilities for adaptive mechanisms which do not involve internal model updating. Further systematic efforts to experimentally refine and validate the model are indicated.

Benefits of rotational ground motions for planetary seismology

Science.gov (United States)

Donner, S.; Joshi, R.; Hadziioannou, C.; Nunn, C.; van Driel, M.; Schmelzbach, C.; Wassermann, J. M.; Igel, H.

2017-12-01

Exploring the internal structure of planetary objects is fundamental to understand the evolution of our solar system. In contrast to Earth, planetary seismology is hampered by the limited number of stations available, often just a single one. Classic seismology is based on the measurement of three components of translational ground motion. Its methods are mainly developed for a larger number of available stations. Therefore, the application of classical seismological methods to other planets is very limited. Here, we show that the additional measurement of three components of rotational ground motion could substantially improve the situation. From sparse or single station networks measuring translational and rotational ground motions it is possible to obtain additional information on structure and source. This includes direct information on local subsurface seismic velocities, separation of seismic phases, propagation direction of seismic energy, crustal scattering properties, as well as moment tensor source parameters for regional sources. The potential of this methodology will be highlighted through synthetic forward and inverse modeling experiments.

Subjective Vertical Conflict Theory and Space Motion Sickness.

Science.gov (United States)

Chen, Wei; Chao, Jian-Gang; Wang, Jin-Kun; Chen, Xue-Wen; Tan, Cheng

2016-02-01

Space motion sickness (SMS) remains a troublesome problem during spaceflight. The subjective vertical (SV) conflict theory postulates that all motion sickness provoking situations are characterized by a condition in which the SV sensed from gravity and visual and idiotropic cues differs from the expected vertical. This theory has been successfully used to predict motion sickness in different vehicles on Earth. We have summarized the most outstanding and recent studies on the illusions and characteristics associated with spatial disorientation and SMS during weightlessness, such as cognitive map and mental rotation, the visual reorientation and inversion illusions, and orientation preferences between visual scenes and the internal z-axis of the body. The relationships between the SV and the incidence of and susceptibility to SMS as well as spatial disorientation were addressed. A consistent framework was presented to understand and explain SMS characteristics in more detail on the basis of the SV conflict theory, which is expected to be more advantageous in SMS prediction, prevention, and training.

Measurement of shoulder motion fraction and motion ratio

International Nuclear Information System (INIS)

Kang, Yeong Han

2006-01-01

This study was to understand about the measurement of shoulder motion fraction and motion ratio. We proposed the radiological criterior of glenohumeral and scapulothoracic movement ratio. We measured the motion fraction of the glenohumeral and scapulothoracic movement using CR (computed radiological system) of arm elevation at neutral, 90 degree, full elevation. Central ray was 15 .deg., 19 .deg., 22 .deg. to the cephald for the parallel scapular spine, and the tilting of torso was external oblique 40 .deg., 36 .deg., 22 .deg. for perpendicular to glenohumeral surface. Healthful donor of 100 was divided 5 groups by age (20, 30, 40, 50, 60). The angle of glenohumeral motion and scapulothoracic motion could be taken from gross arm angle and radiological arm angle. We acquired 3 images at neutral, 90 .deg. and full elevation position and measured radiographic angle of glenoheumeral, scapulothoracic movement respectively. While the arm elevation was 90 .deg., the shoulder motion fraction was 1.22 (M), 1.70 (W) in right arm and 1.31, 1.54 in left. In full elevation, Right arm fraction was 1.63, 1.84 and left was 1.57, 1.32. In right dominant arm (78%), 90 .deg. and Full motion fraction was 1.58, 1.43, in left (22%) 1.82, 1.94. In generation 20, 90 .deg. and Full motion fraction was 1.56, 1.52, 30' was 1.82, 1.43, 40' was 1.23, 1.16, 50' was 1.80, 1.28,60' was 1.24, 1.75. There was not significantly by gender, dominant arm and age. The criteria of motion fraction was useful reference for clinical diagnosis the shoulder instability

Gating based on internal/external signals with dynamic correlation updates

International Nuclear Information System (INIS)

Wu Huanmei; Zhao Qingya; Berbeco, Ross I; Nishioka, Seiko; Shirato, Hiroki; Jiang, Steve B

2008-01-01

Precise localization of mobile tumor positions in real time is critical to the success of gated radiotherapy. Tumor positions are usually derived from either internal or external surrogates. Fluoroscopic gating based on internal surrogates, such as implanted fiducial markers, is accurate however requiring a large amount of imaging dose. Gating based on external surrogates, such as patient abdominal surface motion, is non-invasive however less accurate due to the uncertainty in the correlation between tumor location and external surrogates. To address these complications, we propose to investigate an approach based on hybrid gating with dynamic internal/external correlation updates. In this approach, the external signal is acquired at high frequency (such as 30 Hz) while the internal signal is sparsely acquired (such as 0.5 Hz or less). The internal signal is used to validate and update the internal/external correlation during treatment. Tumor positions are derived from the external signal based on the newly updated correlation. Two dynamic correlation updating algorithms are introduced. One is based on the motion amplitude and the other is based on the motion phase. Nine patients with synchronized internal/external motion signals are simulated retrospectively to evaluate the effectiveness of hybrid gating. The influences of different clinical conditions on hybrid gating, such as the size of gating windows, the optimal timing for internal signal acquisition and the acquisition frequency are investigated. The results demonstrate that dynamically updating the internal/external correlation in or around the gating window will reduce false positive with relatively diminished treatment efficiency. This improvement will benefit patients with mobile tumors, especially greater for early stage lung cancers, for which the tumors are less attached or freely floating in the lung.

Gating based on internal/external signals with dynamic correlation updates

Energy Technology Data Exchange (ETDEWEB)

Wu Huanmei [Purdue School of Engineering and Technology, Indiana University School of Informatics, IUPUI, Indianapolis, IN (United States); Zhao Qingya [School of Health Sciences, Purdue University, West Lafayette, IN (United States); Berbeco, Ross I [Department of Radiation Oncology, Dana-Farber/Brigham and Womens Cancer Center and Harvard Medical School, Boston, MA (United States); Nishioka, Seiko [NTT East-Japan Sapporo Hospital, Sapporo (Japan); Shirato, Hiroki [Hokkaido University Graduate School of Medicine, Sapporo (Japan); Jiang, Steve B [Department of Radiation Oncology, School of Medicine, University of California, San Diego, CA (United States)], E-mail: hw9@iupui.edu, E-mail: sbjiang@ucsd.edu

2008-12-21

Precise localization of mobile tumor positions in real time is critical to the success of gated radiotherapy. Tumor positions are usually derived from either internal or external surrogates. Fluoroscopic gating based on internal surrogates, such as implanted fiducial markers, is accurate however requiring a large amount of imaging dose. Gating based on external surrogates, such as patient abdominal surface motion, is non-invasive however less accurate due to the uncertainty in the correlation between tumor location and external surrogates. To address these complications, we propose to investigate an approach based on hybrid gating with dynamic internal/external correlation updates. In this approach, the external signal is acquired at high frequency (such as 30 Hz) while the internal signal is sparsely acquired (such as 0.5 Hz or less). The internal signal is used to validate and update the internal/external correlation during treatment. Tumor positions are derived from the external signal based on the newly updated correlation. Two dynamic correlation updating algorithms are introduced. One is based on the motion amplitude and the other is based on the motion phase. Nine patients with synchronized internal/external motion signals are simulated retrospectively to evaluate the effectiveness of hybrid gating. The influences of different clinical conditions on hybrid gating, such as the size of gating windows, the optimal timing for internal signal acquisition and the acquisition frequency are investigated. The results demonstrate that dynamically updating the internal/external correlation in or around the gating window will reduce false positive with relatively diminished treatment efficiency. This improvement will benefit patients with mobile tumors, especially greater for early stage lung cancers, for which the tumors are less attached or freely floating in the lung.

Problem statement: international safeguards for a light-water reactor fuels reprocessing plant

International Nuclear Information System (INIS)

Shipley, J.P.; Hakkila, E.A.; Dietz, R.J.; Cameron, C.P.; Bleck, M.E.; Darby, J.L.

1979-03-01

This report considers the problem of developing international safeguards for a light-water reactor (LWR) fuel reprocessing/conversion facility that combines the Purex process with conversion of plutonium nitrate to the oxide by means of plutonium (III) oxalate precipitation and calcination. Current international safeguards systems are based on the complementary concepts of materials accounting and containment and surveillance, which are designed to detect covert, national diversion of nuclear material. This report discusses the possible diversion threats and some types of countermeasures, and it represents the first stage in providing integrated international safeguards system concepts that make optimum use of available resources. The development of design methodology to address this problem will constitute a significant portion of the subsequent effort. Additionally, future technology development requirements are identified. 8 figures, 1 table

Markerless motion estimation for motion-compensated clinical brain imaging

Science.gov (United States)

Kyme, Andre Z.; Se, Stephen; Meikle, Steven R.; Fulton, Roger R.

2018-05-01

Motion-compensated brain imaging can dramatically reduce the artifacts and quantitative degradation associated with voluntary and involuntary subject head motion during positron emission tomography (PET), single photon emission computed tomography (SPECT) and computed tomography (CT). However, motion-compensated imaging protocols are not in widespread clinical use for these modalities. A key reason for this seems to be the lack of a practical motion tracking technology that allows for smooth and reliable integration of motion-compensated imaging protocols in the clinical setting. We seek to address this problem by investigating the feasibility of a highly versatile optical motion tracking method for PET, SPECT and CT geometries. The method requires no attached markers, relying exclusively on the detection and matching of distinctive facial features. We studied the accuracy of this method in 16 volunteers in a mock imaging scenario by comparing the estimated motion with an accurate marker-based method used in applications such as image guided surgery. A range of techniques to optimize performance of the method were also studied. Our results show that the markerless motion tracking method is highly accurate (brain imaging and holds good promise for a practical implementation in clinical PET, SPECT and CT systems.

Internal doses to Ukrainian populations using Dnieper River water

International Nuclear Information System (INIS)

Berkovski, V.; Ratia, G.; Nasvit, O.

1996-01-01

The dynamics of internal doses from 137 Cs and 90 Sr as a consequence of the use of Dnieper River water were calculated. Local peculiarities of municipal tap, irrigation, and fish consumption in the Ukraine were considered. The dynamics of 90 Sr accumulation in human bone as a result of the use of Dnieper water is simulated. The dose predictions are based on de facto data and the stochastic forecast of radionuclide concentrations in Dnieper reservoirs. A large array of statistical data on the age-structures of exposed populations, food consumption rate, agricultural production, fish contamination, and site-specific parameters were used. Exposures are estimated for 12 regions of the Dnieper basin and the Crimea Republic. The maximal individual annual committed effective doses are 1.7 x 10 -5 and 2.7 x 10 -5 Sv from 90 Sr and 137 Cs, respectively, due to the use of water in 1986 by members of the population in the Kievska region. Commercial fishermen on the Kievska reservoir, who consumed 360 kg y -1 of fish in 1986, received 4.7 x 10 -4 and 5 x 10 -3 Sv from 90 Sr and 137 Cs, respectively. The contributions to the collective (over 70 6) effective dose of irrigation, municipal tap water, and fish consumption for members of the general public, respectively, are 18%, 43%,39% in the Kievska region; 8%,25%,67% in the Poltavska region; 50% 50%, 0% (no Dnieper fish consumed) in the Crimea Republic. The predicted contribution of 90 Sr to collective dose resulting from the use of water is 80%. The collective dose to the population of the Dnieper regions (32.5 million people) is 3,000 person-Sv, due to the use of water. 14 refs., 12 figs., 2 tabs

Circular motion of particles suspended in a Gaussian beam with circular polarization validates the spin part of the internal energy flow

DEFF Research Database (Denmark)

Angelsky, O. V.; Bekshaev, A. Ya.; Maksimyak, P. P.

2012-01-01

switching to the right (left) circular polarization, the particles performed spinning motion in agreement with the angular momentum imparted by the field, but they were involved in an orbital rotation around the beam axis as well, which in previous works [Y. Zhao et al, Phys. Rev. Lett. 99, 073901 (2007......Non-spherical dielectric microparticles were suspended in a water-filled cell and exposed to a coherent Gaussian light beam with controlled state of polarization. When the beam polarization is linear, the particles were trapped at certain off-axial position within the beam cross section. After...... of inhomogeneously polarized paraxial beams [A. Bekshaev et al, J. Opt. 13, 053001 (2011)]....

Rigid-body motion correction of the liver in image reconstruction for golden-angle stack-of-stars DCE MRI.

Science.gov (United States)

Johansson, Adam; Balter, James; Cao, Yue

2018-03-01

Respiratory motion can affect pharmacokinetic perfusion parameters quantified from liver dynamic contrast-enhanced MRI. Image registration can be used to align dynamic images after reconstruction. However, intra-image motion blur remains after alignment and can alter the shape of contrast-agent uptake curves. We introduce a method to correct for inter- and intra-image motion during image reconstruction. Sixteen liver dynamic contrast-enhanced MRI examinations of nine subjects were performed using a golden-angle stack-of-stars sequence. For each examination, an image time series with high temporal resolution but severe streak artifacts was reconstructed. Images were aligned using region-limited rigid image registration within a region of interest covering the liver. The transformations resulting from alignment were used to correct raw data for motion by modulating and rotating acquired lines in k-space. The corrected data were then reconstructed using view sharing. Portal-venous input functions extracted from motion-corrected images had significantly greater peak signal enhancements (mean increase: 16%, t-test, P <  0.001) than those from images aligned using image registration after reconstruction. In addition, portal-venous perfusion maps estimated from motion-corrected images showed fewer artifacts close to the edge of the liver. Motion-corrected image reconstruction restores uptake curves distorted by motion. Motion correction also reduces motion artifacts in estimated perfusion parameter maps. Magn Reson Med 79:1345-1353, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

PET motion correction using PRESTO with ITK motion estimation

Energy Technology Data Exchange (ETDEWEB)

Botelho, Melissa [Institute of Biophysics and Biomedical Engineering, Science Faculty of University of Lisbon (Portugal); Caldeira, Liliana; Scheins, Juergen [Institute of Neuroscience and Medicine (INM-4), Forschungszentrum Jülich (Germany); Matela, Nuno [Institute of Biophysics and Biomedical Engineering, Science Faculty of University of Lisbon (Portugal); Kops, Elena Rota; Shah, N Jon [Institute of Neuroscience and Medicine (INM-4), Forschungszentrum Jülich (Germany)

2014-07-29

The Siemens BrainPET scanner is a hybrid MRI/PET system. PET images are prone to motion artefacts which degrade the image quality. Therefore, motion correction is essential. The library PRESTO converts motion-corrected LORs into highly accurate generic projection data [1], providing high-resolution PET images. ITK is an open-source software used for registering multidimensional data []. ITK provides motion estimation necessary to PRESTO.

