WorldWideScience

Sample records for internal water motions

  1. Water droplets' internal fluidity during horizontal motion on a superhydrophobic surface with an external electric field.

    Science.gov (United States)

    Sakai, Munetoshi; Kono, Hiroki; Nakajima, Akira; Sakai, Hideki; Abe, Masahiko; Fujishima, Akira

    2010-02-02

    On a superhydrophobic surface, the internal fluidity of water droplets with different volumes (15, 30 microL) and their horizontal motion in an external electric field were evaluated using particle image velocimetry (PIV). For driving of water droplets on a superhydrophobic coating between parallel electrodes, it was important to place them at appropriate positions. Droplets moved with slipping. Small droplets showed deformation that is more remarkable. Results show that the dielectrophoretic force induced the initial droplet motion and that the surface potential gradient drove the droplets after reaching the middle point between electrodes.

  2. INTERNAL PROPER MOTIONS IN THE ESKIMO NEBULA

    International Nuclear Information System (INIS)

    García-Díaz, Ma. T.; Gutiérrez, L.; Steffen, W.; López, J. A.; Beckman, J.

    2015-01-01

    We present measurements of internal proper motions at more than 500 positions of NGC 2392, the Eskimo Nebula, based on images acquired with WFPC2 on board the Hubble Space Telescope at two epochs separated by 7.695 yr. Comparisons of the two observations clearly show the expansion of the nebula. We measured the amplitude and direction of the motion of local structures in the nebula by determining their relative shift during that interval. In order to assess the potential uncertainties in the determination of proper motions in this object, in general, the measurements were performed using two different methods, used previously in the literature. We compare the results from the two methods, and to perform the scientific analysis of the results we choose one, the cross-correlation method, because it is more reliable. We go on to perform a ''criss-cross'' mapping analysis on the proper motion vectors, which helps in the interpretation of the velocity pattern. By combining our results of the proper motions with radial velocity measurements obtained from high resolution spectroscopic observations, and employing an existing 3D model, we estimate the distance to the nebula to be 1.3 kpc

  3. INTERNAL PROPER MOTIONS IN THE ESKIMO NEBULA

    Energy Technology Data Exchange (ETDEWEB)

    García-Díaz, Ma. T.; Gutiérrez, L.; Steffen, W.; López, J. A. [Instituto de Astronomía, Universidad Nacional Autónoma de México, Km 103 Carretera Tijuana-Ensenada, 22860 Ensenada, B.C. (Mexico); Beckman, J., E-mail: tere@astro.unam.mx, E-mail: leonel@astro.unam.mx, E-mail: wsteffen@astro.unam.mx, E-mail: jal@astro.unam.mx, E-mail: jeb@iac.es [Instituto de Astrofísica de Canarias, La Laguna, Tenerife (Spain)

    2015-01-10

    We present measurements of internal proper motions at more than 500 positions of NGC 2392, the Eskimo Nebula, based on images acquired with WFPC2 on board the Hubble Space Telescope at two epochs separated by 7.695 yr. Comparisons of the two observations clearly show the expansion of the nebula. We measured the amplitude and direction of the motion of local structures in the nebula by determining their relative shift during that interval. In order to assess the potential uncertainties in the determination of proper motions in this object, in general, the measurements were performed using two different methods, used previously in the literature. We compare the results from the two methods, and to perform the scientific analysis of the results we choose one, the cross-correlation method, because it is more reliable. We go on to perform a ''criss-cross'' mapping analysis on the proper motion vectors, which helps in the interpretation of the velocity pattern. By combining our results of the proper motions with radial velocity measurements obtained from high resolution spectroscopic observations, and employing an existing 3D model, we estimate the distance to the nebula to be 1.3 kpc.

  4. Internal Motion Estimation by Internal-external Motion Modeling for Lung Cancer Radiotherapy.

    Science.gov (United States)

    Chen, Haibin; Zhong, Zichun; Yang, Yiwei; Chen, Jiawei; Zhou, Linghong; Zhen, Xin; Gu, Xuejun

    2018-02-27

    The aim of this study is to develop an internal-external correlation model for internal motion estimation for lung cancer radiotherapy. Deformation vector fields that characterize the internal-external motion are obtained by respectively registering the internal organ meshes and external surface meshes from the 4DCT images via a recently developed local topology preserved non-rigid point matching algorithm. A composite matrix is constructed by combing the estimated internal phasic DVFs with external phasic and directional DVFs. Principle component analysis is then applied to the composite matrix to extract principal motion characteristics, and generate model parameters to correlate the internal-external motion. The proposed model is evaluated on a 4D NURBS-based cardiac-torso (NCAT) synthetic phantom and 4DCT images from five lung cancer patients. For tumor tracking, the center of mass errors of the tracked tumor are 0.8(±0.5)mm/0.8(±0.4)mm for synthetic data, and 1.3(±1.0)mm/1.2(±1.2)mm for patient data in the intra-fraction/inter-fraction tracking, respectively. For lung tracking, the percent errors of the tracked contours are 0.06(±0.02)/0.07(±0.03) for synthetic data, and 0.06(±0.02)/0.06(±0.02) for patient data in the intra-fraction/inter-fraction tracking, respectively. The extensive validations have demonstrated the effectiveness and reliability of the proposed model in motion tracking for both the tumor and the lung in lung cancer radiotherapy.

  5. Effect of respiratory motion on internal radiation dosimetry

    NARCIS (Netherlands)

    Xie, Tianwu; Zaidi, Habib

    2014-01-01

    Purpose: Estimation of the radiation dose to internal organs is essential for the assessment of radiation risks and benefits to patients undergoing diagnostic and therapeutic nuclear medicine procedures including PET. Respiratory motion induces notable internal organ displacement, which influences

  6. International Water Center

    Science.gov (United States)

    The urban district of Nancy and the Town of Nancy, France, have taken the initiative of creating an International Center of Water (Centre International de l'Eau à Nancy—NAN.C.I.E.) in association with two universities, six engineering colleges, the Research Centers of Nancy, the Rhine-Meuse Basin Agency, and the Chamber of Commerce and Industry. The aim of this center is to promote research and technology transfer in the areas of water and sanitation. In 1985 it will initiate a research program drawing on the experience of 350 researchers and engineers of various disciplines who have already been assigned to research in these fields. The research themes, the majority of which will be multidisciplinary, concern aspects of hygiene and health, the engineering of industrial processes, water resources, and the environment and agriculture. A specialist training program offering five types of training aimed at university graduates, graduates of engineering colleges, or experts, will start in October 1984.

  7. Internal Mass Motion for Spacecraft Dynamics and Control

    National Research Council Canada - National Science Library

    Hall, Christopher D

    2008-01-01

    We present a detailed description of the application of a noncanonical Hamiltonian formulation to the modeling, analysis, and simulation of the dynamics of gyrostat spacecraft with internal mass motion...

  8. Neurons compute internal models of the physical laws of motion.

    Science.gov (United States)

    Angelaki, Dora E; Shaikh, Aasef G; Green, Andrea M; Dickman, J David

    2004-07-29

    A critical step in self-motion perception and spatial awareness is the integration of motion cues from multiple sensory organs that individually do not provide an accurate representation of the physical world. One of the best-studied sensory ambiguities is found in visual processing, and arises because of the inherent uncertainty in detecting the motion direction of an untextured contour moving within a small aperture. A similar sensory ambiguity arises in identifying the actual motion associated with linear accelerations sensed by the otolith organs in the inner ear. These internal linear accelerometers respond identically during translational motion (for example, running forward) and gravitational accelerations experienced as we reorient the head relative to gravity (that is, head tilt). Using new stimulus combinations, we identify here cerebellar and brainstem motion-sensitive neurons that compute a solution to the inertial motion detection problem. We show that the firing rates of these populations of neurons reflect the computations necessary to construct an internal model representation of the physical equations of motion.

  9. Internal conversion mediated by specific nuclear motions

    DEFF Research Database (Denmark)

    Klein, Liv Bærenholdt; Sølling, Theis Ivan

    2014-01-01

    the excitation energies, and the excitation in all cases is by a 200 nm photon, the S1 density-of-states in the Franck-Condon region will be high for the more N-alkylated amine. This, according to standard models, should lead to faster internal conversion. The experimental results are in contrast to this...

  10. Audiovisual biofeedback improves the correlation between internal/external surrogate motion and lung tumor motion.

    Science.gov (United States)

    Lee, Danny; Greer, Peter B; Paganelli, Chiara; Ludbrook, Joanna Jane; Kim, Taeho; Keall, Paul

    2018-03-01

    Breathing management can reduce breath-to-breath (intrafraction) and day-by-day (interfraction) variability in breathing motion while utilizing the respiratory motion of internal and external surrogates for respiratory guidance. Audiovisual (AV) biofeedback, an interactive personalized breathing motion management system, has been developed to improve reproducibility of intra- and interfraction breathing motion. However, the assumption of the correlation of respiratory motion between surrogates and tumors is not always verified during medical imaging and radiation treatment. Therefore, the aim of the study was to test the hypothesis that the correlation of respiratory motion between surrogates and tumors is the same under free breathing without guidance (FB) and with AV biofeedback guidance for voluntary motion management. For 13 lung cancer patients receiving radiotherapy, 2D coronal and sagittal cine-MR images were acquired across two MRI sessions (pre- and mid-treatment) with two breathing conditions: (a) FB and (b) AV biofeedback, totaling 88 patient measurements. Simultaneously, the external respiratory motion of the abdomen was measured. The internal respiratory motion of the diaphragm and lung tumor was retrospectively measured from 2D coronal and sagittal cine-MR images. The correlation of respiratory motion between surrogates and tumors was calculated using Pearson's correlation coefficient for: (a) abdomen to tumor (abdomen-tumor) and (b) diaphragm to tumor (diaphragm-tumor). The correlations were compared between FB and AV biofeedback using several metrics: abdomen-tumor and diaphragm-tumor correlations with/without ≥5 mm tumor motion range and with/without adjusting for phase shifts between the signals. Compared to FB, AV biofeedback improved abdomen-tumor correlation by 11% (p = 0.12) from 0.53 to 0.59 and diaphragm-tumor correlation by 13% (p = 0.02) from 0.55 to 0.62. Compared to FB, AV biofeedback improved abdomen-tumor correlation by 17% (p = 0

  11. An externally and internally deformable, programmable lung motion phantom

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, Yam; Sawant, Amit, E-mail: amit.sawant@utsouthwestern.edu [UT Southwestern Medical Center, University of Texas, Dallas, Texas 75390 (United States)

    2015-05-15

    Purpose: Most clinically deployed strategies for respiratory motion management in lung radiotherapy (e.g., gating and tracking) use external markers that serve as surrogates for tumor motion. However, typical lung phantoms used to validate these strategies are based on a rigid exterior and a rigid or a deformable-interior. Such designs do not adequately represent respiration because the thoracic anatomy deforms internally as well as externally. In order to create a closer approximation of respiratory motion, the authors describe the construction and experimental testing of an externally as well as internally deformable, programmable lung phantom. Methods: The outer shell of a commercially available lung phantom (RS-1500, RSD, Inc.) was used. The shell consists of a chest cavity with a flexible anterior surface, and embedded vertebrae, rib-cage and sternum. A custom-made insert was designed using a piece of natural latex foam block. A motion platform was programmed with sinusoidal and ten patient-recorded lung tumor trajectories. The platform was used to drive a rigid foam “diaphragm” that compressed/decompressed the phantom interior. Experimental characterization comprised of determining the reproducibility and the external–internal correlation of external and internal marker trajectories extracted from kV x-ray fluoroscopy. Experiments were conducted to illustrate three example applications of the phantom—(i) validating the geometric accuracy of the VisionRT surface photogrammetry system; (ii) validating an image registration tool, NiftyReg; and (iii) quantifying the geometric error due to irregular motion in four-dimensional computed tomography (4DCT). Results: The phantom correctly reproduced sinusoidal and patient-derived motion, as well as realistic respiratory motion-related effects such as hysteresis. The reproducibility of marker trajectories over multiple runs for sinusoidal as well as patient traces, as characterized by fluoroscopy, was within 0

  12. Monitoring internal organ motion with continuous wave radar in CT

    International Nuclear Information System (INIS)

    Pfanner, Florian; Maier, Joscha; Allmendinger, Thomas; Flohr, Thomas; Kachelrieß, Marc

    2013-01-01

    Purpose: To avoid motion artifacts in medical imaging or to minimize the exposure of healthy tissues in radiation therapy, medical devices are often synchronized with the patient's respiratory motion. Today's respiratory motion monitors require additional effort to prepare the patients, e.g., mounting a motion belt or placing an optical reflector on the patient's breast. Furthermore, they are not able to measure internal organ motion without implanting markers. An interesting alternative to assess the patient's organ motion is continuous wave radar. The aim of this work is to design, implement, and evaluate such a radar system focusing on application in CT.Methods: The authors designed a radar system operating in the 860 MHz band to monitor the patient motion. In the intended application of the radar system, the antennas are located close to the patient's body inside the table of a CT system. One receive and four transmitting antennas are used to avoid the requirement of exact patient positioning. The radar waves propagate into the patient's body and are reflected at tissue boundaries, for example at the borderline between muscle and adipose tissue, or at the boundaries of organs. At present, the authors focus on the detection of respiratory motion. The radar system consists of the hardware mentioned above as well as of dedicated signal processing software to extract the desired information from the radar signal. The system was evaluated using simulations and measurements. To simulate the radar system, a simulation model based on radar and wave field equations was designed and 4D respiratory-gated CT data sets were used as input. The simulated radar signals and the measured data were processed in the same way. The radar system hardware and the signal processing algorithms were tested with data from ten volunteers. As a reference, the respiratory motion signal was recorded using a breast belt simultaneously with the radar measurements.Results: Concerning the

  13. Effect of respiratory motion on internal radiation dosimetry

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Tianwu [Division of Nuclear Medicine and Molecular Imaging, Geneva University Hospital, Geneva 4 CH-1211 (Switzerland); Zaidi, Habib, E-mail: habib.zaidi@hcuge.ch [Division of Nuclear Medicine and Molecular Imaging, Geneva University Hospital, Geneva 4 CH-1211 (Switzerland); Geneva Neuroscience Center, Geneva University, Geneva CH-1205 (Switzerland); Department of Nuclear Medicine and Molecular Imaging, University of Groningen, University Medical Center Groningen, Groningen 9700 RB (Netherlands)

    2014-11-01

    Purpose: Estimation of the radiation dose to internal organs is essential for the assessment of radiation risks and benefits to patients undergoing diagnostic and therapeutic nuclear medicine procedures including PET. Respiratory motion induces notable internal organ displacement, which influences the absorbed dose for external exposure to radiation. However, to their knowledge, the effect of respiratory motion on internal radiation dosimetry has never been reported before. Methods: Thirteen computational models representing the adult male at different respiratory phases corresponding to the normal respiratory cycle were generated from the 4D dynamic XCAT phantom. Monte Carlo calculations were performed using the MCNP transport code to estimate the specific absorbed fractions (SAFs) of monoenergetic photons/electrons, the S-values of common positron-emitting radionuclides (C-11, N-13, O-15, F-18, Cu-64, Ga-68, Rb-82, Y-86, and I-124), and the absorbed dose of {sup 18}F-fluorodeoxyglucose ({sup 18}F-FDG) in 28 target regions for both the static (average of dynamic frames) and dynamic phantoms. Results: The self-absorbed dose for most organs/tissues is only slightly influenced by respiratory motion. However, for the lung, the self-absorbed SAF is about 11.5% higher at the peak exhale phase than the peak inhale phase for photon energies above 50 keV. The cross-absorbed dose is obviously affected by respiratory motion for many combinations of source-target pairs. The cross-absorbed S-values for the heart contents irradiating the lung are about 7.5% higher in the peak exhale phase than the peak inhale phase for different positron-emitting radionuclides. For {sup 18}F-FDG, organ absorbed doses are less influenced by respiratory motion. Conclusions: Respiration-induced volume variations of the lungs and the repositioning of internal organs affect the self-absorbed dose of the lungs and cross-absorbed dose between organs in internal radiation dosimetry. The dynamic

  14. Brownian motion probe for water-ethanol inhomogeneous mixtures

    Science.gov (United States)

    Furukawa, Kazuki; Judai, Ken

    2017-12-01

    Brownian motion provides information regarding the microscopic geometry and motion of molecules, insofar as it occurs as a result of molecular collisions with a colloid particle. We found that the mobility of polystyrene beads from the Brownian motion in a water-ethanol mixture is larger than that predicted from the liquid shear viscosity. This indicates that mixing water and ethanol is inhomogeneous in micron-sized probe beads. The discrepancy between the mobility of Brownian motion and liquid mobility can be explained by the way the rotation of the beads in an inhomogeneous viscous solvent converts the translational movement.

  15. Context analysis : sky, water and motion

    NARCIS (Netherlands)

    Javanbakhti, S.; Zinger, S.; With, de P.H.N.

    2011-01-01

    Interpreting the events present in the video is a complex task, and the same gesture or motion can be understood in several ways depending on the context of the event and/or the scene. Therefore the context of the scene can contribute to the semantic understanding of the video. In this paper, we

  16. Rectal Balloon for the Immobilization of the Prostate Internal Motion

    International Nuclear Information System (INIS)

    Lee, Sang Kyu; Beak, Jong Geal; Kim, Joo Ho; Jeon, Byong Chul; Cho, Jeong Hee; Kim, Dong Wook; Song, Tae Soo; Cho, Jae Ho; Na, Soo Kyong

    2005-01-01

    The using of endo-rectal balloon has proposed as optimal method that minimized the motion of prostate and the dose of rectum wall volume for treated prostate cancer patients, so we make the customized rectal balloon device. In this study, we analyzed the efficiency of the Self-customized rectal balloon in the aspects of its reproducibility. In 5 patients, for treatment planning, each patient was acquired CT slice images in state of with and without rectal balloon. Also they had CT scanning same repeated third times in during radiation treatment (IMRT). In each case, we analyzed the deviation of rectal balloon position and verified the isodose distribution of rectum wall at closed prostate. Using the rectal balloon, we minimized the planning target volume (PTV) by decreased the internal motion of prostate and overcome the dose limit of radiation therapy in prostate cancer by increased the gap between the rectum wall and high dose region. The using of rectal balloon, although, was reluctant to treat by patients. View a point of immobilization of prostate internal motion and dose escalation of GTV (gross tumor volume), its using consider large efficient for treated prostate cancer patients.

  17. Field theory of the spinning electron: Internal motions

    OpenAIRE

    Salesi, Giovanni; Recami, Erasmo

    1996-01-01

    We present here a field theory of the spinning electron, by writing down a new equation for the 4-velocity field v^mu (different from that of Dirac theory), which allows a classically intelligible description of the electron. Moreover, we make explicit the noticeable kinematical properties of such velocity field (which also result different from the ordinary ones). At last, we analyze the internal zitterbewegung (zbw) motions, for both time-like and light-like speeds. We adopt in this paper t...

  18. On connection of rotation and internal motion in deformed nuclei

    International Nuclear Information System (INIS)

    Krutov, V.A.

    1979-01-01

    In the semiphenomenological nuclear madel (SPNM) the problem of ''overestimate of Coriolis interaction'' is shown to be easily solved. The rotation and internal motion coupling operator H(rot/in) is used. Overdetermination of the operator H(rot/in) has been generalized and extended into schemes of strong and weak coupling. In this case both schemes of coupling are transformed from approximate into precise ones and become applicable for any nuclear deformation. As examples of application of the theory considered are the matrix elements of the E2-transitions and inertia parameters of a 235 U nucleus

  19. 33 CFR 2.24 - Internal waters.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Internal waters. 2.24 Section 2.24 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY GENERAL JURISDICTION Jurisdictional Terms § 2.24 Internal waters. (a) With respect to the United States, internal waters means the...

  20. Thermophoretic Motion of Water Nanodroplets confined inside Carbon Nanotubes

    DEFF Research Database (Denmark)

    Zambrano, Harvey A; Walther, Jens Honore; Koumoutsakos, Petros

    2009-01-01

    We study the thermophoretic motion of water nanodroplets confined inside carbon nanotubes using molecular dynamics simulations. We find that the nanodroplets move in the direction opposite the imposed thermal gradient with a terminal velocity that is linearly proportional to the gradient....... The translational motion is associated with a solid body rotation of the water nanodroplet coinciding with the helical symmetry of the carbon nanotube. The thermal diffusion displays a weak dependence on the wetting of the water-carbon nanotube interface. We introduce the use of the Moment Scaling Spectrum (MSS......) in order to determine the characteristics of the motion of the nanoparticles inside the carbon nanotube. The MSS indicates that affinity of the nanodroplet with the walls of the carbon nanotubes is important for the isothermal diffusion, and hence for the Soret coefficient of the system....

  1. Internal models and prediction of visual gravitational motion.

    Science.gov (United States)

    Zago, Myrka; McIntyre, Joseph; Senot, Patrice; Lacquaniti, Francesco

    2008-06-01

    Baurès et al. [Baurès, R., Benguigui, N., Amorim, M.-A., & Siegler, I. A. (2007). Intercepting free falling objects: Better use Occam's razor than internalize Newton's law. Vision Research, 47, 2982-2991] rejected the hypothesis that free-falling objects are intercepted using a predictive model of gravity. They argued instead for "a continuous guide for action timing" based on visual information updated till target capture. Here we show that their arguments are flawed, because they fail to consider the impact of sensori-motor delays on interception behaviour and the need for neural compensation of such delays. When intercepting a free-falling object, the delays can be overcome by a predictive model of the effects of gravity on target motion.

  2. Laser spectroscopic visualization of hydrogen bond motions in liquid water

    Science.gov (United States)

    Bratos, S.; Leicknam, J.-Cl.; Pommeret, S.; Gallot, G.

    2004-12-01

    Ultrafast pump-probe experiments are described permitting a visualization of molecular motions in diluted HDO/D 2O solutions. The experiments were realized in the mid-infrared spectral region with a time resolution of 150 fs. They were interpreted by a careful theoretical analysis, based on the correlation function approach of statistical mechanics. Combining experiment and theory, stretching motions of the OH⋯O bonds as well as HDO rotations were 'filmed' in real time. It was found that molecular rotations are the principal agent of hydrogen bond breaking and making in water. Recent literatures covering the subject, including molecular dynamics simulations, are reviewed in detail.

  3. Motion of air bubbles in stagnant water condition

    International Nuclear Information System (INIS)

    Bezdegumeli, U.; Ozdemir, S.; Yesin, O.

    2004-01-01

    Full text: In this study, air bubble motion in stagnant water condition in a vertical pipe is investigated experimentally. For this purpose, a test set-up was designed and constructed. Motions of single bubbles, having different diameters in the range of 3.0-4.8 mm, were recorded by using a monochrome camera, an image capture card and a PC. Recorded video images were processed to analyse bubble motion and to obtain the necessary data. The purpose of the study is to determine the variation of bubble axial velocity and bubble drag coefficient as a function of equivalent bubble diameter and bubble Reynolds number, Re b . Therefore, detailed information for this range of bubble diameters was obtained. The results have shown good consistency with the previous studies found in the literature

  4. Motion of air bubbles in stagnant water condition

    International Nuclear Information System (INIS)

    Bezdegumeli, U.; Ozdemir, S.; Yesin, O.

    2004-01-01

    In this study, air bubble motion in stagnant water condition in a vertical pipe of 4.6 cm diameter is investigated experimentally. For this purpose, a test set-up was designed and constructed. Motions of single bubbles, having different diameters in the range of 3.0-4.8 mm, were recorded by using a monochrome camera, an image capture card and a PC. Recorded video images were processed to analyse bubble motion and to obtain the necessary data. The purpose of the study is to determine the variation of bubble axial velocity and bubble drag coefficient as a function of equivalent bubble diameter and bubble Reynolds number, Re b . Therefore, detailed information for this range of bubble diameters was obtained. The results have shown good consistency with the previous studies found in the literature. (author)

  5. Techniques for internal water curing of concrete

    DEFF Research Database (Denmark)

    Jensen, Ole Mejlhede; Pietro, Lura

    2003-01-01

    This paper gives an overview of different techniques for incorporation of internal curing water in concrete. Internal curing can be used to mitigate self-desiccation and self-desiccation shrinkage. Some concretes may need 50 kg/m3 of internal curing water for this purpose. The price of the internal...

  6. Atypical anticlockwise internal tidal motions in the deep ocean

    NARCIS (Netherlands)

    van Haren, H.

    2015-01-01

    In the ocean, horizontal motions associated with freely propagating semidiurnal tidal inertia-gravity waves mainly describe an ellipse that is traversed in a clockwise direction in the Northern Hemisphere. In this article, rare observations of anticlockwise polarised semidiurnal motions are

  7. Relation of external surface to internal tumor motion studied with cine CT

    International Nuclear Information System (INIS)

    Chi, P.-C.M.; Balter, Peter; Luo Dershan; Mohan, Radhe; Pan Tinsu

    2006-01-01

    The accuracy of delivering gated-radiation therapy to lung tumors using an external respiratory surrogate relies on not only interfractional and intrafractional reproducibility, but also a strong correlation between external motion and internal tumor motion. The purpose of this work was to use the cine images acquired by four-dimensional computed tomography acquisition protocol to study the relation between external surface motion and internal tumor motion. The respiratory phase information of tumor motion and chest wall motion was measured on the cine images using a proposed region-of-interest (ROI) method and compared to measurement of an external respiratory monitoring device. On eight lung patient data sets, the phase shifts were measured between (1) the signal of a real-time positioning-management (RPM) respiratory monitoring device placed in the abdominal region and four surface locations on the chest wall (2) the RPM signal in the abdominal region and tumor motions, and (3) chest wall surface motions and tumor motions. Respiratory waveforms measured at different surface locations during the same respiratory cycle often varied and had significant phase shifts. Seven of the 8 patients showed the abdominal motion leading chest wall motion. The best correlation (smallest phase shift) was found between the abdominal motion and the superior-inferior (S-I) tumor motion. A wide range of phase shifts was observed between external surface motion and tumor anterior-posterior (A-P)/lateral motion. The result supported the placement of the RPM block in the abdominal region and suggested that during a gated therapy utilizing the RPM system, it is necessary to place the RPM block at the same location as it is during treatment simulation in order to reduce potential errors introduced by the position of the RPM block. Correlations between external motions and lateral/A-P tumor motions were inconclusive due to a combination of patient selection and the limitation of the ROI

  8. Motion behavior of water droplets driven by triboelectric nanogenerator

    Science.gov (United States)

    Nie, Jinhui; Jiang, Tao; Shao, Jiajia; Ren, Zewei; Bai, Yu; Iwamoto, Mitsumasa; Chen, Xiangyu; Wang, Zhong Lin

    2018-04-01

    By integrating a triboelectric nanogenerator (TENG) and a simple circuit board, the motion of water droplets can be controlled by the output of the TENG, which demonstrates a self-powered microfluidic system toward various practical applications in the fields of microfluidic system and soft robotics. This paper describes a method to construct a physical model for this self-powered system on the basis of electrostatic induction theory. The model can precisely simulate the detailed motion behavior of the droplet under driving of TENG, and it can also reveal the influences of surface hydrophobicity on the motion of the droplet, which can help us to better understand the key parameters that decide the performance of the system. The experimental observation of the dynamic performance of the droplet has also been done with a high speed camera system. A comparison between simulation results and real measurements confirms that the proposed model can predict the velocity and position of the water droplet driven by high voltage source as well as TENG. Hence, the proposed model in this work could serve as a guidance for optimizing the self-powered systems in future studies.

  9. Technical note: Correlation of respiratory motion between external patient surface and internal anatomical landmarks

    Science.gov (United States)

    Fayad, Hadi; Pan, Tinsu; Clément, Jean-François; Visvikis, Dimitris

    2011-01-01

    Purpose Current respiratory motion monitoring devices used for motion synchronization in medical imaging and radiotherapy provide either 1D respiratory signals over a specific region or 3D information based on few external or internal markers. On the other hand, newer technology may offer the potential to monitor the entire patient external surface in real time. The main objective of this study was to assess the motion correlation between such an external patient surface and internal anatomical landmarks motion. Methods Four dimensional Computed Tomography (4D CT) volumes for ten patients were used in this study. Anatomical landmarks were manually selected in the thoracic region across the 4D CT datasets by two experts. The landmarks included normal structures as well as the tumour location. In addition, a distance map representing the entire external patient surface, which corresponds to surfaces acquired by a Time of Flight (ToF) camera or similar devices, was created by segmenting the skin of all 4D CT volumes using a thresholding algorithm. Finally, the correlation between the internal landmarks and external surface motion was evaluated for different regions (placement and size) throughout a patient’s surface. Results Significant variability was observed in the motion of the different parts of the external patient surface. The larger motion magnitude was consistently measured in the central regions of the abdominal and the thoracic areas for the different patient datasets considered. The highest correlation coefficients were observed between the motion of these external surface areas and internal landmarks such as the diaphragm and mediastinum structures as well as the tumour location landmarks (0.8 ± 0.18 and 0.72 ± 0.12 for the abdominal and the thoracic regions respectively). Worse correlation was observed when one considered landmarks not significantly influenced by respiratory motion such as the apex and the sternum. Discussion and conclusions There

  10. Averaging, not internal noise, limits the development of coherent motion processing

    Directory of Open Access Journals (Sweden)

    Catherine Manning

    2014-10-01

    Full Text Available The development of motion processing is a critical part of visual development, allowing children to interact with moving objects and navigate within a dynamic environment. However, global motion processing, which requires pooling motion information across space, develops late, reaching adult-like levels only by mid-to-late childhood. The reasons underlying this protracted development are not yet fully understood. In this study, we sought to determine whether the development of motion coherence sensitivity is limited by internal noise (i.e., imprecision in estimating the directions of individual elements and/or global pooling across local estimates. To this end, we presented equivalent noise direction discrimination tasks and motion coherence tasks at both slow (1.5°/s and fast (6°/s speeds to children aged 5, 7, 9 and 11 years, and adults. We show that, as children get older, their levels of internal noise reduce, and they are able to average across more local motion estimates. Regression analyses indicated, however, that age-related improvements in coherent motion perception are driven solely by improvements in averaging and not by reductions in internal noise. Our results suggest that the development of coherent motion sensitivity is primarily limited by developmental changes within brain regions involved in integrating motion signals (e.g., MT/V5.

  11. Field theory of the spinning electron: I - Internal motions

    International Nuclear Information System (INIS)

    Salesi, Giovanni; Recami, Erasmo; Universidade Estadual de Campinas, SP

    1994-05-01

    One of the most satisfactory picture of spinning particles is the Barut-Zanghi (BZ) classical theory for the relativistic electron, that relates the electron spin with the so-called Zitterbewegung (zbw). The BZ theory has been recently studied in the Lagrangian and Hamiltonian symplectic formulations, both in flat and in curved space-time. The BZ motion equations constituted the starting point for two recent works about spin and electron structure, co-authored by us, which adopted the Clifford algebra formalism. In this letter, by employing on the contrary the ordinary tensorial language, we first write down a meaningful (real) equation of motion, describing particle classical paths, quite different from the corresponding (complex) equation of the standard Dirac theory. As a consequence, we succeed in regarding the electron as an extended-type object with a classically intelligible structure (thus overcoming some long-standing, well-known problems). Second, we make explicit the kinematical properties of the 4-velocity field v μ , which also result to be quite different from the ordinary ones, valid for scalar particles. At last, we analyze the inner zbw motions, both time-like and light-like, as functions of the initial conditions (in particular, for the case of classical uniform motions, the z component of spin s is shown to be quantized). In so doing, we make explicit the strict correlation existing between electron polarization and zbw kinematics. (author). 9 refs

  12. Field theory of the spinning electron: I - Internal motions

    Energy Technology Data Exchange (ETDEWEB)

    Salesi, Giovanni [Universita Statale di Catania (Italy). Dipt. di Fisica; Recami, Erasmo [Universita Statale di Bergamo, Dalmine, BG (Italy). Facolta di Ingegneria]|[Universidade Estadual de Campinas, SP (Brazil). Dept. de Matematica Aplicada

    1994-05-01

    One of the most satisfactory picture of spinning particles is the Barut-Zanghi (BZ) classical theory for the relativistic electron, that relates the electron spin with the so-called Zitterbewegung (zbw). The BZ theory has been recently studied in the Lagrangian and Hamiltonian symplectic formulations, both in flat and in curved space-time. The BZ motion equations constituted the starting point for two recent works about spin and electron structure, co-authored by us, which adopted the Clifford algebra formalism. In this letter, by employing on the contrary the ordinary tensorial language, we first write down a meaningful (real) equation of motion, describing particle classical paths, quite different from the corresponding (complex) equation of the standard Dirac theory. As a consequence, we succeed in regarding the electron as an extended-type object with a classically intelligible structure (thus overcoming some long-standing, well-known problems). Second, we make explicit the kinematical properties of the 4-velocity field v{sup {mu}}, which also result to be quite different from the ordinary ones, valid for scalar particles. At last, we analyze the inner zbw motions, both time-like and light-like, as functions of the initial conditions (in particular, for the case of classical uniform motions, the z component of spin s is shown to be quantized). In so doing, we make explicit the strict correlation existing between electron polarization and zbw kinematics. (author). 9 refs.

  13. Real-Time Observation of Internal Motion within Ultrafast Dissipative Optical Soliton Molecules

    Science.gov (United States)

    Krupa, Katarzyna; Nithyanandan, K.; Andral, Ugo; Tchofo-Dinda, Patrice; Grelu, Philippe

    2017-06-01

    Real-time access to the internal ultrafast dynamics of complex dissipative optical systems opens new explorations of pulse-pulse interactions and dynamic patterns. We present the first direct experimental evidence of the internal motion of a dissipative optical soliton molecule generated in a passively mode-locked erbium-doped fiber laser. We map the internal motion of a soliton pair molecule by using a dispersive Fourier-transform imaging technique, revealing different categories of internal pulsations, including vibrationlike and phase drifting dynamics. Our experiments agree well with numerical predictions and bring insights to the analogy between self-organized states of lights and states of the matter.

  14. Water confinement effects on fuel assembly motion and damping

    International Nuclear Information System (INIS)

    Brenneman, B.; Shah, S.J.; Williams, G.T.; Strumpell, J.H.

    2003-01-01

    It has been established by other authors that the accelerations of the water confined by the reactor core baffle plates has a significant effect on the responses of all the fuel assemblies during LOCA or seismic transients. This particular effect is a consequence of the water being essentially incompressible, and thus experiencing the same horizontal accelerations as the imposed baffle plate motions. These horizontal accelerations of the fluid induce lateral pressure gradients that cause horizontal buoyancy forces on any submerged structures. These forces are in the same direction as the baffle accelerations and, for certain frequencies at least, tend to reduce the relative displacements between the fuel and baffle plates. But there is another confinement effect - the imposed baffle plate velocities must also be transmitted to the water. If the fuel assembly grid strips are treated as simple hydro-foils, these horizontal velocity components change the fluid angle of attack on each strip, and thus may induce large horizontal lift forces on each grid in the same direction as the baffle plate velocity. There is a similar horizontal lift due to inclined flow over the rods when axial flow is present. These combined forces appear to always reduce the relative displacements between the fuel and baffle plates for any significant axial flow velocity. Modeling this effect is very simple. It was shown in previous papers that the mechanism for the large fuel assembly damping due to axial flow may be the hydrodynamic forces on the grid strips, and that this is very well represented by discrete viscous dampers at each grid elevation. To include the imposed horizontal water velocity effects, on both the grids and rods, these dampers are simply attached to the baffle plate rather than 'ground'. The large flow-induced damping really acts in a relative reference frame rather than an absolute or inertial reference frame, and thus it becomes a flow-induced coupling between the fuel

  15. The internal-external respiratory motion correlation is unaffected by audiovisual biofeedback.

    Science.gov (United States)

    Steel, Harry; Pollock, Sean; Lee, Danny; Keall, Paul; Kim, Taeho

    2014-03-01

    This study evaluated if an audiovisual (AV) biofeedback causes variation in the level of external and internal correlation due to its interactive intervention in natural breathing. The internal (diaphragm) and external (abdominal wall) respiratory motion signals of 15 healthy human subjects under AV biofeedback and free breathing (FB) were analyzed and measures of correlation and regularity taken. Regularity metrics (root mean square error and spectral power dispersion metric) were obtained and the correlation between these metrics and the internal and external correlation was investigated. For FB and AV biofeedback assisted breathing the mean correlations found between internal and external respiratory motion were 0.96±0.02 and 0.96±0.03, respectively. This means there is no evidence to suggest (p-value=0.88) any difference in the correlation between internal and external respiratory motion with the use of AV biofeedback. Our results confirmed the hypothesis that the internal-external correlation with AV biofeedback is the same as for free breathing. Should this correlation be maintained for patients, AV biofeedback can be implemented in the clinic with confidence as regularity improvements using AV biofeedback with an external signal will be reflected in increased internal motion regularity.

  16. Globalisation of water resources: International virtual water flows in relation to international crop trade

    NARCIS (Netherlands)

    Hoekstra, Arjen Ysbert; Hung, P.Q.

    2005-01-01

    The water that is used in the production process of a commodity is called the ‘virtual water’ contained in the commodity. International trade of commodities brings along international flows of virtual water. The objective of this paper is to quantify the volumes of virtual water flows between

  17. A Prospective Cohort Study of Gated Stereotactic Liver Radiation Therapy Using Continuous Internal Electromagnetic Motion Monitoring

    DEFF Research Database (Denmark)

    Worm, Esben S; Høyer, Morten; Hansen, Rune

    2018-01-01

    PURPOSE: Intrafraction motion can compromise the treatment accuracy in liver stereotactic body radiation therapy (SBRT). Respiratory gating can improve treatment delivery; however, gating based on external motion surrogates is inaccurate. The present study reports the use of Calypso-based internal...... electromagnetic motion monitoring for gated liver SBRT. METHODS AND MATERIALS: Fifteen patients were included in a study of 3-fraction respiratory gated liver SBRT guided by 3 implanted electromagnetic transponders. The planning target volume was created by a 5-mm axial and 7-mm (n = 12) or 10-mm (n = 3...

  18. Theoretical and experimental investigation into structural and fluid motions at low frequencies in water distribution pipes

    Science.gov (United States)

    Gao, Yan; Liu, Yuyou

    2017-06-01

    Vibrational energy is transmitted in buried fluid-filled pipes in a variety of wave types. Axisymmetric (n = 0) waves are of practical interest in the application of acoustic techniques for the detection of leaks in underground pipelines. At low frequencies n = 0 waves propagate longitudinally as fluid-dominated (s = 1) and shell-dominated (s = 2) waves. Whilst sensors such as hydrophones and accelerometers are commonly used to detect leaks in water distribution pipes, the mechanism governing the structural and fluid motions is not well documented. In this paper, the low-frequency behaviour of the pipe wall and the contained fluid is investigated. For most practical pipework systems, these two waves are strongly coupled; in this circumstance the ratios of the radial pipe wall displacements along with the internal pressures associated with these two wave types are obtained. Numerical examples show the relative insensitivity of the structural and fluid motions to the s = 2 wave for both metallic and plastic pipes buried in two typical soils. It is also demonstrated that although both acoustic and vibration sensors at the same location provide the identical phase information of the transmitted signals, pressure responses have significantly higher levels than acceleration responses, and thus hydrophones are better suited in a low signal-to-noise ratio (SNR) environment. This is supported by experimental work carried out at a leak detection facility. Additional pressure measurements involved excitation of the fluid and the pipe fitting (hydrant) on a dedicated water pipe. This work demonstrates that the s = 1 wave is mainly responsible for the structural and fluid motions at low frequencies in water distribution pipes as a result of water leakage and direct pipe excitation.

  19. Motion detection and correction for dynamic 15O-water myocardial perfusion PET studies

    International Nuclear Information System (INIS)

    Naum, Alexandru; Laaksonen, Marko S.; Oikonen, Vesa; Teraes, Mika; Jaervisalo, Mikko J.; Knuuti, Juhani; Tuunanen, Helena; Nuutila, Pirjo; Kemppainen, Jukka

    2005-01-01

    Patient motion during dynamic PET studies is a well-documented source of errors. The purpose of this study was to investigate the incidence of frame-to-frame motion in dynamic 15 O-water myocardial perfusion PET studies, to test the efficacy of motion correction methods and to study whether implementation of motion correction would have an impact on the perfusion results. We developed a motion detection procedure using external radioactive skin markers and frame-to-frame alignment. To evaluate motion, marker coordinates inside the field of view were determined in each frame for each study. The highest number of frames with identical spatial coordinates during the study were defined as ''non-moved''. Movement was considered present if even one marker changed position, by one pixel/frame compared with reference, in one axis, and such frames were defined as ''moved''. We tested manual, in-house-developed motion correction software and an automatic motion correction using a rigid body point model implemented in MIPAV (Medical Image Processing, Analysis and Visualisation) software. After motion correction, remaining motion was re-analysed. Myocardial blood flow (MBF) values were calculated for both non-corrected and motion-corrected datasets. At rest, patient motion was found in 18% of the frames, but during pharmacological stress the fraction increased to 45% and during physical exercise it rose to 80%. Both motion correction algorithms significantly decreased (p<0.006) the number of moved frames and the amplitude of motion (p<0.04). Motion correction significantly increased MBF results during bicycle exercise (p<0.02). At rest or during adenosine infusion, the motion correction had no significant effects on MBF values. Significant motion is a common phenomenon in dynamic cardiac studies during adenosine infusion but especially during exercise. Applying motion correction for the data acquired during exercise clearly changed the MBF results, indicating that motion

  20. Coherent Motion Reveals Non‐Ergodic Nature of Internal Conversion between Excited States

    DEFF Research Database (Denmark)

    Kuhlman, Thomas Scheby; Sølling, Theis I.; Møller, Klaus Braagaard

    2012-01-01

    for smaller molecules. Specifically, we focus on the S2→S1 internal conversion in cyclobutanone, cyclopentanone, and cyclohexanone. By means of time‐resolved mass spectrometry and photoelectron spectroscopy the relative rate of this transition is determined to be 13:2:1. Remarkably, we observe coherent......We found that specific nuclear motion along low‐frequency modes is effective in coupling electronic states and that this motion prevail in some small molecules. Thus, in direct contradiction to what is expected based on the standard models, the internal conversion process can proceed faster...

  1. Communication: Isotopic effects on tunneling motions in the water trimer

    International Nuclear Information System (INIS)

    Videla, Pablo E.; Rossky, Peter J.; Laria, D.

    2016-01-01

    We present results of ring polymer molecular dynamics simulations that shed light on the effects of nuclear quantum fluctuations on tunneling motions in cyclic [H 2 O] 3 and [D 2 O] 3 , at the representative temperature of T = 75 K. In particular, we focus attention on free energies associated with two key isomerization processes: The first one corresponds to flipping transitions of dangling OH bonds, between up and down positions with respect to the O–O–O plane of the cluster; the second involves the interchange between connecting and dangling hydrogen bond character of the H-atoms in a tagged water molecule. Zero point energy and tunneling effects lead to sensible reductions of the free energy barriers. Due to the lighter nature of the H nuclei, these modifications are more marked in [H 2 O] 3 than in [D 2 O] 3 . Estimates of the characteristic time scales describing the flipping transitions are consistent with those predicted based on standard transition-state-approximation arguments

  2. Communication: Isotopic effects on tunneling motions in the water trimer

    Energy Technology Data Exchange (ETDEWEB)

    Videla, Pablo E. [Departamento de Química Inorgánica Analítica y Química-Física e INQUIMAE, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, Pabellón II, 1428 Buenos Aires (Argentina); Rossky, Peter J. [Department of Chemistry, Rice University, Houston, Texas 77251-1892 (United States); Laria, D., E-mail: dhlaria@cnea.gov.ar [Departamento de Química Inorgánica Analítica y Química-Física e INQUIMAE, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, Pabellón II, 1428 Buenos Aires (Argentina); Departamento de Física de la Materia Condensada, Comisión Nacional de Energía Atómica, Avenida Libertador 8250, 1429 Buenos Aires (Argentina)

    2016-02-14

    We present results of ring polymer molecular dynamics simulations that shed light on the effects of nuclear quantum fluctuations on tunneling motions in cyclic [H{sub 2}O]{sub 3} and [D{sub 2}O]{sub 3}, at the representative temperature of T = 75 K. In particular, we focus attention on free energies associated with two key isomerization processes: The first one corresponds to flipping transitions of dangling OH bonds, between up and down positions with respect to the O–O–O plane of the cluster; the second involves the interchange between connecting and dangling hydrogen bond character of the H-atoms in a tagged water molecule. Zero point energy and tunneling effects lead to sensible reductions of the free energy barriers. Due to the lighter nature of the H nuclei, these modifications are more marked in [H{sub 2}O]{sub 3} than in [D{sub 2}O]{sub 3}. Estimates of the characteristic time scales describing the flipping transitions are consistent with those predicted based on standard transition-state-approximation arguments.

  3. The use of CT density changes at internal tissue interfaces to correlate internal organ motion with an external surrogate

    Energy Technology Data Exchange (ETDEWEB)

    Gaede, Stewart; Yu, Edward; Van Dyk, Jake; Battista, Jerry [Radiation Oncology Program, London Regional Cancer Program, London, Ontario (Canada); Carnes, Gregory; Lee, Ting-Yim [Department of Medical Biophysics, University of Western Ontario, London, Ontario (Canada)

    2009-01-21

    The purpose of this paper is to describe a non-invasive method to monitor the motion of internal organs affected by respiration without using external markers or spirometry, to test the correlation with external markers, and to calculate any time shift between the datasets. Ten lung cancer patients were CT scanned with a GE LightSpeed Plus 4-Slice CT scanner operating in a cine mode. We retrospectively reconstructed the raw CT data to obtain consecutive 0.5 s reconstructions at 0.1 s intervals to increase image sampling. We defined regions of interest containing tissue interfaces, including tumour/lung interfaces that move due to breathing on multiple axial slices and measured the mean CT number versus respiratory phase. Tumour motion was directly correlated with external marker motion, acquired simultaneously, using the sample coefficient of determination, r{sup 2}. Only three of the ten patients showed correlation higher than r{sup 2} = 0.80 between tumour motion and external marker position. However, after taking into account time shifts (ranging between 0 s and 0.4 s) between the two data sets, all ten patients showed correlation better than r{sup 2} = 0.8. This non-invasive method for monitoring the motion of internal organs is an effective tool that can assess the use of external markers for 4D-CT imaging and respiratory-gated radiotherapy on a patient-specific basis.

  4. Molecular Diagnostics of the Internal Motions of Massive Cores

    Science.gov (United States)

    Pineda, Jorge; Velusamy, T.; Goldsmith, P.; Li, D.; Peng, R.; Langer, W.

    2009-12-01

    We present models of the internal kinematics of massive cores in the Orion molecular cloud. We use a sample of cores studied by Velusamy et al. (2008) that show red, blue, and no asymmetry in their HCO+ line profiles in equal proportion, and which therefore may represent a sample of cores in different kinematic states. We use the radiative transfer code RATRAN (Hogerheijde & van der Tak 2000) to model several transitions of HCO+ and H13CO+ as well as the dust continuum emission, of a spherical model cloud with radial density, temperature, and velocity gradients. We find that an excitation and velocity gradients are prerequisites to reproduce the observed line profiles. We use the dust continuum emission to constrain the density and temperature gradients. This allows us to narrow down the functional forms of the velocity gradient giving us the opportunity to test several theoretical predictions of velocity gradients produced by the effect of magnetic fields (e.g. Tassis et. al. 2007) and turbulence (e.g. Vasquez-Semanedi et al 2007).

  5. The effect of internal and external fields of view on visually induced motion sickness

    NARCIS (Netherlands)

    Bos, J.E.; Vries, S.C. de; Emmerik, M.L. van; Groen, E.L.

    2010-01-01

    Field of view (FOV) is said to affect visually induced motion sickness. FOV, however, is characterized by an internal setting used by the graphics generator (iFOV) and an external factor determined by screen size and viewing distance (eFOV). We hypothesized that especially the incongruence between

  6. Electron spin echo studies of the internal motion of radicals in crystals: Phase memory vs correlation time

    International Nuclear Information System (INIS)

    Kispert, L.D.; Bowman, M.K.; Norris, J.R.; Brown, M.S.

    1982-01-01

    An electron spin echo (ESE) study of the internal motion of the CH 2 protons in irradiated zinc acetate dihydrate crystals shows that quantitative measurements of the motional correlation time can be obtained quite directly from pulsed measurements. In the slow motional limit, the motional correlation time is equal to the phase memory time determined by ESE. In the fast motional limit, the motional correlation time is proportional to the no motion spectral second moment divided by the ESE phase memory time. ESE offers a convenient method of studying motion, electron transfer, conductivity, etc. in a variety of systems too complicated for study by ordinary EPR. New systems for study by ESE include biological samples, organic polymers, liquid solutions of radicals with unresolved hyperfine, etc. When motion modulates large anisotropic hyperfine couplings, ESE measurements of the phase memory time are sensitive to modulation of pseudosecular hyperfine interactions

  7. Internal friction due to domain-wall motion in martensitically transformed A15 compounds

    International Nuclear Information System (INIS)

    Snead, C.L. Jr.; Welch, D.O.

    1985-01-01

    A lattice instability in A15 materials in some cases leads to a cubic-to-tetragonal martensitic transformation at low temperatures. The transformed material orients in lamellae with c axes alternately aligned along the directions producing domain walls between the lamellae. An internal-friction (delta) feature below T/sub m/ is attributed to stress-induced domain-wall motion. The magnitude of the friction increases as temperature is lowered below T/sub m/ as (1-c/a) increases, and behaves as (1-c/a) 2 from T/sub m/ down to the superconducting critical temperature where the increasing tetragonality is inhibited. The effect of strain in the lattice is to decrease the domain-wall internal friction, but not affect T/sub m/. Neutron-induced disorder and the addition of some third-elements in alloying decrease both delta and T/sub m/, with some elements reducing only the former. Less than 1 at. % H is seen to completely suppress both delta and T/sub m. Martensitically transformed V 2 Zr demonstrates low-temperature internal-friction and modulus behavior consists with easy β/m wall motion relative to the easy m/m motion of the A15's. For the V 2 Zr, a peak in delta is observed, qualitatively in agreement with expected β/m wall motion

  8. Near field fluid coupling between internal motion of the organ of Corti and the basilar membrane

    Energy Technology Data Exchange (ETDEWEB)

    Elliott, Stephen J.; Ni, Guangjian [Institute of Sound and Vibration Research, University of Southampton, Southampton (United Kingdom)

    2015-12-31

    The pressure distribution in each of the fluid chambers of the cochlea can be decomposed into a 1D, or plane wave, component and a near field component, which decays rapidly away from the excitation point. The transverse motion of the basilar membrane, BM, for example, generates both a 1D pressure field, which couples into the slow wave, and a local near field pressure, proportional to the BM acceleration, that generates an added mass on the BM due to the fluid motion. When the organ of Corti, OC, undergoes internal motion, due for example to outer hair cell activity, this motion will not itself generate any 1D pressure if the OC is incompressible and the BM is constrained not to move volumetrically, and so will not directly couple into the slow wave. This motion will, however, generate a near field pressure, proportional to the OC acceleration, which will act on the OC and thus increases its effective mass. The near field pressure due to this OC motion will also act on the BM, generating a force on the BM proportional to the acceleration of the OC, and thus create a “coupling mass” effect. By reciprocity, this coupling mass is the same as that acting on the OC due to the motion of the BM. This near field fluid coupling is initially observed in a finite element model of a slice of the cochlea. These simulations suggest a simple analytical formulation for the fluid coupling, using higher order beam modes across the width of the cochlear partition. It is well known that the added mass due to the near field pressure dominates the overall mass of the BM, and thus significantly affects the micromechanical dynamics. This work not only quantifies the added mass of the OC due its own motion in the fluid, and shows that this is important, but also demonstrates that the coupling mass effect between the BM and OC significantly affects the dynamics of simple micromechanical models.

  9. Motion-specific internal target volumes for FDG-avid mediastinal and hilar lymph nodes

    International Nuclear Information System (INIS)

    Lamb, James M.; Robinson, Clifford G.; Bradley, Jeffrey D.; Low, Daniel A.

    2013-01-01

    Background and purpose: To quantify the benefit of motion-specific internal target volumes for FDG-avid mediastinal and hilar lymph nodes generated using 4D-PET, vs. conventional internal target volumes generated using non-respiratory gated PET and 4D-CT scans. Materials and methods: Five patients with FDG-avid tumors metastatic to 11 hilar or mediastinal lymph nodes were imaged with respiratory-correlated FDG-PET (4D-PET) and 4D-CT. FDG-avid nodes were contoured by a radiation oncologist in two ways. Standard-of-care volumes were contoured using conventional un-gated PET, 4D-CT, and breath-hold CT. A second, motion-specific, set of volumes were contoured using 4D-PET.Contours based on 4D-PET corresponded directly to an internal target volume (ITV 4D ), whereas contours based on un-gated PET were expanded by a series of exploratory isotropic margins (from 5 to 13 mm) based on literature recommendations on lymph node motion to form internal target volumes (ITV 3D ). Results: A 13 mm expansion of the un-gated PET nodal volume was needed to cover the ITV 4D for 10 of 11 nodes studied. The ITV 3D based on a 13 mm expansion included on average 45 cm 3 of tissue that was not included in the ITV 4D . Conclusions: Motion-specific lymph-node internal target volumes generated from 4D-PET imaging could be used to improve accuracy and/or reduce normal-tissue irradiation compared to the standard-of-care un-gated PET based internal target volumes

  10. SU-E-J-235: Audiovisual Biofeedback Improves the Correlation Between Internal and External Respiratory Motion

    International Nuclear Information System (INIS)

    Lee, D; Pollock, S; Keall, P; Greer, P; Ludbrook, J; Paganelli, C; Kim, T

    2015-01-01

    Purpose: External respiratory surrogates are often used to predict internal lung tumor motion for beam gating but the assumption of correlation between external and internal surrogates is not always verified resulting in amplitude mismatch and time shift. To test the hypothesis that audiovisual (AV) biofeedback improves the correlation between internal and external respiratory motion, in order to improve the accuracy of respiratory-gated treatments for lung cancer radiotherapy. Methods: In nine lung cancer patients, 2D coronal and sagittal cine-MR images were acquired across two MRI sessions (pre- and mid-treatment) with (1) free breathing (FB) and (2) AV biofeedback. External anterior-posterior (AP) respiratory motions of (a) chest and (b) abdomen were simultaneously acquired with physiological measurement unit (PMU, 3T Skyra, Siemens Healthcare Erlangen, Germany) and real-time position management (RPM) system (Varian, Palo Alto, USA), respectively. Internal superior-inferior (SI) respiratory motions of (c) lung tumor (i.e. centroid of auto-segmented lung tumor) and (d) diaphragm (i.e. upper liver dome) were measured from individual cine-MR images across 32 dataset. The four respiratory motions were then synchronized with the cine-MR image acquisition time. Correlation coefficients were calculated in the time variation of two nominated respiratory motions: (1) chest-abdomen, (2) abdomen-diaphragm and (3) diaphragm-lung tumor. The three combinations were compared between FB and AV biofeedback. Results: Compared to FB, AV biofeedback improved chest-abdomen correlation by 17% (p=0.005) from 0.75±0.23 to 0.90±0.05 and abdomen-diaphragm correlation by 4% (p=0.058) from 0.91±0.11 to 0.95±0.05. Compared to FB, AV biofeedback improved diaphragm-lung tumor correlation by 12% (p=0.023) from 0.65±0.21 to 0.74±0.16. Conclusions: Our results demonstrated that AV biofeedback significantly improved the correlation of internal and external respiratory motion, thus

  11. SU-E-J-235: Audiovisual Biofeedback Improves the Correlation Between Internal and External Respiratory Motion

    Energy Technology Data Exchange (ETDEWEB)

    Lee, D; Pollock, S; Keall, P [Radiation Physics Laboratory, Sydney Medical School, The University of Sydney, NSW (Australia); Greer, P [School of Mathematical and Physical Sciences, The University of Newcastle, Newcastle, NSW (Australia); Department of Radiation Oncology, Calvary Mater Newcastle, Newcastle, NSW (Australia); Ludbrook, J [Department of Radiation Oncology, Calvary Mater Newcastle, Newcastle, NSW (Australia); Paganelli, C [Dipartimento di Elettronica, Informazione e Bioingegneria, Politecnico di Milano, Milano (Italy); Kim, T [Radiation Physics Laboratory, Sydney Medical School, The University of Sydney, NSW (Australia); Department of Radiation Oncology, University of Virginia Health System, Charlottesville, NC (United States)

    2015-06-15

    Purpose: External respiratory surrogates are often used to predict internal lung tumor motion for beam gating but the assumption of correlation between external and internal surrogates is not always verified resulting in amplitude mismatch and time shift. To test the hypothesis that audiovisual (AV) biofeedback improves the correlation between internal and external respiratory motion, in order to improve the accuracy of respiratory-gated treatments for lung cancer radiotherapy. Methods: In nine lung cancer patients, 2D coronal and sagittal cine-MR images were acquired across two MRI sessions (pre- and mid-treatment) with (1) free breathing (FB) and (2) AV biofeedback. External anterior-posterior (AP) respiratory motions of (a) chest and (b) abdomen were simultaneously acquired with physiological measurement unit (PMU, 3T Skyra, Siemens Healthcare Erlangen, Germany) and real-time position management (RPM) system (Varian, Palo Alto, USA), respectively. Internal superior-inferior (SI) respiratory motions of (c) lung tumor (i.e. centroid of auto-segmented lung tumor) and (d) diaphragm (i.e. upper liver dome) were measured from individual cine-MR images across 32 dataset. The four respiratory motions were then synchronized with the cine-MR image acquisition time. Correlation coefficients were calculated in the time variation of two nominated respiratory motions: (1) chest-abdomen, (2) abdomen-diaphragm and (3) diaphragm-lung tumor. The three combinations were compared between FB and AV biofeedback. Results: Compared to FB, AV biofeedback improved chest-abdomen correlation by 17% (p=0.005) from 0.75±0.23 to 0.90±0.05 and abdomen-diaphragm correlation by 4% (p=0.058) from 0.91±0.11 to 0.95±0.05. Compared to FB, AV biofeedback improved diaphragm-lung tumor correlation by 12% (p=0.023) from 0.65±0.21 to 0.74±0.16. Conclusions: Our results demonstrated that AV biofeedback significantly improved the correlation of internal and external respiratory motion, thus

  12. Growing controversy over "wise international water governance".

    Science.gov (United States)

    Trondalen, J M

    2004-01-01

    This article takes the perspective that when political relationships are strained, there seem to be few examples of wise international water resources governance. The Middle East is a striking example. Much effort has been put into policy development and the design of international principles, but very little into the translation of those into concrete and lasting governance. One of the theses of the article is that politics--whether domestic or international--in most cases overrides these principles and standards. Moreover readymade regional co-operation models of water managements are not directly applicable to every geographical, political, economic and social setting. Certain factors are often under-estimated in international water negotiations, such as: the complexity of any hydro-political negotiations, and need to develop commonly accepted standards; the difficulty of translating policy--either politically or legally--into an operational and realistic negotiations strategy; the format of the procedures and meetings; recognition that third parties should have a long-term perspective on any conflict they get involved in. With reservations, the lessons learned indicate that the following factors have an impact on grid locked situations, such as: new substantive information; new trade-offs between the parties; and changed political climate or relationship with external power-brokers.

  13. Predictive piston motion control in a free-piston internal combustion engine

    Energy Technology Data Exchange (ETDEWEB)

    Mikalsen, R.; Jones, E.; Roskilly, A.P. [Sir Joseph Swan Institute for Energy Research, Newcastle University, Newcastle upon Tyne, NE1 7RU England (United Kingdom)

    2010-05-15

    A piston motion controller for a free-piston internal combustion engine is presented. To improve dynamic performance in the control of the piston motion and engine compression ratio, the controller response is determined from a prediction of engine top dead centre error rather than the measured value from the previous cycle. The proposed control approach showed superior performance compared with that of standard PI feedback control known from the literature due to a reduced control action time delay. The manipulation of fuel injection timing to reduce in-cylinder pressure peaks and cycle-to-cycle variations was also studied, indicating that with the piston motion estimation, the injection timing is a powerful control variable for this purpose. (author)

  14. Pumice aggregates for internal water curing

    DEFF Research Database (Denmark)

    Pietro, Lura; Bentz, Dale P.; Lange, David A.

    2004-01-01

    without pumice and mixes with 4% and 8% pumice by volume of mortar. By addition of pumice, mortars with improved strength, enhanced degree of hydration and reduced autogenous shrinkage were obtained. An important obstacle to the application of this kind of pumice for actual concrete production......A novel concept in internal curing of High Performance Concrete is based on dispersing very small, saturated lightweight aggregates (LWA) in the concrete, containing sufficient water to counteract self-desiccation. With this approach, the amount of water in the LWA can be minimized, thus...... water absorption, but they release a greater percentage of their absorbed water at the equilibrium relative humidity of practical interest in early-age concrete, above 90%. Additionally, early-age properties of mortars with different contents of saturated pumice were investigated: a reference mix...

  15. Flow effects due to valve and piston motion in an internal combustion engine exhaust port

    International Nuclear Information System (INIS)

    Semlitsch, Bernhard; Wang, Yue; Mihăescu, Mihai

    2015-01-01

    Highlights: • Flow regime identification depending on the valve lift during the exhaust stroke. • Analysis of the valve motion effect onto the flow development in the exhaust port. • Physical interpretation of commonly used discharge and flow coefficient formulations. • Illustration of flow effects in junction regions with pulsatile flow. - Abstract: Performance optimization regarding e.g. exhaust valve strategies in an internal combustion engine is often performed based on one-dimensional simulation investigation. Commonly, a discharge coefficient is used to describe the flow behavior in complex geometries, such as the exhaust port. This discharge coefficient for an exhaust port is obtained by laboratory experiments at fixed valve lifts, room temperatures, and low total pressure drops. The present study investigates the consequences of the valve and piston motion onto the energy losses and the discharge coefficient. Therefore, Large Eddy Simulations are performed in a realistic internal combustion geometry using three different modeling strategies, i.e. fixed valve lift and fixed piston, moving piston and fixed valve lift, and moving piston and moving valve, to estimate the energy losses. The differences in the flow field development with the different modeling approaches is delineated and the dynamic effects onto the primary quantities, e.g. discharge coefficient, are quantified. Considering the motion of piston and valves leads to negative total pressure losses during the exhaust cycle, which cannot be observed at fixed valve lifts. Additionally, the induced flow structures develop differently when valve motion is taken into consideration, which leads to a significant disparity of mass flow rates evolving through the two individual valve ports. However, accounting for piston motion and limited valve motion, leads to a minor discharge coefficient alteration of about one to two percent

  16. Features of internal water supply and water disposal of shopping centers

    Directory of Open Access Journals (Sweden)

    Orlov Evgeniy Vladimirovich

    2014-01-01

    Full Text Available Pipeline from an external system should be inlet in the part of the building where a large number of water folding devices will be concentrated. As a rule, for shopping centers with a lot of water consumers it is necessary to make not less than three inputs, each of them should be connected to different areas of an external ring water supply system in order to make the work of the system more reliable.The places for water folding fittings in shopping centers are the following. The water folding devices: mixers are placed in sanitary cabins of shopping centers. Usually, for for water saving in buildings with a big pass-through capacity per hour it is reasonable to use contactless mixers, which are turned on upon raising a hand with a help of motion sensor or light sensor. Another important argument in favor of such mixers is prevention of infections spread for the reason that the consumer doesn't touch the device, so, the risk of bacteria transmission via the device decreases. Such mixer supplies water with a demanded expense and temperature. As a rule, water for such mixers moves from the centralized internal water supply system of hot water, mixing up with cold water. If there is no centralized hot water supply system, it is possible to use hot water storage heaters in case of a small number of visitors or to reject mixers at all in favor of the cranes giving water of only one temperature (cold, which is also practiced.For the branch of economic and household the water receivers are used, which are present in sanitary cabins in most cases by toilet bowls, wash basins, urinals.

