WorldWideScience

Sample records for internal tandem duplications

  1. Recurrent internal tandem duplications of BCOR in clear cell sarcoma of the kidney

    Science.gov (United States)

    Roy, Angshumoy; Kumar, Vijetha; Zorman, Barry; Fang, Erica; Haines, Katherine M.; Doddapaneni, HarshaVardhan; Hampton, Oliver A.; White, Simon; Bavle, Abhishek A.; Patel, Nimesh R.; Eldin, Karen W.; John Hicks, M.; Rakheja, Dinesh; Leavey, Patrick J.; Skapek, Stephen X.; Amatruda, James F.; Nuchtern, Jed G.; Chintagumpala, Murali M.; Wheeler, David A.; Plon, Sharon E.; Sumazin, Pavel; Parsons, D. Williams

    2015-01-01

    The X-linked BCL-6 co-repressor (BCOR) gene encodes a key constituent of a variant polycomb repressive complex (PRC) that is mutated or translocated in human cancers. Here we report on the identification of somatic internal tandem duplications (ITDs) clustering in the C terminus of BCOR in 23 of 27 (85%) pediatric clear cell sarcomas of the kidney (CCSK) from two independent cohorts. We profile CCSK tumours using a combination of whole-exome, transcriptome and targeted sequencing. Identical ITD mutations are found in primary and relapsed tumour pairs but not in adjacent normal kidney or blood. Mutant BCOR transcripts and proteins are markedly upregulated in ITD-positive tumours. Transcriptome analysis of ITD-positive CCSKs reveals enrichment for PRC2-regulated genes and similarity to undifferentiated sarcomas harbouring BCOR–CCNB3 fusions. The discovery of recurrent BCOR ITDs defines a major oncogenic event in this childhood sarcoma with significant implications for diagnostic and therapeutic approaches to this tumour. PMID:26573325

  2. Finding all sorting tandem duplication random loss operations

    DEFF Research Database (Denmark)

    Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang

    2011-01-01

    A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...

  3. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  4. Narrow, duplicated internal auditory canal

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, T. [Servico de Neurorradiologia, Hospital Garcia de Orta, Avenida Torrado da Silva, 2801-951, Almada (Portugal); Shayestehfar, B. [Department of Radiology, UCLA Oliveview School of Medicine, Los Angeles, California (United States); Lufkin, R. [Department of Radiology, UCLA School of Medicine, Los Angeles, California (United States)

    2003-05-01

    A narrow internal auditory canal (IAC) constitutes a relative contraindication to cochlear implantation because it is associated with aplasia or hypoplasia of the vestibulocochlear nerve or its cochlear branch. We report an unusual case of a narrow, duplicated IAC, divided by a bony septum into a superior relatively large portion and an inferior stenotic portion, in which we could identify only the facial nerve. This case adds support to the association between a narrow IAC and aplasia or hypoplasia of the vestibulocochlear nerve. The normal facial nerve argues against the hypothesis that the narrow IAC is the result of a primary bony defect which inhibits the growth of the vestibulocochlear nerve. (orig.)

  5. Bilateral duplication of the internal auditory canal

    International Nuclear Information System (INIS)

    Weon, Young Cheol; Kim, Jae Hyoung; Choi, Sung Kyu; Koo, Ja-Won

    2007-01-01

    Duplication of the internal auditory canal is an extremely rare temporal bone anomaly that is believed to result from aplasia or hypoplasia of the vestibulocochlear nerve. We report bilateral duplication of the internal auditory canal in a 28-month-old boy with developmental delay and sensorineural hearing loss. (orig.)

  6. Targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae.

    Science.gov (United States)

    Takahashi, Tadashi; Sato, Atsushi; Ogawa, Masahiro; Hanya, Yoshiki; Oguma, Tetsuya

    2014-08-01

    We describe here the first successful construction of a targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae. The targeted tandem chromosomal duplication was achieved by using strains that had a 5'-deleted pyrG upstream of the region targeted for tandem chromosomal duplication and a 3'-deleted pyrG downstream of the target region. Consequently,strains bearing a 210-kb targeted tandem chromosomal duplication near the centromeric region of chromosome 8 and strains bearing a targeted tandem chromosomal duplication of a 700-kb region of chromosome 2 were successfully constructed. The strains bearing the tandem chromosomal duplication were efficiently obtained from the regenerated protoplast of the parental strains. However, the generation of the chromosomal duplication did not depend on the introduction of double-stranded breaks(DSBs) by I-SceI. The chromosomal duplications of these strains were stably maintained after five generations of culture under nonselective conditions. The strains bearing the tandem chromosomal duplication in the 700-kb region of chromosome 2 showed highly increased protease activity in solid-state culture, indicating that the duplication of large chromosomal segments could be a useful new breeding technology and gene analysis method.

  7. Allogeneic stem cell transplantation benefits for patients ≥ 60 years with acute myeloid leukemia and FLT3 internal tandem duplication: a study from the Acute Leukemia Working Party of the European Society for Blood and Marrow Transplantation.

    Science.gov (United States)

    Poiré, Xavier; Labopin, Myriam; Polge, Emmanuelle; Passweg, Jakob; Craddock, Charles; Blaise, Didier; Cornelissen, Jan J; Volin, Liisa; Russell, Nigel H; Socié, Gérard; Michallet, Mauricette; Fegueux, Nathalie; Chevallier, Patrice; Brecht, Arne; Hunault-Berger, Mathilde; Mohty, Mohamad; Esteve, Jordi; Nagler, Arnon

    2018-02-01

    Intermediate-risk cytogenetic acute myeloid leukemia with an internal tandem duplication of FLT3 ( FLT3 -ITD) is associated with a high risk of relapse, and is now a standard indication for allogeneic stem cell transplantation. Nevertheless, most studies supporting this strategy have been performed in young patients. To address the benefit of allogeneic transplantation in the elderly, we made a selection from the European Society for Blood and Marrow Transplantation registry of de novo intermediate-risk cytogenetic acute myeloid leukemia harboring FLT3 -ITD in patients aged 60 or over and transplanted from a related or unrelated donor between January 2000 and December 2015. Two hundred and ninety-one patients were identified. Most patients received a reduced-intensity conditioning (82%), while donors consisted of an unrelated donor in 161 (55%) patients. Two hundred and twelve patients received their transplantation in first remission, 37 in second remission and 42 in a more advanced stage of the disease. The 2-year leukemia-free survival rate was 56% in patients in first remission, 22% in those in second remission and 10% in patients with active disease, respectively ( P <0.005). Non-relapse mortality for the entire cohort was 20%. In multivariate analysis, disease status at transplantation was the most powerful predictor of worse leukemia-free survival, graft- versus -host disease and relapse-free survival, and overall survival. In this elderly population, age was not associated with outcome. Based on the current results, allogeneic transplantation translates into a favorable outcome in fit patients ≥ 60 with FLT3 -ITD acute myeloid leukemia in first remission, similarly to current treatment recommendations for younger patients. Copyright© 2018 Ferrata Storti Foundation.

  8. Internal Tandem Duplication in FLT3 Attenuates Proliferation and Regulates Resistance to the FLT3 Inhibitor AC220 by Modulating p21Cdkn1a and Pbx1 in Hematopoietic Cells.

    Directory of Open Access Journals (Sweden)

    Mariko Abe

    Full Text Available Internal tandem duplication (ITD mutations in the Fms-related tyrosine kinase 3 (FLT3 gene (FLT3-ITD are associated with poor prognosis in patients with acute myeloid leukemia (AML. Due to the development of drug resistance, few FLT3-ITD inhibitors are effective against FLT3-ITD+ AML. In this study, we show that FLT3-ITD activates a novel pathway involving p21Cdkn1a (p21 and pre-B cell leukemia transcription factor 1 (Pbx1 that attenuates FLT3-ITD cell proliferation and is involved in the development of drug resistance. FLT3-ITD up-regulated p21 expression in both mouse bone marrow c-kit+-Sca-1+-Lin- (KSL cells and Ba/F3 cells. The loss of p21 expression enhanced growth factor-independent proliferation and sensitivity to cytarabine as a consequence of concomitantly enriching the S+G2/M phase population and significantly increasing the expression of Pbx1, but not Evi-1, in FLT3-ITD+ cells. This enhanced cell proliferation following the loss of p21 was partially abrogated when Pbx1 expression was silenced in FLT3-ITD+ primary bone marrow colony-forming cells and Ba/F3 cells. When FLT3-ITD was antagonized with AC220, a selective inhibitor of FLT3-ITD, p21 expression was decreased coincident with Pbx1 mRNA up-regulation and a rapid decline in the number of viable FLT3-ITD+ Ba/F3 cells; however, the cells eventually became refractory to AC220. Overexpressing p21 in FLT3-ITD+ Ba/F3 cells delayed the emergence of cells that were refractory to AC220, whereas p21 silencing accelerated their development. These data indicate that FLT3-ITD is capable of inhibiting FLT3-ITD+ cell proliferation through the p21/Pbx1 axis and that treatments that antagonize FLT3-ITD contribute to the subsequent development of cells that are refractory to a FLT3-ITD inhibitor by disrupting p21 expression.

  9. Constitutional Tandem Duplication of 9q34 that Truncates EHMT1 in a Child with Ganglioglioma

    Science.gov (United States)

    Cheung, Hannah C.; Yatsenko, Svetlana A.; Kadapakkam, Meena; Legay, Hélène; Su, Jack; Lupski, James R.; Plon, Sharon E.

    2011-01-01

    Point mutations of EHMT1 or deletions and duplications of chromosome 9q34.3 are found in patients with variable neurologic and developmental disorders. Here, we present a child with congenital cataract, developmental and speech delay who developed a metastatic ganglioglioma with progression to anaplastic astrocytoma. Molecular analysis identified a novel constitutional tandem duplication in 9q34.3 with breakpoints in intron 1 of TRAF2 and intron 16 of EHMT1 generating a fusion transcript predicted to encode a truncated form of EHMT1. The ganglioglioma showed complex chromosomal aberrations with further duplication of the dup9q34. Thus, this unique tandem 9q34.3 duplication may impact brain tumor formation. PMID:21681934

  10. Profiling of gene duplication patterns of sequenced teleost genomes: evidence for rapid lineage-specific genome expansion mediated by recent tandem duplications.