PET motion correction using PRESTO with ITK motion estimation

International Nuclear Information System (INIS)

Botelho, Melissa; Caldeira, Liliana; Scheins, Juergen; Matela, Nuno; Kops, Elena Rota; Shah, N Jon

2014-01-01

The Siemens BrainPET scanner is a hybrid MRI/PET system. PET images are prone to motion artefacts which degrade the image quality. Therefore, motion correction is essential. The library PRESTO converts motion-corrected LORs into highly accurate generic projection data [1], providing high-resolution PET images. ITK is an open-source software used for registering multidimensional data []. ITK provides motion estimation necessary to PRESTO.

Imaging the motion of electrons across semiconductor heterojunctions

Science.gov (United States)

Man, Michael K. L.; Margiolakis, Athanasios; Deckoff-Jones, Skylar; Harada, Takaaki; Wong, E. Laine; Krishna, M. Bala Murali; Madéo, Julien; Winchester, Andrew; Lei, Sidong; Vajtai, Robert; Ajayan, Pulickel M.; Dani, Keshav M.

2017-01-01

Technological progress since the late twentieth century has centred on semiconductor devices, such as transistors, diodes and solar cells. At the heart of these devices is the internal motion of electrons through semiconductor materials due to applied electric fields or by the excitation of photocarriers. Imaging the motion of these electrons would provide unprecedented insight into this important phenomenon, but requires high spatial and temporal resolution. Current studies of electron dynamics in semiconductors are generally limited by the spatial resolution of optical probes, or by the temporal resolution of electronic probes. Here, by combining femtosecond pump-probe techniques with spectroscopic photoemission electron microscopy, we imaged the motion of photoexcited electrons from high-energy to low-energy states in a type-II 2D InSe/GaAs heterostructure. At the instant of photoexcitation, energy-resolved photoelectron images revealed a highly non-equilibrium distribution of photocarriers in space and energy. Thereafter, in response to the out-of-equilibrium photocarriers, we observed the spatial redistribution of charges, thus forming internal electric fields, bending the semiconductor bands, and finally impeding further charge transfer. By assembling images taken at different time-delays, we produced a movie lasting a few trillionths of a second of the electron-transfer process in the photoexcited type-II heterostructure—a fundamental phenomenon in semiconductor devices such as solar cells. Quantitative analysis and theoretical modelling of spatial variations in the movie provide insight into future solar cells, 2D materials and other semiconductor devices.

Analysis of Lung Tumor Motion in a Large Sample: Patterns and Factors Influencing Precise Delineation of Internal Target Volume

Energy Technology Data Exchange (ETDEWEB)

Knybel, Lukas [Department of Oncology, University Hospital Ostrava, Ostrava (Czech Republic); VŠB-Technical University of Ostrava, Ostrava (Czech Republic); Cvek, Jakub, E-mail: Jakub.cvek@fno.cz [Department of Oncology, University Hospital Ostrava, Ostrava (Czech Republic); Molenda, Lukas; Stieberova, Natalie; Feltl, David [Department of Oncology, University Hospital Ostrava, Ostrava (Czech Republic)

2016-11-15

Purpose/Objective: To evaluate lung tumor motion during respiration and to describe factors affecting the range and variability of motion in patients treated with stereotactic ablative radiation therapy. Methods and Materials: Log file analysis from online respiratory tumor tracking was performed in 145 patients. Geometric tumor location in the lungs, tumor volume and origin (primary or metastatic), sex, and tumor motion amplitudes in the superior-inferior (SI), latero-lateral (LL), and anterior-posterior (AP) directions were recorded. Tumor motion variability during treatment was described using intrafraction/interfraction amplitude variability and tumor motion baseline changes. Tumor movement dependent on the tumor volume, position and origin, and sex were evaluated using statistical regression and correlation analysis. Results: After analysis of >500 hours of data, the highest rates of motion amplitudes, intrafraction/interfraction variation, and tumor baseline changes were in the SI direction (6.0 ± 2.2 mm, 2.2 ± 1.8 mm, 1.1 ± 0.9 mm, and −0.1 ± 2.6 mm). The mean motion amplitudes in the lower/upper geometric halves of the lungs were significantly different (P<.001). Motion amplitudes >15 mm were observed only in the lower geometric quarter of the lungs. Higher tumor motion amplitudes generated higher intrafraction variations (R=.86, P<.001). Interfraction variations and baseline changes >3 mm indicated tumors contacting mediastinal structures or parietal pleura. On univariate analysis, neither sex nor tumor origin (primary vs metastatic) was an independent predictive factor of different movement patterns. Metastatic lesions in women, but not men, showed significantly higher mean amplitudes (P=.03) and variability (primary, 2.7 mm; metastatic, 4.9 mm; P=.002) than primary tumors. Conclusion: Online tracking showed significant irregularities in lung tumor movement during respiration. Motion amplitude was significantly lower in upper lobe

A margin model to account for respiration-induced tumour motion and its variability

International Nuclear Information System (INIS)

Coolens, Catherine; Webb, Steve; Evans, Phil M; Shirato, H; Nishioka, K

2008-01-01

In order to reduce the sensitivity of radiotherapy treatments to organ motion, compensation methods are being investigated such as gating of treatment delivery, tracking of tumour position, 4D scanning and planning of the treatment, etc. An outstanding problem that would occur with all these methods is the assumption that breathing motion is reproducible throughout the planning and delivery process of treatment. This is obviously not a realistic assumption and is one that will introduce errors. A dynamic internal margin model (DIM) is presented that is designed to follow the tumour trajectory and account for the variability in respiratory motion. The model statistically describes the variation of the breathing cycle over time, i.e. the uncertainty in motion amplitude and phase reproducibility, in a polar coordinate system from which margins can be derived. This allows accounting for an additional gating window parameter for gated treatment delivery as well as minimizing the area of normal tissue irradiated. The model was illustrated with abdominal motion for a patient with liver cancer and tested with internal 3D lung tumour trajectories. The results confirm that the respiratory phases around exhale are most reproducible and have the smallest variation in motion amplitude and phase (approximately 2 mm). More importantly, the margin area covering normal tissue is significantly reduced by using trajectory-specific margins (as opposed to conventional margins) as the angular component is by far the largest contributor to the margin area. The statistical approach to margin calculation, in addition, offers the possibility for advanced online verification and updating of breathing variation as more data become available

Investigation of the Linker Swing Motion in the Zeolitic Imidazolate Framework ZIF-90

KAUST Repository

Zheng, Bin

2018-03-13

The linker swing motion in the zeolitic imidazolate framework ZIF-90 is investigated by density functional theory (DFT) calculation, molecular dynamics (MD) and grand-canonical Monte Carlo (GCMC) simulations. The relation between the terminal aldehyde group rotation and the linker swing motion is revealed. The extremely high activation energy of the linker swing motion in ZIF-90 can be attributed to the asymmetric geometry and electron distribution of aldehyde groups. The change in the gate structure resulting from the linker rotation is used to understand the guest adsorption in ZIF-90. This study shows that it is possible to tune the linker swing motion and then the properties of ZIF-90 by manipulating the terminal group rotation. The results highlight the importance of considering the internal freedom effects to correctly describe the linker swing motion and the flexibility of metal-organic frameworks (MOFs).

Evaluation Method of Collision Risk by Using True Motion

Directory of Open Access Journals (Sweden)

Hayama Imazu

2017-03-01

Full Text Available It is necessary to develop a useful application to use big data like as AIS for safety and efficiency of ship operation. AIS is very useful system to collect targets information, but this information is not effective use yet. The evaluation method of collision risk is one of the cause disturb. Usually the collision risk of ship is evaluated by the value of the Closest Point of Approach (CPA which is related to a relative motion. So, it becomes difficult to find out a safety pass in a congested water. Here, Line of Predicted Collision (LOPC and Obstacle Zone by Target (OZT for evaluation of collision risk are introduced, these values are related to a true motion and it became visible of dangerous place, so it will make easy to find out a safety pass in a congested water.

Event-by-Event Continuous Respiratory Motion Correction for Dynamic PET Imaging.

Science.gov (United States)

Yu, Yunhan; Chan, Chung; Ma, Tianyu; Liu, Yaqiang; Gallezot, Jean-Dominique; Naganawa, Mika; Kelada, Olivia J; Germino, Mary; Sinusas, Albert J; Carson, Richard E; Liu, Chi

2016-07-01

Existing respiratory motion-correction methods are applied only to static PET imaging. We have previously developed an event-by-event respiratory motion-correction method with correlations between internal organ motion and external respiratory signals (INTEX). This method is uniquely appropriate for dynamic imaging because it corrects motion for each time point. In this study, we applied INTEX to human dynamic PET studies with various tracers and investigated the impact on kinetic parameter estimation. The use of 3 tracers-a myocardial perfusion tracer, (82)Rb (n = 7); a pancreatic β-cell tracer, (18)F-FP(+)DTBZ (n = 4); and a tumor hypoxia tracer, (18)F-fluoromisonidazole ((18)F-FMISO) (n = 1)-was investigated in a study of 12 human subjects. Both rest and stress studies were performed for (82)Rb. The Anzai belt system was used to record respiratory motion. Three-dimensional internal organ motion in high temporal resolution was calculated by INTEX to guide event-by-event respiratory motion correction of target organs in each dynamic frame. Time-activity curves of regions of interest drawn based on end-expiration PET images were obtained. For (82)Rb studies, K1 was obtained with a 1-tissue model using a left-ventricle input function. Rest-stress myocardial blood flow (MBF) and coronary flow reserve (CFR) were determined. For (18)F-FP(+)DTBZ studies, the total volume of distribution was estimated with arterial input functions using the multilinear analysis 1 method. For the (18)F-FMISO study, the net uptake rate Ki was obtained with a 2-tissue irreversible model using a left-ventricle input function. All parameters were compared with the values derived without motion correction. With INTEX, K1 and MBF increased by 10% ± 12% and 15% ± 19%, respectively, for (82)Rb stress studies. CFR increased by 19% ± 21%. For studies with motion amplitudes greater than 8 mm (n = 3), K1, MBF, and CFR increased by 20% ± 12%, 30% ± 20%, and 34% ± 23%, respectively. For (82)Rb

Analysis of Lung Tumor Motion in a Large Sample: Patterns and Factors Influencing Precise Delineation of Internal Target Volume

International Nuclear Information System (INIS)

Knybel, Lukas; Cvek, Jakub; Molenda, Lukas; Stieberova, Natalie; Feltl, David

2016-01-01

Purpose/Objective: To evaluate lung tumor motion during respiration and to describe factors affecting the range and variability of motion in patients treated with stereotactic ablative radiation therapy. Methods and Materials: Log file analysis from online respiratory tumor tracking was performed in 145 patients. Geometric tumor location in the lungs, tumor volume and origin (primary or metastatic), sex, and tumor motion amplitudes in the superior-inferior (SI), latero-lateral (LL), and anterior-posterior (AP) directions were recorded. Tumor motion variability during treatment was described using intrafraction/interfraction amplitude variability and tumor motion baseline changes. Tumor movement dependent on the tumor volume, position and origin, and sex were evaluated using statistical regression and correlation analysis. Results: After analysis of >500 hours of data, the highest rates of motion amplitudes, intrafraction/interfraction variation, and tumor baseline changes were in the SI direction (6.0 ± 2.2 mm, 2.2 ± 1.8 mm, 1.1 ± 0.9 mm, and −0.1 ± 2.6 mm). The mean motion amplitudes in the lower/upper geometric halves of the lungs were significantly different (P 15 mm were observed only in the lower geometric quarter of the lungs. Higher tumor motion amplitudes generated higher intrafraction variations (R=.86, P 3 mm indicated tumors contacting mediastinal structures or parietal pleura. On univariate analysis, neither sex nor tumor origin (primary vs metastatic) was an independent predictive factor of different movement patterns. Metastatic lesions in women, but not men, showed significantly higher mean amplitudes (P=.03) and variability (primary, 2.7 mm; metastatic, 4.9 mm; P=.002) than primary tumors. Conclusion: Online tracking showed significant irregularities in lung tumor movement during respiration. Motion amplitude was significantly lower in upper lobe tumors; higher interfraction amplitude variability indicated tumors in contact

Numerical Prediction of Green Water Incidents

DEFF Research Database (Denmark)

Nielsen, K. B.; Mayer, Stefan

2004-01-01

loads on a moored FPSO exposed to head sea waves. Two cases are investigated: first, green water ona fixed vessel has been analysed, where resulting waterheight on deck, and impact pressure on a deck mounted structure have been computed. These results have been compared to experimental data obtained......Green water loads on moored or sailing ships occur when an incoming wave signigicantly exceeds the freeboard and water runs onto the deck. In this paper, a Navier-Stokes solver with a free surface capturing scheme (i.e. the VOF model; Hirt and Nichols, 1981) is used to numerically model green water...... by Greco (2001) and show very favourable agreement. Second, a full green water incident, including vessel motions has been modelled. In these computations, the vertical motion has been modelled by the use of transfer functions for heave and pitch, but the rotational contribution from the pitch motion has...

Motion control report

CERN Document Server

2013-01-01

Please note this is a short discount publication. In today's manufacturing environment, Motion Control plays a major role in virtually every project.The Motion Control Report provides a comprehensive overview of the technology of Motion Control:* Design Considerations* Technologies* Methods to Control Motion* Examples of Motion Control in Systems* A Detailed Vendors List

Manipulation and controlled amplification of Brownian motion of microcantilever sensors

International Nuclear Information System (INIS)

Mehta, Adosh; Cherian, Suman; Hedden, David; Thundat, Thomas

2001-01-01

Microcantilevers, such as those used in atomic force microscopy, undergo Brownian motion due to mechanical thermal noise. The root mean square amplitude of the Brownian motion of a cantilever typically ranges from 0.01--0.1 nm, which limits its use in practical applications. Here we describe a technique by which the Brownian amplitude and the Q factor in air and water can be amplified by three and two orders of magnitude, respectively. This technique is similar to a positive feedback oscillator, wherein the Brownian motion of the vibrating cantilever controls the frequency output of the oscillator. This technique can be exploited to improve sensitivity of microcantilever-based chemical and biological sensors, especially for sensors in liquid environments

Coal-water slurry fuel internal combustion engine and method for operating same

Science.gov (United States)

McMillian, Michael H.

1992-01-01

An internal combustion engine fueled with a coal-water slurry is described. About 90 percent of the coal-water slurry charge utilized in the power cycle of the engine is directly injected into the main combustion chamber where it is ignited by a hot stream of combustion gases discharged from a pilot combustion chamber of a size less than about 10 percent of the total clearance volume of main combustion chamber with the piston at top dead center. The stream of hot combustion gases is provided by injecting less than about 10 percent of the total coal-water slurry charge into the pilot combustion chamber and using a portion of the air from the main combustion chamber that has been heated by the walls defining the pilot combustion chamber as the ignition source for the coal-water slurry injected into the pilot combustion chamber.

Effects of ship's vibration and motion on plant parameters

International Nuclear Information System (INIS)

Kakuta, Tsunemi; Kitamura, Toshikatsu; Mizushima, Toshihiko; Yamazaki, Hiroshi; Nakahara, Takeshi; Kamiya, Eisei; Kudou, Takahiro; Naitoh, Akira; Tominaga, Mineo.