  17. Processing of angular motion and gravity information through an internal model.

    Science.gov (United States)

    Laurens, Jean; Straumann, Dominik; Hess, Bernhard J M

    2010-09-01

    The vestibular organs in the base of the skull provide important information about head orientation and motion in space. Previous studies have suggested that both angular velocity information from the semicircular canals and information about head orientation and translation from the otolith organs are centrally processed in an internal model of head motion, using the principles of optimal estimation. This concept has been successfully applied to model behavioral responses to classical vestibular motion paradigms. This study measured the dynamic of the vestibuloocular reflex during postrotatory tilt, tilt during the optokinetic afternystagmus, and off-vertical axis rotation. The influence of otolith signal on the VOR was systematically varied by using a series of tilt angles. We found that the time constants of responses varied almost identically as a function of gravity in these paradigms. We show that Bayesian modeling could predict the experimental results in an accurate and consistent manner. In contrast to other approaches, the Bayesian model also provides a plausible explanation of why these vestibulooculo motor responses occur as a consequence of an internal process of optimal motion estimation.

  18. International Conference on water reuse and desalination

    International Nuclear Information System (INIS)

    1984-01-01

    The International conference on water reuse and desalination was held on the 13 November 1984 in Johannesburg, South Africa. Papers delivered on this conference covered the following aspects: desalination technology, industrial effluent control, economics of desalination of wastewaters, consumable supplies in desalination, the world market for seawater desalination equipment, reverse osmosis, evaporation and ultrafiltration, treatment of hazardous wastes, role of reverse osmosis in waste water treatment, as well as the desalination, recovery and recycle of water with high efficiency. A paper was also delivered on the mechanical vapour compression process applied to seawater desalination - as an example the paper presents the largest unit so far constructed by SIDEM using this process: a 1,500 mz/day unit installed in the Nuclear power plant of Flamanville in France

  19. Wetting and motion behaviors of water droplet on graphene under thermal-electric coupling field

    Science.gov (United States)

    Zhang, Zhong-Qiang; Dong, Xin; Ye, Hong-Fei; Cheng, Guang-Gui; Ding, Jian-Ning; Ling, Zhi-Yong

    2015-02-01

    Wetting dynamics and motion behaviors of a water droplet on graphene are characterized under the electric-thermal coupling field using classical molecular dynamics simulation method. The water droplet on graphene can be driven by the temperature gradient, while the moving direction is dependent on the electric field intensity. Concretely, the water droplet on graphene moves from the low temperature region to the high temperature region for the relatively weak electric field intensity. The motion acceleration increases with the electric field intensity on graphene, whereas the moving direction switches when the electric field intensity increases up to a threshold. The essence is the change from hydrophilic to hydrophobic for the water droplet on graphene at a threshold of the electric field intensity. Moreover, the driven force of the water droplet caused by the overall oscillation of graphene has important influence on the motion behaviors. The results are helpful to control the wettability of graphene and further develop the graphene-based fluidic nanodevices.

  20. Water uptake and motion in highly densified bentonite

    International Nuclear Information System (INIS)

    Kahr, G.; Mueller-Vonmoos, F.; Kraehenbuehl, F.; Stoeckli, H.F.

    1986-07-01

    Water uptake by the bentonites MX-80 and Montigel was investigated according to the classical method of determination of the heat immersion and the adsorption-desorption isotherms. In addition, the layer expansion of the montmorillonite was measured as a function of the water content. The evaluation of the adsorption isotherms according to Dubinin-Radushkevich and the stratification distances determined by x-ray confirmed gradual water uptake. Up to 10% water content, the water is adsorbed as a monolayer, up to 20%, as a bimolecular layer around the interlayer cations. The partial specific entropy could be determined from the approximative calculation of the partial specific enthalpy from the heats of immersion and the free enthalpy from the adsorption isotherms. From this it is evident that the interlayer water shows a high degree of order. In this condition, the mobility of the water molecules is considerably lower than in free water. From the adsorption isotherm and the layer expansion observed, it can be assumed that water can appear in the pore space only from approximately 25% water content. The spaces outwith the interlayer space and the surfaces of the montmorillonite particles are considered as pore space. If free swelling is prevented and with dry densities greater than 1.8 Mg/m/sup 3/ for the highly compacted bentonites, water uptake causes a drastic reduction of the original pore space so that practically all the water is in the interlayer space. Calculation of the swelling pressure from the adsorption isotherms gives a good approximation of the measured swelling pressures. A montmorillonite surface of ca. 750 m/sup 2//g for both bentonites can be derived from a Dubinin-Radushkevich analysis of the adsorption isotherm. Water uptake into the compacted unsaturated bentonites can be described as diffusion with a diffusion coefficient of the order of magnitude of 3.10/sup -10/ m/sup 2//s. (author)

  1. Internal water curing with Liapor aggregates

    DEFF Research Database (Denmark)

    Lura, Pietro

    2005-01-01

    Internal water curing is a very efficient way to counteract self-desiccation and autogenous shrinkage in high performance concrete, thereby reducing the likelihood of early-age cracking. This paper deals with early-age volume changes and moisture transport in lightweight aggregate concrete realized...... with wet lightweight aggregates. Lightweight aggregate concrete mixtures with different degree of saturation and different particle size of the lightweight aggregates were studied and compared to normal weight concrete. Autogenous deformations, selfinduced stresses in fully restrained conditions, elastic...

  2. Internal friction of flux motion in Hg-system high-Tc superconductors

    International Nuclear Information System (INIS)

    Tian, W.; Zhu, J.S.; Shao, H.M.; Li, J.; Wang, Y.N.

    1996-01-01

    The internal friction(IF) and modulus as functions of temperature were measured for several Hg-system high-Tc superconductors(Hg1201, Hg1223, Hg1223 doped with Fe and Pb), under the applied magnetic field, with vibrating reed technique. An IF peak associated with flux motion can be found below Tc for all samples. The temperature of the IF peak increases with reducing vibrating amplitude. This amplitude dependence of IF indicates that the flux motion is characterized by nonlinear behavior. No apparent shift of IF peak position can be detected by varying the frequency in the range from 10 2 Hz to 10 3 Hz. Furthermore, the IF peak height satisfies a scaling law Q -1 ∝ω -n . This may be originated from phase transition of flux line lattice(FLL) rather than a thermally activated diffusion process. (orig.)

  3. The effect of internal and external fields of view on visually induced motion sickness.

    Science.gov (United States)

    Bos, Jelte E; de Vries, Sjoerd C; van Emmerik, Martijn L; Groen, Eric L

    2010-07-01

    Field of view (FOV) is said to affect visually induced motion sickness. FOV, however, is characterized by an internal setting used by the graphics generator (iFOV) and an external factor determined by screen size and viewing distance (eFOV). We hypothesized that especially the incongruence between iFOV and eFOV would lead to sickness. To that end we used a computer game environment with different iFOV and eFOV settings, and found the opposite effect. We speculate that the relative large differences between iFOV and eFOV used in this experiment caused the discrepancy, as may be explained by assuming an observer model controlling body motion. Copyright 2009 Elsevier Ltd. All rights reserved.

  4. Contributions from the Second and Third Internal Gravity Modes for the Vertical Motion Response.

    Directory of Open Access Journals (Sweden)

    Julio Buchmann

    2008-07-01

    Full Text Available In earlier papers of a series of real data integrations of the National Center for Atmospheric Research Community ClimateModel with tropical heat anomalies display regions of pronounced subsidence and drying located several thousand kilometers westwardpoleward of the heating for cases of tropical Atlantic heating and tropical east Pacifi c heating. This highly predictable sinking responseis established within the fi rst fi ve days of these integrations. The normal-modes of a set of adiabatic primitive equations linearizedabout a basic state at rest are used to partition model response into gravity-inertia and Rossby modes. The most important contributionfor the vertical motion response comes from the gravity modes added for all vertical modes. The principal emphasis is given upon thecontributions of the second and third internal vertical modes (with equivalent depths on the order of a fews hundred meters for thevertical motion response.

  5. Techniques and materials for internal water curing of concrete

    DEFF Research Database (Denmark)

    Jensen, Ole Mejlhede; Lura, Pietro

    2006-01-01

    This paper gives an overview of different techniques for incorporation of internal curing water in concrete. Internal water curing can be used to mitigate self-desiccation and selfdesiccation shrinkage. Some concretes may need 50 kg/m3 of internal curing water for this purpose. The price...

  6. A unified internal model theory to resolve the paradox of active versus passive self-motion sensation.

    Science.gov (United States)

    Laurens, Jean; Angelaki, Dora E

    2017-10-18

    Brainstem and cerebellar neurons implement an internal model to accurately estimate self-motion during externally generated ('passive') movements. However, these neurons show reduced responses during self-generated ('active') movements, indicating that predicted sensory consequences of motor commands cancel sensory signals. Remarkably, the computational processes underlying sensory prediction during active motion and their relationship to internal model computations during passive movements remain unknown. We construct a Kalman filter that incorporates motor commands into a previously established model of optimal passive self-motion estimation. The simulated sensory error and feedback signals match experimentally measured neuronal responses during active and passive head and trunk rotations and translations. We conclude that a single sensory internal model can combine motor commands with vestibular and proprioceptive signals optimally. Thus, although neurons carrying sensory prediction error or feedback signals show attenuated modulation, the sensory cues and internal model are both engaged and critically important for accurate self-motion estimation during active head movements.

  7. The effect of the earth's rotation on ground water motion.

    Science.gov (United States)

    Loáiciga, Hugo A

    2007-01-01

    The average pore velocity of ground water according to Darcy's law is a function of the fluid pressure gradient and the gravitational force (per unit volume of ground water) and of aquifer properties. There is also an acceleration exerted on ground water that arises from the Earth's rotation. The magnitude and direction of this rotation-induced force are determined in exact mathematical form in this article. It is calculated that the gravitational force is at least 300 times larger than the largest rotation-induced force anywhere on Earth, the latter force being maximal along the equator and approximately equal to 34 N/m(3) there. This compares with a gravitational force of approximately 10(4) N/m(3).

  8. Respiratory gating based on internal electromagnetic motion monitoring during stereotactic liver radiation therapy: First results.

    Science.gov (United States)

    Poulsen, Per Rugaard; Worm, Esben Schjødt; Hansen, Rune; Larsen, Lars Peter; Grau, Cai; Høyer, Morten

    2015-01-01

    Intrafraction motion may compromise the target dose in stereotactic body radiation therapy (SBRT) of tumors in the liver. Respiratory gating can improve the treatment delivery, but gating based on an external surrogate signal may be inaccurate. This is the first paper reporting on respiratory gating based on internal electromagnetic monitoring during liver SBRT. Two patients with solitary liver metastases were treated with respiratory-gated SBRT guided by three implanted electromagnetic transponders. The treatment was delivered in end-exhale with beam-on when the centroid of the three transponders deviated less than 3 mm [left-right (LR) and anterior-posterior (AP) directions] and 4mm [cranio-caudal (CC)] from the planned position. For each treatment fraction, log files were used to determine the transponder motion during beam-on in the actual gated treatments and in simulated treatments without gating. The motion was used to reconstruct the dose to the clinical target volume (CTV) with and without gating. The reduction in D95 (minimum dose to 95% of the CTV) relative to the plan was calculated for both treatment courses. With gating the maximum course mean (standard deviation) geometrical error in any direction was 1.2 mm (1.8 mm). Without gating the course mean error would mainly increase for Patient 1 [to -2.8 mm (1.6 mm) (LR), 7.1 mm (5.8 mm) (CC), -2.6 mm (2.8mm) (AP)] due to a large systematic cranial baseline drift at each fraction. The errors without gating increased only slightly for Patient 2. The reduction in CTV D95 was 0.5% (gating) and 12.1% (non-gating) for Patient 1 and 0.3% (gating) and 1.7% (non-gating) for Patient 2. The mean duty cycle was 55%. Respiratory gating based on internal electromagnetic motion monitoring was performed for two liver SBRT patients. The gating added robustness to the dose delivery and ensured a high CTV dose even in the presence of large intrafraction motion.

  9. 33 CFR 165.1192 - Security Zones; Waters surrounding San Francisco International Airport and Oakland International...

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Security Zones; Waters..., California. 165.1192 Section 165.1192 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... Security Zones; Waters surrounding San Francisco International Airport and Oakland International Airport...

  10. Near-surface energy transfers from internal tide beams to smaller vertical scale motions

    Science.gov (United States)

    Chou, S.; Staquet, C.; Carter, G. S.; Luther, D. S.

    2016-02-01

    Mechanical energy capable of causing diapycnal mixing in the ocean is transferred to the internal wave field when barotropic tides pass over underwater topography and generate internal tides. The resulting internal tide energy is confined in vertically limited structures, or beams. As internal tide beams (ITBs) propagate through regions of non-uniform stratification in the upper ocean, wave energy can be scattered through multiple reflections and refractions, be vertically trapped, or transferred to non-tidal frequencies through different nonlinear processes. Various observations have shown that ITBs are no longer detectable in horizontal kinetic energy beyond the first surface reflection. Importantly, this implies that some of the internal tide energy no longer propagates in to the abyssal ocean and consequently will not be available to maintain the density stratification. Using the NHM, a nonlinear and nonhydrostatic model based on the MITgcm, simulations of an ITB propagating up to the sea surface are examined in order to quantify the transformation of ITB energy to other motions. We compare and contrast the transformations enabled by idealized, smoothly-varying stratification with transformations enabled by realistic stratification containing a broad-band vertical wavenumber spectrum of variations. Preliminary two-dimensional results show that scattering due to small-scale structure in realistic stratification profiles from Hawaii can lead to energy being vertically trapped near the surface. Idealized simulations of "locally" generated internal solitary waves are analyzed in terms of energy flux transfers from the ITB to solitary waves, higher harmonics, and mean flow. The amount of internal tide energy which propagates back down after near-surface reflection of the ITB in different environments is quantified.

  11. Hydrophobic Collapse of Ubiquitin Generates Rapid Protein-Water Motions.

    Science.gov (United States)

    Wirtz, Hanna; Schäfer, Sarah; Hoberg, Claudius; Reid, Korey M; Leitner, David M; Havenith, Martina

    2018-06-04

    We report time-resolved measurements of the coupled protein-water modes of solvated ubiquitin during protein folding. Kinetic terahertz absorption (KITA) spectroscopy serves as a label-free technique for monitoring large scale conformational changes and folding of proteins subsequent to a sudden T-jump. We report here KITA measurements at an unprecedented time resolution of 500 ns, a resolution 2 orders of magnitude better than those of any previous KITA measurements, which reveal the coupled ubiquitin-solvent dynamics even in the initial phase of hydrophobic collapse. Complementary equilibrium experiments and molecular simulations of ubiquitin solutions are performed to clarify non-equilibrium contributions and reveal the molecular picture upon a change in structure, respectively. On the basis of our results, we propose that in the case of ubiquitin a rapid (<500 ns) initial phase of the hydrophobic collapse from the elongated protein to a molten globule structure precedes secondary structure formation. We find that these very first steps, including large-amplitude changes within the unfolded manifold, are accompanied by a rapid (<500 ns) pronounced change of the coupled protein-solvent response. The KITA response upon secondary structure formation exhibits an opposite sign, which indicates a distinct effect on the solvent-exposed surface.

  12. Experimental investigation of single small bubble motion in linear shear flow in water

    International Nuclear Information System (INIS)

    Li, Zhongchun; Zhao, Yang; Song, Xiaoming; Yu, Hongxing; Jiang, Shengyao; Ishii, Mamoru

    2016-01-01

    Highlights: • The bubble motion in simple linear shear flow was experimentally investigated. • The bubble trajectories, bubble velocity and drag and lift force were obtained using image process routine. • The bubble trajectory was coupled with a zigzag motion and incline path. • The lift force was kept negative and it decreased when bubble diameter and shear flow magnitude increased. - Abstract: The motion of small bubble in a simple shear flow in water was experimental studied. Stable shear flow with low turbulence level was achieved with curved screen and measured using LDV. The bubbles were captured by high speed camera and the captured images were processed with digital image routine. The bubble was released from a capillary tube. The instantaneous bubble position, bubble velocity and forces were obtained based on the captured parameters. The quasi-steady lift coefficient was determined by the linear fitting of the bubble trajectory of several cycles. The results indicated that the lateral migration was coupled with the zigzag motion of bubble in the present experiment. The bubble migrated to the left side and its quasi-steady lift coefficient was negative. Good repeatable results were observed by measurements of 18 bubbles. The bubble motion in shear flow in water was first experimental studied and negative lift force was observed in the present study condition. The lift coefficient decreased when shear stress magnitude or bubble diameter increased in the present experiment condition.

  13. Water Management in Islam | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2001-01-01

    Jan 1, 2001 ... In the Middle East and North Africa, water is rapidly becoming the key ... including water demand management, wastewater reuse, and fair pricing. ... the most promising water management policies, adds to our knowledge of ...

  14. Asynchronous partial contact motion due to internal resonance in multiple degree-of-freedom rotordynamics.

    Science.gov (United States)

    Shaw, A D; Champneys, A R; Friswell, M I

    2016-08-01

    Sudden onset of violent chattering or whirling rotor-stator contact motion in rotational machines can cause significant damage in many industrial applications. It is shown that internal resonance can lead to the onset of bouncing-type partial contact motion away from primary resonances. These partial contact limit cycles can involve any two modes of an arbitrarily high degree-of-freedom system, and can be seen as an extension of a synchronization condition previously reported for a single disc system. The synchronization formula predicts multiple drivespeeds, corresponding to different forms of mode-locked bouncing orbits. These results are backed up by a brute-force bifurcation analysis which reveals numerical existence of the corresponding family of bouncing orbits at supercritical drivespeeds, provided the damping is sufficiently low. The numerics reveal many overlapping families of solutions, which leads to significant multi-stability of the response at given drive speeds. Further, secondary bifurcations can also occur within each family, altering the nature of the response and ultimately leading to chaos. It is illustrated how stiffness and damping of the stator have a large effect on the number and nature of the partial contact solutions, illustrating the extreme sensitivity that would be observed in practice.

  15. Autoregressive harmonic analysis of the earth's polar motion using homogeneous international latitude service data

    Science.gov (United States)

    Fong Chao, B.

    1983-12-01

    The homogeneous set of 80-year-long (1900-1979) International Latitude Service (ILS) polar motion data is analyzed using the autoregressive method (Chao and Gilbert, 1980) which resolves and produces estimates for the complex frequency (or frequency and Q) and complex amplitude (or amplitude and phase) of each harmonic component in the data. Principal conclusion of this analysis are that (1) the ILS data support the multiple-component hypothesis of the Chandler wobble (it is found that the Chandler wobble can be adequately modeled as a linear combination of four (coherent) harmonic components, each of which represents a steady, nearly circular, prograte motion, a behavior that is inconsistent with the hypothesis of a single Chandler period excited in a temporally and/or spatially random fashion). (2) the four-component Chandler wobble model ``explains'' the apparent phase reversal during 1920-1940 and the pre-1950 empirical period-amplitude relation, (3) the annual wobble is shown to be rather stationary over the years both in amplitude and in phase and no evidence is found to support the large variations reported by earlier investigations. (4) the Markowitz wobble is found to support the large variations reported by earlier investigations. (4) the Markowitz wobble is found to be marginally retrograde and appears to have a complicated behavior which cannot be resolved because of the shortness of the data set.

  16. On the coupling of cyclotron motion to ion internal degrees of freedom

    International Nuclear Information System (INIS)

    Dunbar, R.C.

    1979-01-01

    A possibility of significant coupling between gas-phase ion cyclotron motion and two internal angular momentum terms is explored. The first case, coupling with ion spin, is treated via the relativistic Hamiltonian, and found to produce only relativistic perturbations which are entirely negligible. The second case, coupling with ion rotation, is developed via its equivalence to a Stark effect. Small shifts in the cyclotron resonances frequency , ωsub(c) and the appearance of a weak cyclotron resonance at 2ωsub(c) are predicted, but these effects are negligible in general. If the cyclotron frequency is near an ion rotational transition, however, a shift of 10 -5 in cyclotron frequency may be observed, and could provide a means of investigating low-frequency rotational transitions of ions. (Auth.)

  17. Understanding the Origins of Dipolar Couplings and Correlated Motion in the Vibrational Spectrum of Water.

    Science.gov (United States)

    Heyden, Matthias; Sun, Jian; Forbert, Harald; Mathias, Gerald; Havenith, Martina; Marx, Dominik

    2012-08-16

    The combination of vibrational spectroscopy and molecular dynamics simulations provides a powerful tool to obtain insights into the molecular details of water structure and dynamics in the bulk and in aqueous solutions. Applying newly developed approaches to analyze correlations of charge currents, molecular dipole fluctuations, and vibrational motion in real and k-space, we compare results from nonpolarizable water models, widely used in biomolecular modeling, to ab initio molecular dynamics. For the first time, we unfold the infrared response of bulk water into contributions from correlated fluctuations in the three-dimensional, anisotropic environment of an average water molecule, from the OH-stretching region down to the THz regime. Our findings show that the absence of electronic polarizability in the force field model not only results in differences in dipolar couplings and infrared absorption but also induces artifacts into the correlated vibrational motion between hydrogen-bonded water molecules, specifically at the intramolecular bending frequency. Consequently, vibrational motion is partially ill-described with implications for the accuracy of non-self-consistent, a posteriori methods to add polarizability.

  18. Virtual water embodied in international trade of soybean

    DEFF Research Database (Denmark)

    Caro, Dario; Thomsen, Marianne

    This study focuses on hidden water flows embodied in the international trade of soybean. The virtual water content embedded in soybean imported and exported by 174 countries during the period 2000-2013 is estimated.......This study focuses on hidden water flows embodied in the international trade of soybean. The virtual water content embedded in soybean imported and exported by 174 countries during the period 2000-2013 is estimated....

  19. Vertical motion and elastic light-scattering of a laser-levitated water droplet

    International Nuclear Information System (INIS)

    Chan, C. W.; Lee, W. K.

    2001-01-01

    We report the vertical motion and elastic scattered light of a single laser-levitated water microdroplet as it slowly evaporated. The vertical displacement as a function of time exhibited peaks of a variety of widths. Morphology-dependent resonances (MDRs) that induced the displacement peaks were identified. We found that the Stokes equation is adequate to describe the vertical motions driven by broad MDRs. For motions driven by relatively narrow MDRs, significant deviations from results predicted by the Stokes equation were found. The elastic scattered light intensity as a function of the size of the droplet showed sudden increases attributable to deformations of the droplet as its size parameter scanned through narrow MDRs. Copyright 2001 Optical Society of America

  20. Molecular dynamics simulation of nonlinear spectroscopies of intermolecular motions in liquid water.

    Science.gov (United States)

    Yagasaki, Takuma; Saito, Shinji

    2009-09-15

    Water is the most extensively studied of liquids because of both its ubiquity and its anomalous thermodynamic and dynamic properties. The properties of water are dominated by hydrogen bonds and hydrogen bond network rearrangements. Fundamental information on the dynamics of liquid water has been provided by linear infrared (IR), Raman, and neutron-scattering experiments; molecular dynamics simulations have also provided insights. Recently developed higher-order nonlinear spectroscopies open new windows into the study of the hydrogen bond dynamics of liquid water. For example, the vibrational lifetimes of stretches and a bend, intramolecular features of water dynamics, can be accurately measured and are found to be on the femtosecond time scale at room temperature. Higher-order nonlinear spectroscopy is expressed by a multitime correlation function, whereas traditional linear spectroscopy is given by a one-time correlation function. Thus, nonlinear spectroscopy yields more detailed information on the dynamics of condensed media than linear spectroscopy. In this Account, we describe the theoretical background and methods for calculating higher order nonlinear spectroscopy; equilibrium and nonequilibrium molecular dynamics simulations, and a combination of both, are used. We also present the intermolecular dynamics of liquid water revealed by fifth-order two-dimensional (2D) Raman spectroscopy and third-order IR spectroscopy. 2D Raman spectroscopy is sensitive to couplings between modes; the calculated 2D Raman signal of liquid water shows large anharmonicity in the translational motion and strong coupling between the translational and librational motions. Third-order IR spectroscopy makes it possible to examine the time-dependent couplings. The 2D IR spectra and three-pulse photon echo peak shift show the fast frequency modulation of the librational motion. A significant effect of the translational motion on the fast frequency modulation of the librational motion is

  1. Impact of quasar proper motions on the alignment between the International Celestial Reference Frame and the Gaia reference frame

    Science.gov (United States)

    Liu, J.-C.; Malkin, Z.; Zhu, Z.

    2018-03-01

    The International Celestial Reference Frame (ICRF) is currently realized by the very long baseline interferometry (VLBI) observations of extragalactic sources with the zero proper motion assumption, while Gaia will observe proper motions of these distant and faint objects to an accuracy of tens of microarcseconds per year. This paper investigates the difference between VLBI and Gaia quasar proper motions and it aims to understand the impact of quasar proper motions on the alignment of the ICRF and Gaia reference frame. We use the latest time series data of source coordinates from the International VLBI Service analysis centres operated at Goddard Space Flight Center (GSF2017) and Paris observatory (OPA2017), as well as the Gaia auxiliary quasar solution containing 2191 high-probability optical counterparts of the ICRF2 sources. The linear proper motions in right ascension and declination of VLBI sources are derived by least-squares fits while the proper motions for Gaia sources are simulated taking into account the acceleration of the Solar system barycentre and realistic uncertainties depending on the source brightness. The individual and global features of source proper motions in GSF2017 and OPA2017 VLBI data are found to be inconsistent, which may result from differences in VLBI observations, data reduction and analysis. A comparison of the VLBI and Gaia proper motions shows that the accuracies of the components of rotation and glide between the two systems are 2-4 μas yr- 1 based on about 600 common sources. For the future alignment of the ICRF and Gaia reference frames at different wavelengths, the proper motions of quasars must necessarily be considered.

  2. A nuclear magnetic relaxation study on internal motion of polyelectrolytes in solution

    International Nuclear Information System (INIS)

    Schriever, J.

    1977-01-01

    The aim of this thesis is to investigate the significance and the amount of information which can be extracted from the study of frequency dependence of magnetic relaxation rates in solutions of a synthetic macromolecule. Solutions of poly(methacrylic acid), PMA, in water were chosen as the object of the present work. A short survey of nuclear magnetic relaxation in solutions of simple macromolecules is presented. Results obtained by continuous wave experiments on PMA solutions are shown (viz. the information about the transverse relaxation from line width analysis of 60 MHz proton spectra). Water enriched in 17 O is used in magnetic relaxation studies; the results of the determination of hydrogen lifetimes in aqueous solutions of acetic acid and poly(methacrylic acid) are given. The possibility of obtaining information about the dynamics of deuterons in the acid side groups of weak polyacids by measuring deuteron relaxation in heavy water solutions of those acids is considered. The use of deuteron relaxation rate experiments on solutions of selectively methylene deuterated poly(methacrylic acid), [-CD 2 -CCH 3 COOH-]n, is demonstrated and the backbone methylene C-atom motion is charachterized. The magne-tic relaxation of nuclei in the side groups of methylene deuterated PMA, viz. protons in the methyland deuterons in the acid side groups is presented

  3. Sloshing of water in annular pressure-suppression pool of boiling water reactors under earthquake ground motions

    International Nuclear Information System (INIS)

    Aslam, M.; Godden, W.G.; Scalise, D.T.

    1979-10-01

    This report presents an analytical investigation of the sloshing response of water in annular-circular as well as simple-circular tanks under horizontal earthquake ground motions, and the results are verified with tests. This study was motivated because of the use of annular tanks for pressure-suppression pools in Boiling Water Reactors. Such a pressure-suppression pool would typically have 80 ft and 120 ft inside and outside diameters and a water depth of 20 ft. The analysis was based upon potential flow theory and a computer program was written to obtain time-history plots of sloshing displacements of water and the dynamic pressures. Tests were carried out on 1/80th and 1/15th scale models under sinusoidal as well as simulated earthquake ground motions. Tests and analytical results regarding the natural frequencies, surface water displacements, and dynamic pressures were compared and a good agreement was found for relatively small displacements. The computer program gave satisfactory results as long as the maximum water surface displacements were less than 30 in., which is roughly the value obtained under full intensity of El Centro earthquake

  4. Determination of capillary motion of water in bricks using neutron radiography

    International Nuclear Information System (INIS)

    Czachor, A.; Abd El-Ghany El-Abd; Milczarek, J.J.

    2002-01-01

    Vertical migration of water in several porous materials has been directly observed and recorded with the recently installed neutron and gamma radiography facility at Maria reactor of Institute of Atomic Energy, Swierk. The density profiles of water in samples were obtained from the optical density of digitalised images. A simple model (representing the porous material as a collection of capillary tubes of various radii) has been introduced to describe the liquid transport in porous materials in terms of capillary motion. The equation for viscous movement of water in porous material in presence of the gravitation is proposed. A good agreement of the calculated density profiles for vertical water migration with the data collected for siliceous bricks suggests that the thinnest capillary tubes determine the upper edge of the water density profile. (author)

  5. SU-E-J-79: Internal Tumor Volume Motion and Volume Size Assessment Using 4D CT Lung Data

    Energy Technology Data Exchange (ETDEWEB)

    Jurkovic, I [University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Stathakis, S; Li, Y; Patel, A; Vincent, J; Papanikolaou, N; Mavroidis, P [Cancer Therapy and Research Center University of Texas Health Sciences Center at San Antonio, San Antonio, TX (United States)

    2014-06-01

    Purpose: To assess internal tumor volume change through breathing cycle and associated tumor motion using the 4DCT data. Methods: Respiration induced volume change through breathing cycle and associated motion was analyzed for nine patients that were scanned during the different respiratory phases. The examined datasets were the maximum and average intensity projections (MIP and AIP) and the 10 phases of the respiratory cycle. The internal target volume (ITV) was delineated on each of the phases and the planning target volume (PTV) was then created by adding setup margins to the ITV. Tumor motion through the phases was assessed using the acquired 4DCT dataset, which was then used to determine if the margins used for the ITV creation successfully encompassed the tumor in three dimensions. Results: Results showed that GTV motion along the superior inferior axes was the largest in all the cases independent of the tumor location and/or size or the use of abdomen compression. The extent of the tumor motion was found to be connected with the size of the GTV. The smallest GTVs exhibited largest motion vector independent of the tumor location. The motion vector size varied through the phases depending on the tumor size and location and it was smallest for phases 20 and 30. The smaller the volume of the delineated GTV, the greater its volume difference through the different respiratory phases was. The average GTV volume change was largest for the phases 60 and 70. Conclusion: Even if GTV is delineated using both AIP and MIP datasets, its motion extent will exceed the used margins especially for the very small GTV volumes. When the GTV size is less than 10 cc it is recommended to use fusion of the GTVs through all the phases to create the planning ITV.

  6. Sloshing of water in torus pressure-suppression pool of boiling water reactors under earthquake ground motions

    International Nuclear Information System (INIS)

    Aslam, M.; Godden, W.G.; Scalise, D.T.

    1978-08-01

    This report presents an analytical and experimental investigation into the sloshing of water in torus tanks under horizontal earthquake ground motions. This study was motivated because of the use of torus tanks for pressure-suppression pools in Boiling Water Reactors. Such a pressure-suppression pool would typically have 80 ft and 140 ft inside and outside diameters, a 30 ft diameter section, and a water depth of 15 ft. A general finite element analysis was developed for all axisymmetric tanks and a computer program was written to obtain time-history plots of sloshing displacements of water and dynamic pressures. Tests were carried out on a 1/60th scale model under sinusoidal as well as simulated earthquake ground motions. Tests and analytical results regarding natural frequencies, surface water displacements, and dynamic pressures were compared and a good agreement was found within the range of displacements studied. The computer program gave satisfactory results within a maximum range of sloshing displacements in the full-size prototype of 30 in. which is greater than the value obtained under the full intensity of the El Centro earthquake (N-S component 1940). The range of linear behavior was studied experimentally by subjecting the torus model to increasing intensities of the El Centro earthquake

  7. Contact angle hysteresis and motion behaviors of a water nano-droplet on suspended graphene under temperature gradient

    Science.gov (United States)

    Foroutan, Masumeh; Fatemi, S. Mahmood; Esmaeilian, Farshad; Fadaei Naeini, Vahid; Baniassadi, Majid

    2018-05-01

    In the present work, the effect of temperature gradient on the behavior of a water nano-droplet resting on a suspended graphene was studied based on a non-equilibrium molecular dynamics simulation. The acquired results indicate that the applied temperature gradient to the suspended graphene drives the water nano-droplet to the colder region. The droplet accelerates its motion toward the cold reservoir as the temperature gradient is increased. In addition to the translational motion of the nano-droplet, the vortical motion of the water molecules was also observed. Contact angle analysis was also utilized to describe the directional motion of the nano-droplet. The translational motion of the droplet leads to the estimation of contact angle hysteresis through advancing and receding contact angles while the rotational motion resulted in the advancing and receding fronts being switched with one another through the simulation. The average displacement vector of the water molecules shows that parts of the droplet seem to stagnate while other parts rotate around them. The reason behind this particular behavior was studied based on interaction energy contours between a water molecule and the suspended graphene. The obtained data indicate that the rotational motion is in agreement with the migration of the water molecules to low interaction energy regions in order to avoid high interaction energy areas.

  8. Visualization of the collective vortex-like motions in liquid argon and water: Molecular dynamics simulation

    Science.gov (United States)

    Anikeenko, A. V.; Malenkov, G. G.; Naberukhin, Yu. I.

    2018-03-01

    We propose a new measure of collectivity of molecular motion in the liquid: the average vector of displacement of the particles, ⟨ΔR⟩, which initially have been localized within a sphere of radius Rsph and then have executed the diffusive motion during a time interval Δt. The more correlated the motion of the particles is, the longer will be the vector ⟨ΔR⟩. We visualize the picture of collective motions in molecular dynamics (MD) models of liquids by constructing the ⟨ΔR⟩ vectors and pinning them to the sites of the uniform grid which divides each of the edges of the model box into equal parts. MD models of liquid argon and water have been studied by this method. Qualitatively, the patterns of ⟨ΔR⟩ vectors are similar for these two liquids but differ in minor details. The most important result of our research is the revealing of the aggregates of ⟨ΔR⟩ vectors which have the form of extended flows which sometimes look like the parts of vortices. These vortex-like clusters of ⟨ΔR⟩ vectors have the mesoscopic size (of the order of 10 nm) and persist for tens of picoseconds. Dependence of the ⟨ΔR⟩ vector field on parameters Rsph, Δt, and on the model size has been investigated. This field in the models of liquids differs essentially from that in a random-walk model.

  9. Experimental observation of internal water curing of concrete

    DEFF Research Database (Denmark)

    Lura, Pietro; Jensen, Ole Mejlhede

    2007-01-01

    Internal water curing has a significant effect on concrete. In addition to affecting hydration and moisture distribution, it influences most concrete properties, such as strength, shrinkage, cracking, and durability. The following paper is an overview of experimental methods to study internal water...... curing of concrete and its consequences. The special techniques needed to study internal water curing are dealt with along with the consequences of this process. Examples of applications are given and new measuring techniques that may potentially be applied to this field are addressed....

  10. Facing the water barrier | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    A world "water crisis" is poised to deliver its most devastating blow to the Middle ... across the region is needed to deepen knowledge, develop research tools, and ... issues as privatization, wastewater reuse, and participatory management.

  11. SU-C-BRF-05: Design and Geometric Validation of An Externally and Internally Deformable, Programmable Lung Motion Phantom

    International Nuclear Information System (INIS)

    Cheung, Y; Sawant, A

    2014-01-01

    Purpose: Most clinically-deployed strategies for respiratory motion management in lung radiotherapy (e.g., gating, tracking) use external markers that serve as surrogates for tumor motion. However, typical lung phantoms used to validate these strategies are rigid-exterior+rigid-interior or rigid-exterior+deformable-interior. Neither class adequately represents the human anatomy, which is deformable internally as well as externally. We describe the construction and experimental validation of a more realistic, externally- and internally-deformable, programmable lung phantom. Methods: The outer shell of a commercially-available lung phantom (RS- 1500, RSD Inc.) was used. The shell consists of a chest cavity with a flexible anterior surface, and embedded vertebrae, rib-cage and sternum. A 3-axis platform was programmed with sinusoidal and six patient-recorded lung tumor trajectories. The platform was used to drive a rigid foam ‘diaphragm’ that compressed/decompressed the phantom interior. Experimental characterization comprised of mapping the superior-inferior (SI) and anterior-posterior (AP) trajectories of external and internal radioopaque markers with kV x-ray fluoroscopy and correlating these with optical surface monitoring using the in-room VisionRT system. Results: The phantom correctly reproduced the programmed motion as well as realistic effects such as hysteresis. The reproducibility of marker trajectories over multiple runs for sinusoidal as well as patient traces, as characterized by fluoroscopy, was within 0.4 mm RMS error for internal as well as external markers. The motion trajectories of internal and external markers as measured by fluoroscopy were found to be highly correlated (R=0.97). Furthermore, motion trajectories of arbitrary points on the deforming phantom surface, as recorded by the VisionRT system also showed a high correlation with respect to the fluoroscopically-measured trajectories of internal markers (R=0.92). Conclusion: We have

  12. Lower internals for pressurized water reactor

    International Nuclear Information System (INIS)

    Chevereau, G.; Babin, M.

    1989-01-01

    The lower internals for PWR has a separating plate mounted beneath its lower core plate and defining a distribution chamber with it, peripheral mechanical connectors joining the plates separated by coolant passage and apertures in the separation plate connected to a coolant pipe [fr

  13. Polar Motion Studies and NOAA's Legacy of International Scientific Cooperation: Ukiah and Gaithersburg Latitude Observatories

    Science.gov (United States)

    Caccamise, D. J., II; Stone, W. A.

    2017-12-01

    In 1895, the International Geodetic Association invited the United States Coast and Geodetic Survey (USC&GS) to join in an unprecedented international effort to observe and measure the earth's polar motion. This effort was in response to the American astronomer Seth C. Chandler Jr. announcing his 1891 discovery that the earth's axis of rotation—and hence the direction of true north—wobbles within the earth with a period of about 14 months, varying latitude everywhere on the globe. In 1899, two astro-geodetic observatories were built in Gaithersburg, Maryland and Ukiah, California with three others in Caloforte, Italy; Kitab, Russia (now Uzbekistan); and Mizusawa, Japan. (A sixth station was located and operated at an astronomical observatory in Cincinnati, Ohio until 1916 using instruments loaned by USC&GS). All five observatories were located along the same parallel - approximately 35 degrees - 8 minutes. The observatories were decommissioned in 1982, and subsequently, NOAA deeded the two remaining U.S. observatories to the cities of Gaithersburg and Ukiah. The observatories and adjacent property were to be used as parkland. Both cities have restored the observatories and opened public parks. Recently, Gaithersburg (Ukiah in progress) has had its latitude observatory dedicated as a National Historic Landmark. In 2014-15, the National Geodetic Survey (NGS, the present-day NOAA successor to the USC&GS) loaned the original zenith telescopes to the communities, returning the observatories to their original configuration. The contribution of NOAA observers and the data collected is still important to astronomers and geophysicists and has practical applications in spacecraft navigation and geospatial positioning. This poster will bring to fruition this multiyear effort among partners by providing examples of NOAA's mission and contribution to science, service, and stewardship at both geodetic observatories, through programs and historic exhibits for students and the

  14. Divining Jordan's desert waters | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... in the area have a long history of being water-conservers, and the idea of using the ... Dr Abu-Jaber examined is covered by an ancient, volcanic rock called basalt. ... When a desert cloudburst drops rain on the area, the raindrops quickly roll ...

  15. Himalayan Adaptation, Water, and Resilience | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Himalayan Adaptation, Water, and Resilience. This research project will serve to help poor and vulnerable women, men, and children learn to adapt to and manage climate change in Asia's Hindu Kush Himalayan region. Why the Himalayan region is important. The region, stretching from central Afghanistan to northern ...

  16. Internal motion time scales of a small, highly stable and disulfide-rich protein: A 15N, 13C NMR and molecular dynamics study

    International Nuclear Information System (INIS)

    Guenneugues, Marc; Gilquin, Bernard; Wolff, Nicolas; Menez, Andre; Zinn-Justin, Sophie

    1999-01-01

    Motions of the backbone CαHα and threonine CβHβ bonds of toxin α were investigated using natural abundance 13C NMR and molecular dynamics. Measurement of the 13C longitudinal and transverse relaxation rates employed ACCORDION techniques together with coherence selection by pulsed field gradients and sensitivity enhancement through the use of preservation of equivalent pathway, thus allowing a considerable reduction of the required spectrometer time. 13C R1, R2, 1H → 13C NOE were obtained, as well as the variations of R1ρ(90 deg.) as a function of the rf field strength. These data were compared to those recorded by 1H and 15N NMR on a labelled sample of the toxin [Guenneugues et al. (1997) Biochemistry, 36, 16097-16108]. Both sets of data showed that picosecond to nanosecond time scale motions are well correlated to the secondary structure of the protein. This was further reinforced by the analysis of a 1 ns molecular dynamics simulation in water. Several CαHα and threonine CβHβ experimentally exhibit fast motions with a correlation time longer than 500 ps, that cannot be sampled along the simulation. In addition, the backbone exhibits motions on the microsecond to millisecond time scale on more than half of its length. Thus, toxin α, a highly stable protein (Tm=75 deg. C at acidic pH) containing 61 amino acids and 4 disulfides, shows important internal motions on time scales ranging from 0.1-0.5 ps, to 10-100 ps, 1 ns, and about 30 μs to 10 ms

  17. Three-dimensional intrafractional internal target motions in accelerated partial breast irradiation using three-dimensional conformal external beam radiotherapy.

    Science.gov (United States)

    Hirata, Kimiko; Yoshimura, Michio; Mukumoto, Nobutaka; Nakamura, Mitsuhiro; Inoue, Minoru; Sasaki, Makoto; Fujimoto, Takahiro; Yano, Shinsuke; Nakata, Manabu; Mizowaki, Takashi; Hiraoka, Masahiro

    2017-07-01

    We evaluated three-dimensional intrafractional target motion, divided into respiratory-induced motion and baseline drift, in accelerated partial breast irradiation (APBI). Paired fluoroscopic images were acquired simultaneously using orthogonal kV X-ray imaging systems at pre- and post-treatment for 23 patients who underwent APBI with external beam radiotherapy. The internal target motion was calculated from the surgical clips placed around the tumour cavity. The peak-to-peak respiratory-induced motions ranged from 0.6 to 1.5mm in all directions. A systematic baseline drift of 1.5mm towards the posterior direction and a random baseline drift of 0.3mm in the lateral-medial and cranial-caudal directions were observed. The baseline for an outer tumour cavity drifted towards the lateral and posterior directions, and that for an upper tumour cavity drifted towards the cranial direction. Moderate correlations were observed between the posterior baseline drift and the patients' physical characteristics. The posterior margin for intrafractional uncertainties was larger than 5mm in patients with greater fat thickness due to the baseline drift. The magnitude of the intrafractional motion was not uniform according to the direction, patients' physical characteristics, or tumour cavity location due to the baseline drift. Therefore, the intrafractional systematic movement should be properly managed. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. A Fast Algorithm to Simulate Droplet Motions in Oil/Water Two Phase Flow

    KAUST Repository

    Zhang, Tao

    2017-06-09

    To improve the research methods in petroleum industry, we develop a fast algorithm to simulate droplet motions in oil and water two phase flow, using phase field model to describe the phase distribution in the flow process. An efficient partial difference equation solver—Shift-Matrix method is applied here, to speed up the calculation coding in high-level language, i.e. Matlab and R. An analytical solution of order parameter is derived, to define the initial condition of phase distribution. The upwind scheme is applied in our algorithm, to make it energy decay stable, which results in the fast speed of calculation. To make it more clear and understandable, we provide the specific code for forming the coefficient matrix used in Shift-Matrix Method. Our algorithm is compared with other methods in different scales, including Front Tracking and VOSET method in macroscopic and LBM method using RK model in mesoscopic scale. In addition, we compare the result of droplet motion under gravity using our algorithm with the empirical formula common used in industry. The result proves the high efficiency and robustness of our algorithm and it’s then used to simulate the motions of multiple droplets under gravity and cross-direction forces, which is more practical in industry and can be extended to wider application.

  19. Water motion and movement without sticking, weight loss and cross-contaminant in superhydrophobic glass tube.

    Science.gov (United States)

    Yuan, Jian-Jun; Jin, Ren-Hua

    2010-02-10

    We report that a simple fabrication of a superhydrophobic nanosurface consisted of a grass-like silica thin film on the inner wall of a glass tube and its feature in water motion and water movement. The glass tube with a superhydrophobic inner wall can make the water flow with friction-drag reduction and completely preventing water sticking. Transferring water by this tube did not cause weight loss at all. Therefore, aqueous solutions containing high content metal ions were cross-moved without washing the tube used and no cross-contamination occurred after cross-movement. Furthermore, in an inside diameter of 6.0 mm glass tube where the half-length of the inner surface is covered by superhydrophobic nanograss and the other half is an unmodified hydrophilic surface, the water droplets flowing down from the hydrophilic side can be stopped spontaneously at the hydrophilic-superhydrophobic boundary as if there is an invisible flow-stopping fence built inside the glass tube.

  20. Leaks in the internal water supply piping systems

    OpenAIRE

    Orlov Evgeniy Vladimirovich; Komarov Anatoliy Sergeevich; Mel’nikov Fedor Alekseevich; Serov Aleksandr Evgen’evich

    2015-01-01

    Great water losses in the internal plumbing of a building lead to the waste of money for a fence, purification and supply of water volumes in excess. This does not support the concept of water conservation and resource saving lying today in the basis of any building’s construction having plumbing. Leakage means unplanned of water losses systems in domestic water supply systems (hot or cold) as a result of impaired integrity, complicating the operation of a system and leading to high costs of ...

  1. Correlation of glenohumeral internal rotation deficit and total rotational motion to shoulder injuries in professional baseball pitchers.

    Science.gov (United States)

    Wilk, Kevin E; Macrina, Leonard C; Fleisig, Glenn S; Porterfield, Ronald; Simpson, Charles D; Harker, Paul; Paparesta, Nick; Andrews, James R

    2011-02-01

    Glenohumeral internal rotation deficit (GIRD) indicates a 20° or greater loss of internal rotation of the throwing shoulder compared with the nondominant shoulder. To determine whether GIRD and a deficit in total rotational motion (external rotation + internal rotation) compared with the nonthrowing shoulder correlate with shoulder injuries in professional baseball pitchers. Case series; Level of evidence, 4. Over 3 competitive seasons (2005 to 2007), passive range of motion measurements were evaluated on the dominant and nondominant shoulders for 170 pitcher-seasons. This included 122 professional pitchers during the 3 seasons of data collection, in which some pitchers were measured during multiple seasons. Ranges of motion were measured with a bubble goniometer during the preseason, by the same examiner each year. External and internal rotation of the glenohumeral joint was assessed with the participant supine and the arm abducted 90° in the plane of the scapula, with the scapula stabilized anteriorly at the coracoid process. The reproducibility of the test methods had an intraclass correlation coefficient of .81. Days in which the player was unable to participate because of injury or surgery were recorded during the season by the medical staff of the team and defined as an injury. Pitchers with GIRD (n = 40) were nearly twice as likely to be injured as those without but without statistical significance (P = .17). Pitchers with total rotational motion deficit greater than 5° had a higher rate of injury. Minor league pitchers were more likely than major league pitchers to be injured. However, when players were injured, major league pitchers missed a significantly greater number of games than minor league pitchers. Compared with pitchers without GIRD, pitchers with GIRD appear to be at a higher risk for injury and shoulder surgery.

  2. Virtual water trade: an assessment of water use efficiency in the international food trade

    Directory of Open Access Journals (Sweden)

    H. Yang

    2006-01-01

    Full Text Available Amid an increasing water scarcity in many parts of the world, virtual water trade as both a policy instrument and practical means to balance the local, national and global water budget has received much attention in recent years. Building upon the knowledge of virtual water accounting in the literature, this study assesses the efficiency of water use embodied in the international food trade from the perspectives of exporting and importing countries and at the global and country levels. The investigation reveals that the virtual water flows primarily from countries of high crop water productivity to countries of low crop water productivity, generating a global saving in water use. Meanwhile, the total virtual water trade is dominated by green virtual water, which constitutes a low opportunity cost of water use as opposed to blue virtual water. A sensitivity analysis, however, suggests high uncertainties in the virtual water accounting and the estimation of the scale of water saving. The study also raises awareness of the limited effect of water scarcity on the global virtual water trade and the negative implications of the global water saving for the water use efficiency and food security in importing countries and the environment in exporting countries. The analysis shows the complexity in evaluating the efficiency gains in the international virtual water trade. The findings of the study, nevertheless, call for a greater emphasis on rainfed agriculture to improve the global food security and environmental sustainability.

  3. MERLIN observations of water maser proper motions in VY Canis Majoris

    Science.gov (United States)

    Richards, A. M. S.; Yates, J. A.; Cohen, R. J.

    1998-09-01

    MERLIN observations of the 22-GHz water masers in the circumstellar envelope of the supergiant VY CMa show an ellipsoidal distribution with a maximum extent of 700 mas east-west and 400 mas north-south. Comparison with observations made nine years earlier shows that the majority of maser features have survived and show proper motions throughout the region. The mean change in position is 28 mas and the proper motions are generally directed away from the assumed stellar position, and tend to be larger for features at greater projected distances. If the H_2O maser region is modelled as a partially filled thick spherical shell, and VY CMa is at a distance of 1.5 kpc, then the proper motion velocities in the direction of expansion are between 8kms^-1 at a distance of 75 mas from the assumed stellar position and 32kms^-1 at 360 mas. These velocities are consistent with the H_2O maser spectral line velocities which correspond to a maximum expansion velocity of 36kms^-1 at 400 mas from the assumed stellar position. These observations are consistent with radiation pressure on dust providing the force to accelerate the stellar wind as it passes through the H_2O maser shell. The H_2O maser region is elongated in the same direction as the dusty nebula around VY CMa. The water masers illuminate the small-scale dynamics and clumpiness which show the role of dust in driving the outflow. The overall ellipsoidal shape may be due to properties of the dust, such as its behaviour in the stellar magnetic field, or to interaction between the wind and circumstellar material. Maser monitoring also shows the difference between changes on the time-scale of stellar variability (a few years) and possible stages in the evolution of VY CMa to its likely fate as a supernova.

  4. Altered Gravity Simulated by Parabolic Flight and Water Immersion Leads to Decreased Trunk Motion.

    Directory of Open Access Journals (Sweden)

    Peiliang Wang

    Full Text Available Gravity is one of the important environmental factors that influence the physiologies and behaviors of animals and humans, and changes in gravity elicit a variety of physiological and behavioral alterations that include impaired movement coordination, vertigo, spatial disorientation, and perceptual illusions. To elucidate the effects of gravity on human physiology and behavior, we examined changes in wrist and trunk activities and heart rate during parabolic flight and the activity of wrist and trunk in water immersion experiments. Data from 195 person-time parabolas performed by eight subjects revealed that the trunk motion counts decreased by approximately half during ascending legs (hypergravity, relative to the data acquired before the parabolic flights. In contrast, the wrist activity remained unchanged. The results from the water immersion experiments demonstrated that in the underwater condition, both the wrist and trunk activities were significantly decreased but the latter decreased to a much lower level. Together, these data suggest that gravitational alterations can result in differential influences on the motions of the wrist and the trunk. These findings might be important for understanding the degeneration of skeleton and muscular system and performance of astronauts in microgravity.

  5. Altered Gravity Simulated by Parabolic Flight and Water Immersion Leads to Decreased Trunk Motion

    Science.gov (United States)

    Tian, Yu; Li, Fan; Zhang, Shaoyao; Zhang, Lin; Guo, Yaoyu; Liu, Weibo; Wang, Chunhui; Chen, Shanguang; Guo, Jinhu

    2015-01-01

    Gravity is one of the important environmental factors that influence the physiologies and behaviors of animals and humans, and changes in gravity elicit a variety of physiological and behavioral alterations that include impaired movement coordination, vertigo, spatial disorientation, and perceptual illusions. To elucidate the effects of gravity on human physiology and behavior, we examined changes in wrist and trunk activities and heart rate during parabolic flight and the activity of wrist and trunk in water immersion experiments. Data from 195 person-time parabolas performed by eight subjects revealed that the trunk motion counts decreased by approximately half during ascending legs (hypergravity), relative to the data acquired before the parabolic flights. In contrast, the wrist activity remained unchanged. The results from the water immersion experiments demonstrated that in the underwater condition, both the wrist and trunk activities were significantly decreased but the latter decreased to a much lower level. Together, these data suggest that gravitational alterations can result in differential influences on the motions of the wrist and the trunk. These findings might be important for understanding the degeneration of skeleton and muscular system and performance of astronauts in microgravity. PMID:26208253

  6. Neural correlates of sensory prediction errors in monkeys: evidence for internal models of voluntary self-motion in the cerebellum.

    Science.gov (United States)

    Cullen, Kathleen E; Brooks, Jessica X

    2015-02-01

    During self-motion, the vestibular system makes essential contributions to postural stability and self-motion perception. To ensure accurate perception and motor control, it is critical to distinguish between vestibular sensory inputs that are the result of externally applied motion (exafference) and that are the result of our own actions (reafference). Indeed, although the vestibular sensors encode vestibular afference and reafference with equal fidelity, neurons at the first central stage of sensory processing selectively encode vestibular exafference. The mechanism underlying this reafferent suppression compares the brain's motor-based expectation of sensory feedback with the actual sensory consequences of voluntary self-motion, effectively computing the sensory prediction error (i.e., exafference). It is generally thought that sensory prediction errors are computed in the cerebellum, yet it has been challenging to explicitly demonstrate this. We have recently addressed this question and found that deep cerebellar nuclei neurons explicitly encode sensory prediction errors during self-motion. Importantly, in everyday life, sensory prediction errors occur in response to changes in the effector or world (muscle strength, load, etc.), as well as in response to externally applied sensory stimulation. Accordingly, we hypothesize that altering the relationship between motor commands and the actual movement parameters will result in the updating in the cerebellum-based computation of exafference. If our hypothesis is correct, under these conditions, neuronal responses should initially be increased--consistent with a sudden increase in the sensory prediction error. Then, over time, as the internal model is updated, response modulation should decrease in parallel with a reduction in sensory prediction error, until vestibular reafference is again suppressed. The finding that the internal model predicting the sensory consequences of motor commands adapts for new

  7. A study of the effects of internal organ motion on dose escalation in conformal prostate treatments

    International Nuclear Information System (INIS)

    Happersett, Laura; Mageras, Gig S.; Zelefsky, Michael J.; Burman, Chandra M.; Leibel, Steven A.; Chui Chen; Fuks, Zvi; Bull, Sarah; Ling, C. Clifton; Kutcher, Gerald J.

    2003-01-01

    Background and purpose: To assess the effect of internal organ motion on the dose distributions and biological indices for the target and non-target organs for three different conformal prostate treatment techniques. Materials and methods: We examined three types of treatment plans in 20 patients: (1) a six field plan, with a prescribed dose of 75.6 Gy; (2) the same six field plan to 72 Gy followed by a boost to 81 Gy; and (3) a five field plan with intensity modulated beams delivering 81 Gy. Treatment plans were designed using an initial CT data set (planning) and applied to three subsequent CT scans (treatment). The treatment CT contours were used to represent patient specific organ displacement; in addition, the dose distribution was convolved with a Gaussian distribution to model random setup error. Dose-volume histograms were calculated using an organ deformation model in which the movement between scans of individual points interior to the organs was tracked and the dose accumulated. The tumor control probability (TCP) for the prostate and proximal half of seminal vesicles (clinical target volume, CTV), normal tissue complication probability (NTCP) for the rectum and the percent volume of bladder wall receiving at least 75 Gy were calculated. Results: The patient averaged increase in the planned TCP between plan types 2 and 1 and types 3 and 1 was 9.8% (range 4.9-12.5%) for both, whereas the corresponding increases in treatment TCP were 9.0% (1.3-16%) and 8.1% (-1.3-13.8%). In all patients, plans 2 and 3 (81 Gy) exhibited equal or higher treatment TCP than plan 1 (75.6 Gy). The maximum treatment NTCP for rectum never exceeded the planning constraint and percent volume of bladder wall receiving at least 75 Gy was similar in the planning and treatment scans for all three plans. Conclusion: For plans that deliver a uniform prescribed dose to the planning target volume (PTV) (plan 1), current margins are adequate. In plans that further escalate the dose to part

  8. Influence of different breathing maneuvers on internal and external organ motion: Use of fiducial markers in dynamic MRI

    International Nuclear Information System (INIS)

    Plathow, Christian; Zimmermann, Hendrik; Fink, Christian; Umathum, Reiner; Schoebinger, Max; Huber, Peter; Zuna, Ivan; Debus, Juergen; Schlegel, Wolfgang; Meinzer, Hans-Peter; Semmler, Wolfhard; Kauczor, Hans-Ulrich; Bock, Michael

    2005-01-01

    Purpose: To investigate, with dynamic magnetic resonance imaging (dMRI) and a fiducial marker, the influence of different breathing maneuvers on internal organ and external chest wall motion. Methods and materials: Lung and chest wall motion of 16 healthy subjects (13 male, 3 female) were examined with real-time trueFISP (true fast imaging with steady-state precession) dMRI and a small inductively coupled marker coil on either the abdomen or thorax. Three different breathing maneuvers were performed (predominantly 'abdominal breathing,' 'thoracic breathing,' and unspecific 'normal breathing'). The craniocaudal (CC), anteroposterior (AP), and mediolateral (ML) lung distances were correlated (linear regression coefficient) with marker coil position during forced and quiet breathing. Results: Differences of the CC distance between maximum forced inspiration and expiration were significant between abdominal and thoracic breathing (p < 0.05). The correlation between CC distance and coil position was best for forced abdominal breathing and a marker coil in the abdominal position (r 0.89 ± 0.04); for AP and ML distance, forced thoracic breathing and a coil in the thoracic position was best (r = 0.84 ± 0.03 and 0.82 ± 0.03, respectively). In quiet breathing, a lower correlation was found. Conclusion: A fiducial marker coil external to the thorax in combination with dMRI is a new technique to yield quantitative information on the correlation of internal organ and external chest wall motion. Correlations are highly dependent on the breathing maneuver

  9. Angry Birds realized: water balloon launcher for teaching projectile motion with drag

    International Nuclear Information System (INIS)

    Edwards, Boyd F; Sam, David D; Christiansen, Michael A; Booth, William A; Jessup, Leslie O

    2014-01-01

    A simple, collapsible design for a large water balloon slingshot launcher features a fully adjustable initial velocity vector and a balanced launch platform. The design facilitates quantitative explorations of the dependence of the balloon range and time of flight on the initial speed, launch angle, and projectile mass, in an environment where quadratic air drag is important. Presented are theory and experiments that characterize this drag, and theory and experiments that characterize the nonlinear elastic energy and hysteresis of the latex tubing used in the slingshot. The experiments can be carried out with inexpensive and readily available tools and materials. The launcher provides an engaging way to teach projectile motion and elastic energy to students of a wide variety of ages. (paper)

  10. Motion-based, high-yielding, and fast separation of different charged organics in water.

    Science.gov (United States)

    Xuan, Mingjun; Lin, Xiankun; Shao, Jingxin; Dai, Luru; He, Qiang

    2015-01-12

    We report a self-propelled Janus silica micromotor as a motion-based analytical method for achieving fast target separation of polyelectrolyte microcapsules, enriching different charged organics with low molecular weights in water. The self-propelled Janus silica micromotor catalytically decomposes a hydrogen peroxide fuel and moves along the direction of the catalyst face at a speed of 126.3 μm s(-1) . Biotin-functionalized Janus micromotors can specifically capture and rapidly transport streptavidin-modified polyelectrolyte multilayer capsules, which could effectively enrich and separate different charged organics in water. The interior of the polyelectrolyte multilayer microcapsules were filled with a strong charged polyelectrolyte, and thus a Donnan equilibrium is favorable between the inner solution within the capsules and the bulk solution to entrap oppositely charged organics in water. The integration of these self-propelled Janus silica micromotors and polyelectrolyte multilayer capsules into a lab-on-chip device that enables the separation and analysis of charged organics could be attractive for a diverse range of applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Boiling-Water Reactor internals aging degradation study

    International Nuclear Information System (INIS)

    Luk, K.H.

    1993-09-01

    This report documents the results of an aging assessment study for boiling water reactor (BWR) internals. Major stressors for BWR internals are related to unsteady hydrodynamic forces generated by the primary coolant flow in the reactor vessel. Welding and cold-working, dissolved oxygen and impurities in the coolant, applied loads and exposures to fast neutron fluxes are other important stressors. Based on results of a component failure information survey, stress corrosion cracking (SCC) and fatigue are identified as the two major aging-related degradation mechanisms for BWR internals. Significant reported failures include SCC in jet-pump holddown beams, in-core neutron flux monitor dry tubes and core spray spargers. Fatigue failures were detected in feedwater spargers. The implementation of a plant Hydrogen Water Chemistry (HWC) program is considered as a promising method for controlling SCC problems in BWR. More operating data are needed to evaluate its effectiveness for internal components. Long-term fast neutron irradiation effects and high-cycle fatigue in a corrosive environment are uncertainty factors in the aging assessment process. BWR internals are examined by visual inspections and the method is access limited. The presence of a large water gap and an absence of ex-core neutron flux monitors may handicap the use of advanced inspection methods, such as neutron noise vibration measurements, for BWR

  12. Ecosystem Services and International Water Law: towards a more ...

    African Journals Online (AJOL)

    While key principles of international water law, for example, equitable and reasonable utilisation, are not in conflict with an ecosystem services approach; significant challenges remain in its implementation. However, as the methods and tools used to identify ecosystem services improve, it is likely that such an approach will ...

  13. Water Balances in the Eastern Mediterranean | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    As a result, the importance of fresh water to economic development, quality of life, ... Case studies from Lebanon, Israel, Palestine, Jordan, Turkey, and North ... balances and propose methods for regional cooperation in the management of ... An IDRC delegation will join international delegates and city representatives at the ...

  14. Internal models of target motion: expected dynamics overrides measured kinematics in timing manual interceptions.

    Science.gov (United States)

    Zago, Myrka; Bosco, Gianfranco; Maffei, Vincenzo; Iosa, Marco; Ivanenko, Yuri P; Lacquaniti, Francesco

    2004-04-01

    Prevailing views on how we time the interception of a moving object assume that the visual inputs are informationally sufficient to estimate the time-to-contact from the object's kinematics. Here we present evidence in favor of a different view: the brain makes the best estimate about target motion based on measured kinematics and an a priori guess about the causes of motion. According to this theory, a predictive model is used to extrapolate time-to-contact from expected dynamics (kinetics). We projected a virtual target moving vertically downward on a wide screen with different randomized laws of motion. In the first series of experiments, subjects were asked to intercept this target by punching a real ball that fell hidden behind the screen and arrived in synchrony with the visual target. Subjects systematically timed their motor responses consistent with the assumption of gravity effects on an object's mass, even when the visual target did not accelerate. With training, the gravity model was not switched off but adapted to nonaccelerating targets by shifting the time of motor activation. In the second series of experiments, there was no real ball falling behind the screen. Instead the subjects were required to intercept the visual target by clicking a mousebutton. In this case, subjects timed their responses consistent with the assumption of uniform motion in the absence of forces, even when the target actually accelerated. Overall, the results are in accord with the theory that motor responses evoked by visual kinematics are modulated by a prior of the target dynamics. The prior appears surprisingly resistant to modifications based on performance errors.

  15. Simulation and experimental research on trans-media vehicle water-entry motion characteristics at low speed.

    Science.gov (United States)

    Yang, Jian; Li, Yongli; Feng, Jinfu; Hu, Junhua; Liu, An

    2017-01-01

    The motion characteristics of trans-media vehicles during the water-entry process were explored in this study in an effort to obtain the optimal water-entry condition of the vehicle for developing a novel, single control strategy integrating underwater non-control and in-air control. A water-entry dynamics model is established by combining the water-entry motion characteristics of the vehicle in uncontrolled conditions at low speed with time-varying parameters (e.g. buoyancy, added mass). A water-entry experiment is designed to confirm the effectiveness of the established model. After that, by comparing the experimental results with the simulated results, the model is further modified to more accurately reflect water-entry motion. The change laws of the vehicle's attitude and position during the water-entry process are also obtained by analyzing the simulation of the modified model under different velocity, angle, and angle of attack conditions. The results presented here have guiding significance for the future realization of reaching the stable underwater navigation state of the vehicle after water-entry process.