    Science.gov (United States)

    Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang

    2012-06-15

    Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication

  11. MSOAR 2.0: Incorporating tandem duplications into ortholog assignment based on genome rearrangement

    Directory of Open Access Journals (Sweden)

    Zhang Liqing

    2010-01-01

    Full Text Available Abstract Background Ortholog assignment is a critical and fundamental problem in comparative genomics, since orthologs are considered to be functional counterparts in different species and can be used to infer molecular functions of one species from those of other species. MSOAR is a recently developed high-throughput system for assigning one-to-one orthologs between closely related species on a genome scale. It attempts to reconstruct the evolutionary history of input genomes in terms of genome rearrangement and gene duplication events. It assumes that a gene duplication event inserts a duplicated gene into the genome of interest at a random location (i.e., the random duplication model. However, in practice, biologists believe that genes are often duplicated by tandem duplications, where a duplicated gene is located next to the original copy (i.e., the tandem duplication model. Results In this paper, we develop MSOAR 2.0, an improved system for one-to-one ortholog assignment. For a pair of input genomes, the system first focuses on the tandemly duplicated genes of each genome and tries to identify among them those that were duplicated after the speciation (i.e., the so-called inparalogs, using a simple phylogenetic tree reconciliation method. For each such set of tandemly duplicated inparalogs, all but one gene will be deleted from the concerned genome (because they cannot possibly appear in any one-to-one ortholog pairs, and MSOAR is invoked. Using both simulated and real data experiments, we show that MSOAR 2.0 is able to achieve a better sensitivity and specificity than MSOAR. In comparison with the well-known genome-scale ortholog assignment tool InParanoid, Ensembl ortholog database, and the orthology information extracted from the well-known whole-genome multiple alignment program MultiZ, MSOAR 2.0 shows the highest sensitivity. Although the specificity of MSOAR 2.0 is slightly worse than that of InParanoid in the real data experiments

  12. "Tandem duplication-random loss" is not a real feature of oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Zhang Guofan

    2009-02-01

    Full Text Available Abstract Duplications and rearrangements of coding genes are major themes in the evolution of mitochondrial genomes, bearing important consequences in the function of mitochondria and the fitness of organisms. Yu et al. (BMC Genomics 2008, 9:477 reported the complete mt genome sequence of the oyster Crassostrea hongkongensis (16,475 bp and found that a DNA segment containing four tRNA genes (trnK1, trnC, trnQ1 and trnN, a duplicated (rrnS and a split rRNA gene (rrnL5' was absent compared with that of two other Crassostrea species. It was suggested that the absence was a novel case of "tandem duplication-random loss" with evolutionary significance. We independently sequenced the complete mt genome of three C. hongkongensis individuals, all of which were 18,622 bp and contained the segment that was missing in Yu et al.'s sequence. Further, we designed primers, verified sequences and demonstrated that the sequence loss in Yu et al.'s study was an artifact caused by placing primers in a duplicated region. The duplication and split of ribosomal RNA genes are unique for Crassostrea oysters and not lost in C. hongkongensis. Our study highlights the need for caution when amplifying and sequencing through duplicated regions of the genome.

  13. DB2: a probabilistic approach for accurate detection of tandem duplication breakpoints using paired-end reads.

    Science.gov (United States)

    Yavaş, Gökhan; Koyutürk, Mehmet; Gould, Meetha P; McMahon, Sarah; LaFramboise, Thomas

    2014-03-05

    With the advent of paired-end high throughput sequencing, it is now possible to identify various types of structural variation on a genome-wide scale. Although many methods have been proposed for structural variation detection, most do not provide precise boundaries for identified variants. In this paper, we propose a new method, Distribution Based detection of Duplication Boundaries (DB2), for accurate detection of tandem duplication breakpoints, an important class of structural variation, with high precision and recall. Our computational experiments on simulated data show that DB2 outperforms state-of-the-art methods in terms of finding breakpoints of tandem duplications, with a higher positive predictive value (precision) in calling the duplications' presence. In particular, DB2's prediction of tandem duplications is correct 99% of the time even for very noisy data, while narrowing down the space of possible breakpoints within a margin of 15 to 20 bps on the average. Most of the existing methods provide boundaries in ranges that extend to hundreds of bases with lower precision values. Our method is also highly robust to varying properties of the sequencing library and to the sizes of the tandem duplications, as shown by its stable precision, recall and mean boundary mismatch performance. We demonstrate our method's efficacy using both simulated paired-end reads, and those generated from a melanoma sample and two ovarian cancer samples. Newly discovered tandem duplications are validated using PCR and Sanger sequencing. Our method, DB2, uses discordantly aligned reads, taking into account the distribution of fragment length to predict tandem duplications along with their breakpoints on a donor genome. The proposed method fine tunes the breakpoint calls by applying a novel probabilistic framework that incorporates the empirical fragment length distribution to score each feasible breakpoint. DB2 is implemented in Java programming language and is freely available

  14. Origin of a function by tandem gene duplication limits the evolutionary capability of its sister copy.

    Science.gov (United States)

    Hasselmann, Martin; Lechner, Sarah; Schulte, Christina; Beye, Martin

    2010-07-27

    The most remarkable outcome of a gene duplication event is the evolution of a novel function. Little information exists on how the rise of a novel function affects the evolution of its paralogous sister gene copy, however. We studied the evolution of the feminizer (fem) gene from which the gene complementary sex determiner (csd) recently derived by tandem duplication within the honey bee (Apis) lineage. Previous studies showed that fem retained its sex determination function, whereas the rise of csd established a new primary signal of sex determination. We observed a specific reduction of nonsynonymous to synonymous substitution ratios in Apis to non-Apis fem. We found a contrasting pattern at two other genetically linked genes, suggesting that hitchhiking effects to csd, the locus under balancing selection, is not the cause of this evolutionary pattern. We also excluded higher synonymous substitution rates by relative rate testing. These results imply that stronger purifying selection is operating at the fem gene in the presence of csd. We propose that csd's new function interferes with the function of Fem protein, resulting in molecular constraints and limited evolvability of fem in the Apis lineage. Elevated silent nucleotide polymorphism in fem relative to the genome-wide average suggests that genetic linkage to the csd gene maintained more nucleotide variation in today's population. Our findings provide evidence that csd functionally and genetically interferes with fem, suggesting that a newly evolved gene and its functions can limit the evolutionary capability of other genes in the genome.

  15. Whole Genome and Tandem Duplicate Retention facilitated Glucosinolate Pathway Diversification in the Mustard Family.

    NARCIS (Netherlands)

    Hofberger, J.A.; Lyons, E.; Edger, P.P.; Pires, J.C.; Schranz, M.E.

    2013-01-01

    Plants share a common history of successive whole genome duplication (WGD) events retaining genomic patterns of duplicate gene copies (ohnologs) organized in conserved syntenic blocks. Duplication was often proposed to affect the origin of novel traits during evolution. However, genetic evidence

  16. North Carolina macular dystrophy (MCDR1) caused by a novel tandem duplication of the PRDM13 gene.

    Science.gov (United States)

    Bowne, Sara J; Sullivan, Lori S; Wheaton, Dianna K; Locke, Kirsten G; Jones, Kaylie D; Koboldt, Daniel C; Fulton, Robert S; Wilson, Richard K; Blanton, Susan H; Birch, David G; Daiger, Stephen P

    2016-01-01

    To identify the underlying cause of disease in a large family with North Carolina macular dystrophy (NCMD). A large four-generation family (RFS355) with an autosomal dominant form of NCMD was ascertained. Family members underwent comprehensive visual function evaluations. Blood or saliva from six affected family members and three unaffected spouses was collected and DNA tested for linkage to the MCDR1 locus on chromosome 6q12. Three affected family members and two unaffected spouses underwent whole exome sequencing (WES) and subsequently, custom capture of the linkage region followed by next-generation sequencing (NGS). Standard PCR and dideoxy sequencing were used to further characterize the mutation. Of the 12 eyes examined in six affected individuals, all but two had Gass grade 3 macular degeneration features. Large central excavation of the retinal and choroid layers, referred to as a macular caldera, was seen in an age-independent manner in the grade 3 eyes. The calderas are unique to affected individuals with MCDR1. Genome-wide linkage mapping and haplotype analysis of markers from the chromosome 6q region were consistent with linkage to the MCDR1 locus. Whole exome sequencing and custom-capture NGS failed to reveal any rare coding variants segregating with the phenotype. Analysis of the custom-capture NGS sequencing data for copy number variants uncovered a tandem duplication of approximately 60 kb on chromosome 6q. This region contains two genes, CCNC and PRDM13 . The duplication creates a partial copy of CCNC and a complete copy of PRDM13 . The duplication was found in all affected members of the family and is not present in any unaffected members. The duplication was not seen in 200 ethnically matched normal chromosomes. The cause of disease in the original family with MCDR1 and several others has been recently reported to be dysregulation of the PRDM13 gene, caused by either single base substitutions in a DNase 1 hypersensitive site upstream of the CCNC

  17. A Narrow Internal Auditory Canal with Duplication in a Patient with Congenital Sensorineural Hearing Loss

    Energy Technology Data Exchange (ETDEWEB)

    Baik, Hye Won; Yu, Hye On; Kim, Kyung Soo; Kim, Gi Hyeon [Chung-Ang University Hospital, College of Medicine, Seoul (Korea, Republic of)

    2008-07-15

    A narrow internal auditory canal (IAC) with duplication is a rare anomaly of the temporal bone. It is associated with congenital sensorineural hearing loss. Aplasia or hypoplasia of the vestibulocochlear nerve may cause the hearing loss. We present an unusual case of an isolated narrow IAC with duplication that was detected by a CT scan. In this case, the IAC was divided by a bony septum into an empty stenotic inferoposterior portion and a large anterosuperior portion containing the facial nerve that was clearly delineated on MRI.

  18. TANDEM

    Data.gov (United States)

    Federal Laboratory Consortium — The Tandem Van de Graaff facility provides researchers with beams of more than 40 different types of ions - atoms that have been stripped of their electrons. One of...

  19. Duplicate editorial on duplicate publication.

    Science.gov (United States)

    Corson, Stephen L; Decherney, Alan H

    2005-04-01

    The authors define and discuss the various forms taken by duplicate publications, and provide suggested remedies to help authors, editors, reviewers, and readers avoid this form of internal plagiarism.