1992-03-01

Present report was written about the study of the effects of ship's vibration and motion on reactor plant performances measured and analyzed to confirm the total balance for control systems of reactor to propulsion. On July 10, 1990, or on the first day of the first voyage for the power up test, the sea trials of MUTSU, nuclear ship made first in Japan, started from the anchoring test. The trial tests had finished through the third voyage between October 30 and November 9 to the fourth voyage between 7 and 14 of December. The trial tests had been conducted over ten items or so containing in-house tests of the measurements of ship's vibration and motion in order to research the effects on reactor performance. We here call the in-house tests the plant correlation tests. In regard to the correlation with ship's vibration, we confirmed that the inherent vibrations of hull and reactor containment arisen from ship structure had precisely been measured and that the plant correlations due to the hull and local vibrations arising from propeller revolutions are very small. Concerning the correlation with ship's motion, it was shown that her rolling motion strongly had affected on the propulsion system such as shaft power and shaft revolutions. About the correlation with reactor systems it was found that her pitching motion had given effect on the water level in pressurizer, primary coolant average temperature, ε-signal of the auto-control of reactor power and primary coolant pressure etc, particularly, most-strongly on the water level in pressurizer; her rolling and pitching motions had given effect on nuclear characteristics such as reactivity and startup rate; in addition the fluctuation of 0.06 Hz, we think the response inherent in (MUTSU) reactor systems, had been observed on her reactor parameters like reactivity and startup rate, and her propulsion systems like shaft horse power. (author)

Typical use of inverse dynamics in perceiving motion in autistic adults: Exploring computational principles of perception and action.

Science.gov (United States)

Takamuku, Shinya; Forbes, Paul A G; Hamilton, Antonia F de C; Gomi, Hiroaki

2018-05-07

There is increasing evidence for motor difficulties in many people with autism spectrum condition (ASC). These difficulties could be linked to differences in the use of internal models which represent relations between motions and forces/efforts. The use of these internal models may be dependent on the cerebellum which has been shown to be abnormal in autism. Several studies have examined internal computations of forward dynamics (motion from force information) in autism, but few have tested the inverse dynamics computation, that is, the determination of force-related information from motion information. Here, we examined this ability in autistic adults by measuring two perceptual biases which depend on the inverse computation. First, we asked participants whether they experienced a feeling of resistance when moving a delayed cursor, which corresponds to the inertial force of the cursor implied by its motion-both typical and ASC participants reported similar feelings of resistance. Second, participants completed a psychophysical task in which they judged the velocity of a moving hand with or without a visual cue implying inertial force. Both typical and ASC participants perceived the hand moving with the inertial cue to be slower than the hand without it. In both cases, the magnitude of the effects did not differ between the two groups. Our results suggest that the neural systems engaged in the inverse dynamics computation are preserved in ASC, at least in the observed conditions. Autism Res 2018. © 2018 International Society for Autism Research, Wiley Periodicals, Inc. We tested the ability to estimate force information from motion information, which arises from a specific "inverse dynamics" computation. Autistic adults and a matched control group reported feeling a resistive sensation when moving a delayed cursor and also judged a moving hand to be slower when it was pulling a load. These findings both suggest that the ability to estimate force information from

Hierarchical Motion Control for a Team of Humanoid Soccer Robots

Directory of Open Access Journals (Sweden)

Seung-Joon Yi

2016-02-01

Full Text Available Robot soccer has become an effective benchmarking problem for robotics research as it requires many aspects of robotics including perception, self localization, motion planning and distributed coordination to work in uncertain and adversarial environments. Especially with humanoid robots that lack inherent stability, a capable and robust motion controller is crucial for generating walking and kicking motions without losing balance. In this paper, we describe the details of a motion controller to control a team of humanoid soccer robots, which consists of a hierarchy of controllers with different time frames and abstraction levels. A low level controller governs the real time control of each joint angle, either using target joint angles or target endpoint transforms. A mid-level controller handles bipedal locomotion and balancing of the robot. A high level controller decides the long term behavior of the robot, and finally the team level controller coordinates the behavior of a group of robots by means of asynchronous communication between the robots. The suggested motion system has been successfully used by many humanoid robot teams at the RoboCup international robot soccer competitions, which has awarded us five successful championships in a row.

Development of advanced boiling water reactor for medium capacity

International Nuclear Information System (INIS)

Kazuo Hisajima; Yutaka Asanuma

2005-01-01

This paper describes a result of development of an Advanced Boiling Water Reactor for medium capacity. 1000 MWe was selected as the reference. The features of the current Advanced Boiling Water Reactors, such as a Reactor Internal Pump, a Fine Motion Control Rod Drive, a Reinforced Concrete Containment Vessel, and three-divisionalized Emergency Core Cooling System are maintained. In addition, optimization for 1000 MWe has been investigated. Reduction in thermal power and application of the latest fuel reduced the number of fuel assemblies, Control Rods and Control Rod Drives, Reactor Internal Pumps, and Safety Relief Valves. The number of Main Steam lines was reduced from four to two. As for the engineered safety features, the Flammability Control System was removed. Special efforts were made to realize a compact Turbine Building, such as application of an in line Moisture Separator, reduction in the number of pumps in the Condensate and Feedwater System, and change from a Turbine-Driven Reactor Feedwater Pump to a Motor-Driven Reactor Feedwater Pump. 31% reduction in the volume of the Turbine Building is expected in comparison with the current Advanced Boiling Water Reactors. (authors)

Real-Time 3D Motion capture by monocular vision and virtual rendering

OpenAIRE

Gomez Jauregui , David Antonio; Horain , Patrick

2012-01-01

International audience; Avatars in networked 3D virtual environments allow users to interact over the Internet and to get some feeling of virtual telepresence. However, avatar control may be tedious. Motion capture systems based on 3D sensors have recently reached the consumer market, but webcams and camera-phones are more widespread and cheaper. The proposed demonstration aims at animating a user's avatar from real time 3D motion capture by monoscopic computer vision, thus allowing virtual t...

Brownian motion of solitons in a Bose-Einstein condensate.

Science.gov (United States)

Aycock, Lauren M; Hurst, Hilary M; Efimkin, Dmitry K; Genkina, Dina; Lu, Hsin-I; Galitski, Victor M; Spielman, I B

2017-03-07

We observed and controlled the Brownian motion of solitons. We launched solitonic excitations in highly elongated [Formula: see text] Bose-Einstein condensates (BECs) and showed that a dilute background of impurity atoms in a different internal state dramatically affects the soliton. With no impurities and in one dimension (1D), these solitons would have an infinite lifetime, a consequence of integrability. In our experiment, the added impurities scatter off the much larger soliton, contributing to its Brownian motion and decreasing its lifetime. We describe the soliton's diffusive behavior using a quasi-1D scattering theory of impurity atoms interacting with a soliton, giving diffusion coefficients consistent with experiment.

Water Hydraulic Systems

DEFF Research Database (Denmark)

Conrad, Finn

2005-01-01

The paper presents research results using IT-Tools for CAD and dynamic modelling, simulation, analysis, and design of water hydraulic actuators for motion control of machines, lifts, cranes and robots. Matlab/Simulink and CATIA are used as IT-Tools. The contributions include results from on......-going research projects on fluid power and mechatronics based on tap water hydraulic servovalves and linear servo actuators and rotary vane actuators for motion control and power transmission. Development and design a novel water hydraulic rotary vane actuator for robot manipulators. Proposed mathematical...... modelling, control and simulation of a water hydraulic rotary vane actuator applied to power and control a two-links manipulator and evaluate performance. The results include engineering design and test of the proposed simulation models compared with IHA Tampere University’s presentation of research...

Total internal reflection second-harmonic generation: probing the alkane water interface

International Nuclear Information System (INIS)

Conboy, J.C.; Daschbach, J.L.; Richmond, G.L.

1994-01-01

Total internal reflection Second-Harmonic Generation (SHG) has been used to study a series of neat n-alkane/water interfaces. Polarization and incident angular-dependent measurements of the SH response show good agreement with theoretical predictions. Analysis of the incident and polarization angular-dependent SH response allows for determination of the nonlinear optical properties of molecules comprising the interfacial region. Based on Kleinman symmetry, the measured surface nonlinear susceptibilities suggest a high degree of interfacial order for octane and decane with less order indicated by the odd carbon n-alkanes examined, heptane and nonane. The SH response in reflection and transmission has been measured under a Total Internal Reflection (TIR) of the fundamental. The measured nonlinear susceptibilities in each case are found to be identical. (orig.)

The influence of atomizer internal design and liquid physical properties on effervescent atomizing of coal-water slurry

Energy Technology Data Exchange (ETDEWEB)

Liu, Meng; Duan, Yufeng [Southeast Univ., Nanjing (China). Inst. of Thermal Engineering

2013-07-01

This study investigated the dependence of effervescent atomizing of coal-water slurry (CWS) on atomizer internal design and fluid properties. Results demonstrate that internal design of atomizer and fluid properties directly affect the two-phase flow pattern inside the atomizer which consequently affects the spray quality. The influence of mixing chamber length on spray quality is not significant at the ALR of 0.15 except for spray 0.75 glycerol/0.248 water/0.002 xanthan mixture. The same trend also found in the effect of angle of aeration holes at ALR of 0.15. Large diameter of the inclined aeration holes shows small SMD for water. The consistency index of fluids has no effect on the spray quality and Sauter Mean Diameter (SMD) increases when polymer additions were added to the glycerin-water mixture. The radial profile of SMD for spray water are almost flat, however, the largest SMD can be obtained at the edge of spray for three other fluids.

Rrsm: The European Rapid Raw Strong-Motion Database

Science.gov (United States)

Cauzzi, C.; Clinton, J. F.; Sleeman, R.; Domingo Ballesta, J.; Kaestli, P.; Galanis, O.

2014-12-01

We introduce the European Rapid Raw Strong-Motion database (RRSM), a Europe-wide system that provides parameterised strong motion information, as well as access to waveform data, within minutes of the occurrence of strong earthquakes. The RRSM significantly differs from traditional earthquake strong motion dissemination in Europe, which has focused on providing reviewed, processed strong motion parameters, typically with significant delays. As the RRSM provides rapid open access to raw waveform data and metadata and does not rely on external manual waveform processing, RRSM information is tailored to seismologists and strong-motion data analysts, earthquake and geotechnical engineers, international earthquake response agencies and the educated general public. Access to the RRSM database is via a portal at http://www.orfeus-eu.org/rrsm/ that allows users to query earthquake information, peak ground motion parameters and amplitudes of spectral response; and to select and download earthquake waveforms. All information is available within minutes of any earthquake with magnitude ≥ 3.5 occurring in the Euro-Mediterranean region. Waveform processing and database population are performed using the waveform processing module scwfparam, which is integrated in SeisComP3 (SC3; http://www.seiscomp3.org/). Earthquake information is provided by the EMSC (http://www.emsc-csem.org/) and all the seismic waveform data is accessed at the European Integrated waveform Data Archive (EIDA) at ORFEUS (http://www.orfeus-eu.org/index.html), where all on-scale data is used in the fully automated processing. As the EIDA community is continually growing, the already significant number of strong motion stations is also increasing and the importance of this product is expected to also increase. Real-time RRSM processing started in June 2014, while past events have been processed in order to provide a complete database back to 2005.

Climate-driven seasonal geocenter motion during the GRACE period

Science.gov (United States)

Zhang, Hongyue; Sun, Yu

2018-03-01

Annual cycles in the geocenter motion time series are primarily driven by mass changes in the Earth's hydrologic system, which includes land hydrology, atmosphere, and oceans. Seasonal variations of the geocenter motion have been reliably determined according to Sun et al. (J Geophys Res Solid Earth 121(11):8352-8370, 2016) by combining the Gravity Recovery And Climate Experiment (GRACE) data with an ocean model output. In this study, we reconstructed the observed seasonal geocenter motion with geophysical model predictions of mass variations in the polar ice sheets, continental glaciers, terrestrial water storage (TWS), and atmosphere and dynamic ocean (AO). The reconstructed geocenter motion time series is shown to be in close agreement with the solution based on GRACE data supporting with an ocean bottom pressure model. Over 85% of the observed geocenter motion time series, variance can be explained by the reconstructed solution, which allows a further investigation of the driving mechanisms. We then demonstrated that AO component accounts for 54, 62, and 25% of the observed geocenter motion variances in the X, Y, and Z directions, respectively. The TWS component alone explains 42, 32, and 39% of the observed variances. The net mass changes over oceans together with self-attraction and loading effects also contribute significantly (about 30%) to the seasonal geocenter motion in the X and Z directions. Other contributing sources, on the other hand, have marginal (less than 10%) impact on the seasonal variations but introduce a linear trend in the time series.

Relevance of motion-related assessment metrics in laparoscopic surgery.

Science.gov (United States)

Oropesa, Ignacio; Chmarra, Magdalena K; Sánchez-González, Patricia; Lamata, Pablo; Rodrigues, Sharon P; Enciso, Silvia; Sánchez-Margallo, Francisco M; Jansen, Frank-Willem; Dankelman, Jenny; Gómez, Enrique J

2013-06-01

Motion metrics have become an important source of information when addressing the assessment of surgical expertise. However, their direct relationship with the different surgical skills has not been fully explored. The purpose of this study is to investigate the relevance of motion-related metrics in the evaluation processes of basic psychomotor laparoscopic skills and their correlation with the different abilities sought to measure. A framework for task definition and metric analysis is proposed. An explorative survey was first conducted with a board of experts to identify metrics to assess basic psychomotor skills. Based on the output of that survey, 3 novel tasks for surgical assessment were designed. Face and construct validation was performed, with focus on motion-related metrics. Tasks were performed by 42 participants (16 novices, 22 residents, and 4 experts). Movements of the laparoscopic instruments were registered with the TrEndo tracking system and analyzed. Time, path length, and depth showed construct validity for all 3 tasks. Motion smoothness and idle time also showed validity for tasks involving bimanual coordination and tasks requiring a more tactical approach, respectively. Additionally, motion smoothness and average speed showed a high internal consistency, proving them to be the most task-independent of all the metrics analyzed. Motion metrics are complementary and valid for assessing basic psychomotor skills, and their relevance depends on the skill being evaluated. A larger clinical implementation, combined with quality performance information, will give more insight on the relevance of the results shown in this study.

Correlation of photon beam motion with vacuum chamber cooling on the NSLS x-ray ring

International Nuclear Information System (INIS)

Johnson, E.D.; Fauchet, A.M.; Zhang, Xiaohao.