  16. Simulation and experimental research on trans-media vehicle water-entry motion characteristics at low speed.

    Directory of Open Access Journals (Sweden)

    Jian Yang

    Full Text Available The motion characteristics of trans-media vehicles during the water-entry process were explored in this study in an effort to obtain the optimal water-entry condition of the vehicle for developing a novel, single control strategy integrating underwater non-control and in-air control. A water-entry dynamics model is established by combining the water-entry motion characteristics of the vehicle in uncontrolled conditions at low speed with time-varying parameters (e.g. buoyancy, added mass. A water-entry experiment is designed to confirm the effectiveness of the established model. After that, by comparing the experimental results with the simulated results, the model is further modified to more accurately reflect water-entry motion. The change laws of the vehicle's attitude and position during the water-entry process are also obtained by analyzing the simulation of the modified model under different velocity, angle, and angle of attack conditions. The results presented here have guiding significance for the future realization of reaching the stable underwater navigation state of the vehicle after water-entry process.

  17. The Effects of International Trade on Water Use.

    Science.gov (United States)

    Kagohashi, Kazuki; Tsurumi, Tetsuya; Managi, Shunsuke

    2015-01-01

    The growing scarcity of water resources worldwide is conditioned not only by precipitation changes but also by changes to water use patterns; the latter is driven by social contexts such as capital intensity, trade openness, and income. This study explores the determinants of water use by focusing on the effect of trade openness on the degree to which water is withdrawn and consumed. Previous studies have conducted analyses on the determinants of water use but have ignored the endogeneity of trade openness. To deal with this endogeneity problem, we adopt instrumental variable estimation and clarify the determinants of water use. The determinants of water use are divided into scale, technique, and composition effects. Calculating each trade-induced effect, we examine how trade openness affects the degree of water use. Our results show that while trade has a positive effect on water withdrawal/consumption through trade-induced scale effects and direct composition effects, the trade-induced technique and the indirect composition effect, both of which exhibit a negative sign, counteract the scale effect and the direct composition effect, resulting in reduced water withdrawal/consumption. The overall effect induced by trade is calculated as being in the range of -1.00 to -1.52; this means that the overall effect of a 1% increase in the intensity of trade openness reduces the degree of water withdrawal/consumption by roughly 1.0-1.5%, on average. This result indicates that international bilateral trade would promote efficient water use through the diffusion of water-saving technologies and the reformation of industry composition.

  18. NASA's Impacts Towards Improving International Water Management Using Satellites

    Science.gov (United States)

    Toll, D. L.; Doorn, B.; Searby, N. D.; Entin, J. K.; Lawford, R. G.; Mohr, K. I.; Lee, C. M.

    2013-12-01

    Key objectives of the NASA's Water Resources and Capacity Building Programs are to discover and demonstrate innovative uses and practical benefits of NASA's advanced system technologies for improved water management. This presentation will emphasize NASA's water research, applications, and capacity building activities using satellites and models to contribute to water issues including water availability, transboundary water, flooding and droughts to international partners, particularly developing countries. NASA's free and open exchange of Earth data observations and products helps engage and improve integrated observation networks and enables national and multi-national regional water cycle research and applications that are especially useful in data sparse regions of most developing countries. NASA satellite and modeling products provide a huge volume of valuable data extending back over 50 years across a broad range of spatial (local to global) and temporal (hourly to decadal) scales and include many products that are available in near real time (see earthdata.nasa.gov). To further accomplish these objectives NASA works to actively partner with public and private groups (e.g. federal agencies, universities, NGO's, and industry) in the U.S. and internationally to ensure the broadest use of its satellites and related information and products and to collaborate with regional end users who know the regions and their needs best. The event will help demonstrate the strong partnering and the use of satellite data to provide synoptic and repetitive spatial coverage helping water managers' deal with complex issues. This presentation will outline and describe NASA's international water related research, applications and capacity building programs' efforts to address developing countries critical water challenges in Asia, African and Latin America. This will specifically highlight impacts and case studies from NASA's programs in Water Resources (e.g., drought, snow

  19. The Analysis of Motion Dynamics and Resistance of the Multipurpose Boat Operating in Shallow Water

    Directory of Open Access Journals (Sweden)

    Jan Kulczyk

    2014-09-01

    Full Text Available Polish market of small boats has been developed very dynamically in recent years. Market competition forces the shipyards to build new more efficient hull forms and to cut the cost of production as well. This is why modern computer simulation programs are used more often by naval architects. Another trend is to design more universal ships that may be used by larger number of diversified customers. This paper presents project proposal of multipurpose boat hull form. The boat was design to fulfil the requirements imposed by public services like water police, fire brigades, and border guards. It is supposed to be operated on unexplored floodplains and other type shallow waters. The analysis of boat’s motion was based on computer simulations. The resistance curve was evaluated with two methods: comparison study of model test results of similar ships and CFD methods. The results obtained from Ansys Fluent and FINE/Marine systems were compared in this paper. It was shown that taking into consideration dynamic trim and sinkage has a significant impact on free surface capture and resistance values.

  20. Rotational Spectrum of the Methyl Salicylate-Water Complex: the Missing Conformer and the Tunneling Motions

    Science.gov (United States)

    Ghosh, Supriya; Thomas, Javix; Xu, Yunjie; Jäger, Wolfgang

    2015-06-01

    Methyl salicylate is a naturally occurring organic ester produced by wintergreen and other plants. It is also found in many over-the-counter remedies, such as muscle ache creams. The rotational spectrum of the methyl salicylate monomer was reported previously, where the most stable, dominant conformer was identified. The methyl salicylate-water complex was first studied using fluorescence-detected infrared spectroscopy; only one monohydrate conformer was found in that work. In the present study, we employed both broadband chirped and cavity based Fourier transform microwave spectroscopy to examine the competition between intra- and intermolecular hydrogen-bonding interactions and possible large amplitude motions associated with the methyl group and the water subunit. In contrast to the previous infrared study, two monohydrate conformers were identified, with carbonyl O or hydroxyl O as the hydrogen bond acceptors. Detailed analyses of the observed hyperfine structures will be presented, as well as our efforts to extend the study to larger methyl salicylate hydration clusters. S. Melandri, B. M. Giuliano, A. Maris, L. B. Favero, P. Ottaviani, B. Velino, W. Caminati, J. Phys. Chem. A. 2007, 111, 9076. A. Mitsuzuka, A. Fujii, T. Ebata, N. Mikami, J. Phys. Chem. A 1998, 102, 9779.

  1. TU-AB-BRA-06: BEST IN PHYSICS (JOINT IMAGING-THERAPY): An MRI Compatible Externally and Internally Deformable Lung Motion Phantom for Multi-Modality IGRT

    Energy Technology Data Exchange (ETDEWEB)

    Sabouri, P; Sawant, A [University of Texas Southwestern Medical Center, Dallas, TX (United States); Arai, T [University of Maryland School of Medicine, Baltimore, MD (United States)

    2016-06-15

    Purpose: MRI has become an attractive tool for tumor motion management. Current MR-compatible phantoms are only capable of reproducing translational motion. This study describes the construction and validation of a more realistic, MRI-compatible lung phantom that is deformable internally as well as externally. We demonstrate a radiotherapy application of this phantom by validating the geometric accuracy of the open-source deformable image registration software NiftyReg (UCL, UK). Methods: The outer shell of a commercially-available dynamic breathing torso phantom was filled with natural latex foam with eleven water tubes. A rigid foam cut-out served as the diaphragm. A high-precision programmable, in-house, MRI-compatible motion platform was used to drive the diaphragm. The phantom was imaged on a 3T scanner (Philips, Ingenia). Twenty seven tumor traces previously recorded from lung cancer patients were programmed into the phantom and 2D+t image sequences were acquired using a sparse-sampling sequence k-t BLAST (accn=3, resolution=0.66×0.66×5mm3; acquisition-time=110ms/slice). The geometric fidelity of the MRI-derived trajectories was validated against those obtained via fluoroscopy using the on board kV imager on a Truebeam linac. NiftyReg was used to perform frame by frame deformable image registration. The location of each marker predicted by using NiftyReg was compared with the values calculated by intensity-based segmentation on each frame. Results: In all cases, MR trajectories were within 1 mm of corresponding fluoroscopy trajectories. RMSE between centroid positions obtained from segmentation with those obtained by NiftyReg varies from 0.1 to 0.21 mm in the SI direction and 0.08 to 0.13 mm in the LR direction showing the high accuracy of deformable registration. Conclusion: We have successfully designed and demonstrated a phantom that can accurately reproduce deformable motion under a variety of imaging modalities including MRI, CT and x-ray fluodoscopy

  2. Axial and radial water transport and internal water storage in tropical forest canopy trees.

    Science.gov (United States)

    Shelley A. James; Frederick C. Meinzer; Guillermo Goldstein; David Woodruff; Timothy Jones; Teresa Restom; Monica Mejia; Michael Clearwater; Paula. Campanello

    2003-01-01

    Heat and stable isotope tracers were used to study axial and radial water transport in relation to sapwood anatomical characteristics and internal water storage in four canopy tree species of a seasonally dry tropical forest in Panama. Anatomical characteristics of the wood and radial profiles of sap flow were measured at the base, upper trunk, and crown of a single...

  3. Age-related degradation of boiling water reactor vessel internals

    International Nuclear Information System (INIS)

    Ware, A.G.; Shah, V.N.

    1992-01-01

    Researchers at the Idaho National Engineering Laboratory performed an assessment of the aging of the reactor internals in boiling water reactors (BWRs), and identified the unresolved technical issues related to the degradation of these components. The overall life-limiting mechanism is intergranular stress corrosion cracking (IGSCC). Irradiation-assisted stress corrosion cracking, fatigue, and thermal aging embrittlement are other potential degradation mechanisms. Several failures in BWR internals have been caused by a combination of factors such as environment, high residual or preload stresses, and flow-induced vibration. The ASME Code Section XI in-service inspection requirements are insufficient for detecting aging-related degradation at many locations in reactor internals. Many of the potential locations for IGSCC or fatigue are not accessible for inspection. (orig.)

  4. Dynamic analysis of electron density in the course of the internal motion of molecular system

    International Nuclear Information System (INIS)

    Tachibana, A.; Hori, K.; Asai, Y.; Yamabe, T.

    1984-01-01

    The general dynamic aspect of electron density of a molecular system is studied on the basis of the general equation of the electron orbital which is formulated for the dynamic study of electronic motion. The newly defined electron orbital incorporates the dynamics of molecular vibration into the electronic structures. In this scheme, the change of electron distribution caused by excitation of vibrational state is defined as the ''dynamic electron transfer.'' The dynamic electron density is found to have the remarkable ''additive'' property. The time-dependent aspect of the dynamic electron redistribution is also analyzed on the basis of the ''coherent state.'' The new method relates the classical vibrational amplitude to the quantum number of the vibrational state. As a preliminary application of the present treatment, the dynamic electron densities of H 2 , HD, HT, HF, and HCl molecules are calculated by use of ab initio molecular orbital method

  5. Efficiency of a new internal combustion engine concept with variable piston motion

    Directory of Open Access Journals (Sweden)

    Dorić Jovan Ž.

    2014-01-01

    Full Text Available This paper presents simulation of working process in a new IC engine concept. The main feature of this new IC engine concept is the realization of variable movement of the piston. With this unconventional piston movement it is easy to provide variable compression ratio, variable displacement and combustion during constant volume. These advantages over standard piston mechanism are achieved through synthesis of the two pairs of non-circular gears. Presented mechanism is designed to obtain a specific motion law which provides better fuel consumption of IC engines. For this paper Ricardo/WAVE software was used, which provides a fully integrated treatment of time-dependent fluid dynamics and thermodynamics by means of onedimensional formulation. The results obtained herein include the efficiency characteristic of this new heat engine concept. The results show that combustion during constant volume, variable compression ratio and variable displacement have significant impact on improvement of fuel consumption.

  6. On the roto-translatory internal motions of a three layer non-isobarycentric Earth model: a Lagrangian system approach

    Science.gov (United States)

    Escapa, Alberto; Fukushima, Toshio

    2010-05-01

    The internal structure of numerous celestial bodies are well approximated by means of a three layer model composed of a solid external layer, which encloses a fluid layer containing a solid body. An analysis of the inner dynamics of this model can provide some constrains on its rheological characteristics; an information that in many situations is only accessible through this indirect way. In addition, the understanding of this kind of motions, especially of those associated with a rigid displacement (a rotation or a relative translation) of the solid layers, is of primary importance to establish with enough accuracy the definition of the terrestrial reference frames. In the Earth case, most approaches to this formidable problem rely on the numerical solution of the respective elastic field equations, once they have been projected on a set of spherical harmonics functions of a given degree. Due to its intrinsic nature these numerical methods do not provide by themselves much insight into the internal dynamics, hence the interest to develop simpler dynamical models that reproduces the main characteristics of the motion and allows obtaining analytical approximate solutions of the problem. To this aim, and as a first stage, we have considered the internal dynamics of a simple Earth model made up of a spherical rigid mantle, an inviscid, homogeneous fluid outer core and a spherical rigid inner core. Initially the barycenters of all the constituents are located at the same point (isobarycentric model) and the whole system rotates with constant angular velocity around the figure axis. When this situation is perturbed both the motions of the fluid and of the solid layers depart from the reference uniform rotation. However, following Busse (1974) we have assumed that the motion of the mantle is the same as in the unperturbed state, and that the inner core dynamics only suffers a variation of oscillatory nature in the translational motion of its barycenter. As a consequence

  7. Leaks in the internal water supply piping systems

    Directory of Open Access Journals (Sweden)

    Orlov Evgeniy Vladimirovich

    2015-03-01

    Full Text Available Great water losses in the internal plumbing of a building lead to the waste of money for a fence, purification and supply of water volumes in excess. This does not support the concept of water conservation and resource saving lying today in the basis of any building’s construction having plumbing. Leakage means unplanned of water losses systems in domestic water supply systems (hot or cold as a result of impaired integrity, complicating the operation of a system and leading to high costs of repair and equipment restoration. A large number of leaks occur in old buildings, where the regulatory service life of pipelines has come to an end, and the scheduled repair for some reason has not been conducted. Steel pipelines are used in the systems without any protection from corrosion and they get out of order. Leakages in new houses are also not uncommon. They usually occur as a result of low-quality adjustment of the system by workers. It also important to note the absence of certain skills of plumbers, who don’t conduct the inspections of in-house systems in time. Sometimes also the residents themselves forget to keep their pipeline systems and water fittings in their apartment in good condition. Plumbers are not systematically invited for preventive examinations to detect possible leaks in the domestic plumbing. The amount of unproductive losses increases while simultaneous use of valve tenants, and at the increase of the number of residents in the building. Water leaks in the system depend on the amount of water system piping damages, and damages of other elements, for example, water valves, connections, etc. The pressure in the leak area also plays an important role.

  8. Tsunami generation and associated waves in the water column and seabed due to an asymmetric earthquake motion within an anisotropic substratum

    Science.gov (United States)

    Bagheri, Amirhossein; Greenhalgh, Stewart; Khojasteh, Ali; Rahimian, Mohammad; Attarnejad, Reza

    2016-10-01

    In this paper, closed-form integral expressions are derived to describe how surface gravity waves (tsunamis) are generated when general asymmetric ground displacement (due to earthquake rupturing), involving both horizontal and vertical components of motion, occurs at arbitrary depth within the interior of an anisotropic subsea solid beneath the ocean. In addition, we compute the resultant hydrodynamic pressure within the seawater and the elastic wavefield within the seabed at any position. The method of potential functions and an integral transform approach, accompanied by a special contour integration scheme, are adopted to handle the equations of motion and produce the numerical results. The formulation accounts for any number of possible acoustic-gravity modes and is valid for both shallow and deep water situations as well as for any focal depth of the earthquake source. Phase and group velocity dispersion curves are developed for surface gravity (tsunami mode), acoustic-gravity, Rayleigh, and Scholte waves. Several asymptotic cases which arise from the general analysis are discussed and compared to existing solutions. The role of effective parameters such as hypocenter location and frequency of excitation is examined and illustrated through several figures which show the propagation pattern in the vertical and horizontal directions. Attention is directed to the unexpected contribution from the horizontal ground motion. The results have important application in several fields such as tsunami hazard prediction, marine seismology, and offshore and coastal engineering. In a companion paper, we examine the effect of ocean stratification on the appearance and character of internal and surface gravity waves.

  9. Trying Physics: Analyzing the Motion of the Quickest Score in International Rugby

    Science.gov (United States)

    Goff, John Eric; Lipscombe, Trevor Davis

    2015-01-01

    The hearts of sports fans were stirred recently by the fastest-ever try scored in international rugby. Welsh winger Dafydd Howells crossed the Fijian try line to score a mere six seconds after Angus O'Brien had started the game with a kickoff, in one of the fixtures in rugby's Junior World Cup played on June 2, 2014, in New Zealand. This…

  10. Bottom-pressure observations of deep-sea internal hydrostatic and non-hydrostatic motions

    NARCIS (Netherlands)

    van Haren, H.

    2013-01-01

    In the ocean, sloping bottom topography is important for the generation and dissipation of internal waves. Here, the transition of such waves to turbulence is demonstrated using an accurate bottom-pressure sensor that was moored with an acoustic Doppler current profiler and high-resolution

  11. Dry deposition of submicron atmospheric aerosol over water surfaces in motion

    International Nuclear Information System (INIS)

    Nevenick, Calec

    2013-01-01

    Whether by chronic or accidental releases, the impact of a nuclear installation on the environment mainly depends on atmospheric transfers; and as the accidents at Chernobyl and Fukushima show, affect the contamination of surfaces and impacts in the medium and long-term on the environment and the population. In this context, this work focuses on the characterization and modeling of dry deposition of submicron aerosols on liquid surfaces in motion such as rivers. Unlike wet deposition which is conditioned by washout and rainout (rain and clouds), dry deposition is a phenomenon that depends entirely on the characteristics of aerosols, receiving surfaces, and air flow. In practice, the evaluation of dry deposition is based on the estimation of flux modeling as the product of particle concentration and deposition velocity which can vary over several orders of magnitude depending on the receiving surfaces (forest, snow, urban, grassland...). This topic is motivated by the virtual non-existence of studies on the mechanisms of dry deposition on continental water systems such as rivers; and respect for submicron aerosols. They have the lowest deposition efficiencies and filtration and the longer residence time in the atmosphere. In addition, they are potentially the most dangerous to living beings because they can penetrate deeper into the airway. Due to the lack of data on the dry deposition of submicron aerosols on a liquid surface in motion, the approach was based on two axes: 1) the acquisition of experimental deposition velocities and 2) the analysis and interpretation of results through modeling. The experiments were performed with uranine aerosols released into the IOA wind tunnel (Interface Ocean Atmosphere) of the Institute for Research on Non Equilibrium Phenomena which is configured to study the coupling between the air flow and water. These experiments have given many dry deposition velocities for different configurations characterized according to wind

  12. Dry deposition of submicron atmospheric aerosol over water surfaces in motion

    International Nuclear Information System (INIS)

    Calec, Nevenick

    2013-01-01

    Whether by chronic or accidental releases, the impact of a nuclear installation on the environment mainly depends on atmospheric transfers; and as the accidents at Chernobyl and Fukushima show, affect the contamination of surfaces and impacts in the medium and long-term on the environment and the population. In this context, this work focuses on the characterization and modeling of dry deposition of submicron aerosols on liquid surfaces in motion such as rivers. Unlike wet deposition which is conditioned by washout and rainout (rain and clouds), dry deposition is a phenomenon that depends entirely on the characteristics of aerosols, receiving surfaces, and air flow. In practice, the evaluation of dry deposition is based on the estimation of flux modeling as the product of particle concentration and deposition velocity which can vary over several orders of magnitude depending on the receiving surfaces (forest, snow, urban, grassland..). This topic is motivated by the virtual non-existence of studies on the mechanisms of dry deposition on continental water systems such as rivers; and respect for submicron aerosols. They have the lowest deposition efficiencies and filtration and the longer residence time in the atmosphere. In addition, they are potentially the most dangerous to living beings because they can penetrate deeper into the airway. Due to the lack of data on the dry deposition of submicron aerosols on a liquid surface in motion, the approach was based on two axes: 1) the acquisition of experimental deposition velocities and 2) the analysis and interpretation of results through modeling. The experiments were performed with uranine aerosols released into the IOA wind tunnel (Interface Ocean Atmosphere) of the Institute for Research on Non Equilibrium Phenomena which is configured to study the coupling between the air flow and water. These experiments have given many dry deposition velocities for different configurations characterized according to wind

  13. Allocation of Internal Medicine Resident Time in a Swiss Hospital: A Time and Motion Study of Day and Evening Shifts.

    Science.gov (United States)

    Wenger, Nathalie; Méan, Marie; Castioni, Julien; Marques-Vidal, Pedro; Waeber, Gérard; Garnier, Antoine

    2017-04-18

    Little current evidence documents how internal medicine residents spend their time at work, particularly with regard to the proportions of time spent in direct patient care versus using computers. To describe how residents allocate their time during day and evening hospital shifts. Time and motion study. Internal medicine residency at a university hospital in Switzerland, May to July 2015. 36 internal medicine residents with an average of 29 months of postgraduate training. Trained observers recorded the residents' activities using a tablet-based application. Twenty-two activities were categorized as directly related to patients, indirectly related to patients, communication, academic, nonmedical tasks, and transition. In addition, the presence of a patient or colleague and use of a computer or telephone during each activity was recorded. Residents were observed for a total of 696.7 hours. Day shifts lasted 11.6 hours (1.6 hours more than scheduled). During these shifts, activities indirectly related to patients accounted for 52.4% of the time, and activities directly related to patients accounted for 28.0%. Residents spent an average of 1.7 hours with patients, 5.2 hours using computers, and 13 minutes doing both. Time spent using a computer was scattered throughout the day, with the heaviest use after 6:00 p.m. The study involved a small sample from 1 institution. At this Swiss teaching hospital, internal medicine residents spent more time at work than scheduled. Activities indirectly related to patients predominated, and about half the workday was spent using a computer. Information Technology Department and Department of Internal Medicine of Lausanne University Hospital.

  14. Cleaning the feed-water pipeline internal surfaces

    International Nuclear Information System (INIS)

    Podkopaev, V.A.

    1984-01-01

    The procedure of cleaning the feed-water pipeline internal surfaces at the Chernobylsk-4 power unit is described. Cleaning was conducted in five stages. Pipelines were cleaned from mechanical impurities at the first stage. At the second stage the pipelines were washing by water heated up to 80 deg C. At the third stage nitric acid was added to 95-100 deg C water the acid concentration in the circuit = 60 mg/l, purification period = 14 h. At the fourth stage hydrogen peroxide was added to the circuit at 95-100 deg C (the solution concentration was equal to 5-6 mg/l, the solution stayed in the circuit for 1 h 20 min). At the fifth stage sodium nitrite concentrated to 20 mg/l was introduced to the circuit in 75 minutes; this promoted strengthening of the oxide layer in the circuit on the base of nitric acid and hydrogen peroxide. Data on the water acidity in the circuit, water electric conductivity and iron concentration after the fourth stage and on completion of the circuit cleaning are presented. The described method of cleaning enables to save scarce reagents and use cheaper ones

  15. Cleaning the feed-water pipeline internal surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Podkopaev, V.A.

    1984-12-01

    The procedure of cleaning the feed-water pipeline internal surfaces at the Chernobylsk-4 power unit is described. Cleaning was conducted in five stages. Pipelines were cleaned from mechanical impurities at the first stage. At the second stage the pipelines were washed by water heated up to 80 deg C. At the third stage nitric acid was added to 95-100 deg C water with the acid concentration in the circuit = 60 mg/l, purification period = 14 h. At the fourth stage hydrogen peroxide was added to the circuit at 95-100 deg C (the solution concentration was equal to 5-6 mg/l, the solution stayed in the circuit for 1 h 20 min). At the fifth stage sodium nitrite concentrated to 20 mg/l was introduced to the circuit in 75 minutes; this promoted strengthening of the oxide layer in the circuit on the base of nitric acid and hydrogen peroxide. Data on the water acidity in the circuit, water electric conductivity and iron concentration after the fourth stage and on completion of the circuit cleaning are presented. The described method of cleaning enables to save scarce reagents and use cheaper ones.

  16. Investigating the significance of zero-point motion in small molecular clusters of sulphuric acid and water

    International Nuclear Information System (INIS)

    Stinson, Jake L.; Ford, Ian J.; Kathmann, Shawn M.

    2014-01-01

    The nucleation of particles from trace gases in the atmosphere is an important source of cloud condensation nuclei, and these are vital for the formation of clouds in view of the high supersaturations required for homogeneous water droplet nucleation. The methods of quantum chemistry have increasingly been employed to model nucleation due to their high accuracy and efficiency in calculating configurational energies; and nucleation rates can be obtained from the associated free energies of particle formation. However, even in such advanced approaches, it is typically assumed that the nuclei have a classical nature, which is questionable for some systems. The importance of zero-point motion (also known as quantum nuclear dynamics) in modelling small clusters of sulphuric acid and water is tested here using the path integral molecular dynamics method at the density functional level of theory. The general effect of zero-point motion is to distort the mean structure slightly, and to promote the extent of proton transfer with respect to classical behaviour. In a particular configuration of one sulphuric acid molecule with three waters, the range of positions explored by a proton between a sulphuric acid and a water molecule at 300 K (a broad range in contrast to the confinement suggested by geometry optimisation at 0 K) is clearly affected by the inclusion of zero point motion, and similar effects are observed for other configurations

  17. Internal fuel motion as an inherent shutdown mechanism for LMFBR accidents: PINEX-3, PINEX-2, and HUT 5-2A experiments

    International Nuclear Information System (INIS)

    Ferrell, P.C.; Porten, D.R.; Martin, F.J.

    1981-01-01

    The PINEX-2 experiment verified the concept of axial internal molten fuel motion within annular fuel, representing an inherent shutdown mechanism for hypothetical transient overpower excursions on the order of 5$/s. The PINEX-3 experiment, simulating a 50 cents/s transient overpower, showed that limitations on the effectiveness of fuel motion may arise from freezing of the fuel and blockage of the internal movement. Analysis of these experiments was performed to assess the physical processes that dominate fuel relocation potential and to apply them to prototypic LMFBR pin conditions. Results indicate that internal fuel motion should be reliable as a shutdown mechanism in LMFBR's for a range of reactivity insertion rates beyond presently available experimental data

  18. Water permeation through the internal water pathway in activated GPCR rhodopsin.

    Directory of Open Access Journals (Sweden)

    Katsufumi Tomobe

    Full Text Available Rhodopsin is a light-driven G-protein-coupled receptor that mediates signal transduction in eyes. Internal water molecules mediate activation of the receptor in a rhodopsin cascade reaction and contribute to conformational stability of the receptor. However, it remains unclear how internal water molecules exchange between the bulk and protein inside, in particular through a putative solvent pore on the cytoplasmic. Using all-atom molecular dynamics simulations, we identified the solvent pore on cytoplasmic side in both the Meta II state and the Opsin. On the other hand, the solvent pore does not exist in the dark-adapted rhodopsin. We revealed two characteristic narrow regions located within the solvent pore in the Meta II state. The narrow regions distinguish bulk and the internal hydration sites, one of which is adjacent to the conserved structural motif "NPxxY". Water molecules in the solvent pore diffuse by pushing or sometimes jumping a preceding water molecule due to the geometry of the solvent pore. These findings revealed a total water flux between the bulk and the protein inside in the Meta II state, and suggested that these pathways provide water molecules to the crucial sites of the activated rhodopsin.

  19. 78 FR 70076 - Aging Management of Internal Surfaces, Fire Water Systems, Atmospheric Storage Tanks, and...

    Science.gov (United States)

    2013-11-22

    ... Systems, Atmospheric Storage Tanks, and Corrosion Under Insulation AGENCY: Nuclear Regulatory Commission... Internal Surfaces, Fire Water Systems, Atmospheric Storage Tanks, and Corrosion Under Insulation.'' This LR... related to internal surface aging effects, fire water systems, atmospheric storage tanks, and corrosion...

  20. 13th International Conference on Motion and Vibration Control (MOVIC 2016) and the 12th International Conference on Recent Advances in Structural Dynamics (RASD 2016)

    International Nuclear Information System (INIS)

    2016-01-01

    This volume contains the papers presented at the Thirteenth International Conference on Motion and Vibration Control (MoViC), together with the Twelfth International Conference on Recent Advances in Structural Dynamics (RASD). MoViC is an event that started in Yokohama, Japan in 1992 and has been organised every two years alternating between Japan, USA and Europe. The eleven previous RASD conferences have been held every three years or so since 1980 primarily in Southampton, UK. The idea of joining the two conferences came quite naturally because of the common ground of the two conferences and the chances of cross-pollination between two otherwise separate research groups. This joint conference is devoted to theoretical, numerical and experimental developments in motion/vibration/structural dynamics, their control and application to all types of structures and dynamical systems. The conference reflects the state-of-the- art in these topics, and is an excellent opportunity to exchange scientific, technical and experimental ideas. The Conference Proceedings include over 250 papers by authors from over 20 countries, forty technical sessions and five plenary presentations. The five invited speakers are Professor Roger Goodall (Loughborough University, UK) presenting “Motion and vibration control for railway vehicles”, Professor Takeshi Mizuno (Saitama University, Japan) presenting “Recent advances in magnetic suspension technology”, Professor Kevin Murphy (University of Louisville, USA) presenting “Dynamics of Passive Balancing Rings for Rotating Systems”, Professor David Wagg (University of Sheffield, UK) presenting “Reducing vibrations in structures using structural control”, and Professor Kon-Well Wang (University of Michigan, USA) presenting “From Muscles to Plants - Nature-Inspired Adaptive Metastructures for Structural Dynamics Enhancement”. I would like to thank members of the Organising Committee for their help, over the last year or so, in

  1. Agradient velocity, vortical motion and gravity waves in a rotating shallow-water model

    Science.gov (United States)

    Sutyrin Georgi, G.

    2004-07-01

    A new approach to modelling slow vortical motion and fast inertia-gravity waves is suggested within the rotating shallow-water primitive equations with arbitrary topography. The velocity is exactly expressed as a sum of the gradient wind, described by the Bernoulli function,B, and the remaining agradient part, proportional to the velocity tendency. Then the equation for inverse potential vorticity,Q, as well as momentum equations for agradient velocity include the same source of intrinsic flow evolution expressed as a single term J (B, Q), where J is the Jacobian operator (for any steady state J (B, Q) = 0). Two components of agradient velocity are responsible for the fast inertia-gravity wave propagation similar to the traditionally used divergence and ageostrophic vorticity. This approach allows for the construction of balance relations for vortical dynamics and potential vorticity inversion schemes even for moderate Rossby and Froude numbers assuming the characteristic value of |J(B, Q)| = to be small. The components of agradient velocity are used as the fast variables slaved to potential vorticity that allows for diagnostic estimates of the velocity tendency, the direct potential vorticity inversion with the accuracy of 2 and the corresponding potential vorticity-conserving agradient velocity balance model (AVBM). The ultimate limitations of constructing the balance are revealed in the form of the ellipticity condition for balanced tendency of the Bernoulli function which incorporates both known criteria of the formal stability: the gradient wind modified by the characteristic vortical Rossby wave phase speed should be subcritical. The accuracy of the AVBM is illustrated by considering the linear normal modes and coastal Kelvin waves in the f-plane channel with topography.

  2. Internal doses to Ukrainian populations using Dnieper River water

    International Nuclear Information System (INIS)

    Berkovski, V.; Ratia, G.; Nasvit, O.

    1996-01-01

    The dynamics of internal doses from 137 Cs and 90 Sr as a consequence of the use of Dnieper River water were calculated. Local peculiarities of municipal tap, irrigation, and fish consumption in the Ukraine were considered. The dynamics of 90 Sr accumulation in human bone as a result of the use of Dnieper water is simulated. The dose predictions are based on de facto data and the stochastic forecast of radionuclide concentrations in Dnieper reservoirs. A large array of statistical data on the age-structures of exposed populations, food consumption rate, agricultural production, fish contamination, and site-specific parameters were used. Exposures are estimated for 12 regions of the Dnieper basin and the Crimea Republic. The maximal individual annual committed effective doses are 1.7 x 10 -5 and 2.7 x 10 -5 Sv from 90 Sr and 137 Cs, respectively, due to the use of water in 1986 by members of the population in the Kievska region. Commercial fishermen on the Kievska reservoir, who consumed 360 kg y -1 of fish in 1986, received 4.7 x 10 -4 and 5 x 10 -3 Sv from 90 Sr and 137 Cs, respectively. The contributions to the collective (over 70 6) effective dose of irrigation, municipal tap water, and fish consumption for members of the general public, respectively, are 18%, 43%,39% in the Kievska region; 8%,25%,67% in the Poltavska region; 50% 50%, 0% (no Dnieper fish consumed) in the Crimea Republic. The predicted contribution of 90 Sr to collective dose resulting from the use of water is 80%. The collective dose to the population of the Dnieper regions (32.5 million people) is 3,000 person-Sv, due to the use of water. 14 refs., 12 figs., 2 tabs

  3. Gender differences in triple jump phase ratios and arm swing motion of international level athletes

    Directory of Open Access Journals (Sweden)

    Vassilios Panoutsakopoulos

    2016-12-01

    Full Text Available Background: Female triple jumping is a relatively new athletics event. A limited number of researchers have focused on comparing male and female jumpers competing in international events, resulting in scarce findings in the literature regarding gender differences of the determinants of triple jump performance. Objective: The aim of the study was to examine the possible gender differences in the approach step characteristics, the spatiotemporal parameters of the separate phases of the triple jump as performed by athletes participating in sub-elite international events. Methods: The male and female participants of the 2015 European Team Championships triple jump event were recorded with a panning video camera. Approach speed was measured using photocells. Kinematical parameters were extracted using the APAS WIZARD 13.3.0.3 software. The relationships between the examined parameters and the actual triple jump performance were examined with Pearson's correlation analysis. Repeated measures ANOVA and chi-square statistical tests were run to examine the significance of the differences between genders. Results: Approach speed significantly correlated with the actual jumping distance in both males and females (p < .05. Significant gender differences (p < .05 existed concerning basic kinematical parameters. Men were found to have larger average horizontal speed of the 11 m to 1 m segment of the final approach, step length of the final six steps of the approach, step frequency of the final two steps, actual phase distances and percentage distribution of the step. Women, unlike men, used solely single arm swing techniques. No athlete executed the jump using a jump dominated technique. Conclusions: Gender differences in triple jump performance lies upon the kinematical parameters of the final two steps of the approach, the length of the step phase and the support time for the jump. The technique elements of the penultimate step are suggested to

  4. Assessing Respiration-Induced Tumor Motion and Internal Target Volume Using Four-Dimensional Computed Tomography for Radiotherapy of Lung Cancer

    International Nuclear Information System (INIS)

    Liu, H. Helen; Balter, Peter; Tutt, Teresa; Choi, Bum; Zhang, Joy; Wang, Catherine; Chi, Melinda; Luo Dershan; Pan Tinsu; Hunjan, Sandeep; Starkschall, George; Rosen, Isaac; Prado, Karl; Liao Zhongxing; Chang, Joe; Komaki, Ritsuko; Cox, James D.; Mohan, Radhe; Dong Lei

    2007-01-01

    Purpose: To assess three-dimensional tumor motion caused by respiration and internal target volume (ITV) for radiotherapy of lung cancer. Methods and Materials: Respiration-induced tumor motion was analyzed for 166 tumors from 152 lung cancer patients, 57.2% of whom had Stage III or IV non-small-cell lung cancer. All patients underwent four-dimensional computed tomography (4DCT) during normal breathing before treatment. The expiratory phase of 4DCT images was used as the reference set to delineate gross tumor volume (GTV). Gross tumor volumes on other respiratory phases and resulting ITVs were determined using rigid-body registration of 4DCT images. The association of GTV motion with various clinical and anatomic factors was analyzed statistically. Results: The proportions of tumors that moved >0.5 cm along the superior-inferior (SI), lateral, and anterior-posterior (AP) axes during normal breathing were 39.2%, 1.8%, and 5.4%, respectively. For 95% of the tumors, the magnitude of motion was less than 1.34 cm, 0.40 cm, and 0.59 cm along the SI, lateral, and AP directions. The principal component of tumor motion was in the SI direction, with only 10.8% of tumors moving >1.0 cm. The tumor motion was found to be associated with diaphragm motion, the SI tumor location in the lung, size of the GTV, and disease T stage. Conclusions: Lung tumor motion is primarily driven by diaphragm motion. The motion of locally advanced lung tumors is unlikely to exceed 1.0 cm during quiet normal breathing except for small lesions located in the lower half of the lung

  5. Fluid-structure-interaction of the pressurized water reactor core internals during blowdown - numerical simulation with a homogenization model

    International Nuclear Information System (INIS)

    Benner, J.

    1984-03-01

    A method for the numerical simulation of the Pressurized Water Reactor (PWR) core internal's behaviour during a blowdown accident is described, by which the motion of the reactor core and the interaction of the fuel elements with the core barrel and the coolant medium is calculated. Furthermore, some simple models for the support columns, lower and upper core support and the grid plate are provided. All these models have been implemented into the code Flux-4. For the solution of the very complex, coupled equations of motions for fluid and fuel rods an efficient numerical solution technique has been developed. With the new code-version Flux-5 the PWR-blowdown is parametically investigated. The calculated core barrel loadings are compared with Flux-4 results, simulating the core's inertia by a mass ring of HDR type. (orig.) [de

  6. Biological quarantine on international waters: an initiative for onboard protocols

    Science.gov (United States)

    Takano, Yoshinori; Yano, Hajime; Funase, Ryu; Sekine, Yasuhito; Takai, Ken

    2012-07-01

    The research vessel Chikyu is expanding new frontiers in science, technology, and international collaboration through deep-sea expedition. The Chikyu (length: 210 m, gross tonnage: 56752 tons) has advanced and comprehensive scientific research facilities. One of the scientific purposes of the vessel is to investigate into unexplored biosphere (i.e., undescribed extremophiles) on the Earth. Therefore, "the onboard laboratory" provides us systematic microbiological protocols with a physical containment situation. In parallel, the onboard equipments provide sufficient space for fifty scientists and technical support staff. The helicopter deck also supports various logistics through transporting by a large scale helicopter (See, http://www.jamstec.go.jp/chikyu/eng/). Since the establishment of Panel on Planetary Protection (PPP) in Committee on Space Research (COSPAR), we have an international consensus about the development and promulgation of planetary protection knowledge, policy, and plans to prevent the harmful effects of biological contamination on the Earth (e.g., Rummel, 2002). However, the matter to select a candidate location of initial quarantine at BSL4 level is often problematic. To answer the key issue, we suggest that international waters can be a meaningful option with several advantages to conduct initial onboard-biological quarantine investigation. Hence, the research vessel Chikyu is promising for further PPP requirements (e.g., Enceladus sample return project: Tsou et al., 2012). Rummel, J., Seeking an international consensus in planetary protection: COSPAR's planetary protection panel. Advances in Space Research, 30, 1573-1575 (2002). Tsou, P. et al. LIFE: Life Investigation For Enceladus - A Sample Return Mission Concept in Search for Evidence of Life. Astrobiology, in press.

  7. International Virtual Observatory System for Water Resources Information

    Science.gov (United States)

    Leinenweber, Lewis; Bermudez, Luis

    2013-04-01

    Sharing, accessing, and integrating hydrologic and climatic data have been identified as a critical need for some time. The current state of data portals, standards, technologies, activities, and expertise can be leverage to develop an initial operational capability for a virtual observatory system. This system will allow to link observations data with stream networks and models, and to solve semantic inconsistencies among communities. Prototyping a virtual observatory system is an inter-disciplinary, inter-agency and international endeavor. The Open Geospatial Consortium (OGC) within the OGC Interoperability Program provides the process and expertise to run such collaborative effort. The OGC serves as a global forum for the collaboration of developers and users of spatial data products and services, and to advance the development of international standards for geospatial interoperability. The project coordinated by OGC that is advancing an international virtual observatory system for water resources information is called Climatology-Hydrology Information Sharing Pilot, Phase 1 (CHISP-1). It includes observations and forecasts in the U.S. and Canada levering current networks and capabilities. It is designed to support the following use cases: 1) Hydrologic modeling for historical and near-future stream flow and groundwater conditions. Requires the integration of trans-boundary stream flow and groundwater well data, as well as national river networks (US NHD and Canada NHN) from multiple agencies. Emphasis will be on time series data and real-time flood monitoring. 2) Modeling and assessment of nutrient load into the lakes. Requires accessing water-quality data from multiple agencies and integrating with stream flow information for calculating loads. Emphasis on discrete sampled water quality observations, linking those to specific NHD stream reaches and catchments, and additional metadata for sampled data. The key objectives of these use cases are: 1) To link

  8. Wave excited motion of a body floating on water confined between two semi-infinite ice sheets

    Science.gov (United States)

    Ren, K.; Wu, G. X.; Thomas, G. A.

    2016-12-01

    The wave excited motion of a body floating on water confined between two semi-infinite ice sheets is investigated. The ice sheet is treated as an elastic thin plate and water is treated as an ideal and incompressible fluid. The linearized velocity potential theory is adopted in the frequency domain and problems are solved by the method of matched eigenfunctions expansion. The fluid domain is divided into sub-regions and in each sub-region the velocity potential is expanded into a series of eigenfunctions satisfying the governing equation and the boundary conditions on horizontal planes including the free surface and ice sheets. Matching is conducted at the interfaces of two neighbouring regions to ensure the continuity of the pressure and velocity, and the unknown coefficients in the expressions are obtained as a result. The behaviour of the added mass and damping coefficients of the floating body with the effect of the ice sheets and the excitation force are analysed. They are found to vary oscillatorily with the wave number, which is different from that for a floating body in the open sea. The motion of the body confined between ice sheets is investigated, in particular its resonant behaviour with extremely large motion found to be possible under certain conditions. Standing waves within the polynya are also observed.

  9. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  10. Measurements of the internal magnetic field using the B-Stark motional Stark effect diagnostic on DIII-D (inivited)

    Energy Technology Data Exchange (ETDEWEB)

    Pablant, N. A. [University of California-San Diego, La Jolla, California 92093 (United States); Burrell, K. H.; Groebner, R. J.; Kaplan, D. H. [General Atomics, P.O. Box 85608, San Diego, California 92186-5608 (United States); Holcomb, C. T. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States)

    2010-10-15

    Results are presented from the B-Stark diagnostic installed on the DIII-D tokamak. This diagnostic provides measurements of the magnitude and direction of the internal magnetic field. The B-Stark system is a version of a motional Stark effect (MSE) diagnostic based on the relative line intensities and spacing of the Stark split D{sub {alpha}} emission from injected neutral beams. This technique may have advantages over MSE polarimetry based diagnostics in future devices, such as the ITER. The B-Stark diagnostic technique and calibration procedures are discussed. The system is shown to provide accurate measurements of B{sub {theta}}/B{sub T} and |B| over a range of plasma conditions. Measurements have been made with toroidal fields in the range of 1.2-2.1 T, plasma currents in the range 0.5-2.0 MA, densities between 1.7 and 9.0x10{sup 19} m{sup -3}, and neutral beam voltages between 50 and 81 keV. The viewing direction and polarization dependent transmission properties of the collection optics are found using an in situ beam into gas calibration. These results are compared to values found from plasma equilibrium reconstructions and the MSE polarimetry system on DIII-D.

  11. Measurements of the internal magnetic field using the B-Stark motional Stark effect diagnostic on DIII-D (inivited).

    Science.gov (United States)

    Pablant, N A; Burrell, K H; Groebner, R J; Holcomb, C T; Kaplan, D H

    2010-10-01

    Results are presented from the B-Stark diagnostic installed on the DIII-D tokamak. This diagnostic provides measurements of the magnitude and direction of the internal magnetic field. The B-Stark system is a version of a motional Stark effect (MSE) diagnostic based on the relative line intensities and spacing of the Stark split D(α) emission from injected neutral beams. This technique may have advantages over MSE polarimetry based diagnostics in future devices, such as the ITER. The B-Stark diagnostic technique and calibration procedures are discussed. The system is shown to provide accurate measurements of B(θ)/B(T) and ∣B∣ over a range of plasma conditions. Measurements have been made with toroidal fields in the range of 1.2-2.1 T, plasma currents in the range 0.5-2.0 MA, densities between 1.7 and 9.0×10(19) m(-3), and neutral beam voltages between 50 and 81 keV. The viewing direction and polarization dependent transmission properties of the collection optics are found using an in situ beam into gas calibration. These results are compared to values found from plasma equilibrium reconstructions and the MSE polarimetry system on DIII-D.

  12. Direct measurements of safety factor profiles with motional Stark effect for KSTAR tokamak discharges with internal transport barriers

    Science.gov (United States)

    Ko, J.; Chung, J.

    2017-06-01

    The safety factor profile evolutions have been measured from the plasma discharges with the external current drive mechanism such as the multi-ion-source neutral beam injection for the Korea Superconducting Tokamak Advanced Research (KSTAR) for the first time. This measurement has been possible by the newly installed motional Stark effect (MSE) diagnostic system that utilizes the polarized Balmer-alpha emission from the energetic neutral deuterium atoms induced by the Stark effect under the Lorentz electric field. The 25-channel KSTAR MSE diagnostic is based on the conventional photoelastic modulator approach with the spatial and temporal resolutions less than 2 cm (for the most of the channels except 2 to 3 channels inside the magnetic axis) and about 10 ms, respectively. The strong Faraday rotation imposed on the optical elements in the diagnostic system is calibrated out from a separate and well-designed polarization measurement procedure using an in-vessel reference polarizer during the toroidal-field ramp-up phase before the plasma experiment starts. The combination of the non-inductive current drive during the ramp-up and shape control enables the formation of the internal transport barrier where the pitch angle profiles indicate flat or slightly hollow profiles in the safety factor.

  13. Measurement of Intervertebral Motion Using Quantitative Fluoroscopy: Report of an International Forum and Proposal for Use in the Assessment of Degenerative Disc Disease in the Lumbar Spine

    Directory of Open Access Journals (Sweden)

    Alan C. Breen

    2012-01-01

    Full Text Available Quantitative fluoroscopy (QF is an emerging technology for measuring intervertebral motion patterns to investigate problem back pain and degenerative disc disease. This International Forum was a networking event of three research groups (UK, US, Hong Kong, over three days in San Francisco in August 2009. Its aim was to reach a consensus on how best to record, analyse, and communicate QF information for research and clinical purposes. The Forum recommended that images should be acquired during regular trunk motion that is controlled for velocity and range, in order to minimise externally imposed variability as well as to correlate intervertebral motion with trunk motion. This should be done in both the recumbent passive and weight bearing active patient configurations. The main recommended outputs from QF were the true ranges of intervertebral rotation and translation, neutral zone laxity and the consistency of shape of the motion patterns. The main clinical research priority should initially be to investigate the possibility of mechanical subgroups of patients with chronic, nonspecific low back pain by comparing their intervertebral motion patterns with those of matched healthy controls.

  14. Wave energy conversion utilizing vertical motion of water in the array of water chambers aligned in the direction of wave propagation

    Directory of Open Access Journals (Sweden)

    Kesayoshi Hadano

    2017-05-01

    Full Text Available As a new technical approach, wave energy converter by using vertical motion of water in the multiple water chambers were developed to realize actual wave power generation as eco-environmental renewable energy. And practical use of wave energy converter was actually to require the following conditions: (1 setting up of the relevant device and its application to wave power generation in case that severe wave loading is avoided; (2 workability in installation and maintenance operations; (3 high energy conversion potential; and (4 low cost. In this system, neither the wall(s of the chambers nor the energy conversion device(s are exposed to the impulsive load due to water wave. Also since this system is profitable when set along the jetty or along a long floating body, installation and maintenance are done without difficulty and the cost is reduced. In this paper, we describe the system which consists of a float, a shaft connected with another shaft, a rack and pinion arrangement, a ratchet mechanism, and rotary type generator(s. Then, we present the dynamics model for evaluating the output electric power, and the results of numerical calculation including the effect of the phase shift of up/down motion of the water in the array of water chambers aligned along the direction of wave propagation.

  15. Modeling Water Motion near Seismic Waves Propagating across a Graded Seabed, as Generated by Man-Made Impacts

    Directory of Open Access Journals (Sweden)

    Richard A. Hazelwood

    2016-08-01

    Full Text Available Seismic interface waves generated by seabed impacts are believed to have biological importance. Various wave types are of interest to seismologists, who can minimize the unwanted, but often dominant, ground roll waves with suitable instrumentation. Waves made by dredging and piling have been measured using geophones and found to be of this interface type, which propagate much more slowly than the pressure waves in the water column above. Short interface wavelets of a few cycles were modeled using transient finite element analysis (FEA. Wavelets with low losses have been modeled using graded sediment data from the literature. They do not radiate energy away from the interface because the evanescent acoustic pressures they generate decay rapidly with distance from the seabed. Associated water particle velocities are much greater than would be expected from similar acoustic pressure measurements in a free field. This motion is significant to aquatic life which is dependent on inertial sensors (otoliths, etc. to respond to the environment. Additional amplification of the horizontal seabed motion of the adjacent water is predicted for a short seismic wavelet modeled in a graded solid seabed. Further recent analysis studied the distribution of the energy flux within the sediment layers.

  16. Water saving through international trade of agricultural products

    NARCIS (Netherlands)

    Chapagain, Ashok; Hoekstra, Arjen Ysbert; Savenije, H.H.G.

    2006-01-01

    Many nations save domestic water resources by importing water-intensive products and exporting commodities that are less water intensive. National water saving through the import of a product can imply saving water at a global level if the flow is from sites with high to sites with low water

  17. The initial safe range of motion of the ankle joint after three methods of internal fixation of simulated fractures of the medial malleolus.

    Science.gov (United States)

    Shimamura, Yoshio; Kaneko, Kazuo; Kume, Kazuhiko; Maeda, Mutsuhiro; Iwase, Hideaki

    2006-07-01

    Previous studies have demonstrated the safe passive range of ankle motion for inter-bone stiffness after internal fixation under load but there is a lack of information about the safe range of ankle motion for early rehabilitation in the absence of loading. The present study was designed to assess the effect of ankle movement on inter-bone displacement characteristics of medial malleolus fractures following three types of internal fixation to determine the safe range of motion. Five lower legs obtained during autopsy were used to assess three types of internal fixation (two with Kirschner-wires alone; two with Kirschner-wires plus tension band wiring; and, one with an AO/ASIF malleolar screw alone). Following a simulated fracture by sawing through the medial malleolus the displacement between the fractured bone ends was measured during a passive range of movement with continuous monitoring using omega (Omega) shaped transducers and a biaxial flexible goniometer. Statistical analysis was performed with repeated measures analysis of variance. Inter-bone displacement was not proportional to the magnitude of movement throughout the range of ankle motion as, when separation exceeded 25 microm, there was increasingly wide separation as plantar-flexion or dorsal-flexion was increased. There was no statistical significant difference between the small amount of inter-bone displacement observed with three types of fixation within the safe range of dorsal-flexion and plantar-flexion for early rehabilitation. However the inter-bone separation when fixation utilized two Kirschner-wires alone tended to be greater than when using the other two types of fixation during dorsal-flexion and eversion. The present study revealed a reproducible range of ankle motion for early rehabilitation which was estimated to be within the range of 20 degrees of dorsal-flexion and 10 degrees of plantar-flexion without eversion. Also, internal fixation with two Kirschner-wires alone does not seem to

  18. Realizing Conflict, Negotiation, and Cooperation Concepts in the Context of International Water Courses

    Science.gov (United States)

    Dinar, Ariel; McKinney, Daene

    2010-01-01

    In this paper we offer a negotiation and cooperative game theory application to international water in the classroom. A simulation game was developed for the Aral Sea water dispute as part of a textbook prepared for teaching a diverse group of students a graduate-level International Water course. A condensed version of the Aral Sea Basin water…

  19. Evaluation of hip internal and external rotation range of motion as an injury risk factor for hip, abdominal and groin injuries in professional baseball players

    Directory of Open Access Journals (Sweden)

    Xinning Li

    2015-12-01

    Full Text Available Normal hip range of motion (ROM is essential in running and transfer of energy from lower to upper extremities during overhead throwing. Dysfunctional hip ROM may alter lower extremity kinematics and predispose athletes to hip and groin injuries. The purpose of this study is characterize hip internal/external ROM (Arc and its effect on the risk of hip, hamstring, and groin injuries in professional baseball players. Bilateral hip internal and external ROM was measured on all baseball players (N=201 in one professional organization (major and minor league during spring training. Players were organized according to their respective positions. All injuries were documented prospectively for an entire MLB season (2010 to 2011. Data was analyzed according to position and injuries during the season. Total number of players (N=201 with an average age of 24±3.6 (range=17-37. Both pitchers (N=93 and catchers (N=22 had significantly decreased mean hip internal rotation and overall hip arc of motion compared to the positional players (N=86. Players with hip, groin, and hamstring injury also had decreased hip rotation arc when compared to the normal group. Overall, there is a correlation between decreased hip internal rotation and total arc of motion with hip, hamstring, and groin injuries.

  20. Making the most of minimal water | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2010-12-15

    Dec 15, 2010 ... "Water conservation requires behavioural change at the societal level, ... and meager water supply, which becomes further depleted with increased use, ... for particular uses, or changing the timing of water use to avoid losses.

  1. Deep-water bedforms induced by refracting Internal Solitary Waves

    Science.gov (United States)

    Falcini, Federico; Droghei, Riccardo; Casalbore, Daniele; Martorelli, Eleonora; Mosetti, Renzo; Sannino, Gianmaria; Santoleri, Rosalia; Latino Chiocci, Francesco

    2017-04-01

    Subaqueous bedforms (or sand waves) are typically observed in those environments that are exposed to strong currents, characterized by a dominant unidirectional flow. However, sand-wave fields may be also observed in marine environments where no such current exists; the physical processes driving their formation are enigmatic or not well understood. We propose that internal solitary waves (ISWs), induced by tides, can produce an effective, unidirectional boundary flow filed that forms asymmetric sand waves. We test this idea by examining a sand-wave field off the Messina Strait, where we hypothesize that ISWs formed at the interface between intermediate and surface waters are refracted by topography. Hence, we argue that the deflected pattern (i.e., the depth-dependent orientation) of the sand-wave field is due to refraction of such ISWs. Combining field observations and numerical modelling, we show that ISWs can account for three key features: ISWs produce fluid velocities capable of mobilizing bottom sediments; the predicted refraction pattern resulting from the interaction of ISWs with bottom topography matches the observed deflection of the sand waves; and predicted migration rates of sand waves match empirical estimates. This work shows how ISWs may contribute to sculpting the structure of continental margins and it represents a promising link between the geological and oceanographic communities.

  2. Experimental investigation of the sloshing motion of the water free surface in the draft tube of a Francis turbine operating in synchronous condenser mode

    Science.gov (United States)

    Vagnoni, Elena; Favrel, Arthur; Andolfatto, Loïc; Avellan, François

    2018-06-01

    Hydropower units may be required to operate in condenser mode to supply reactive power. In this operating mode, the water level in the turbine or pump-turbine is decreased below the runner by closing the guide vanes and injecting pressurized air. While operating in condenser mode the machine experiences power losses due to several air-water interaction phenomena which cause air losses. One of such phenomena is the sloshing motion of the water free surface below the runner in the draft tube cone of a Francis turbine. The objective of the present work is to experimentally investigate the sloshing motion of the water free surface in the draft tube cone of a reduced scale physical model of a Francis turbine operating in condenser mode. Images acquisition and simultaneous pressure fluctuation measurements are performed and an image processing method is developed to investigate amplitude and frequency of the sloshing motion of the free surface. It is found that this motion is excited at the natural frequency of the water volume and corresponds to the azimuthal wavenumber m = 1 of a rotating gravity wave. The amplitude of the motion is perturbed by wave breaking and it decreases by increasing the densimetric Froude number. The sloshing frequency slightly increases with respect to the natural frequency of the water volume by increasing the densimetric Froude number. Moreover, it results that this resonant phenomenon is not related to the torque perturbation.

  3. Molecular motion of water molecules in lyotropic mesophases formed from fatty acid soaps

    International Nuclear Information System (INIS)

    Olszewski, K.J.; Pislewski, N.

    1980-01-01

    The results of study of self-diffusion coefficients and relaxation times for the mesophases formed from water mixtures of potassium laurate (denoted by C 12 K), myristate (C 14 K), and palmitate (C 16 K), are presented. The samples containing by weight 70% of soaps and 30% of water as well as samples containing 30% of soaps and 70% of water were examined. It allowed to obtain lamellar and middle phase respectively. (author)

  4. Cooperation at different scales: challenges for local and international water resource governance in South Africa

    CSIR Research Space (South Africa)

    Mirumachi, N

    2010-03-01

    Full Text Available . This paper examines how the cooperative principle has influenced stakeholder interaction at the local and international scales of water governance in South Africa. Water policies and initiatives have been set up to promote multi-level governance...

  5. Infrared and Raman study of the fast internal motions of non-rigid molecules in condensed state: method of selective deuteration

    International Nuclear Information System (INIS)

    Lascombe, J.; Cavagnat, D.; Lassegues, J.C.; Rafilipomanana, C.

    1983-01-01

    The dynamical behaviour of non-rigid molecules in the gas state is now well known but very little information is available on these molecules in condensed state. The authors present a method of study based on the analysis of the infrared and Raman spectra of selectively deuterated molecules. It is applied to the nitromethane and cyclopentene molecules which provide respectively characteristic examples of methyl internal rotation and ring-puckering motion. In each case, an isolated -C0 or -CD oscillator is modulated by the internal motion and several γ(CH) or γ(CD) bands are observed as a result of the dependence of the vibrational frequency of the oscillator on its conformational situation. Moreover, in the case of crystalline nitromethane a detailed study of the temperature dependence of the band profiles allows the main mechanism of relaxation of the -CH oscillator to be deduced. (orig.)

  6. Molecular dynamics test of the Brownian description of Na+ motion in water

    International Nuclear Information System (INIS)

    Wilson, M.A.; Pohorille, A.; Pratt, L.R.

    1985-01-01

    The autocorrelation function of the velocity of an infinitely dilute Na + ion in aqueous solution, and the autocorrelation function of the force exerted on a stationary Na + under the same conditions are evaluated by molecular dynamics calculations. The results are used to test the accuracy of Brownian motion assumptions which are basic to hydrodynamic models of ion dynamics in solution. The self-diffusion coefficient of the Na + ion predicted by Brownian motion theory is (0.65 +- 0.1) x 10 -5 cm 2 /s. This value is about 60% greater than the one obtained for the proper dynamics of the finite mass ion, (0.4 +- 0.1) x 10 -5 cm 2 /s. The numerically correct velocity autocorrelation function is nonexponential, and the autocorrelation of the force on the stationary ion does not decay faster than the ion velocity autocorrelation function. Motivated by previous hydrodynamic modeling of friction kernels, we examine the approximation in which the memory function for the velocity autocorrelation function is identified with the autocorrelation function of the force on the stationary ion. The overall agreement between this approximation for the velocity autocorrelation function and the numerically correct answer is quite good

  7. IT-Tools Concept for Simulation and Design of Water Hydraulic Mechatronic Test Facilities for Motion Control and Operation in Environmentally Sensitive Application Areas

    DEFF Research Database (Denmark)

    Conrad, Finn; Pobedza, J.; Sobczyk, A.

    2004-01-01

    This paper presents a proposed IT-Tools concept for modeling, simulation, analysis and design of water hydraulic actuators for motion control of machines, lifts, cranes and robots. The designed test rigs have tap water hydraulic components of the Danfoss Nessie® product family and equipped...... with a measurement and data acquisition system. Results of the mathematical modeling, simulation and design of the motion control test rigs are presented. Furthermore, the paper presents selected experimental and identifying test results for the water hydraulic test rigs....

  8. Changing the Currents of Water Management | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Avoiding a catastrophic water shortage in the coming decades will require finding ... a water crisis, 40 are in the Middle East, North Africa, or sub-Saharan Africa. ... the availability of water, in dryer regions water conservation has always been a ...

  9. Experimental-based Modelling and Simulation of Water Hydraulic Mechatronics Test Facilities for Motion Control and Operation in Environmental Sensitive Applications` Areas

    DEFF Research Database (Denmark)

    Conrad, Finn; Pobedza, J.; Sobczyk, A.

    2003-01-01

    The paper presents experimental-based modelling, simulation, analysis and design of water hydraulic actuators for motion control of machines, lifts, cranes and robots. The contributions includes results from on-going research projects on fluid power and mechatronics based on tap water hydraulic...

  10. Analysis of Lung Tumor Motion in a Large Sample: Patterns and Factors Influencing Precise Delineation of Internal Target Volume

    Energy Technology Data Exchange (ETDEWEB)

    Knybel, Lukas [Department of Oncology, University Hospital Ostrava, Ostrava (Czech Republic); VŠB-Technical University of Ostrava, Ostrava (Czech Republic); Cvek, Jakub, E-mail: Jakub.cvek@fno.cz [Department of Oncology, University Hospital Ostrava, Ostrava (Czech Republic); Molenda, Lukas; Stieberova, Natalie; Feltl, David [Department of Oncology, University Hospital Ostrava, Ostrava (Czech Republic)

    2016-11-15

    Purpose/Objective: To evaluate lung tumor motion during respiration and to describe factors affecting the range and variability of motion in patients treated with stereotactic ablative radiation therapy. Methods and Materials: Log file analysis from online respiratory tumor tracking was performed in 145 patients. Geometric tumor location in the lungs, tumor volume and origin (primary or metastatic), sex, and tumor motion amplitudes in the superior-inferior (SI), latero-lateral (LL), and anterior-posterior (AP) directions were recorded. Tumor motion variability during treatment was described using intrafraction/interfraction amplitude variability and tumor motion baseline changes. Tumor movement dependent on the tumor volume, position and origin, and sex were evaluated using statistical regression and correlation analysis. Results: After analysis of >500 hours of data, the highest rates of motion amplitudes, intrafraction/interfraction variation, and tumor baseline changes were in the SI direction (6.0 ± 2.2 mm, 2.2 ± 1.8 mm, 1.1 ± 0.9 mm, and −0.1 ± 2.6 mm). The mean motion amplitudes in the lower/upper geometric halves of the lungs were significantly different (P<.001). Motion amplitudes >15 mm were observed only in the lower geometric quarter of the lungs. Higher tumor motion amplitudes generated higher intrafraction variations (R=.86, P<.001). Interfraction variations and baseline changes >3 mm indicated tumors contacting mediastinal structures or parietal pleura. On univariate analysis, neither sex nor tumor origin (primary vs metastatic) was an independent predictive factor of different movement patterns. Metastatic lesions in women, but not men, showed significantly higher mean amplitudes (P=.03) and variability (primary, 2.7 mm; metastatic, 4.9 mm; P=.002) than primary tumors. Conclusion: Online tracking showed significant irregularities in lung tumor movement during respiration. Motion amplitude was significantly lower in upper lobe

  11. Experimental and numerical study on coupled motion responses of a floating crane vessel and a lifted subsea manifold in deep water

    Directory of Open Access Journals (Sweden)

    B.W. Nam

    2017-09-01

    Full Text Available The floating crane vessel in waves gives rise to the motion of the lifted object which is connected to the hoisting wire. The dynamic tension induced by the lifted object also affects the motion responses of the floating crane vessel in return. In this study, coupled motion responses of a floating crane vessel and a lifted subsea manifold during deep-water installation operations were investigated by both experiments and numerical calculations. A series of model tests for the deep-water lifting operation were performed at Ocean Engineering Basin of KRISO. For the model test, the vessel with a crane control system and a typical subsea manifold were examined. To validate the experimental results, a frequency-domain motion analysis method is applied. The coupled motion equations of the crane vessel and the lifted object are solved in the frequency domain with an additional linear stiffness matrix due to the hoisting wire. The hydrodynamic coefficients of the lifted object, which is a significant factor to affect the coupled dynamics, are estimated based on the perforation value of the structure and the CFD results. The discussions were made on three main points. First, the motion characteristics of the lifted object as well as the crane vessel were studied by comparing the calculation results. Second, the dynamic tension of the hoisting wire were evaluated under the various wave conditions. Final discussion was made on the effect of passive heave compensator on the motion and tension responses.