  20. Tandem duplications of a degenerated GTP-binding domain at the origin of GTPase receptors Toc159 and thylakoidal SRP

    International Nuclear Information System (INIS)

    Hernandez Torres, Jorge; Maldonado, Monica Alexandra Arias; Chomilier, Jacques

    2007-01-01

    The evolutionary origin of some nuclear encoded proteins that translocate proteins across the chloroplast envelope remains unknown. Therefore, sequences of GTPase proteins constituting the Arabidopsis thaliana translocon at the outer membrane of chloroplast (atToc) complexes were analyzed by means of HCA. In particular, atToc159 and related proteins (atToc132, atToc120, and atToc90) do not have proven homologues of prokaryotic or eukaryotic ancestry. We established that the three domains commonly referred to as A, G, and M originate from the GTPase G domain, tandemly repeated, and probably evolving toward an unstructured conformation in the case of the A domain. It resulted from this study a putative common ancestor for these proteins and a new domain definition, in particular the splitting of A into three domains (A1, A2, and A3), has been proposed. The family of Toc159, previously containing A. thaliana and Pisum sativum, has been extended to Medicago truncatula and Populus trichocarpa and it has been revised for Oryza sativa. They have also been compared to GTPase subunits involved in the cpSRP system. A distant homology has been revealed among Toc and cpSRP GTP-hydrolyzing proteins of A. thaliana, and repetitions of a GTPase domain were also found in cpSRP protein receptors, by means of HCA analysis

  1. A Tandem Duplicate of Anti-Müllerian Hormone with a Missense SNP on the Y Chromosome Is Essential for Male Sex Determination in Nile Tilapia, Oreochromis niloticus

    Science.gov (United States)

    Li, Minghui; Sun, Yunlv; Zhao, Jiue; Shi, Hongjuan; Zeng, Sheng; Ye, Kai; Jiang, Dongneng; Zhou, Linyan; Sun, Lina; Tao, Wenjing; Nagahama, Yoshitaka; Kocher, Thomas D.; Wang, Deshou

    2015-01-01

    Variation in the TGF-β signaling pathway is emerging as an important mechanism by which gonadal sex determination is controlled in teleosts. Here we show that amhy, a Y-specific duplicate of the anti-Müllerian hormone (amh) gene, induces male sex determination in Nile tilapia. amhy is a tandem duplicate located immediately downstream of amhΔ-y on the Y chromosome. The coding sequence of amhy was identical to the X-linked amh (amh) except a missense SNP (C/T) which changes an amino acid (Ser/Leu92) in the N-terminal region. amhy lacks 5608 bp of promoter sequence that is found in the X-linked amh homolog. The amhΔ-y contains several insertions and deletions in the promoter region, and even a 5 bp insertion in exonVI that results in a premature stop codon and thus a truncated protein product lacking the TGF-β binding domain. Both amhy and amhΔ-y expression is restricted to XY gonads from 5 days after hatching (dah) onwards. CRISPR/Cas9 knockout of amhy in XY fish resulted in male to female sex reversal, while mutation of amhΔ-y alone could not. In contrast, overexpression of Amhy in XX fish, using a fosmid transgene that carries the amhy/amhΔ-y haplotype or a vector containing amhy ORF under the control of CMV promoter, resulted in female to male sex reversal, while overexpression of AmhΔ-y alone in XX fish could not. Knockout of the anti-Müllerian hormone receptor type II (amhrII) in XY fish also resulted in 100% complete male to female sex reversal. Taken together, these results strongly suggest that the duplicated amhy with a missense SNP is the candidate sex determining gene and amhy/amhrII signal is essential for male sex determination in Nile tilapia. These findings highlight the conserved roles of TGF-β signaling pathway in fish sex determination. PMID:26588702

  2. Narrow duplicated internal auditory canal: radiological findings and review of the literature

    International Nuclear Information System (INIS)

    Demir, Oezguen Ilhan; Cakmakci, Handan; Men, Sueleyman; Erdag, Taner Kemal

    2005-01-01

    Narrow duplicated internal auditory canal (IAC) is a rare malformation of the temporal bone that is associated with ipsilateral congenital sensorineural hearing loss. This may be an isolated finding or a part of a syndrome. Radiological examination should demonstrate aplasia or hypoplasia of the neural components of the narrow IAC, to guide the surgical approach. We report a 7-year-old boy with Klippel-Feil syndrome with a narrow double IAC with no sensorineural hearing loss but with conductive hearing loss. In this patient, the IAC consisted of two separate narrow bony canals clearly seen on 3D temporal bone CT and one nerve that was delineated on MRI. The contralateral external auditory canal was stenotic and the ossicles were dysplastic. (orig.)

  3. Evolutionary history and functional divergence of the cytochrome P450 gene superfamily between Arabidopsis thaliana and Brassica species uncover effects of whole genome and tandem duplications.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Wang, Linhai; Dossa, Komivi; Zhang, Xiurong; Ke, Tao; Liao, Boshou

    2017-09-18

    The cytochrome P450 monooxygenase (P450) superfamily is involved in the biosynthesis of various primary and secondary metabolites. However, little is known about the effects of whole genome duplication (WGD) and tandem duplication (TD) events on the evolutionary history and functional divergence of P450s in Brassica after splitting from a common ancestor with Arabidopsis thaliana. Using Hidden Markov Model search and manual curation, we detected that Brassica species have nearly 1.4-fold as many P450 members as A. thaliana. Most P450s in A. thaliana and Brassica species were located on pseudo-chromosomes. The inferred phylogeny indicated that all P450s were clustered into two different subgroups. Analysis of WGD event revealed that different P450 gene families had appeared after evolutionary events of species. For the TD event analyses, the P450s from TD events in Brassica species can be divided into ancient and recent parts. Our comparison of influence of WGD and TD events on the P450 gene superfamily between A. thaliana and Brassica species indicated that the family-specific evolution in the Brassica lineage can be attributed to both WGD and TD, whereas WGD was recognized as the major mechanism for the recent evolution of the P450 super gene family. Expression analysis of P450s from A. thaliana and Brassica species indicated that WGD-type P450s showed the same expression pattern but completely different expression with TD-type P450s across different tissues in Brassica species. Selection force analysis suggested that P450 orthologous gene pairs between A. thaliana and Brassica species underwent negative selection, but no significant differences were found between P450 orthologous gene pairs in A. thaliana-B. rapa and A. thaliana-B. oleracea lineages, as well as in different subgenomes in B. rapa or B. oleracea compared with A. thaliana. This study is the first to investigate the effects of WGD and TD on the evolutionary history and functional divergence of P450

  4. Startling mosaicism of the Y-chromosome and tandem duplication of the SRY and DAZ genes in patients with Turner Syndrome.

    Directory of Open Access Journals (Sweden)

    Sanjay Premi

    Full Text Available Presence of the human Y-chromosome in females with Turner Syndrome (TS enhances the risk of development of gonadoblastoma besides causing several other phenotypic abnormalities. In the present study, we have analyzed the Y chromosome in 15 clinically diagnosed Turner Syndrome (TS patients and detected high level of mosaicisms ranging from 45,XO:46,XY = 100:0% in 4; 45,XO:46,XY:46XX = 4:94:2 in 8; and 45,XO:46,XY:46XX = 50:30:20 cells in 3 TS patients, unlike previous reports showing 5-8% cells with Y- material. Also, no ring, marker or di-centric Y was observed in any of the cases. Of the two TS patients having intact Y chromosome in >85% cells, one was exceptionally tall. Both the patients were positive for SRY, DAZ, CDY1, DBY, UTY and AZFa, b and c specific STSs. Real Time PCR and FISH demonstrated tandem duplication/multiplication of the SRY and DAZ genes. At sequence level, the SRY was normal in 8 TS patients while the remaining 7 showed either absence of this gene or known and novel mutations within and outside of the HMG box. SNV/SFV analysis showed normal four copies of the DAZ genes in these 8 patients. All the TS patients showed aplastic uterus with no ovaries and no symptom of gonadoblastoma. Present study demonstrates new types of polymorphisms indicating that no two TS patients have identical genotype-phenotype. Thus, a comprehensive analysis of more number of samples is warranted to uncover consensus on the loci affected, to be able to use them as potential diagnostic markers.

  5. Tandem duplication of 11p12-p13 in a child with borderline development delay and eye abnormalities: dose effect of the PAX6 gene product?

    NARCIS (Netherlands)

    Aalfs, C. M.; Fantes, J. A.; Wenniger-Prick, L. J.; Sluijter, S.; Hennekam, R. C.; van Heyningen, V.; Hoovers, J. M.

    1997-01-01

    We report on a girl with a duplication of chromosome band 11p12-->13, which includes the Wilms tumor gene (WT1) and the aniridia gene (PAX6). The girl had borderline developmental delay, mild facial anomalies, and eye abnormalities. Eye findings were also present in most of the 11 other published

  6. Enteric Duplication.

    Science.gov (United States)

    Jeziorczak, Paul M; Warner, Brad W

    2018-03-01

    Enteric duplications have been described throughout the entire gastrointestinal tract. The usual perinatal presentation is an abdominal mass. Duplications associated with the foregut have associated respiratory symptoms, whereas duplications in the midgut and hindgut can present with obstructive symptoms, perforation, nausea, emesis, hemorrhage, or be asymptomatic, and identified as an incidental finding. These are differentiated from other cystic lesions by the presence of a normal gastrointestinal mucosal epithelium. Enteric duplications are located on the mesenteric side of the native structures and are often singular with tubular or cystic characteristics. Management of enteric duplications often requires operative intervention with preservation of the native blood supply and intestine. These procedures are usually very well tolerated with low morbidity.

  7. Rectal duplication.

    Directory of Open Access Journals (Sweden)

    Kulkarni B

    1995-04-01

    Full Text Available Duplications of the alimentary tract are of a great rarity, particularly so in the rectum. Because of its rarity, the difficulty of making a correct diagnosis and of selection of proper approach for treatment, this entity bears a special significance. The present case report deals with a female newborn who presented with imperforate anus and a rectovestibular fistula and a mass prolapsing at the introitus. Complete excision of the mass was carried out through the perineal approach and the child then underwent, a PSARP for the correction of the rectal anomaly. Histology confirmed the mass to be a rectal duplication.

  8. Gallbladder duplication

    Directory of Open Access Journals (Sweden)

    Yagan Pillay

    2015-01-01

    Conclusion: Duplication of the gallbladder is a rare congenital abnormality, which requires special attention to the biliary ductal and arterial anatomy. Laparoscopic cholecystectomy with intraoperative cholangiography is the appropriate treatment in a symptomatic gallbladder. The removal of an asymptomatic double gallbladder remains controversial.

  9. An internal duplication in the 5' noncoding region of strain H: a bovine viral diarrhoea virus (BVDV) isolated from pigs

    NARCIS (Netherlands)

    Gennip, van H.G.P.; Widjojoatmodjo, M.N.; Smit, de A.J.; Moormann, R.J.M.