1991-01-01

The NSLS X-ray ring exhibits a direct correlation between photon beam motion, and distortion of the ring vacuum chamber induced by fluctuations in the cooling system. We have made long term measurements of photon beam vertical position, accelerator vacuum chamber motion, process water temperatures, and angular motions of the magnets around one superperiod of the NSLS x-ray ring. Short term transients in water temperature cause deflection of the ring vacuum chamber which have in turn been shown to induce very small angular rotations of the magnets, on the order of 10 micro-radians. A larger and more difficult to correct effect is the drift in beam position over the course of a fill. This problem has been shown to be related to the thermal gradients that develop across the vacuum chamber which, as a consequence of the configuration of the chamber cooling, depend upon stored current. Orbit simulations based upon the measured rotations are in agreement with the observed beam motions, and reveal that certain patterns of correlated motions of the magnets can produce much larger errors than random motion or concerted motion of all the magnets. During the course of these measurements global orbit feedback was installed, and found to significantly reduce the orbit errors which could not be corrected at their source

Quantification of organ motion based on an adaptive image-based scale invariant feature method

Energy Technology Data Exchange (ETDEWEB)

Paganelli, Chiara [Dipartimento di Elettronica, Informazione e Bioingegneria, Politecnico di Milano, piazza L. Da Vinci 32, Milano 20133 (Italy); Peroni, Marta [Dipartimento di Elettronica, Informazione e Bioingegneria, Politecnico di Milano, piazza L. Da Vinci 32, Milano 20133, Italy and Paul Scherrer Institut, Zentrum für Protonentherapie, WMSA/C15, CH-5232 Villigen PSI (Italy); Baroni, Guido; Riboldi, Marco [Dipartimento di Elettronica, Informazione e Bioingegneria, Politecnico di Milano, piazza L. Da Vinci 32, Milano 20133, Italy and Bioengineering Unit, Centro Nazionale di Adroterapia Oncologica, strada Campeggi 53, Pavia 27100 (Italy)

2013-11-15

Purpose: The availability of corresponding landmarks in IGRT image series allows quantifying the inter and intrafractional motion of internal organs. In this study, an approach for the automatic localization of anatomical landmarks is presented, with the aim of describing the nonrigid motion of anatomo-pathological structures in radiotherapy treatments according to local image contrast.Methods: An adaptive scale invariant feature transform (SIFT) was developed from the integration of a standard 3D SIFT approach with a local image-based contrast definition. The robustness and invariance of the proposed method to shape-preserving and deformable transforms were analyzed in a CT phantom study. The application of contrast transforms to the phantom images was also tested, in order to verify the variation of the local adaptive measure in relation to the modification of image contrast. The method was also applied to a lung 4D CT dataset, relying on manual feature identification by an expert user as ground truth. The 3D residual distance between matches obtained in adaptive-SIFT was then computed to verify the internal motion quantification with respect to the expert user. Extracted corresponding features in the lungs were used as regularization landmarks in a multistage deformable image registration (DIR) mapping the inhale vs exhale phase. The residual distances between the warped manual landmarks and their reference position in the inhale phase were evaluated, in order to provide a quantitative indication of the registration performed with the three different point sets.Results: The phantom study confirmed the method invariance and robustness properties to shape-preserving and deformable transforms, showing residual matching errors below the voxel dimension. The adapted SIFT algorithm on the 4D CT dataset provided automated and accurate motion detection of peak to peak breathing motion. The proposed method resulted in reduced residual errors with respect to standard SIFT

A synchronous surround increases the motion strength gain of motion.

Science.gov (United States)

Linares, Daniel; Nishida, Shin'ya

2013-11-12

Coherent motion detection is greatly enhanced by the synchronous presentation of a static surround (Linares, Motoyoshi, & Nishida, 2012). To further understand this contextual enhancement, here we measured the sensitivity to discriminate motion strength for several pedestal strengths with and without a surround. We found that the surround improved discrimination of low and medium motion strengths, but did not improve or even impaired discrimination of high motion strengths. We used motion strength discriminability to estimate the perceptual response function assuming additive noise and found that the surround increased the motion strength gain, rather than the response gain. Given that eye and body movements continuously introduce transients in the retinal image, it is possible that this strength gain occurs in natural vision.

Present status of fuel motion detection by radiation

International Nuclear Information System (INIS)

Sumita, Kenji; Mizuta, Hiroshi; Ishizuka, Makoto; Ara, Katsuyuki; Nakata, Hirokatsu.

1978-05-01

In reactor safety research, it is important to know transient fuel behavior under accidental conditions. Transient histories such as temperature and axial expansion of fuel and cladding and internal pressure of fuel rod are thus measured in experiments simulating accidents. If fuel motion could then be observed during and after fuel failure, this would greatly make for fuel behavior research. The present status is reviewed of fuel motion detections by radiations such as neutron, γ-ray and X-ray, including the principle and system. A neutron hodoscope among them is used already with practical results in in-reactor safety experiments of sodium-cooled fast breeder reactor. So, this is described in detail and its conceptual design as applied to the NSRR is presented. (auth.)

A high and low noise model for strong motion accelerometers

Science.gov (United States)

Clinton, J. F.; Cauzzi, C.; Olivieri, M.

2010-12-01

We present reference noise models for high-quality strong motion accelerometer installations. We use continuous accelerometer data acquired by the Swiss Seismological Service (SED) since 2006 and other international high-quality accelerometer network data to derive very broadband (50Hz-100s) high and low noise models. The proposed noise models are compared to the Peterson (1993) low and high noise models designed for broadband seismometers; the datalogger self-noise; background noise levels at existing Swiss strong motion stations; and typical earthquake signals recorded in Switzerland and worldwide. The standard strong motion station operated by the SED consists of a Kinemetrics Episensor (2g clip level; flat acceleration response from 200 Hz to DC; insulated sensor / datalogger systems placed in vault quality sites. At all frequencies, there is at least one order of magnitude between the ALNM and the AHNM; at high frequencies (> 1Hz) this extends to 2 orders of magnitude. This study provides remarkable confirmation of the capability of modern strong motion accelerometers to record low-amplitude ground motions with seismic observation quality. In particular, an accelerometric station operating at the ALNM is capable of recording the full spectrum of near source earthquakes, out to 100 km, down to M2. Of particular interest for the SED, this study provides acceptable noise limits for candidate sites for the on-going Strong Motion Network modernisation.

Hydration level is an internal variable for computing motivation to obtain water rewards in monkeys.

Science.gov (United States)

Minamimoto, Takafumi; Yamada, Hiroshi; Hori, Yukiko; Suhara, Tetsuya

2012-05-01

In the process of motivation to engage in a behavior, valuation of the expected outcome is comprised of not only external variables (i.e., incentives) but also internal variables (i.e., drive). However, the exact neural mechanism that integrates these variables for the computation of motivational value remains unclear. Besides, the signal of physiological needs, which serves as the primary internal variable for this computation, remains to be identified. Concerning fluid rewards, the osmolality level, one of the physiological indices for the level of thirst, may be an internal variable for valuation, since an increase in the osmolality level induces drinking behavior. Here, to examine the relationship between osmolality and the motivational value of a water reward, we repeatedly measured the blood osmolality level, while 2 monkeys continuously performed an instrumental task until they spontaneously stopped. We found that, as the total amount of water earned increased, the osmolality level progressively decreased (i.e., the hydration level increased) in an individual-dependent manner. There was a significant negative correlation between the error rate of the task (the proportion of trials with low motivation) and the osmolality level. We also found that the increase in the error rate with reward accumulation can be well explained by a formula describing the changes in the osmolality level. These results provide a biologically supported computational formula for the motivational value of a water reward that depends on the hydration level, enabling us to identify the neural mechanism that integrates internal and external variables.

Virtual water flows in the international trade of agricultural products of China.

Science.gov (United States)

Zhang, Yu; Zhang, Jinhe; Tang, Guorong; Chen, Min; Wang, Lachun

2016-07-01

With the rapid development of the economy and population, water scarcity and poor water quality caused by water pollution have become increasingly severe in China. Virtual water trade is a useful tool to alleviate water shortage. This paper focuses on a comprehensive study of China's international virtual water flows from agricultural products trade and completes a diachronic analysis from 2001 to 2013. The results show that China was in trade surplus in relation to the virtual water trade of agricultural products. The exported virtual water amounted to 29.94billionm(3)/yr. while 155.55billionm(3)/yr. was embedded in imported products. The trend that China exported virtual water per year was on the decline while the imported was on a rising trend. Virtual water trade of China was highly concentrated. Not all of the exported products had comparative advantages in virtual water content. Imported products were excessively concentrated on water intensive agricultural products such as soya beans, cotton, and palm oil. The exported virtual water mainly flowed to the Republic of Korea, Hong Kong of China and Japan, while the imported mainly flowed from the United States of America, Brazil and Argentina. From the ethical point of view, the trade partners were classified into four types in terms of "net import" and "water abundance": mutual benefit countries, such as Australia and Canada; unilateral benefit countries, such as Mongolia and Norway; supported countries, such as Egypt and Singapore; and double pressure countries, such as India and Pakistan. Virtual water strategy refers to water resources, agricultural products and human beings. The findings are beneficial for innovating water resources management system, adjusting trade structure, ensuring food security in China, and promoting the construction of national ecological security system. Copyright © 2016 Elsevier B.V. All rights reserved.

Direct Contribution of Auditory Motion Information to Sound-Induced Visual Motion Perception

Directory of Open Access Journals (Sweden)

Souta Hidaka

2011-10-01

Full Text Available We have recently demonstrated that alternating left-right sound sources induce motion perception to static visual stimuli along the horizontal plane (SIVM: sound-induced visual motion perception, Hidaka et al., 2009. The aim of the current study was to elucidate whether auditory motion signals, rather than auditory positional signals, can directly contribute to the SIVM. We presented static visual flashes at retinal locations outside the fovea together with a lateral auditory motion provided by a virtual stereo noise source smoothly shifting in the horizontal plane. The flashes appeared to move in the situation where auditory positional information would have little influence on the perceived position of visual stimuli; the spatiotemporal position of the flashes was in the middle of the auditory motion trajectory. Furthermore, the auditory motion altered visual motion perception in a global motion display; in this display, different localized motion signals of multiple visual stimuli were combined to produce a coherent visual motion perception so that there was no clear one-to-one correspondence between the auditory stimuli and each visual stimulus. These findings suggest the existence of direct interactions between the auditory and visual modalities in motion processing and motion perception.

Internal wave turbulence near a Texel beach.

Directory of Open Access Journals (Sweden)

Hans van Haren

Full Text Available A summer bather entering a calm sea from the beach may sense alternating warm and cold water. This can be felt when moving forward into the sea ('vertically homogeneous' and 'horizontally different', but also when standing still between one's feet and body ('vertically different'. On a calm summer-day, an array of high-precision sensors has measured fast temperature-changes up to 1 °C near a Texel-island (NL beach. The measurements show that sensed variations are in fact internal waves, fronts and turbulence, supported in part by vertical stable stratification in density (temperature. Such motions are common in the deep ocean, but generally not in shallow seas where turbulent mixing is expected strong enough to homogenize. The internal beach-waves have amplitudes ten-times larger than those of the small surface wind waves. Quantifying their turbulent mixing gives diffusivity estimates of 10(-4-10(-3 m(2 s(-1, which are larger than found in open-ocean but smaller than wave breaking above deep sloping topography.

Motions and electrostatic interactions in natural and semisynthetic myoglobins: a carbon-13 nuclear magnetic resonance study

International Nuclear Information System (INIS)

Maskalick, D.G.

1984-01-01

It is expected that the internal motions of amino acid side chains and protein backbone segments influence and are in turn affected by charge-charge and related interactions, steric constraints, hydrophobic forces, and hydrogen bonding. As an initial test of this theory 13 C-enriched glycine, alanine, and isoleucine have been substituted for the amino terminal valine of sperm whale myoglobin using semisynthetic techniques. 13 C-NMR has been used to analyze the motions of the side chain and the protonation state of the alpha amino group as a function of pH. The addition of a single methyl group to the side chain can alter the alpha amino pK value by as much as 0.3 pH units indicating a delicately balanced set of change-charge interactions between the alpha amino group and the rest of the protein. Further evidence in support of the state theory was found upon examination of the internal motions of seven of nine isoleucine vectors. These motions were extracted from natural abundance 13 C-NMR relaxation data. The results suggest a strong possibility that concerted motions are important. Also, an increase in temperature from 32 0 C to 52 0 C leads to an electrostatically driven tightening of the myoglobin structure as evidenced by no significant increase in motion amplitude of most of the vectors

Development of a real-time internal and external marker tracking system for particle therapy: a phantom study using patient tumor trajectory data.

Science.gov (United States)

Cho, Junsang; Cheon, Wonjoong; Ahn, Sanghee; Jung, Hyunuk; Sheen, Heesoon; Park, Hee Chul; Han, Youngyih

2017-09-01

Target motion-induced uncertainty in particle therapy is more complicated than that in X-ray therapy, requiring more accurate motion management. Therefore, a hybrid motion-tracking system that can track internal tumor motion and as well as an external surrogate of tumor motion was developed. Recently, many correlation tests between internal and external markers in X-ray therapy have been developed; however, the accuracy of such internal/external marker tracking systems, especially in particle therapy, has not yet been sufficiently tested. In this article, the process of installing an in-house hybrid internal/external motion-tracking system is described and the accuracy level of tracking system was acquired. Our results demonstrated that the developed in-house external/internal combined tracking system has submillimeter accuracy, and can be clinically used as a particle therapy system as well as a simulation system for moving tumor treatment. © The Author 2017. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

Brownian motion using video capture

International Nuclear Information System (INIS)

Salmon, Reese; Robbins, Candace; Forinash, Kyle

2002-01-01

Although other researchers had previously observed the random motion of pollen grains suspended in water through a microscope, Robert Brown's name is associated with this behaviour based on observations he made in 1828. It was not until Einstein's work in the early 1900s however, that the origin of this irregular motion was established to be the result of collisions with molecules which were so small as to be invisible in a light microscope (Einstein A 1965 Investigations on the Theory of the Brownian Movement ed R Furth (New York: Dover) (transl. Cowper A D) (5 papers)). Jean Perrin in 1908 (Perrin J 1923 Atoms (New York: Van Nostrand-Reinhold) (transl. Hammick D)) was able, through a series of painstaking experiments, to establish the validity of Einstein's equation. We describe here the details of a junior level undergraduate physics laboratory experiment where students used a microscope, a video camera and video capture software to verify Einstein's famous calculation of 1905. (author)

A multistage motion vector processing method for motion-compensated frame interpolation.

Science.gov (United States)

Huang, Ai- Mei; Nguyen, Truong Q

2008-05-01

In this paper, a novel, low-complexity motion vector processing algorithm at the decoder is proposed for motion-compensated frame interpolation or frame rate up-conversion. We address the problems of having broken edges and deformed structures in an interpolated frame by hierarchically refining motion vectors on different block sizes. Our method explicitly considers the reliability of each received motion vector and has the capability of preserving the structure information. This is achieved by analyzing the distribution of residual energies and effectively merging blocks that have unreliable motion vectors. The motion vector reliability information is also used as a prior knowledge in motion vector refinement using a constrained vector median filter to avoid choosing identical unreliable one. We also propose using chrominance information in our method. Experimental results show that the proposed scheme has better visual quality and is also robust, even in video sequences with complex scenes and fast motion.