  12. Analysis of Lung Tumor Motion in a Large Sample: Patterns and Factors Influencing Precise Delineation of Internal Target Volume

    International Nuclear Information System (INIS)

    Knybel, Lukas; Cvek, Jakub; Molenda, Lukas; Stieberova, Natalie; Feltl, David

    2016-01-01

    Purpose/Objective: To evaluate lung tumor motion during respiration and to describe factors affecting the range and variability of motion in patients treated with stereotactic ablative radiation therapy. Methods and Materials: Log file analysis from online respiratory tumor tracking was performed in 145 patients. Geometric tumor location in the lungs, tumor volume and origin (primary or metastatic), sex, and tumor motion amplitudes in the superior-inferior (SI), latero-lateral (LL), and anterior-posterior (AP) directions were recorded. Tumor motion variability during treatment was described using intrafraction/interfraction amplitude variability and tumor motion baseline changes. Tumor movement dependent on the tumor volume, position and origin, and sex were evaluated using statistical regression and correlation analysis. Results: After analysis of >500 hours of data, the highest rates of motion amplitudes, intrafraction/interfraction variation, and tumor baseline changes were in the SI direction (6.0 ± 2.2 mm, 2.2 ± 1.8 mm, 1.1 ± 0.9 mm, and −0.1 ± 2.6 mm). The mean motion amplitudes in the lower/upper geometric halves of the lungs were significantly different (P 15 mm were observed only in the lower geometric quarter of the lungs. Higher tumor motion amplitudes generated higher intrafraction variations (R=.86, P 3 mm indicated tumors contacting mediastinal structures or parietal pleura. On univariate analysis, neither sex nor tumor origin (primary vs metastatic) was an independent predictive factor of different movement patterns. Metastatic lesions in women, but not men, showed significantly higher mean amplitudes (P=.03) and variability (primary, 2.7 mm; metastatic, 4.9 mm; P=.002) than primary tumors. Conclusion: Online tracking showed significant irregularities in lung tumor movement during respiration. Motion amplitude was significantly lower in upper lobe tumors; higher interfraction amplitude variability indicated tumors in contact

  13. Smart solutions to a worsening water crisis | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2013-01-23

    Jan 23, 2013 ... Innovative policies and new technologies that reduce water waste are helping countries across the Middle East and North Africa deal with chronic ... Home · Resources · Publications. Smart solutions to a worsening water crisis.

  14. Science helps to calm water conflicts | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2010-12-08

    Dec 8, 2010 ... The researchers fed information on water use and environmental ... a new irrigation-water law, and in 2006, a Ministry of Water was created. ... Flowing through Bolivia's low-rainfall Altiplano region, the Mauri “is a source of life for more than 70 highland communities,” Alurralde says. ... IDRC Digital Library

  15. International water and sanitation technology transfers, experiences from Europe

    NARCIS (Netherlands)

    Krozer, Yoram; Hophmayer Tokich, Sharon

    2016-01-01

    Possibilities of transferring cost-effective, innovative water and wastewater technologies on public water markets are discussed based on experiences of the Dutch water business cluster in the Central and Eastern European Countries. These transfers evolved under suitable conditions, among others

  16. Analyses of impacts of China's international trade on its water resources and uses

    Science.gov (United States)

    Zhang, Z. Y.; Yang, H.; Shi, M. J.; Zehnder, A. J. B.; Abbaspour, K. C.

    2011-04-01

    This study provides an insight into the impact of China's international trade of goods and services on its water resources and uses. Virtual water flows associated with China's international trade are quantified in an input-output framework. The analysis is scaled down to the sectoral and provincial levels to trace the origins and destinations of virtual water flows associated with the international trade. The results reveal that China is a net virtual water exporter of 4.7 × 1010 m3 year-1, accounting for 2.1% of its total water resources and 8.9% of the total water use. Water scarce regions tend to have higher percentages of virtual water export relative to their water resources and water uses. In the water scarce Huang-Huai-Hai region, the net virtual water export accounts for 7.9% of the region's water resources and 11.2% of its water uses. For individual sectors, major net virtual water exporters are those where agriculture provides raw materials in the initial process of the production chain and/or pollution intensity is high. The results suggest that China's economic gains from being a world "manufacture factory" have come at a high cost to its water resources and through pollution to its environment.

  17. Water droplet accumulation and motion in PEM (Proton Exchange Membrane) fuel cell mini-channels

    International Nuclear Information System (INIS)

    Carton, J.G.; Lawlor, V.; Olabi, A.G.; Hochenauer, C.; Zauner, G.

    2012-01-01

    Effective water management is one of the key strategies for improving low temperature PEM (Proton Exchange Membrane) fuel cell performance and durability. Phenomena such as membrane dehydration, catalyst layer flooding, mass transport and fluid flow regimes can be affected by the interaction, distribution and movement of water in flow plate channels. In this paper a literature review is completed in relation to PEM fuel cell water flooding. It is clear that droplet formation, movement and interaction with the GDL (Gas Diffusion Layer) have been studied extensively. However slug formation and droplet accumulation in the flow channels has not been analysed in detail. In this study, a CFD (Computational Fluid Dynamic) model and VOF (Volume of Fluid) method is used to simulate water droplet movement and slug formation in PEM fuel cell mini-channels. In addition, water slug visualisation is recorded in ex situ PEM fuel cell mini-channels. Observation and simulation results are discussed with relation to slug formation and the implications to PEM fuel cell performance. -- Highlights: ► Excess water in mini-channels from the collision and coalescence of droplets can directly form slugs in PEM fuel cells. ► Slugs can form at low flow rates so increasing the flow rate can reduce the size and frequency of slugs. ► One channel of a double serpentine mini-channel may become blocked due to the redistribution of airflow and pressure caused by slug formation. ► Correct GDL and mini-channel surface coatings are essential to reduce slug formation and stagnation. ► Having geometry changes (bends and steps) in the flow fields can disrupt slug movement and avoid channel blockages.

  18. Mathematical Model and Analysis of the Water-Lubricated Hydrostatic Journal Bearings considering the Translational and Tilting Motions

    Directory of Open Access Journals (Sweden)

    Hui-Hui Feng

    2014-01-01

    Full Text Available The water-lubricated bearings have been paid attention for their advantages to reduce the power loss and temperature rise and increase load capacity at high speed. To fully study the complete dynamic coefficients of two water-lubricated, hydrostatic journal bearings used to support a rigid rotor, a four-degree-of-freedom model considering the translational and tilting motion is presented. The effects of tilting ratio, rotary speed, and eccentricity ratio on the static and dynamic performances of the bearings are investigated. The bulk turbulent Reynolds equation is adopted. The finite difference method and a linear perturbation method are used to calculate the zeroth- and first-order pressure fields to obtain the static and dynamic coefficients. The results suggest that when the tilting ratio is smaller than 0.4 or the eccentricity ratio is smaller than 0.1, the static and dynamic characteristics are relatively insensitive to the tilting and eccentricity ratios; however, for larger tilting or eccentricity ratios, the tilting and eccentric effects should be fully considered. Meanwhile, the rotary speed significantly affects the performance of the hydrostatic, water-lubricated bearings.

  19. 76 FR 34690 - Placer County Water Agency; Notice of Application Accepted for Filing, Soliciting Motions To...

    Science.gov (United States)

    2011-06-14

    ... electronic filing, documents may also be paper-filed. To paper-file, mail an original and seven copies to... (project) has two principal water storage reservoirs, French Meadows and Hell Hole. These reservoirs are...-Middle Fork tunnel into French Meadows reservoir (134,993 ac-ft of gross storage). Flows in the Middle...

  20. Ship motion effects in CTD-data from weakly stratified waters of the Puerto Rico trench

    NARCIS (Netherlands)

    van Haren, H.

    2015-01-01

    Shipborne SBE 911plus Conductivity Temperature Depth (CTD)-casts have been made to maximum 7220 m in the Puerto Rico Trench (PRT). In PRT-waters from 5500 m and deeper and specifically below the 6500 m transition to the hadal-zone, the vertical density stratification is found very weak, with

  1. Application of gis - technology for modelling motion water in the open channels

    OpenAIRE

    Venherskyi, Petro; Kokovska, Yaryna

    2012-01-01

    In this paper technology that would be allowed to use ArcGIS-Extension, that is GIS-components for Webapplications based on ArcGIS Server'a. Such technologies provide simple and easy integration and use of GIS-component on the WEB-site, where a separate layer provided opportunities modeling and solving applied problems of moving water flow in rivers.

  2. Probing water motion in heterogenous systems : a multi-parameter NMR approach

    NARCIS (Netherlands)

    Dusschoten, van D.

    1996-01-01


    In this Thesis a practical approach is presented to study water mobility in heterogeneous systems by a number of novel NMR sequences. The major part of this Thesis describes how the reliability of diffusion measurements can be improved using some of the novel NMR sequences. The

  3. Motion of water droplets in the counter flow of high-temperature combustion products

    Science.gov (United States)

    Volkov, R. S.; Strizhak, P. A.

    2018-01-01

    This paper presents the experimental studies of the deceleration, reversal, and entrainment of water droplets sprayed in counter current flow to a rising stream of high-temperature (1100 K) combustion gases. The initial droplets velocities 0.5-2.5 m/s, radii 10-230 μm, relative volume concentrations 0.2·10-4-1.8·10-4 (m3 of water)/(m3 of gas) vary in the ranges corresponding to promising high-temperature (over 1000 K) gas-vapor-droplet applications (for example, polydisperse fire extinguishing using water mist, fog, or appropriate water vapor-droplet veils, thermal or flame treatment of liquids in the flow of combustion products or high-temperature air; creating coolants based on flue gas, vapor and water droplets; unfreezing of granular media and processing of the drossed surfaces of thermal-power equipment; ignition of liquid and slurry fuel droplets). A hardware-software cross-correlation complex, high-speed (up to 105 fps) video recording tools, panoramic optical techniques (Particle Image Velocimetry, Particle Tracking Velocimetry, Interferometric Particle Imagine, Shadow Photography), and the Tema Automotive software with the function of continuous monitoring have been applied to examine the characteristics of the processes under study. The scale of the influence of initial droplets concentration in the gas flow on the conditions and features of their entrainment by high-temperature gases has been specified. The dependencies Red = f(Reg) and Red' = f(Reg) have been obtained to predict the characteristics of the deceleration of droplets by gases at different droplets concentrations.

  4. Internal radiation doses from radioactivity of drinking water in Finland

    International Nuclear Information System (INIS)

    Kahlos, H.; Asikainen, M.

    1980-01-01

    A study of the radioactivity of drinking water in Finland was carried out from 1974 to 1978. Samples were collected from nearly all water supply plants with more than 200 users and from privately dug or drilled wells. This paper considers drinking water as a factor in increasing the natural radiation exposure of the population and estimates the collective and per capita dose rates caused by the 222 Rn present in water. Instead of performing dose calculations, the significance of 226 Ra and uranium is assessed by means of daily intake. The assessment is made for both the whole population and three subgroups using the water from water supply plants and privately dug or drilled wells. (author)

  5. Rotation-Infall Motion around the Protostar IRAS 16293-2422 Traced by Water Maser Emission

    Science.gov (United States)

    Imai, Hiroshi; Iwata, Takahiro; Miyoshi, Makoto

    1999-08-01

    We made VLBI observations of the water maser emission associated with a protostar, IRAS 16293-2422, using the Kashima-Nobeyama Interferometer (KNIFE) and the Japanese domestic VLBI network (J-Net).\\footnote[2]. These distributions of water maser features showed the blue-shifted and red-shifted components separated in the north-south direction among three epochs spanning three years. The direction of the separation was perpendicular to the molecular outflow and parallel to the elongation of the molecular disk. These steady distributions were successfully modeled by a rotating-infalling disk with an outer radius of 100 AU around a central object with a mass of 0.3 MO . The local specific angular momentum of the disk was calculated to be 0.2-1.0times 10-3 km s-1 pc at a radius of 20-100 AU. This value is roughly equal to that of the disk of IRAS 00338+6312 in L1287 and those of the molecular disks around the protostars in the Taurus molecular cloud. The relatively large disk radius of about 100 AU traced by water maser emission suggests that impinging clumps onto the disk should be hotter than 200 K to excite the water maser emission. Mizusawa, Nobeyama, and Kagoshima stations are operated by staff members of National Astronomical Observatory of the Ministry of Education, Science, Sports and Culture. Kashima station is operated by staff members of Communications Research Laboratory of the Ministry of Posts and Telecomunications. The recent status of J-Net is seen in the WWW home page: http://www.nro.nao.ac.jp/\\ \\ miyaji/Jnet.

  6. Emerging risks from ballast water treatment: The run-up to the International Ballast Water Management Convention

    NARCIS (Netherlands)

    Werschkun, B.; Banerji, S.; Basurko, O.C.; David, M.; Fuhr, F; Gollasch, S.; Grummt, T.; Haarich, M.; Jha, A.N.; Kacan, S.; Kehrer, A.; Linders, J.; Mesbahi, E.; Pughiuc, D.; Richardson, S.D.; Schwarz-Schulz, B.; Shah, A.; Theobald, N.; von Gunten, U.; Wieck, S.; Hofer, T.

    2014-01-01

    Uptake and discharge of ballast water by ocean-going ships contribute to the worldwide spread of aquatic invasive species, with negative impacts on the environment, economies, and public health. The International Ballast Water Management Convention aims at a global answer. The agreed standards for

  7. Mid-Ventilation Concept for Mobile Pulmonary Tumors: Internal Tumor Trajectory Versus Selective Reconstruction of Four-Dimensional Computed Tomography Frames Based on External Breathing Motion

    International Nuclear Information System (INIS)

    Guckenberger, Matthias; Wilbert, Juergen; Krieger, Thomas; Richter, Anne; Baier, Kurt; Flentje, Michael

    2009-01-01

    Purpose: To evaluate the accuracy of direct reconstruction of mid-ventilation and peak-phase four-dimensional (4D) computed tomography (CT) frames based on the external breathing signal. Methods and Materials: For 11 patients with 15 pulmonary targets, a respiration-correlated CT study (4D CT) was acquired for treatment planning. After retrospective time-based sorting of raw projection data and reconstruction of eight CT frames equally distributed over the breathing cycle, mean tumor position (P mean ), mid-ventilation frame, and breathing motion were evaluated based on the internal tumor trajectory. Analysis of the external breathing signal (pressure sensor around abdomen) with amplitude-based sorting of projections was performed for direct reconstruction of the mid-ventilation frame and frames at peak phases of the breathing cycle. Results: On the basis of the eight 4D CT frames equally spaced in time, tumor motion was largest in the craniocaudal direction, with 12 ± 7 mm on average. Tumor motion between the two frames reconstructed at peak phases was not different in the craniocaudal and anterior-posterior directions but was systematically smaller in the left-right direction by 1 mm on average. The 3-dimensional distance between P mean and the tumor position in the mid-ventilation frame based on the internal tumor trajectory was 1.2 ± 1 mm. Reconstruction of the mid-ventilation frame at the mean amplitude position of the external breathing signal resulted in tumor positions 2.0 ± 1.1 mm distant from P mean . Breathing-induced motion artifacts in mid-ventilation frames caused negligible changes in tumor volume and shape. Conclusions: Direct reconstruction of the mid-ventilation frame and frames at peak phases based on the external breathing signal was reliable. This makes the reconstruction of only three 4D CT frames sufficient for application of the mid-ventilation technique in clinical practice.

  8. Fair access to water | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2013-03-19

    Mar 19, 2013 ... ... blocks of the environment on which people, plants, and animals depend. ... the planning and monitoring will ensure fair and safe access to water for all ... Faruqui's work has focused on water management in Islam, and the ...

  9. Internal Corrosion Control of Water Supply Systems Code of Practice

    Science.gov (United States)

    This Code of Practice is part of a series of publications by the IWA Specialist Group on Metals and Related Substances in Drinking Water. It complements the following IWA Specialist Group publications: 1. Best Practice Guide on the Control of Lead in Drinking Water 2. Best Prac...

  10. Cone-Beam Computed Tomography Internal Motion Tracking Should Be Used to Validate 4-Dimensional Computed Tomography for Abdominal Radiation Therapy Patients

    Energy Technology Data Exchange (ETDEWEB)

    Rankine, Leith; Wan, Hanlin; Parikh, Parag; Maughan, Nichole [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States); Poulsen, Per [Department of Oncology, Aarhus University Hospital, Aarhus (Denmark); DeWees, Todd; Klein, Eric [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States); Santanam, Lakshmi, E-mail: lsantanam@radonc.wustl.edu [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States)

    2016-06-01

    Purpose: To demonstrate that fiducial tracking during pretreatment Cone-Beam CT (CBCT) can accurately measure tumor motion and that this method should be used to validate 4-dimensional CT (4DCT) margins before each treatment fraction. Methods and Materials: For 31 patients with abdominal tumors and implanted fiducial markers, tumor motion was measured daily with CBCT and fluoroscopy for 202 treatment fractions. Fiducial tracking and maximum-likelihood algorithms extracted 3-dimensional fiducial trajectories from CBCT projections. The daily internal margin (IM) (ie, range of fiducial motion) was calculated for CBCT and fluoroscopy as the 5th-95th percentiles of displacement in each cardinal direction. The planning IM from simulation 4DCT (IM{sub 4DCT}) was considered adequate when within ±1.2 mm (anterior–posterior, left–right) and ±3 mm (superior–inferior) of the daily measured IM. We validated CBCT fiducial tracking as an accurate predictive measure of intrafraction motion by comparing the daily measured IM{sub CBCT} with the daily IM measured by pretreatment fluoroscopy (IM{sub pre-fluoro}); these were compared with pre- and posttreatment fluoroscopy (IM{sub fluoro}) to identify those patients who could benefit from imaging during treatment. Results: Four-dimensional CT could not accurately predict intrafractional tumor motion for ≥80% of fractions in 94% (IM{sub CBCT}), 97% (IM{sub pre-fluoro}), and 100% (IM{sub fluoro}) of patients. The IM{sub CBCT} was significantly closer to IM{sub pre-fluoro} than IM{sub 4DCT} (P<.01). For patients with median treatment time t < 7.5 minutes, IM{sub CBCT} was in agreement with IM{sub fluoro} for 93% of fractions (superior–inferior), compared with 63% for the t > 7.5 minutes group, demonstrating the need for patient-specific intratreatment imaging. Conclusions: Tumor motion determined from 4DCT simulation does not accurately predict the daily motion observed on CBCT or fluoroscopy. Cone-beam CT could

  11. Water droplet deformation under the motion in gas area with subsonic velocities

    Directory of Open Access Journals (Sweden)

    Kuibin Pavel A.

    2015-01-01

    Full Text Available The experimental investigation of water droplet deformation (characteristic dimensions 3 ÷ 6 mm when moving through the gas area (air with 1÷ 5 m/s velocities was carried out. The high-speed (delay time between the frames is less than 100 ns tools of cross-correlation videorecording were used. A cyclic change nature of the droplet shapes (from close to spherical to conditionally ellipsoidal was found. The characteristic times of “deformation cycles” and the maximal deviations of droplet dimensions relative to initial dimensions were determined. The influence of droplet velocities and its dimensions on the deformation characteristics was determined.

  12. Water Demand Management for Social Justice | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2012-01-18

    Jan 18, 2012 ... Water Demand Management for Social Justice ... Women play larger role in Latin America's commercial urban waste management ... the management of solid waste in Latin America, according to research supported by IDRC.

  13. A home-based clean water revolution | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2010-12-08

    Dec 8, 2010 ... Highly effective yet simple BioSand Filters are providing clean water in more ... Manz, the University of Calgary civil engineering professor who developed the filter. ... Keeping the technology in the public domain has allowed ...

  14. Sunshine and saris equals safe drinking water | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2016-06-09

    Jun 9, 2016 ... ... Moringa oleifera, sari-cloth filtration and solar UV disinfection. ... Protecting food, energy, and livelihoods in Punjab through water-efficient agriculture ... India is responsible for nearly 70% of the world's mango production, ...

  15. Virtual Water and Food Security in Tunisia | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... on the world grain market has social implications for Tunisia's small farmers and ... Thus, when a country exports an agricultural product, in effect it also exports ... Tunisia that incorporates the virtual water concept in a food security strategy.

  16. Working to reverse a water deficit | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... and Yugoslavia, Bataineh began work for the Ministry of Water and Irrigation in 1975. ... cubic metres of wastewater treated in Jordan can only be used in agriculture ... Consequently, the ministry has started to improve existing wastewater ...

  17. Introduction to reactor internal materials for pressurized water reactor

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Woo Suk; Hong, Joon Hwa; Jee, Se Hwan; Lee, Bong Sang; Kuk, Il Hyun [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

    1994-06-01

    This report reviewed the R and D states of reactor internal materials in order to be a reference for researches and engineers who are concerning on localization of the materials in the field or laboratory. General structure of PWR internals and material specification for YGN 3 and 4 were reviewed. States-of-arts on R and D of stainless steel and Alloy X-750 were reviewed, and degradation mechanisms of the components were analyzed. In order to develop the good domestic materials for reactor internal, following studies would be carried out: microstructure, sensitization behavior, fatigue property, irradiation-induced stress corrosion cracking/radiation-induced segregation, radiation embrittlement. (Author) 7 refs., 14 figs., 5 tabs.,.

  18. Introduction to reactor internal materials for pressurized water reactor

    International Nuclear Information System (INIS)

    Ryu, Woo Suk; Hong, Joon Hwa; Jee, Se Hwan; Lee, Bong Sang; Kuk, Il Hyun

    1994-06-01

    This report reviewed the R and D states of reactor internal materials in order to be a reference for researches and engineers who are concerning on localization of the materials in the field or laboratory. General structure of PWR internals and material specification for YGN 3 and 4 were reviewed. States-of-arts on R and D of stainless steel and Alloy X-750 were reviewed, and degradation mechanisms of the components were analyzed. In order to develop the good domestic materials for reactor internal, following studies would be carried out: microstructure, sensitization behavior, fatigue property, irradiation-induced stress corrosion cracking/radiation-induced segregation, radiation embrittlement. (Author) 7 refs., 14 figs., 5 tabs.,

  19. Internal Corrosion Direct Assessment Detection of Water (WP #205)

    Science.gov (United States)

    2010-12-12

    Internal corrosion of natural gas pipelines is the result of interaction between the inside pipe wall and impurities in the product being transported. Such interactions can lead to an overall loss of material thereby thinning the pipe wall and thus r...

  20. Water security of nations: how international trade affects national water scarity and dependency

    NARCIS (Netherlands)

    Hoekstra, Arjen Ysbert; Jones, J. Anthony A.; Vardanian, Trahel G.; Hakopian, Christina

    2009-01-01

    Import of water in virtual form, i.e. in the form of agricultural and industrial commodities, can be an effective means for water-scarce countries to preserve their domestic water resources. On the other hand, export of water-intensive commodities will increase the use and thus the scarcity of water

  1. Static and Dynamic Water Motion-Induced Instability in Oxide Thin-Film Transistors and Its Suppression by Using Low-k Fluoropolymer Passivation.

    Science.gov (United States)

    Choi, Seungbeom; Jo, Jeong-Wan; Kim, Jaeyoung; Song, Seungho; Kim, Jaekyun; Park, Sung Kyu; Kim, Yong-Hoon

    2017-08-09

    Here, we report static and dynamic water motion-induced instability in indium-gallium-zinc-oxide (IGZO) thin-film transistors (TFTs) and its effective suppression with the use of a simple, solution-processed low-k (ε ∼ 1.9) fluoroplastic resin (FPR) passivation layer. The liquid-contact electrification effect, in which an undesirable drain current modulation is induced by a dynamic motion of a charged liquid such as water, can cause a significant instability in IGZO TFTs. It was found that by adopting a thin (∼44 nm) FPR passivation layer for IGZO TFTs, the current modulation induced by the water-contact electrification was greatly reduced in both off- and on-states of the device. In addition, the FPR-passivated IGZO TFTs exhibited an excellent stability to static water exposure (a threshold voltage shift of +0.8 V upon 3600 s of water soaking), which is attributed to the hydrophobicity of the FPR passivation layer. Here, we discuss the origin of the current instability caused by the liquid-contact electrification as well as various static and dynamic stability tests for IGZO TFTs. On the basis of our findings, we believe that the use of a thin, solution-processed FPR passivation layer is effective in suppressing the static and dynamic water motion-induced instabilities, which may enable the realization of high-performance and environment-stable oxide TFTs for emerging wearable and skin-like electronics.

  2. The Cross-fertilization between the Sustainable Development Goals and International Water Law

    NARCIS (Netherlands)

    Spijkers, O.

    2016-01-01

    Are the main principles of international water law, as reflected in the Watercourses Convention, sufficiently equipped to motivate States to sustainably manage their freshwater resources? This article suggests that a more pronounced sustainable approach to these principles is desirable. The

  3. Changes in the Characteristics of Water-in-Oil-based High Internal ...

    African Journals Online (AJOL)

    HP

    Pharmacy, Faculty of Pharmacy and Alternative Medicine, the Islamia University of Bahawalpur 63100, ... and water-in-oil (W/O) systems with internal .... stresses were applied on the samples, and shear rates and .... Curr Opin Colloid Interfac.

  4. Circular motion of particles suspended in a Gaussian beam with circular polarization validates the spin part of the internal energy flow

    DEFF Research Database (Denmark)

    Angelsky, O. V.; Bekshaev, A. Ya.; Maksimyak, P. P.

    2012-01-01

    switching to the right (left) circular polarization, the particles performed spinning motion in agreement with the angular momentum imparted by the field, but they were involved in an orbital rotation around the beam axis as well, which in previous works [Y. Zhao et al, Phys. Rev. Lett. 99, 073901 (2007......Non-spherical dielectric microparticles were suspended in a water-filled cell and exposed to a coherent Gaussian light beam with controlled state of polarization. When the beam polarization is linear, the particles were trapped at certain off-axial position within the beam cross section. After...... of inhomogeneously polarized paraxial beams [A. Bekshaev et al, J. Opt. 13, 053001 (2011)]....

  5. Technical Note: Intrafractional changes in time lag relationship between anterior–posterior external and superior–inferior internal motion signals in abdominal tumor sites

    Science.gov (United States)

    Regmi, Rajesh; Lovelock, D. Michael; Zhang, Pengpeng; Pham, Hai; Xiong, Jianping; Yorke, Ellen D.; Goodman, Karyn A.; Wu, Abraham J.; Mageras, Gig S.

    2015-01-01

    Purpose: To investigate constancy, within a treatment session, of the time lag relationship between implanted markers in abdominal tumors and an external motion surrogate. Methods: Six gastroesophageal junction and three pancreatic cancer patients (IRB-approved protocol) received two cone-beam CTs (CBCT), one before and one after treatment. Time between scans was less than 30 min. Each patient had at least one implanted fiducial marker near the tumor. In all scans, abdominal displacement (Varian RPM) was recorded as the external motion signal. Purpose-built software tracked fiducials, representing internal signal, in CBCT projection images. Time lag between superior–inferior (SI) internal and anterior–posterior external signals was found by maximizing the correlation coefficient in each breathing cycle and averaging over all cycles. Time-lag-induced discrepancy between internal SI position and that predicted from the external signal (external prediction error) was also calculated. Results: Mean ± standard deviation time lag, over all scans and patients, was 0.10 ± 0.07 s (range 0.01–0.36 s). External signal lagged the internal in 17/18 scans. Change in time lag between pre- and post-treatment CBCT was 0.06 ± 0.07 s (range 0.01–0.22 s), corresponding to 3.1% ± 3.7% (range 0.6%–10.8%) of gate width (range 1.6–3.1 s). In only one patient, change in time lag exceeded 10% of the gate width. External prediction error over all scans of all patients varied from 0.1 ± 0.1 to 1.6 ± 0.4 mm. Conclusions: Time lag between internal motion along SI and external signals is small compared to the treatment gate width of abdominal patients examined in this study. Change in time lag within a treatment session, inferred from pre- to post-treatment measurements is also small, suggesting that a single measurement of time lag at the session start is adequate. These findings require confirmation in a larger number of patients. PMID:26127033

  6. Technical Note: Intrafractional changes in time lag relationship between anterior-posterior external and superior-inferior internal motion signals in abdominal tumor sites.

    Science.gov (United States)

    Regmi, Rajesh; Lovelock, D Michael; Zhang, Pengpeng; Pham, Hai; Xiong, Jianping; Yorke, Ellen D; Goodman, Karyn A; Wu, Abraham J; Mageras, Gig S

    2015-06-01

    To investigate constancy, within a treatment session, of the time lag relationship between implanted markers in abdominal tumors and an external motion surrogate. Six gastroesophageal junction and three pancreatic cancer patients (IRB-approved protocol) received two cone-beam CTs (CBCT), one before and one after treatment. Time between scans was less than 30 min. Each patient had at least one implanted fiducial marker near the tumor. In all scans, abdominal displacement (Varian RPM) was recorded as the external motion signal. Purpose-built software tracked fiducials, representing internal signal, in CBCT projection images. Time lag between superior-inferior (SI) internal and anterior-posterior external signals was found by maximizing the correlation coefficient in each breathing cycle and averaging over all cycles. Time-lag-induced discrepancy between internal SI position and that predicted from the external signal (external prediction error) was also calculated. Mean ± standard deviation time lag, over all scans and patients, was 0.10 ± 0.07 s (range 0.01-0.36 s). External signal lagged the internal in 17/18 scans. Change in time lag between pre- and post-treatment CBCT was 0.06 ± 0.07 s (range 0.01-0.22 s), corresponding to 3.1% ± 3.7% (range 0.6%-10.8%) of gate width (range 1.6-3.1 s). In only one patient, change in time lag exceeded 10% of the gate width. External prediction error over all scans of all patients varied from 0.1 ± 0.1 to 1.6 ± 0.4 mm. Time lag between internal motion along SI and external signals is small compared to the treatment gate width of abdominal patients examined in this study. Change in time lag within a treatment session, inferred from pre- to post-treatment measurements is also small, suggesting that a single measurement of time lag at the session start is adequate. These findings require confirmation in a larger number of patients.

  7. Morocco: The value of water | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2016-05-13

    May 13, 2016 ... World Bank. Bouchra ... “This creates an exodus of populations to the cities,” explains Hasnaoui. “It also ... Another important objective is the design of new dams that are better adapted to variations in water resources. For the ...

  8. Coping with water crisis in Cuba | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Even those that did had to treat their water before it was safe to drink. ... containers were distributed only after it was clear that the filters were working properly. ... factors in the urban environment that affect human health — in other words, they ...

  9. in_focus - Water: Local-level Management | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... in the availability and supply of fresh water are truly a matter of life and death, and ... David B. Brooks is a specialist in natural resources who works with the ... of Energy Conservation, Dr Brooks worked for 6 years with Friends of the Earth ...

  10. Motion Sickness: First Aid

    Science.gov (United States)

    ... com. Accessed July 29, 2017. Priesol AJ. Motion sickness. https://www.uptodate.com/content/search. Accessed July 29, 2017. Brunette GW, et al. CDC Health Information for International Travel 2018. New York, N. ...

  11. Nonlocal Reformulations of Water and Internal Waves and Asymptotic Reductions

    Science.gov (United States)

    Ablowitz, Mark J.

    2009-09-01

    Nonlocal reformulations of the classical equations of water waves and two ideal fluids separated by a free interface, bounded above by either a rigid lid or a free surface, are obtained. The kinematic equations may be written in terms of integral equations with a free parameter. By expressing the pressure, or Bernoulli, equation in terms of the surface/interface variables, a closed system is obtained. An advantage of this formulation, referred to as the nonlocal spectral (NSP) formulation, is that the vertical component is eliminated, thus reducing the dimensionality and fixing the domain in which the equations are posed. The NSP equations and the Dirichlet-Neumann operators associated with the water wave or two-fluid equations can be related to each other and the Dirichlet-Neumann series can be obtained from the NSP equations. Important asymptotic reductions obtained from the two-fluid nonlocal system include the generalizations of the Benney-Luke and Kadomtsev-Petviashvili (KP) equations, referred to as intermediate-long wave (ILW) generalizations. These 2+1 dimensional equations possess lump type solutions. In the water wave problem high-order asymptotic series are obtained for two and three dimensional gravity-capillary solitary waves. In two dimensions, the first term in the asymptotic series is the well-known hyperbolic secant squared solution of the KdV equation; in three dimensions, the first term is the rational lump solution of the KP equation.

  12. Nuclear desalination of sea water. Proceedings of an international symposium

    International Nuclear Information System (INIS)

    1997-01-01

    About 250 participants from 24 Member States and seven international organizations took part in the Symposium. A wide variety of topics related to nuclear desalination were reviewed and discussed. These covered the activities of some organizations and institutes, the experience gained in existing nuclear desalination plants and their facilities, national and bilateral programmes, including research, design and development, forecasts for the future and the challenges that lie ahead. It is hoped that the Proceedings will be of value to technical, financial and regulatory decision makers associated with nuclear desalination

  13. A magma ocean and the Earth's internal water budget

    Science.gov (United States)

    Ahrens, Thomas J.

    1992-01-01

    There are lines of evidence which relate bounds on the primordial water content of the Earth's mantle to a magma ocean and the accompanying Earth accretion process. We assume initially (before a magma ocean could form) that as the Earth accreted, it grew from volatile- (H2O, CO2, NH3, CH4, SO2, plus noble) gas-rich planetesimals, which accreted to form an initial 'primitive accretion core' (PAC). The PAC retained the initial complement of planetesimal gaseous components. Shock wave experiments in which both solid, and more recently, the gaseous components of materials such as serpentine and the Murchison meteorite have demonstrated that planetesimal infall velocities of less than 0.5 km/sec, induce shock pressures of less than 0.5 GPa and result in virtually complete retention of planetary gases.

  14. Negotiation Support Systems for Facilitating International Water Conflicts

    Science.gov (United States)

    Mirchi, A.; Madani, K.; Rouhani, O. M.

    2011-12-01

    Two decades after the collapse of the Soviet Union, Caspian Sea -the largest inland body of water on earth- continues to be the subject of one of the world's most insurmountable disputes, involving Iran, Russia, and the new sovereign states of Azerbaijan, Kazakhstan, and Turkmenistan. The conflict is over the legal status of this multinational water body, which supplies almost all of the world's black caviar, and holds about 10% and 4% of the world's oil and gas reserves, respectively. Typically, proposed division methods for sharing the Caspian Sea and its valuable resources focus either on the areal shares or on the oil and gas shares of the parties. As such, total gains of littoral states under different division methods have remained unclear. In this study, we have developed the Caspian Sea Negotiation Support System (NSS) to delineate optimal boundaries for sharing the sea. The Caspian Sea NSS facilitates simultaneous consideration of the countries' areal and resource shares from the sea under different sharing methods. The developed model is run under different division scenarios to provide insights into the sensitivity of the countries' gains and locations of nautical boundaries to the proposed division rules and the economic values of the Caspian Sea resources. The results are highly sensitive to the proposed division rules, and there is an indirect relationship between the allocated area and resource shares. The main policy implication of the study is that explicit quantification of the countries' resource and areal gains under any suggested legal regime for governing the Caspian Sea is a precursor the success of the negotiations.

  15. Sustainable access to safe drinking water: fundamental human right in the international and national scene

    Directory of Open Access Journals (Sweden)

    Celso Maran de Oliveira

    2017-12-01

    Full Text Available Access to potable water is absolutely essential to the maintenance of life, as well as to provide regular exercise of other human rights. The lack of access to water in sufficient quantity or access to non-potable water may cause serious and irreparable damage to people. This paper investigates the evolution of international and national recognition of this fundamental human right, whether implicit or explicit. This was accomplished by the study of international human rights treaties, bibliographic information on water resources and their corresponding legal systems, national and international. The results suggest that sustainable access to drinking water is a fundamental human right in the context of international relations and the State. Further, even without explicitly stating this right in the Constitution of 1988, Brazil has incorporated the main international provisions on the subject, but this right must be acknowledged according to the principles of non-typical fundamental rights and the dignity of the human person. This right should be universally guaranteed by the Government in sufficient quantity and quality, regardless of the economic resources of individuals.

  16. Cervical range of motion, cervical and shoulder strength in senior versus age-grade Rugby Union International front-row forwards.

    Science.gov (United States)

    Davies, Mark; Moore, Isabel S; Moran, Patrick; Mathema, Prabhat; Ranson, Craig A

    2016-05-01

    To provide normative values for cervical range of motion (CROM), isometric cervical and shoulder strength for; International Senior professional, and International Age-grade Rugby Union front-row forwards. Cross-sectional population study. All international level front-row players within a Rugby Union Tier 1 Nation. Nineteen Senior and 21 Age-grade front-row forwards underwent CROM, cervical and shoulder strength testing. CROM was measured using the CROM device and the Gatherer System was used to measure multi-directional isometric cervical and shoulder strength. The Age-grade players had significantly lower; cervical strength (26-57% deficits), cervical flexion to extension strength ratios (0.5 vs. 0.6), and shoulder strength (2-36% deficits) than the Senior players. However, there were no differences between front-row positions within each age group. Additionally, there were no differences between age groups or front-row positions in the CROM measurements. Senior Rugby Union front-row forwards have greater cervical and shoulder strength than Age-grade players, with the biggest differences being in cervical strength, highlighting the need for age specific normative values. Importantly, Age-grade players should be evaluated to ensure they have developed sufficient cervical strength prior to entering professional level Rugby Union. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Measurements of the internal magnetic field on DIII-D using intensity and spacing of the motional Stark multiplet.

    Science.gov (United States)

    Pablant, N A; Burrell, K H; Groebner, R J; Kaplan, D H; Holcomb, C T

    2008-10-01

    We describe a version of a motional Stark effect (MSE) diagnostic based on the relative line intensities and spacing of Stark split D(alpha) emission from the neutral beams. This system, named B-Stark, has been recently installed on the DIII-D tokamak. To find the magnetic pitch angle, we use the ratio of the intensities of the pi(3) and sigma(1) lines. These lines originate from the same upper level and so are not dependent on the level populations. In future devices, such as ITER, this technique may have advantages over diagnostics based on MSE polarimetry. We have done an optimization of the viewing direction for the available ports on DIII-D to choose the installation location. With this placement, we have a near optimal viewing angle of 59.6 degrees from the vertical direction. All hardware has been installed for one chord, and we have been routinely taking data since January 2007. We fit the spectra using a simple Stark model in which the upper level populations of the D(alpha) transition are treated as free variables. The magnitude and direction of the magnetic field obtained using this diagnostic technique compare well with measurements from MSE polarimetry and EFIT.

  18. Virtual water flows in the international trade of agricultural products of China.

    Science.gov (United States)

    Zhang, Yu; Zhang, Jinhe; Tang, Guorong; Chen, Min; Wang, Lachun

    2016-07-01

    With the rapid development of the economy and population, water scarcity and poor water quality caused by water pollution have become increasingly severe in China. Virtual water trade is a useful tool to alleviate water shortage. This paper focuses on a comprehensive study of China's international virtual water flows from agricultural products trade and completes a diachronic analysis from 2001 to 2013. The results show that China was in trade surplus in relation to the virtual water trade of agricultural products. The exported virtual water amounted to 29.94billionm(3)/yr. while 155.55billionm(3)/yr. was embedded in imported products. The trend that China exported virtual water per year was on the decline while the imported was on a rising trend. Virtual water trade of China was highly concentrated. Not all of the exported products had comparative advantages in virtual water content. Imported products were excessively concentrated on water intensive agricultural products such as soya beans, cotton, and palm oil. The exported virtual water mainly flowed to the Republic of Korea, Hong Kong of China and Japan, while the imported mainly flowed from the United States of America, Brazil and Argentina. From the ethical point of view, the trade partners were classified into four types in terms of "net import" and "water abundance": mutual benefit countries, such as Australia and Canada; unilateral benefit countries, such as Mongolia and Norway; supported countries, such as Egypt and Singapore; and double pressure countries, such as India and Pakistan. Virtual water strategy refers to water resources, agricultural products and human beings. The findings are beneficial for innovating water resources management system, adjusting trade structure, ensuring food security in China, and promoting the construction of national ecological security system. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Effective drinking water collaborations are not accidental: interagency relationships in the international water utility sector.

    Science.gov (United States)

    Jalba, D I; Cromar, N J; Pollard, S J T; Charrois, J W; Bradshaw, R; Hrudey, S E

    2014-02-01

    The role that deficient institutional relationships have played in aggravating drinking water incidents over the last 30 years has been identified in several inquiries of high profile drinking water safety events, peer-reviewed articles and media reports. These indicate that collaboration between water utilities and public health agencies (PHAs) during normal operations, and in emergencies, needs improvement. Here, critical elements of these interagency collaborations, that can be integrated within the corporate risk management structures of water utilities and PHAs alike, were identified using a grounded theory approach and 51 semi-structured interviews with utility and PHA staff. Core determinants of effective interagency relationships are discussed. Intentionally maintained functional relationships represent a key ingredient in assuring the delivery of safe, high quality drinking water. © 2013.

  20. Effective drinking water collaborations are not accidental: Interagency relationships in the international water utility sector

    International Nuclear Information System (INIS)

    Jalba, D.I.; Cromar, N.J.; Pollard, S.J.T.; Charrois, J.W.; Bradshaw, R.; Hrudey, S.E.

    2014-01-01

    The role that deficient institutional relationships have played in aggravating drinking water incidents over the last 30 years has been identified in several inquiries of high profile drinking water safety events, peer-reviewed articles and media reports. These indicate that collaboration between water utilities and public health agencies (PHAs) during normal operations, and in emergencies, needs improvement. Here, critical elements of these interagency collaborations, that can be integrated within the corporate risk management structures of water utilities and PHAs alike, were identified using a grounded theory approach and 51 semi-structured interviews with utility and PHA staff. Core determinants of effective interagency relationships are discussed. Intentionally maintained functional relationships represent a key ingredient in assuring the delivery of safe, high quality drinking water. - Highlights: • Qualitative analysis of current water sector practices on interagency relations • Identification of suboptimal approaches to working with public health agencies • Effective strategies for developing and maintaining institutional collaborations • Supporting the implementation of WHO guidelines for drinking water quality

  1. Effective drinking water collaborations are not accidental: Interagency relationships in the international water utility sector

    Energy Technology Data Exchange (ETDEWEB)

    Jalba, D.I. [School of Medicine, Flinders University, GPO 2100, Adelaide, SA 5001 (Australia); Cromar, N.J., E-mail: nancy.cromar@flinders.edu.au [School of the Environment, Flinders University, GPO 2100, Adelaide, SA 5001 (Australia); Pollard, S.J.T. [Cranfield Water Science Institute, Cranfield University, Bedfordshire, MK43 0AL (United Kingdom); Charrois, J.W. [Curtin Water Quality Research Centre, Curtin University, GPO Box U1987, Perth, WA 6845 (Australia); Bradshaw, R. [Cranfield Water Science Institute, Cranfield University, Bedfordshire, MK43 0AL (United Kingdom); Hrudey, S.E. [Analytical and Environmental Toxicology Division, Faculty of Medicine and Dentistry, 10-102 Clinical Sciences Building, University of Alberta, Edmonton, AB T6G 2G3 (Canada)

    2014-02-01

    The role that deficient institutional relationships have played in aggravating drinking water incidents over the last 30 years has been identified in several inquiries of high profile drinking water safety events, peer-reviewed articles and media reports. These indicate that collaboration between water utilities and public health agencies (PHAs) during normal operations, and in emergencies, needs improvement. Here, critical elements of these interagency collaborations, that can be integrated within the corporate risk management structures of water utilities and PHAs alike, were identified using a grounded theory approach and 51 semi-structured interviews with utility and PHA staff. Core determinants of effective interagency relationships are discussed. Intentionally maintained functional relationships represent a key ingredient in assuring the delivery of safe, high quality drinking water. - Highlights: • Qualitative analysis of current water sector practices on interagency relations • Identification of suboptimal approaches to working with public health agencies • Effective strategies for developing and maintaining institutional collaborations • Supporting the implementation of WHO guidelines for drinking water quality.

  2. Experimental Investigation of the Self-Propelled Motion of a Sodium Oleate Tablet and Boat at an Oil-Water Interface.

    Science.gov (United States)

    Watahiki, Yasuhito; Nomoto, Tomonori; Chiari, Luca; Toyota, Taro; Fujinami, Masanori

    2018-05-15

    The self-propelled behaviors of macroscopic inanimate objects at surfaces and interfaces are ubiquitous phenomena of fundamental interest in interface science. However, given the existence of a large variety of systems with their own inherent chemical properties, the kinematics of the self-propelled motion and the dynamics of the forces driving these systems often remain largely unknown. Here, we experimentally investigate the spontaneous motion of a sodium oleate tablet at a water-nitrobenzene interface, under nonequilibrium and global isothermal conditions, through measurements of the interfacial tension with the noninvasive, quasi-elastic laser scattering method. The sodium oleate tablet was self-propelled due to an imbalance in the interfacial tension induced by the inhomogeneous adsorption of oleate/oleic acid molecules. The kinetics of the self-propelled motion of a boat-shaped plastic sheet bearing sodium oleate tablets at a sodium oleate aqueous solution-nitrobenzene interface was also studied. The interfacial tension difference between the front and rear of the boat was quantitatively identified as the force pushing the boat forward, although the Marangoni flow due to the uneven distribution of the interfacial tension behind the boat tended to decelerate the motion.

  3. International symposium on isotope hydrology and integrated water resources management. Book of extended synopses

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2003-07-01

    Scarcity of freshwater, degradation of its quality, and increasing demand has motivated ongoing concern in the international community for more effective utilization of freshwater resources. The IAEA's symposia on the use of isotope techniques in water resources development and management have become a recurrent event held every four years. They have provided an international forum for a comprehensive review of the present state-of-the-art and recent advances made in this specific field as well as a basis for delineation of further research and development needs. The year 2003 marks the 40th anniversary of the first IAEA water resources symposium. Increasing use of isotope techniques over the past four decades, in part due to efforts of IAEA, has enhanced availability and effective use of isotopes to address water resources management issues. The Symposium covers a multi-disciplinary spectrum of research and applications of isotope techniques. The participation of isotope specialists, hydrologists, hydrogeologists, geochemists, environmental scientists and water managers is welcomed. The Organizers further encourage the participation and contribution of graduate students in these fields. The major areas covered include: Water cycle processes in the atmosphere and hydrosphere, including surface water, groundwater, and watershed-based studies, age dating of young groundwaters, water, carbon and nutrient cycling processes at the land-ocean-atmosphere interface, recent advances in analytical techniques for isotope hydrology and field applications of isotopes in groundwater or surface water resources management. This book of synopses covers oral presentations and poster sessions.

  4. The UN Convention on International Watercourses and integrated water management: A bridge built

    Science.gov (United States)

    Tzatzaki, Vasiliki-Maria

    2008-11-01

    The UN Convention on the Law of the Non Navigational Uses of International Watercourses incorporates principles regarding the management of international water resources. The most important principles are the duty of the riparian states to cooperate, not to cause significant harm, to protect the aquatic environment and to utilize the watercourses reasonably and equitably. The lack of hierarchy between these principles signifies that the necessary step for the sound management of shared natural resources is an integrated approach, which takes into account economic development, human needs and environmental protection. Moreover, the UN Convention proved to be useful for the International Court of Justice (hereinafter ICJ) in the settlement of the Gabcikovo- Nagymaros dispute between Hungary and Slovakia for the Danube River. The Court highlighted the importance of the Convention by reminding the riparian states of their obligation to abide by its principles. On the other hand, the ICJ has used the principles of the Convention in the pending case of Pulp Mills between Uruguay and Argentina. This paper is going to show that the UN Convention is an international legal framework with general guidelines in order to create regional conventions, which promotes integrated water management as a solution to the emerging challenges of international water law and potential future conflicts.

  5. The UN Convention on International Watercourses and integrated water management: A bridge built

    International Nuclear Information System (INIS)

    Tzatzaki, Vasiliki-Maria

    2008-01-01

    The UN Convention on the Law of the Non Navigational Uses of International Watercourses incorporates principles regarding the management of international water resources. The most important principles are the duty of the riparian states to cooperate, not to cause significant harm, to protect the aquatic environment and to utilize the watercourses reasonably and equitably. The lack of hierarchy between these principles signifies that the necessary step for the sound management of shared natural resources is an integrated approach, which takes into account economic development, human needs and environmental protection. Moreover, the UN Convention proved to be useful for the International Court of Justice (hereinafter ICJ) in the settlement of the Gabcikovo- Nagymaros dispute between Hungary and Slovakia for the Danube River. The Court highlighted the importance of the Convention by reminding the riparian states of their obligation to abide by its principles. On the other hand, the ICJ has used the principles of the Convention in the pending case of Pulp Mills between Uruguay and Argentina. This paper is going to show that the UN Convention is an international legal framework with general guidelines in order to create regional conventions, which promotes integrated water management as a solution to the emerging challenges of international water law and potential future conflicts.

  6. Changes in the Characteristics of Water-in-Oil-based High Internal ...

    African Journals Online (AJOL)

    Changes in the Characteristics of Water-in-Oil-based High Internal Phase Emulsion Containing Moringa Leaves Extract at Various Storage Conditions. ... Conclusion: Moringa HIPE showed stability and can be guided exclusively to protect skin against ultraviolet radiation-mediated oxidative damage. Keywords: Moringa ...

  7. 3 CFR - Designation of Officers of the United States Section, International Boundary and Water Commission...

    Science.gov (United States)

    2010-01-01

    ... 3 The President 1 2010-01-01 2010-01-01 false Designation of Officers of the United States Section, International Boundary and Water Commission, United States and Mexico To Act as the Commissioner of the United... States and Mexico To Act as the Commissioner of the United States Section Memorandum for the Commissioner...

  8. International Cooperation for the Training of Water Managers from Developing Countries

    Science.gov (United States)

    Aswathanarayana, U.

    2007-12-01

    Water is the key to the well being of a community. On one hand, water security is linked to food security, as food cannot be grown without water. On the other hand, water security is linked to environmental security, as water is needed to maintain the health of a community. International cooperation is proposed for the training in Hyderabad, India, with international faculty, of ~ 300 water managers from the developing countries at an estimated cost of ~USD 3300/- per candidate (including ~ USD 1800/- for international travel), through ten interactive and customized training programmes during the period of five years, to enable them to address two crucial issues affecting the poor in the developing countries, namely, access to affordable water and coping with water scarcity. Ways of Good governance and geographical targeting of poverty alleviation programmes are built into each training programme. Each training programme will be for about three weeks (inclusive of field work). Each course will have a component common to all, plus a component customized to the biophysical and socioeconomic situation in a candidate's country. Ten course manuals will be produced. which can later be published commercially as low-cost volumes, for the benefit of the readership in the Developing countries . Each candidate will be provided his own computer, and software, and individual faculty adviser. On the basis of the training received, a candidate should be able to carry with him at the end of the course a draft outline of techno-socio-economic action plan for his country/area in respect of the theme of the course, prepared by himself/herself. A copy of this outline would be provided to the World Bank, and relevant organizations for follow- up activity

  9. Trends in Modelling, Simulation and Design of Water Hydraulic Systems – Motion Control and Open-Ended Solutions

    DEFF Research Database (Denmark)

    Conrad, Finn

    2006-01-01

    is on the advantages using ordinary tap water and the range of application areas are illustrated with examples, in particular within the food processing industry, humidification operations, water mist systems for fire fighting, high water pressure cleaners, water moisturising systems for wood processing, lumber drying...... is that the components operate with pure water from the tap without additives of any kind. Hence water hydraulics takes the benefit of pure water as fluid being environmentally friendly, easy to clean sanitary design, non-toxic, non-flammable, inexpensive, readily available and easily disposable. The low-pressure tap......, dedicated pumps and accessories running with sea-water as fluid are available. A unique solution is to use reverse osmosis to generate drinking water from sea-water, and furthermore for several off-shore applications. Furthermore, tap water hydraulic components of the Nessie® family and examples of measured...

  10. The influence of large-amplitude librational motion on the hydrogen bond energy for alcohol–water complexes

    DEFF Research Database (Denmark)

    Andersen, Jonas; Heimdal, J.; Larsen, René Wugt

    2015-01-01

    is a superior hydrogen bond acceptor. The class of large-amplitude donor OH librational motion is shown to account for up to 5.1 kJ mol-1 of the destabilizing change of vibrational zero-point energy upon intermolecular OH...O hydrogen bond formation. The experimental findings are supported by complementary...

  11. THE ESSENTIAL DYNAMICS OF THERMOLYSIN - CONFIRMATION OF THE HINGE-BENDING MOTION AND COMPARISON OF SIMULATIONS IN VACUUM AND WATER

    NARCIS (Netherlands)

    van Aalten, D.M.F.; Amadei, A; Linssen, A.B M; Eijsink, V.G.H.; Vriend, G.; Berendsen, H.J.C.

    Comparisons of the crystal structures of thermolysin and the thermolysin-like protease produced by B. cereus have recently led to the hypothesis that neutral proteases undergo a hinge-bending motion. We have investigated this hypothesis by analyzing molecular dynamics simulations of thermolysin in

  12. Internal hydraulic control in the Little Belt, Denmark - observations of flow configurations and water mass formation

    Science.gov (United States)

    Holtegaard Nielsen, Morten; Vang, Torben; Chresten Lund-Hansen, Lars

    2017-12-01

    Internal hydraulic control, which occurs when stratified water masses are forced through an abrupt constriction, plays an enormous role in nature on both large and regional scales with respect to dynamics, circulation, and water mass formation. Despite a growing literature on this subject surprisingly few direct observations have been made that conclusively show the existence of and the circumstances related to internal hydraulic control in nature. In this study we present observations from the Little Belt, Denmark, one of three narrow straits connecting the Baltic Sea and the North Sea. The observations (comprised primarily of along-strait, detailed transects of salinity and temperature; continuous observations of flow velocity, salinity, and temperature at a permanent station; and numerous vertical profiles of salinity, temperature, fluorescence, and flow velocity in various locations) show that internal hydraulic control is a frequently occurring phenomenon in the Little Belt. The observations, which are limited to south-going flows of approximately two-layered water masses, show that internal hydraulic control may take either of two configurations, i.e. the lower or the upper layer being the active, accelerating one. This is connected to the depth of the pycnocline on the upstream side and the topography, which is both deepening and contracting toward the narrow part of the Little Belt. The existence of two possible flow configurations is known from theoretical and laboratory studies, but we believe that this has never been observed in nature and reported before. The water masses formed by the intense mixing, which is tightly connected with the presence of control, may be found far downstream of the point of control. The observations show that these particular water masses are associated with chlorophyll concentrations that are considerably higher than in adjacent water masses, showing that control has a considerable influence on the primary production and

  13. Transformation of a Water Slug in Free Fall Under the Conditions of Exposure to an Air Flow Orthogonal to the Direction of the Slug Motion

    Science.gov (United States)

    Volkov, R. S.; Zabelin, M. V.; Kuznetsov, G. V.; Strizhak, P. A.

    2016-07-01

    An experimental study has been made of the influence of an orthogonal (side) air flow propagating with a velocity to 5 m/s on the phases of transformation of a water slug with an initial volume of 0.05-0.5 liter in free fall from a height of 3 m. Use was made of Phantom V411 and Phantom Miro M310 high-speed video cameras and a Tema Automotive software system with the function of continuous tracking. The laws of retardation of the phases of transformation of the water slug from the instant of formation to that of formation of a droplet cloud under the action of the air flow orthogonal to the direction of the slug motion, and also of the deceleration, removal, and destruction of the droplets and fragments of water separating from the slug surface, have been established.

  14. 19 CFR 210.26 - Other motions.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Other motions. 210.26 Section 210.26 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Motions § 210.26 Other motions. Motions pertaining to discovery shall be filed in...

  15. International Comparison of Water Resources Utilization Efficiency in the Silk Road Economic Belt

    Science.gov (United States)

    Yan, Long; Ma, Jing; Deng, Wei; Wang, Yong

    2018-03-01

    In order to get knowledge of the standard of water utilization of the Silk Road Economic Belt from international point of view, the paper analyzes the annual variation of water resources utilization in the Silk Road Economic Belt, and compares with other typical countries. The study shows that Water resources utilization efficiency has been greatly improved in recent 20 years and the water consumption per USD 10000 of GDP has been declined 87.97%. the improvement of industrial water consumption efficiency is the key driving factors for substantial decrease in water consumption.The comparison of water utilization and human development shows that the higher HDI the country is, the more efficient water utilization the country has. water consumption per USD 10000 of GDP in country with HDI>0.9 is 194m³, being 8.5% of that in country with HDI from 0.5 to 0.6. On the premise of maintaining the stable economic and social development of the Silk Road Economic Belt, the realization of the control target of total water consumption must depend on the strict control over the disorderly expansion of irrigated area, the change in the mode of economic growth, the implementation of the development strategy for new industrialization and urbanization, vigorous development of the processing industry with low water consumption as well as the high-tech and high value-added industry. Only in this way, the control target of total water consumption can be realized in the process of completing the industrialization task.

  16. Hydration level is an internal variable for computing motivation to obtain water rewards in monkeys.

    Science.gov (United States)

    Minamimoto, Takafumi; Yamada, Hiroshi; Hori, Yukiko; Suhara, Tetsuya

    2012-05-01

    In the process of motivation to engage in a behavior, valuation of the expected outcome is comprised of not only external variables (i.e., incentives) but also internal variables (i.e., drive). However, the exact neural mechanism that integrates these variables for the computation of motivational value remains unclear. Besides, the signal of physiological needs, which serves as the primary internal variable for this computation, remains to be identified. Concerning fluid rewards, the osmolality level, one of the physiological indices for the level of thirst, may be an internal variable for valuation, since an increase in the osmolality level induces drinking behavior. Here, to examine the relationship between osmolality and the motivational value of a water reward, we repeatedly measured the blood osmolality level, while 2 monkeys continuously performed an instrumental task until they spontaneously stopped. We found that, as the total amount of water earned increased, the osmolality level progressively decreased (i.e., the hydration level increased) in an individual-dependent manner. There was a significant negative correlation between the error rate of the task (the proportion of trials with low motivation) and the osmolality level. We also found that the increase in the error rate with reward accumulation can be well explained by a formula describing the changes in the osmolality level. These results provide a biologically supported computational formula for the motivational value of a water reward that depends on the hydration level, enabling us to identify the neural mechanism that integrates internal and external variables.

  17. Molecular water motions of skim milk powder solutions during acidification studied by 17O and 1H nuclear magnetic resonance and rheology

    DEFF Research Database (Denmark)

    Møller, S M; Whittaker, A. K.; Stokes, J. R.

    2011-01-01

    The molecular motion of water was studied in glucono-δ-lactone-acidified skim milk powder (SMP) solutions with various pH values and dry matter contents. NMR relaxometry measurements revealed that lowering the pH in SMP solutions affected 17O and 1HT2 relaxation rates almost identically. Conseque......The molecular motion of water was studied in glucono-δ-lactone-acidified skim milk powder (SMP) solutions with various pH values and dry matter contents. NMR relaxometry measurements revealed that lowering the pH in SMP solutions affected 17O and 1HT2 relaxation rates almost identically...... could contribute to the initial decrease in 17O and 1Hrelaxation rate in the pH range between 6.6 and 5.5 for 15% SMP and in the pH range between 6.6 and 5.9 for 25% SMP. However, below pH 5.5 the viscosity and 17Oand 1HNMRrelaxation rates did not correlate, revealing that the aggregation of casein...... micelles, which increases viscosity below pH 5.5, does not involve major repartitioning of water....

  18. Ice crystallization in ultrafine water-salt aerosols: nucleation, ice-solution equilibrium, and internal structure.

    Science.gov (United States)

    Hudait, Arpa; Molinero, Valeria

    2014-06-04

    Atmospheric aerosols have a strong influence on Earth's climate. Elucidating the physical state and internal structure of atmospheric aqueous aerosols is essential to predict their gas and water uptake, and the locus and rate of atmospherically important heterogeneous reactions. Ultrafine aerosols with sizes between 3 and 15 nm have been detected in large numbers in the troposphere and tropopause. Nanoscopic aerosols arising from bubble bursting of natural and artificial seawater have been identified in laboratory and field experiments. The internal structure and phase state of these aerosols, however, cannot yet be determined in experiments. Here we use molecular simulations to investigate the phase behavior and internal structure of liquid, vitrified, and crystallized water-salt ultrafine aerosols with radii from 2.5 to 9.5 nm and with up to 10% moles of ions. We find that both ice crystallization and vitrification of the nanodroplets lead to demixing of pure water from the solutions. Vitrification of aqueous nanodroplets yields nanodomains of pure low-density amorphous ice in coexistence with vitrified solute rich aqueous glass. The melting temperature of ice in the aerosols decreases monotonically with an increase of solute fraction and decrease of radius. The simulations reveal that nucleation of ice occurs homogeneously at the subsurface of the water-salt nanoparticles. Subsequent ice growth yields phase-segregated, internally mixed, aerosols with two phases in equilibrium: a concentrated water-salt amorphous mixture and a spherical cap-like ice nanophase. The surface of the crystallized aerosols is heterogeneous, with ice and solution exposed to the vapor. Free energy calculations indicate that as the concentration of salt in the particles, the advance of the crystallization, or the size of the particles increase, the stability of the spherical cap structure increases with respect to the alternative structure in which a core of ice is fully surrounded by

  19. Proceedings of the international congress on desalination and water reuse: water, the essence of life, 1981

    Energy Technology Data Exchange (ETDEWEB)

    Bakish, R. (ed.)

    1981-11-01

    This conference proceedings contains 112 papers of which 21 appear in abstract form only. 38 papers have been abstracted separately. The papers in volume 1 are arranged in the following sections: thermal processes; scale control; materials; membranes-reverse osmosis: membrane fundamentals, pretreatment and seawater reverse osmosis; and membranes-electrodialysis. The papers in volume 2 are arranged in the following sections: instrumentation; new energy sources; activities in the Middle East; activities in the American continent; activities in Europe and the Mediterranean; activities in Asia and the Far East; role of energy and economics in water conversion; education and management; and related topics.

  20. Diagram of the Water Recovery and Management for the International Space Station

    Science.gov (United States)

    2000-01-01

    This diagram shows the flow of water recovery and management in the International Space Station (ISS). The Environmental Control and Life Support System (ECLSS) Group of the Flight Projects Directorate at the Marshall Space Flight Center is responsible for the regenerative ECLSS hardware, as well as providing technical support for the rest of the system. The regenerative ECLSS, whose main components are the Water Recovery System (WRS), and the Oxygen Generation System (OGS), reclaims and recycles water oxygen. The ECLSS maintains a pressurized habitation environment, provides water recovery and storage, maintains and provides fire detection/ suppression, and provides breathable air and a comfortable atmosphere in which to live and work within the ISS. The ECLSS hardware will be located in the Node 3 module of the ISS.

  1. Coal-water slurry fuel internal combustion engine and method for operating same

    Science.gov (United States)

    McMillian, Michael H.

    1992-01-01

    An internal combustion engine fueled with a coal-water slurry is described. About 90 percent of the coal-water slurry charge utilized in the power cycle of the engine is directly injected into the main combustion chamber where it is ignited by a hot stream of combustion gases discharged from a pilot combustion chamber of a size less than about 10 percent of the total clearance volume of main combustion chamber with the piston at top dead center. The stream of hot combustion gases is provided by injecting less than about 10 percent of the total coal-water slurry charge into the pilot combustion chamber and using a portion of the air from the main combustion chamber that has been heated by the walls defining the pilot combustion chamber as the ignition source for the coal-water slurry injected into the pilot combustion chamber.

  2. 3. SEGMITE International Symposium on Sustainable Development of Surface and Ground Water Resources

    International Nuclear Information System (INIS)

    Tabrez, A.R.

    1999-01-01

    The Society of Economic Geologist and Mineral Technologist (SEGMITE), National Institute of Oceanography (NIO) and Association of Geo-scientists for International Development with the collaboration of Export Promotion Bureau, Government of Pakistan has organised this symposium. The third Segmite International Symposium on Sustainable Development of surface and ground water resources was held on 8-10 march 1999 at Karachi, Pakistan. This book gives the conference information, brochure and abstracts of papers presented in the conference. There are about 38 abstracts submitted for the conference and related nature of the materials. Out of these 38 papers 16 are of nuclear oriented which are presented here separately. (A.B.)

  3. Degradation of austenitic stainless steel (SS) light water ractor (LWR) core internals due to neutron irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Rao, Appajosula S., E-mail: Appajosula.Rao@nrc.gov

    2014-04-01

    Austenitic stainless steels (SSs) are extensively being used in the fabrication of light water reactor (LWR) core internal components. It is because these steels have relatively high ductility, fracture toughness and moderate strength. However, the LWR internal components exposure to neutron irradiation over an extended period of plant operation degrades the materials mechanical properties such as the fracture toughness. This paper summarizes some of the results of the existing open literature data on irradiation assisted stress corrosion cracking (IASCC) of 316 CW steels that have been published by the United States Nuclear Regulatory Commission (USNRC), industry, academia, and other research agencies.