    1999-01-01

    A pig pestivirus isolate, strain H, was characterized by using reverse transcription-PCR (RT-PCR) and direct sequencing of the amplicons. A duplication of 74 nucleotides was found at the 5' terminus of the 5' noncoding (NC) region, which was also found in RNA isolates from tonsils from two other

  10. Genotypic characterization by multi locus variable number of tandem repeats analysis international Bordetella pertussis vaccine strains

    Directory of Open Access Journals (Sweden)

    M. Fatah Moghadam

    2017-10-01

    Full Text Available Background: In 1930's first whole cell pertussis vaccines became available to the public heralding a dramatic success in overcoming the global burden of the disease. To date only a handful of B. pertussis strains have been used by international/local pertussis vaccine manufacturers. Inevitable well-documented genetic changes in the world population of this pathogen have prompted serious questions on suitability of traditional vaccine strains protect human against currently circulating wild isolates of Bordetella pertussis. Objective: Analyzing the genetic diversity within the most frequently-used vaccine strains of B. pertussis in the world Methods: A recently developed multi locus variable number of tandem repeats analysis (MLVA genotyping system along with a bioinforamtic piece of analysis was conducted on 11 strain / substrains of B137, B203 (10536, C393, Cs, E476, Tohama I, J445 (134, B202 and J446 (509 plus 2 sub-strains of 134 and 509 that are used at Razi institute for preparation of pertussis vaccine. In this study have used 6 individual loci of VNTR1, VNTR3a, VNTR3b, VNTR4, VNTR5 and VNTR6. Findings: Six distinct genotypes were recognized among the examined strains by comparing our data with the Dutch MLVA databank. These were all new and not reported before in the database. Conclusion: This observation reiterates on necessity for detection of predominant native strains to include in vaccine preparations suitable for different countries.

  11. Visualization of uncorrelated, tandem symmetry mismatches in the internal genome packaging apparatus of bacteriophage T7.

    Science.gov (United States)

    Guo, Fei; Liu, Zheng; Vago, Frank; Ren, Yue; Wu, Weimin; Wright, Elena T; Serwer, Philip; Jiang, Wen

    2013-04-23

    Motor-driven packaging of a dsDNA genome into a preformed protein capsid through a unique portal vertex is essential in the life cycle of a large number of dsDNA viruses. We have used single-particle electron cryomicroscopy to study the multilayer structure of the portal vertex of the bacteriophage T7 procapsid, the recipient of T7 DNA in packaging. A focused asymmetric reconstruction method was developed and applied to selectively resolve neighboring pairs of symmetry-mismatched layers of the portal vertex. However, structural features in all layers of the multilayer portal vertex could not be resolved simultaneously. Our results imply that layers with mismatched symmetries can join together in several different relative orientations, and that orientations at different interfaces assort independently to produce structural isomers, a process that we call combinatorial assembly isomerism. This isomerism explains rotational smearing in previously reported asymmetric reconstructions of the portal vertex of T7 and other bacteriophages. Combinatorial assembly isomerism may represent a new regime of structural biology in which globally varying structures assemble from a common set of components. Our reconstructions collectively validate previously proposed symmetries, compositions, and sequential order of T7 portal vertex layers, resolving in tandem the 5-fold gene product 10 (gp10) shell, 12-fold gp8 portal ring, and an internal core stack consisting of 12-fold gp14 adaptor ring, 8-fold bowl-shaped gp15, and 4-fold gp16 tip. We also found a small tilt of the core stack relative to the icosahedral fivefold axis and propose that this tilt assists DNA spooling without tangling during packaging.

  12. Craniofacial duplication (diprosopus).

    Science.gov (United States)

    Turpin, I M; Furnas, D W; Amlie, R N

    1981-02-01

    No congenital malformation in infants is more profound than anterior craniofacial duplication. The precise term for this rare anomaly is diprosopus, referring to a fetus with a single trunk, normal limbs, and varying degrees of facial duplication. A search of the world literature produced only 16 cases of diprosopus since 1864. Despite the rarity of this anomaly, three such infants were born in the Southern California area during the past year, making this the largest reported series to date. The three infants were born with two distinctly formed faces. Each had four separate eyes, two mouths, two noses, and two ears with a primitive ear or sinus tract at the plane of fusion. In addition, multiple congenital aberrations existed which involved a variety of internal organs. The pathogenesis of diprosopus is not well understood, but environmental stress early in embryologic development has been suggested as a possible factor. The apparent mechanism is a slowing of pregastrulation oxidation with resultant focal developmental arrests.

  13. Tandemly Arrayed Genes in Vertebrate Genomes

    Directory of Open Access Journals (Sweden)

    Deng Pan

    2008-01-01

    Full Text Available Tandemly arrayed genes (TAGs are duplicated genes that are linked as neighbors on a chromosome, many of which have important physiological and biochemical functions. Here we performed a survey of these genes in 11 available vertebrate genomes. TAGs account for an average of about 14% of all genes in these vertebrate genomes, and about 25% of all duplications. The majority of TAGs (72–94% have parallel transcription orientation (i.e., they are encoded on the same strand in contrast to the genome, which has about 50% of its genes in parallel transcription orientation. The majority of tandem arrays have only two members. In all species, the proportion of genes that belong to TAGs tends to be higher in large gene families than in small ones; together with our recent finding that tandem duplication played a more important role than retroposition in large families, this fact suggests that among all types of duplication mechanisms, tandem duplication is the predominant mechanism of duplication, especially in large families. Finally, several species have a higher proportion of large tandem arrays that are species-specific than random expectation.

  14. Duplicated middle cerebral artery

    Science.gov (United States)

    Perez, Jesus; Machado, Calixto; Scherle, Claudio; Hierro, Daniel

    2009-01-01

    Duplicated middle cerebral artery (DMCA) is an anomalous vessel arising from the internal carotid artery. The incidence DMCA is relatively law, and an association between this anomaly and cerebral aneurysms has been documented. There is a controversy whether DMCA may have perforating arteries. This is an important fact to consider in aneurysm surgery. We report the case of a 34-year-old black woman who suffered a subarachnoid hemorrhage and the angiography a left DMCA, and an aneurysm in an inferior branch of the main MCA. The DMCA and the MCA had perforating arteries. The aneurysm was clipped without complications. The observation of perforating arteries in our patient confirms that the DMCA may have perforating arteries. This is very important to be considered in cerebral aneurysms surgery. Moreover, the DMCA may potentially serve as a collateral blood supply to the MCA territory in cases of MCA occlusion. PMID:22140405

  15. Duplication of the oesophagus

    International Nuclear Information System (INIS)

    Lingg, G.; Nebel, G.

    1981-01-01

    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined. (orig.) [de

  16. Duplication of the oesophagus

    Energy Technology Data Exchange (ETDEWEB)

    Lingg, G; Nebel, G

    1981-08-01

    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined.

  17. Duplication in DNA Sequences

    Science.gov (United States)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  18. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia) gene family: tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes.

    Science.gov (United States)

    Harduin-Lepers, Anne; Petit, Daniel; Mollicone, Rosella; Delannoy, Philippe; Petit, Jean-Michel; Oriol, Rafael

    2008-09-23

    initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD) R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.

  19. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia gene family: Tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes

    Directory of Open Access Journals (Sweden)

    Petit Jean-Michel

    2008-09-01

    activities, in both invertebrates and vertebrates. The initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.

  20. The impact of genome triplication on tandem gene evolution in Brassica rapa

    Directory of Open Access Journals (Sweden)

    Lu eFang

    2012-11-01

    Full Text Available Whole genome duplication (WGD and tandem duplication (TD are both important modes of gene expansion. However, how whole genome duplication influences tandemly duplicated genes is not well studied. We used Brassica rapa, which has undergone an additional genome triplication (WGT and shares a common ancestor with Arabidopsis thaliana, Arabidopsis lyrata and Thellungiella parvula, to investigate the impact of genome triplication on tandem gene evolution. We identified 2,137, 1,569, 1,751 and 1,135 tandem gene arrays in B. rapa, A. thaliana, A. lyrata and T. parvula respectively. Among them, 414 conserved tandem arrays are shared by the 3 species without WGT, which were also considered as existing in the diploid ancestor of B. rapa. Thus, after genome triplication, B. rapa should have 1,242 tandem arrays according to the 414 conserved tandems. Here, we found 400 out of the 414 tandems had at least one syntenic ortholog in the genome of B. rapa. Furthermore, 294 out of the 400 shared syntenic orthologs maintain tandem arrays (more than one gene for each syntenic hit in B. rapa. For the 294 tandem arrays, we obtained 426 copies of syntenic paralogous tandems in the triplicated genome of B. rapa. In this study, we demonstrated that tandem arrays in B. rapa were dramatically fractionated after WGT when compared either to non-tandem genes in the B. rapa genome or to the tandem arrays in closely related species that have not experienced a recent whole-genome polyploidization event.

  1. Typewriting: Toward Duplicating Success

    Science.gov (United States)

    Orsborn, Karen J.

    1977-01-01

    A description of two projects (secretarial handbook and memo pad and personalized stationery) for use in teaching the duplication process that will capture the interests of students in an advanced typewriting class. (HD)

  2. Enteric and rectal duplications and duplication cysts in the adult.

    Science.gov (United States)

    Simsek, Abdurrahman; Zeybek, Nazif; Yagci, Gokhan; Kaymakcioglu, Nihat; Tas, Huseyin; Saglam, Mutlu; Cetiner, Sadettin

    2005-03-01

    Alimentary tract duplication and duplication cysts are rare congenital malformations. The ileum is the most frequently affected site. However, alimentary tract duplication and duplication cysts can occur at any point along the gastrointestinal tract. Early diagnosis and prompt surgical treatment is the best way to prevent associated morbidity. This article presents the cases of three patients admitted to Gulhane Military Medical Academy with signs of acute abdomen, intra-abdominal mass and chronic abdominal pain. These patients were found to have enteric duplication, duplication cyst and/or retro-rectal cyst. The literature on alimentary tract duplications is reviewed.

  3. Thorough in silico and in vitro cDNA analysis of 21 putative BRCA1 and BRCA2 splice variants and a complex tandem duplication in BRCA2 allowing the identification of activated cryptic splice donor sites in BRCA2 exon 11.

    Science.gov (United States)

    Baert, Annelot; Machackova, Eva; Coene, Ilse; Cremin, Carol; Turner, Kristin; Portigal-Todd, Cheryl; Asrat, Marie Jill; Nuk, Jennifer; Mindlin, Allison; Young, Sean; MacMillan, Andree; Van Maerken, Tom; Trbusek, Martin; McKinnon, Wendy; Wood, Marie E; Foulkes, William D; Santamariña, Marta; de la Hoya, Miguel; Foretova, Lenka; Poppe, Bruce; Vral, Anne; Rosseel, Toon; De Leeneer, Kim; Vega, Ana; Claes, Kathleen B M

    2018-04-01

    For 21 putative BRCA1 and BRCA2 splice site variants, the concordance between mRNA analysis and predictions by in silico programs was evaluated. Aberrant splicing was confirmed for 12 alterations. In silico prediction tools were helpful to determine for which variants cDNA analysis is warranted, however, predictions for variants in the Cartegni consensus region but outside the canonical sites, were less reliable. Learning algorithms like Adaboost and Random Forest outperformed the classical tools. Further validations are warranted prior to implementation of these novel tools in clinical settings. Additionally, we report here for the first time activated cryptic donor sites in the large exon 11 of BRCA2 by evaluating the effect at the cDNA level of a novel tandem duplication (5' breakpoint in intron 4; 3' breakpoint in exon 11) and of a variant disrupting the splice donor site of exon 11 (c.6841+1G > C). Additional sites were predicted, but not activated. These sites warrant further research to increase our knowledge on cis and trans acting factors involved in the conservation of correct transcription of this large exon. This may contribute to adequate design of ASOs (antisense oligonucleotides), an emerging therapy to render cancer cells sensitive to PARP inhibitor and platinum therapies. © 2017 Wiley Periodicals, Inc.