Motion in radiotherapy

DEFF Research Database (Denmark)

Korreman, Stine Sofia

2012-01-01

This review considers the management of motion in photon radiation therapy. An overview is given of magnitudes and variability of motion of various structures and organs, and how the motion affects images by producing artifacts and blurring. Imaging of motion is described, including 4DCT and 4DPE...

High power cable with internal water cooling 400 kV

Science.gov (United States)

Rasquin, W.; Harjes, B.

1982-08-01

Due to the concentration of electricity production in large power plants, the need of higher power transmissions, and the protection of environment, developement of a 400 kV water cooled cable in the power range of 1 to 5 GVA was undertaken. The fabrication and testing of equipment, engineering of cable components, fabrication of a test cable, development of cable terminal laboratory, testing of test cable, field testing of test cable, fabrication of industrial cable laboratory, testing of industrial cable, field testing of industrial cable, and system analysis for optimization were prepared. The field testing was impossible to realize. However, it is proved that a cable consisting of an internal stainless steel water cooled tube, covered by stranded copper profiles, insulated with heavy high quality paper, and protected by an aluminum cover can be produced, withstand tests accordingly to IEC/VDE recommendations, and is able to fulfill all exploitation conditions.

Digital Motion Imagery, Interoperability Challenges for Space Operations

Science.gov (United States)

Grubbs, Rodney

2012-01-01

With advances in available bandwidth from spacecraft and between terrestrial control centers, digital motion imagery and video is becoming more practical as a data gathering tool for science and engineering, as well as for sharing missions with the public. The digital motion imagery and video industry has done a good job of creating standards for compression, distribution, and physical interfaces. Compressed data streams can easily be transmitted or distributed over radio frequency, internet protocol, and other data networks. All of these standards, however, can make sharing video between spacecraft and terrestrial control centers a frustrating and complicated task when different standards and protocols are used by different agencies. This paper will explore the challenges presented by the abundance of motion imagery and video standards, interfaces and protocols with suggestions for common formats that could simplify interoperability between spacecraft and ground support systems. Real-world examples from the International Space Station will be examined. The paper will also discuss recent trends in the development of new video compression algorithms, as well likely expanded use of Delay (or Disruption) Tolerant Networking nodes.

MO-B-201-02: Motion Management for Proton Lung SBR

Energy Technology Data Exchange (ETDEWEB)

Flampouri, S. [University of Florida Proton Therapy Institute (United States)

2016-06-15

The motion management in stereotactic body radiation therapy (SBRT) is a key to success for a SBRT program, and still an on-going challenging task. A major factor is that moving structures behave differently than standing structures when examined by imaging modalities, and thus require special considerations and employments. Understanding the motion effects to these different imaging processes is a prerequisite for a decent motion management program. The commonly used motion control techniques to physically restrict tumor motion, if adopted correctly, effectively increase the conformity and accuracy of hypofractionated treatment. The effective application of such requires one to understand the mechanics of the application and the related physiology especially related to respiration. The image-guided radiation beam control, or tumor tracking, further realized the endeavor for precision-targeting. During tumor tracking, the respiratory motion is often constantly monitored by non-ionizing beam sources using the body surface as its surrogate. This then has to synchronize with the actual internal tumor motion. The latter is often accomplished by stereo X-ray imaging or similar techniques. With these advanced technologies, one may drastically reduce the treated volume and increase the clinicians’ confidence for a high fractional ablative radiation dose. However, the challenges in implementing the motion management may not be trivial and is dependent on each clinic case. This session of presentations is intended to provide an overview of the current techniques used in managing the tumor motion in SBRT, specifically for routine lung SBRT, proton based treatments, and newly-developed MR guided RT. Learning Objectives: Through this presentation, the audience will understand basic roles of commonly used imaging modalities for lung cancer studies; familiarize the major advantages and limitations of each discussed motion control methods; familiarize the major advantages and

MO-B-201-02: Motion Management for Proton Lung SBR

International Nuclear Information System (INIS)

Flampouri, S.

2016-01-01

The motion management in stereotactic body radiation therapy (SBRT) is a key to success for a SBRT program, and still an on-going challenging task. A major factor is that moving structures behave differently than standing structures when examined by imaging modalities, and thus require special considerations and employments. Understanding the motion effects to these different imaging processes is a prerequisite for a decent motion management program. The commonly used motion control techniques to physically restrict tumor motion, if adopted correctly, effectively increase the conformity and accuracy of hypofractionated treatment. The effective application of such requires one to understand the mechanics of the application and the related physiology especially related to respiration. The image-guided radiation beam control, or tumor tracking, further realized the endeavor for precision-targeting. During tumor tracking, the respiratory motion is often constantly monitored by non-ionizing beam sources using the body surface as its surrogate. This then has to synchronize with the actual internal tumor motion. The latter is often accomplished by stereo X-ray imaging or similar techniques. With these advanced technologies, one may drastically reduce the treated volume and increase the clinicians’ confidence for a high fractional ablative radiation dose. However, the challenges in implementing the motion management may not be trivial and is dependent on each clinic case. This session of presentations is intended to provide an overview of the current techniques used in managing the tumor motion in SBRT, specifically for routine lung SBRT, proton based treatments, and newly-developed MR guided RT. Learning Objectives: Through this presentation, the audience will understand basic roles of commonly used imaging modalities for lung cancer studies; familiarize the major advantages and limitations of each discussed motion control methods; familiarize the major advantages and

Assessing the effects of subject motion on T2 relaxation under spin tagging (TRUST) cerebral oxygenation measurements using volume navigators.

Science.gov (United States)

Stout, Jeffrey N; Tisdall, M Dylan; McDaniel, Patrick; Gagoski, Borjan; Bolar, Divya S; Grant, Patricia Ellen; Adalsteinsson, Elfar

2017-12-01

Subject motion may cause errors in estimates of blood T 2 when using the T 2 -relaxation under spin tagging (TRUST) technique on noncompliant subjects like neonates. By incorporating 3D volume navigators (vNavs) into the TRUST pulse sequence, independent measurements of motion during scanning permit evaluation of these errors. The effects of integrated vNavs on TRUST-based T 2 estimates were evaluated using simulations and in vivo subject data. Two subjects were scanned with the TRUST+vNav sequence during prescribed movements. Mean motion scores were derived from vNavs and TRUST images, along with a metric of exponential fit quality. Regression analysis was performed between T 2 estimates and mean motion scores. Also, motion scores were determined from independent neonatal scans. vNavs negligibly affected venous blood T 2 estimates and better detected subject motion than fit quality metrics. Regression analysis showed that T 2 is biased upward by 4.1 ms per 1 mm of mean motion score. During neonatal scans, mean motion scores of 0.6 to 2.0 mm were detected. Motion during TRUST causes an overestimate of T 2 , which suggests a cautious approach when comparing TRUST-based cerebral oxygenation measurements of noncompliant subjects. Magn Reson Med 78:2283-2289, 2017. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

Smoothing Motion Estimates for Radar Motion Compensation.

Energy Technology Data Exchange (ETDEWEB)

Doerry, Armin W. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

2017-07-01

Simple motion models for complex motion environments are often not adequate for keeping radar data coherent. Eve n perfect motion samples appli ed to imperfect models may lead to interim calculations e xhibiting errors that lead to degraded processing results. Herein we discuss a specific i ssue involving calculating motion for groups of pulses, with measurements only available at pulse-group boundaries. - 4 - Acknowledgements This report was funded by General A tomics Aeronautical Systems, Inc. (GA-ASI) Mission Systems under Cooperative Re search and Development Agre ement (CRADA) SC08/01749 between Sandia National Laboratories and GA-ASI. General Atomics Aeronautical Systems, Inc. (GA-ASI), an affilia te of privately-held General Atomics, is a leading manufacturer of Remotely Piloted Aircraft (RPA) systems, radars, and electro-optic and rel ated mission systems, includin g the Predator(r)/Gray Eagle(r)-series and Lynx(r) Multi-mode Radar.

Replica exchange simulation of reversible folding/unfolding of the Trp-cage miniprotein in explicit solvent: on the structure and possible role of internal water.

Science.gov (United States)

Paschek, Dietmar; Nymeyer, Hugh; García, Angel E

2007-03-01

We simulate the folding/unfolding equilibrium of the 20-residue miniprotein Trp-cage. We use replica exchange molecular dynamics simulations of the AMBER94 atomic detail model of the protein explicitly solvated by water, starting from a completely unfolded configuration. We employ a total of 40 replicas, covering the temperature range between 280 and 538 K. Individual simulation lengths of 100 ns sum up to a total simulation time of about 4 micros. Without any bias, we observe the folding of the protein into the native state with an unfolding-transition temperature of about 440 K. The native state is characterized by a distribution of root mean square distances (RMSD) from the NMR data that peaks at 1.8A, and is as low as 0.4A. We show that equilibration times of about 40 ns are required to yield convergence. A folded configuration in the entire extended ensemble is found to have a lifetime of about 31 ns. In a clamp-like motion, the Trp-cage opens up during thermal denaturation. In line with fluorescence quenching experiments, the Trp-residue sidechain gets hydrated when the protein opens up, roughly doubling the number of water molecules in the first solvation shell. We find the helical propensity of the helical domain of Trp-cage rather well preserved even at very high temperatures. In the folded state, we can identify states with one and two buried internal water molecules interconnecting parts of the Trp-cage molecule by hydrogen bonds. The loss of hydrogen bonds of these buried water molecules in the folded state with increasing temperature is likely to destabilize the folded state at elevated temperatures.

Directional Limits on Motion Transparency Assessed Through Colour-Motion Binding.

Science.gov (United States)

Maloney, Ryan T; Clifford, Colin W G; Mareschal, Isabelle

2018-03-01

Motion-defined transparency is the perception of two or more distinct moving surfaces at the same retinal location. We explored the limits of motion transparency using superimposed surfaces of randomly positioned dots defined by differences in motion direction and colour. In one experiment, dots were red or green and we varied the proportion of dots of a single colour that moved in a single direction ('colour-motion coherence') and measured the threshold direction difference for discriminating between two directions. When colour-motion coherences were high (e.g., 90% of red dots moving in one direction), a smaller direction difference was required to correctly bind colour with direction than at low coherences. In another experiment, we varied the direction difference between the surfaces and measured the threshold colour-motion coherence required to discriminate between them. Generally, colour-motion coherence thresholds decreased with increasing direction differences, stabilising at direction differences around 45°. Different stimulus durations were compared, and thresholds were higher at the shortest (150 ms) compared with the longest (1,000 ms) duration. These results highlight different yet interrelated aspects of the task and the fundamental limits of the mechanisms involved: the resolution of narrowly separated directions in motion processing and the local sampling of dot colours from each surface.

Effects of deformability and thermal motion of lipid membrane on electroporation: By molecular dynamics simulations

International Nuclear Information System (INIS)

Sun, Sheng; Yin, Guangyao; Lee, Yi-Kuen; Wong, Joseph T.Y.; Zhang, Tong-Yi

2011-01-01

Research highlights: → MD simulations show that deformability and thermal motion of membrane affect electroporation. → Stiffer membrane inhibits electroporation and makes water penetrate from both sides. → Higher temperature accelerates electroporation. -- Abstract: Effects of mechanical properties and thermal motion of POPE lipid membrane on electroporation were studied by molecular dynamics simulations. Among simulations in which specific atoms of lipids were artificially constrained at their equilibrium positions using a spring with force constant of 2.0 kcal/(mol A 2 ) in the external electric field of 1.4 kcal/(mol A e), only constraint on lateral motions of lipid tails prohibited electroporation while non-tail parts had little effects. When force constant decreased to 0.2 kcal/(mol A 2 ) in the position constraints on lipid tails in the external electric field of 2.0 kcal/(mol A e), water molecules began to enter the membrane. Position constraints of lipid tails allow water to penetrate from both sides of membrane. Thermal motion of lipids can induce initial defects in the hydrophobic core of membrane, which are favorable nucleation sites for electroporation. Simulations at different temperatures revealed that as the temperature increases, the time taken to the initial pore formation will decrease.

Simulation of range imaging-based estimation of respiratory lung motion. Influence of noise, signal dimensionality and sampling patterns.

Science.gov (United States)

Wilms, M; Werner, R; Blendowski, M; Ortmüller, J; Handels, H

2014-01-01

A major problem associated with the irradiation of thoracic and abdominal tumors is respiratory motion. In clinical practice, motion compensation approaches are frequently steered by low-dimensional breathing signals (e.g., spirometry) and patient-specific correspondence models, which are used to estimate the sought internal motion given a signal measurement. Recently, the use of multidimensional signals derived from range images of the moving skin surface has been proposed to better account for complex motion patterns. In this work, a simulation study is carried out to investigate the motion estimation accuracy of such multidimensional signals and the influence of noise, the signal dimensionality, and different sampling patterns (points, lines, regions). A diffeomorphic correspondence modeling framework is employed to relate multidimensional breathing signals derived from simulated range images to internal motion patterns represented by diffeomorphic non-linear transformations. Furthermore, an automatic approach for the selection of optimal signal combinations/patterns within this framework is presented. This simulation study focuses on lung motion estimation and is based on 28 4D CT data sets. The results show that the use of multidimensional signals instead of one-dimensional signals significantly improves the motion estimation accuracy, which is, however, highly affected by noise. Only small differences exist between different multidimensional sampling patterns (lines and regions). Automatically determined optimal combinations of points and lines do not lead to accuracy improvements compared to results obtained by using all points or lines. Our results show the potential of multidimensional breathing signals derived from range images for the model-based estimation of respiratory motion in radiation therapy.

MotionExplorer: exploratory search in human motion capture data based on hierarchical aggregation.

Science.gov (United States)

Bernard, Jürgen; Wilhelm, Nils; Krüger, Björn; May, Thorsten; Schreck, Tobias; Kohlhammer, Jörn

2013-12-01

We present MotionExplorer, an exploratory search and analysis system for sequences of human motion in large motion capture data collections. This special type of multivariate time series data is relevant in many research fields including medicine, sports and animation. Key tasks in working with motion data include analysis of motion states and transitions, and synthesis of motion vectors by interpolation and combination. In the practice of research and application of human motion data, challenges exist in providing visual summaries and drill-down functionality for handling large motion data collections. We find that this domain can benefit from appropriate visual retrieval and analysis support to handle these tasks in presence of large motion data. To address this need, we developed MotionExplorer together with domain experts as an exploratory search system based on interactive aggregation and visualization of motion states as a basis for data navigation, exploration, and search. Based on an overview-first type visualization, users are able to search for interesting sub-sequences of motion based on a query-by-example metaphor, and explore search results by details on demand. We developed MotionExplorer in close collaboration with the targeted users who are researchers working on human motion synthesis and analysis, including a summative field study. Additionally, we conducted a laboratory design study to substantially improve MotionExplorer towards an intuitive, usable and robust design. MotionExplorer enables the search in human motion capture data with only a few mouse clicks. The researchers unanimously confirm that the system can efficiently support their work.