  4. International symposium and field seminar on karst waters and environmental impacts. Abstracts

    International Nuclear Information System (INIS)

    Gunay, G.; Tezcan, L.; Atilla, A.O.

    1995-01-01

    The international symposium and field seminar on karst waters and environmental impacts was held on 10-20 September 1995 in Beldibi,Antalya, Turkey. The specialists discussed COST Action 65, Environmental Impact sand Legal Aspects, Engineering and Environmental Impacts of Karst, Research Methods, Tracing Techniques, Hydro chemistry, Environmental Isotopes in Karst, Transport Processing, Modeling and Flow Systems, Karst Morphology and Paleoenvironment, Regional Karst Systems, James F. Quinlay Pollution Control and Karst Water Protection Session and Hydrology. Almost 140 papers were presented in the meeting

  5. International symposium and field seminar on karst waters and environmental impacts. Abstracts

    Energy Technology Data Exchange (ETDEWEB)

    Gunay, G; Tezcan, L; Atilla, A O [comps.

    1996-12-31

    The international symposium and field seminar on karst waters and environmental impacts was held on 10-20 September 1995 in Beldibi,Antalya, Turkey. The specialists discussed COST Action 65, Environmental Impact sand Legal Aspects, Engineering and Environmental Impacts of Karst, Research Methods, Tracing Techniques, Hydro chemistry, Environmental Isotopes in Karst, Transport Processing, Modeling and Flow Systems, Karst Morphology and Paleoenvironment, Regional Karst Systems, James F. Quinlay Pollution Control and Karst Water Protection Session and Hydrology. Almost 140 papers were presented in the meeting.

  6. An International Survey of Electric Storage Tank Water Heater Efficiency and Standards

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, Alissa; Lutz, James; McNeil, Michael A.; Covary, Theo

    2013-11-13

    Water heating is a main consumer of energy in households, especially in temperate and cold climates. In South Africa, where hot water is typically provided by electric resistance storage tank water heaters (geysers), water heating energy consumption exceeds cooking, refrigeration, and lighting to be the most consumptive single electric appliance in the home. A recent analysis for the Department of Trade and Industry (DTI) performed by the authors estimated that standing losses from electric geysers contributed over 1,000 kWh to the annual electricity bill for South African households that used them. In order to reduce this burden, the South African government is currently pursuing a programme of Energy Efficiency Standards and Labelling (EES&L) for electric appliances, including geysers. In addition, Eskom has a history of promoting heat pump water heaters (HPWH) through incentive programs, which can further reduce energy consumption. This paper provides a survey of international electric storage water heater test procedures and efficiency metrics which can serve as a reference for comparison with proposed geyser standards and ratings in South Africa. Additionally it provides a sample of efficiency technologies employed to improve the efficiency of electric storage water heaters, and outlines programs to promote adoption of improved efficiency. Finally, it surveys current programs used to promote HPWH and considers the potential for this technology to address peak demand more effectively than reduction of standby losses alone

  7. Water-mediated influence of a crowded environment on internal vibrations of a protein molecule.

    Science.gov (United States)

    Kuffel, Anna; Zielkiewicz, Jan

    2016-02-14

    The influence of crowding on the protein inner dynamics is examined by putting a single protein molecule close to one or two neighboring protein molecules. The presence of additional molecules influences the amplitudes of protein fluctuations. Also, a weak dynamical coupling of collective velocities of surface atoms of proteins separated by a layer of water is detected. The possible mechanisms of these phenomena are described. The cross-correlation function of the collective velocities of surface atoms of two proteins was decomposed into the Fourier series. The amplitude spectrum displays a peak at low frequencies. Also, the results of principal component analysis suggest that the close presence of an additional protein molecule influences the high-amplitude, low-frequency modes in the most prominent way. This part of the spectrum covers biologically important protein motions. The neighbor-induced changes in the inner dynamics of the protein may be connected with the changes in the velocity power spectrum of interfacial water. The additional protein molecule changes the properties of solvation water and in this way it can influence the dynamics of the second protein. It is suggested that this phenomenon may be described, at first approximation, by a damped oscillator driven by an external random force. This model was successfully applied to conformationally rigid Choristoneura fumiferana antifreeze protein molecules.

  8. Aging considerations for PWR [pressurized water reactor] control rod drive mechanisms and reactor internals

    International Nuclear Information System (INIS)

    Ware, A.G.

    1988-01-01

    This paper describes age-related degradation mechanisms affecting life extension of pressurized water reactor control rod drive mechanisms and reactor internals. The major sources of age-related degradation for control rod drive mechanisms are thermal transients such as plant heatups and cooldowns, latchings and unlatchings, long-term aging effects on electrical insulation, and the high temperature corrosive environment. Flow induced loads, the high-temperature corrosive environment, radiation exposure, and high tensile stresses in bolts all contribute to aging related degradation of reactor internals. Another problem has been wear and fretting of instrument guide tubes. The paper also discusses age-related failures that have occurred to date in pressurized water reactors

  9. Influence of internal tides on Antarctic Bottom Water propagation through abyssal channels

    Science.gov (United States)

    Morozov, Eugene

    2010-05-01

    Antarctic Bottom Water (AABW) propagates in the Atlantic Ocean from the Weddell Sea to the north through narrow passages in submarine ridges. Submarine ridges are regions of strong internal tide generation in the ocean that causes mixing and eventually AABW loses its distinguishing properties such as low temperature and salinity. The Vema Fracture Zone (11 N) and Romanche Fracture Zone (equator) in the Mid-Atlantic Ridge (MAR) are pathways for AABW to the Northeast Atlantic. The deep basin of the Northeast Atlantic (Canary Basin and Gambia Abyssal Plain) are filled with the bottom water propagating through the Vema FZ rather than through the equatorial fracture zones because strong internal tides and mixing over the slopes of the MAR near the equator cause warming of AABW and decrease of its density. Further propagation of AABW through the Kane Gap is low. Recent field measurements in the fracture zones confirm this concept based on modeling results. Results of recent cruises are presented.

  10. A Comparison of Amplitude-Based and Phase-Based Positron Emission Tomography Gating Algorithms for Segmentation of Internal Target Volumes of Tumors Subject to Respiratory Motion

    International Nuclear Information System (INIS)

    Jani, Shyam S.; Robinson, Clifford G.; Dahlbom, Magnus; White, Benjamin M.; Thomas, David H.; Gaudio, Sergio; Low, Daniel A.; Lamb, James M.

    2013-01-01

    Purpose: To quantitatively compare the accuracy of tumor volume segmentation in amplitude-based and phase-based respiratory gating algorithms in respiratory-correlated positron emission tomography (PET). Methods and Materials: List-mode fluorodeoxyglucose-PET data was acquired for 10 patients with a total of 12 fluorodeoxyglucose-avid tumors and 9 lymph nodes. Additionally, a phantom experiment was performed in which 4 plastic butyrate spheres with inner diameters ranging from 1 to 4 cm were imaged as they underwent 1-dimensional motion based on 2 measured patient breathing trajectories. PET list-mode data were gated into 8 bins using 2 amplitude-based (equal amplitude bins [A1] and equal counts per bin [A2]) and 2 temporal phase-based gating algorithms. Gated images were segmented using a commercially available gradient-based technique and a fixed 40% threshold of maximum uptake. Internal target volumes (ITVs) were generated by taking the union of all 8 contours per gated image. Segmented phantom ITVs were compared with their respective ground-truth ITVs, defined as the volume subtended by the tumor model positions covering 99% of breathing amplitude. Superior-inferior distances between sphere centroids in the end-inhale and end-exhale phases were also calculated. Results: Tumor ITVs from amplitude-based methods were significantly larger than those from temporal-based techniques (P=.002). For lymph nodes, A2 resulted in ITVs that were significantly larger than either of the temporal-based techniques (P<.0323). A1 produced the largest and most accurate ITVs for spheres with diameters of ≥2 cm (P=.002). No significant difference was shown between algorithms in the 1-cm sphere data set. For phantom spheres, amplitude-based methods recovered an average of 9.5% more motion displacement than temporal-based methods under regular breathing conditions and an average of 45.7% more in the presence of baseline drift (P<.001). Conclusions: Target volumes in images generated

  11. Problem statement: international safeguards for a light-water reactor fuels reprocessing plant

    International Nuclear Information System (INIS)

    Shipley, J.P.; Hakkila, E.A.; Dietz, R.J.; Cameron, C.P.; Bleck, M.E.; Darby, J.L.

    1979-03-01

    This report considers the problem of developing international safeguards for a light-water reactor (LWR) fuel reprocessing/conversion facility that combines the Purex process with conversion of plutonium nitrate to the oxide by means of plutonium (III) oxalate precipitation and calcination. Current international safeguards systems are based on the complementary concepts of materials accounting and containment and surveillance, which are designed to detect covert, national diversion of nuclear material. This report discusses the possible diversion threats and some types of countermeasures, and it represents the first stage in providing integrated international safeguards system concepts that make optimum use of available resources. The development of design methodology to address this problem will constitute a significant portion of the subsequent effort. Additionally, future technology development requirements are identified. 8 figures, 1 table

  12. Analysis on traditional fishing grounds in Indonesia`s Natuna waters under International Law

    Science.gov (United States)

    Kurniaty, R.; Ikaningtyas; Ruslijanto, P. A.

    2018-04-01

    This paper examines the boundary tension between Indonesia and China regarding traditional fishing ground in Natuna. Indonesia`s Natuna island is claimed by the China government as its traditional fishing zone/ground. The inclusion of Natuna territory into China`s traditional fishing zone brings new problems to Indonesia, especially with the Chinese ships docked and entered Indonesia`s exclusive economic zone, as well as several cases of illegal fishing over the territorial waters of Indonesia. Claims on traditional fishing zones have the potential to threaten the sovereignty of the Indonesian territory. This study aims to analyze the claims of the traditional fishing rights of China over the waters of the Natuna Islands under international law, especially UNCLOS 1982. This study revealed that the china`s argument of traditional fishing ground in Natuna to the nine dash line map is a unilateral claim, there is no international legal norm that can be used as the legal basis. Indonesia and some ASEAN countries have Internationally validated bilateral agreement on the continental shelf (i.e. Indonesia-Vietnam and Indonesia-Malaysia) thus the inclusion of Natuna into China`s nine dash line map rejects the legal status of Indonesian water under UNCLOS 1982.

  13. Mode pattern of internal flow in a water droplet on a vibrating hydrophobic surface.

    Science.gov (United States)

    Kim, Hun; Lim, Hee-Chang

    2015-06-04

    The objective of this study is to understand the mode pattern of the internal flow in a water droplet placed on a hydrophobic surface that periodically and vertically vibrates. As a result, a water droplet on a vibrating hydrophobic surface has a typical shape that depends on each resonance mode, and, additionally, we observed a diversified lobe size and internal flows in the water droplet. The size of each lobe at the resonance frequency was relatively greater than that at the neighboring frequencies, and the internal flow of the nth order mode was also observed in the flow visualization. In general, large symmetrical flow streams were generated along the vertical axis in each mode, with a large circulating movement from the bottom to the top, and then to the triple contact line along the droplet surface. In contrast, modes 2 and 4 generated a Y-shaped flow pattern, in which the flow moved to the node point in the lower part of the droplet, but modes 6 and 8 had similar patterns, with only a little difference. In addition, as a result of the PIV measurement, while the flow velocity of mode 4 was faster than that of model 2, those of modes 6 and 8 were almost similar.

  14. Effect of motion-induced PET-CT misalignment on cardiac function and myocardial blood flow measured using dynamic 15O-water PET

    DEFF Research Database (Denmark)

    Lubberink, Mark; Ebrahimi, M; Harms, Hans

    -CT misalignment on MBF, transmural MBF (MBFt), perfusable tissue fraction (PTF), cardiac output (CO), stroke volume (SV) and left-ventricular ejection fraction (LVEF) based on dynamic 15O-water scans. Methods: 10 patients underwent 6 min PET scans after injection of 400 MBq 15O-water at rest and during adenosine......Aim: Motion-induced PET-CT misalignment artifacts are common in myocardial blood flow (MBF) measurements with 82Rb and 13N-ammonia. For 15O-water, MBF is based on the clearance rate rather than uptake of the tracer. The clearance rate is determined by the shape of the time-activity curve, not its...... amplitude, and is thus not affected by attenuation correction errors. Hence, misalignment is hypothesized not to affect 15O-water-based MBF to any large extent, but it may affect cardiac function measures derived from 15O-water scans. The aim of the present work was to assess the effect of PET...

  15. EXPERIMENTAL INSTALLATION FOR AN ASSESSMENT OF METHODS OF WATER SUPPLY IN AN INTERNAL COMBUSTION ENGINE

    Directory of Open Access Journals (Sweden)

    A. V. Bizhaev

    2015-01-01

    Full Text Available The water additive to fuel became one of effective ways of the solution of the main problems of the piston internal combustion engines (ICE as it reduces thermal factor of the engine, toxic emissions of exhaust products, and also increases efficiency by some operating modes. The way of fuel and air mix with water feeding in the combustion chamber has a great influence on process of combustion. Experimental installation for obtaining comparative characteristics of the main methods of water supply in the ICE combustion chamber was created. It was defined that there are two ways of water supply in the combustion chamber. At the first way water feed is carried out in the form of a water fuel emulsion which moves to the combustion chamber through a nozzle by means of the fuel pump with a high pressure. At the second way water arrives with air through the spraying element - the carburetor or a nozzle. This way is very simple in difference of emulsion feeding. The easiest way is nozzles application. It was established that the emulsion as the non-uniform highly dispersed fluid can be divide into components. Therefore it is necessary to use during the feeding system operation special emulsifiers with air for the uniformity water getting to the cylinder. The system for each nozzle opening at some point was offered. System of feedback with sensors of exhaust gases temperature in a final collector for adjustment of duration of injection was worked out. It was showed that at the developed experimental stand it is possible to carry out tests at various power modes. As result it will be possible to estimate both ways of fuel and air mix with water feeding.

  16. Drinking water treatment using a submerged internal-circulation membrane coagulation reactor coupled with permanganate oxidation.

    Science.gov (United States)

    Zhang, Zhongguo; Liu, Dan; Qian, Yu; Wu, Yue; He, Peiran; Liang, Shuang; Fu, Xiaozheng; Li, Jiding; Ye, Changqing

    2017-06-01

    A submerged internal circulating membrane coagulation reactor (MCR) was used to treat surface water to produce drinking water. Polyaluminum chloride (PACl) was used as coagulant, and a hydrophilic polyvinylidene fluoride (PVDF) submerged hollow fiber microfiltration membrane was employed. The influences of trans-membrane pressure (TMP), zeta potential (ZP) of the suspended particles in raw water, and KMnO 4 dosing on water flux and the removal of turbidity and organic matter were systematically investigated. Continuous bench-scale experiments showed that the permeate quality of the MCR satisfied the requirement for a centralized water supply, according to the Standards for Drinking Water Quality of China (GB 5749-2006), as evaluated by turbidity (<1 NTU) and total organic carbon (TOC) (<5mg/L) measurements. Besides water flux, the removal of turbidity, TOC and dissolved organic carbon (DOC) in the raw water also increased with increasing TMP in the range of 0.01-0.05MPa. High ZP induced by PACl, such as 5-9mV, led to an increase in the number of fine and total particles in the MCR, and consequently caused serious membrane fouling and high permeate turbidity. However, the removal of TOC and DOC increased with increasing ZP. A slightly positive ZP, such as 1-2mV, corresponding to charge neutralization coagulation, was favorable for membrane fouling control. Moreover, dosing with KMnO 4 could further improve the removal of turbidity and DOC, thereby mitigating membrane fouling. The results are helpful for the application of the MCR in producing drinking water and also beneficial to the research and application of other coagulation and membrane separation hybrid processes. Copyright © 2016. Published by Elsevier B.V.

  17. A Computational Study of Internal Flows in a Heated Water-Oil Emulsion Droplet

    KAUST Repository

    Sim, Jaeheon

    2015-01-05

    The vaporization characteristics of water-oil emulsion droplets are investigated by high fidelity computational simulations. One of the key objectives is to identify the physical mechanism for the experimentally observed behavior that the component in the dispersed micro-droplets always vaporizes first, for both oil-in-water and water-in-oil emulsion droplets. The mechanism of this phenomenon has not been clearly understood. In this study, an Eulerian-Lagrangian method was implemented with a temperature-dependent surface tension model and a dynamic adaptive mesh refinement in order to effectively capture the thermo-capillary effect of a micro-droplet in an emulsion droplet efficiently. It is found that the temperature difference in an emulsion droplet creates a surface tension gradient along the micro-droplet surface, inducing surface movement. Subsequently, the outer shear flow and internal flow circulation inside the droplet, referred to as the Marangoni convection, are created. The present study confirms that the Marangoni effect can be sufficiently large to drive the micro-droplets to the emulsion droplet surface at higher temperature, for both water-in-oil and oil-and-water emulsion droplets. A further parametric study with different micro-droplet sizes and temperature gradients demonstrates that larger micro-droplets move faster with larger temperature gradient. The oil micro-droplet in oil-in-water emulsion droplets moves faster due to large temperature gradients by smaller thermal conductivity.

  18. Low internal pressure in femtoliter water capillary bridges reduces evaporation rates.

    Science.gov (United States)

    Cho, Kun; Hwang, In Gyu; Kim, Yeseul; Lim, Su Jin; Lim, Jun; Kim, Joon Heon; Gim, Bopil; Weon, Byung Mook

    2016-03-01

    Capillary bridges are usually formed by a small liquid volume in a confined space between two solid surfaces. They can have a lower internal pressure than the surrounding pressure for volumes of the order of femtoliters. Femtoliter capillary bridges with relatively rapid evaporation rates are difficult to explore experimentally. To understand in detail the evaporation of femtoliter capillary bridges, we present a feasible experimental method to directly visualize how water bridges evaporate between a microsphere and a flat substrate in still air using transmission X-ray microscopy. Precise measurements of evaporation rates for water bridges show that lower water pressure than surrounding pressure can significantly decrease evaporation through the suppression of vapor diffusion. This finding provides insight into the evaporation of ultrasmall capillary bridges.

  19. Low internal pressure in femtoliter water capillary bridges reduces evaporation rates

    Science.gov (United States)

    Cho, Kun; Hwang, In Gyu; Kim, Yeseul; Lim, Su Jin; Lim, Jun; Kim, Joon Heon; Gim, Bopil; Weon, Byung Mook

    2016-01-01

    Capillary bridges are usually formed by a small liquid volume in a confined space between two solid surfaces. They can have a lower internal pressure than the surrounding pressure for volumes of the order of femtoliters. Femtoliter capillary bridges with relatively rapid evaporation rates are difficult to explore experimentally. To understand in detail the evaporation of femtoliter capillary bridges, we present a feasible experimental method to directly visualize how water bridges evaporate between a microsphere and a flat substrate in still air using transmission X-ray microscopy. Precise measurements of evaporation rates for water bridges show that lower water pressure than surrounding pressure can significantly decrease evaporation through the suppression of vapor diffusion. This finding provides insight into the evaporation of ultrasmall capillary bridges. PMID:26928329

  20. Rainfall simulation and Structure-from-Motion photogrammetry for the analysis of soil water erosion in Mediterranean vineyards

    NARCIS (Netherlands)

    Prosdocimi, Massimo; Burguet, Maria; Prima, Di Simone; Sofia, Giulia; Terol, Enric; Rodrigo Comino, Jesús; Cerda Bolinches, Artemio; Tarolli, Paolo

    2017-01-01

    Soil water erosion is a serious problem, especially in agricultural lands. Among these, vineyards deserve attention, because they constitute for the Mediterranean areas a type of land use affected by high soil losses. A significant problem related to the study of soil water erosion in these areas

  1. Internal flow and evaporation characteristic inside a water droplet on a vertical vibrating hydrophobic surface

    International Nuclear Information System (INIS)

    Kim Hun; Lim, Hee Chang

    2015-01-01

    This study aims to understand the internal flow and the evaporation characteristics of a deionized water droplet subjected to vertical forced vibrations. To predict and evaluate its resonance frequency, the theories of Lamb, Strani, and Sabetta have been applied. To visualize the precise mode, shape, and internal flow inside a droplet, the experiment utilizes a combination of a high-speed camera, macro lens, and continuous laser. As a result, a water droplet on a hydrophobic surface has its typical shape at each mode, and complicated vortices are observed inside the droplet. In particular, large symmetrical flow streams are generated along the vertical axis at each mode, with a large circulating movement from the bottom to the top and then to the triple contact line along the droplet surface. In addition, a bifurcation-shaped flow pattern is formed at modes 2 and 4, whereas a large ellipsoid-shape flow pattern forms at modes 6 and 8. Mode 4 has the fastest internal flow speed and evaporation rate, followed by modes 8 then 6, with 2 having the slowest of these properties. Each mode has the fastest evaporation rate amongst its neighboring frequencies. Finally, the droplet evaporation under vertical vibration would lead to more rapid evaporation, particularly for mode 4

  2. Internal flow and evaporation characteristic inside a water droplet on a vertical vibrating hydrophobic surface

    Energy Technology Data Exchange (ETDEWEB)

    Kim Hun; Lim, Hee Chang [School of Mechanical Engineering, Pusan National University, Busan (Korea, Republic of)

    2015-07-15

    This study aims to understand the internal flow and the evaporation characteristics of a deionized water droplet subjected to vertical forced vibrations. To predict and evaluate its resonance frequency, the theories of Lamb, Strani, and Sabetta have been applied. To visualize the precise mode, shape, and internal flow inside a droplet, the experiment utilizes a combination of a high-speed camera, macro lens, and continuous laser. As a result, a water droplet on a hydrophobic surface has its typical shape at each mode, and complicated vortices are observed inside the droplet. In particular, large symmetrical flow streams are generated along the vertical axis at each mode, with a large circulating movement from the bottom to the top and then to the triple contact line along the droplet surface. In addition, a bifurcation-shaped flow pattern is formed at modes 2 and 4, whereas a large ellipsoid-shape flow pattern forms at modes 6 and 8. Mode 4 has the fastest internal flow speed and evaporation rate, followed by modes 8 then 6, with 2 having the slowest of these properties. Each mode has the fastest evaporation rate amongst its neighboring frequencies. Finally, the droplet evaporation under vertical vibration would lead to more rapid evaporation, particularly for mode 4.

  3. IWRM: for sustainable use of water; 50 years of international experience with the concept of integrated water resources management; background document to the FAO/Netherlands conference on water for food an ecosystems, The Hague, 31 January - 5 February 2005

    NARCIS (Netherlands)

    Snellen, W.B.; Schrevel, A.

    2004-01-01

    Since the concept was explained in detail at the Dublin Conference in 1992 (International Conference on Water and the Environment: Development Issues for the 21st Century), Integrated Water Resources Management has been at the core of thinking on water resource development. Today, integrated water

  4. Gender and water from a human rights perspective : The role of context in translating international norms into local action

    OpenAIRE

    SINGH, Nandita; Åström, Karsten; Wickenberg, Per; Hydén, Håkan

    2008-01-01

    An important area in the discourse on gender and water is water supply where women are seen as the key actors and beneficiaries. A human rights approach to development has been adopted with access to safe water explicitly recognized as a basic human right. This right places a legal obligation upon governments to translate the international norms into practice. But does explicitly acknowledging the human right to water make a practical difference in women's lives? Using an actor-oriented persp...

  5. Cogeneration of Electricity and Potable Water Using The International Reactor Innovative And Secure (IRIS) Design

    International Nuclear Information System (INIS)

    Ingersoll, D.T.; Binder, J.L.; Kostin, V.I.; Panov, Y.K.; Polunichev, V.; Ricotti, M.E.; Conti, D.; Alonso, G.

    2004-01-01

    The worldwide demand for potable water has been steadily growing and is projected to accelerate, driven by a continued population growth and industrialization of emerging countries. This growth is reflected in a recent market survey by the World Resources Institute, which shows a doubling in the installed capacity of seawater desalination plants every ten years. The production of desalinated water is energy intensive, requiring approximately 3-6 kWh/m3 of produced desalted water. At current U.S. water use rates, a dedicated 1000 MW power plant for every one million people would be required to meet our water needs with desalted water. Nuclear energy plants are attractive for large scale desalination application. The thermal energy produced in a nuclear plant can provide both electricity and desalted water without the production of greenhouse gases. A particularly attractive option for nuclear desalination is to couple a desalination plant with an advanced, modular, passively safe reactor design. The use of small-to-medium sized nuclear power plants allows for countries with smaller electrical grid needs and infrastructure to add new electrical and water capacity in more appropriate increments and allows countries to consider siting plants at a broader number of distributed locations. To meet these needs, a modified version of the International Reactor Innovative and Secure (IRIS) nuclear power plant design has been developed for the cogeneration of electricity and desalted water. The modular, passively safe features of IRIS make it especially well adapted for this application. Furthermore, several design features of the IRIS reactor will ensure a safe and reliable source of energy and water even for countries with limited nuclear power experience and infrastructure. The IRIS-D design utilizes low-quality steam extracted from the low-pressure turbine to boil seawater in a multi-effect distillation desalination plant. The desalination plant is based on the horizontal

  6. Biological effects of tritium on fish cells in the concentration range of international drinking water standards.

    Science.gov (United States)

    Stuart, Marilyne; Festarini, Amy; Schleicher, Krista; Tan, Elizabeth; Kim, Sang Bog; Wen, Kendall; Gawlik, Jilian; Ulsh, Brant

    2016-10-01

    To evaluate whether the current Canadian tritium drinking water limit is protective of aquatic biota, an in vitro study was designed to assess the biological effects of low concentrations of tritium, similar to what would typically be found near a Canadian nuclear power station, and higher concentrations spanning the range of international tritium drinking water standards. Channel catfish peripheral blood B-lymphoblast and fathead minnow testis cells were exposed to 10-100,000 Bq l(-1) of tritium, after which eight molecular and cellular endpoints were assessed. Increased numbers of DNA strand breaks were observed and ATP levels were increased. There were no increases in γH2AX-mediated DNA repair. No differences in cell growth were noted. Exposure to the lowest concentrations of tritium were associated with a modest increase in the viability of fathead minnow testicular cells. Using the micronucleus assay, an adaptive response was observed in catfish B-lymphoblasts. Using molecular endpoints, biological responses to tritium in the range of Canadian and international drinking water standards were observed. At the cellular level, no detrimental effects were noted on growth or cycling, and protective effects were observed as an increase in cell viability and an induced resistance to a large challenge dose.

  7. Proceedings of the Fourteenth International Symposium on Water-Rock Interaction

    Energy Technology Data Exchange (ETDEWEB)

    Hellmann, Roland [Institute for Earth Sciences - ISTerre, CNRS UMR 5275 Grenoble (France); Pitsch, Helmut [IRSN, DSDP, SPIIC, BP17, 92262 Fontenay-aux-Roses Cedex (France)

    2013-07-01

    The 14. edition of the International Symposium on Water-Rock Interaction was held from 9-14 June 2013 in the Palais des Papes in the historic city of Avignon, located in southeastern France. As is the tradition with WRI symposia, earth scientists and guests from around the world convened over a week's time to exchange the latest ideas, advances, and data covering some of the most important aspects of rock-water interactions. The research that was presented in both oral and poster format covered studies derived from experimental and laboratory work, modeling and theoretical approaches, and field measurements. The presentations at the symposium showed the immense range of conditions associated with natural, experimental, and theoretical rock-water systems, encompassing a wide range of pH, as well as temperature and pressure conditions ranging from ambient to beyond the critical point of water. In addition, as can be evidenced from the presentations, many water-rock systems are increasingly being described in terms of control by both abiotic and biogeochemical processes. Advances in fundamental WRI research are also making significant contributions to better understanding current environmental problems, which are quite often highlighted in today's media headlines. Reflecting the importance of these environmental and societal challenges, an important number of presentations in this symposium described the current state of the knowledge concerning acid mine drainage, geological CO{sub 2} sequestration, shale gas extraction, aquifer salinization and diminishing potable water resources, and nuclear waste storage. Some 260 manuscripts were submitted to WRI-14 by scientists from 37 countries. Each manuscript was peer reviewed for scientific content by two reviewers. In the end, 230 manuscripts were accepted for either oral or poster presentation at the symposium. Each one of these papers can be found in this special symposium volume. The WRI-14 symposium has been

  8. Proceedings of the Fourteenth International Symposium on Water-Rock Interaction

    International Nuclear Information System (INIS)

    Hellmann, Roland; Pitsch, Helmut

    2013-01-01

    The 14. edition of the International Symposium on Water-Rock Interaction was held from 9-14 June 2013 in the Palais des Papes in the historic city of Avignon, located in southeastern France. As is the tradition with WRI symposia, earth scientists and guests from around the world convened over a week's time to exchange the latest ideas, advances, and data covering some of the most important aspects of rock-water interactions. The research that was presented in both oral and poster format covered studies derived from experimental and laboratory work, modeling and theoretical approaches, and field measurements. The presentations at the symposium showed the immense range of conditions associated with natural, experimental, and theoretical rock-water systems, encompassing a wide range of pH, as well as temperature and pressure conditions ranging from ambient to beyond the critical point of water. In addition, as can be evidenced from the presentations, many water-rock systems are increasingly being described in terms of control by both abiotic and biogeochemical processes. Advances in fundamental WRI research are also making significant contributions to better understanding current environmental problems, which are quite often highlighted in today's media headlines. Reflecting the importance of these environmental and societal challenges, an important number of presentations in this symposium described the current state of the knowledge concerning acid mine drainage, geological CO 2 sequestration, shale gas extraction, aquifer salinization and diminishing potable water resources, and nuclear waste storage. Some 260 manuscripts were submitted to WRI-14 by scientists from 37 countries. Each manuscript was peer reviewed for scientific content by two reviewers. In the end, 230 manuscripts were accepted for either oral or poster presentation at the symposium. Each one of these papers can be found in this special symposium volume. The WRI-14 symposium has been

  9. Stress Corrosion Evaluation of Nitinol 60 for the International Space Station Water Recycling System

    Science.gov (United States)

    Torres, P. D.

    2016-01-01

    A stress corrosion cracking (SCC) evaluation of Nitinol 60 was performed because this alloy is considered a candidate bearing material for the Environmental Control and Life Support System (ECLSS), specifically in the Urine Processing Assembly of the International Space Station. An SCC evaluation that preceded this one during the 2013-2014 timeframe included various alloys: Inconel 625, Hastelloy C-276, titanium (Ti) commercially pure (CP), Ti 6Al-4V, extra-low interstitial (ELI) Ti 6Al-4V, and Cronidur 30. In that evaluation, most specimens were exposed for a year. The results of that evaluation were published in NASA/TM-2015-218206, entitled "Stress Corrosion Evaluation of Various Metallic Materials for the International Space Station Water Recycling System,"1 available at the NASA Scientific and Technical Information program web page: http://www.sti.nasa.gov. Nitinol 60 was added to the test program in 2014.

  10. Total internal reflection second-harmonic generation: probing the alkane water interface

    International Nuclear Information System (INIS)

    Conboy, J.C.; Daschbach, J.L.; Richmond, G.L.

    1994-01-01

    Total internal reflection Second-Harmonic Generation (SHG) has been used to study a series of neat n-alkane/water interfaces. Polarization and incident angular-dependent measurements of the SH response show good agreement with theoretical predictions. Analysis of the incident and polarization angular-dependent SH response allows for determination of the nonlinear optical properties of molecules comprising the interfacial region. Based on Kleinman symmetry, the measured surface nonlinear susceptibilities suggest a high degree of interfacial order for octane and decane with less order indicated by the odd carbon n-alkanes examined, heptane and nonane. The SH response in reflection and transmission has been measured under a Total Internal Reflection (TIR) of the fundamental. The measured nonlinear susceptibilities in each case are found to be identical. (orig.)

  11. Global Energy and Water Cycle Experiment (GEWEX) and the Continental-scale International Project (GCIP)

    Science.gov (United States)

    Vane, Deborah

    1993-01-01

    A discussion of the objectives of the Global Energy and Water Cycle Experiment (GEWEX) and the Continental-scale International Project (GCIP) is presented in vugraph form. The objectives of GEWEX are as follows: determine the hydrological cycle by global measurements; model the global hydrological cycle; improve observations and data assimilation; and predict response to environmental change. The objectives of GCIP are as follows: determine the time/space variability of the hydrological cycle over a continental-scale region; develop macro-scale hydrologic models that are coupled to atmospheric models; develop information retrieval schemes; and support regional climate change impact assessment.

  12. International Space Station (ISS) Potable Water Dispenser (PWD) Beverage Adapter (BA) Redesign

    Science.gov (United States)

    Edgerly, Rachel; Benoit, Jace; Shindo, David

    2012-01-01

    The Potable Water Dispenser used on the International Space Station (ISS) interfaces with food and drink packages using the Beverage Adapter and Needle. Unexpected leakage has been seen in this interface. The Beverage Adapter used on ]orbit was returned to the ground for Test, Teardown, and Evaluation. The results of that investigation prompted a redesign of the Beverage Adapter and Needle. The Beverage Adapter materials were changed to be more corrosion resistant, and the Needle was redesigned to preclude leakage. The redesigns have been tested and proven.

  13. High power cable with internal water cooling 400 kV

    Science.gov (United States)

    Rasquin, W.; Harjes, B.

    1982-08-01

    Due to the concentration of electricity production in large power plants, the need of higher power transmissions, and the protection of environment, developement of a 400 kV water cooled cable in the power range of 1 to 5 GVA was undertaken. The fabrication and testing of equipment, engineering of cable components, fabrication of a test cable, development of cable terminal laboratory, testing of test cable, field testing of test cable, fabrication of industrial cable laboratory, testing of industrial cable, field testing of industrial cable, and system analysis for optimization were prepared. The field testing was impossible to realize. However, it is proved that a cable consisting of an internal stainless steel water cooled tube, covered by stranded copper profiles, insulated with heavy high quality paper, and protected by an aluminum cover can be produced, withstand tests accordingly to IEC/VDE recommendations, and is able to fulfill all exploitation conditions.

  14. International academic program in technologies of light-water nuclear reactors. Phases of development and implementation

    International Nuclear Information System (INIS)

    Geraskin, N I; Glebov, V B

    2017-01-01

    The results of implementation of European educational projects CORONA and CORONA II dedicated to preserving and further developing nuclear knowledge and competencies in the area of technologies of light-water nuclear reactors are analyzed. Present article addresses issues of design and implementation of the program for specialized training in the branch of technologies of light-water nuclear reactors. The systematic approach has been used to construct the program for students of nuclear specialties, which corresponding to IAEA standards and commonly accepted nuclear principles recognized in the European Union. Possibilities of further development of the international cooperation between countries and educational institutions are analyzed. Special attention is paid to e-learning/distance training, nuclear knowledge preservation and interaction with European Nuclear Education Network. (paper)

  15. Cabri - water loop a new IPSN-OECD international research program

    International Nuclear Information System (INIS)

    Anon.

    2001-01-01

    In 1993, the Institut de Protection et de Surete Nucleaire (IPSN, the French Nuclear Safety and Radiation Protection Institute) working with EDF (electric utilities) and backed by the NRC (Nuclear Regulatory Commission, USA) launched a research program, dubbed Cabri REP Na addressing uranium oxide-based fuels and MOX fuels. So far twelve tests have been conducted including eight on UO 2 fuel and four on MOX fuel. More testing is now required to determine fuel performance at higher specific burn-up levels in typical PWR (Pressurized Water Reactor) conditions, the purpose being to determine the acceptance criteria for tomorrow's fuels. IPSN has defined a new research program for the Cabri reactor. The OECD's Nuclear Energy Agency is quarterbacking the international program called 'Cabri-Water Loop'. (authors)

  16. An Evaluation of Technology to Remove Problematic Organic Compounds from the International Space Station Potable Water

    Science.gov (United States)

    Rector, Tony; Metselaar, Carol; Peyton, Barbara; Steele, John; Michalek, William; Bowman, Elizabeth; Wilson, Mark; Gazda, Daniel; Carter, Layne

    2014-01-01

    Since activation of the Water Processor Assembly (WPA) on the International Space Station (ISS) in November of 2008, there have been three events in which the TOC (Total Organic Carbon) in the product water has increased to approximately 3 mg/L and has subsequently recovered. Analysis of the product water in 2010 identified the primary component of the TOC as dimethylsilanediol (DMSD). An investigation into the fate of DMSD in the WPA ultimately determined that replacement of both Multifiltration (MF) Beds is the solution to recovering product water quality. The MF Beds were designed to ensure that ionic breakthrough occurs before organic breakthrough. However, DMSD saturated both MF Beds in the series, requiring removal and replacement of both MF Beds with significant life remaining. Analysis of the MF Beds determined that the adsorbent was not effectively removing DMSD, trimethylsilanol, various polydimethylsiloxanes, or dimethylsulfone. Coupled with the fact that the current adsorbent is now obsolete, the authors evaluated various media to identify a replacement adsorbent as well as media with greater capacity for these problematic organic contaminants. This paper provides the results and recommendations of this collaborative study.

  17. Evaluation of Electrochemically Generated Potable Water Disinfectants for Use on the International Space Station

    Science.gov (United States)

    Rodriquez, Branelle; Anderson, Molly; Adams, Niklas; Vega, Leticia; Botkin, Douglas

    2013-01-01

    Microbial contamination and subsequent growth in spacecraft water systems are constant concerns for missions involving human crews. The current potable water disinfectant for the International Space Station (ISS) is iodine; however, with the end of the Space Shuttle Program, there is a need to develop redundant biocide systems that do not require regular up-mass dependencies. Throughout the course of a year, four different electrochemical systems were investigated as a possible biocide for potable water on the ISS. Research has indicated that a wide variability exists with regards to efficacy in both concentration and exposure time of these disinfectants; therefore, baseline efficacy values were established. This paper describes a series of tests performed to establish optimal concentrations and exposure times for four disinfectants against single and mixed species planktonic and biofilm bacteria. Results of the testing determined whether these electrochemical disinfection systems are able to produce a sufficient amount of chemical in both concentration and volume to act as a biocide for potable water on the ISS.

  18. Pengaruh Usia dan Masa Kerja Terhadap Produktivitas Kerja (Studi Kasus: PT. OASIS Water International Cabang Palembang

    Directory of Open Access Journals (Sweden)

    Selvia Aprilyanti

    2017-12-01

    Full Text Available Age and years of service are factors directly related to work productivity. Age and employment perceived by employees can decrease productivity or increase employee productivity. This research was conducted at PT. Oasis Water International Palembang Branch and aims to determine the influence of Age and Duration of employment on employee productivity. The number of sample is 27 respondents by using random sampling technique. Analysis method used is multiple linear regression method using SPSS aid which includes t test and F test. As independent variable (independent, that is age and work period, while dependent variable is work productivity. The result of data analysis showed that the variable of age and duration of work did not have a positive effect on work productivity, where the probability value of F test of significance value for the effect of age and work period simultaneously to productivity was 0.355 > 0.05 and F value count 1.083 Water International.

  19. International approaches to the hydraulic control of surface water runoff in mitigating flood and environmental risks

    Directory of Open Access Journals (Sweden)

    Ballard Bridget Woods

    2016-01-01

    Full Text Available This paper compares and contrasts a number of international approaches to the hydraulic control of surface water runoff from new development and redevelopment, known as sustainable drainage systems (SuDS or low impact development (LID. The paper provides a commentary on the progress and current status of national standards for SuDS in the UK to control the frequency, flow rate and volume of runoff from both frequent and extreme rainfall events, and the best practice design criteria presented in the revised UK CIRIA SuDS Manual, published in November 2015. The paper then compares these design criteria and standards with those developed and applied in China, USA, France and Germany and also looks at the drivers behind their development. The benefits of these different approaches are assessed in the context of flood risk mitigation, climate resilience and wider environmental protection objectives, including water quality, morphology and ecology. The paper also reviews the design approaches promoted by the new SuDS Manual and internationally for delivering additional benefits for urban spaces (such as recreation, visual character, education and economic growth through multi-functional urban design.

  20. Development of inspection and evaluation guidelines for light water reactor internals

    International Nuclear Information System (INIS)

    Aoki, T.; Yamashita, H.; Sakai, K.

    2002-01-01

    reasonable and clarify the technical reasons or rationale to obtain the public acceptance. This is essential not only to plant operation management but also to fulfilling the accountability for the standard rules. Based on the understanding described above, the Thermal and Nuclear Power Engineering Society (TENPES) has organized a committee named 'The Committee on Inspection and Evaluation Guidelines for Light Water Reactor Internals' to develop the guidelines necessary for the inspection, evaluation and repair of PWR and BWR reactor internals. The outline of the guidelines developed by the TENPES committee is presented herein. (author)

  1. A Dynamic Model for Roll Motion of Ships Due to Flooding

    DEFF Research Database (Denmark)

    Xia, Jinzhu; Jensen, Jørgen Juncher; Pedersen, Preben Terndrup

    1997-01-01

    A dynamic model is presented of the roll motion of damaged RoRo vessels which couples the internal cross-flooding flow and the air action in the equalizing compartment. The cross flooding flow and the air motion are modelled by a modified Bernoulli equation, where artificial damping is introduced...... to avoid modal instability based on the original Bernoulli equation. The fluid action of the flooded water on the ship is expressed by its influence on the moment of inertia of the ship and the heeling moment, which is a couple created by the gravitational force of the flooded water and the change...... of buoyancy of the ship.Two limiting flooding cases are examined in the present analysis: The sudden ingress of a certain amount of water to the damaged compartment with no further water exchange between the sea and the flooded compartment during the roll motion, and the continuous ingress of water through...

  2. In situ-observation of the vertical motion of soil waters by means of deuterated water using the gamma/neutron method: Laboratory and field

    International Nuclear Information System (INIS)

    Moutonnet, P.; Couchat, P.; Brissaud, F.; Puard, M.; Pappalardo, A.

    1978-01-01

    In order to study water movements in the field, the gamma/neutron method for measuring deuterated water was investigated. A laboratory device is presented which supplies measurements on 5 ml soil solution samples. A probe for in situ experiments is studied in all its performances: Background, calibration (count rate versus volumetric deuterated water content) and resolution. A dispersive transport of D 2 O pulses on soil column is presented and checked with a numerical simulation model. Then simultaneous measurement of soil water content and D 2 O concentration by neutron moisture gauge and gamma/neutron probe enable us to interpret the evolution of D 2 O pulse with an experimental field irrigation. (orig.) [de

  3. 19 CFR 210.15 - Motions.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Motions. 210.15 Section 210.15 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Motions § 210.15 Motions. (a) Presentation and disposition. (1) During the period...

  4. Drilling in troubled waters. For an international regulation on offshore gas and oil activities

    International Nuclear Information System (INIS)

    Rochette, Julien

    2014-01-01

    Due to an increased energy demand, offshore activities are being extended to deep and ultra-deep waters: nearly one third of consumed oil and one quarter of consumed gas come from offshore drilling. This development threatens the environment and natural resources, and may have an impact on human activities which depend on the concerned ecosystems. As some accident had cross-border consequences, the relevance of the international regulatory framework is put into question again. This article first outlines the incomplete character of the legal framework for the safety of offshore activities: uncoordinated national systems, lack of an international convention, fragmented regional initiatives (some agreements exist for some specific regions: Arctic Sea, Baltic Sea, Mediterranean Sea, North-Eastern Atlantic, Persic Gulf and Oman Sea, Africa, western Indian Ocean). The author outlines that there is no international rules regarding responsibility and compensations. While highlighting the risks of a status-quo on these different issues, the author proposes and discusses a set of recommendations aimed at strengthening the regulation of offshore drilling activities

  5. Projects for People: An International Exchange Focused on Drinking Water Quality in Rural Peru

    Science.gov (United States)

    Weathers, T. S.; Tarazona Vasquez, F.; Bailey, E.; Duong, V.; Gonzales Vera, R.; LaPorte, D.; Rojas Cala, B.; Torres Atencia, S.; Vasquez Auqui, J.

    2016-12-01

    The integration of human-centered design with technical engineering in a classroom setting can be challenging but immensely rewarding if coupled with a community-focused experience. Undergraduate students participated in an international exchange to address drinking water quality in the community of Huamancaca, located in the Junin region of Peru. Technical research and experimentation often comes easily to students in undergraduate engineering programs, however, implementation within a community requires a social license to operate. The objectives of this study were to address the technical challenges of designing a sustainable and effective water filtration system while also ensuring community support and education, coupled with user ownership of the process. In tandem with filter media experimentation with biochar and activated carbon produced using locally available agricultural waste from potatoes and carrots, we visited the people of Huamancaca to understand their needs and concerns. This direct communication with the community was invaluable; we observed that many of the residents' water quality problems could be solved with education. For example, proper sanitation techniques and appropriate addition of bleach or sufficient boiling time may make up for inconsistent water quality provided by the local distribution system. An education plan may also be developed for water treatment plant operators covering chlorine dosage for effective residual treatment within the distribution network in addition to filtration. Upon site visitation and sample collection, we realized that open communication with city officials, operators, business owners, and residents in both technical and social settings is essential for continued collaboration within this community. Solving a tangible problem or designing a product that can be effectively adopted is not a concept that is rigorously addressed in undergraduate education, however the setbacks, challenges, and triumphs

  6. Design of a supercritical water-cooled reactor. Pressure vessel and internals

    Energy Technology Data Exchange (ETDEWEB)

    Fischer, Kai

    2008-08-15

    The High Performance Light Water Reactor (HPLWR) is a light water reactor with supercritical steam conditions which has been investigated within the 5th Framework Program of the European Commission. Due to the supercritical pressure of 25 MPa, water, used as moderator and as coolant, flows as a single phase through the core and can be directly fed to the turbine. Using the technology of coal fired power plants with supercritical steam conditions, the heat-up in the core is done in several steps to achieve the targeted high steam outlet temperature of 500.C without exceeding available cladding material limits. Based on a first design of a fuel assembly cluster for a HPLWR with a single pass core, the surrounding internals and the reactor pressure vessel (RPV) are dimensioned for the first time, following the safety standards of the nuclear safety standards commission in Germany. Furthermore, this design is extended to the incorporation of core arrangements with two and three passes. The design of the internals and the RPV are verified using mechanical or, in the case of large thermal deformations, combined mechanical and thermal stress analyses. Additionally, a passive safety component for the feedwater inlet of the RPV of the HPLWR is designed. Its purpose is the reduction of the mass flow rate in case of a LOCA for a feedwater line break until further steps are executed. Starting with a simple vortex diode, several steps are executed to enhance the performance of the diode and adapt it to this application. Then, this first design is further optimized using combined 1D and 3D flow analyses. Parametric studies determine the performance and characteristic for changing mass flow rates for this backflow limiter. (orig.)

  7. Radiation methods for purification of water, wastewater and flue gases at international chemical congress of Pacific basic societies

    International Nuclear Information System (INIS)

    Pikaev, A.K.

    1996-01-01

    Content of report, presented at the symposium Ecological applications of ionizing radiation (water, waste water and technological waste products), which took place within the frames of the International Chemical Congress of the Pacific Ocean Region counters (the PacifiChem'95, December 17-22, 1995, Honolulu, Hawaii, USA) is briefly presented. The problems on electron-radiation purification of natural water, domestic and technological waste waters, flue gases and contaminated soils, radiation treatment of the waste water sediments, ionizing radiation sources, applied in this area of technology and economics of radiation purification methods were discussed

  8. Effect of Leaf Water Potential on Internal Humidity and CO2 Dissolution: Reverse Transpiration and Improved Water Use Efficiency under Negative Pressure.

    Science.gov (United States)

    Vesala, Timo; Sevanto, Sanna; Grönholm, Tiia; Salmon, Yann; Nikinmaa, Eero; Hari, Pertti; Hölttä, Teemu

    2017-01-01

    The pull of water from the soil to the leaves causes water in the transpiration stream to be under negative pressure decreasing the water potential below zero. The osmotic concentration also contributes to the decrease in leaf water potential but with much lesser extent. Thus, the surface tension force is approximately balanced by a force induced by negative water potential resulting in concavely curved water-air interfaces in leaves. The lowered water potential causes a reduction in the equilibrium water vapor pressure in internal (sub-stomatal/intercellular) cavities in relation to that over water with the potential of zero, i.e., over the flat surface. The curved surface causes a reduction also in the equilibrium vapor pressure of dissolved CO 2 , thus enhancing its physical solubility to water. Although the water vapor reduction is acknowledged by plant physiologists its consequences for water vapor exchange at low water potential values have received very little attention. Consequences of the enhanced CO 2 solubility to a leaf water-carbon budget have not been considered at all before this study. We use theoretical calculations and modeling to show how the reduction in the vapor pressures affects transpiration and carbon assimilation rates. Our results indicate that the reduction in vapor pressures of water and CO 2 could enhance plant water use efficiency up to about 10% at a leaf water potential of -2 MPa, and much more when water potential decreases further. The low water potential allows for a direct stomatal water vapor uptake from the ambient air even at sub-100% relative humidity values. This alone could explain the observed rates of foliar water uptake by e.g., the coastal redwood in the fog belt region of coastal California provided the stomata are sufficiently open. The omission of the reduction in the water vapor pressure causes a bias in the estimates of the stomatal conductance and leaf internal CO 2 concentration based on leaf gas exchange

  9. Development of Urban Inundation Warning Model at Cyclic Artificial Water Way in Song-do International City, Republic of Korea

    Science.gov (United States)

    Lee, T.; Lee, C.; Kim, H.

    2016-12-01

    Abstract Song-do international city was constructed by reclaiming land from the coastal waters of Yeonsu-gu, Incheon Metropolitan City, Republic of Korea. The □-shaped cyclic artificial water way has been considered for improving water quality, waterfront and internal drainage in Song-do international city. By improving water quality, various marine facilities, such as marina, artificial beach, marine terminal, and so on, will be set up around the artificial water way for the waterfront. Since the water stage of the artificial water way changes depending on water gates operations, it is necessary to develop an urban inundation warning model to evaluate safeties of the waterfront facilities and its passengers. By considering characteristics of urban watershed, we calculate discharge flowing into the water way using XP-SWMM model. As a result of estimating 100-year flood frequency, although there are slight differences in drainage sections, the maximum flood discharge occurs in 90-min rainfall duration. In order to consider impacts of tide and hydraulic structure, we establish Inland drainage plans through the analysis of unsteady flow using HEC-RAS. The urban inundation warning model is configured to issue a warning when the water plain elevation exceeds EL. 1.5m which is usually managed at EL. 1.0m. In this study, the design flood stage of artificial water way and urban inundation warning model are developed for Song-do international city, and therefore it is expected that a reliability of management and operation of the waterfront facilities is improved. Keywords : Artificial Water Way; Waterfront; Urban Inundation Warning Model. Acknowlegement This research was supported by a grant [MPSS-NH-2015-79] through the Disaster and Safety Management Institute funded by Ministry of Public Safety and Security of Korean government.

  10. Exhaust gas heat recovery through secondary expansion cylinder and water injection in an internal combustion engine

    Directory of Open Access Journals (Sweden)

    Nassiri Toosi Ali

    2017-01-01

    Full Text Available To enhance thermal efficiency and increase performance of an internal combustion engine, a novel concept of coupling a conventional engine with a secondary 4-stroke cylinder and direct water injection process is proposed. The burned gases after working in a traditional 4-stroke combustion cylinder are transferred to a secondary cylinder and expanded even more. After re-compression of the exhaust gases, pre-heated water is injected at top dead center. The evaporation of injected water not only recovers heat from exhaust gases, but also increases the mass of working gas inside the cylinder, therefore improves the overall thermal efficiency. A 0-D/1-D model is used to numerically simulate the idea. The simulations outputs showed that the bottoming cycle will be more efficient at higher engines speeds, specifically in a supercharged/turbocharged engine, which have higher exhaust gas pressure that can reproduce more positive work. In the modeled supercharged engine, results showed that brake thermal efficiency can be improved by about 17%, and brake power by about 17.4%.

  11. [Verification of ballast water exchange for international ships anchored in Xiamen Port by CDOM tracer].

    Science.gov (United States)

    Li, Chao; Zhang, Yan-po; Guo, Wei-dong; Zhu, Yue; Xu, Jing; Deng, Xun

    2010-09-01

    Fluorescence excitation-emission matrix (EEM) and absorption spectroscopy were applied to study the optical properties of 29 CDOM samples collected from different ballast tanks of nine international route vessels anchored in Xiamen Port between October 2007 and April 2008. The purpose was to examine the feasibility of these spectral properties as a tracer to verify if these vessels follow the mid-ocean ballast water exchange (BWE) regulation. Using parallel factor analysis, four fluorescent components were identified, including two humic-like components (C1: 245, 300/386 nm; C2: 250, 345/458 nm) and two protein-like components (C3: 220, 275/306 nm; C4: 235, 290/345 nm), of which C2 component was the suitable fluorescence verification indicator. The vertical distribution of all fluorescent components in ballast tank was nearly similar indicating that profile-mixing sampling was preferable. Combined use of C2 component, spectral slope ratio (SR) of absorption spectroscopy and salinity may provide reasonable verification if BWE carried out by these nine ships. The results suggested that the combined use of multiple parameters (fluorescence, absorption and salinity) would be much reliable to determine the origin of ballast water, and to provide the technical guarantee for fast examination of ballast water exchange in Chinese ports.

  12. Cone-beam computed tomography internal motion tracking should be used to validate 4-dimensional computed tomography for abdominal radiation therapy patients

    DEFF Research Database (Denmark)

    Rankine, Leith; Wan, Hanlin; Parikh, Parag

    2016-01-01

    Purpose To demonstrate that fiducial tracking during pretreatment Cone-Beam CT (CBCT) can accurately measure tumor motion and that this method should be used to validate 4-dimensional CT (4DCT) margins before each treatment fraction. Methods and Materials For 31 patients with abdominal tumors and...

  13. Temporomandibular joint motion

    International Nuclear Information System (INIS)

    Maeda, M.; Kawamura, Y.; Matsuda, T.; Itou, S.; Odori, T.; Ishii, Y.; Torizuka, K.

    1990-01-01

    This paper evaluates MR imaging with the therapeutic effect after splint therapy in internal derangement of the temporomandibular joint (TMJ). Fifteen patients (19 TMJs) with internal derangement of the TMJ and five normal volunteers (10 TMJs) were examined with sagittal T1-weighted spin-echo and gradient recalled acquisition in a steady state (GRASS) MR imaging. MR studies of the patients undergoing splint therapy were performed with an without splints. Pseudodynamic images of TMJ motion provide information that was not available from spin-echo T1-weighted images

  14. The Role of Technology Spillovers in the Process of Water Pollution Abatement for Large International Firms

    Directory of Open Access Journals (Sweden)

    Luigi Aldieri

    2017-05-01

    Full Text Available The objective of this paper is to analyze the effects of technology externalities stemming from different technological sectors for international firms engaged both in water pollution abatement and in dirty activities. We present a theoretical framework and an empirical analysis based upon a dataset composed of worldwide R&D-intensive firms. In order to identify the technological proximity between the firms, we construct an original Mahalanobis environmental industry weight matrix, based on the construction of technological vectors for each firm, with European ecological patents distributed across more technology classes. Opportune econometric techniques that deal with the firms’ unobserved heterogeneity and the weak exogeneity of the explanatory variables are implemented. The findings show significant spillover effects on the productivity and environmental performance of the firms.

  15. International patent analysis of water source heat pump based on orbit database

    Science.gov (United States)

    Li, Na

    2018-02-01

    Using orbit database, this paper analysed the international patents of water source heat pump (WSHP) industry with patent analysis methods such as analysis of publication tendency, geographical distribution, technology leaders and top assignees. It is found that the beginning of the 21st century is a period of rapid growth of the patent application of WSHP. Germany and the United States had done researches and development of WSHP in an early time, but now Japan and China have become important countries of patent applications. China has been developing faster and faster in recent years, but the patents are concentrated in universities and urgent to be transferred. Through an objective analysis, this paper aims to provide appropriate decision references for the development of domestic WSHP industry.

  16. Structural analysis of steam generator internals following feed water main steam line break: DLF approach

    International Nuclear Information System (INIS)

    Bhasin, Vivek; Kushwaha, H.S.; Mahajan, S.C.; Kakodkar, A.

    1993-01-01

    In order to evaluate the possible release of radioactivity in extreme events, some postulated accidents are analysed and studied during the design stage of Steam Generator (SG). Among the various accidents postulated, the most important are Feed Water Line Break (FWLB) and Main Steam Line Break (MSLB). This report concerns with dynamic structural analysis of SG internals following FWLB/MSLB. The pressure/drag-force time histories considered were corresponding to the conditions leading to the accident of maximum potential. The SG internals were analysed using two approaches of structural dynamics. In first approach simplified DLF method was adopted. This method yields an upper bound values of stresses and deflection. In the second approach time history analysis by Mode Superposition Technique was adopted. This approach gives more realistic results. The structure was qualified as per ASME B and PV Code SecIII NB. It was concluded that in all the components except perforated flow distribution plate, the stress values based on elastic analysis are within the limits specified by ASME Code. In case of perforated flow distribution plate during the MSLB transient the stress values based on elastic analysis are higher than the ASME Code limits. Therefore, its limit load analysis had to be done. Finally, the collapse pressure evaluated using limit load analysis was shown to be within the limits of ASME B and PV Code SecIII Nb. (author). 31 refs., 94 figs., 16 tabs

  17. WATER POLO GAME-RELATED STATISTICS IN WOMEN'S INTERNATIONAL CHAMPIONSHIPS: DIFFERENCES AND DISCRIMINATORY POWER

    Directory of Open Access Journals (Sweden)

    Yolanda Escalante

    2012-09-01

    Full Text Available The aims of this study were (i to compare women's water polo game-related statistics by match outcome (winning and losing teams and phase (preliminary, classificatory, and semi-final/bronze medal/gold medal, and (ii identify characteristics that discriminate performances for each phase. The game-related statistics of the 124 women's matches played in five International Championships (World and European Championships were analyzed. Differences between winning and losing teams in each phase were determined using the chi-squared. A discriminant analysis was then performed according to context in each of the three phases. It was found that the game-related statistics differentiate the winning from the losing teams in each phase of an international championship. The differentiating variables were both offensive (centre goals, power-play goals, counterattack goal, assists, offensive fouls, steals, blocked shots, and won sprints and defensive (goalkeeper-blocked shots, goalkeeper-blocked inferiority shots, and goalkeeper-blocked 5-m shots. The discriminant analysis showed the game-related statistics to discriminate performance in all phases: preliminary, classificatory, and final phases (92%, 90%, and 83%, respectively. Two variables were discriminatory by match outcome (winning or losing teams in all three phases: goals and goalkeeper-blocked shots

  18. The stormy waters of the International Criminal Court: universal fight against impunity or liberal universalization?

    Directory of Open Access Journals (Sweden)

    Mateus Kowalski

    2014-05-01

    Full Text Available The universalistic dimension of the International Criminal Court's (ICC nature and function is clear. Yet, this dimension must be thoroughly defined. We must ask ‘what universalism’? A rational approach to international social relations is different from an ethical one. While the rational approach may lead to universalization of localized specific moral models (e.g. the liberal Western model promoting its hegemony, the ethical approach promotes diversity through considering non-reducible differences and common human phenomena in which only a minimal common ethics is universal. This paper argues that the answer to this structural question is crucial to understand if the ICC is essentially a hegemonic tool to expand the predominant Western liberal model or rather a mechanism to fight impunity acknowledging diversity and rooted on an ethical concern. We contend that the ICC is immersed in troubled waters where it is not always possible to separate a universalizing Western liberal approach from an ethical universal approach. Nevertheless, we conclude that the Court, even if partially and at times serves as tool for hegemony, is essentially defined by the universalization of the fight against impunity through reference to a minimal common ethics.

  19. Management of water hyacinth: Final meeting and international conference. Working paper submitted by the Regional Coordinator

    International Nuclear Information System (INIS)

    1981-01-01

    Full text: Final Meeting. This meeting will essentially make a terminal review of the project and register final records of work done on the various aspects, such as: - biology of the plant; - biological control; - biogas; - wastewater treatment; - papers and boards; - integrated systems, etc. We should have at the meeting a complete account of the work done in the project under each of the above headings. For example, under 'biogas' we should prepare one consolidated account of work carried out in all the three participating countries rather than individual country reports. Likewise on 'papers and boards', and the other items. To enable preparation of reports in this form there should naturally be prior consultations and contacts among the concerned investigators by correspondence and, if necessary, personal visits. These reports will then be edited and compiled by the Regional Coordinator in the form of a book or monograph on the Management of Water Hyacinth project as a whole. Contributors to chapters will be cited. International Conference. Independent of the consolidated reports, national coordinators may prepare papers for presentation at the proposed international conference. These papers could be prepared m the usual form and style for publication in international scientific journals. Although several papers could be prepared out of work done by us, we may consider the desirability of limiting the number, in order to give adequate opportunities for the other invited participants to the conference. There would be no bar on publication of these scientific papers after the conference in appropriate journals irrespective of whether a separate volume on proceedings of the conference is brought out or not. India would be happy to host the terminal review meeting to be followed by the conference. The likely period would be last week of January to first week in February, 1983. (author)

  20. Simulation of water flow in fractured porous medium by using discretized virtual internal bond

    Science.gov (United States)

    Peng, Shujun; Zhang, Zhennan; Li, Chunfang; He, Guofu; Miao, Guoqing

    2017-12-01

    The discretized virtual internal bond (DVIB) is adopted to simulate the water flow in fractured porous medium. The intact porous medium is permeable because it contains numerous micro cracks and pores. These micro discontinuities construct a fluid channel network. The representative volume of this fluid channel network is modeled as a lattice bond cell with finite number of bonds in statistical sense. Each bond serves as a fluid channel. In fractured porous medium, many bond cells are cut by macro fractures. The conductivity of the fracture facet in a bond cell is taken over by the bonds parallel to the flow direction. The equivalent permeability and volumetric storage coefficient of a micro bond are calibrated based on the ideal bond cell conception, which makes it unnecessary to consider the detailed geometry of a specific element. Such parameter calibration method is flexible and applicable to any type of element. The accuracy check results suggest this method has a satisfying accuracy in both the steady and transient flow simulation. To simulate the massive fractures in rockmass, the bond cells intersected by fracture are assigned aperture values, which are assumed random numbers following a certain distribution law. By this method, any number of fractures can be implicitly incorporated into the background mesh, avoiding the setup of fracture element and mesh modification. The fracture aperture heterogeneity is well represented by this means. The simulation examples suggest that the present method is a feasible, simple and efficient approach to the numerical simulation of water flow in fractured porous medium.

  1. Replica exchange simulation of reversible folding/unfolding of the Trp-cage miniprotein in explicit solvent: on the structure and possible role of internal water.

    Science.gov (United States)

    Paschek, Dietmar; Nymeyer, Hugh; García, Angel E

    2007-03-01

    We simulate the folding/unfolding equilibrium of the 20-residue miniprotein Trp-cage. We use replica exchange molecular dynamics simulations of the AMBER94 atomic detail model of the protein explicitly solvated by water, starting from a completely unfolded configuration. We employ a total of 40 replicas, covering the temperature range between 280 and 538 K. Individual simulation lengths of 100 ns sum up to a total simulation time of about 4 micros. Without any bias, we observe the folding of the protein into the native state with an unfolding-transition temperature of about 440 K. The native state is characterized by a distribution of root mean square distances (RMSD) from the NMR data that peaks at 1.8A, and is as low as 0.4A. We show that equilibration times of about 40 ns are required to yield convergence. A folded configuration in the entire extended ensemble is found to have a lifetime of about 31 ns. In a clamp-like motion, the Trp-cage opens up during thermal denaturation. In line with fluorescence quenching experiments, the Trp-residue sidechain gets hydrated when the protein opens up, roughly doubling the number of water molecules in the first solvation shell. We find the helical propensity of the helical domain of Trp-cage rather well preserved even at very high temperatures. In the folded state, we can identify states with one and two buried internal water molecules interconnecting parts of the Trp-cage molecule by hydrogen bonds. The loss of hydrogen bonds of these buried water molecules in the folded state with increasing temperature is likely to destabilize the folded state at elevated temperatures.

  2. Marine nitrous oxide emissions: An unknown liability for the international water sector

    International Nuclear Information System (INIS)

    Short, Michael D.; Peters, Gregory M.; Peirson, William L.; Ashbolt, Nicholas J.