  4. Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias.

    Science.gov (United States)

    Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J

    2016-11-04

    Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types

  5. "So They're Actually Real?" Integrating E-Tandem Learning into the Study of Language for International Business

    Science.gov (United States)

    Bruen, Jennifer; Sudhershan, Aleksandra

    2015-01-01

    Tandem learning involves learners with complementary target and native languages communicating for the purpose of learning each other's languages and cultures. Studies indicate that it can function as a powerful complement to formal language learning classes with regard to the development of both language proficiency and cultural intelligence.…

  6. The centriole duplication cycle

    Science.gov (United States)

    Fırat-Karalar, Elif Nur; Stearns, Tim

    2014-01-01

    Centrosomes are the main microtubule-organizing centre of animal cells and are important for many critical cellular and developmental processes from cell polarization to cell division. At the core of the centrosome are centrioles, which recruit pericentriolar material to form the centrosome and act as basal bodies to nucleate formation of cilia and flagella. Defects in centriole structure, function and number are associated with a variety of human diseases, including cancer, brain diseases and ciliopathies. In this review, we discuss recent advances in our understanding of how new centrioles are assembled and how centriole number is controlled. We propose a general model for centriole duplication control in which cooperative binding of duplication factors defines a centriole ‘origin of duplication’ that initiates duplication, and passage through mitosis effects changes that license the centriole for a new round of duplication in the next cell cycle. We also focus on variations on the general theme in which many centrioles are created in a single cell cycle, including the specialized structures associated with these variations, the deuterosome in animal cells and the blepharoplast in lower plant cells. PMID:25047614

  7. Centrioles: duplicating precariously.

    Science.gov (United States)

    Pelletier, Laurence

    2007-09-04

    To assemble a mitotic spindle and accurately segregate chromosomes to progeny, a cell needs to precisely regulate its centrosome number, a feat largely accomplished through the tight control of centriole duplication. Recent work showing that the overexpression of centriolar proteins can lead to the formation of multiple centrioles in the absence of pre-existing centrioles challenges the idea that it is a self-replicating organelle.

  8. Rectal duplication: a case report.

    Science.gov (United States)

    Didden, K; Masereel, B; Geyskens, P

    2013-01-01

    Gastrointestinal tract duplications are uncommon congenital abnormalities, that may occur anywhere along the alimentary tract. Most frequently they occur at the level of the small bowel tract and are symptomatic before the age of two. In our case we report the history of a 68-years old women with a colon duplication, especially a rectal duplication. This is very exceptional.

  9. Embryonic duplications in sheep.

    Science.gov (United States)

    Dennis, S M

    1975-02-01

    Twenty-seven embryonic duplications were examined during a 3-year investigation into the causes of perinatal lamb mortality. Twenty of the 27 were anomalous twins with 19 being conjoined (diplopagus 9 and heteropagus 10). The various duplications were: haloacardius acephalus 1, diprosopus 2, dicephalus 2, dipypus 3, diprosopus dipygus 1, syncephalus dipygus 1, pygopagus parasiticus 1, heteropagus dipygus 3, melodidymus 6, polyury 4, penile duplication 2, and bilateral otognathia 1. Four lambs were living and the time of death of the others was: parturient 8, and post-parturient 15. Average dry weight of the lambs was 3.35 kg (range 1.59 to 5.45 kg). Breed distribution was: Merino 77.8%, Crossbred 14.8%, Dorset Horn 3.7%, and Corriedale 3.7%. The caudal region was involved in 10 of the conjoined twins (52.6%), anterior region in 7 (36.9%), and both anterior and caudal regions in 2 (10.5%). Associated defects were present in 70.4% of the 27 lambs, the most common being atresia ani.

  10. A conserved segmental duplication within ELA.

    Science.gov (United States)

    Brinkmeyer-Langford, C L; Murphy, W J; Childers, C P; Skow, L C

    2010-12-01

    The assembled genomic sequence of the horse major histocompatibility complex (MHC) (equine lymphocyte antigen, ELA) is very similar to the homologous human HLA, with the notable exception of a large segmental duplication at the boundary of ELA class I and class III that is absent in HLA. The segmental duplication consists of a ∼ 710 kb region of at least 11 repeated blocks: 10 blocks each contain an MHC class I-like sequence and the helicase domain portion of a BAT1-like sequence, and the remaining unit contains the full-length BAT1 gene. Similar genomic features were found in other Perissodactyls, indicating an ancient origin, which is consistent with phylogenetic analyses. Reverse-transcriptase PCR (RT-PCR) of mRNA from peripheral white blood cells of healthy and chronically or acutely infected horses detected transcription from predicted open reading frames in several of the duplicated blocks. This duplication is not present in the sequenced MHCs of most other mammals, although a similar feature at the same relative position is present in the feline MHC (FLA). Striking sequence conservation throughout Perissodactyl evolution is consistent with a functional role for at least some of the genes included within this segmental duplication. © 2010 The Authors, Journal compilation © 2010 Stichting International Foundation for Animal Genetics.

  11. Craniofacial duplication: a case report.

    Science.gov (United States)

    Suryawanshi, Pradeep; Deshpande, Mandar; Verma, Nitin; Mahendrakar, Vivek; Mahendrakar, Sandhya

    2013-09-01

    A craniofacial duplication or diprosopus is an unusual variant of conjoined twinning. The reported incidence is one in 180,000-15 million births and 35 cases have been reported till date. The phenotype is wide, with the partial duplication of a few facial structures to complete dicephalus. A complete duplication is associated with a high incidence of anomalies in the central nervous system, cardiovascular system, gastrointestinal system and the respiratory system, whereas no major anomalies are found in the infants with a partial duplication. A term baby with the features of a craniofacial duplication has been described, with the proposed theories on embryogenesis and a brief review of the literature.

  12. Rectal duplication with sciatic hernia.

    Science.gov (United States)

    Nosek, Marzena; Golonka, Anna; Kalińska-Lipert, Anita; Nachulewicz, Paweł

    2015-07-01

    Rectal duplications represent 5% of all duplications in the alimentary tract, and they are very rarely diagnosed during the neonatal period. The authors present the method of investigation and the results of surgical treatment of a full-term neonate with a sciatic hernia containing a rectal duplication. The procedure started with three-port laparoscopy, but excision of the tubular duplication of the rectum was possible only by a transanal endorectal pull-through approach. The sciatic hernia was closed, and plastic sutures on the buttock finished the procedure. The coincidence of sciatic hernia with rectal duplication is extremely rare, and the method of treatment depends exclusively on the anatomical conditions.

  13. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  14. MECP2 Duplication Syndrome

    DEFF Research Database (Denmark)

    Signorini, Cinzia; De Felice, Claudio; Leoncini, Silvia

    2016-01-01

    Rett syndrome (RTT) and MECP2 duplication syndrome (MDS) are neurodevelopmental disorders caused by alterations in the methyl-CpG binding protein 2 (MECP2) gene expression. A relationship between MECP2 loss-of-function mutations and oxidative stress has been previously documented in RTT patients...... and murine models. To date, no data on oxidative stress have been reported for the MECP2 gain-of-function mutations in patients with MDS. In the present work, the pro-oxidant status and oxidative fatty acid damage in MDS was investigated (subjects n = 6) and compared to RTT (subjects n = 24) and healthy...... similar to those observed in RTT patients except for higher plasma F2-isoprostanes levels (P work shows unique data in patients affected by MDS. For the first...

  15. Quantification of pramipexole in human plasma by liquid chromatography tandem mass spectrometry using tamsulosin as internal standard.

    Science.gov (United States)

    Nirogi, Ramakrishna V S; Kandikere, Vishwottam; Shrivastava, Wishu; Mudigonda, Koteshwara; Maurya, Santosh; Ajjala, Devender

    2007-11-01

    A high-performance liquid chromatography/electrospray ionization tandem mass spectrometry method was developed and validated for the quantification of pramipexole in human plasma. Following liquid-liquid extraction, the analytes were separated using an isocratic mobile phase on a reverse-phase column and analyzed by MS/MS in the multiple reaction monitoring mode using the respective [M + H](+) ions, m/z 212/152 for pramipexole and m/z 409/228 for the IS. The method exhibited a linear dynamic range of 200-8000 pg/mL for pramipexole in human plasma. The lower limit of quantification was 200 pg/mL with a relative standard deviation of less than 8%. Acceptable precision and accuracy were obtained for concentrations over the standard curve range. A run time of 3.5 min for each sample made it possible to analyze more than 200 human plasma samples per day. The validated method has been successfully used to analyze human plasma samples for application in pharmacokinetic, bioavailability or bioequivalence studies. Copyright (c) 2007 John Wiley & Sons, Ltd.

  16. A Pre-Mobility eTandem Project for Incoming International Students at the University of Padua

    Science.gov (United States)

    Griggio, Lisa; Rózsavölgyi, Edit

    2016-01-01

    This study focuses on a strategic partnership with students from the University of Padua and international students coming to Padua mainly in the setting of Erasmus student mobility and exchange programs. The project is designed specifically for incoming international students to facilitate their integration into the Italian higher educational…

  17. Colonic duplication in an adult

    International Nuclear Information System (INIS)

    Baro, P.; Dario Casas, J.; Sanchez, D.

    1988-01-01

    A case of colonic duplication that was diagnosed radiologically in an adult is reported. A long duplicated segment below the normal transverse colon, with a wide anastomosis at the hepatic flexure level, was observed on barium enema. The rarity of this anomaly unassociated with other malformations is emphasized. (orig.)

  18. Complete colonic duplication in children.

    Science.gov (United States)

    Khaleghnejad Tabari, Ahmad; Mirshemirani, Alireza; Khaleghnejad Tabari, Nasibeh

    2012-01-01

    Complete colonic duplication is a very rare congenital anomaly that may have different presentations according to its location and size. Complete colonic duplication can occur in 15% of gastrointestinal duplication. We report two cases of complete colonic duplications, and their characteristics. We present two patients with complete colonic duplication with different types and presentations. Case 1: A 2- year old boy presented to the clinic with abdominal protrusion, difficulty to defecate, chronic constipation and mucosal prolaps covered bulging (rectocele) since he was 6 months old. The patient had palpable pelvic mass with doughy consistency. Rectal exam confirmed perirectal mass with soft consistency. The patient underwent a surgical operation that had total tubular colorectal duplication with one blind end and was treated with simple fenestration of distal end, and was discharged without complication. After two years follow up, he had normal defecation and good weight gain. Case 2: A 2 -day old infant was referred with imperforate anus and complete duplication of recto-sigmoid colon, diphallus, double bladder, and hypospadiasis. After clinical and paraclinical investigations, he underwent operations in several stages in different periods, and was discharged without complications. After four years follow up, he led a normal life. The patients with complete duplication have to be examined carefully because of the high incidence of other systemic anomalies. Treatment includes simple resection of distal common wall, fenestration, and repair other associated anomalies.