A programmable motion phantom for quality assurance of motion management in radiotherapy

International Nuclear Information System (INIS)

Dunn, L.; Franich, R.D.; Kron, T.; Taylor, M.L.; Johnston, P.N.; McDermott, L.N.; Callahan, J.

2012-01-01

A commercially available motion phantom (QUASAR, Modus Medical) was modified for programmable motion control with the aim of reproducing patient respiratory motion in one dimension in both the anterior–posterior and superior–inferior directions, as well as, providing controllable breath-hold and sinusoidal patterns for the testing of radiotherapy gating systems. In order to simulate realistic patient motion, the DC motor was replaced by a stepper motor. A separate 'chest-wall' motion platform was also designed to accommodate a variety of surrogate marker systems. The platform employs a second stepper motor that allows for the decoupling of the chest-wall and insert motion. The platform's accuracy was tested by replicating patient traces recorded with the Varian real-time position management (RPM) system and comparing the motion platform's recorded motion trace with the original patient data. Six lung cancer patient traces recorded with the RPM system were uploaded to the motion platform's in-house control software and subsequently replicated through the phantom motion platform. The phantom's motion profile was recorded with the RPM system and compared to the original patient data. Sinusoidal and breath-hold patterns were simulated with the motion platform and recorded with the RPM system to verify the systems potential for routine quality assurance of commercial radiotherapy gating systems. There was good correlation between replicated and actual patient data (P 0.003). Mean differences between the location of maxima in replicated and patient data-sets for six patients amounted to 0.034 cm with the corresponding minima mean equal to 0.010 cm. The upgraded motion phantom was found to replicate patient motion accurately as well as provide useful test patterns to aid in the quality assurance of motion management methods and technologies.

Indirect wrist MR arthrography: the effects of passive motion versus active exercise

Energy Technology Data Exchange (ETDEWEB)

Schweitzer, M.E.; Natale, P.; Winalski, C.S.; Culp, R. [Thomas Jefferson University Hospital, Department of Radiology, Philadelphia, PA (United States)

2000-01-01

Purpose. In the wrist, to determine whether passive motion or active exercise yields a better indirect MR arthrographic effect following intravenous gadolinium administration.Design and patients. Twenty-six consecutive patients were studied by indirect wrist MR arthrography. In half active exercise and in half passive motion was performed. Four regions of interest were studied including the distal radioulnar joint, the radiocarpal joint, the midcarpal joint, and the triangular fibrocartilage. Ranges and means of signal intensity were calculated. Surgical follow-up was performed in 22 patients.Results. The joint fluid intensity was greatest in the distal radioulnar joint. Fluid signal intensity was greater and more consistent in the passive motion group although the results did not achieve statistical significance. Imaging accuracy appeared similar in the two groups and was excellent for the triangular fibrocartilage (100%) and scapholunate ligaments (96%).Conclusion. Active exercise and passive motion yield similar degrees of wrist arthrographic effect, but the effect of passive motion is somewhat more consistent. Preliminary data show good accuracy for internal derangements. (orig.)

Internal and external force-based impedance control for cooperative manipulation

NARCIS (Netherlands)

Heck, D.J.F.; Kostic, D.; Denasi, A.; Nijmeijer, H.

2013-01-01

An asymptotically stable cascaded control algorithm is proposed for cooperative manipulation of a common object. This algorithm controls motion and internal forces of the object, as well as the contact forces between the object and environment. The motion of each manipulator is controlled using an

An International Survey of Electric Storage Tank Water Heater Efficiency and Standards

Energy Technology Data Exchange (ETDEWEB)

Johnson, Alissa; Lutz, James; McNeil, Michael A.; Covary, Theo

2013-11-13

Water heating is a main consumer of energy in households, especially in temperate and cold climates. In South Africa, where hot water is typically provided by electric resistance storage tank water heaters (geysers), water heating energy consumption exceeds cooking, refrigeration, and lighting to be the most consumptive single electric appliance in the home. A recent analysis for the Department of Trade and Industry (DTI) performed by the authors estimated that standing losses from electric geysers contributed over 1,000 kWh to the annual electricity bill for South African households that used them. In order to reduce this burden, the South African government is currently pursuing a programme of Energy Efficiency Standards and Labelling (EES&L) for electric appliances, including geysers. In addition, Eskom has a history of promoting heat pump water heaters (HPWH) through incentive programs, which can further reduce energy consumption. This paper provides a survey of international electric storage water heater test procedures and efficiency metrics which can serve as a reference for comparison with proposed geyser standards and ratings in South Africa. Additionally it provides a sample of efficiency technologies employed to improve the efficiency of electric storage water heaters, and outlines programs to promote adoption of improved efficiency. Finally, it surveys current programs used to promote HPWH and considers the potential for this technology to address peak demand more effectively than reduction of standby losses alone

Water quality - Determination of tritium activity concentration - Liquid scintillation counting method (International Standard Publication ISO 9698:1989)

International Nuclear Information System (INIS)

Stefanik, J.

1999-01-01

This International Standard specifies a method for the determination of tritiated water ([ 3 H]H 2 O) activity concentration in water by liquid scintillation counting. The method is applicable to all types of water including seawater with tritium activity concentrations of up to 10 6 Bq/m 3 when using 20 ml counting vials. Below tritium activity concentrations of about 5 x 10 4 Bq/m 3[ 8], a prior enrichment step and/or the measurement of larger sample volumes can significantly improve the accuracy of the determination and lower the limit of detection. Tritium activity concentrations higher than 10 6 Bq/m 3 may be determined after appropriate dilution with distilled water of proven low tritium content. An alternative method for the determination of these higher activities involves increasing the tritium activity concentrations of the internal standard solution. The method is not applicable to the analysis of organically bound tritium; its determination requires an oxidative digestion

Measurements of ground motion and magnet vibrations at the APS

International Nuclear Information System (INIS)

Shiltsev, V.

1996-01-01

This article presents results of ground motion and magnet vibrations measurements at the Advanced Photon Source. The experiments were done over a wide, frequency range (0-05-100 Hz) with the use of SM-3KV-type seismic probes from the Budker Institute of Nuclear Physics (Russia). Spectral power densities of vertical and horizontal motions of the APS hall floor and quadrupoles on regular supports were obtained. Also investigated were magnet vibrations induced by designed cooling water flow and spectral characteristics of spatial correlation of the quadrupole vibrations at different sectors of the ring. The influence of personnel activity in the hall and traffic under the ring on the slow motion of storage ring elements were observed. Amplitudes of vibrations at the APS are compared with results of seismic measurements at some other accelerators

Software package for modeling spin-orbit motion in storage rings

Science.gov (United States)

Zyuzin, D. V.

2015-12-01

A software package providing a graphical user interface for computer experiments on the motion of charged particle beams in accelerators, as well as analysis of obtained data, is presented. The software package was tested in the framework of the international project on electric dipole moment measurement JEDI (Jülich Electric Dipole moment Investigations). The specific features of particle spin motion imply the requirement to use a cyclic accelerator (storage ring) consisting of electrostatic elements, which makes it possible to preserve horizontal polarization for a long time. Computer experiments study the dynamics of 106-109 particles in a beam during 109 turns in an accelerator (about 1012-1015 integration steps for the equations of motion). For designing an optimal accelerator structure, a large number of computer experiments on polarized beam dynamics are required. The numerical core of the package is COSY Infinity, a program for modeling spin-orbit dynamics.

Structural motion engineering

CERN Document Server

Connor, Jerome

2014-01-01

This innovative volume provides a systematic treatment of the basic concepts and computational procedures for structural motion design and engineering for civil installations. The authors illustrate the application of motion control to a wide spectrum of buildings through many examples. Topics covered include optimal stiffness distributions for building-type structures, the role of damping in controlling motion, tuned mass dampers, base isolation systems, linear control, and nonlinear control. The book's primary objective is the satisfaction of motion-related design requirements, such as restrictions on displacement and acceleration. The book is ideal for practicing engineers and graduate students. This book also: ·         Broadens practitioners' understanding of structural motion control, the enabling technology for motion-based design ·         Provides readers the tools to satisfy requirements of modern, ultra-high strength materials that lack corresponding stiffness, where the motion re...

An internal reference model-based PRF temperature mapping method with Cramer-Rao lower bound noise performance analysis.

Science.gov (United States)

Li, Cheng; Pan, Xinyi; Ying, Kui; Zhang, Qiang; An, Jing; Weng, Dehe; Qin, Wen; Li, Kuncheng

2009-11-01

The conventional phase difference method for MR thermometry suffers from disturbances caused by the presence of lipid protons, motion-induced error, and field drift. A signal model is presented with multi-echo gradient echo (GRE) sequence using a fat signal as an internal reference to overcome these problems. The internal reference signal model is fit to the water and fat signals by the extended Prony algorithm and the Levenberg-Marquardt algorithm to estimate the chemical shifts between water and fat which contain temperature information. A noise analysis of the signal model was conducted using the Cramer-Rao lower bound to evaluate the noise performance of various algorithms, the effects of imaging parameters, and the influence of the water:fat signal ratio in a sample on the temperature estimate. Comparison of the calculated temperature map and thermocouple temperature measurements shows that the maximum temperature estimation error is 0.614 degrees C, with a standard deviation of 0.06 degrees C, confirming the feasibility of this model-based temperature mapping method. The influence of sample water:fat signal ratio on the accuracy of the temperature estimate is evaluated in a water-fat mixed phantom experiment with an optimal ratio of approximately 0.66:1. (c) 2009 Wiley-Liss, Inc.

Examination of faults active motion on buried pipelines | Parish ...

African Journals Online (AJOL)

... lateral spreading, landslides and slope failures. Since the pipelines are widely spread, and in some areas necessarily cross through the areas with faults, therefore, improvement study of pipelines in areas with faults is very important. This article explores faults active motion on buried pipelines. Keywords: water utilities ...

External respiratory motion for abdominal radiotherapy patients: implications for patient alignment

International Nuclear Information System (INIS)

Kearvell, Rachel; Ebert, Martin A.

2003-01-01

Conformal external beam radiotherapy relies on accurate spatial positioning of the tumor and normal tissues during treatment. For abdominal patients, this is complicated by the motion of internal organs and the external patient contour due to respiration. As external motion influences the degree of accuracy achievable in patient setup, this motion was studied to provide indication of motions occurring during treatment, as well as to assess the technique of breath-holding at exhale (B-HEX). The motion of external abdominal points (anterior and right lateral) of a series of volunteers was tracked in real-time using an infrared tracking system, with the volunteers in treatment position. The resulting motion data was assessed to evaluate (1) the change in position of each point per breath/breath-hold, (2) the change in position between breaths/breath-holds, and (3) the change in position across the whole recording time. Analysis shows that, for the anterior abdominal point, there is little difference in the variation of position with time for free-breathing as opposed to the B-HEX technique. For the lateral point however, the B-HEX technique reduces the motion during each treatment cycle (i.e., during the breath-hold) and over an extended period (i.e., during a series of breath-holds). The B-HEX technique thus provides greater accuracy for setup to lateral markers and provides the opportunity to reduce systematic and random localization errors

Measurement of time delays in gated radiotherapy for realistic respiratory motions

International Nuclear Information System (INIS)

Chugh, Brige P.; Quirk, Sarah; Conroy, Leigh; Smith, Wendy L.

2014-01-01

Purpose: Gated radiotherapy is used to reduce internal motion margins, escalate target dose, and limit normal tissue dose; however, its temporal accuracy is limited. Beam-on and beam-off time delays can lead to treatment inefficiencies and/or geographic misses; therefore, AAPM Task Group 142 recommends verifying the temporal accuracy of gating systems. Many groups use sinusoidal phantom motion for this, under the tacit assumption that use of sinusoidal motion for determining time delays produces negligible error. The authors test this assumption by measuring gating time delays for several realistic motion shapes with increasing degrees of irregularity. Methods: Time delays were measured on a linear accelerator with a real-time position management system (Varian TrueBeam with RPM system version 1.7.5) for seven motion shapes: regular sinusoidal; regular realistic-shape; large (40%) and small (10%) variations in amplitude; large (40%) variations in period; small (10%) variations in both amplitude and period; and baseline drift (30%). Film streaks of radiation exposure were generated for each motion shape using a programmable motion phantom. Beam-on and beam-off time delays were determined from the difference between the expected and observed streak length. Results: For the system investigated, all sine, regular realistic-shape, and slightly irregular amplitude variation motions had beam-off and beam-on time delays within the AAPM recommended limit of less than 100 ms. In phase-based gating, even small variations in period resulted in some time delays greater than 100 ms. Considerable time delays over 1 s were observed with highly irregular motion. Conclusions: Sinusoidal motion shapes can be considered a reasonable approximation to the more complex and slightly irregular shapes of realistic motion. When using phase-based gating with predictive filters even small variations in period can result in time delays over 100 ms. Clinical use of these systems for patients

Measurement of time delays in gated radiotherapy for realistic respiratory motions

Energy Technology Data Exchange (ETDEWEB)

Chugh, Brige P.; Quirk, Sarah; Conroy, Leigh; Smith, Wendy L., E-mail: Wendy.Smith@albertahealthservices.ca [Department of Medical Physics, Tom Baker Cancer Centre, Calgary, Alberta T2N 4N2 (Canada)

2014-09-15

Purpose: Gated radiotherapy is used to reduce internal motion margins, escalate target dose, and limit normal tissue dose; however, its temporal accuracy is limited. Beam-on and beam-off time delays can lead to treatment inefficiencies and/or geographic misses; therefore, AAPM Task Group 142 recommends verifying the temporal accuracy of gating systems. Many groups use sinusoidal phantom motion for this, under the tacit assumption that use of sinusoidal motion for determining time delays produces negligible error. The authors test this assumption by measuring gating time delays for several realistic motion shapes with increasing degrees of irregularity. Methods: Time delays were measured on a linear accelerator with a real-time position management system (Varian TrueBeam with RPM system version 1.7.5) for seven motion shapes: regular sinusoidal; regular realistic-shape; large (40%) and small (10%) variations in amplitude; large (40%) variations in period; small (10%) variations in both amplitude and period; and baseline drift (30%). Film streaks of radiation exposure were generated for each motion shape using a programmable motion phantom. Beam-on and beam-off time delays were determined from the difference between the expected and observed streak length. Results: For the system investigated, all sine, regular realistic-shape, and slightly irregular amplitude variation motions had beam-off and beam-on time delays within the AAPM recommended limit of less than 100 ms. In phase-based gating, even small variations in period resulted in some time delays greater than 100 ms. Considerable time delays over 1 s were observed with highly irregular motion. Conclusions: Sinusoidal motion shapes can be considered a reasonable approximation to the more complex and slightly irregular shapes of realistic motion. When using phase-based gating with predictive filters even small variations in period can result in time delays over 100 ms. Clinical use of these systems for patients

Biological quarantine on international waters: an initiative for onboard protocols

Science.gov (United States)

Takano, Yoshinori; Yano, Hajime; Funase, Ryu; Sekine, Yasuhito; Takai, Ken

2012-07-01

The research vessel Chikyu is expanding new frontiers in science, technology, and international collaboration through deep-sea expedition. The Chikyu (length: 210 m, gross tonnage: 56752 tons) has advanced and comprehensive scientific research facilities. One of the scientific purposes of the vessel is to investigate into unexplored biosphere (i.e., undescribed extremophiles) on the Earth. Therefore, "the onboard laboratory" provides us systematic microbiological protocols with a physical containment situation. In parallel, the onboard equipments provide sufficient space for fifty scientists and technical support staff. The helicopter deck also supports various logistics through transporting by a large scale helicopter (See, http://www.jamstec.go.jp/chikyu/eng/). Since the establishment of Panel on Planetary Protection (PPP) in Committee on Space Research (COSPAR), we have an international consensus about the development and promulgation of planetary protection knowledge, policy, and plans to prevent the harmful effects of biological contamination on the Earth (e.g., Rummel, 2002). However, the matter to select a candidate location of initial quarantine at BSL4 level is often problematic. To answer the key issue, we suggest that international waters can be a meaningful option with several advantages to conduct initial onboard-biological quarantine investigation. Hence, the research vessel Chikyu is promising for further PPP requirements (e.g., Enceladus sample return project: Tsou et al., 2012). Rummel, J., Seeking an international consensus in planetary protection: COSPAR's planetary protection panel. Advances in Space Research, 30, 1573-1575 (2002). Tsou, P. et al. LIFE: Life Investigation For Enceladus - A Sample Return Mission Concept in Search for Evidence of Life. Astrobiology, in press.