    2013-01-01

    Highlights: • IPCC methodology for indirect marine nitrous oxide (N 2 O) emissions does not exist. • The water sector has an unknown N 2 O emissions liability from marine sewage disposal. • We model global sewage-nitrogen (N) emissions to coastal oceans during 1970–2050. • Emission factors for marine N 2 O will enable water sector N 2 O emissions accounting. • Industry benefits will include future revenue streams and better N emissions policy. -- Abstract: Reliable estimates of anthropogenic greenhouse gas (GHG) emissions are essential for setting effective climate policy at both the sector and national level. Current IPCC Guidelines for calculating nitrous oxide (N 2 O) emissions from sewage management are both highly uncertain and incomplete; a major methodological gap relates to the calculation of indirect N 2 O emissions from sewage disposed to marine environments. Here we apply a novel approach to estimate past and future global sewage-nitrogen emissions to coastal oceans and the potential marine N 2 O emissions linked to this nitrogen source. Then, by estimating the future cost associated with this largely uncharacterized emission source, we demonstrate the industry significance of developing a methodology for estimating N 2 O emissions from marine receiving environments. The capacity to accurately estimate, monitor and report GHG emissions has important consequences for informing future policy decisions regarding both mitigation and adaptation. A robust N 2 O emissions estimation methodology for sewage-nitrogen disposed to coastal oceans will allow the international water sector to more accurately and comprehensively inventory its N 2 O emissions. This will in turn allow for proper accounting of related future emissions liabilities while also enabling the sector to capitalize on any future economic returns linked to this source – providing much-needed capital to support the sector's future infrastructure and climate change adaptation challenges

  3. Pressure control of a proton beam-irradiated water target through an internal flow channel-induced thermosyphon.

    Science.gov (United States)

    Hong, Bong Hwan; Jung, In Su

    2017-07-01

    A water target was designed to enhance cooling efficiency using a thermosyphon, which is a system that uses natural convection to induce heat exchange. Two water targets were fabricated: a square target without any flow channel and a target with a flow channel design to induce a thermosyphon mechanism. These two targets had the same internal volume of 8 ml. First, visualization experiments were performed to observe the internal flow by natural convection. Subsequently, an experiment was conducted to compare the cooling performance of both water targets by measuring the temperature and pressure. A 30-MeV proton beam with a beam current of 20 μA was used to irradiate both targets. Consequently, the target with an internal flow channel had a lower mean temperature and a 50% pressure drop compared to the target without a flow channel during proton beam irradiation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. The International Drinking Water Supply and Sanitation Decade in South-East Asia.

    Science.gov (United States)

    1984-01-01

    The International Drinking Water Supply and Sanitation Decade, 1981-90, which has a diversity of objectives, takes a different form in each country. What makes this decade different from previous actions for water and sanitation is the way in which the programs, projects, and servces are to be conceived, planned, implemented, managed, operated, and maintained. The urban population to be covered by water and sanitation services, in the developing nations that have prepared plans for the Decade, is roughly between 280-290 million people. In rural areas, some 750 million people are to be provided with drinking water and around 300 million with sanitation facilities. The initial goal of 100% of the population to be provided with water and sanitation by 1990 is proving difficult to realize. Only a small proportion of developing nations have even planned for 100% coverage by 1990. The initial optimism arising from the declaration of the Decade and the expectations of increased aid has given way to realism in the face of the global recession and the scarcity of development capital. The Southeast Asia Region of the World Health Organization (WHO) covers 11 member countries with a combined population of over 1000 million people. Among the countries in Southeast Asia that have prepared Decade plans, the following populations are to be covered by 1990: urban water supply, 126 million; urban sanitation, 156 million; rural water supply, 585 million; and rural sanitation, 212 million. Such a challenge calls for a stock taking of the real issues in order to identify what action can be taken. The lack of up-to-date and comprehensive databases is a serious problem. The information system for the Decade should be and integral part of it, be timed to keep pace with it, and be developed from the lowest level. The annual investment needed during the Decade is estimated at over 4 times that prior to the Decade. The accepted strategy is to meet the minimum needs of the largest number of

  5. Effects of ultraviolet-B radiation on plants during mild water stress, 4: The insensitivity of soybean internal water relations to ultraviolet-B radiation

    International Nuclear Information System (INIS)

    Teramura, A.H.; Forseth, I.N.; Lydon, J.

    1984-01-01

    The combined effects of ultraviolet-B (UV-B, 280–320 nm) radiation and water stress were investigated on the water relations of greenhouse grown soybean [Glycine max (L.) Merr. cv. Essex]. On a weighted (Caldwell 1971), total daily dose basis, plants received either 0 or 3 000 effective J m 2 UV-B BE supplied by filtered FS-40 sunlamps. The latter dose simulated the solar UV-B radiation anticipated at College Park, Maryland, U.S.A. (39°N latitude) in the event that the global stratospheric ozone column is reduced by 25%. Plants were either well-watered or preconditioned by drought stress cycles. Diurnal measurements of water potential and stomatal conductance were made on the youngest fully expanded leaf. Various internal water relations parameters were determined for detached leaves. Plants were monitored before, during and after water stress. There were no significant differences in leaf water potential or stomatal conductance between treatments before plants were preconditioned to water stress. However, drought stress resulted in significantly lower midday and afternoon leaf water potentials and lower leaf conductances as compared to well-watered plants. UV-B radiation had no additional effect on leaf water potential; however, UV did result in lower leaf conductances in plants preconditioned to water stress. Turgid weight:dry weight ratio, elastic modulus, bound water and relative water content were unaffected by UV-B radiation. Osmotic potentials at full and zero turgor were significantly lower in the drought stressed treatments as compared to well-watered plants. (author)

  6. International

    International Nuclear Information System (INIS)

    Anon.

    1997-01-01

    This rubric reports on 10 short notes about international economical facts about nuclear power: Electricite de France (EdF) and its assistance and management contracts with Eastern Europe countries (Poland, Hungary, Bulgaria); Transnuclear Inc. company (a 100% Cogema daughter company) acquired the US Vectra Technologies company; the construction of the Khumo nuclear power plant in Northern Korea plays in favour of the reconciliation between Northern and Southern Korea; the delivery of two VVER 1000 Russian reactors to China; the enforcement of the cooperation agreement between Euratom and Argentina; Japan requested for the financing of a Russian fast breeder reactor; Russia has planned to sell a floating barge-type nuclear power plant to Indonesia; the control of the Swedish reactor vessels of Sydkraft AB company committed to Tractebel (Belgium); the renewal of the nuclear cooperation agreement between Swiss and USA; the call for bids from the Turkish TEAS electric power company for the building of the Akkuyu nuclear power plant answered by three candidates: Atomic Energy of Canada Limited (AECL), Westinghouse (US) and the French-German NPI company. (J.S.)

  7. The IBNET Water Supply and Sanitation Blue Book 2014 : The International Benchmarking Network for Water and Sanitation Utilities Databook

    OpenAIRE

    Danilenko, Alexander; van den Berg, Caroline; Macheve, Berta; Moffitt, L. Joe

    2014-01-01

    Well-run water utilities play an important role in ending poverty and boosting shared prosperity. Consumers need reliable access to high quality and affordable water and sanitation services. To deliver these basic services efficiently and effectively requires high-performing utilities that are able to respond to urban growth, to connect with the poor, and to improve wastewater disposal practices. The IBNET Water Supply and Sanitation Blue Book 2014 summarizes the water sector status from 2006...

  8. Water quality - Determination of tritium activity concentration - Liquid scintillation counting method (International Standard Publication ISO 9698:1989)

    International Nuclear Information System (INIS)

    Stefanik, J.

    1999-01-01

    This International Standard specifies a method for the determination of tritiated water ([ 3 H]H 2 O) activity concentration in water by liquid scintillation counting. The method is applicable to all types of water including seawater with tritium activity concentrations of up to 10 6 Bq/m 3 when using 20 ml counting vials. Below tritium activity concentrations of about 5 x 10 4 Bq/m 3[ 8], a prior enrichment step and/or the measurement of larger sample volumes can significantly improve the accuracy of the determination and lower the limit of detection. Tritium activity concentrations higher than 10 6 Bq/m 3 may be determined after appropriate dilution with distilled water of proven low tritium content. An alternative method for the determination of these higher activities involves increasing the tritium activity concentrations of the internal standard solution. The method is not applicable to the analysis of organically bound tritium; its determination requires an oxidative digestion

  9. International symposium on nuclear techniques in integrated plant nutrient, water and soil management. Book of extended synopses

    International Nuclear Information System (INIS)

    2000-10-01

    This document contains extended synopsis of 92 papers presented at the International Symposium on Nuclear Techniques in Integrated Plant Nutrient, Water, and Soil Management held in Vienna, Austria, 16-20 October 2000. The efficient use of plant nutrient and fertilizer using carbon 13 and nitrogen 15 tracers; plant water use using oxygen 18 and moisture gauges, as well as soil and plant radioactivity monitoring, are some of the major subjects covered by these papers

  10. Lattice cell and full core physics of internally cooled annular fuel in heavy water moderated reactors

    Energy Technology Data Exchange (ETDEWEB)

    Armstrong, J.; Hamilton, H.; Hyland, B. [Atomic Energy of Canada Limited, Chalk River Laboratories, Chalk River, Ontario, K0J 1J0 (Canada)

    2013-07-01

    A program is underway at Atomic Energy of Canada Limited (AECL) to develop a new fuel bundle concept to enable greater burnups for PT-HWR (pressure tube heavy water reactor) cores. One option that AECL is investigating is an internally cooled annular fuel (ICAF) element concept. ICAF contains annular cylindrical pellets with cladding on the inner and outer diameters. Coolant flows along the outside of the element and through the centre. With such a concept, the maximum fuel temperature as a function of linear element rating is significantly reduced compared to conventional, solid-rod type fuel. The preliminary ICAF bundle concept considered in this study contains 24 half-metre long internally cooled annular fuel elements and one non-fuelled centre pin. The introduction of the non-fuelled centre pin reduces the coolant void reactivity (CVR), which is the increase in reactivity that occurs on voiding the coolant in accident scenarios. Lattice cell and full core physics calculations of the preliminary ICAF fuel bundle concept have been performed for medium burnups of approximately 18 GWd/tU using WIMS-AECL and reactor fuel simulation program (RFSP). The results will be used to assist in concept configuration optimization. The effects of radial and axial core power distributions, linear element power ratings, refuelling rates and operational power ramps have been analyzed. The results suggest that burnups of greater than 18 GWd/tU can be achieved in current reactor designs. At approximately 18 GWd/tU, expected maximum linear element ratings in a PT-HWR with online-refuelling are approximately 90 kW/m. These conditions would be prohibitive for solid-rod fuel, but may be possible in ICAF fuel given the reduced maximum fuel temperature as a function of linear element rating. (authors)

  11. Lattice cell and full core physics of internally cooled annular fuel in heavy water moderated reactors

    International Nuclear Information System (INIS)

    Armstrong, J.; Hamilton, H.; Hyland, B.

    2013-01-01

    A program is underway at Atomic Energy of Canada Limited (AECL) to develop a new fuel bundle concept to enable greater burnups for PT-HWR (pressure tube heavy water reactor) cores. One option that AECL is investigating is an internally cooled annular fuel (ICAF) element concept. ICAF contains annular cylindrical pellets with cladding on the inner and outer diameters. Coolant flows along the outside of the element and through the centre. With such a concept, the maximum fuel temperature as a function of linear element rating is significantly reduced compared to conventional, solid-rod type fuel. The preliminary ICAF bundle concept considered in this study contains 24 half-metre long internally cooled annular fuel elements and one non-fuelled centre pin. The introduction of the non-fuelled centre pin reduces the coolant void reactivity (CVR), which is the increase in reactivity that occurs on voiding the coolant in accident scenarios. Lattice cell and full core physics calculations of the preliminary ICAF fuel bundle concept have been performed for medium burnups of approximately 18 GWd/tU using WIMS-AECL and reactor fuel simulation program (RFSP). The results will be used to assist in concept configuration optimization. The effects of radial and axial core power distributions, linear element power ratings, refuelling rates and operational power ramps have been analyzed. The results suggest that burnups of greater than 18 GWd/tU can be achieved in current reactor designs. At approximately 18 GWd/tU, expected maximum linear element ratings in a PT-HWR with online-refuelling are approximately 90 kW/m. These conditions would be prohibitive for solid-rod fuel, but may be possible in ICAF fuel given the reduced maximum fuel temperature as a function of linear element rating. (authors)

  12. Cross-shelf transport into nearshore waters due to shoaling internal tides in San Pedro Bay, CA

    Science.gov (United States)

    Noble, Marlene A.; Burt Jones,; Peter Hamilton,; Xu, Jingping; George Robertson,; Rosenfeld, Leslie; John Largier,

    2009-01-01

    In the summer of 2001, a coastal ocean measurement program in the southeastern portion of San Pedro Bay, CA, was designed and carried out. One aim of the program was to determine the strength and effectiveness of local cross-shelf transport processes. A particular objective was to assess the ability of semidiurnal internal tidal currents to move suspended material a net distance across the shelf. Hence, a dense array of moorings was deployed across the shelf to monitor the transport patterns associated with fluctuations in currents, temperature and salinity. An associated hydrographic program periodically monitored synoptic changes in the spatial patterns of temperature, salinity, nutrients and bacteria. This set of measurements show that a series of energetic internal tides can, but do not always, transport subthermocline water, dissolved and suspended material from the middle of the shelf into the surfzone. Effective cross-shelf transport occurs only when (1) internal tides at the shelf break are strong and (2) subtidal currents flow strongly downcoast. The subtidal downcoast flow causes isotherms to tilt upward toward the coast, which allows energetic, nonlinear internal tidal currents to carry subthermocline waters into the surfzone. During these events, which may last for several days, the transported water remains in the surfzone until the internal tidal current pulses and/or the downcoast subtidal currents disappear. This nonlinear internal tide cross-shelf transport process was capable of carrying water and the associated suspended or dissolved material from the mid-shelf into the surfzone, but there were no observation of transport from the shelf break into the surfzone. Dissolved nutrients and suspended particulates (such as phytoplankton) transported from the mid-shelf into the nearshore region by nonlinear internal tides may contribute to nearshore algal blooms, including harmful algal blooms that occur off local beaches.

  13. DTU International Energy Report 2016: The Energy-Water-Food Nexus - from local to global aspects

    DEFF Research Database (Denmark)

    Energy, water, and food systems are closely interlinked in the Energy-Water-Food Nexus. Water is of paramount importance for the energy sector. Fossil fuels require water for extraction, trans-port and processing. Thermal power plants require water for cooling, whether they use nuclear, fossil or...

  14. Influence of Transformation Plasticity on the Distribution of Internal Stress in Three Water-Quenched Cylinders

    Science.gov (United States)

    Liu, Yu; Qin, Shengwei; Zhang, Jiazhi; Wang, Ying; Rong, Yonghua; Zuo, Xunwei; Chen, Nailu

    2017-10-01

    Based on the hardenability of three medium carbon steels, cylinders with the same 60-mm diameter and 240-mm length were designed for quenching in water to obtain microstructures, including a pearlite matrix (Chinese steel mark: 45), a bainite matrix (42CrMo), and a martensite matrix (40CrNiMo). Through the combination of normalized functions describing transformation plasticity (TP), the thermo-elasto-plastic constitutive equation was deduced. The results indicate that the finite element simulation (FES) of the internal stress distribution in the three kinds of hardenable steel cylinders based on the proposed exponent-modified (Ex-Modified) normalized function is more consistent with the X-ray diffraction (XRD) measurements than those based on the normalized functions proposed by Abrassart, Desalos, and Leblond, which is attributed to the fact that the Ex-Modified normalized function better describes the TP kinetics. In addition, there was no significant difference between the calculated and measured stress distributions, even though TP was taken into account for the 45 carbon steel; that is, TP can be ignored in FES. In contrast, in the 42CrMo and 40CrNiMo alloyed steels, the significant effect of TP on the residual stress distributions was demonstrated, meaning that TP must be included in the FES. The rationality of the preceding conclusions was analyzed. The complex quenching stress is a consequence of interactions between the thermal and phase transformation stresses. The separated calculations indicate that the three steels exhibit similar thermal stress distributions for the same water-quenching condition, but different phase transformation stresses between 45 carbon steel and alloyed steels, leading to different distributions of their axial and tangential stresses.

  15. Seismic Intensity Map Triggered by Observed Strong Motion Records Considering Site Amplification and its service based on Geo-spatial International Standard

    International Nuclear Information System (INIS)

    Matsuoka, Masashi

    2014-01-01

    Instrumental seismic intensity measurement is carried out at approximately 4,200 points in Japan, but the correct values at points without seismometers cannot always be provided because seismic motion depends on geologic and geomorphologic features. Quick provision of accurate information on seismic intensity distribution over wide areas is required for disaster mitigation. To estimate seismic intensity at specific points, it is important to prepare ground amplification characteristics for local areas beforehand and use an interpolation algorithm. The QuiQuake system (quick estimation system for earthquake maps triggered by using observation records from K-NET and KiK-net that have been released by the National Research Institute for Earth Science and Disaster Prevention), which uses these, was developed; it can be started up automatically using seismograms and can immediately display a seismic intensity distribution map. The calculation results are sent to IAEA and JNES in the form of strong motion evaluation maps with a mesh size of 250 x 250 m. These maps are also sent to the general public via social networking web sites. (author)

  16. Report: EPA Lacks Internal Controls to Prevent Misuse of Emergency Drinking Water Facilities

    Science.gov (United States)

    Report #11-P-0001, October 12, 2010. EPA cannot accurately assess the risk of public water systems delivering contaminated drinking water from emergency facilities because of limitations in Safe Drinking Water Information System (SDWIS) data management.

  17. Estimating network effect in geocenter motion: Theory

    Science.gov (United States)

    Zannat, Umma Jamila; Tregoning, Paul

    2017-10-01

    Geophysical models and their interpretations of several processes of interest, such as sea level rise, postseismic relaxation, and glacial isostatic adjustment, are intertwined with the need to realize the International Terrestrial Reference Frame. However, this realization needs to take into account the geocenter motion, that is, the motion of the center of figure of the Earth surface, due to, for example, deformation of the surface by earthquakes or hydrological loading effects. Usually, there is also a discrepancy, known as the network effect, between the theoretically convenient center of figure and the physically accessible center of network frames, because of unavoidable factors such as uneven station distribution, lack of stations in the oceans, disparity in the coverage between the two hemispheres, and the existence of tectonically deforming zones. Here we develop a method to estimate the magnitude of the network effect, that is, the error introduced by the incomplete sampling of the Earth surface, in measuring the geocenter motion, for a network of space geodetic stations of a fixed size N. For this purpose, we use, as our proposed estimate, the standard deviations of the changes in Helmert parameters measured by a random network of the same size N. We show that our estimate scales as 1/√N and give an explicit formula for it in terms of the vector spherical harmonics expansion of the displacement field. In a complementary paper we apply this formalism to coseismic displacements and elastic deformations due to surface water movements.

  18. Particle Size Characterization of Water-Elutriated Libby Amphibole 2000 and RTI International Amosite

    Science.gov (United States)

    Lowers, Heather; Bern, Amy M.

    2009-01-01

    This report presents data on particle characterization analyzed by scanning electron microscopy on Libby amphibole collected by the U.S. Geological Survey in 2000 (LA2000) and amosite material collected by RTI International (RTI amosite). The particle characterization data were generated to support a portion of the Libby Action Plan. Prior to analysis, the raw LA2000 and RTI amosite materials were subjected to a preparation step. Each sample was water-elutriated by U.S. Environmental Protection Agency (USEPA) Office of Research and Development, Research Triangle Park using the methods generally described in another published report and then delivered to the U.S. Geological Survey, Denver Microbeam Laboratory for analysis. Data presented here represent analyses performed by the U.S. Geological Survey, Denver Microbeam Laboratory and USEPA National Enforcement Investigations Center. This report consists of two Excel spreadsheet files developed by USEPA, Region 8 Superfund Technical Assistance Unit and describe the particle size characterization of the LA2000 and RTI amosite, respectively. Multiple tabs and data entry cells exist in each spreadsheet and are defined herein.

  19. A history of diabetes insipidus: paving the road to internal water balance.

    Science.gov (United States)

    Eknoyan, Garabed

    2010-12-01

    Diabetes insipidus is an ancient disease considered under the rubric of diabetes, the Greek descriptive term for polyuria, which was unrecognized even after the sweetness of urine was reported as a characteristic of diabetes mellitus in the 17th century. It would be another century before diabetes insipidus was identified from the insipid rather than saccharine taste of urine in cases of polyuria. After its increased recognition, pathologic observations and experimental studies connected diabetes insipidus to the pituitary gland in the opening decades of the 20th century. Simultaneously, posterior pituitary lobe extracts were shown to be vasoconstrictive (vasopressin) and antidiuretic (antidiuretic hormone). As vasopressin was purified and synthesized and its assay became available, it was shown to be released in response to both osmotic and volume stimuli that are integrated in the hypothalamus, and vasopressin thereby was essential to maintaining internal water balance. The antidiuretic properties of vasopressin to treat the rare cases of diabetes insipidus were of limited clinical utility until its vasoconstrictive effects were resuscitated in the 1970s, with the consequent increasing wider use of vasopressin for the treatment of compromised hemodynamic states. In addition, the discovery of antidiuretic hormone receptor blockers has led to their increasing use in managing hypo-osmolar states. Copyright © 2010 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

  20. The development of reactor vessel internal heavy forging for 1000 MW pressurized-water reactor nuclear power plant

    International Nuclear Information System (INIS)

    Zhang Zhifeng; Chen Yongbo; Ding Xiuping; Zhang Lingfang

    2012-01-01

    This Paper introduced the development of Reactor Vessel Internal (RVI) heavy forgings for 1000 MW Pressurized Water Reactor (PWR) nuclear power plant, analyzed the manufacture difficulties and technical countermeasures. The testing result of the product indicated that the performance of RVI heavy forgings manufactured by Shanghai Heavy Machinery Plant Ld. (SHMP) is outstanding and entirely satisfy the technical requirements for RVI product. (authors)

  1. Removal of Arsenic, Iron, Manganese, and Ammonia in Drinking Water: Nagaoka International Corporation CHEMILES NCL Series Water Treatment System

    Science.gov (United States)

    The Nagaoka International Corporation CHEMILES NCL Series system was tested to verify its performance for the reduction of multiple contaminants including: arsenic, ammonia, iron, and manganese. The objectives of this verification, as operated under the conditions at the test si...

  2. Responding to the challenges of water security: the Eighth Phase of the International Hydrological Programme, 2014–2021

    Directory of Open Access Journals (Sweden)

    B. Jimenez-Cisneros

    2015-04-01

    Full Text Available This paper presents the major water challenges at global, regional and local levels, including the need to adapt to climate change. It relates how the International Hydrological Programme (IHP – an intergovernmental scientific programme – will respond in its Eighth Phase to the water-related risks and seize potential opportunities, thereby contributing to ensure Water Security at all levels. The Member States of UNESCO IHP periodically define priorities for research, technological development, innovation and education. To implement the priorities in a coordinated manner, the Member States can count on the team and the projects of IHP based at UNESCO, as well as on the "UNESCO Water Family|, consisting to date of a Category 1 centre UNESCO-IHE located in the Netherlands; the World Water Assessment Programme, based in Italy, which produces the World Water Development Report of the United Nations; 30 Category 2 water centres under the auspices of UNESCO; and 35 water chairs in various parts of the world. Governments can access the powerful network of the UNESCO Water Family through IHP and its Intergovernmental Council.

  3. The International Center for Integrated Water Resources Management (ICIWaRM): The United States' Contribution to UNESCO IHP's Global Network of Water Centers

    Science.gov (United States)

    Logan, W. S.

    2015-12-01

    The concept of a "category 2 center"—i.e., one that is closely affiliated with UNESCO, but not legally part of UNESCO—dates back many decades. However, only in the last decade has the concept been fully developed. Within UNESCO, the International Hydrological Programme (IHP) has led the way in creating a network of regional and global water-related centers.ICIWaRM—the International Center for Integrated Water Resources Management—is one member of this network. Approved by UNESCO's General Conference, the center has been operating since 2009. It was designed to fill a niche in the system for a center that was backed by an institution with on-the-ground water management experience, but that also had strong connections to academia, NGOs and other governmental agencies. Thus, ICIWaRM is hosted by the US Army Corps of Engineers' Institute for Water Resources (IWR), but established with an internal network of partner institutions. Three main factors have contributed to any success that ICIWaRM has achieved in its global work: A focus on practical science and technology which can be readily transferred. This includes the Corps' own methodologies and models for planning and water management, and those of our university and government partners. Collaboration with other UNESCO Centers on joint applied research, capacity-building and training. A network of centers needs to function as a network, and ICIWaRM has worked together with UNESCO-affiliated centers in Chile, Brazil, Paraguay, the Dominican Republic, Japan, China, and elsewhere. Partnering with and supporting existing UNESCO-IHP programs. ICIWaRM serves as the Global Technical Secretariat for IHP's Global Network on Water and Development Information in Arid Lands (G-WADI). In addition to directly supporting IHP, work through G-WADI helps the center to frame, prioritize and integrate its activities. With the recent release of the United Nation's 2030 Agenda for Sustainable Development, it is clear that

  4. Rational designing of the internal water supply system in reconstructed residential buildings of mass standard series

    OpenAIRE

    Orlov Evgeny

    2018-01-01

    The issues of water supply system reconstruction in mass series buildings are reviewed with consideration of water- and resource saving. Principal points for location of plumbing cells in apartments, arrangement of water devices and wastewater receivers, selection of pipelines for reconstructed water line are described. Comparative analysis of design variants of inner water line before and following reconstruction are given. It was found that applying the developed system design approaches th...

  5. Is the fresh water fish consumption a significant determinant of the internal exposure to perfluoroalkylated substances (PFAS)?

    Science.gov (United States)

    Denys, Sébastien; Fraize-Frontier, Sandrine; Moussa, Oumar; Le Bizec, Bruno; Veyrand, Bruno; Volatier, Jean-Luc

    2014-12-01

    PFAS are man-made compounds that are highly spread in the environment. Human dietary exposure to such contaminants is of high concern as they may accumulate in the food chain. Different studies already demonstrated the importance of the fish consumption in the dietary exposure of these molecules and the potential increase of internal doses of PFAS following the consumption of PFAS. However, so far few study aimed to study the link between the consumption of fresh water fishes and the internal exposure to PFAS. Objectives of this study were (i) to estimate the internal exposure of populations that are potentially high consumers of fresh water fishes and (ii) to determine whether the consumption of fish caught from fresh water is a significant determinant of the internal exposure of PFAS. In this work, a large sample of adult freshwater anglers from the French metropolitan population (478 individuals) was constituted randomly from participants lists of anglers associations. Questionnaires provided social and demographic information and diet information for each subject. In addition, analyses of blood serum samples provided the internal concentration of 14 PFAS. The survey design allowed to extrapolate the data obtained on the 478 individuals to the freshwater angler population. Descriptive data regarding internal levels of PFAS were discussed at the population level, whereas identification of the determinants were done at the 478 individuals level as sufficient contrast was required in terms of fresh water fish consumption. Only molecules for which the detection frequency were above 80% in blood were considered, i.e., PFOS, PFOA, PFHxS, PFNA, PFHpS, and PFDA. Distribution profiles showed log-normal distribution and PFOS and PFOA were the main contributors of the PFAS sum. For PFOS, the results obtained on the 478 individuals showed that upper percentiles were higher as compared to upper percentiles obtained on occidental general population. This confirmed an over

  6. The Maritime Environment - International Conference and Exhibition on Ballast Water, Waste Water and Sewage Treatment on Ships and in Ports Held in Bremerhaven, Germany on 12-14 September 2001. Conference Proceedings

    National Research Council Canada - National Science Library

    2001-01-01

    The Maritime International Conference on Ballast Water, Waste Water and Sewage Treatment on Ships and in Ports held in Bremerhaven, Germany on 12-14 September 2001 was cosponsored by Deerberg-Systems...

  7. Auditory Motion Elicits a Visual Motion Aftereffect

    Directory of Open Access Journals (Sweden)

    Christopher C. Berger

    2016-12-01

    Full Text Available The visual motion aftereffect is a visual illusion in which exposure to continuous motion in one direction leads to a subsequent illusion of visual motion in the opposite direction. Previous findings have been mixed with regard to whether this visual illusion can be induced cross-modally by auditory stimuli. Based on research on multisensory perception demonstrating the profound influence auditory perception can have on the interpretation and perceived motion of visual stimuli, we hypothesized that exposure to auditory stimuli with strong directional motion cues should induce a visual motion aftereffect. Here, we demonstrate that horizontally moving auditory stimuli induced a significant visual motion aftereffect—an effect that was driven primarily by a change in visual motion perception following exposure to leftward moving auditory stimuli. This finding is consistent with the notion that visual and auditory motion perception rely on at least partially overlapping neural substrates.

  8. Auditory Motion Elicits a Visual Motion Aftereffect.

    Science.gov (United States)

    Berger, Christopher C; Ehrsson, H Henrik

    2016-01-01

    The visual motion aftereffect is a visual illusion in which exposure to continuous motion in one direction leads to a subsequent illusion of visual motion in the opposite direction. Previous findings have been mixed with regard to whether this visual illusion can be induced cross-modally by auditory stimuli. Based on research on multisensory perception demonstrating the profound influence auditory perception can have on the interpretation and perceived motion of visual stimuli, we hypothesized that exposure to auditory stimuli with strong directional motion cues should induce a visual motion aftereffect. Here, we demonstrate that horizontally moving auditory stimuli induced a significant visual motion aftereffect-an effect that was driven primarily by a change in visual motion perception following exposure to leftward moving auditory stimuli. This finding is consistent with the notion that visual and auditory motion perception rely on at least partially overlapping neural substrates.

  9. Auditory motion capturing ambiguous visual motion

    Directory of Open Access Journals (Sweden)

    Arjen eAlink

    2012-01-01

    Full Text Available In this study, it is demonstrated that moving sounds have an effect on the direction in which one sees visual stimuli move. During the main experiment sounds were presented consecutively at four speaker locations inducing left- or rightwards auditory apparent motion. On the path of auditory apparent motion, visual apparent motion stimuli were presented with a high degree of directional ambiguity. The main outcome of this experiment is that our participants perceived visual apparent motion stimuli that were ambiguous (equally likely to be perceived as moving left- or rightwards more often as moving in the same direction than in the opposite direction of auditory apparent motion. During the control experiment we replicated this finding and found no effect of sound motion direction on eye movements. This indicates that auditory motion can capture our visual motion percept when visual motion direction is insufficiently determinate without affecting eye movements.

  10. Efforts to Reduce International Space Station Crew Maintenance for the Management of the Extravehicular Mobility Unit Transport Loop Water Quality

    Science.gov (United States)

    Steele, John W.; Etter, David; Rector, Tony; Boyle, Robert; Vandezande, Christopher

    2013-01-01

    The EMU (Extravehicular Mobility Unit) contains a semi-closed-loop re-circulating water circuit (Transport Loop) to absorb heat into a LCVG (Liquid Coolant and Ventilation Garment) worn by the astronaut. A second, single-pass water circuit (Feed-water Loop) provides water to a cooling device (Sublimator) containing porous plates, and that water sublimates through the porous plates to space vacuum. The cooling effect from the sublimation of this water translates to a cooling of the LCVG water that circulates through the Sublimator. The quality of the EMU Transport Loop water is maintained through the use of a water processing kit (ALCLR Airlock Cooling Loop Remediation) that is used to periodically clean and disinfect the water circuit. Opportunities to reduce crew time associated with on-orbit ALCLR operations include a detailed review of the historical water quality data for evidence to support an extension to the implementation cycle. Furthermore, an EMU returned after 2-years of use on the ISS (International Space Station) is being used as a test bed to evaluate the results of extended and repeated ALCLR implementation cycles. Finally, design, use and on-orbit location enhancements to the ALCLR kit components are being considered to allow the implementation cycle to occur in parallel with other EMU maintenance and check-out activities, and to extend the life of the ALCLR kit components. These efforts are undertaken to reduce the crew-time and logistics burdens for the EMU, while ensuring the long-term health of the EMU water circuits for a post-Shuttle 6-year service life.

  11. The effect of internal mould water spray cooling on rotationally moulded polyethylene parts

    Science.gov (United States)

    McCourt, Mark P.; Kearns, Mark P.; Martin, Peter J.

    2018-05-01

    The conventional method of cooling during the rotational moulding process is through the use of forced air. During the cooling phase of a typical rotomoulding cycle, large volumes of high velocity room temperature air are forced across the outside of the rotating rotomoulding tool to encourage cooling of the metal mould and molten polymer. Since no cooling is applied to the inside of the mould, the inner surface of the polymer (polyethylene) cools more slowly and will have a tendency to be more crystalline and the polyethylene will have a higher density in this region. The side that cools more quickly (in contact with the inside mould wall) will be less crystalline, and will therefore have a lower density. The major consequence of this difference in crystallinity will be a buildup of internal stresses producing warpage and excessive shrinkage of the part with subsequent increased levels of scrap. Therefore excessive cooling on the outside of the mould should be avoided. One consequence of this effect is that the cooling time for a standard rotationally moulded part can be quite long and this has an effect on the overall economics of the process in terms of part manufacture. A number of devices are currently on the market to enhance the cooling of rotational moulding by introducing a water spray to the inside of the rotomoulding during cooling. This paper reports on one such device 'Rotocooler' which during a series of initial industrial trials has been shown to reduce the cycletime by approximately 12 to 16%, with minimal effect on the mechanical properties, leading to a part which has less warpage and shrinkage than a conventionally cooled part.

  12. Multiple scattering of light by water cloud droplets with external and internal mixing of black carbon aerosols

    International Nuclear Information System (INIS)

    Wang Hai-Hua; Sun Xian-Ming

    2012-01-01

    The mixture of water cloud droplets with black carbon impurities is modeled by external and internal mixing models. The internal mixing model is modeled with a two-layered sphere (water cloud droplets containing black carbon (BC) inclusions), and the single scattering and absorption characteristics are calculated at the visible wavelength of 0.55 μm by using the Lorenz—Mie theory. The external mixing model is developed assuming that the same amount of BC particles are mixed with the water droplets externally. The multiple scattering characteristics are computed by using the Monte Carlo method. The results show that when the size of the BC aerosol is small, the reflection intensity of the internal mixing model is bigger than that of the external mixing model. However, if the size of the BC aerosol is big, the absorption of the internal mixing model will be larger than that of the external mixing model. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

  13. Motion Sickness

    Science.gov (United States)

    ... potatoes. Don’t eat greasy, spicy, or acidic foods just before or during travel. Drink plenty of water. Avoid alcohol. Get a ... Conditions Prevention and Wellness Staying Healthy Healthy Living Travel ... myhealthfinder Food and Nutrition Healthy Food Choices Weight Loss and ...

  14. Motion control report

    CERN Document Server

    2013-01-01

    Please note this is a short discount publication. In today's manufacturing environment, Motion Control plays a major role in virtually every project.The Motion Control Report provides a comprehensive overview of the technology of Motion Control:* Design Considerations* Technologies* Methods to Control Motion* Examples of Motion Control in Systems* A Detailed Vendors List

  15. Aging Management Strategy and Requirements of Pressurized Water Reactor Internal Components

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Jun Seog; Oh, Sung Jin; Won, Se Yol; Jeong, Sun Mi [KHNP, Daejeon (Korea, Republic of)

    2016-05-15

    The demonstration that the effects of degradation in the components of PWR internals are adequately managed is essential for maintaining a healthy fleet and ensuring the continued functionality of the reactor internals. It is also very important to determine when and where irradiation susceptibility may occur for the continued operation. This paper introduces the aging management strategies and requirements for PWR internals components and discusses effects of irradiation aging results from the functionality assessments based on the categorization of internal components. This paper introduces aging management strategies and requirements for PWR internals components. The aging management requirements for PWR internals are specified in four final component groups, which are Primary, Expansion, Existing Program and No Additional Measures. Among these groups, Primary groups include any restriction on general applicability, degradation mechanism, forward link to any Expansion components, examination method, initial examination and frequency, and examination coverage and accessibility. Expansion groups are backward link to the Primary component.

  16. The influence of atomizer internal design and liquid physical properties on effervescent atomizing of coal-water slurry

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Meng; Duan, Yufeng [Southeast Univ., Nanjing (China). Inst. of Thermal Engineering

    2013-07-01

    This study investigated the dependence of effervescent atomizing of coal-water slurry (CWS) on atomizer internal design and fluid properties. Results demonstrate that internal design of atomizer and fluid properties directly affect the two-phase flow pattern inside the atomizer which consequently affects the spray quality. The influence of mixing chamber length on spray quality is not significant at the ALR of 0.15 except for spray 0.75 glycerol/0.248 water/0.002 xanthan mixture. The same trend also found in the effect of angle of aeration holes at ALR of 0.15. Large diameter of the inclined aeration holes shows small SMD for water. The consistency index of fluids has no effect on the spray quality and Sauter Mean Diameter (SMD) increases when polymer additions were added to the glycerin-water mixture. The radial profile of SMD for spray water are almost flat, however, the largest SMD can be obtained at the edge of spray for three other fluids.

  17. Second meeting of the International Working Group on Advanced Technologies for Water Cooled Reactors, Helsinki, 6-9 June 1988

    International Nuclear Information System (INIS)

    1989-05-01

    The Second Meeting of the IAEA International Working Group on Advanced Technologies for Water Cooled Reactors (IWGATWR) was held in Helsinki, Finland, from 6-9 June 1988. The Summary Report (Part II) contains the papers which review the national programmes since the first meeting of IWGATWR in May 1987 in the field of Advanced Technologies for Water Cooled Reactors and other presentations at the Meeting. A separate abstract was prepared for each of these 12 papers presented at the meeting. Figs and tabs

  18. Adaptive motion of animals and machines

    National Research Council Canada - National Science Library

    Kimura, Hiroshi

    2006-01-01

    ... single function in a control system and mechanism. That is, adaptation in motion is induced at every level from the central nervous system to the musculoskeletal system. Thus, we organized the International Symposium on Adaptive Motion in Animals and Machines (AMAM) for scientists and engineers concerned with adaptation on various levels to be broug...

  19. Motion compensation for MRI-guided radiotherapy

    NARCIS (Netherlands)

    Glitzner, M.

    2017-01-01

    Radiotherapy aims to deliver a lethal radiation dose to cancer cells immersed in the body using a high energetic photon beam. Due to physiologic motion of the human anatomy (e.g. caused by filling of internal organs or breathing), the target volume is under permanent motion during irradiation,

  20. Colloborative International Resesarch on the Water Energy Nexus: Lessons Learned from the Clean Energy Research Center - Water Energy Technologies (CERC-WET)

    Science.gov (United States)

    Remick, C.

    2017-12-01

    The U.S.-China Clean Energy Research Center - Water and Energy Technologies (CERC-WET) is a global research partnership focused on developing and deploying technologies that to allow the U.S. and China to thrive in a future with constrained energy and water resources in a changing global climate. This presentation outlines and addresses the opportunities and challenges for international research collaboration on the so called "water-energy nexus", with a focus on industrial partnership, market readiness, and intellectual property. The U.S. Department of Energy created the CERC program as a research and development partnership between the United States and China to accelerate the development and deployment of advanced clean energy technologies. The United States and China are not only the world's largest economies; they are also the world's largest energy producers and energy consumers. Together, they account for about 40% of annual global greenhouse gas emissions. The bilateral investment in CERC-WET will total $50 million over five years and will target on the emerging issues and cut-edge research on the topics of (1) water use reduction at thermoelectric plants; (2) treatment and management of non-traditional waters; (3) improvements in sustainable hydropower design and operation; (4) climate impact modeling, methods, and scenarios to support improved understanding of energy and water systems; and (5) data and analysis to inform planning and policy.

  1. Frictional pressure drop of high pressure steam-water two-phase flow in internally helical ribbed tubes

    International Nuclear Information System (INIS)

    Tingkuan, C.; Xuanzheng, C.

    1987-01-01

    It is well known that the internally helical ribbed tubes are effective in suppressing the dry-out in boiling tubes at high pressures, so they are widely used as furnace water wall tubes in modern large steam power boilers. Design of the boilers requires the data on frictional pressure drop characteristics of the ribbed tubes, but they are not sufficient now. This paper describes the experimental results on the adiabatic frictional pressure drop in both horizontal ribbed tubes with measured mean inside diameter of 11.69 mm and 35.42 mm at high pressure from 10 to 21 MPa, mass flow rate from 350 to 3800 kg/m/sup 2/s and steam quality from 0 to 1 in our high pressure electrically heated water loop. Simultaneously, both smooth tubes under the same conditions for comparison. Based on the tests the correlation for determining the frictional pressure drop of internally ribbed tubes are proposed

  2. International production versus global competition. Bosch`s business area `water heating systems` meets the press; International im globalen Wettbewerb. Bosch Geschaeftsbereich Thermotechnik stellt sich der Fachpresse vor

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1996-08-01

    The business area `water heating systems` has developed into an internationally operating enterprise of the Bosch group. Its factories are distributed over seven countries: Junkers at Wernau (Germany), Worcester at Worcester (Great Britain), Radson at Houthalen (Belgium), Vulcano at Aveiro (Portugal), e.I.m. leblanc at Drancy and Brest (France) and at Lecong (PR China).- The article reports impressions gathered at a meeting of representatives of the technical press, organized by Bosch Thermotechnik at Aveiro, Portugal. This colloquy in a European site of production enabled representatives of the press to inform themselves on the spot on the internationality of the enterprise. (orig.) [Deutsch] Der Geschaeftsbereich Thermotechnik hat sich zu einem international operierenden Unternehmen der Bosch-Gruppe entwickelt. In sieben Laendern hat er Fertigungsstaetten, Junkers in Wernau (D), Worcester in Worcester (GB), Radson in Houthalen (B), Vulcano in Aveiro (P), e.l.m. Leblanc in Drancy und Brest (F) und in Lecong (VR China). Im folgenden wird ueber Eindruecke aus einem Fachpresse-Kolloquium berichtet, zu dem Bosch Thermotechnik Fachpressevertreter nach Aveiro in Portugal eingeladen hatte. Es fand also an einem der europaeischen Standorte statt, so dass sich die Pressevertreter vor Ort ein konkretes Bild zum Thema `Internationalitaet` verschaffen konnten. (orig.)

  3. Nuclear power plant conference 2010 (NPC 2010): International conference on water chemistry of nuclear reactor systems and 8th International radiolysis, electrochemistry and materials performance workshop

    International Nuclear Information System (INIS)

    2010-01-01

    The Nuclear Plant Chemistry Conference was held in Quebec City, Quebec, Canada on October 3-7, 2010. It was hosted by the Canadian Nuclear Society and was held in Canada for the first time. This international event hosted over 300 attendees, two thirds from outside of Canada, mostly from Europe and and Far East. The conference is formally known as the International Conference on Water Chemistry of Nuclear Reactor Systems and is the 15th of a series that began in 1977 in Bournemouth, UK. The conference focussed on the latest developments in the science and technology of water chemistry control in nuclear reactor systems. Utility scientists, engineers and operations people met their counterparts from research institutes, service organizations and universities to address the challenges of chemistry control and degradation management of their complex and costly plants for the many decades that they are expected to operate. Following the four day conference, the 8th International Radiolysis, Electrochemistry and Materials Performance Workshop was held as associated, but otherwise free-standing event on Friday, October 8, 2010. It was also well attended and the primary focus was the effect of radiation on corrosion. When asked about the importance of chemistry in operating nuclear power plants, the primary organizers summarized it in the following statement: 'Once a nuclear plant is in operation, chemistry improvement is the only way to increase the longevity of the plant and its equipment'. The organisers of the 2010 Workshop and the NPC 2010 conference decided that these two events would be held consecutively, as previous, but for the first time the organization and registration would be shared, which proved to be a winning combination by the attendance.

  4. International Space Station Atmosphere Control and Supply, Atmosphere Revitalization, and Water Recovery and Management Subsystem - Verification for Node 1

    Science.gov (United States)

    Williams, David E.

    2007-01-01

    The International Space Station (ISS) Node 1 Environmental Control and Life Support (ECLS) System is comprised of five subsystems: Atmosphere Control and Supply (ACS), Atmosphere Revitalization (AR), Fire Detection and Suppression (FDS), Temperature and Humidity Control (THC), and Water Recovery and Management (WRM). This paper provides a summary of the nominal operation of the Node 1 ACS, AR, and WRM design and detailed Element Verification methodologies utilized during the Qualification phase for Node 1.

  5. Morphological study in internal derangement of the temporomandibular joint with MRI. The relationships between the state of the articular disc and limitation of motion of the mandibular head

    International Nuclear Information System (INIS)

    Miyazu, Hiroko; Sakurai, Takashi; Numayama, Sukenao; Furuya, Nobuaki; Kashima, Isamu

    1997-01-01

    In this study, we used MRI to investigate the relationships between these factors in temporomandibular joint (TMJ) patients, especially with regard to the range of condylar movement. Bone configurations and articular disc conditions were analyzed in a total of 367 TMJ of 255 internal derangement patients using MRI. We examined the influence of articular disc condition on functional disorder and identified the tendencies of the pathology of patients with internal derangements. Anterolateral displacement was more frequent than anteromedial displacement, and lateral rotary displacement was more frequent than medial rotary displacement. Therefore, the articular disc displaced more readily laterally, rather than medially. With regard to the relationship between the articular disc configuration and reduction, enlargement of the posterior band and biconvex discs showed a tendency for articular disc displacement that did not reduce, while discs with even thickness showed a tendency of articular disc displacement which would reduce. Folding and biconvexity tended to limit condylar movement while less limitation occurred with discs of even thickness. In cases of disc displacement without reduction, there was a significantly higher percentage of cases with limited condylar movement than in cases of displacement with reduction. (K.H.)

  6. Mental imagery of gravitational motion.

    Science.gov (United States)

    Gravano, Silvio; Zago, Myrka; Lacquaniti, Francesco

    2017-10-01

    There is considerable evidence that gravitational acceleration is taken into account in the interaction with falling targets through an internal model of Earth gravity. Here we asked whether this internal model is accessed also when target motion is imagined rather than real. In the main experiments, naïve participants grasped an imaginary ball, threw it against the ceiling, and caught it on rebound. In different blocks of trials, they had to imagine that the ball moved under terrestrial gravity (1g condition) or under microgravity (0g) as during a space flight. We measured the speed and timing of the throwing and catching actions, and plotted ball flight duration versus throwing speed. Best-fitting duration-speed curves estimate the laws of ball motion implicit in the participant's performance. Surprisingly, we found duration-speed curves compatible with 0g for both the imaginary 0g condition and the imaginary 1g condition, despite the familiarity with Earth gravity effects and the added realism of performing the throwing and catching actions. In a control experiment, naïve participants were asked to throw the imaginary ball vertically upwards at different heights, without hitting the ceiling, and to catch it on its way down. All participants overestimated ball flight durations relative to the durations predicted by the effects of Earth gravity. Overall, the results indicate that mental imagery of motion does not have access to the internal model of Earth gravity, but resorts to a simulation of visual motion. Because visual processing of accelerating/decelerating motion is poor, visual imagery of motion at constant speed or slowly varying speed appears to be the preferred mode to perform the tasks. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Performance Evaluation of the Operational Air Quality Monitor for Water Testing Aboard the International Space Station

    Science.gov (United States)

    Wallace, William T.; Limero, Thomas F.; Gazda, Daniel B.; Minton, John M.; Macatangay, Ariel V.; Dwivedi, Prabha; Fernandez, Facundo M.

    2014-01-01

    Real-time environmental monitoring on ISS is necessary to provide data in a timely fashion and to help ensure astronaut health. Current real-time water TOC monitoring provides high-quality trending information, but compound-specific data is needed. The combination of ETV with the AQM showed that compounds of interest could be liberated from water and analyzed in the same manner as air sampling. Calibration of the AQM using water samples allowed for the quantitative analysis of ISS archival samples. Some calibration issues remain, but the excellent accuracy of DMSD indicates that ETV holds promise for as a sample introduction method for water analysis in spaceflight.

  8. Options for decoupling economic growth from water use and water pollution: A report of the Water Working Group of the International Resource Panel Options for decoupling economic growth from water use and water pollution

    Science.gov (United States)

    Global trends have pointed to a relative decoupling of water – that is, the rate of water resource use is increasing at a rate slower than that of economic growth. Despite this progress at the global level, it is projected that by 2030 there will be a 40% gap between water supply and water demand if...

  9. The application of national and international guidelines in the assessment of the radiological quality of drinking water

    International Nuclear Information System (INIS)

    Cooper, M.B.

    1998-01-01

    Full text: The World Health Organisation has developed international guidelines for drinking water quality which define acceptable levels of contaminants including radionuclides. These guidelines were the basis for the recent Australian water quality guidelines developed by the National Health and Medical Research Council in conjunction with the Agriculture and Resource Management Council of Australia and New Zealand. This paper highlights some of the practical problems in applying the guidelines in the assessment of groundwater supplies in Australia where the radium content of the water may be significant and the presence of other dissolved minerals can create difficulties in the analytical procedures. Generally, screening methods are based on the determination of gross alpha and beta radioactivity and the limitations of these techniques are discussed. The issue is also addressed as to the appropriate actions in the event of guideline values for specific radionuclides being exceeded

  10. An adaptive control algorithm for optimization of intensity modulated radiotherapy considering uncertainties in beam profiles, patient set-up and internal organ motion

    International Nuclear Information System (INIS)

    Loef, Johan; Lind, Bengt K.; Brahme, Anders

    1998-01-01

    A new general beam optimization algorithm for inverse treatment planning is presented. It utilizes a new formulation of the probability to achieve complication-free tumour control. The new formulation explicitly describes the dependence of the treatment outcome on the incident fluence distribution, the patient geometry, the radiobiological properties of the patient and the fractionation schedule. In order to account for both measured and non-measured positioning uncertainties, the algorithm is based on a combination of dynamic and stochastic optimization techniques. Because of the difficulty in measuring all aspects of the intra- and interfractional variations in the patient geometry, such as internal organ displacements and deformations, these uncertainties are primarily accounted for in the treatment planning process by intensity modulation using stochastic optimization. The information about the deviations from the nominal fluence profiles and the nominal position of the patient relative to the beam that is obtained by portal imaging during treatment delivery, is used in a feedback loop to automatically adjust the profiles and the location of the patient for all subsequent treatments. Based on the treatment delivered in previous fractions, the algorithm furnishes optimal corrections for the remaining dose delivery both with regard to the fluence profile and its position relative to the patient. By dynamically refining the beam configuration from fraction to fraction, the algorithm generates an optimal sequence of treatments that very effectively reduces the influence of systematic and random set-up uncertainties to minimize and almost eliminate their overall effect on the treatment. Computer simulations have shown that the present algorithm leads to a significant increase in the probability of uncomplicated tumour control compared with the simple classical approach of adding fixed set-up margins to the internal target volume. (author)

  11. Boundary Judgments in Water Governance: Diagnosing Internal and External Factors that Matter in a Complex World

    NARCIS (Netherlands)

    de Loë, Rob C.; Patterson, J.J.

    2018-01-01

    Governance failures are widely recognized as a key reason why, despite sustained attention over previous decades, many longstanding water problems continue to go unsolved around the world. A major challenge in analyzing and addressing water governance problems is making “boundary judgments” in the

  12. 5. International seminar on primary and secondary side water chemistry of nuclear power plants

    International Nuclear Information System (INIS)

    2001-01-01

    The major subjects of the meetings are: water chemistry of primary and secondary coolant circuits of PWR type reactors (mainly WWER types), corrosion of steam generators, decontamination processes, treatment of radioactive waste waters and related subjects. All the 29 papers were individually indexed and abstracted for the INIS database. (R.P.)

  13. 5. International seminar on primary and secondary side water chemistry of nuclear power plants

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-07-01

    The major subjects of the meetings are: water chemistry of primary and secondary coolant circuits of PWR type reactors (mainly WWER types), corrosion of steam generators, decontamination processes, treatment of radioactive waste waters and related subjects. All the 29 papers were individually indexed and abstracted for the INIS database. (R.P.)

  14. Tourism and water use: Supply, demand, and security. An international review

    NARCIS (Netherlands)

    Gössling, S.; Peeters, P.M.; Hall, C.M.; Ceron, J.P.; Dubois, G.; Lehmann, L.V.; Scott, D.

    2012-01-01

    This article reviews direct freshwater consumption in tourism from both quantitative and qualitative viewpoints to assess the current water demand of the tourism sector and to identify current and future management challenges. The article concludes that even though tourism increases global water

  15. Sino-US cooperation in water saving technologies: essential international problems

    Science.gov (United States)

    The United States and China share many agricultural problems, but one of great importance is the need to produce more crop yield in the face of water scarcity. Common recognition of this problem led to the development of a joint Sino-US Water Saving Technologies Flagship project within the larger US...

  16. Energy and water tradeoffs in enhancing food security: A selective international assessment

    International Nuclear Information System (INIS)

    Mushtaq, Shahbaz; Maraseni, Tek Narayan; Maroulis, Jerry; Hafeez, Mohsin

    2009-01-01

    Rice is the major staple food in most Asian countries. However, with rapidly growing populations, sustained high productivity and yields through improving water productivity is critically important. Increasingly complex energy-agriculture relationships require an in-depth understanding of water and energy tradeoffs. This study contributes to energy and food policies by analysing the complex energy, water and economics dynamics across a selection of major rice growing countries. The results show that tradeoffs exist between yield and energy inputs with high yield attributed to higher levels of energy input. The selected developed countries show higher energy productivity, relative to all other energy inputs, compared to the selected developing counties, owing to enhanced mechanisation, on-farm technology and improved farm management. Among all countries, China has the highest water productivity due to water-saving irrigation practices. These practices offer opportunities for developed and developing countries to increase water productivity at the same time taking advantage of economic and energy benefits of reduced pumping. Sustained production from agriculture is vital to food security. Improved irrigation practices can offset environmental footprints in the short run but their large-scale implementation remains an issue. In the long run, investments are needed to buffer the negative impacts of food production on the environment. Investments to boost water productivity and improved energy use efficiency in crop production are two pathways to reduce energy dependency, enhanced natural resource sustainability and ensuring future food security.

  17. Motion correction options in PET/MRI.

    Science.gov (United States)

    Catana, Ciprian

    2015-05-01

    Subject motion is unavoidable in clinical and research imaging studies. Breathing is the most important source of motion in whole-body PET and MRI studies, affecting not only thoracic organs but also those in the upper and even lower abdomen. The motion related to the pumping action of the heart is obviously relevant in high-resolution cardiac studies. These two sources of motion are periodic and predictable, at least to a first approximation, which means certain techniques can be used to control the motion (eg, by acquiring the data when the organ of interest is relatively at rest). Additionally, nonperiodic and unpredictable motion can also occur during the scan. One obvious limitation of methods relying on external devices (eg, respiratory bellows or the electrocardiogram signal to monitor the respiratory or cardiac cycle, respectively) to trigger or gate the data acquisition is that the complex motion of internal organs cannot be fully characterized. However, detailed information can be obtained using either the PET or MRI data (or both) allowing the more complete characterization of the motion field so that a motion model can be built. Such a model and the information derived from simple external devices can be used to minimize the effects of motion on the collected data. In the ideal case, all the events recorded during the PET scan would be used to generate a motion-free or corrected PET image. The detailed motion field can be used for this purpose by applying it to the PET data before, during, or after the image reconstruction. Integrating all these methods for motion control, characterization, and correction into a workflow that can be used for routine clinical studies is challenging but could potentially be extremely valuable given the improvement in image quality and reduction of motion-related image artifacts. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Motion in radiotherapy

    DEFF Research Database (Denmark)

    Korreman, Stine Sofia

    2012-01-01

    This review considers the management of motion in photon radiation therapy. An overview is given of magnitudes and variability of motion of various structures and organs, and how the motion affects images by producing artifacts and blurring. Imaging of motion is described, including 4DCT and 4DPE...

  19. Acoustic mode coupling induced by shallow water nonlinear internal waves: sensitivity to environmental conditions and space-time scales of internal waves.

    Science.gov (United States)

    Colosi, John A

    2008-09-01

    While many results have been intuited from numerical simulation studies, the precise connections between shallow-water acoustic variability and the space-time scales of nonlinear internal waves (NLIWs) as well as the background environmental conditions have not been clearly established analytically. Two-dimensional coupled mode propagation through NLIWs is examined using a perturbation series solution in which each order n is associated with nth-order multiple scattering. Importantly, the perturbation solution gives resonance conditions that pick out specific NLIW scales that cause coupling, and seabed attenuation is demonstrated to broaden these resonances, fundamentally changing the coupling behavior at low frequency. Sound-speed inhomogeneities caused by internal solitary waves (ISWs) are primarily considered and the dependence of mode coupling on ISW amplitude, range width, depth structure, location relative to the source, and packet characteristics are delineated as a function of acoustic frequency. In addition, it is seen that significant energy transfer to modes with initially low or zero energy involves at least a second order scattering process. Under moderate scattering conditions, comparisons of first order, single scattering theoretical predictions to direct numerical simulation demonstrate the accuracy of the approach for acoustic frequencies upto 400 Hz and for single as well as multiple ISW wave packets.

  20. Robot Motion and Control 2011

    CERN Document Server

    2012-01-01

    Robot Motion Control 2011 presents very recent results in robot motion and control. Forty short papers have been chosen from those presented at the sixth International Workshop on Robot Motion and Control held in Poland in June 2011. The authors of these papers have been carefully selected and represent leading institutions in this field. The following recent developments are discussed: • Design of trajectory planning schemes for holonomic and nonholonomic systems with optimization of energy, torque limitations and other factors. • New control algorithms for industrial robots, nonholonomic systems and legged robots. • Different applications of robotic systems in industry and everyday life, like medicine, education, entertainment and others. • Multiagent systems consisting of mobile and flying robots with their applications The book is suitable for graduate students of automation and robotics, informatics and management, mechatronics, electronics and production engineering systems as well as scientists...

  1. Welding residual stress improvement in internal components by water jet peening

    International Nuclear Information System (INIS)

    Enomoto, K.; Hirano, K.; Hayashi, M.; Hayashi, E.

    1996-01-01

    Cavitations are generated when highly pressurized water is jetted in water. Surface residual stress is improved remarkably due to the peening effect of extremely high pressure caused by the collapse of cavitation bubbles. This technique is called water jet peening (WJP). WJP is expected to be an effective maintenance technique for the prevention of stress corrosion cracking caused by residual stress in various components of power generating plants. Various kinds of specimens were water jet peened to evaluate the fundamental characteristics of WJP and to select the most appropriate conditions for the residual stress improvement. Test results showed that WJP markedly improved the tensile residual stress caused by welding and grinding to the high compressive residual stress and seems to prevent the stress corrosion cracking

  2. IDRC and water: A matter of life and death | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2011-02-25

    Feb 25, 2011 ... But throughout the developing world, countless communities lack an ... defined priorities and take into account interactions among the many factors that ... the technical and social aspects of complex water-related challenges.

  3. Water security at risk in peri-urban India | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2016-06-22

    Jun 22, 2016 ... The majority of India's population lives in water-stressed regions. ... demand, inefficient usage, overexploitation of groundwater, pollution, and climate change. ... Balancing trade-offs for wastewater treatment in Mexico City.

  4. Modelling and Internal Fuzzy Model Power Control of a Francis Water Turbine

    Directory of Open Access Journals (Sweden)

    Klemen Nagode

    2014-02-01

    Full Text Available This paper presents dynamic modelling of a Francis turbine with a surge tank and the control of a hydro power plant (HPP. Non-linear and linear models include technical parameters and show high similarity to measurement data. Turbine power control with an internal model control (IMC is proposed, based on a turbine fuzzy model. Considering appropriate control responses in the entire area of turbine power, the model parameters of the process are determined from a fuzzy model, which are further included in the internal model controller. The results are compared to a proportional-integral (PI controller tuned with an integral absolute error (IAE objective function, and show an improved response of internal model control.

  5. Water

    Science.gov (United States)

    ... www.girlshealth.gov/ Home Nutrition Nutrition basics Water Water Did you know that water makes up more ... to drink more water Other drinks How much water do you need? top Water is very important, ...

  6. ROBUST MOTION SEGMENTATION FOR HIGH DEFINITION VIDEO SEQUENCES USING A FAST MULTI-RESOLUTION MOTION ESTIMATION BASED ON SPATIO-TEMPORAL TUBES

    OpenAIRE

    Brouard , Olivier; Delannay , Fabrice; Ricordel , Vincent; Barba , Dominique

    2007-01-01

    4 pages; International audience; Motion segmentation methods are effective for tracking video objects. However, objects segmentation methods based on motion need to know the global motion of the video in order to back-compensate it before computing the segmentation. In this paper, we propose a method which estimates the global motion of a High Definition (HD) video shot and then segments it using the remaining motion information. First, we develop a fast method for multi-resolution motion est...

  7. Carbon, land, and water footprint accounts for the European Union: consumption, production, and displacements through international trade.

    Science.gov (United States)

    Steen-Olsen, Kjartan; Weinzettel, Jan; Cranston, Gemma; Ercin, A Ertug; Hertwich, Edgar G

    2012-10-16

    A nation's consumption of goods and services causes various environmental pressures all over the world due to international trade. We use a multiregional input-output model to assess three kinds of environmental footprints for the member states of the European Union. Footprints are indicators that take the consumer responsibility approach to account for the total direct and indirect effects of a product or consumption activity. We quantify the total environmental pressures (greenhouse gas emissions: carbon footprint; appropriation of biologically productive land and water area: land footprint; and freshwater consumption: water footprint) caused by consumption in the EU. We find that the consumption activities by an average EU citizen in 2004 led to 13.3 tCO(2)e of induced greenhouse gas emissions, appropriation of 2.53 gha (hectares of land with global-average biological productivity), and consumption of 179 m(3) of blue water (ground and surface water). By comparison, the global averages were 5.7 tCO(2)e, 1.23 gha, and 163 m(3) blue water, respectively. Overall, the EU displaced all three types of environmental pressures to the rest of the world, through imports of products with embodied pressures. Looking at intra-EU displacements only, the UK was the most important displacer overall, while the largest net exporters of embodied environmental pressures were Poland (greenhouse gases), France (land), and Spain (freshwater).

  8. 19 CFR 210.57 - Amendment of the motion.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Amendment of the motion. 210.57 Section 210.57 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Temporary Relief § 210.57 Amendment of the motion. A motion for...

  9. International Arid Lands Consortium: Better land stewardship in water and watershed management

    Science.gov (United States)

    Peter F. Ffolliott; James T. Fisher; Menachem Sachs; Darrell W. DeBoer; Jeffrey O. Dawson; Timothy E. Fulbright; John Tracy

    2000-01-01

    The International Arid Lands Consortium (IALC) was established in 1990 to promote research, education, and training for the development, management, and restoration of arid and semi-arid lands throughout the world. One activity of IALC members and cooperators is to support research and development and demonstration projects that enhance management of these fragile...

  10. Motion Transplantation Techniques: A Survey

    NARCIS (Netherlands)

    van Basten, Ben; Egges, Arjan

    2012-01-01

    During the past decade, researchers have developed several techniques for transplanting motions. These techniques transplant a partial auxiliary motion, possibly defined for a small set of degrees of freedom, on a base motion. Motion transplantation improves motion databases' expressiveness and

  11. Globalization of water and food through international trade: impacts on food security, resilience and justice

    Science.gov (United States)

    D'Odorico, P.; Carr, J. A.; Seekell, D. A.; Suweis, S. S.

    2015-12-01

    The global distribution of water resources in general depends on geographic conditions but can be (virtually) modified by humans through mechanisms of globalization, such as trade, that make food commodities available to populations living far from the production regions. While trade is expected to improve access to food and (virtual) water, its impact on the global food system and its vulnerability to shocks remains poorly understood. It is also unclear who benefits from trade and whether it contributes to inequality and justice in resource redistribution. We reconstruct the global patterns of food trade and show with a simple model how the ongoing intensification of imports and exports has eroded the resilience of the global food system. Drawing on human rights theory, we investigate the relationship between inequality and injustice in access to water and food. We assess the fulfillment of positive and negative water and food rights and evaluate the obligations arising from the need to ensure that these rights are met throughout the world. We find that trade enhances the vulnerability to shocks but overall increase the number of people whose water and food rights are met.