  19. A survey of innovation through duplication in the reduced genomes of twelve parasites.

    Directory of Open Access Journals (Sweden)

    Jeremy D DeBarry

    Full Text Available We characterize the prevalence, distribution, divergence, and putative functions of detectable two-copy paralogs and segmental duplications in the Apicomplexa, a phylum of parasitic protists. Apicomplexans are mostly obligate intracellular parasites responsible for human and animal diseases (e.g. malaria and toxoplasmosis. Gene loss is a major force in the phylum. Genomes are small and protein-encoding gene repertoires are reduced. Despite this genomic streamlining, duplications and gene family amplifications are present. The potential for innovation introduced by duplications is of particular interest. We compared genomes of twelve apicomplexans across four lineages and used orthology and genome cartography to map distributions of duplications against genome architectures. Segmental duplications appear limited to five species. Where present, they correspond to regions enriched for multi-copy and species-specific genes, pointing toward roles in adaptation and innovation. We found a phylum-wide association of duplications with dynamic chromosome regions and syntenic breakpoints. Trends in the distribution of duplicated genes indicate that recent, species-specific duplicates are often tandem while most others have been dispersed by genome rearrangements. These trends show a relationship between genome architecture and gene duplication. Functional analysis reveals: proteases, which are vital to a parasitic lifecycle, to be prominent in putative recent duplications; a pair of paralogous genes in Toxoplasma gondii previously shown to produce the rate-limiting step in dopamine synthesis in mammalian cells, a possible link to the modification of host behavior; and phylum-wide differences in expression and subcellular localization, indicative of modes of divergence. We have uncovered trends in multiple modes of duplicate divergence including sequence, intron content, expression, subcellular localization, and functions of putative recent duplicates that

  20. A large duplication involving the IHH locus mimics acrocallosal syndrome.

    Science.gov (United States)

    Yuksel-Apak, Memnune; Bögershausen, Nina; Pawlik, Barbara; Li, Yun; Apak, Selcuk; Uyguner, Oya; Milz, Esther; Nürnberg, Gudrun; Karaman, Birsen; Gülgören, Ayan; Grzeschik, Karl-Heinz; Nürnberg, Peter; Kayserili, Hülya; Wollnik, Bernd

    2012-06-01

    Indian hedgehog (Ihh) signaling is a major determinant of various processes during embryonic development and has a pivotal role in embryonic skeletal development. A specific spatial and temporal expression of Ihh within the developing limb buds is essential for accurate digit outgrowth and correct digit number. Although missense mutations in IHH cause brachydactyly type A1, small tandem duplications involving the IHH locus have recently been described in patients with mild syndactyly and craniosynostosis. In contrast, a ∼600-kb deletion 5' of IHH in the doublefoot mouse mutant (Dbf) leads to severe polydactyly without craniosynostosis, but with craniofacial dysmorphism. We now present a patient resembling acrocallosal syndrome (ACS) with extensive polysyndactyly of the hands and feet, craniofacial abnormalities including macrocephaly, agenesis of the corpus callosum, dysplastic and low-set ears, severe hypertelorism and profound psychomotor delay. Single-nucleotide polymorphism (SNP) array copy number analysis identified a ∼900-kb duplication of the IHH locus, which was confirmed by an independent quantitative method. A fetus from a second pregnancy of the mother by a different spouse showed similar craniofacial and limb malformations and the same duplication of the IHH-locus. We defined the exact breakpoints and showed that the duplications are identical tandem duplications in both sibs. No copy number changes were observed in the healthy mother. To our knowledge, this is the first report of a human phenotype similar to the Dbf mutant and strikingly overlapping with ACS that is caused by a copy number variation involving the IHH locus on chromosome 2q35.

  1.  Hypertelorism in Charcot-Marie-Tooth disease 1A from the common PMP22 duplication: A Case Report

    Directory of Open Access Journals (Sweden)

    Josef Finsterer

    2012-03-01

    Full Text Available  The 1.4Mb tandem-duplication in the PMP22 gene at 17p11.2 usually manifests as hereditary sensorimotor polyneuropathy with foot deformity, sensorineural hearing-loss, moderate developmental delay, and gait disturbance. Hypertelorism and marked phenotypic variability within a single family has not been reported. In a single family, the PMP22 tandem-duplication manifested as short stature, sensorimotor polyneuropathy, tremor, ataxia, sensorineural hearing-loss, and hypothyroidism in the 27 years-old index case, as mild facial dysmorphism, muscle cramps, tinnitus, intention tremor, bradydiadochokinesia, and sensorimotor polyneuropathy in the 31 year-old half-brother of the index-patient, and as sensorimotor polyneuropathy and foot deformityin the father of the two. The half-brother additionally presented with hypertelorism, not previously reported in PMP22tandem-duplication carriers. The presented cases show that the tandem-duplication 17p11.2 may present with marked intra-familialphenotype variability and that mild facial dysmorphism with stuck-out ears and hypertelorism may be a rare phenotypic feature of this mutation. The causal relation between facial dysmorphism and the PMP22 tandem-duplication, however, remains speculative.

  2. Liquid chromatography-tandem mass spectrometry quantification of 6-thioguanine in DNA using endogenous guanine as internal standard

    DEFF Research Database (Denmark)

    Jacobsen, Jack Hummeland; Schmiegelow, Kjeld; Nersting, Jakob

    2012-01-01

    was estimated at 63% (RSD 26%), which is corrected for by the internal standard resulting in stable quantification. The TG levels found were above the LOQ in 18 out of 18 childhood leukemia patients on 6-mercaptopurine/methotrexate maintenance therapy (median 377, range 45-1190 fmol/μg DNA) with intra...

  3. DNA Commission of the International Society of Forensic Genetics: recommendations on forensic analysis using Y-chromosome short tandem repeats

    DEFF Research Database (Denmark)

    Gill, P.; Brenner, C.; Brinkmann, B.

    2001-01-01

    During the past few years the DNA commission of the International Society of Forensic Genetics has published a series of documents providing guidelines and recommendations concerning the application of DNA polymorphisms to the problems of human identification. This latest report addresses a relat...

  4. Tandem Translation Classroom: A Case Study

    Science.gov (United States)

    Kim, Dohun; Koh, Taejin

    2018-01-01

    The transition to student-centred learning, advances in teleconferencing tools, and active international student exchange programmes have stimulated tandem learning in many parts of the world. This pedagogical model is based on a mutual language exchange between tandem partners, where each student is a native speaker in the language the…

  5. Anterior colorectal duplication presenting as rectal prolapse.

    Science.gov (United States)

    Ramirez-Resendiz, Amador; Asz, Jose; Medina-Vega, F Antonio; Ortega-Salgado, J Arturo

    2007-09-01

    Duplications of the gastrointestinal (GI) tract are rare. Only 5% of them are rectal and there are very few reports of rectal prolapse (RP) caused by a duplication. An 11 month-old female presented with a RP caused by a blind-ended anterior tubular colorectal duplication. The duplication was successfully opened and connected to the normal rectum without complications. Although infrequent, a rectal duplication should be considered in the differential diagnosis of RP.

  6. External cystic rectal duplication: an unusual presentation of rectal duplication cyst.

    Science.gov (United States)

    Karaman, I; Karaman, A; Arda, N; Cakmak, O

    2007-11-01

    Duplications of gastrointestinal tract are rare anomalies, and rectal duplications account for five percent of the alimentary tract duplications. We present an unusual case of rectal duplication, which was located externally in a newborn female, and discuss the types of distal hindgut duplications.

  7. Age distribution of human gene families shows significant roles of both large- and small-scale duplications in vertebrate evolution.

    Science.gov (United States)

    Gu, Xun; Wang, Yufeng; Gu, Jianying

    2002-06-01

    The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.

  8. Coenzyme Q10 quantification in muscle, fibroblasts and cerebrospinal fluid by liquid chromatography/tandem mass spectrometry using a novel deuterated internal standard.

    Science.gov (United States)

    Duberley, Kate E C; Hargreaves, Iain P; Chaiwatanasirikul, Korn-Anong; Heales, Simon J R; Land, John M; Rahman, Shamima; Mills, Kevin; Eaton, Simon

    2013-05-15

    Neurological dysfunction is common in primary coenzyme Q10 (2,3-dimethoxy, 5-methyl, 6-polyisoprene parabenzoquinone; CoQ10 ; ubiquinone) deficiencies, the most readily treatable subgroup of mitochondrial disorders. Therapeutic benefit from CoQ10 supplementation has also been noted in other neurodegenerative diseases. CoQ10 can be measured by high-performance liquid chromatography (HPLC) in plasma, muscle or leucocytes; however, there is no reliable method to quantify CoQ10 in cerebrospinal fluid (CSF). Additionally, many methods use CoQ9 , an endogenous ubiquinone in humans, as an internal standard. Deuterated CoQ10 (d6 -CoQ10 ) was synthesised by a novel, simple, method. Total CoQ10 was measured by liquid chromatography/tandem mass spectrometry (LC/MS/MS) using d6 -CoQ10 as internal standard and 5 mM methylamine as an ion-pairing reagent. Chromatography was performed using a Hypsersil GOLD C4 column (150 × 3 mm, 3 µm). CoQ10 levels were linear over a concentration range of 0-200 nM (R(2) = 0.9995). The lower limit of detection was 2 nM. The inter-assay coefficient of variation (CV) was 3.6% (10 nM) and 4.3% (20 nM), and intra-assay CV 3.4% (10 nM) and 3.6% (20 nM). Reference ranges were established for CoQ10 in CSF (5.7-8.7 nM; n = 17), fibroblasts (57.0-121.6 pmol/mg; n = 50) and muscle (187.3-430.1 pmol/mg; n = 15). Use of d6 -CoQ10 internal standard has enabled the development of a sensitive LC/MS/MS method to accurately determine total CoQ10 levels. Clinical applications of CSF CoQ10 determination include identification of patients with cerebral CoQ10 deficiency, and monitoring CSF CoQ10 levels following supplementation. Copyright © 2013 John Wiley & Sons, Ltd.