Effect of site conditions on ground motion and damage

Science.gov (United States)

Borcherdt, R.; Glassmoyer, G.; Andrews, M.; Cranswick, E.

1989-01-01

Results of seismologic studies conducted by the U.S. reconnaissance team in conjunction with Soviet colleagues following the tragic earthquakes of December 7, 1988, suggest that site conditions may have been a major factor in contributing to increased damage levels in Leninakan. As the potential severity of these effects in Leninakan had not been previously identified, this chapter presents results intended to provide a preliminary quantification of these effects on both damage and levels of ground motion observed in Leninakan. The article describes the damage distribution geologic setting, ground motion amplification in Leninakan, including analog amplifications and spectral amplifications. Preliminary model estimates for site response are presented. It is concluded that ground motion amplification in the 0.5-2.5-second period range was a major contributing factor to increased damage in Leninakan as compared with Kirovakan. Leninakan is located on thick water saturated alluvial deposits.

Effectiveness of Manual Therapy and Stretching for Baseball Players With Shoulder Range of Motion Deficits.

Science.gov (United States)

Bailey, Lane B; Thigpen, Charles A; Hawkins, Richard J; Beattie, Paul F; Shanley, Ellen

Baseball players displaying deficits in shoulder range of motion (ROM) are at increased risk of arm injury. Currently, there is a lack of consensus regarding the best available treatment options to restore shoulder ROM. Instrumented manual therapy with self-stretching will result in clinically significant deficit reductions when compared with self-stretching alone. Controlled laboratory study. Shoulder ROM and humeral torsion were assessed in 60 active baseball players (mean age, 19 ± 2 years) with ROM deficits (nondominant - dominant, ≥15°). Athletes were randomly assigned to receive a single treatment of instrumented manual therapy plus self-stretching (n = 30) or self-stretching only (n = 30). Deficits in internal rotation, horizontal adduction, and total arc of motion were compared between groups immediately before and after a single treatment session. Treatment effectiveness was determined by mean comparison data, and a number-needed-to-treat (NNT) analysis was used for assessing the presence of ROM risk factors. Prior to intervention, players displayed significant ( P < 0.001) dominant-sided deficits in internal rotation (-26°), total arc of motion (-18°), and horizontal adduction (-17°). After the intervention, both groups displayed significant improvements in ROM, with the instrumented manual therapy plus self-stretching group displaying greater increases in internal rotation (+5°, P = 0.010), total arc of motion (+6°, P = 0.010), and horizontal adduction (+7°, P = 0.004) compared with self-stretching alone. For horizontal adduction deficits, the added use of instrumented manual therapy with self-stretching decreased the NNT to 2.2 (95% CI, 2.1-2.4; P = 0.010). Instrumented manual therapy with self-stretching significantly reduces ROM risk factors in baseball players with motion deficits when compared with stretching alone. The added benefits of manual therapy may help to reduce ROM deficits in clinical scenarios where stretching alone is

Observing Structure and Motion in Molecules with Ultrafast Strong Field and Short Wavelength Laser Radiation

Energy Technology Data Exchange (ETDEWEB)

Bucksbaum, Philip H

2011-04-13

The term "molecular movie" has come to describe efforts to track and record Angstrom-scale coherent atomic and electronic motion in a molecule. The relevant time scales for this range cover several orders of magnitude, from sub-femtosecond motion associated with electron-electron correlations, to 100-fs internal vibrations, to multi-picosecond motion associated with the dispersion and quantum revivals of molecular reorientation. Conventional methods of cinematography do not work well in this ultrafast and ultrasmall regime, but stroboscopic "pump and probe" techniques can reveal this motion with high fidelity. This talk will describe some of the methods and recent progress in exciting and controlling this motion, using both laboratory lasers and the SLAC Linac Coherent Light Source x-ray free electron laser, and will further try to relate the date to the goal of molecular movies.

Is digital photography an accurate and precise method for measuring range of motion of the shoulder and elbow?

Science.gov (United States)

Russo, Russell R; Burn, Matthew B; Ismaily, Sabir K; Gerrie, Brayden J; Han, Shuyang; Alexander, Jerry; Lenherr, Christopher; Noble, Philip C; Harris, Joshua D; McCulloch, Patrick C

2018-03-01

Accurate measurements of shoulder and elbow motion are required for the management of musculoskeletal pathology. The purpose of this investigation was to compare three techniques for measuring motion. The authors hypothesized that digital photography would be equivalent in accuracy and show higher precision compared to the other two techniques. Using infrared motion capture analysis as the reference standard, shoulder flexion/abduction/internal rotation/external rotation and elbow flexion/extension were measured using visual estimation, goniometry, and digital photography on 10 fresh frozen cadavers. These measurements were performed by three physical therapists and three orthopaedic surgeons. Accuracy was defined by the difference from the reference standard (motion capture analysis), while precision was defined by the proportion of measurements within the authors' definition of clinical significance (10° for all motions except for elbow extension where 5° was used). Analysis of variance (ANOVA), t-tests, and chi-squared tests were used. Although statistically significant differences were found in measurement accuracy between the three techniques, none of these differences met the authors' definition of clinical significance. Precision of the measurements was significantly higher for both digital photography (shoulder abduction [93% vs. 74%, p < 0.001], shoulder internal rotation [97% vs. 83%, p = 0.001], and elbow flexion [93% vs. 65%, p < 0.001]) and goniometry (shoulder abduction [92% vs. 74%, p < 0.001] and shoulder internal rotation [94% vs. 83%, p = 0.008]) than visual estimation. Digital photography was more precise than goniometry for measurements of elbow flexion only [93% vs. 76%, p < 0.001]. There was no clinically significant difference in measurement accuracy between the three techniques for shoulder and elbow motion. Digital photography showed higher measurement precision compared to visual estimation for shoulder abduction, shoulder

The motion planning problem and exponential stabilization of a heavy chain. Part II

OpenAIRE

Piotr Grabowski

2008-01-01

This is the second part of paper [P. Grabowski, The motion planning problem and exponential stabilization of a heavy chain. Part I, to appear in International Journal of Control], where a model of a heavy chain system with a punctual load (tip mass) in the form of a system of partial differential equations was interpreted as an abstract semigroup system and then analysed on a Hilbert state space. In particular, in [P. Grabowski, The motion planning problem and exponential stabilization of a h...

SU-E-J-115: Correlation of Displacement Vector Fields Calculated by Deformable Image Registration Algorithms with Motion Parameters of CT Images with Well-Defined Targets and Controlled-Motion

Energy Technology Data Exchange (ETDEWEB)

Jaskowiak, J; Ahmad, S; Ali, I [University of Oklahoma Health Sciences Center, Oklahoma City, OK (United States); Alsbou, N [Ohio Northern University, Ada, OH (United States)

2015-06-15

Purpose: To investigate correlation of displacement vector fields (DVF) calculated by deformable image registration algorithms with motion parameters in helical axial and cone-beam CT images with motion artifacts. Methods: A mobile thorax phantom with well-known targets with different sizes that were made from water-equivalent material and inserted in foam to simulate lung lesions. The thorax phantom was imaged with helical, axial and cone-beam CT. The phantom was moved with a cyclic motion with different motion amplitudes and frequencies along the superior-inferior direction. Different deformable image registration algorithms including demons, fast demons, Horn-Shunck and iterative-optical-flow from the DIRART software were used to deform CT images for the phantom with different motion patterns. The CT images of the mobile phantom were deformed to CT images of the stationary phantom. Results: The values of displacement vectors calculated by deformable image registration algorithm correlated strongly with motion amplitude where large displacement vectors were calculated for CT images with large motion amplitudes. For example, the maximal displacement vectors were nearly equal to the motion amplitudes (5mm, 10mm or 20mm) at interfaces between the mobile targets lung tissue, while the minimal displacement vectors were nearly equal to negative the motion amplitudes. The maximal and minimal displacement vectors matched with edges of the blurred targets along the Z-axis (motion-direction), while DVF’s were small in the other directions. This indicates that the blurred edges by phantom motion were shifted largely to match with the actual target edge. These shifts were nearly equal to the motion amplitude. Conclusions: The DVF from deformable-image registration algorithms correlated well with motion amplitude of well-defined mobile targets. This can be used to extract motion parameters such as amplitude. However, as motion amplitudes increased, image artifacts increased

Optimizing 4-Dimensional Magnetic Resonance Imaging Data Sampling for Respiratory Motion Analysis of Pancreatic Tumors

Energy Technology Data Exchange (ETDEWEB)

Stemkens, Bjorn, E-mail: b.stemkens@umcutrecht.nl [Department of Radiotherapy, University Medical Center Utrecht, Utrecht (Netherlands); Tijssen, Rob H.N. [Department of Radiotherapy, University Medical Center Utrecht, Utrecht (Netherlands); Senneville, Baudouin D. de [Imaging Division, University Medical Center Utrecht, Utrecht (Netherlands); L' Institut de Mathématiques de Bordeaux, Unité Mixte de Recherche 5251, Centre National de la Recherche Scientifique/University of Bordeaux, Bordeaux (France); Heerkens, Hanne D.; Vulpen, Marco van; Lagendijk, Jan J.W.; Berg, Cornelis A.T. van den [Department of Radiotherapy, University Medical Center Utrecht, Utrecht (Netherlands)

2015-03-01

Purpose: To determine the optimum sampling strategy for retrospective reconstruction of 4-dimensional (4D) MR data for nonrigid motion characterization of tumor and organs at risk for radiation therapy purposes. Methods and Materials: For optimization, we compared 2 surrogate signals (external respiratory bellows and internal MRI navigators) and 2 MR sampling strategies (Cartesian and radial) in terms of image quality and robustness. Using the optimized protocol, 6 pancreatic cancer patients were scanned to calculate the 4D motion. Region of interest analysis was performed to characterize the respiratory-induced motion of the tumor and organs at risk simultaneously. Results: The MRI navigator was found to be a more reliable surrogate for pancreatic motion than the respiratory bellows signal. Radial sampling is most benign for undersampling artifacts and intraview motion. Motion characterization revealed interorgan and interpatient variation, as well as heterogeneity within the tumor. Conclusions: A robust 4D-MRI method, based on clinically available protocols, is presented and successfully applied to characterize the abdominal motion in a small number of pancreatic cancer patients.

A geophone wireless sensor network for investigating glacier stick-slip motion

Science.gov (United States)

Martinez, Kirk; Hart, Jane K.; Basford, Philip J.; Bragg, Graeme M.; Ward, Tyler; Young, David S.

2017-08-01

We have developed an innovative passive borehole geophone system, as part of a wireless environmental sensor network to investigate glacier stick-slip motion. The new geophone nodes use an ARM Cortex-M3 processor with a low power design capable of running on battery power while embedded in the ice. Only data from seismic events was stored, held temporarily on a micro-SD card until they were retrieved by systems on the glacier surface which are connected to the internet. The sampling rates, detection and filtering levels were determined from a field trial using a standard commercial passive seismic system. The new system was installed on the Skalafellsjökull glacier in Iceland and provided encouraging results. The results showed that there was a relationship between surface melt water production and seismic event (ice quakes), and these occurred on a pattern related to the glacier surface melt-water controlled velocity changes (stick-slip motion). Three types of seismic events were identified, which were interpreted to reflect a pattern of till deformation (Type A), basal sliding (Type B) and hydraulic transience (Type C) associated with stick-slip motion.

Picosecond orientational dynamics of water in living cells.

Science.gov (United States)

Tros, Martijn; Zheng, Linli; Hunger, Johannes; Bonn, Mischa; Bonn, Daniel; Smits, Gertien J; Woutersen, Sander

2017-10-12

Cells are extremely crowded, and a central question in biology is how this affects the intracellular water. Here, we use ultrafast vibrational spectroscopy and dielectric-relaxation spectroscopy to observe the random orientational motion of water molecules inside living cells of three prototypical organisms: Escherichia coli, Saccharomyces cerevisiae (yeast), and spores of Bacillus subtilis. In all three organisms, most of the intracellular water exhibits the same random orientational motion as neat water (characteristic time constants ~9 and ~2 ps for the first-order and second-order orientational correlation functions), whereas a smaller fraction exhibits slower orientational dynamics. The fraction of slow intracellular water varies between organisms, ranging from ~20% in E. coli to ~45% in B. subtilis spores. Comparison with the water dynamics observed in solutions mimicking the chemical composition of (parts of) the cytosol shows that the slow water is bound mostly to proteins, and to a lesser extent to other biomolecules and ions.The cytoplasm's crowdedness leads one to expect that cell water is different from bulk water. By measuring the rotational motion of water molecules in living cells, Tros et al. find that apart from a small fraction of water solvating biomolecules, cell water has the same dynamics as bulk water.