  12. International Working Group on Water Reactor Fuel Performance and Technology. Summary report of the 14. plenary meeting. Working material

    International Nuclear Information System (INIS)

    1997-01-01

    The fourteenth Plenary Meeting of the International Working Group on Water Reactor Fuel Performance and Technology (IWGFPT) was held at IAEA Headquarters, Vienna, from 21 to 23 May 1997. Twenty-seven participants, from twenty two Member States and two international organizations, attended the meeting. These presentations generally gave: The general situation of the nuclear industry in the country; Fuel fabrication; Fuel performance, high burnup fuel (including MOX) operational experience; Status and trends in fuel research programmes directed to achievement sufficient safety margins at high burnups with regard to normal and transient operational conditions. Majority of countries reported on the stable situation of the nuclear fuel industry, i.e. without significant additions/cuts in nuclear power plant and fuel fabrication plant (NPP) capacities. Refs, figs, tabs

  13. International Working Group on Water Reactor Fuel Performance and Technology. Summary report of the 14. plenary meeting. Working material

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-12-01

    The fourteenth Plenary Meeting of the International Working Group on Water Reactor Fuel Performance and Technology (IWGFPT) was held at IAEA Headquarters, Vienna, from 21 to 23 May 1997. Twenty-seven participants, from twenty two Member States and two international organizations, attended the meeting. These presentations generally gave: The general situation of the nuclear industry in the country; Fuel fabrication; Fuel performance, high burnup fuel (including MOX) operational experience; Status and trends in fuel research programmes directed to achievement sufficient safety margins at high burnups with regard to normal and transient operational conditions. Majority of countries reported on the stable situation of the nuclear fuel industry, i.e. without significant additions/cuts in nuclear power plant and fuel fabrication plant (NPP) capacities. Refs, figs, tabs.

  14. Report of International Workshop on tracing isotopic composition of past and present precipitation - opportunities for climate and water studies

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-12-31

    The Workshop on Tracing Isotopic Composition of Past and Present Precipitation - Opportunities for Climate and Water Studies, was jointly organized by the World Meteorological Organization (WMO), the International Atomic Energy Agency (IAEA), Past Global Changes (PAGES) - a core project of the International Geosphere - Biosphere Programme (IGBP), and the International Association of Hydrological Sciences (IAHS). The Global Network ``Isotopes in Precipitation`` (GNIP) was initiated by IAEA in 1958 and became operational in 1961. The main objective was to collect systematic data on isotopic content of precipitation on a global scale and to establish temporal and spatial variations of environmental isotopes in precipitation. The network is now expected to serve additional purposes, namely as a benchmark for the interpretation of paleo-records, as a validation tool for Global Circulation Models, and for establishing large-scale regional (and continental-scale) waster balances. Furthermore, the structure of GNIP should be strengthened. This includes the build-up of: stations located close to major natural climatic archives (e.g. Greenland, mountain areas); stations which represent climatically sensitive areas (indicated by GCM`s and biome models). Isotope monitoring of river outflow from major continental basins should be initiated. This could be realized in co-operation with the UNEP/WHO Global Environmental Monitoring System-Water (GEMS-Water). The deuterium excess parameter ({delta}) is of particular importance in climate modelling and in the understanding of hydro-meteorological pathways. The use of the deuterium excess imposes strict requirements on the accuracy of deuterium and oxygen-18 analysis. A GNIP-based worldwide documentation of quality control regarding sampling, shipping and measurements is needed. The IAEA/WMO database and other isotope data sets should be included in the World Data Center A for palaeo-climatology. Refs, figs, tabs.

  15. Report of International Workshop on tracing isotopic composition of past and present precipitation - opportunities for climate and water studies

    International Nuclear Information System (INIS)

    1995-01-01

    The Workshop on Tracing Isotopic Composition of Past and Present Precipitation - Opportunities for Climate and Water Studies, was jointly organized by the World Meteorological Organization (WMO), the International Atomic Energy Agency (IAEA), Past Global Changes (PAGES) - a core project of the International Geosphere - Biosphere Programme (IGBP), and the International Association of Hydrological Sciences (IAHS). The Global Network ''Isotopes in Precipitation'' (GNIP) was initiated by IAEA in 1958 and became operational in 1961. The main objective was to collect systematic data on isotopic content of precipitation on a global scale and to establish temporal and spatial variations of environmental isotopes in precipitation. The network is now expected to serve additional purposes, namely as a benchmark for the interpretation of paleo-records, as a validation tool for Global Circulation Models, and for establishing large-scale regional (and continental-scale) waster balances. Furthermore, the structure of GNIP should be strengthened. This includes the build-up of: stations located close to major natural climatic archives (e.g. Greenland, mountain areas); stations which represent climatically sensitive areas (indicated by GCM's and biome models). Isotope monitoring of river outflow from major continental basins should be initiated. This could be realized in co-operation with the UNEP/WHO Global Environmental Monitoring System-Water (GEMS-Water). The deuterium excess parameter (δ) is of particular importance in climate modelling and in the understanding of hydro-meteorological pathways. The use of the deuterium excess imposes strict requirements on the accuracy of deuterium and oxygen-18 analysis. A GNIP-based worldwide documentation of quality control regarding sampling, shipping and measurements is needed. The IAEA/WMO database and other isotope data sets should be included in the World Data Center A for palaeo-climatology. Refs, figs, tabs

  16. International dissemination of epidemic Vibrio cholerae by cargo ship ballast and other nonpotable waters.

    Science.gov (United States)

    McCarthy, S A; Khambaty, F M

    1994-07-01

    In 1991 and 1992, toxigenic Vibrio cholerae O1, serotype Inaba, biotype El Tor, was recovered from nonpotable (ballast, bilge, and sewage) water from five cargo ships docked in ports of the U.S. Gulf of Mexico. Four of these ships had taken on ballast water in cholera-infected countries; the fifth took on ballast in a noninfected country. Isolates examined by pulsed-field gel electrophoresis were indistinguishable from the Latin American epidemic strain, C6707; however, they differed significantly from the endemic Gulf Coast strain (VRL 1984), the sixth-pandemic strain (569-B), and a V. cholerae non-O1 strain isolated from a ship arriving from a foreign port. On the basis of our findings, the Food and Drug Administration recommended that the U.S. Coast Guard issue an advisory to shipping agents and captains requesting that ballast waters be exchanged on the high seas before entry of ships into U.S. ports.

  17. [The adaptation reactions in hormonal systems to the internal use of mineral waters].

    Science.gov (United States)

    Polushina, N D

    1991-01-01

    A single intake of mineral water Essentuki 17 by male Wistar rats (n-130, b. w. 180-250 g) leads to stress reactions. It is evident from elevated levels of ACTH, hydrocortisone, leuenkephaline, glucagon and gastrin. Course intake of the water brings about a rise in most of the hormones levels studied. However, single doses of Essentuki 17 inhibit production of hormones in the adrenals, hypophysis, hypothalamus, the system of endogenic opiates. The enhancement of relevant levels are noted in the gastroenteropancreatic system.

  18. A Numerical and Experimental Investigation of the Internal Flow of a Freezing Water Droplet

    OpenAIRE

    Karlsson, Linn

    2015-01-01

    The overarching aim of this work is to study the freezing process of a single water droplet freezing on a cold surface, which is an interesting and important phenomenon with possible applications in many areas. Understanding the freezing process of a single water droplet is for example an important step when preventing unwanted icing, e.g. in the case of airplane wings and propellers, wind turbine rotor blades, and road surfaces.As a step in understanding the freezing process, the study speci...

  19. International Space Station United States Laboratory Module Water Recovery Management Subsystem Verification from Flight 5A to Stage ULF2

    Science.gov (United States)

    Williams, David E.; Labuda, Laura

    2009-01-01

    The International Space Station (ISS) Environmental Control and Life Support (ECLS) system comprises of seven subsystems: Atmosphere Control and Supply (ACS), Atmosphere Revitalization (AR), Fire Detection and Suppression (FDS), Temperature and Humidity Control (THC), Vacuum System (VS), Water Recovery and Management (WRM), and Waste Management (WM). This paper provides a summary of the nominal operation of the United States (U.S.) Laboratory Module WRM design and detailed element methodologies utilized during the Qualification phase of the U.S. Laboratory Module prior to launch and the Qualification of all of the modification kits added to it from Flight 5A up and including Stage ULF2.

  20. First meeting of the International Working Group on Advanced Technologies for Water Cooled Reactors, Vienna, 18-21 May 1987. (Pt. 1)

    International Nuclear Information System (INIS)

    1987-12-01

    The first meeting of the IAEA International Working Group on Advanced Technologies for Water Cooled Reactors was held in Vienna, Austria from 18-21 May 1987. Part I of the Summary Report contains the minutes of the meeting

  1. Microbiology of aquatic environments: Characterizations of the microbiotas of municipal water supplies, the International Space Station Internal Active Thermal Control System's heat transport fluid, and US Space Shuttle drinking water

    Science.gov (United States)

    Bernardini, James Nicholas, III

    An understanding of the microbiota within life support systems is essential for the prolonged presence of humans in space. This is because microbes may cause disease or induce biofouling and/or corrosion within spacecraft water systems. It is imperative that we develop effective high-throughput technologies for characterizing microbial populations that can eventually be used in the space environment. This dissertation describes testing and development of such methodologies, targeting both bacteria and viruses in water, and examines the bacterial and viral diversity within two spacecraft life support systems. The bacterial community of the International Space Station Internal Active Thermal Control System (IATCS) was examined using conventional culture-based and advanced molecular techniques including adenosine triphosphate (ATP) and Limulus Amebocyte Lysate (LAL) assays, direct microscopic examination, and analyses of 16S rRNA gene libraries from the community metagenome. The cultivable heterotrophs of the IATCS fluids ranged from below detection limit to 1.1x10 5/100 ml, and viable cells, measured by ATP, ranged from 1.4x10 3/100 ml to 7.7x105/100 ml. DNA extraction, cloning, sequencing, and bioinformatic analysis of the clones from 16S RNA gene libraries showed members of the firmicutes, alpha, beta, and gamma-proteobacteria to be present in the fluids. This persistent microbial bioburden and the presence of probable metal reducers, biofilm formers, and opportunistic pathogens illustrate the need for better characterization of bacterial communities present within spacecraft fluids. A new methodology was developed for detection of viruses in water using microarrays. Samples were concentrated by lyophilization, resuspended and filtered (0.22microm). Viral nucleic acids were then extracted, amplified, fluorescently labeled and hybridized onto a custom microarray with probes for ˜1000 known viruses. Numerous virus signatures were observed. Human Adenovirus C and

  2. Summary of principles for intervention in food and drinking water in a radiological emergency developed by several international organizations

    International Nuclear Information System (INIS)

    Sugiyama, Hideo

    1994-01-01

    After the Chernobyl accident in April 1986 it became clear that the guidelines on the management of the consequence of a nuclear accident were needed for action over long time scales and for dealing with the widespread radioactive contamination that affected many countries at distances far from the accident site. One of the major difficulties in area away from the site of a nuclear accident concerns decisions on the safety of contaminated food and drinking water. International organizations, ICRP, IAEA, WHO and several other organizations, have considered it appropriate to develop guidelines to assist national authorities in making decisions on the control of food in the event of widespread contamination by radionuclides in a radiological emergency. These guidelines and the recommendations for intervention in food and drinking water by WHO, ICRP and CEC are summarized, and the considerations and problems to adopt the guidelines are proposed in this paper. (author)

  3. International symposium on advances in isotope hydrology and its role in sustainable water resources management (IHS-2007). Book of abstracts

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2007-07-01

    The quadrennial IAEA isotope hydrology symposia provide an international forum for a comprehensive review of the state of the art and recent advances in this field. The symposia also facilitate the transfer of information, knowledge and interactions between developed and developing countries. Isotopes are increasingly being used to address many of the challenges in sustainable water resources management. The integration of these tools with classical methods and spatial information technologies has been growing rapidly over the past sel years. These have provided unsurpassed capabilities to apply nuclear and geochemical techniques in complex hydrological systems. The main objectives of this symposium are to: - Review the state of the art in isotope hydrology; - Outline recent developments in the application of isotope techniques for water resources management; - Identify future trends and developments for research and applications.

  4. International symposium on advances in isotope hydrology and its role in sustainable water resources management (IHS-2007). Book of abstracts

    International Nuclear Information System (INIS)

    2007-01-01

    The quadrennial IAEA isotope hydrology symposia provide an international forum for a comprehensive review of the state of the art and recent advances in this field. The symposia also facilitate the transfer of information, knowledge and interactions between developed and developing countries. Isotopes are increasingly being used to address many of the challenges in sustainable water resources management. The integration of these tools with classical methods and spatial information technologies has been growing rapidly over the past several years. These have provided unsurpassed capabilities to apply nuclear and geochemical techniques in complex hydrological systems. The main objectives of this symposium are to: - Review the state of the art in isotope hydrology; - Outline recent developments in the application of isotope techniques for water resources management; - Identify future trends and developments for research and applications

  5. Water, Biodiversity and Climate Change Studies in International Schools Network of the Park Škocjan Caves, Slovenia

    Science.gov (United States)

    Debevec Gerjevic, Vanja

    2010-05-01

    As UNESCO World Heritage Site, Ramsar Site and Biosphere Reserve the Park Škocjan Caves strongly believes in development of quality educational programme in order to fulfill the guidelines of international conventions and also provide for awareness and development in the future. Ten years ago we started with water analysis projects and performed several projects related to natural, cultural and social aspect of water protection. We developed a special model of training the teachers and educating the children. Together we have accomplished two international projects, two national project and several research projects dealing with The Reka river and karst phenomena. In 2003 we officially established the schools network, where we join in research education programmes five elementary schools form Slovenia and two from Italy. They are all located beside the surface and underground flow of the Reka River. Fifteen teachers and more than hundred children are involved in educational programme every year. Our work in the schools network enables us to bring science to society in a comprehensive way including the scientists and their work in preparation and implementation of projects. With teachers help we promote science studies but also encourage children to do social projects in order to keep intergeneration connections and gain knowledge of past experience and life from our grandparents. The paper will present the role of protected area in public awareness and education with special emphasis on natural phenomena of water in the Karst region as a toll for joint work in the field for scientists and school children. Chemical and biological analysis of the Reka River and other water bodies will be presented and accompanied with the biodiversity survey and climate change research projects. New approach of performing the research studies and presentation of results for schoolchildren will be explained.

  6. Investigation of forced convection heat transfer of supercritical pressure water in a vertically upward internally ribbed tube

    International Nuclear Information System (INIS)

    Wang Jianguo; Li Huixiong; Guo Bin; Yu Shuiqing; Zhang Yuqian; Chen Tingkuan

    2009-01-01

    In the present paper, the forced convection heat transfer characteristics of water in a vertically upward internally ribbed tube at supercritical pressures were investigated experimentally. The six-head internally ribbed tube is made of SA-213T12 steel with an outer diameter of 31.8 mm and a wall thickness of 6 mm and the mean inside diameter of the tube is measured to be 17.6 mm. The experimental parameters were as follows. The pressure at the inlet of the test section varied from 25.0 to 29.0 MPa, and the mass flux was from 800 to 1200 kg/(m 2 s), and the inside wall heat flux ranged from 260 to 660 kW/m 2 . According to experimental data, the effects of heat flux and pressure on heat transfer of supercritical pressure water in the vertically upward internally ribbed tube were analyzed, and the characteristics and mechanisms of heat transfer enhancement, and also that of heat transfer deterioration, were also discussed in the so-called large specific heat region. The drastic changes in thermophysical properties near the pseudocritical points, especially the sudden rise in the specific heat of water at supercritical pressures, may result in the occurrence of the heat transfer enhancement, while the covering of the heat transfer surface by fluids lighter and hotter than the bulk fluid makes the heat transfer deteriorated eventually and explains how this lighter fluid layer forms. It was found that the heat transfer characteristics of water at supercritical pressures were greatly different from the single-phase convection heat transfer at subcritical pressures. There are three heat transfer modes of water at supercritical pressures: (1) normal heat transfer, (2) deteriorated heat transfer with low HTC but high wall temperatures in comparison to the normal heat transfer, and (3) enhanced heat transfer with high HTC and low wall temperatures in comparison to the normal heat transfer. It was also found that the heat transfer deterioration at supercritical pressures was

  7. Acoustic observations of internal tides and tidal currents in shallow water.

    Science.gov (United States)

    Turgut, Altan; Mignerey, Peter C; Goldstein, David J; Schindall, Jeffrey A

    2013-04-01

    Significant acoustic travel-time variability and frequency shifts of acoustic intensity level curves in broadband signal spectrograms were measured in the East China Sea during the summer of 2008. The broadband pulses (270-330 Hz) were transmitted from a fixed source and received at a bottomed horizontal array, located at the 33 km range. The acoustic intensity level curves of the received signals indicate regular frequency shifts that are well correlated with the measured internal tides. Similarly, regular travel-time shifts of the acoustic mode arrivals correlate well with the barotropic tides and can be explained by tidal currents along the acoustic propagation track. These observations indicate the potential of monitoring internal tides and tidal currents using low-frequency acoustic signals propagating at long ranges.

  8. Fish out of Water: Refugee and International Students in Mainstream Australian Schools

    Science.gov (United States)

    Dumenden, Iris E.; English, Rebecca

    2013-01-01

    In this paper, the authors combine Pierre Bourdieu's concept of hysteresis (the "fish out of water" experience) with the discourse historical approach to critical discourse analysis (CDA) as a theoretical and analytical framework through which they examine specific moments in the schooling experiences of one refugee student and one…

  9. Recruitment of benthic Microcystis (Cyanophyceae) to the water column: internal buoyancy changes or resuspension?

    NARCIS (Netherlands)

    Verspagen, J.M.H.; Snelder, E.O.F.M.; Visser, P.M.; Huisman, J.; Mur, L.R.; Ibelings, B.W.

    2004-01-01

    In some lakes, large amounts of the potentially toxic cyanobacterium Microcystis overwinter in the sediment. This overwintering population might inoculate the water column in spring and promote the development of dense surface blooms of Microcystis during summer. In the Dutch Lake Volkerak, we found

  10. Water scarcity from climate change and adaptation response in an international river basin context

    NARCIS (Netherlands)

    Levin-Koopman, J.F.; Kuik, O.J.; Tol, Richard S.J.; Brouwer, Roy

    We simulate and analyze the direct and indirect economic impacts of climate change on water availability for irrigation on the economy of the Netherlands and the other EU countries which share the Rhine and Meuse river basin (France, Germany and Belgium), employing a computable general equilibrium

  11. Requirements and international co-operation in nuclear safety for evolutionary light water reactors

    International Nuclear Information System (INIS)

    Carnino, A.

    1999-01-01

    The principles of safety are now well known and implemented world-wide, leading to a situation of harmonisation in accordance with the Convention on Nuclear Safety. Future reactors are expected not only to meet current requirements but to go beyond the safety level presently accepted. To this end, technical safety requirements, as defined by the IAEA document Safety Fundamentals, need be duly considered in the design, the risks to workers and population must be decreased, a stable, transparent and objective regulatory process, including an international harmonisation with respect to licensing of new reactors, must be developed, and the issue of public acceptance must be addressed. Well-performing existing installations are seen as a prerequisite for an improved public acceptability; there should be no major accidents, the results from safety performance indicators must be unquestionable, and compliance with internationally harmonised criteria is essential. Economical competitiveness is another factor that influences the acceptability; the costs for constructing the plant, for its operation and maintenance, for the fuel cycle, and for the final decommissioning are of paramount importance. Plant simplification, longer fuel cycles, life extension are appealing options, but safety will have first priority. The IAEA can play an important role in this field, by providing peer reviews by teams of international experts and assistance to Member States on the use of its safety standards. (author)

  12. Internal exposure monitoring of personnel of a nuclear power plant with pressurized-water reactors

    International Nuclear Information System (INIS)

    Krueger, F.W.; Poulheim, K.F.; Rueger, G.; Schreiter, W.D.

    1982-01-01

    In the GDR a programme for monitoring the internal radiation exposure of personnel has been established in the Bruno Leuschner Nuclear Power Plant, Greifswald, which allows one to estimate the effective dose equivalent in the way recommended by the ICRP. The measuring equipment used, and the methods of calibration and of evaluation of results are described. At present about 400 persons are monthly monitored with a thorax monitor in the nuclear power plant. If an investigation level - corresponding to an effective dose equivalent of 0.3mSv/month - is exceeded, a more exact measurement is made in the whole-body counter at the National Board for Nuclear Safety and Radiation Protection of the GDR. In addition, a selected group of 50 persons is measured twice yearly in the whole-body counter. The measurements show the high effectiveness of the protective measures against radionuclide intake by workers in the nuclear power plant, resulting in a contribution of less than 1% to the collective dose of the personnel. A correlation has been found between external and internal exposure indicating that, in general, there will be a higher intake only under conditions resulting also in higher external exposures. The highest individual values of internal exposure found are below 0.5mSv/month and thus within the range of the lower detection limit of dosimeter films used for monitoring the external exposure. (author)

  13. Vertical pressure gradient and particle motions in wave boundary layers

    DEFF Research Database (Denmark)

    Jensen, Karsten Lindegård

    . The experiment is conducted in a oscillating water tunnel, for both smooth bed and rough bed. The particle motion is determined by utilizing particle tracking base on a video recording of the particle motion in the flow. In the oscillatory flow, in contrast to steady current, the particle motion is a function...

  14. Quench of molten aluminum oxide associated with in-vessel debris retention by RPV internal water

    International Nuclear Information System (INIS)

    Maruyama, Yu; Yamano, Norihiro; Moriyama, Kiyofumi; Park, Hyun Sun; Kudo, Tamotsu; Yang, Yanhua; Sugimoto, Jun

    1999-01-01

    In-vessel debris coolability experiments were performed in ALPHA program at JAERI. Molten aluminum oxide (Al 2 O 3 ) was poured into a pool of water in a lower head experimental vessel. Post-test observation and measurement using an ultrasonic technique indicated the formation of the interfacial gap between the solidified Al 2 O 3 and the vessel wall. Thermal responses of the vessel wall implied that the interfacial gap acted initially as a thermal resistance and water subsequently penetrated into the interfacial gap. The maximum heat flux at the inner surface of the vessel facing to the solidified Al 2 O 3 was roughly evaluated to be ranged from 320 kW/m 2 to 600 kW/m 2 . A post-test analysis was conducted with CAMP code. The influence of the interfacial gap on thermal behavior of Al 2 O 3 and the vessel wall was examined. (authors)

  15. International Space Science Institute Workshop on Shallow Clouds, Water Vapor, Circulation and Climate Sensitivity

    CERN Document Server

    Winker, David; Bony, Sandrine; Stevens, Bjorn

    2018-01-01

    This volume presents a series of overview articles arising from a workshop exploring the links among shallow clouds, water vapor, circulation, and climate sensitivity. It provides a state-of-the art synthesis of understanding about the coupling of clouds and water vapor to the large-scale circulation. The emphasis is on two phenomena, namely the self-aggregation of deep convection and interactions between low clouds and the large-scale environment, with direct links to the sensitivity of climate to radiative perturbations. Each subject is approached using simulations, observations, and synthesizing theory; particular attention is paid to opportunities offered by new remote-sensing technologies, some still prospective. The collection provides a thorough grounding in topics representing one of the World Climate Research Program’s Grand Challenges. Previously published in Surveys in Geophysics, Volume 38, Issue 6, 2017 The articles “Observing Convective Aggregation”, “An Observational View of Relationshi...

  16. Internal conditions of a bubble containing radio-frequency plasma in water

    International Nuclear Information System (INIS)

    Mukasa, Shinobu; Nomura, Shinfuku; Toyota, Hiromichi; Maehara, Tsunehiro; Yamashita, Hiroshi

    2011-01-01

    We analyzed the gas generated by a radio-frequency plasma in water and found that the ratio of oxygen to hydrogen in it was approximately 0.7-11%. Numerical simulations of the chemical reactions occurring inside and outside the bubble with increasing energy supply in the concentric volume in it were carried out. Thermal conduction and diffusion occurring inside and outside the bubble, and evaporation (condensation) and solution of gases at the surface were taken into consideration. After terminating the energy supply, we found that nearly all the oxygen within the bubble was consumed but that hydrogen remained, and that oxygen in the water produced from dissolved chemical species diffused into the bubble. Good agreement with experiment results was obtained for reducing the production rate of hydrogen and the oxygen-hydrogen ratio that occurred with a pressure increase. We found that in comparison with experimental results the hydrogen production rate was underestimated by approximately 35%.

  17. 1st International Conference on Hydraulic Design in Water Resources Engineering : Channels and Channel Control Structures

    CERN Document Server

    1984-01-01

    The development of water resources has proceeded at an amazing speed around the world in the last few decades. The hydraulic engineer has played his part: in constructing much larger artificial channels than ever before, larger and more sophisticated control structures, and systems of irrigation, drainage and water supply channels in which the flow by its nature is complex and unsteady requiring computer-based techniques at both the design and operation stage. It seemed appropriate to look briefly at some of the developments in hydraulic design resulting from this situation. Hence the idea of the Conference was formed. The Proceedings of the Conference show that hydraulic engineers have been able to acquire a very substantial base of design capability from the experience of the period referred to. The most outstanding development to have occurred is in the combination of physical and mathematical modelling, which in hydraulic engineering has followed a parallel path to that in other branches of engineering sc...

  18. On the necessity for evaluation of the limits of radioactive waste disposal into water systems of international importance

    International Nuclear Information System (INIS)

    Gedeonov, L.I.; Blinov, V.A.; Gustova, L.I.; Ivanova, L.M.; Lazarev, L.N.; Vakulovskij, S.M.; Chumichev, V.B.; Rakov, N.A.

    1977-01-01

    The paper considers the IAEA criteria for determination of the concept of high-level radioactive waste, the disposal of which into the oceans is forbidden according to the London Convention of 1972. It is proposed that this concept be revised every five years, using the experience which may be acquired from the present practice of disposal in the Atlantic. Data on the assessment of global fallout quantities introduced into the Atlantic and on the dilution of contamination in its waters are given. The problem is discussed of the principles of international collaboration in accepting limiting rates of disposal into water systems of international importance. It is shown that in the Irish Sea and the North Sea sources of radioactive contamination have arisen which are dangerous for the Baltic. Co-operative research of the Baltic within the CEC framework is reported. A review and evaluation of radiation conditions and their trends in the Baltic Sea is given. The problem of mutual co-operation in limiting radioactive pollution of the Danube between countries in the Danube Catchment Area is discussed. A review and a forecast of trends of radiation conditions in the Danube area are given. (author)

  19. International experience and status of fuel element performance and modelling for water reactors

    International Nuclear Information System (INIS)

    Gittus, J.H.

    1982-04-01

    Current knowledge concerning water reactor fuel performance and technology is reviewed (212 references). The emphasis is on aspects of in-reactor performance including behaviour in accidents. Computer models for predicting fuel behaviour during the ordinary running of the reactor and during accidents are described. These codes include COMETHE, HOTROD, SLEUTH-SEER and FRAPCON. Their agreement with experimental data is examined. (U.K.)

  20. A 2D fluid motion model of the estuarine water circulation: Physical analysis of the salinity stratification in the Sebou estuary

    Science.gov (United States)

    Haddout, Soufiane; Maslouhi, Abdellatif; Magrane, Bouchaib

    2018-02-01

    Estuaries, which are coastal bodies of water connecting the riverine and marine environment, are among the most important ecosystems in the world. Saltwater intrusion is the movement of coastal saline water into an estuary, which makes up-estuary water, that becomes salty due to the mixing of freshwater with saltwater. It has become a serious environmental problem in the Sebou estuary (Morocco) during wet and dry seasons, which have a considerable impact on residential water supply, agricultural water supply as well as urban industrial production. The variations of salt intrusion, and the vertical stratification under different river flow conditions in the Sebou estuary were investigated in this paper using a two-dimensional numerical model. The model was calibrated and verified against water level variation, and salinity variation during 2016, respectively. Additionally, the model validation process showed that the model results fit the observed data fairly well ( R2 > 0.85, NSC > 0.89 and RMSE = 0.26 m). Model results show that freshwater is a dominant influencing factor to the saltwater intrusion and controlled salinity structure, vertical stratification and length of the saltwater intrusion. Additionally, the extent of salinity intrusion depends on the balance between fresh water discharges and saltwater flow from the sea. This phenomenon can be reasonably predicted recurring to mathematical models supported by monitored data. These tools can be used to quantify how much fresh water is required to counterbalance salinity intrusion at the upstream water intakes.

  1. Stress Corrosion Evaluation of Various Metallic Materials for the International Space Station Water Recycling System

    Science.gov (United States)

    Torres, P. D.

    2015-01-01

    A stress corrosion evaluation was performed on Inconel 625, Hastelloy C276, titanium commercially pure (TiCP), Ti-6Al-4V, Ti-6Al-4V extra low interstitial, and Cronidur 30 steel as a consequence of a change in formulation of the pretreatment for processing the urine in the International Space Station Environmental Control and Life Support System Urine Processing Assembly from a sulfuric acid-based to a phosphoric acid-based solution. The first five listed were found resistant to stress corrosion in the pretreatment and brine. However, some of the Cronidur 30 specimens experienced reduction in load-carrying ability.

  2. High power cable with internal water cooling 400 kV

    Energy Technology Data Exchange (ETDEWEB)

    Rasquin, W; Harjes, B

    1982-08-01

    The project was planned for a duration of 4 years. Afterwards it has been extended over 6 years and finally stopped after 3 1/2 years. Therefore, of course results of field tests with an internally cooled 400 kV cable are not available. Nevertheless, this conductor cooled high power cable has been developed to such an extend, that this manufactured cable could withstand type tests according to IEC/VDE recommendations. Even by missing field tests it is obvious that a high power cable for 400 kV is available.

  3. International safeguards for a light-water reactor fuels reprocessing plant: containment and surveillance concepts

    International Nuclear Information System (INIS)

    Cameron, C.P.; Bleck, M.E.

    1980-12-01

    Concepts for containment/surveillance for reprocessing plants are described, conceptual designs are developed, and their effectiveness is evaluated. A technical approach to design of containment/surveillance systems is presented, and design considerations are discussed. This is the second in a series of reports. The first described the basis for the study of international safeguards for reprocessing plants. In this second report, only containment/surveillance is discussed. The third report will discuss the integration of concepts for containment/surveillance and material accountancy

  4. The International Association of Hydrogeologists (IAH): reflecting on 60 years of contributions to groundwater science and water management

    Science.gov (United States)

    Struckmeier, Willi; Howard, Ken; Chilton, John

    2016-08-01

    The 60th anniversary of the founding of the International Association of Hydrogeologists (IAH) is an important milestone that allows pause for reflection on how the association has evolved over the years and the contributions it has made to groundwater science and water management. IAH was founded in 1956 at the 20th International Geological Congress and developed rapidly during the 1980s and 1990s in response to a growing global interest in groundwater mapping and in sound approaches to resource protection and sustainable aquifer management. Incorporated in 2000, IAH has now secured its position as the world's leading international association specialising in groundwater with over 4,100 members in 131 countries. Much credit for this success must go to members, past and present, whose individual efforts and collaboration with sister institutions are documented here. These members have shaped the association's goals and contributed selflessly to its scientific programmes, publications and educational and charitable activities. Looking ahead to the next 60 years, it is essential that IAH does not rest on past achievements but listens and adjusts to the needs of members while continuing to pursue its mission of furthering the understanding, wise use and protection of groundwater resources throughout the world.

  5. Autoantibody-induced internalization of CNS AQP4 water channel and EAAT2 glutamate transporter requires astrocytic Fc receptor.

    Science.gov (United States)

    Hinson, Shannon R; Clift, Ian C; Luo, Ningling; Kryzer, Thomas J; Lennon, Vanda A

    2017-05-23

    Aquaporin-4 (AQP4) water channel-specific IgG distinguishes neuromyelitis optica (NMO) from multiple sclerosis and causes characteristic immunopathology in which central nervous system (CNS) demyelination is secondary. Early events initiating the pathophysiological outcomes of IgG binding to astrocytic AQP4 are poorly understood. CNS lesions reflect events documented in vitro following IgG interaction with AQP4: AQP4 internalization, attenuated glutamate uptake, intramyelinic edema, interleukin-6 release, complement activation, inflammatory cell recruitment, and demyelination. Here, we demonstrate that AQP4 internalization requires AQP4-bound IgG to engage an astrocytic Fcγ receptor (FcγR). IgG-lacking Fc redistributes AQP4 within the plasma membrane and induces interleukin-6 release. However, AQP4 endocytosis requires an activating FcγR's gamma subunit and involves astrocytic membrane loss of an inhibitory FcγR, CD32B. Interaction of the IgG-AQP4 complex with FcγRs triggers coendocytosis of the excitatory amino acid transporter 2 (EAAT2). Requirement of FcγR engagement for internalization of two astrocytic membrane proteins critical to CNS homeostasis identifies a complement-independent, upstream target for potential early therapeutic intervention in NMO.

  6. Attention and apparent motion.

    Science.gov (United States)

    Horowitz, T; Treisman, A

    1994-01-01

    Two dissociations between short- and long-range motion in visual search are reported. Previous research has shown parallel processing for short-range motion and apparently serial processing for long-range motion. This finding has been replicated and it has also been found that search for short-range targets can be impaired both by using bicontrast stimuli, and by prior adaptation to the target direction of motion. Neither factor impaired search in long-range motion displays. Adaptation actually facilitated search with long-range displays, which is attributed to response-level effects. A feature-integration account of apparent motion is proposed. In this theory, short-range motion depends on specialized motion feature detectors operating in parallel across the display, but subject to selective adaptation, whereas attention is needed to link successive elements when they appear at greater separations, or across opposite contrasts.

  7. Quantized motion of trapped ions

    International Nuclear Information System (INIS)

    Steinbach, J.

    1999-01-01

    This thesis is concerned with a theoretical and numerical study of the preparation and coherent manipulation of quantum states in the external and internal degrees of freedom of trapped ions. In its first part, this thesis proposes and investigates schemes for generating several nonclassical states for the quantized vibrational motion of a trapped ion. Based on dark state preparation specific laser excitation configurations are presented which, given appropriately chosen initial states, realize the desired motional states in the steady-state, indicated by the cessation of the fluorescence emitted by the ion. The focus is on the SU(1,1) intelligent states in both their single- and two-mode realization, corresponding to one- and two-dimensional motion of the ion. The presented schemes are also studied numerically using a Monte-Carlo state-vector method. The second part of the thesis describes how two vibrational degrees of freedom of a single trapped ion can be coupled through the action of suitably chosen laser excitation. Concentrating on a two-dimensional ion trap with dissimilar vibrational frequencies a variety of quantized two-mode couplings are derived. The focus is on a linear coupling that takes excitations from one mode to another. It is demonstrated how this can result in a state rotation, in which it is possible to coherently transfer the motional state of the ion between orthogonal directions without prior knowledge of that motional state. The third part of this thesis presents a new efficient method for generating maximally entangled internal states of a collection of trapped ions. The method is deterministic and independent of the number of ions in the trap. As the essential element of the scheme a mechanism for the realization of a controlled NOT operation that can operate on multiple ions is proposed. The potential application of the scheme for high-precision frequency standards is explored. (author)

  8. Technical Analysis Ballast Water Treatment By Using Economizer Utilizing Main Engines Exhaust Heat To Comply With International Ship Ballast Water Management At Mv. Leader Win

    Directory of Open Access Journals (Sweden)

    Hari Prastowo

    2017-03-01

    Full Text Available Based on the International Ballast Water Management regulations (IBWM, waste water ballast itself has the attention of some researchers to reduce the amount of waste species present in the ballast water with a variety of methods, as of biological, physical, mechanical, and chemical. The decision-making tools such as ballast water heater, flow-through system and others where possible these tools can minimize waste species in ballast water at a certain temperature or pressure of the flow according to the calculations. This study was aimed to calculate and analysis the effectiveness of the system treatment between Option 1 (Economizer & Bundle and Option 2 (Economizer & Heat Excharger then it will compare. First option is using economizer and bundles to transfer a heat from a source heat of exhaust gas then medium by thermal oil circulated. The second option is using economizer and heat excharger where a same heat source , but sea water from ballast tank sirculated to heat excharger. And from economizer to heat excharger is using thermal oil as a heat medium. For all calculation and anaalysis is using softwere HTRI. First option having a duty 2.503 MegaWatts at economizer and 1.9567 MegaWatts at bundles. Over design 2.01% at Economizer and 7.1%5 at bundles. Pessure drop 63.287 kPa at thermal oil after economizer and 68.196 kPa after bundles. Treatment time to this option is 44.424 hors. Second option having a duty 3.38 MegaWatts at economizer and 3.1227 MegaWatts at heat excharger. Over design 5.85% at Economizer and 3.49%5 at heat excharger. Pessure drop 38.697 kPa at thermal oil after economizer and 28.476 kPa after heat excharger. Treatment time to second option is 42.03 hours. Option 2 (Economizer & Heat Excharger is more optimum than option in analytical techniques. By analysis of treatment system, are expected this thesis can be applied to either the MV. Leader Win Vessel to comply with the operational needs according to standard

  9. The international protocol for the dosimetry of external radiotherapy beams based on standards of absorbed dose to water

    International Nuclear Information System (INIS)

    Andreo, P.

    2001-01-01

    An International Code of Practice (CoP, or dosimetry protocol) for external beam radiotherapy dosimetry based on standards of absorbed dose to water has been published by the IAEA on behalf of IAEA, WHO, PAHO and ESTRO. The CoP provides a systematic and internationally unified approach for the determination of the absorbed dose to water in reference conditions with radiotherapy beams. The development of absorbed-dose-to-water standards for high-energy photons and electrons offers the possibility of reducing the uncertainty in the dosimetry of radiotherapy beams. Many laboratories already provide calibrations at the radiation quality of 60Co gamma-rays and some have extended calibrations to high-energy photon and electron beams. The dosimetry of kilovoltage x-rays, as well as that of proton and ion beams can also be based on these standards. Thus, a coherent dosimetry system based on the same formalism is achieved for practically all radiotherapy beams. The practical use of the CoP as simple. The document is formed by a set of different CoPs for each radiation type, which include detailed procedures and worksheets. All CoPs are based on ND,w chamber calibrations at a reference beam quality Qo, together with radiation beam quality correction factors kQ preferably measured directly for the user's chamber in a standards laboratory. Calculated values of kQ are provided together with their uncertainty estimates. Beam quality specifiers are 60Co, TPR20,10 (high-energy photons), R50 (electrons), HVL and kV (x-rays) and Rres (protons and ions) [es

  10. Effects of neutron radiation and residual stresses on the corrosion of welds in light water reactor internals

    International Nuclear Information System (INIS)

    Schaaf, Bob van der; Gavillet, Didier; Lapena, Jesus; Ohms, Carsten; Roth, Armin; Dyck, Steven van

    2006-01-01

    After many years of operation in Light Water Reactors (LWR) Irradiation Assisted Stress Corrosion Cracking (IASCC) of internals has been observed. In particular the heat-affected zone (HAZ) has been associated with IASCC attack. The welding process induces residual stresses and micro-structural modifications. Neutron irradiation affects the materials response to mechanical loading. IASCC susceptibility of base materials is widely studied, but the specific conditions of irradiated welds are rarely assessed. Core component relevant welds of Type 304 and 347 steels have been fabricated and were irradiated in the High Flux Reactor (HFR) in Petten to 0.3 and 1 dpa (displacement per atom). In-service welds were cut from the thermal shield of the decommissioned BR-3 reactor. Residual stresses, measured using neutron diffraction, ring core tests and X-ray showed residual stress levels up to 400 MPa. Micro-structural characterization showed higher dislocation densities in the weld and HAZ. Neutron radiation increased the dislocation density, resulting in hardening and reduced fracture toughness. The sensitization degree of the welds, measured with the electrochemical potentio-dynamic reactivation method, was negligible. The Slow Strain Rate Tensile (SSRT) tests, performed at 290 deg. C in water with 200 ppb dissolved oxygen, (DO), did not reveal inter-granular cracking. Inter-granular attack of in-service steel is observed in water with 8 ppm (DO), attributed not only to IASCC, but also to IGSCC from thermal sensitization during fabrication. Stress-relieve annealing has caused Cr-grain boundary precipitation, indicating the sensitization. The simulated internal welds, irradiated up to 1.0 dpa, did not show inter-granular cracking with 8 ppm DO. (authors)

  11. Assessment of internal contamination problems associated with bioregenerative air/water purification systems

    Science.gov (United States)

    Johnson, Anne H.; Bounds, B. Keith; Gardner, Warren

    1990-01-01

    The emphasis is to characterize the mechanisms of bioregenerative revitalization of air and water as well as to assess the possible risks associated with such a system in a closed environment. Marsh and aquatic plants are utilized for purposes of wastewater treatment as well as possible desalinization and demineralization. Foliage plants are also being screened for their ability to remove toxic organics from ambient air. Preliminary test results indicate that treated wastewater is typically of potable quality with numbers of pathogens such as Salmonella and Shigella significantly reduced by the artificial marsh system. Microbiological analyses of ambient air indicate the presence of bacilli as well as thermophilic actinomycetes.

  12. Objects in Motion

    Science.gov (United States)

    Damonte, Kathleen

    2004-01-01

    One thing scientists study is how objects move. A famous scientist named Sir Isaac Newton (1642-1727) spent a lot of time observing objects in motion and came up with three laws that describe how things move. This explanation only deals with the first of his three laws of motion. Newton's First Law of Motion says that moving objects will continue…

  13. Motion compensated digital tomosynthesis

    NARCIS (Netherlands)

    van der Reijden, Anneke; van Herk, Marcel; Sonke, Jan-Jakob

    2013-01-01

    Digital tomosynthesis (DTS) is a limited angle image reconstruction method for cone beam projections that offers patient surveillance capabilities during VMAT based SBRT delivery. Motion compensation (MC) has the potential to mitigate motion artifacts caused by respiratory motion, such as blur. The

  14. On the motion of internal carbonation layers

    NARCIS (Netherlands)

    Muntean, A.; Böhm, M.; Schmidt, A.; Franke, L.; Deckelmann, G.; Espinoza-Marzal, R.

    2009-01-01

    Carbonation is the reaction of environmental carbon dioxide with alkaline species in concrete. It is one of the major processes affecting the concrete durability. In this note, we review a few modelling strategies that are behind conceptually different carbonation models which are all able to

  15. Internal motion in high vacuum systems

    Science.gov (United States)

    Frank, J. M.

    Three transfer and positioning mechanisms have been developed for the non-air exposed, multistep processing of components in vacuum chambers. The functions to be performed in all of the systems include ultraviolet/ozone cleaning, vacuum baking, deposition of thin films, and thermocompression sealing of the enclosures. Precise positioning of the components is required during the evaporation and sealing processes. The three methods of transporting and positioning the components were developed to accommodate the design criteria and goals of each individual system. The design philosophy, goals, and operation of the three mechanisms are discussed.

  16. Rolling Shutter Motion Deblurring

    KAUST Repository

    Su, Shuochen

    2015-06-07

    Although motion blur and rolling shutter deformations are closely coupled artifacts in images taken with CMOS image sensors, the two phenomena have so far mostly been treated separately, with deblurring algorithms being unable to handle rolling shutter wobble, and rolling shutter algorithms being incapable of dealing with motion blur. We propose an approach that delivers sharp and undis torted output given a single rolling shutter motion blurred image. The key to achieving this is a global modeling of the camera motion trajectory, which enables each scanline of the image to be deblurred with the corresponding motion segment. We show the results of the proposed framework through experiments on synthetic and real data.

  17. Smoothing Motion Estimates for Radar Motion Compensation.

    Energy Technology Data Exchange (ETDEWEB)

    Doerry, Armin W. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-07-01

    Simple motion models for complex motion environments are often not adequate for keeping radar data coherent. Eve n perfect motion samples appli ed to imperfect models may lead to interim calculations e xhibiting errors that lead to degraded processing results. Herein we discuss a specific i ssue involving calculating motion for groups of pulses, with measurements only available at pulse-group boundaries. - 4 - Acknowledgements This report was funded by General A tomics Aeronautical Systems, Inc. (GA-ASI) Mission Systems under Cooperative Re search and Development Agre ement (CRADA) SC08/01749 between Sandia National Laboratories and GA-ASI. General Atomics Aeronautical Systems, Inc. (GA-ASI), an affilia te of privately-held General Atomics, is a leading manufacturer of Remotely Piloted Aircraft (RPA) systems, radars, and electro-optic and rel ated mission systems, includin g the Predator(r)/Gray Eagle(r)-series and Lynx(r) Multi-mode Radar.

  18. International symposium on isotope hydrology and integrated water resources management. Unedited proceedings

    International Nuclear Information System (INIS)

    2004-01-01

    Global effects to overcome the growing challenge of freshwater availability have been at the forefront of the world development agenda for nearly three decades. For developing policies towards sustainable management of freshwater resources, an improved understanding of the Earth's water cycle bas been widely recognized as one of the key elements of scientific information. The IAEA has played a crucial role in promoting and expanding the field of isotope hydrology. Starting in 1963, the IAEA's quadrennial symposia on isotope hydrology have played a central role in developing this scientific discipline. This publication contains 174 extended abstracts of papers and posters presented during 11 technical sessions of the 11th symposium in the series that was convened during 19-23 May 2003 in Vienna. Nearly 275 participants from 69 countries participated in the symposium to discuss the past, present and future of isotope applications in hydrology and climate research. Each of the papers and poster presentations have been analysed and indexed separately

  19. Curves from Motion, Motion from Curves

    Science.gov (United States)

    2000-01-01

    De linearum curvarum cum lineis rectis comparatione dissertatio geometrica - an appendix to a treatise by de Lalouv~re (this was the only publication... correct solution to the problem of motion in the gravity of a permeable rotating Earth, considered by Torricelli (see §3). If the Earth is a homogeneous...in 1686, which contains the correct solution as part of a remarkably comprehensive theory of orbital motions under centripetal forces. It is a

  20. Relative invasion risk for plankton across marine and freshwater systems: examining efficacy of proposed international ballast water discharge standards.

    Directory of Open Access Journals (Sweden)

    Oscar Casas-Monroy

    Full Text Available Understanding the implications of different management strategies is necessary to identify best conservation trajectories for ecosystems exposed to anthropogenic stressors. For example, science-based risk assessments at large scales are needed to understand efficacy of different vector management approaches aimed at preventing biological invasions associated with commercial shipping. We conducted a landscape-scale analysis to examine the relative invasion risk of ballast water discharges among different shipping pathways (e.g., Transoceanic, Coastal or Domestic, ecosystems (e.g., freshwater, brackish and marine, and timescales (annual and per discharge event under current and future management regimes. The arrival and survival potential of nonindigenous species (NIS was estimated based on directional shipping networks and their associated propagule pressure, environmental similarity between donor-recipient ecosystems (based on salinity and temperature, and effects of current and future management strategies (i.e., ballast water exchange and treatment to meet proposed international biological discharge standards. Our findings show that current requirements for ballast water exchange effectively reduce invasion risk to freshwater ecosystems but are less protective of marine ecosystems because of greater environmental mismatch between source (oceanic and recipient (freshwater ecoregions. Future requirements for ballast water treatment are expected to reduce risk of zooplankton NIS introductions across ecosystem types but are expected to be less effective in reducing risk of phytoplankton NIS. This large-scale risk assessment across heterogeneous ecosystems represents a major step towards understanding the likelihood of invasion in relation to shipping networks, the relative efficacy of different invasion management regimes and seizing opportunities to reduce the ecological and economic implications of biological invasions.

  1. Appraising longitudinal trends in the strategic risks cited by risk managers in the international water utility sector, 2005-2015.

    Science.gov (United States)

    Chalker, Rosemary T C; Pollard, Simon J T; Leinster, Paul; Jude, Simon

    2018-03-15

    We report dynamic changes in the priorities for strategic risks faced by international water utilities over a 10year period, as cited by managers responsible for managing them. A content analysis of interviews with three cohorts of risk managers in the water sector was undertaken. Interviews probed the focus risk managers' were giving to strategic risks within utilities, as well as specific questions on risk analysis tools (2005); risk management cultures (2011) and the integration of risk management with corporate decision-making (2015). The coding frequency of strategic (business, enterprise, corporate) risk terms from 18 structured interviews (2005) and 28 semi-structured interviews (12 in 2011; 16 in 2015) was used to appraise changes in the perceived importance of strategic risks within the sector. The aggregated coding frequency across the study period, and changes in the frequency of strategic risks cited at three interview periods identified infrastructure assets as the most significant risk over the period and suggests an emergence of extrinsic risk over time. Extended interviews with three utility risk managers (2016) from the UK, Canada and the US were then used to contextualise the findings. This research supports the ongoing focus on infrastructure resilience and the increasing prevalence of extrinsic risk within the water sector, as reported by the insurance sector and by water research organisations. The extended interviews provided insight into how strategic risks are now driving the implementation agenda within utilities, and into how utilities can secure tangible business value from proactive risk governance. Strategic external risks affecting the sector are on the rise, involve more players and are less controllable from within a utility's own organisational boundaries. Proportionate risk management processes and structures provide oversight and assurance, whilst allowing a focus on the tangible business value that comes from managing strategic

  2. Bottoming organic Rankine cycle configurations to increase Internal Combustion Engines power output from cooling water waste heat recovery

    International Nuclear Information System (INIS)

    Peris, Bernardo; Navarro-Esbrí, Joaquín; Molés, Francisco

    2013-01-01

    This work is focused on waste heat recovery of jacket cooling water from Internal Combustion Engines (ICEs). Cooling water heat does not always find use due to its low temperature, typically around 90 °C, and usually is rejected to the ambient despite its high thermal power. An efficient way to take benefit from the ICE cooling water waste heat can be to increase the power output through suitable bottoming Organic Rankine Cycles (ORCs). Thereby, this work simulates six configurations using ten non flammable working fluids and evaluates their performances in efficiency, safety, cost and environmental terms. Results show that the Double Regenerative ORC using SES36 gets the maximum net efficiency of 7.15%, incrementing the ICE electrical efficiency up to 5.3%, although requires duplicating the number of main components and high turbine size. A more rigorous analysis, based on the system feasibility, shows that small improvements in the basic cycle provide similar gains compared to the most complex schemes proposed. So, the single Regenerative ORC using R236fa and the Reheat Regenerative ORC using R134a seem suitable cycles which provide a net efficiency of 6.55%, incrementing the ICE electrical efficiency up to 4.9%. -- Highlights: • Suitable bottoming cycles for ICE cooling water waste heat recovery are studied. • Non flammable working fluids and various ORC configurations are evaluated. • Double regenerative cycle using SES36 is the most efficient configuration. • Regenerative and reheat regenerative ORCs seem feasible cycles. • Electrical efficiency of the ICE can be improved up to 5.3%

  3. Structural motion engineering

    CERN Document Server

    Connor, Jerome

    2014-01-01

    This innovative volume provides a systematic treatment of the basic concepts and computational procedures for structural motion design and engineering for civil installations. The authors illustrate the application of motion control to a wide spectrum of buildings through many examples. Topics covered include optimal stiffness distributions for building-type structures, the role of damping in controlling motion, tuned mass dampers, base isolation systems, linear control, and nonlinear control. The book's primary objective is the satisfaction of motion-related design requirements, such as restrictions on displacement and acceleration. The book is ideal for practicing engineers and graduate students. This book also: ·         Broadens practitioners' understanding of structural motion control, the enabling technology for motion-based design ·         Provides readers the tools to satisfy requirements of modern, ultra-high strength materials that lack corresponding stiffness, where the motion re...

  4. Hydraulic paths and estimation of the real residence time of the water in Lago Maggiore (N. Italy: application of massless markers transported in 3D motion fields

    Directory of Open Access Journals (Sweden)

    Nicoletta Sala

    2012-01-01

    Full Text Available This study, conducted using the TRIM_LM model, is a continuation of work on the movement of the water mass at different depths in Lago Maggiore, and thus on the estimation of the real residence time of the water in the lake. Three-dimensional CFD numerical simulations were extended to a 4-year period, focusing on the movements of 202 (two hundred and two massless markers inserted at different points in Lago Maggiore and at the mouths of 11 of its tributaries, enabling us to establish more realistic water renewal times for Lago Maggiore. By crossing the data of the horizontal trajectories of the environmental markers with those of their vertical variations, we reconstructed their movements over the four years of the simulation programme. An analysis of the results shows that the water mass in the layers of the upper 100 m has residence times between a minimum of 1 y and a maximum of 4-5 y. The water from the tributaries has residence times between 250 and 1000 days, depending on the distance of the tributaries from the closing section of the lake. The water in the layers below 100 m has residence times that still cannot be quantified with precision, but that can certainly be estimated at a number of years in two figures. These times are strongly conditioned by the depth of the late winter mixing, which in the last 40 y has not exceeded 200 m.

  5. Development of an internally cooled annular fuel bundle for pressurized heavy water reactors

    Energy Technology Data Exchange (ETDEWEB)

    Hamilton, H.; Armstrong, J.; Kittmer, A.; Zhuchkova, A.; Xu, R.; Hyland, B.; King, M.; Nava-Dominguez, A.; Livingstone, S.; Bergeron, A. [Atomic Energy of Canada, Ltd., Chalk River Laboratories, Chalk River, ON (Canada)

    2013-07-01

    A number of preliminary studies have been conducted at Atomic Energy of Canada Limited to explore the potential of using internally cooled annular fuel (ICAF) in CANDU reactors including finite element thermo-mechanical modelling, reactor physics, thermal hydraulics, fabrication and mechanical design. The most compelling argument for this design compared to the conventional solid-rod design is the significant reduction in maximum fuel temperature for equivalent LERs (linear element ratings). This feature presents the potential for power up-rating or higher burnup and a decreased defect probability due to in-core power increases. The thermal-mechanical evaluation confirmed the significant reduction in maximum fuel temperatures for ICAF fuel compared to solid-rod fuel for equivalent LER. The maximum fuel temperature increase as a function of LER increase is also significantly less for ICAF fuel. As a result, the sheath stress induced by an equivalent power increase is approximately six times less for ICAF fuel than solid-rod fuel. This suggests that the power-increase thresholds to failure (due to stress-corrosion cracking) for ICAF fuel should be well above those for solid-rod fuel, providing improvement in operation flexibility and safety.

  6. International light water nuclear fuel fabrication supply. Are fabrication services assured?

    International Nuclear Information System (INIS)

    Rothwell, Geoffrey

    2010-01-01

    This paper examines the cost structure of fabricating light water reactor (LWR) fuel with low-enriched uranium (LEU, with less than 5% enrichment). The LWR-LEU fuel industry is decades old, and (except for the high entry cost of designing and licensing a fuel fabrication facility and its fuel), labor and additional fabrication lines can be added at Nth-of-a-Kind cost to the maximum capacity allowed by a site license. The industry appears to be competitive: nuclear fuel fabrication capacity is assured with many competitors and reasonable prices. However, nuclear fuel assurance has become an important issue for nations now to considering new nuclear power plants. To provide this assurance many proposals equate 'nuclear fuel banks' (which would require fuel for specific reactors) with 'LEU banks' (where LEU could be blended into nuclear fuel with the proper enrichment) with local fuel fabrication. The policy issues (which are presented, but not answered in this paper) become (1) whether the construction of new nuclear fuel fabrication facilities in new nuclear power nations could lead to the proliferation of nuclear weapons, and (2) whether nuclear fuel quality can be guaranteed under current industry arrangements, given that fuel failure at one reactor can lead to forced shutdowns at many others. (author)

  7. “Live” Formulations of International Association for the properties of Water and Steam (IAPWS)

    Science.gov (United States)

    Ochkov, V. F.; Orlov, K. A.; Gurke, S.

    2017-11-01

    Online publication of IAPWS formulations for calculation of the properties of water and steam is reviewed. The advantages of electronic delivery via Internet over traditional publication on paper are examined. Online calculation can be used with or without formulas or equations printed in traditional publications. Online calculations should preferably free of charge and compatible across multiple platforms (Windows, Android, Linux). Other requirements include availability of multilingual interface, traditional math operators and functions, 2D and 3D graphic capabilities, animation, numerical and symbolic math, tools for solving equation systems, local functions, etc. Using of online visualization tools for verification of functions for calculating thermophysical properties of substances is reviewed. Specific examples are provided of tools for the modeling of the properties of chemical substances, including desktop and online calculation software, downloadable online calculations, and calculations that use server technologies such as Mathcad Calculation Server (see the site of National Research University “Moscow Power Engineering Institute”) and SMath (see the site of Knovel, an Elsevier company).

  8. Management strategies for trace organic chemicals in water - A review of international approaches.

    Science.gov (United States)

    Bieber, Stefan; Snyder, Shane A; Dagnino, Sonia; Rauch-Williams, Tanja; Drewes, Jörg E

    2018-03-01

    To ensure an appropriate management of potential health risks and uncertainties from the release of trace organic chemicals (TOrCs) into the aqueous environment, many countries have evaluated and implemented strategies to manage TOrCs. The aim of this study was to evaluate existing management strategies for TOrCs in different countries to derive and compare underlying core principles and paradigms and to develop suggestions for more holistic management strategies to protect the environment and drinking water supplies from the discharge of undesired TOrCs. The strategies in different industrial countries were summarized and subsequently compared with regards to three particular questions: 1) Do the approaches different countries have implemented manage all or only specific portions of the universe of chemicals; 2) What implementation and compliance strategies are used to manage aquatic and human health risk and what are their pros and cons; and 3) How are site-specific watershed differences being addressed? While management strategies of the different countries target similar TOrCs, the programs differ in several important aspects, including underlying principles, the balance between aquatic or human health protection, implementation methods, and financing mechanisms used to fund regulatory programs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Hygroscopic properties of internally mixed particles composed of NaCl and water-soluble organic acids.

    Science.gov (United States)

    Ghorai, Suman; Wang, Bingbing; Tivanski, Alexei; Laskin, Alexander

    2014-02-18

    Atmospheric aging of naturally emitted marine aerosol often leads to formation of internally mixed particles composed of sea salts and water-soluble organic compounds of anthropogenic origin. Mixing of sea salt and organic components has profound effects on the evolving chemical composition and hygroscopic properties of the resulted particles, which are poorly understood. Here, we have studied chemical composition and hygroscopic properties of laboratory generated NaCl particles mixed with malonic acid (MA) and glutaric acid (GA) at different molar ratios using micro-FTIR spectroscopy, atomic force microscopy, and X-ray elemental microanalysis. Hygroscopic properties of internally mixed NaCl and organic acid particles were distinctly different from pure components and varied significantly with the type and amount of organic compound present. Experimental results were in a good agreement with the AIM modeling calculations of gas/liquid/solid partitioning in studied systems. X-ray elemental microanalysis of particles showed that Cl/Na ratio decreased with increasing organic acid component in the particles with MA yielding lower ratios relative to GA. We attribute the depletion of chloride to the formation of sodium malonate and sodium glutarate salts resulted by HCl evaporation from dehydrating particles.

  10. Microstructural characterization and model of hardening for the irradiated austenitic stainless steels of the internals of pressurized water reactors

    International Nuclear Information System (INIS)

    Pokor, C.

    2003-01-01

    The core internals of Pressurized Water Reactors (PWR) are composed of SA 304 stainless steel plates and CW 316 stainless steel bolts. These internals undergo a neutron flux at a temperature between 280 deg C and 380 deg C which modifies their mechanical properties. These modifications are due to the changes in the microstructure of these materials under irradiation which depend on flux, dose and irradiation temperature. We have studied, by Transmission Electron Microscopy, the microstructure of stainless steels SA 304, CW 316 and CW 316Ti irradiated in a mixed flux reactor (OSIRIS at 330 deg C between 0,8 dpa et 3,4 dpa) and in a fast breeder reactor at 330 deg C (BOR-60) up to doses of 40 dpa. Moreover, samples have been irradiated at 375 deg C in a fast breeder reactor (EBR-II) up to doses of 10 dpa. The microstructure of the irradiated stainless steels consists in faulted Frank dislocation loops in the [111] planes of austenitic, with a Burgers vector of [111]. It is possible to find some voids in the solution annealed samples irradiated at 375 deg C. The evolution of the dislocations loops and voids has been simulated with a 'cluster dynamic' model. The fit of the model parameters has allowed us to have a quantitative description of our experimental results. This description of the microstructure after irradiation was coupled together with a hardening model by Frank loops that has permitted us to make a quantitative description of the hardening of SA 304, CW 316 and CW 316Ti stainless steels after irradiation at a certain dose, flux and temperature. The irradiation doses studied grow up to 90 dpa, dose of the end of life of PWR internals. (author)

  11. The 2nd International Conference on Water Resource and Environment (WRE 2016

    Directory of Open Access Journals (Sweden)

    Zhouli Liu

    2016-11-01

    Full Text Available Table of contents 01 The eco-toxicological effects of cadmium stress on five ornamental plants Zhouli Liu, Wei Chen, Xingyuan He, Shuai Yu, Weihang Ding 02 Study on the formation and release mechanisms of hydrogen sulfide in Longtan coal mine Jianjun Liu, Yuliang Wu, Kaixiang Fan 03 Coral bleaching in the North Reef of China’s Xisha Islands in 2014 Yuanchao Li, Xinqing Zheng, Shiquan Chen, Haiqun Xie 04 Soil chemical characteristics in a Cunninghamia lanceolata stand suffering from ice-snow damage Jie Li, Zhuomin Wang, Li Xue 05 Diversity of understory vegetation was under a Cunninghamia lanceolata stand suffering from ice-snow damage Zhiyang Lie, Weilong Huang, Tongtong Zhou, Li Xue 06 The effect of water, nitrogen and harvesting time on yield and biomass allocation of Helianthus tuberosus L. Kai Gao, Tiexia Zhu 07 The vertical variation of microbial communities in the sediment of sea cucumber pond Weiteng Mao, Pei Yu, Xinfang Lv, Yunchun Li 08 Indicating significances of alpine plant functional groups to environmental change Peixi Su, Rui Shi 09 Research on the daily CH4 fluxes of soil in summer mangrove community at Yingluogang of Guangxi, China Yong Jiang, Xingbin Chen, Shichu liang 10 Beach protection structures in middle and lower reaches of Yangtze River Junfeng Xu 11 Social responsibility management of large dam project with owner as core: an empirical case in China Jiwei Zhu, Zhao Zhai, Linan Zhou, Yun Le, Li Cao 12 The ecological function value assessment analysis of urban waterfront Jiwei Zhu, Ping Lu, Zhiqian Huang, Bei Zhou 13 Mechanism of diurnal osmotic potential changes and adjustment of three Caragana species in different habitats of the Inner Mongolia Plateau Zhirong Zheng, Shihai Lv, Chaoyang Feng 14 Biodiversity of phytoplankton and environmental influences analysis of Longfeng Wetland, China Nan Song, Yan Liu, Xinxin Lu, Yawen Fan 15 The effect of human activities on culturable soil microbes from Yaoquan Mountain in

  12. Experimental research on density wave oscillation of steam-water two-phase flow in parallel inclined internally ribbed pipes

    International Nuclear Information System (INIS)

    Gao Feng; Chen Tingkuan; Luo Yushan; Yin Fei; Liu Weimin

    2005-01-01

    At p=3-10 MPa, G=300-600 kg/(m 2 ·s), Δt sub =30-90 degree C, and q=0-190 kW/m 2 , the experiments on steam-water two-phase flow instabilities have been performed. The test sections are parallel inclined internally ribbed pipes with an outer diameter of φ38.1 mm, a wall thinkness of 7.5 mm, a obliquity of 19.5 and a length more than 15 m length. Based on the experimental results, the effects of pressure, mass velocity, inlet subcooling and asymmetrical heat flux on steam-water two-phase flow density wave oscillation were analyzed. The experimental results showed that the flow system were more stable as pressure increased. As an increase in mass velocity, critical heat flux increased but critical steam quality decreased. Inlet subcooling had a monotone effect on density wave oscillation, when inlet subcooling decreased, critical heat flux decreased. Under a certain working condition, critical heat flux on asymmetrically heating parallel pipes is higher than that on symmetrically heating parallel pipes, that means the system with symmetrically heating parallel pips was more stable. (authors)

  13. Numerical modelling of disintegration of basin-scale internal waves in a tank filled with stratified water

    Directory of Open Access Journals (Sweden)

    N. Stashchuk

    2005-01-01

    Full Text Available We present the results of numerical experiments performed with the use of a fully non-linear non-hydrostatic numerical model to study the baroclinic response of a long narrow tank filled with stratified water to an initially tilted interface. Upon release, the system starts to oscillate with an eigen frequency corresponding to basin-scale baroclinic gravitational seiches. Field observations suggest that the disintegration of basin-scale internal waves into packets of solitary waves, shear instabilities, billows and spots of mixed water are important mechanisms for the transfer of energy within stratified lakes. Laboratory experiments performed by D. A. Horn, J. Imberger and G. N. Ivey (JFM, 2001 reproduced several regimes, which include damped linear waves and solitary waves. The generation of billows and shear instabilities induced by the basin-scale wave was, however, not sufficiently studied. The developed numerical model computes a variety of flows, which were not observed with the experimental set-up. In particular, the model results showed that under conditions of low dissipation, the regimes of billows and supercritical flows may transform into a solitary wave regime. The obtained results can help in the interpretation of numerous observations of mixing processes in real lakes.