  9. Radiological findings of male urethral duplication associated with bladder duplication: case report

    International Nuclear Information System (INIS)

    Kim, Hyoung Jung; Lim, Joo Won; Lee, Dong Ho; Ko, Young Tae

    2004-01-01

    Urethral duplication or accessory urethra is a rare congenital anomaly. Even rarer, is its association with bladder duplication. We report a case of urethral duplication associated with bladder duplication in a seven-year-old boy who underwent retrograde urethrography, sonography and magnetic resonance (MR) imaging. WhiIe retrograde urethrography can demonstrate the extent of the duplicated urethra, MR imaging and sonography can provide detailed information on the anatomy of the adjacent tissues as well as urethral duplication

  10. Evaluation of contrast in duplicated radiographs

    International Nuclear Information System (INIS)

    Thunthy, K.H.; Weinberg, R.

    1982-01-01

    This investigation evaluated changes in the contrast of duplicated radiographs made at different ultraviolet light exposures. Increasing ultraviolet light exposure had different effects on the duplicates of originals of different background densities. When correctly exposed, a duplicate radiograph enhanced contrast. When originals had the same contrast but different background densities, their duplicates did not have the same contrast. It was not possible to duplicate accurately all the different contrasts measured on an original. It was possible, however, to produce duplicates with all contrasts greater than those of the original

  11. A novel duplication polymorphism in the FANCA promoter and its association with breast and ovarian cancer

    International Nuclear Information System (INIS)

    Thompson, Ella; Dragovic, Rebecca L; Stephenson, Sally-Anne; Eccles, Diana M; Campbell, Ian G; Dobrovic, Alexander

    2005-01-01

    The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer

  12. A novel duplication polymorphism in the FANCA promoter and its association with breast and ovarian cancer.

    Science.gov (United States)

    Thompson, Ella; Dragovic, Rebecca L; Stephenson, Sally-Anne; Eccles, Diana M; Campbell, Ian G; Dobrovic, Alexander

    2005-04-29

    The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer.

  13. A novel duplication polymorphism in the FANCA promoter and its association with breast and ovarian cancer

    Directory of Open Access Journals (Sweden)

    Campbell Ian G

    2005-04-01

    Full Text Available Abstract The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. Methods We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. Results The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. Conclusion The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer.

  14. Facial duplication: case, review, and embryogenesis.

    Science.gov (United States)

    Barr, M

    1982-04-01

    The craniofacial anatomy of an infant with facial duplication is described. There were four eyes, two noses, two maxillae, and one mandible. Anterior to the single pituitary the brain was duplicated and there was bilateral arhinencephaly. Portions of the brain were extruded into a large frontal encephalocele. Cases of symmetrical facial duplication reported in the literature range from two complete faces on a single head (diprosopus) to simple nasal duplication. The variety of patterns of duplication suggests that the doubling of facial components arises in several different ways: Forking of the notochord, duplication of the prosencephalon, duplication of the olfactory placodes, and duplication of maxillary and/or mandibular growth centers around the margins of the stomatodeal plate. Among reported cases, the female:male ratio is 2:1.

  15. Biliary tract duplication cyst with gastric heterotopia

    Energy Technology Data Exchange (ETDEWEB)

    Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.

    1988-05-01

    Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst.

  16. Biliary tract duplication cyst with gastric heterotopia

    International Nuclear Information System (INIS)

    Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.

    1988-01-01

    Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst. (orig.)

  17. Preliminary experiments of electronic duplication

    International Nuclear Information System (INIS)

    Fay, Bernard

    1974-01-01

    Systems of electron sputtering (at the unit scale) use as master mask a photocathode with localized emitting zones. Emitted electrons are accelerated and focussed on a silicon substrate covered with an electrosensitive resin. The very high definition associated with electron masking is obtained whatever the complexity of the master mask is, for a printing duration of the order of the minute. This is a duplication method without any contact that prevents the master mask from any mechanical erosion. Alignment of the successive masks is obtained from an electric signal directly usable through an automatic alignment system. Experiments using the apparatus for reproducing masks through an electronic image or ''electronic duplicator'' developed in Thomson-CSF Laboratory at Corbeville, are presented [fr

  18. Megalourethra with Y-Type Duplication of Urethra Presented as Perianal Fistula: A Rare Case Report

    Directory of Open Access Journals (Sweden)

    Shashi Verma

    2015-01-01

    Full Text Available Megalourethra with Y-type duplication is an extremely rare anomaly. We report here one such case, diagnosed with retrograde urethrogram, which was done from both penile meatus and perianal opening simultaneously. Patient was successfully treated by laser optical internal urethrotomy (OIU, excision of duplicated urethra, and reduction urethroplasty in a single stage.

  19. Noncommunicating Isolated Enteric Duplication Cyst in the ...

    African Journals Online (AJOL)

    Noncommunicating isolated enteric duplications in the abdomen are an extremely rare variant of enteric duplications with their own blood supply. We report a case of a noncommunicating isolated ileal duplication in a 10-month-old boy. He was admitted because of severe abdominal distension and developed irritability ...

  20. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.

    Science.gov (United States)

    Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L

    2015-12-01

    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  1. Diprosopus (partially duplicated head) associated with anencephaly: a case report.

    Science.gov (United States)

    al Muti Zaitoun, A; Chang, J; Booker, M

    1999-01-01

    Craniofacial duplication (diprosopus) is a rare form of conjoined twin. A 16 year old mother with a twin pregnancy delivered one normally formed baby boy and one diprosopus male. The malformed baby was 33 weeks of gestation with a single trunk, normal limbs and various degrees of facial duplication. Of the following structures there were two of each: noses, eyes, ears (and one dimple), mouths, tongues and, with bilateral central cleft lips and cleft palates. This was associated with holoprosencephaly and craniorachischisis. Internal organs showed no duplication. There were multiple congenital anomalies including diaphragmatic hernia, small lungs, two lobes of the right lung, ventricular septal defect, small adrenal gland and small left kidney with short ureter. The body also had a short neck, small chest cavities and kyphosis. X-ray revealed duplication of the vertebral column. The case presented here represents a type II of diprosopia of Rating (1933) and is the least common type reported. We also reviewed 22 recently reported cases of diprosopus. In addition to facial duplication, anencephaly, neural tube defect and cardiac malformations represent the more common congenital abnormalities associated with diprosopus. The pathogenesis of diprosopus is not well understood. Factors that play a role in diprosopus are probably similar to those factors (genetic, environmental and abnormal placental circulation) which affect monozoygotic twins as observed in this case report. Early ultrasonography diagnosis of diprosopus permits one to consider a vaginal therapeutic abortion.

  2. Duplicability of self-interacting human genes.

    LENUS (Irish Health Repository)

    Pérez-Bercoff, Asa

    2010-01-01

    BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.

  3. Large tandem accelerators

    International Nuclear Information System (INIS)

    Jones, C.M.

    1976-01-01

    The increasing importance of energetic heavy ion beams in the study of atomic physics, nuclear physics, and materials science has partially or wholly motivated the construction of a new generation of tandem accelerators designed to operate at maximum terminal potentials in the range 14 to 30 MV. In addition, a number of older tandem accelerators are now being significantly upgraded to improve their heavy ion performance. Both of these developments have reemphasized the importance of negative heavy ion sources. The new large tandem accelerators are described, and the requirements placed on negative heavy ion source technology by these and other tandem accelerators used for the acceleration of heavy ions are discussed. First, a brief description is given of the large tandem accelerators which have been completed recently, are under construction, or are funded for construction, second, the motivation for construction of these accelerators is discussed, and last, criteria for negative ion sources for use with these accelerators are presented

  4. Current incidence of duplicate publication in otolaryngology.

    Science.gov (United States)

    Cheung, Veronique Wan Fook; Lam, Gilbert O A; Wang, Yun Fan; Chadha, Neil K

    2014-03-01

    Duplicate publication--deemed highly unethical--is the reproduction of substantial content in another article by the same authors. In 1999, Rosenthal et al. identified an 8.5% incidence of duplicate articles in two otolaryngology journals. We explored the current incidence in three otolaryngology journals in North America and Europe. Retrospective literature review. Index articles in 2008 in Archives of Otolaryngology-Head and Neck Surgery, Laryngoscope, and Clinical Otolaryngology were searched using MEDLINE. Potential duplicate publications in 2006 through 2010 were identified using the first, second, and last authors' names. Three authors independently investigated suspected duplicate publications--classifying them by degree of duplication. Of 358 index articles screened, 75 (20.9%) had 119 potential duplicates from 2006 to 2010. Full review of these 119 potential duplicates revealed a total of 40 articles with some form of redundancy (33.6% of the potential duplicates) involving 27 index articles (7.5% of 358 index articles); one (0.8%) "dual" publication (identical or nearly identical data and conclusions to the index article); three (2.5%) "suspected" dual publications (less than 50% new data and same conclusions); and 36 (30.3%) publications with "salami-slicing" (portion of the index article data repeated) were obtained. Further analysis compared the likelihood of duplicate publication by study source and subspecialty within otolaryngology. The incidence of duplicate publication has not significantly changed over 10 years. "Salami-slicing" was a concerning practice, with no cross-referencing in 61% of these cases. Detecting and eliminating redundant publications is a laborious task, but it is essential in upholding the journal quality and research integrity. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.

  5. Clinical Fact of Rectal Duplication with gastric heterotopy | Atmani ...

    African Journals Online (AJOL)

    Enteric duplication could occur through the entire alimentary tract. A case of rectal duplication cyst with heterotopic gastric mucosa in a chid is described. MRI scan is shown useful in the diagnosis of the duplication. The treatment is the complete local resection of the rectal duplication. Keywords: duplication, rectal, MRI, ...