Design of a supercritical water-cooled reactor. Pressure vessel and internals

Energy Technology Data Exchange (ETDEWEB)

Fischer, Kai

2008-08-15

The High Performance Light Water Reactor (HPLWR) is a light water reactor with supercritical steam conditions which has been investigated within the 5th Framework Program of the European Commission. Due to the supercritical pressure of 25 MPa, water, used as moderator and as coolant, flows as a single phase through the core and can be directly fed to the turbine. Using the technology of coal fired power plants with supercritical steam conditions, the heat-up in the core is done in several steps to achieve the targeted high steam outlet temperature of 500.C without exceeding available cladding material limits. Based on a first design of a fuel assembly cluster for a HPLWR with a single pass core, the surrounding internals and the reactor pressure vessel (RPV) are dimensioned for the first time, following the safety standards of the nuclear safety standards commission in Germany. Furthermore, this design is extended to the incorporation of core arrangements with two and three passes. The design of the internals and the RPV are verified using mechanical or, in the case of large thermal deformations, combined mechanical and thermal stress analyses. Additionally, a passive safety component for the feedwater inlet of the RPV of the HPLWR is designed. Its purpose is the reduction of the mass flow rate in case of a LOCA for a feedwater line break until further steps are executed. Starting with a simple vortex diode, several steps are executed to enhance the performance of the diode and adapt it to this application. Then, this first design is further optimized using combined 1D and 3D flow analyses. Parametric studies determine the performance and characteristic for changing mass flow rates for this backflow limiter. (orig.)

Thermodynamic insight into spontaneous hydration and rapid water permeation in aquaporins

Energy Technology Data Exchange (ETDEWEB)

Barati Farimani, A.; Aluru, N. R. [Department of Mechanical Science and Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Tajkhorshid, Emad [Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Department of Biochemistry and Center for Biophysics and Computational Biology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States)

2014-08-25

We report here a detailed thermodynamic description of water molecules inside a biological water channel. Taking advantage of high-resolution molecular dynamics trajectories calculated for an aquaporin (AQP) channel, we compute the spatial translational and rotational components of water diffusion and entropy in AQP. Our results reveal that the spontaneous filling and entry of water into the pore in AQPs are driven by an entropic gain. Specifically, water molecules exhibit an elevated degree of rotational motion inside the pore, while their translational motion is slow compared with bulk. The partial charges of the lining asparagine residues at the conserved signature Asn-Pro-Ala motifs play a key role in enhancing rotational diffusion and facilitating dipole flipping of water inside the pore. The frequencies of the translational and rotational motions in the power spectra overlap indicating a strong coupling of these motions in AQPs. A shooting mechanism with diffusive behavior is observed in the extracellular region which might be a key factor in the fast conduction of water in AQPs.

3. SEGMITE International Symposium on Sustainable Development of Surface and Ground Water Resources

International Nuclear Information System (INIS)

Tabrez, A.R.

1999-01-01

The Society of Economic Geologist and Mineral Technologist (SEGMITE), National Institute of Oceanography (NIO) and Association of Geo-scientists for International Development with the collaboration of Export Promotion Bureau, Government of Pakistan has organised this symposium. The third Segmite International Symposium on Sustainable Development of surface and ground water resources was held on 8-10 march 1999 at Karachi, Pakistan. This book gives the conference information, brochure and abstracts of papers presented in the conference. There are about 38 abstracts submitted for the conference and related nature of the materials. Out of these 38 papers 16 are of nuclear oriented which are presented here separately. (A.B.)

IWRM: for sustainable use of water; 50 years of international experience with the concept of integrated water resources management; background document to the FAO/Netherlands conference on water for food an ecosystems, The Hague, 31 January - 5 February 2005

NARCIS (Netherlands)

Snellen, W.B.; Schrevel, A.

2004-01-01

Since the concept was explained in detail at the Dublin Conference in 1992 (International Conference on Water and the Environment: Development Issues for the 21st Century), Integrated Water Resources Management has been at the core of thinking on water resource development. Today, integrated water

Self-referenced coherent diffraction x-ray movie of Ångstrom- and femtosecond-scale atomic motion

International Nuclear Information System (INIS)

Glownia, J. M.; Natan, A.; Cryan, J. P.; Hartsock, R.; Kozina, M.

2016-01-01

Time-resolved femtosecond x-ray diffraction patterns from laser-excited molecular iodine are used to create a movie of intramolecular motion with a temporal and spatial resolution of 30 fs and 0.3 Å. This high fidelity is due to interference between the nonstationary excitation and the stationary initial charge distribution. The initial state is used as the local oscillator for heterodyne amplification of the excited charge distribution to retrieve real-space movies of atomic motion on ångstrom and femtosecond scales. This x-ray interference has not been employed to image internal motion in molecules before. In conclusion, coherent vibrational motion and dispersion, dissociation, and rotational dephasing are all clearly visible in the data, thereby demonstrating the stunning sensitivity of heterodyne methods.

Use of offshore mooring platform for sea wave motion analysis

International Nuclear Information System (INIS)

Cicconi, G.; Dagnino, I.; Papa, L.

1979-01-01

An offshore mooring platform for supertankers may often turn out to be an ideal solution for the problem of installing a meteorological station. Its location may be particularly desirable for the purpose of recording and analysing sea wave motion in deep water or in the intermediate zone between shallow and deep water. The preliminary results obtained through the operation of a subsurface sensor at the mooring platform off the harbour of Genova are reported. (author)

Use of offshore mooring platform for sea wave motion analysis

Energy Technology Data Exchange (ETDEWEB)

Cicconi, G.; Dagnino, I.; Papa, L. (Genova Univ. (Italy). Ist. Geofisica e Geodetico); Basano, L.; Ottonello, P. (Genoa Univ. (Italy))

An offshore mooring platform for supertankers may often turn out to be an ideal solution for the problem of installing a meteorological station. Its location may be particularly desirable for the purpose of recording and analysing sea wave motion in deep water or in the intermediate zone between shallow and deep water. The preliminary results obtained through the operation of a subsurface sensor at the mooring platform off the harbour of Genova are reported.

Exploring the Internal Dynamics of Globular Clusters

Science.gov (United States)

Watkins, Laura L.; van der Marel, Roeland; Bellini, Andrea; Luetzgendorf, Nora; HSTPROMO Collaboration

2018-01-01

Exploring the Internal Dynamics of Globular ClustersThe formation histories and structural properties of globular clusters are imprinted on their internal dynamics. Energy equipartition results in velocity differences for stars of different mass, and leads to mass segregation, which results in different spatial distributions for stars of different mass. Intermediate-mass black holes significantly increase the velocity dispersions at the centres of clusters. By combining accurate measurements of their internal kinematics with state-of-the-art dynamical models, we can characterise both the velocity dispersion and mass profiles of clusters, tease apart the different effects, and understand how clusters may have formed and evolved.Using proper motions from the Hubble Space Telescope Proper Motion (HSTPROMO) Collaboration for a set of 22 Milky Way globular clusters, and our discrete dynamical modelling techniques designed to work with large, high-quality datasets, we are studying a variety of internal cluster properties. We will present the results of theoretical work on simulated clusters that demonstrates the efficacy of our approach, and preliminary results from application to real clusters.

Is Diaphragm Motion a Good Surrogate for Liver Tumor Motion?

Energy Technology Data Exchange (ETDEWEB)

Yang, Juan [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States); School of Information Science and Engineering, Shandong University, Jinan, Shandong (China); Cai, Jing [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States); Wang, Hongjun [School of Information Science and Engineering, Shandong University, Jinan, Shandong (China); Chang, Zheng; Czito, Brian G. [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States); Bashir, Mustafa R. [Department of Radiology, Duke University Medical Center, Durham, North Carolina (United States); Palta, Manisha [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States); Yin, Fang-Fang, E-mail: fangfang.yin@duke.edu [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States)

2014-11-15

Purpose: To evaluate the relationship between liver tumor motion and diaphragm motion. Methods and Materials: Fourteen patients with hepatocellular carcinoma (10 of 14) or liver metastases (4 of 14) undergoing radiation therapy were included in this study. All patients underwent single-slice cine–magnetic resonance imaging simulations across the center of the tumor in 3 orthogonal planes. Tumor and diaphragm motion trajectories in the superior–inferior (SI), anterior–posterior (AP), and medial–lateral (ML) directions were obtained using an in-house-developed normalized cross-correlation–based tracking technique. Agreement between the tumor and diaphragm motion was assessed by calculating phase difference percentage, intraclass correlation coefficient, and Bland-Altman analysis (Diff). The distance between the tumor and tracked diaphragm area was analyzed to understand its impact on the correlation between the 2 motions. Results: Of all patients, the mean (±standard deviation) phase difference percentage values were 7.1% ± 1.1%, 4.5% ± 0.5%, and 17.5% ± 4.5% in the SI, AP, and ML directions, respectively. The mean intraclass correlation coefficient values were 0.98 ± 0.02, 0.97 ± 0.02, and 0.08 ± 0.06 in the SI, AP, and ML directions, respectively. The mean Diff values were 2.8 ± 1.4 mm, 2.4 ± 1.1 mm, and 2.2 ± 0.5 mm in the SI, AP, and ML directions, respectively. Tumor and diaphragm motions had high concordance when the distance between the tumor and tracked diaphragm area was small. Conclusions: This study showed that liver tumor motion had good correlation with diaphragm motion in the SI and AP directions, indicating diaphragm motion in the SI and AP directions could potentially be used as a reliable surrogate for liver tumor motion.

Hotspot Motion, Before and After the Hawaiian-Emperor Bend

Science.gov (United States)

Tarduno, J. A.; Bono, R. K.

2014-12-01

Hawaiian hotspot motion of >40 mm/yr is best documented by paleomagnetic investigations of basalt cores recovered by ocean drilling of the Emperor seamounts during ODP Leg 197 (Tarduno et al., 2003). These data indicate that the trend of the Emperor Seamounts dominantly records motion of the hotspot in the mantle, further suggesting that the great Hawaiian-Emperor bend (HEB) reflects mainly a change in hotspot motion. Data used for Pacific "absolute plate motion models" for times before the age of the HEB are also internally inconsistent with a fixed hotspot assumption; at present the best way to estimate Pacific absolute plate motion prior to the HEB bend is through use of predictions derived from plate circuits (e.g. Doubrovine and Tarduno, 2008). These analyses predict much less motion for the hotspot responsible for the Louisville Seamount chain, as has been observed by paleomagnetic analyses of cores recovered by IODP Expedition 330 (Koppers et al., 2012). Together, the ocean drilling data sets favor hotspot-specific processes to explain high drift rates, such as the model whereby the Hawaiian mantle plume was captured by a ridge in the Late Cretaceous, and subsequent changes in sub-Pacific mantle flow resulted in the trend of the Emperor Seamounts (Tarduno et al., 2009). However, the question of whether there is a smaller signal of motion between groups of hotspots remains. Plate circuit analyses yield a small discrepancy between predicted and actual hotspot locations for times between ca. 47 Ma and 10 Ma that could be a signal of continued southward migration of the Hawaiian hotspot. Alternatively, this could reflect the motion of the group of Indo-Atlantic hotspots relative to Hawaii. New paleomagnetic data from Midway Atoll (ca. 27 Ma) suggests little difference with the present-day latitude of the plume, indicating that the rate of motion of either the Hawaiian hotspot, or the Indo-Atlantic hotspot group, was about 15 mm/yr between 47 and 27 Ma. This

Can walking motions improve visually induced rotational self-motion illusions in virtual reality?

Science.gov (United States)

Riecke, Bernhard E; Freiberg, Jacob B; Grechkin, Timofey Y

2015-02-04

Illusions of self-motion (vection) can provide compelling sensations of moving through virtual environments without the need for complex motion simulators or large tracked physical walking spaces. Here we explore the interaction between biomechanical cues (stepping along a rotating circular treadmill) and visual cues (viewing simulated self-rotation) for providing stationary users a compelling sensation of rotational self-motion (circular vection). When tested individually, biomechanical and visual cues were similarly effective in eliciting self-motion illusions. However, in combination they yielded significantly more intense self-motion illusions. These findings provide the first compelling evidence that walking motions can be used to significantly enhance visually induced rotational self-motion perception in virtual environments (and vice versa) without having to provide for physical self-motion or motion platforms. This is noteworthy, as linear treadmills have been found to actually impair visually induced translational self-motion perception (Ash, Palmisano, Apthorp, & Allison, 2013). Given the predominant focus on linear walking interfaces for virtual-reality locomotion, our findings suggest that investigating circular and curvilinear walking interfaces offers a promising direction for future research and development and can help to enhance self-motion illusions, presence and immersion in virtual-reality systems. © 2015 ARVO.

Transformation of a Water Slug in Free Fall Under the Conditions of Exposure to an Air Flow Orthogonal to the Direction of the Slug Motion

Science.gov (United States)

Volkov, R. S.; Zabelin, M. V.; Kuznetsov, G. V.; Strizhak, P. A.

2016-07-01

An experimental study has been made of the influence of an orthogonal (side) air flow propagating with a velocity to 5 m/s on the phases of transformation of a water slug with an initial volume of 0.05-0.5 liter in free fall from a height of 3 m. Use was made of Phantom V411 and Phantom Miro M310 high-speed video cameras and a Tema Automotive software system with the function of continuous tracking. The laws of retardation of the phases of transformation of the water slug from the instant of formation to that of formation of a droplet cloud under the action of the air flow orthogonal to the direction of the slug motion, and also of the deceleration, removal, and destruction of the droplets and fragments of water separating from the slug surface, have been established.

Curves from Motion, Motion from Curves

Science.gov (United States)

2000-01-01

De linearum curvarum cum lineis rectis comparatione dissertatio geometrica - an appendix to a treatise by de Lalouv~re (this was the only publication... correct solution to the problem of motion in the gravity of a permeable rotating Earth, considered by Torricelli (see §3). If the Earth is a homogeneous...in 1686, which contains the correct solution as part of a remarkably comprehensive theory of orbital motions under centripetal forces. It is a

4D CT sorting based on patient internal anatomy

Science.gov (United States)

Li, Ruijiang; Lewis, John H.; Cerviño, Laura I.; Jiang, Steve B.

2009-08-01

Respiratory motion during free-breathing computed tomography (CT) scan may cause significant errors in target definition for tumors in the thorax and upper abdomen. A four-dimensional (4D) CT technique has been widely used for treatment simulation of thoracic and abdominal cancer radiotherapy. The current 4D CT techniques require retrospective sorting of the reconstructed CT slices oversampled at the same couch position. Most sorting methods depend on external surrogates of respiratory motion recorded by extra instruments. However, respiratory signals obtained from these external surrogates may not always accurately represent the internal target motion, especially when irregular breathing patterns occur. We have proposed a new sorting method based on multiple internal anatomical features for multi-slice CT scan acquired in the cine mode. Four features are analyzed in this study, including the air content, lung area, lung density and body area. We use a measure called spatial coherence to select the optimal internal feature at each couch position and to generate the respiratory signals for 4D CT sorting. The proposed method has been evaluated for ten cancer patients (eight with thoracic cancer and two with abdominal cancer). For nine patients, the respiratory signals generated from the combined internal features are well correlated to those from external surrogates recorded by the real-time position management (RPM) system (average correlation: 0.95 ± 0.02), which is better than any individual internal measures at 95% confidence level. For these nine patients, the 4D CT images sorted by the combined internal features are almost identical to those sorted by the RPM signal. For one patient with an irregular breathing pattern, the respiratory signals given by the combined internal features do not correlate well with those from RPM (correlation: 0.68 ± 0.42). In this case, the 4D CT image sorted by our method presents fewer artifacts than that from the RPM signal. Our