  14. Study of heat removal by natural convection from the internal core catcher in PFBR using water model experiments

    International Nuclear Information System (INIS)

    Jasmin Sudha, A.; Punitha, G.; Das, S.K.; Lydia, G.; Murthy, S.S.; Malarvizhi, B.; Harvey, J.; Kannan, S.E.

    2005-01-01

    Full text of publication follows: In the event of a core meltdown accident in a Fast Breeder Reactor, the molten core material settling on the bottom of the main vessel can endanger the structural integrity of the main vessel. In the design of Prototype Fast Breeder Reactor in India, the construction of which is about to commence, a core catcher is provided as the internal core retention device to collect and retain the core debris in a coolable configuration. Heat transfer by natural convection above and below the core catcher plate, in the zone beneath the core support structure is evaluated from water mockup experiments in the 1:4 geometrically scaled setup. These studies were undertaken towards comparison of experimentally measured temperatures at different locations with the numerical results. The core catcher assembly consists of a core catcher plate, a heat shield plate and a chimney. Decay heat from the core debris is simulated by electrical heating of the heat shield plate. An opening is provided in the cover plate to reproduce the situation in the actual accident where the core debris would have breached a part of the core support structure. Experiments were carried out with different heat flux levels prevailing upon the heat shield plate. Temperature monitoring was done at more than 100 locations, distributed both on the solid components and in water. The temperature data was analysed to get the temperature profile at different steady state conditions. Flow visualisation was also carried out using water soluble dye to establish the direction of the convective currents. The captured images show that water flows through the slots provided in the top portion of the chimney in the upward direction as evidenced from the diffusion of dye injected inside the chimney. Both the temperature data and flow visualisation confirm mixing of water through the opening in the core support structure which indicates that natural convection is set up in that zone

  15. Internal waves and temperature fronts on slopes

    Directory of Open Access Journals (Sweden)

    S. A. Thorpe

    Full Text Available Time series measurements from an array of temperature miniloggers in a line at constant depth along the sloping boundary of a lake are used to describe the `internal surf zone' where internal waves interact with the sloping boundary. More small positive temperature time derivatives are recorded than negative, but there are more large negative values than positive, giving the overall distribution of temperature time derivatives a small negative skewness. This is consistent with the internal wave dynamics; fronts form during the up-slope phase of the motion, bringing cold water up the slope, and the return flow may become unstable, leading to small advecting billows and weak warm fronts. The data are analysed to detect `events', periods in which the temperature derivatives exceed a set threshold. The speed and distance travelled by `events' are described. The motion along the slope may be a consequence of (a instabilities advected by the flow (b internal waves propagating along-slope or (c internal waves approaching the slope from oblique directions. The propagation of several of the observed 'events' can only be explained by (c, evidence that the internal surf zone has some, but possibly not all, the characteristics of the conventional 'surface wave' surf zone, with waves steepening as they approach the slope at oblique angles.

    Key words. Oceanography: general (benthic boundary layers; limnology, Oceanography: physical (internal and inertial waves

  16. International collaboration for development of accident-resistant LWR fuel. International Collaboration for Development of Accident Resistant Light Water Reactor Fuel

    International Nuclear Information System (INIS)

    Sowder, Andrew

    2013-01-01

    Following the March 2011 multi-unit accident at the Fukushima Daiichi plant, there has been increased interest in the development of breakthrough nuclear fuel designs that can reduce or eliminate many of the outcomes of a severe accident at a light water reactor (LWR) due to loss of core cooling following an extended station blackout or other initiating event. With this interest and attention comes a unique opportunity for the nuclear industry to fundamentally change the nature and impact of severe accidents. Clearly, this is no small feat. The challenges are many and the technical barriers are high. Early estimates for moving maturing R and D concepts to the threshold of commercialisation exceed one billion USD. Given the anticipated effort and resources required, no single entity or group can succeed alone. Accordingly, the Electric Power Research Institute (EPRI) sees the need for and promise of cooperation among many stakeholders on an international scale to bring about what could be transformation in LWR fuel performance and robustness. An important initial task in any R and D programme is to define the goals and metrics for measuring success. As starting points for accident-tolerant fuel development, the extension of core coolability under loss of coolant conditions and the elimination or reduction of hydrogen generation are widely recognised R and D endpoints for deployment. Furthermore, any new LWR fuel technology will, at a minimum, need to (1) be compatible with the safe, economic operation of existing plants and (2) maintain acceptable or improve nuclear fuel performance under normal operating conditions. While the primary focus of R and D to date has been on cladding and fuel improvements, there are a number of other potential paths to improve outcomes following a severe accident at an LWR that include modifications to other fuel hardware and core internals to fully address core coolability, criticality, and hydrogen generation concerns. The US

  17. Brownian motion using video capture

    International Nuclear Information System (INIS)

    Salmon, Reese; Robbins, Candace; Forinash, Kyle

    2002-01-01

    Although other researchers had previously observed the random motion of pollen grains suspended in water through a microscope, Robert Brown's name is associated with this behaviour based on observations he made in 1828. It was not until Einstein's work in the early 1900s however, that the origin of this irregular motion was established to be the result of collisions with molecules which were so small as to be invisible in a light microscope (Einstein A 1965 Investigations on the Theory of the Brownian Movement ed R Furth (New York: Dover) (transl. Cowper A D) (5 papers)). Jean Perrin in 1908 (Perrin J 1923 Atoms (New York: Van Nostrand-Reinhold) (transl. Hammick D)) was able, through a series of painstaking experiments, to establish the validity of Einstein's equation. We describe here the details of a junior level undergraduate physics laboratory experiment where students used a microscope, a video camera and video capture software to verify Einstein's famous calculation of 1905. (author)

  18. Motion and relativity

    CERN Document Server

    Infeld, Leopold

    1960-01-01

    Motion and Relativity focuses on the methodologies, solutions, and approaches involved in the study of motion and relativity, including the general relativity theory, gravitation, and approximation.The publication first offers information on notation and gravitational interaction and the general theory of motion. Discussions focus on the notation of the general relativity theory, field values on the world-lines, general statement of the physical problem, Newton's theory of gravitation, and forms for the equation of motion of the second kind. The text then takes a look at the approximation meth

  19. Brain Image Motion Correction

    DEFF Research Database (Denmark)

    Jensen, Rasmus Ramsbøl; Benjaminsen, Claus; Larsen, Rasmus

    2015-01-01

    The application of motion tracking is wide, including: industrial production lines, motion interaction in gaming, computer-aided surgery and motion correction in medical brain imaging. Several devices for motion tracking exist using a variety of different methodologies. In order to use such devices...... offset and tracking noise in medical brain imaging. The data are generated from a phantom mounted on a rotary stage and have been collected using a Siemens High Resolution Research Tomograph for positron emission tomography. During acquisition the phantom was tracked with our latest tracking prototype...

  20. International conference on opportunities and challenges for water cooled reactors in the 21. century. PowerPoint presentations

    International Nuclear Information System (INIS)

    2009-01-01

    Water Cooled Reactors have been the keystone of the nuclear industry in the 20th Century. As we move into the 21st Century and face new challenges such as the threat of climate change or the large growth in world energy demand, nuclear energy has been singled out as one of the sources that could substantially and sustainably contribute to power the world. As the nuclear community worldwide looks into the future with the development of advanced and innovative reactor designs and fuel cycles, it becomes important to explore the role Water Cooled Reactors (WCRs) will play in this future. To support the future role of WCRs, substantial design and development programmes are underway in a number of Member States to incorporate additional technology improvements into advanced nuclear power plants (NPPs) designs. One of the key features of advanced nuclear reactor designs is their improved safety due to a reduction in the probability and consequences of accidents and to an increase in the operator time allowed to better assess and properly react to abnormal events. A systematic approach and the experience of many years of successful operation have allowed designers to focus their design efforts and develop safer, more efficient and more reliable designs, and to optimize plant availability and cost through improved maintenance programs and simpler operation and inspection practices. Because many of these advanced WCR designs will be built in countries with no previous nuclear experience, it is also important to establish a forum to facilitate the exchange of information on the infrastructure and technical issues associated with the sustainable deployment of advanced nuclear reactors and its application for the optimization of maintenance of operating nuclear power plants. This international conference seeks to be all-inclusive, bringing together the policy, economic and technical decision-makers and the stakeholders in the nuclear industry such as operators, suppliers

  1. Electrostatic Model Applied to ISS Charged Water Droplet Experiment

    Science.gov (United States)

    Stevenson, Daan; Schaub, Hanspeter; Pettit, Donald R.

    2015-01-01

    The electrostatic force can be used to create novel relative motion between charged bodies if it can be isolated from the stronger gravitational and dissipative forces. Recently, Coulomb orbital motion was demonstrated on the International Space Station by releasing charged water droplets in the vicinity of a charged knitting needle. In this investigation, the Multi-Sphere Method, an electrostatic model developed to study active spacecraft position control by Coulomb charging, is used to simulate the complex orbital motion of the droplets. When atmospheric drag is introduced, the simulated motion closely mimics that seen in the video footage of the experiment. The electrostatic force's inverse dependency on separation distance near the center of the needle lends itself to analytic predictions of the radial motion.

  2. First meeting of the International Working Group on Advanced Technologies for Water Cooled Reactors, Vienna, 18-21 May 1987. (Pt. 2)

    International Nuclear Information System (INIS)

    1987-12-01

    The First Meeting of the IAEA International Working Group on Advanced Technologies for Water Cooled Reactors was held in Vienna, Austria from 18-21 May 1987. The Summary Report (Pt. 2) contains the papers which review the national programmes in the field of Advanced Technologies for Water Cooled Reactors and other presentations at the Meeting. A separate abstract was prepared for each of the 10 papers presented at this meeting. Refs, figs

  3. The open quantum Brownian motions

    International Nuclear Information System (INIS)

    Bauer, Michel; Bernard, Denis; Tilloy, Antoine

    2014-01-01

    Using quantum parallelism on random walks as the original seed, we introduce new quantum stochastic processes, the open quantum Brownian motions. They describe the behaviors of quantum walkers—with internal degrees of freedom which serve as random gyroscopes—interacting with a series of probes which serve as quantum coins. These processes may also be viewed as the scaling limit of open quantum random walks and we develop this approach along three different lines: the quantum trajectory, the quantum dynamical map and the quantum stochastic differential equation. We also present a study of the simplest case, with a two level system as an internal gyroscope, illustrating the interplay between the ballistic and diffusive behaviors at work in these processes. Notation H z : orbital (walker) Hilbert space, C Z in the discrete, L 2 (R) in the continuum H c : internal spin (or gyroscope) Hilbert space H sys =H z ⊗H c : system Hilbert space H p : probe (or quantum coin) Hilbert space, H p =C 2 ρ t tot : density matrix for the total system (walker + internal spin + quantum coins) ρ-bar t : reduced density matrix on H sys : ρ-bar t =∫dxdy ρ-bar t (x,y)⊗|x〉 z 〈y| ρ-hat t : system density matrix in a quantum trajectory: ρ-hat t =∫dxdy ρ-hat t (x,y)⊗|x〉 z 〈y|. If diagonal and localized in position: ρ-hat t =ρ t ⊗|X t 〉 z 〈X t | ρ t : internal density matrix in a simple quantum trajectory X t : walker position in a simple quantum trajectory B t : normalized Brownian motion ξ t , ξ t † : quantum noises (paper)

  4. Water

    Science.gov (United States)

    ... drink and water in food (like fruits and vegetables). 6. Of all the earth’s water, how much is ocean or seas? 97 percent of the earth’s water is ocean or seas. 7. How much of the world’s water is frozen? Of all the water on earth, about 2 percent is frozen. 8. How much ...

  5. Projectile Motion Hoop Challenge

    Science.gov (United States)

    Jordan, Connor; Dunn, Amy; Armstrong, Zachary; Adams, Wendy K.

    2018-01-01

    Projectile motion is a common phenomenon that is used in introductory physics courses to help students understand motion in two dimensions. Authors have shared a range of ideas for teaching this concept and the associated kinematics in "The Physics Teacher" ("TPT"); however, the "Hoop Challenge" is a new setup not…

  6. Temporal logic motion planning

    CSIR Research Space (South Africa)

    Seotsanyana, M

    2010-01-01

    Full Text Available In this paper, a critical review on temporal logic motion planning is presented. The review paper aims to address the following problems: (a) In a realistic situation, the motion planning problem is carried out in real-time, in a dynamic, uncertain...

  7. Aristotle, Motion, and Rhetoric.

    Science.gov (United States)

    Sutton, Jane

    Aristotle rejects a world vision of changing reality as neither useful nor beneficial to human life, and instead he reaffirms both change and eternal reality, fuses motion and rest, and ends up with "well-behaved" changes. This concept of motion is foundational to his world view, and from it emerges his theory of knowledge, philosophy of…

  8. Stochastic ground motion simulation

    Science.gov (United States)

    Rezaeian, Sanaz; Xiaodan, Sun; Beer, Michael; Kougioumtzoglou, Ioannis A.; Patelli, Edoardo; Siu-Kui Au, Ivan

    2014-01-01

    Strong earthquake ground motion records are fundamental in engineering applications. Ground motion time series are used in response-history dynamic analysis of structural or geotechnical systems. In such analysis, the validity of predicted responses depends on the validity of the input excitations. Ground motion records are also used to develop ground motion prediction equations(GMPEs) for intensity measures such as spectral accelerations that are used in response-spectrum dynamic analysis. Despite the thousands of available strong ground motion records, there remains a shortage of records for large-magnitude earthquakes at short distances or in specific regions, as well as records that sample specific combinations of source, path, and site characteristics.

  9. pH-induced inversion of water-in-oil emulsions to oil-in-water high internal phase emulsions (HIPEs) using core cross-linked star (CCS) polymer as interfacial stabilizer.

    Science.gov (United States)

    Chen, Qijing; Deng, Xiaoyong; An, Zesheng

    2014-06-01

    A pH-responsive core cross-linked star (CCS) polymer containing poly(N,N-dimethylaminoethyl methacrylate) (PDMAEMA) arms was used as an interfacial stabilizer for emulsions containing toluene (80 v%) and water (20 v%). In the pH range of 12.1-9.3, ordinary water-in-oil emulsions were formed. Intermediate multiple emulsions of oil-in-water-in-oil and water-in-oil-in-water were formed at pH 8.6 and 7.5, respectively. Further lowering the pH resulted in the formation of gelled high internal phase emulsions of oil-in-water type in the pH range of 6.4-0.6. The emulsion behavior was correlated with interfacial tension, conductivity and configuration of the CCS polymer at different pH. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Subtle Motion Analysis and Spotting using the Riesz Pyramid

    OpenAIRE

    Arango , Carlos ,; Alata , Olivier; Emonet , Rémi; Legrand , Anne-Claire; Konik , Hubert

    2018-01-01

    International audience; Analyzing and temporally spotting motions which are almost invisible to the human eye might reveal interesting information about the world. However, detecting these events is difficult due to their short duration and low intensities. Taking inspiration from video magnification techniques, we design a workflow for analyzing and temporally spotting subtle motions based on the Riesz pyramid. In addition, we propose a filtering and masking scheme that segments motions of i...

  11. Compensating for Quasi-periodic Motion in Robotic Radiosurgery

    CERN Document Server

    Ernst, Floris

    2012-01-01

    Compensating for Quasi-periodic Motion in Robotic Radiosurgery outlines the techniques needed to accurately track and compensate for respiratory and pulsatory motion during robotic radiosurgery. The algorithms presented within the book aid in the treatment of tumors that move during respiration. In Chapters 1 and 2,  the book introduces the concept of stereotactic body radiation therapy, motion compensation strategies and the clinical state-of-the-art. In Chapters 3 through 5, the author describes and evaluates new methods for motion prediction, for correlating external motion to internal organ motion, and for the evaluation of these algorithms’ output based on an unprecedented amount of real clinical data. Finally, Chapter 6 provides a brief introduction into currently investigated, open questions and further fields of research. Compensating for Quasi-periodic Motion in Robotic Radiosurgery targets researchers working in the related fields of surgical oncology, artificial intelligence, robotics and more. ...

  12. Costs, benefits, and international financing related to the water sector in the Danube and Black Sea region in the perspective of WFD implementation

    International Nuclear Information System (INIS)

    Paleari, S.

    2006-01-01

    Further to constitute a challenge far many EU15 countries, the EU Water Framework Directive (WFD) is going to represent the main reference for the process of approximation of water legislation of accession countries, as well as water policy and legislation of many third countries of Eastern Europe and Central Asia. In this work we focus on expected investment costs, estimated benefits, and external financing programmes for water policies and WFD implementation in an extensive geographical area, the Black Sea region, which includes the Danube Basin (that is the second largest European water basin after the Volga Basin) and covers industrial and agricultural areas of 22 countries. As we are primarily interested in the economic aspects of water policies and the WFD implementation in the above geographical area, we will develop a joint analysis of: (a) the available estimates on the size of investments in the water sector required to approximate the provisions and/or (depending on single countries) the principles of WFD; (b) the available estimates on the expected benefits from implementing EU water legislation and the WFD; (c) the flows of international assistance and financial resources available during the next few years for investing in water-sector infrastructures and management in the countries of the Black Sea region. The approximation of EU water legislation and the implementation of the WFD will entail huge investment costs by accession countries during the next decades and water is expected be the most significant area of investment within the environmental sector in the majority of these countries. The attempts to estimate economic and environmental benefits indicate that the same process of compliance with EU legislation and the WFD will produce significant benefits for the economy and the environment of these countries. During the last part of the I990s, however, the trends of actual expenses in environmental and water infrastructures in the countries of

  13. Water

    International Nuclear Information System (INIS)

    Chovanec, A.; Grath, J.; Kralik, M.; Vogel, W.

    2002-01-01

    An up-date overview of the situation of the Austrian waters is given by analyzing the status of the water quality (groundwater, surface waters) and water protection measures. Maps containing information of nitrate and atrazine in groundwaters (analyses at monitoring stations), nitrate contents and biological water quality of running waters are included. Finally, pollutants (nitrate, orthophosphate, ammonium, nitrite, atrazine etc.) trends in annual mean values and median values for the whole country for the years 1992-1999 are presented in tables. Figs. 5. (nevyjel)

  14. A kinetic model for impact/sliding wear of pressurized water reactor internal components: Application to rod cluster control assemblies

    International Nuclear Information System (INIS)

    Zbinden, M.

    1996-01-01

    Certain internal components of Pressurized Water Reactors are damaged by wear when subjected to vibration induced by flow. In order to enable predictive calculation of such wear, one must have a model which takes account reliably of real damages. The modelling of wear represents a final link in a succession of numerical calculations which begins by the determination of hydraulic excitations induced by the flow. One proceeds, then, in the dynamic response calculation of the structure to finish up with an estimation of volumetric wear and of the depth of wear scars. A new concept of industrial wear model adapted to components of nuclear plants is proposed. Its originality is to be supported, on one hand, by experimental results obtained via wear machines of relatively short operational times, and, on the other hand, by the information obtained from the operating feedback over real wear kinetics of the reactors components. The proposed model is illustrated by an example which correspond to a specific real situation. The determination of the coefficients permitting to cover all assembly of configurations and the validation of the model in these configurations have been the object of the most recent work

  15. Heat Conductivity Resistance of Concrete Wall Panel by Water Flowing in Different Orientations of Internal PVC pipe

    Science.gov (United States)

    Umi, N. N.; Norazman, M. N.; Daud, N. M.; Yusof, M. A.; Yahya, M. A.; Othman, M.

    2018-04-01

    Green building technology and sustainability development is current focus in the world nowadays. In Malaysia and most tropical countries the maximum temperature recorded typically at 35°C. Air-conditioning system has become a necessity in occupied buildings, thereby increasing the cost of electric consumption. The aim of this study is to find out the solution in minimizing heat transfer from the external environment and intentions towards going green. In this study, the experimental work includes testing three types of concrete wall panels. The main heat intervention material in this research is 2 inch diameter Polyvinyl Chloride (PVC) pipe embedded at the center of the concrete wall panel, while the EPS foam beads were added to the cement content in the concrete mix forming the outer layer of the wall panel. Water from the rainwater harvesting system is regulated in the PVC pipe to intervene with the heat conductivity through the wall panel. Results from the experimental works show that the internal surface temperature of these heat resistance wall panels is to 3□C lower than control wall panel from plain interlocking bricks.

  16. ENVIRONMENTAL TECHNOLOGY VERIFICATION REPORT, REMOVAL OF ARSENIC IN DRINKING WATER: ADI INTERNATIONAL INC. ADI PILOT TEST UNIT NO. 2002-09 WITH MEDIA G2®; PHASE II

    Science.gov (United States)

    Verification testing of the ADI International Inc. Unit No. 2002-09 with MEDIA G2® arsenic adsorption media filter system was conducted at the Hilltown Township Water and Sewer Authority (HTWSA) Well Station No. 1 in Sellersville, Pennsylvania from October 8, 2003 through May 28,...

  17. Spiro(phosphoamidite) ligand (SIPHOS)/Cu(OTf)2-catalyzed highly regio-and stereo-selective hydroborations of internal alkynes with diborane in water

    Institute of Scientific and Technical Information of China (English)

    Qing-Qing Xuan; Ya-Hui Wei; Qiu-Ling Song

    2017-01-01

    The highly regio-and stereoselective hydroborations of unactivated internal alkynes with diboron compound catalyzed by Cu(OTf)2 with spiro(phosphoamidite) as ligand in the presence of Cs2CO3 in water was developed.This protocol was applied efficiently in the aqueous synthesis of multi-substituted vinylboranes.

  18. Lithium salt of N,N-dimethylsalicylamide in pyridine and pyridine-water solutions. NMR study on the internal rotation about the C-N bond

    Energy Technology Data Exchange (ETDEWEB)

    Gryff-Keller, A; Szczecinski, P [Politechnika Warszawska (Poland)

    1981-01-01

    NMR spectra of the title compound in pyridine and pyridine-water mixtures have been measured at various temperatures. The dependence of internal rotation rate and of chemical shift difference between N-CH/sub 3/ signals on the solvent composition has been discussed with reference to structure of the solution investigated.

  19. A Country-Specific Water Consumption Inventory Considering International Trade in Asian Countries Using a Multi-Regional Input-Output Table

    Directory of Open Access Journals (Sweden)

    Yuya Ono

    2017-08-01

    Full Text Available Interest in the impacts of water use in the life cycle of products and services are increasing among various stakeholders. The water footprint is a tool to identify critical and effective points for reducing the impact of water use through the entire life cycle of products, services, and organizations. The purpose of this study was to develop a water consumption inventory database that focused on identifying of Asian water consumption using an input-output (IO framework. An Asia International Input-Output table (AIIO was applied in this study. The amount of water consumption required for agricultural products was estimated by modeling; for other sectors it was estimated from statistical reports. The intensities of direct water consumption in each sector were calculated by dividing the amount of water consumption by the domestic production. Based on the IO analysis using Leontief’s inverse matrix, the intensities of water consumption from cradle to gate were estimated for all goods and services. There was high intensity of water consumption in the primary industry sectors, together with a high dependency on rainwater as an input water source. The water consumption intensities generally showed a larger reduction in secondary sectors, in comparison with the tertiary sectors, due to the use of recycled water. There were differences between this study and previous studies due to the use of site-specific production data and the temporal resolution of crop production. By considering site-specific conditions, it is expected that the dataset developed here can be used for estimating the water footprint of products, services, and organizations in nine countries (Japan, South Korea, China, Taiwan, Thailand, the Philippines, Malaysia, Singapore, Indonesia, and USA.

  20. Water

    Science.gov (United States)

    ... can be found in some metal water taps, interior water pipes, or pipes connecting a house to ... reduce or eliminate lead. See resources below. 5. Children and pregnant women are especially vulnerable to the ...

  1. Evaluation of internal loading and water level changes: implications for phosphorus, algal production, and nuisance blooms in Kabetogama Lake, Voyageurs National Park, Minnesota

    Science.gov (United States)

    Christensen, Victoria G.; Maki, Ryan P.; Kiesling, Richard L.

    2013-01-01

    Hydrologic manipulations have the potential to exacerbate or remediate eutrophication in productive reservoirs. Dam operations at Kabetogama Lake, Minnesota, were modified in 2000 to restore a more natural water regime and improve water quality. The US Geological Survey and National Park Service evaluated nutrient, algae, and nuisance bloom data in relation to changes in Kabetogama Lake water levels. Comparison of the results of this study to previous studies indicates that chlorophyll a concentrations have decreased, whereas total phosphorus (TP) concentrations have not changed significantly since 2000. Water and sediment quality data were collected at Voyageurs National Park during 2008–2009 to assess internal phosphorus loading and determine whether loading is a factor affecting TP concentrations and algal productivity. Kabetogama Lake often was mixed vertically, except for occasional stratification measured in certain areas, including Lost Bay in the northeastern part of Kabetogama Lake. Stratification, higher bottom water and sediment nutrient concentrations than in other parts of the lake, and phosphorus release rates estimated from sediment core incubations indicated that Lost Bay is one of several areas that may be contributing to internal loading. Internal loading of TP is a concern because increased TP may cause excessive algal growth including potentially toxic cyanobacteria.

  2. IGS polar motion measurement accuracy

    Directory of Open Access Journals (Sweden)

    Jim Ray

    2017-11-01

    Full Text Available We elaborate an error budget for the long-term accuracy of IGS (International Global Navigation Satellite System Service polar motion estimates, concluding that it is probably about 25–30 μas (1-sigma overall, although it is not possible to quantify possible contributions (mainly annual that might transfer directly from aliases of subdaily rotational tide errors. The leading sources are biases arising from the need to align daily, observed terrestrial frames, within which the pole coordinates are expressed and which are continuously deforming, to the secular, linear international reference frame. Such biases are largest over spans longer than about a year. Thanks to the very large number of IGS tracking stations, the formal covariance errors are much smaller, around 5 to 10 μas. Large networks also permit the systematic frame-related errors to be more effectively minimized but not eliminated. A number of periodic errors probably also influence polar motion results, mainly at annual, GPS (Global Positioning System draconitic, and fortnightly periods, but their impact on the overall error budget is unlikely to be significant except possibly for annual tidal aliases. Nevertheless, caution should be exercised in interpreting geophysical excitations near any of the suspect periods.

  3. Acoustic Measurement Of Periodic Motion Of Levitated Object

    Science.gov (United States)

    Watkins, John L.; Barmatz, Martin B.

    1992-01-01

    Some internal vibrations, oscillations in position, and rotations of acoustically levitated object measured by use of microphone already installed in typical levitation chamber for tuning chamber to resonance and monitoring operation. Levitating acoustic signal modulated by object motion of lower frequency. Amplitude modulation detected and analyzed spectrally to determine amplitudes and frequencies of motions.

  4. 19 CFR 210.53 - Motion filed after complaint.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Motion filed after complaint. 210.53 Section 210.53 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Temporary Relief § 210.53 Motion filed after complaint. (a) A...

  5. Laws of motion for interacting Yang-Mills particles

    International Nuclear Information System (INIS)

    Fuchs, H.

    1988-01-01

    Our recent Lagrangian approach to the equations of motion for test particles with internal structure can be enlarged to the laws of motion for interacting particles, at least in principle. As an example we consider the interaction of point particles endowed with a pole-dipole structure of the non-abelian charge. (author)

  6. Water pollution and environmental governance systems of the Tai and Chao Lake Basins in China in an international perspective

    NARCIS (Netherlands)

    Lei Qiu; M.P. van Dijk (Meine Pieter); H. Wang (Huimin)

    2015-01-01

    markdownabstractThe Tai and Chao Lake basins are currently facing a serious water pollution crisis associated with the absence of an effective environmental governance system. The water pollution and the water governance system of the two basins will be compared. The reasons for water pollution in

  7. Microbiological Tests Performed During the Design of the International Space Station ECLSS: Part 1, Bulk Phase Water and Wastewater

    Science.gov (United States)

    Roman, Monsi C.; Mittelman, Marc W.

    2010-01-01

    This slide presentation summarizes the studies performed to assess the bulk phase microbial community during the Space Station Water Recover Tests (WRT) from 1990-1998. These tests show that it is possible to recycle water from different sources including urine, and produce water that can exceed the quality of municpally produced tap water.

  8. Study on frictional pressure drop of steam-water two phase flow in optimized four-head internal-ribbed tube

    International Nuclear Information System (INIS)

    Wang Weishu; Zhu Xiaojing; Bi Qincheng; Wu Gang; Yu Shuiqing

    2012-01-01

    The optimized internal-ribbed tube is different from the normal internal-ribbed tube on the frictional pressure drop characteristics. The frictional pressure drop characteristics of steam-water two phase flow in horizontal four-head optimized internal-ribbed were studied under adiabatic condition. According to the experimental and calculation results, the two-phase multiplier is greatly affected by the steam quality and pressure. The two-phase multiplier increases with increasing quality, and decreases with increasing pressure. In the near-critical pressure region, the two-phase multiplier is close to 1. The frictional pressure drop of two phase flow in optimized tube is less than that in the normal tube under the same work condition. The good hydrodynamic condition could be achieved when the optimized internal-ribbed tube is used in the heat transfer equipment because the self-compensating characteristics exist due to the reduction of frictional pressure drop. (authors)

  9. Molecular dynamics simulations of protein-tyrosine phosphatase 1B. I. Ligand-induced changes in the protein motions

    DEFF Research Database (Denmark)

    Peters, Günther H. J.; Frimurer, T.M.; Andersen, J.N.

    1999-01-01

    Activity of enzymes, such as protein tyrosine phosphatases (PTPs), is often associated with structural changes in the enzyme, resulting in selective and stereospecific reactions with the substrate. To investigate the effect of a substrate on the motions occurring in PTPs, we have performed...... molecular dynamics simulations of PTP1B and PTP1B complexed with a high-affinity peptide DADEpYL, where pY stands for phosphorylated tyrosine. The peptide sequence is derived from the epidermal growth factor receptor (EGFR(988-993)). Simulations were performed in water for 1 ns, and the concerted motions...... in the protein were analyzed using the essential dynamics technique. Our results indicate that the predominately internal motions in PTP1B occur in a subspace of only a few degrees of freedom. Upon substrate binding, the flexibility of the protein is reduced by similar to 10%. The largest effect is found...

  10. Post-Flight Microbial Analysis of Samples from the International Space Station Water Recovery System and Oxygen Generation System

    Science.gov (United States)

    Birmele, Michele N.

    2011-01-01

    The Regenerative, Environmental Control and Life Support System (ECLSS) on the International Space Station (ISS) includes the the Water Recovery System (WRS) and the Oxygen Generation System (OGS). The WRS consists of a Urine Processor Assembly (UPA) and Water Processor Assembly (WPA). This report describes microbial characterization of wastewater and surface samples collected from the WRS and OGS subsystems, returned to KSC, JSC, and MSFC on consecutive shuttle flights (STS-129 and STS-130) in 2009-10. STS-129 returned two filters that contained fluid samples from the WPA Waste Tank Orbital Recovery Unit (ORU), one from the waste tank and the other from the ISS humidity condensate. Direct count by microscopic enumeration revealed 8.38 x 104 cells per mL in the humidity condensate sample, but none of those cells were recoverable on solid agar media. In contrast, 3.32 x lOs cells per mL were measured from a surface swab of the WRS waste tank, including viable bacteria and fungi recovered after S12 days of incubation on solid agar media. Based on rDNA sequencing and phenotypic characterization, a fungus recovered from the filter was determined to be Lecythophora mutabilis. The bacterial isolate was identified by rDNA sequence data to be Methylobacterium radiotolerans. Additional UPA subsystem samples were returned on STS-130 for analysis. Both liquid and solid samples were collected from the Russian urine container (EDV), Distillation Assembly (DA) and Recycle Filter Tank Assembly (RFTA) for post-flight analysis. The bacterium Pseudomonas aeruginosa and fungus Chaetomium brasiliense were isolated from the EDV samples. No viable bacteria or fungi were recovered from RFTA brine samples (N= 6), but multiple samples (N = 11) from the DA and RFTA were found to contain fungal and bacterial cells. Many recovered cells have been identified to genus by rDNA sequencing and carbon source utilization profiling (BiOLOG Gen III). The presence of viable bacteria and fungi from WRS

  11. Chemical and Physical Properties of De-Mineralized Water Compared to Ground Water and Rainwater with Respect to Local and International Standards

    OpenAIRE

    , M.A. Khalifa; , T.A. Nasser

    2010-01-01

    The present study was carried out from 2007 to 2008. Water samples were collected from different stations in Tarhona valley 90 Km from Tripoli, Libya. Water samples were studied including 4 samples from desalination stations, 5 of house roofs rain water, 5 of direct rain water, 5 samples of state wells and 8 of private public wells. The study covers total dissolved solids (TDS), pH, alkaline ions and heavy metals. The desalination water samples showed 74 ppm of mineral salts, these amounts ar...

  12. Toying with Motion.

    Science.gov (United States)

    Galus, Pamela J.

    2002-01-01

    Presents a variety of activities that support the development of an understanding of Newton's laws of motion. Activities use toy cars, mobile roads, and a seat-of-nails. Includes a scoring rubric. (DDR)

  13. Projectile Motion Hoop Challenge

    Science.gov (United States)

    Jordan, Connor; Dunn, Amy; Armstrong, Zachary; Adams, Wendy K.

    2018-04-01

    Projectile motion is a common phenomenon that is used in introductory physics courses to help students understand motion in two dimensions. Authors have shared a range of ideas for teaching this concept and the associated kinematics in The Physics Teacher; however, the "Hoop Challenge" is a new setup not before described in TPT. In this article an experiment is illustrated to explore projectile motion in a fun and challenging manner that has been used with both high school and university students. With a few simple materials, students have a vested interest in being able to calculate the height of the projectile at a given distance from its launch site. They also have an exciting visual demonstration of projectile motion when the lab is over.

  14. Travelers' Health: Motion Sickness

    Science.gov (United States)

    ... sickness, especially when pregnant, menstruating, or on hormones. Race/ethnicity—Asians may be more susceptible to motion ... it, sitting in the front seat of a car or bus, sitting over the wing of an ...

  15. Dizziness and Motion Sickness

    Science.gov (United States)

    ... that extends into the inner ear can completely destroy both the hearing and equilibrium function of that ... motion sickness: •Do not read while traveling •Avoid sitting in the rear seat •Do not sit in ...

  16. History of Virtual Water , International Trade and Economic Metabolism at the Time Colonialism and a First Attempt to Assess Their Impact on Hydrologic Changes

    Science.gov (United States)

    Greco, F.

    2008-12-01

    This research considers the historical impact of virtual water into the geophysical arena by considering it as a human-led phenomenon that impacts the hydrologic system and, consequently, the environment as a whole. This paper is in line with the idea of including the humans into the water-balance model, and it is deepening the idea that this has to be done not only at the light of each watershed, but globally, looking at the role of water-trade embedded in food and tradable goods. Starting from a definition of what virtual water is, this research explores the role of crops export in the early U.S. Colonial time. As early as 1630 a huge biomass from here was already exported to the UK (the fur trade). In 1700 the tobacco export started, along with cereals exports and timber. An entire ecosystem has been "exported" in terms of water-embedded-in-goods. This was the beginning of a massive depletion of bio-mass stocks and flows, a raise in nitrogen discharge into the environment and its impact on the hydrological systems ( CUAHSI Summer Institute findings). Immigration and its effects on the water balance is also considered in this work. The experiment of interdisciplinary work of CUAHSI Summer Institute 2008 has proven that there is space for a historical reconstruction of evidence of human-led changes to the hydrological systems. This has been possible through the analysis of material stocks and flows, water-balance analysis of these stocks and flows, including human-led changes like international trade and population growth. This proposal will argue that these changes can also be identified by the term of 'socio- economic metabolism', in which societies are trading their goods internationally but taking the primary resources, including water, locally. This work will put the basis for the history of virtual water and its implications on both socio-economic metabolism and local geophysical changes.

  17. Visual Motion Perception

    Science.gov (United States)

    1991-08-15

    displace- ment limit for motion in random dots," Vision Res., 24, 293-300. Pantie , A. & K. Turano (1986) "Direct comparisons of apparent motions...Hicks & AJ, Pantie (1978) "Apparent movement of successively generated subjec. uve figures," Perception, 7, 371-383. Ramachandran. V.S. & S.M. Anstis...thanks think deaf girl until world uncle flag home talk finish short thee our screwdiver sonry flower wrCstlir~g plan week wait accident guilty tree

  18. Coupled transverse motion

    International Nuclear Information System (INIS)

    Teng, L.C.

    1989-01-01

    The magnetic field in an accelerator or a storage ring is usually so designed that the horizontal (x) and the vertical (y) motions of an ion are uncoupled. However, because of imperfections in construction and alignment, some small coupling is unavoidable. In this lecture, we discuss in a general way what is known about the behaviors of coupled motions in two degrees-of-freedom. 11 refs., 6 figs

  19. Efforts to Reduce International Space Station Crew Maintenance Time in the Management of the Extravehicular Mobility Unit Transport Loop Water Quality

    Science.gov (United States)

    Etter,David; Rector, Tony; Boyle, robert; Zande, Chris Vande

    2012-01-01

    The EMU (Extravehicular Mobility Unit) contains a semi-closed-loop re-circulating water circuit (Transport Loop) to absorb heat into a LCVG (Liquid Coolant and Ventilation Garment) worn by the astronaut. A second, single-pass water circuit (Feed-water Loop) provides water to a cooling device (Sublimator) containing porous plates, and that water sublimates through the porous plates to space vacuum. The cooling effect from the sublimation of this water translates to a cooling of the LCVG water that circulates through the Sublimator. The quality of the EMU Transport Loop water is maintained through the use of a water processing kit (ALCLR - Airlock Cooling Loop Remediation) that is used to periodically clean and disinfect the water circuit. Opportunities to reduce crew time associated with ALCLR operations include a detailed review of the historical water quality data for evidence to support an extension to the implementation cycle. Furthermore, an EMU returned after 2-years of use on the ISS (International Space Station) is being used as a test bed to evaluate the results of extended and repeated ALCLR implementation cycles. Finally, design, use and on-orbit location enhancements to the ALCLR kit components are being considered to allow the implementation cycle to occur in parallel with other EMU maintenance and check-out activities, and to extend the life of the ALCLR kit components. These efforts are undertaken to reduce the crew-time and logistics burdens for the EMU, while ensuring the long-term health of the EMU water circuits for a post- Shuttle 6-year service life.

  20. International Physical Activity Questionnaire (IPAQ and New Zealand Physical Activity Questionnaire (NZPAQ: A doubly labelled water validation

    Directory of Open Access Journals (Sweden)

    Rodgers Anthony

    2007-12-01

    Full Text Available Abstract Background Accurate measurement of physical activity is a pre-requisite for monitoring population health and for evaluating effective interventions. The International Physical Activity Questionnaire (IPAQ is used as a comparable and standardised self-report measure of habitual physical activity of populations from different countries and socio-cultural contexts. The IPAQ has been modified to produce a New Zealand physical activity questionnaire (NZPAQ. The aim of this study was to validate the IPAQ and NZPAQ against doubly labelled water (DLW. Method: Total energy expenditure (TEE was measured over a 15-day period using DLW. Activity-related energy expenditure (AEE was estimated by subtracting the energy expenditure from resting metabolic rate and thermic effect of feeding from TEE. The IPAQ (long form and NZPAQ (short form were completed at the end of each 7-day period. Activity-related energy expenditure (IPAQAEE and NZPAQAEE was calculated from each questionnaire and compared to DLWAEE. Results Thirty six adults aged 18 to 56 years (56% female completed all measurements. Compared to DLWAEE, IPAQAEE and NZPAQAEE on average underestimated energy expenditure by 27% and 59%, respectively. There was good agreement between DLWAEE and both IPAQAEE and NZPAQAEE at lower levels of physical activity. However there was marked underestimation of questionnaire-derived energy expenditure at higher levels of activity. Conclusion Both the IPAQ and NZPAQ instruments have a demonstrated systematic bias toward underestimation of physical activity-related energy expenditure at higher levels of physical activity compared to DLW. Appropriate calibration factors could be used to correct for measurement error in physical activity questionnaires and hence improve estimation of AEE.

  1. El contragolpe generado en el oído interno como etiopatogenia de la enfermedad de Méniére Water Hammer impact on the internal ear in the pathogenesis of Méniére's disease

    Directory of Open Access Journals (Sweden)

    William Alvarez Gaviria

    1992-02-01

    Full Text Available Se postula la hipótesis de que una de las funciones del saco endolinfático es hacer las veces de amortiguador de los contragolpes generados en el oído interno, como respuesta a las desaceleraciones súbitas ocasionadas en los Iíquidos laberínticos por el cambio o el frenado súbito de los movimientos. Si dicho amortiguador no reúne las condiciones suficientes para tal efecto como, por ejemplo, capacidad volumétrica y orientación adecuada, los contragolpes constituyen un trauma repetitivo sobre los elementos neurosensoriales estatoacústicos. De esta manera se origina en forma crónica, recurrente y lentamente progresiva, la enfermedad de Méniere. Se explica el procedimiento del experimento realizado con un modelo del oído Interno; se discuten las posibles repercusiones de esta hipótesis, no sólo en la sintomatología de la enfermedad de Méniere, sino también en la hidrocefalia normotensa de Hakim y sus implicaciones en la anatomía comparada This paper proposes the hypothesis that the endolymphatic sac acts as a shock absorber of the water hammer Impacts generated in the internal ear in response to decreases of acceleration in the laberynthine fluids during motion changes or sudden stops. If the shock absorber does not meet the required conditions for proper functioning (lack of volumetric capacity, inadequate orientation the impacts cause repeated trauma on the neurosensorial elements that might be the chronic, recurrent and progressive origin of Méniere's disease. The experimental procedure with a model of internal ear is explained and the implications of this hypothesis for both Méniere's disease and Hakim's normotense hydrocephalus are discussed

  2. Microbial Challenge Testing of Single Liquid Cathode Feed Water Electrolysis Cells for the International Space Station (ISS) Oxygen Generator Assembly (OGA)

    Science.gov (United States)

    Roy, Robert J.; Wilson, Mark E.; Diderich, Greg S.; Steele, John W.

    2011-01-01

    The International Space Station (ISS) Oxygen Generator Assembly (OGA) operational performance may be adversely impacted by microbiological growth and biofilm formation over the electrolysis cell membranes. Biofilms could hinder the transport of water from the bulk fluid stream to the membranes and increase the cell concentration overpotential resulting in higher cell voltages and a shorter cell life. A microbial challenge test was performed on duplicate single liquid-cathode feed water electrolysis cells to evaluate operational performance with increasing levels of a mixture of five bacteria isolated from ISS and Space Shuttle potable water systems. Baseline performance of the single water electrolysis cells was determined for approximately one month with deionized water. Monthly performance was also determined following each inoculation of the feed tank with 100, 1000, 10,000 and 100,000 cells/ml of the mixed suspension of test bacteria. Water samples from the feed tank and recirculating water loops for each cell were periodically analyzed for enumeration and speciation of bacteria and total organic carbon. While initially a concern, this test program has demonstrated that the performance of the electrolysis cell is not adversely impacted by feed water containing the five species of bacteria tested at a concentration measured as high as 1,000,000 colony forming units (CFU)/ml. This paper presents the methodologies used in the conduct of this test program along with the performance test results at each level of bacteria concentration.

  3. A Comparison between heat transfer performance of rectangular and semicircular tubes considering boundary effects on Brownian motions in the presence of Ag / water nanofluids: Applicable in the design of cooling system of photovoltaic cells.

    Science.gov (United States)

    Jafarimoghaddam, Amin; Aberoumand, Sadegh

    2017-01-01

    The present study aims to experimentally investigate heat transfer performance of rectangular and semicircular tubes in the presence of Ag / water nanofluids. The nanoparticles of Ag (silver) were used in seven different volume concentrations of 0.03%, 0.07%, 0.1%, 0.2%, 0.4%, 1% and 2%. The experiment was conducted in relatively low Reynolds numbers of 301 to 740. A heater with the power of 200 W was used to keep the outer surface of the tubes under a constant heat flux condition. In addition, the rectangular tube has been designed within the same length as the semicircular one and also within the same hydraulic diameter. Moreover, the average nanoparticles size was 20 nm. The outcome results of the present empirical work indicate that, for all the examined Reynolds numbers, the semicircular tube has higher convective heat transfer coefficient for all the utilized volume concentrations of Ag nanoparticles. The possible reasons behind this advantage are discussed through the present work mainly by taking the boundary effect on Brownian motions into account. Coming to this point that the conventional design for cooling system of photovoltaic cells is a heat sink with the rectangular graves, it is discussed that using a semicircular design may have the advantage over the rectangular one in convective heat transfer coefficient enhancement and hence a better cooling performance for these solar cells.

  4. A Comparison between heat transfer performance of rectangular and semicircular tubes considering boundary effects on Brownian motions in the presence of Ag / water nanofluids: Applicable in the design of cooling system of photovoltaic cells.

    Directory of Open Access Journals (Sweden)

    Amin Jafarimoghaddam

    Full Text Available The present study aims to experimentally investigate heat transfer performance of rectangular and semicircular tubes in the presence of Ag / water nanofluids. The nanoparticles of Ag (silver were used in seven different volume concentrations of 0.03%, 0.07%, 0.1%, 0.2%, 0.4%, 1% and 2%. The experiment was conducted in relatively low Reynolds numbers of 301 to 740. A heater with the power of 200 W was used to keep the outer surface of the tubes under a constant heat flux condition. In addition, the rectangular tube has been designed within the same length as the semicircular one and also within the same hydraulic diameter. Moreover, the average nanoparticles size was 20 nm. The outcome results of the present empirical work indicate that, for all the examined Reynolds numbers, the semicircular tube has higher convective heat transfer coefficient for all the utilized volume concentrations of Ag nanoparticles. The possible reasons behind this advantage are discussed through the present work mainly by taking the boundary effect on Brownian motions into account. Coming to this point that the conventional design for cooling system of photovoltaic cells is a heat sink with the rectangular graves, it is discussed that using a semicircular design may have the advantage over the rectangular one in convective heat transfer coefficient enhancement and hence a better cooling performance for these solar cells.

  5. From Conflict to Co-co-operation in International Water Resources Management: Challenges and Opportunities in Sub-Saharan Africa

    International Nuclear Information System (INIS)

    Onyango, O.W

    2006-01-01

    Water and life are interdependent and inseparable. In order to achieve effective water management strategies ought to be premised on good understanding of ecosystems within the environment. Fresh water resources experience a lot of stress due to high competition which results in local, national and regional conflicts due to lack of co-ordinated water management system. The fresh water basins comprise nearly half of the territory and population of the world. In 2002, the World Summit on Sustainable development held in Johannesburg pointed out that, due to looming water shortage other sectors of life like health, human rights, environment, welfare politics and culture. On the other hand, due to diminishing trans-boundary water resources and their variable occurrence in space and time, there is a likelihood of inter-state tensions with possibilities of armed conflict. The paper therefore recommended for integrated, cooperative and culturally adapted solutions which take into account the diversity of human interactions with water

  6. Ninth plenary meeting of the International Working Group on Water Reactor Fuel Performance and Technology Vienna, 2-4 October 1989

    International Nuclear Information System (INIS)

    1990-03-01

    The 9th Plenary Meeting of the International Working Group on Water Reactor Fuel Performance and Technology (IWGFPT) was held in Vienna from 2 to 4 October 1989. The meeting was attended by 24 participants from 18 Member States and one international organization. This publication is a summary report of this meeting. It contains review of the IWGFPT activities of the period since the 8th meeting. The representatives of the Member States presented information about National Programs and multilateral projects status with emphasis on new results. Summary of the discussion on schedule of IWGFPT activities for the period of 1990-91 is also published in this report. Refs, figs and tabs

  7. Water

    CSIR Research Space (South Africa)

    Van Wyk, Llewellyn V

    2010-08-01

    Full Text Available Water scarcity is without a doubt on of the greatest threats to the human species and has all the potential to destabilise world peace. Falling water tables are a new phenomenon. Up until the development of steam and electric motors, deep groudwater...

  8. Water

    OpenAIRE

    Hertie School of Governance

    2010-01-01

    All human life depends on water and air. The sustainable management of both is a major challenge for today's public policy makers. This issue of Schlossplatz³ taps the streams and flows of the current debate on the right water governance.

  9. Simulated earthquake ground motions

    International Nuclear Information System (INIS)

    Vanmarcke, E.H.; Gasparini, D.A.

    1977-01-01

    The paper reviews current methods for generating synthetic earthquake ground motions. Emphasis is on the special requirements demanded of procedures to generate motions for use in nuclear power plant seismic response analysis. Specifically, very close agreement is usually sought between the response spectra of the simulated motions and prescribed, smooth design response spectra. The features and capabilities of the computer program SIMQKE, which has been widely used in power plant seismic work are described. Problems and pitfalls associated with the use of synthetic ground motions in seismic safety assessment are also pointed out. The limitations and paucity of recorded accelerograms together with the widespread use of time-history dynamic analysis for obtaining structural and secondary systems' response have motivated the development of earthquake simulation capabilities. A common model for synthesizing earthquakes is that of superposing sinusoidal components with random phase angles. The input parameters for such a model are, then, the amplitudes and phase angles of the contributing sinusoids as well as the characteristics of the variation of motion intensity with time, especially the duration of the motion. The amplitudes are determined from estimates of the Fourier spectrum or the spectral density function of the ground motion. These amplitudes may be assumed to be varying in time or constant for the duration of the earthquake. In the nuclear industry, the common procedure is to specify a set of smooth response spectra for use in aseismic design. This development and the need for time histories have generated much practical interest in synthesizing earthquakes whose response spectra 'match', or are compatible with a set of specified smooth response spectra

  10. Inter-fraction variations in respiratory motion models

    Energy Technology Data Exchange (ETDEWEB)

    McClelland, J R; Modat, M; Ourselin, S; Hawkes, D J [Centre for Medical Image Computing, University College London (United Kingdom); Hughes, S; Qureshi, A; Ahmad, S; Landau, D B, E-mail: j.mcclelland@cs.ucl.ac.uk [Department of Oncology, Guy' s and St Thomas' s Hospitals NHS Trust, London (United Kingdom)

    2011-01-07

    Respiratory motion can vary dramatically between the planning stage and the different fractions of radiotherapy treatment. Motion predictions used when constructing the radiotherapy plan may be unsuitable for later fractions of treatment. This paper presents a methodology for constructing patient-specific respiratory motion models and uses these models to evaluate and analyse the inter-fraction variations in the respiratory motion. The internal respiratory motion is determined from the deformable registration of Cine CT data and related to a respiratory surrogate signal derived from 3D skin surface data. Three different models for relating the internal motion to the surrogate signal have been investigated in this work. Data were acquired from six lung cancer patients. Two full datasets were acquired for each patient, one before the course of radiotherapy treatment and one at the end (approximately 6 weeks later). Separate models were built for each dataset. All models could accurately predict the respiratory motion in the same dataset, but had large errors when predicting the motion in the other dataset. Analysis of the inter-fraction variations revealed that most variations were spatially varying base-line shifts, but changes to the anatomy and the motion trajectories were also observed.

  11. Galileo and the Problems of Motion

    Science.gov (United States)

    Hooper, Wallace Edd

    Galileo's science of motion changed natural philosophy. His results initiated a broad human awakening to the intricate new world of physical order found in the midst of familiar operations of nature. His thinking was always based squarely on the academic traditions of the spiritual old world. He advanced physics by new standards of judgment drawn from mechanics and geometry, and disciplined observation of the world. My study first determines the order of composition of the earliest essays on motion and physics, ca. 1588 -1592, from internal evidence, and bibliographic evidence. There are clear signs of a Platonist critique of Aristotle, supported by Archimedes, in the Ten Section Version of On Motion, written ca. 1588, and probably the earliest of his treatises on motion or physics. He expanded upon his opening Platonic -Archimedean position by investigating the ideas of scholastic critics of Aristotle, including the Doctores Parisienses, found in his readings of the Jesuit Professors at the Collegio Romano. Their influences surfaced clearly in Galileo's Memoranda on Motion and the Dialogue on Motion, and in On Motion, which followed, ca. 1590-1592. At the end of his sojourn in Pisa, Galileo opened the road to the new physics by solving an important problem in the mechanics of Pappus, concerning motion along inclined planes. My study investigates why Galileo gave up attempts to establish a ratio between speed and weight, and why he began to seek the ratios of time and distance and speed, by 1602. It also reconstructs Galileo's development of the 1604 principle, seeking to outline its invention, elaboration, and abandonment. Then, I try to show that we have a record of Galileo's moment of recognition of the direct relation between the time of fall and the accumulated speed of motion--that great affinity between time and motion and the key to the new science of motion established before 1610. Evidence also ties the discovery of the time affinity directly to Galileo

  12. Expert Water Quality Panel Review of Responses to the NASA Request for Information for the International Space Station On-Board Environmental Monitoring System

    Science.gov (United States)

    Fishman, Julianna L.; Mudgett, Paul D.; Packham, Nigel J.; Schultz, John R.; Straub, John E., II

    2005-01-01

    On August 9, 2003, NASA, with the cooperative support of the Vehicle Office of the International Space Station Program, the Advanced Human Support Technology Program, and the Johnson Space Center Habitability and Environmental Factors Office released a Request for Information, or RFI, to identify next-generation environmental monitoring systems that have demonstrated ability or the potential to meet defined requirements for monitoring air and water quality onboard the International Space Station. This report summarizes the review and analysis of the proposed solutions submitted to meet the water quality monitoring requirements. Proposals were to improve upon the functionality of the existing Space Station Total Organic Carbon Analyzer (TOCA) and monitor additional contaminants in water samples. The TOCA is responsible for in-flight measurement of total organic carbon, total inorganic carbon, total carbon, pH, and conductivity in the Space Station potable water supplies. The current TOCA requires hazardous reagents to accomplish the carbon analyses. NASA is using the request for information process to investigate new technologies that may improve upon existing capabilities, as well as reduce or eliminate the need for hazardous reagents. Ideally, a replacement for the TOCA would be deployed in conjunction with the delivery of the Node 3 water recovery system currently scheduled for November 2007.

  13. Trace element analysis of water using radioisotope induced X-ray fluorescence (Cd-109) and a preconcentration-internal standard method

    International Nuclear Information System (INIS)

    Alvarez, M.; Cano, W.

    1986-10-01

    Radioisotope induced X-ray fluorescence using Cd-109 was used for the determination of iron, nickel, copper, zinc, lead and mercury in water. These metals were concentrated by precipitation with the chelating agent APDC. The precipitated formed was filtered using a membrane filter. Cobalt was added as an internal standard. Minimum detection limit, sensitivities and calibration curves linearities have been obtained to find the limits of the method. The usefulness of the method is illustrated analysing synthetic standard solutions. As an application analytical results are given for water of a highly polluted river area. (Author)

  14. MAIN PROBLEMS AND PROSPECTS OF REPUBLIC OF BELARUS IN RESPECT OF ITS ENTRY TO INTERNATIONAL BOTTLED WATER MARKET

    Directory of Open Access Journals (Sweden)

    P. G. Nikitenko

    2009-01-01

    Full Text Available The Republic of Belarus has significant reserves of ground fresh and mineral water. Consumption of bottled water in the world has a tendency of steady growth. In this regard, Belarus can increase production and sale of bottled water on the external  and domestic markets as well. The paper  describes main tendencies prevailing on the world market;  it contains an analysis of the normative and legal foundation on regulation of production and sale of bottled water in the Republic and abroad; the paper also estimates the possibilities to increase volume of export water

  15. Indicators of food and water security in an Arctic Health context--results from an international workshop discussion.

    Science.gov (United States)

    Nilsson, Lena Maria; Berner, James; Dudarev, Alexey A; Mulvad, Gert; Odland, Jon Øyvind; Parkinson, Alan; Rautio, Arja; Tikhonov, Constantine; Evengård, Birgitta

    2013-01-01

    In August 2012, a literature search with the aim of describing indicators on food and water security in an Arctic health context was initialized in collaboration between the Arctic Human Health Expert Group, SDWG/AHHEG and the AMAP (Arctic Monitoring and Assessment Programme within the Arctic Council) Human Health Assessment Group, AMAP/HHAG. In December 2012, workshop discussions were performed with representatives from both of these organizations, including 7 Arctic countries. The aim of this article is to describe the workshop discussions and the rational for the 12 indicators selected and the 9 rejected and to discuss the potential feasibility of these. Advantages and disadvantages of candidate indicators were listed. Informative value and costs for collecting were estimated separately on a 3-level scale: low, medium and high. Based on these reviews, the final selection of promoted and rejected indicators was performed and summarized in tables. Among 10 suggested indicators of food security, 6 were promoted: healthy weight, traditional food proportion in diet, monetary food costs, non-monetary food accessibility, food-borne diseases and food-related contaminants. Four were rejected: per-person dietary energy supply, food security modules, self-estimated food safety and healthy eating. Among 10 suggested indicators of water security, 6 were promoted: per-capita renewable water, accessibility of running water, waterborne diseases, drinking-water-related contaminants, authorized water quality assurance and water safety plans. Four were rejected: water consumption, types of water sources, periodic water shortages and household water costs.

  16. Indicators of food and water security in an Arctic Health context – results from an international workshop discussion

    Directory of Open Access Journals (Sweden)

    Lena Maria Nilsson

    2013-08-01

    Full Text Available In August 2012, a literature search with the aim of describing indicators on food and water security in an Arctic health context was initialized in collaboration between the Arctic Human Health Expert Group, SDWG/AHHEG and the AMAP (Arctic Monitoring and Assessment Programme within the Arctic Council Human Health Assessment Group, AMAP/HHAG. In December 2012, workshop discussions were performed with representatives from both of these organizations, including 7 Arctic countries. The aim of this article is to describe the workshop discussions and the rational for the 12 indicators selected and the 9 rejected and to discuss the potential feasibility of these. Advantages and disadvantages of candidate indicators were listed. Informative value and costs for collecting were estimated separately on a 3-level scale: low, medium and high. Based on these reviews, the final selection of promoted and rejected indicators was performed and summarized in tables. Among 10 suggested indicators of food security, 6 were promoted: healthy weight, traditional food proportion in diet, monetary food costs, non-monetary food accessibility, food-borne diseases and food-related contaminants. Four were rejected: per-person dietary energy supply, food security modules, self-estimated food safety and healthy eating. Among 10 suggested indicators of water security, 6 were promoted: per-capita renewable water, accessibility of running water, waterborne diseases, drinking-water-related contaminants, authorized water quality assurance and water safety plans. Four were rejected: water consumption, types of water sources, periodic water shortages and household water costs.

  17. In-Flight Water Quality Monitoring on the International Space Station (ISS): Measuring Biocide Concentrations with Colorimetric Solid Phase Extraction (CSPE)

    Science.gov (United States)

    Gazda, Daniel B.; Schultz, John R.; Siperko, Lorraine M.; Porter, Marc D.; Lipert, Robert J.; Flint, Stephanie M.; McCoy, J. Torin

    2011-01-01

    The colorimetric water quality monitoring kit (CWQMK) was delivered to the International Space Station (ISS) on STS-128/17A and was initially deployed in September 2009. The kit was flown as a station development test objective (SDTO) experiment to evaluate the acceptability of colorimetric solid phase extraction (CSPE) technology for routine water quality monitoring on the ISS. During the SDTO experiment, water samples from the U.S. water processor assembly (WPA), the U.S. potable water dispenser (PWD), and the Russian system for dispensing ground-supplied water (SVO-ZV) were collected and analyzed with the CWQMK. Samples from the U.S. segment of the ISS were analyzed for molecular iodine, which is the biocide added to water in the WPA. Samples from the SVOZV system were analyzed for ionic silver, the biocide used on the Russian segment of the ISS. In all, thirteen in-flight analysis sessions were completed as part of the SDTO experiment. This paper provides an overview of the experiment and reports the results obtained with the CWQMK. The forward plan for certifying the CWQMK as operational hardware and expanding the capabilities of the kit are also discussed.

  18. THE USE OF STABILIZED LIQUIDE CHLORINE DIOXIDE (ClO2 FOR INTERNAL WATER SUPPLY SYSTEM SANITATION OF FARM WITH LAYING FLOCK AFFECTED BY COLISEPTICEMIA

    Directory of Open Access Journals (Sweden)

    Abdulah Gagić

    2014-03-01

    Full Text Available A successful and harmless method for rehabilitation of hygienic status of water and its supply system using a stabilized liquid chlorine dioxide solution on a farm of the laying hens affected by severe colisepticemia is described. Source of infection was drinking water contaminated by slurry from two pig facilities located above the water tank. The contaminated water caused the emergence of biofilm consisting mainly of coliform bacteria on the interior surfaces of the plastic pipes. Through drinking the contaminated water the infection of the laying flocks occurred. With the aim of improving the flocks’ health status, a programme of sanitary treatment of external and internal water supply system and water was created and implemented. In order to prevent biofilm formation and improve sanitation prescribed was the use of stabilized liquid chlorine dioxide (ClO2 in the 4‰ concentration for so-called night "shock" treatments, and 2‰ concentration for prophylactic daily disinfection of drinking water. With the improvement of the flocks’ health status, the "shock" treatments with ClO2 were repeated in the upcoming months. As an add-on therapy, 40 mg per bird of vitamin C through drinking water for three days was prescribed. The use of non-resorptive antibiotics, AD3E vitamins and amino acid supplements was excluded because they had failed to improve the flocks’ health status in the acute phase. Therefore, the sanitation programme based on the use of stabilized liquid ClO2 in the water supply system of the laying flocks affected by severe colisepticemia resulted in radical decrease of mortality during the next three months. Key words: chlorine dioxide, biofilm, sanitation, disinfection, colisepticemia

  19. Hip strength and range of motion

    DEFF Research Database (Denmark)

    Mosler, Andrea B.; Crossley, Kay M.; Thorborg, Kristian

    2017-01-01

    Objectives To determine the normal profiles for hip strength and range of motion (ROM) in a professional football league in Qatar, and examine the effect of leg dominance, age, past history of injury, and ethnicity on these profiles. Design Cross-sectional cohort study. Methods Participants...... values are documented for hip strength and range of motion that can be used as reference profiles in the clinical assessment, screening, and management of professional football players. Leg dominance, recent past injury history and ethnicity do not need to be accounted for when using these profiles...... included 394 asymptomatic, male professional football players, aged 18–40 years. Strength was measured using a hand held dynamometer with an eccentric test in side-lying for hip adduction and abduction, and the squeeze test in supine with 45° hip flexion. Range of motion measures included: hip internal...

  20. Communication: Mode bifurcation of droplet motion under stationary laser irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Takabatake, Fumi [Department of Physics, Graduate School of Science, Kyoto University, Kyoto 606-8502 (Japan); Department of Bioengineering and Robotics, Graduate School of Engineering, Tohoku University, Sendai, Miyagi 980-8579 (Japan); Yoshikawa, Kenichi [Faculty of Life and Medical Sciences, Doshisha University, Kyotanabe, Kyoto 610-0394 (Japan); Ichikawa, Masatoshi, E-mail: ichi@scphys.kyoto-u.ac.jp [Department of Physics, Graduate School of Science, Kyoto University, Kyoto 606-8502 (Japan)

    2014-08-07

    The self-propelled motion of a mm-sized oil droplet floating on water, induced by a local temperature gradient generated by CW laser irradiation is reported. The circular droplet exhibits two types of regular periodic motion, reciprocal and circular, around the laser spot under suitable laser power. With an increase in laser power, a mode bifurcation from rectilinear reciprocal motion to circular motion is caused. The essential aspects of this mode bifurcation are discussed in terms of spontaneous symmetry-breaking under temperature-induced interfacial instability, and are theoretically reproduced with simple coupled differential equations.