  6. Determination of bovine lactoferrin in dairy products by ultra-high performance liquid chromatography–tandem mass spectrometry based on tryptic signature peptides employing an isotope-labeled winged peptide as internal standard

    International Nuclear Information System (INIS)

    Zhang, Jingshun; Lai, Shiyun; Cai, Zengxuan; Chen, Qi; Huang, Baifen; Ren, Yiping

    2014-01-01

    Highlights: • A UHPLC–MS/MS method for quantification of bovine lactoferrin was developed. • Tryptic fragment LRPVAAEIYGTK was chosen as signature peptide of bovine lactoferrin. • A winged peptide containing isotopically-labeled signature peptide was designed as internal standard. • The method for determining lactoferrin does not discriminate between the different forms of lactoferrin. • Meet the growing demand to quantify bovine lactoferrin in different dairy products. - Abstract: A new and sensitive determination method was developed for bovine lactoferrin in dairy products including infant formulas based on the signature peptide by ultra high-performance liquid chromatography and triple-quadrupole tandem mass spectrometry under the multiple reaction monitoring mode. The simple pretreatment procedures included the addition of a winged peptide containing the isotope-labeled signature peptide as internal standard, followed by an enzymatic digestion with trypsin. The signature peptide was chosen and identified from the tryptic hydrolyzates of bovine lactoferrin by ultra high-performance liquid chromatography and quadrupole-time-of-flight tandem mass spectrometry based on sequence database search. Analytes were separated on an ACQUITY UPLC BEH 300 C18 column and monitored by MS/MS in seven minutes. Quantitative result bias due to matrix effect and tryptic efficiency was corrected through the use of synthetic isotope-labeled standards. The limit of detection and limit of quantification were 0.3 mg/100 g and 1.0 mg/100 g, respectively. Bovine lactoferrin within the concentration range of 10–1000 nmol L −1 showed a strong linear relationship with a linear correlation coefficient (r) of >0.998. The intra- and inter-day precision of the method were RSD < 6.5% and RSD < 7.1%, respectively. Excellent repeatability (RSD < 6.4%) substantially supported the application of this method for the determination of bovine lactoferrin in dairy samples. The present

  7. Determination of bovine lactoferrin in dairy products by ultra-high performance liquid chromatography–tandem mass spectrometry based on tryptic signature peptides employing an isotope-labeled winged peptide as internal standard

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jingshun [Zhejiang Provincial Center for Disease Control and Prevention, Hangzhou 310051 (China); Lai, Shiyun [Beingmate Research Institute, Beingmate Baby and Child Food Co., Ltd., Hangzhou 310007 (China); Cai, Zengxuan [Zhejiang Provincial Center for Disease Control and Prevention, Hangzhou 310051 (China); Chen, Qi [Beingmate Research Institute, Beingmate Baby and Child Food Co., Ltd., Hangzhou 310007 (China); Huang, Baifen [Zhejiang Provincial Center for Disease Control and Prevention, Hangzhou 310051 (China); Ren, Yiping, E-mail: renyiping@263.net [Zhejiang Provincial Center for Disease Control and Prevention, Hangzhou 310051 (China)

    2014-06-01

    Highlights: • A UHPLC–MS/MS method for quantification of bovine lactoferrin was developed. • Tryptic fragment LRPVAAEIYGTK was chosen as signature peptide of bovine lactoferrin. • A winged peptide containing isotopically-labeled signature peptide was designed as internal standard. • The method for determining lactoferrin does not discriminate between the different forms of lactoferrin. • Meet the growing demand to quantify bovine lactoferrin in different dairy products. Abstract: A new and sensitive determination method was developed for bovine lactoferrin in dairy products including infant formulas based on the signature peptide by ultra high-performance liquid chromatography and triple-quadrupole tandem mass spectrometry under the multiple reaction monitoring mode. The simple pretreatment procedures included the addition of a winged peptide containing the isotope-labeled signature peptide as internal standard, followed by an enzymatic digestion with trypsin. The signature peptide was chosen and identified from the tryptic hydrolyzates of bovine lactoferrin by ultra high-performance liquid chromatography and quadrupole-time-of-flight tandem mass spectrometry based on sequence database search. Analytes were separated on an ACQUITY UPLC BEH 300 C18 column and monitored by MS/MS in seven minutes. Quantitative result bias due to matrix effect and tryptic efficiency was corrected through the use of synthetic isotope-labeled standards. The limit of detection and limit of quantification were 0.3 mg/100 g and 1.0 mg/100 g, respectively. Bovine lactoferrin within the concentration range of 10–1000 nmol L⁻¹ showed a strong linear relationship with a linear correlation coefficient (r) of >0.998. The intra- and inter-day precision of the method were RSD < 6.5% and RSD < 7.1%, respectively. Excellent repeatability (RSD < 6.4%) substantially supported the application of this method for the determination of bovine lactoferrin in dairy samples. The present method

  8. The duplicated genes database: identification and functional annotation of co-localised duplicated genes across genomes.

    Directory of Open Access Journals (Sweden)

    Marion Ouedraogo

    Full Text Available BACKGROUND: There has been a surge in studies linking genome structure and gene expression, with special focus on duplicated genes. Although initially duplicated from the same sequence, duplicated genes can diverge strongly over evolution and take on different functions or regulated expression. However, information on the function and expression of duplicated genes remains sparse. Identifying groups of duplicated genes in different genomes and characterizing their expression and function would therefore be of great interest to the research community. The 'Duplicated Genes Database' (DGD was developed for this purpose. METHODOLOGY: Nine species were included in the DGD. For each species, BLAST analyses were conducted on peptide sequences corresponding to the genes mapped on a same chromosome. Groups of duplicated genes were defined based on these pairwise BLAST comparisons and the genomic location of the genes. For each group, Pearson correlations between gene expression data and semantic similarities between functional GO annotations were also computed when the relevant information was available. CONCLUSIONS: The Duplicated Gene Database provides a list of co-localised and duplicated genes for several species with the available gene co-expression level and semantic similarity value of functional annotation. Adding these data to the groups of duplicated genes provides biological information that can prove useful to gene expression analyses. The Duplicated Gene Database can be freely accessed through the DGD website at http://dgd.genouest.org.

  9. An on-spot internal standard addition approach for accurately determining colistin A and colistin B in dried blood spots using ultra high-performance liquid chromatography-tandem mass spectrometry.

    Science.gov (United States)

    Tsai, I-Lin; Kuo, Ching-Hua; Sun, Hsin-Yun; Chuang, Yu-Chung; Chepyala, Divyabharathi; Lin, Shu-Wen; Tsai, Yun-Jung

    2017-10-25

    Outbreaks of multidrug-resistant Gram-negative bacterial infections have been reported worldwide. Colistin, an antibiotic with known nephrotoxicity and neurotoxicity, is now being used to treat multidrug-resistant Gram-negative strains. In this study, we applied an on-spot internal standard addition approach coupled with an ultra high-performance liquid chromatography-tandem mass spectrometry (LC-MS/MS) method to quantify colistin A and B from dried blood spots (DBSs). Only 15μL of whole blood was required for each sample. An internal standard with the same yield of extraction recoveries as colistin was added to the spot before sample extraction for accurate quantification. Formic acid in water (0.15%) with an equal volume of acetonitrile (50:50v/v) was used as the extraction solution. With the optimized extraction process and LC-MS/MS conditions, colistin A and B could be quantified from a DBS with respective limits of quantification of 0.13 and 0.27μgmL -1 , and the retention times were spot internal standard addition approach which benefited the precision and accuracy. Results showed that DBS sampling coupled with the sensitive LC-MS/MS method has the potential to be an alternative approach for colistin quantification, where the bias of prodrug hydrolysis in liquid samples is decreased. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Rectal duplications accompanying rectovestibular fistula: report of two cases.

    Science.gov (United States)

    Pampal, Arzu; Ozbayoglu, Asli; Kaya, Cem; Pehlivan, Yildiz; Poyraz, Aylar; Ozen, I Onur; Percin, Ferda E; Demirogullari, Billur

    2013-08-01

    Rectal duplication (RD) cysts are rare congenital anomalies that can be diagnosed with the presence of another opening in the perineum. They seldom accompany anorectal malformations (ARM). Two cases of RD accompanying ARM at opposite ends of the phenotypic spectrum, are described. A 3-month-old baby and a 2-year-old girl with ARM were scheduled for posterior sagittal anorectoplasty. The infant had an orifice at the anal dimple and the other had an orifice at the vestibulum posterior to the rectovestibular fistula. The infant presented with no other anomalies whereas the older one presented with an unusual coexistence of caudal duplication and caudal regression syndromes. Perioperatively both orifices were found to be related to retrorectal cysts, and were excised. Clinicians should always be alert when dealing with complex malformations. Because these malformations have variable anatomical and clinical presentations, they can represent a diagnostic and therapeutic challenge. © 2013 The Authors. Pediatrics International © 2013 Japan Pediatric Society.

  11. Duplicate Record Elimination in Large Data Files.

    Science.gov (United States)

    1981-08-01

    UNCLASSIFIJED CSTR -445 NL LmEE~hhE - I1.0 . 111112----5 1.~4 __112 ___IL25_ 1.4 111111.6 EI24 COMPUTER SCIENCES DEPARTMENT oUniversity of Wisconsin...we propose a combinatorial model for the use in the analysis of algorithms for duplicate elimination. We contend that this model can serve as a...duplicates in a multiset of records, knowing the size of the multiset and the number of distinct records in it. 3. Algorithms for Duplicate Elimination

  12. Parallel origins of duplications and the formation of pseudogenes in mitochondrial DNA from parthenogenetic lizards (Heteronotia binoei; Gekkonidae).

    Science.gov (United States)

    Zevering, C E; Moritz, C; Heideman, A; Sturm, R A

    1991-11-01

    Analysis of mitochondrial DNAs (mtDNAs) from parthenogenetic lizards of the Heteronotia binoei complex with restriction enzymes revealed an approximately 5-kb addition present in all 77 individuals. Cleavage site mapping suggested the presence of a direct tandem duplication spanning the 16S and 12S rRNA genes, the control region and most, if not all, of the gene for the subunit 1 of NADH dehydrogenase (ND1). The location of the duplication was confirmed by Southern hybridization. A restriction enzyme survey provided evidence for modifications to each copy of the duplicated sequence, including four large deletions. Each gene affected by a deletion was complemented by an intact version in the other copy of the sequence, although for one gene the functional copy was heteroplasmic for another deletion. Sequencing of a fragment from one copy of the duplication which encompassed the tRNA(leu)(UUR) and parts of the 16S rRNA and ND1 genes, revealed mutations expected to disrupt function. Thus, evolution subsequent to the duplication event has resulted in mitochondrial pseudogenes. The presence of duplications in all of these parthenogens, but not among representatives of their maternal sexual ancestors, suggests that the duplications arose in the parthenogenetic form. This provides the second instance in H. binoei of mtDNA duplication associated with the transition from sexual to parthenogenetic reproduction. The increased incidence of duplications in parthenogenetic lizards may be caused by errors in mtDNA replication due to either polyploidy or hybridity of their nuclear genomes.

  13. Partial Duplication of Chromosome 8p

    African Journals Online (AJOL)

    rme

    The partial chromosome 8p duplication is a rare syndrome and is ... abnormality of maternal origin that ... second trimester by vaginal bleeding and ... echocardiography, brain CT scan and. MRI. Fig. 1:Conventional karyotype of case 3 showing.

  14. Case Report Duplication Of Gastrointestinal Tract

    African Journals Online (AJOL)

    duplication (Fig 3). A tragic event occurred intra-operatively when ... Brain damage persisted and all modalities of treatment were terminated upon confirmation of brain death. ... compression, epithelial recanalization, and vascular accidents (6) ...

  15. Genetics Home Reference: 17q12 duplication

    Science.gov (United States)

    ... J, Li C, Roeder E, Cox S, Karaviti L, Pearson M, Kang SH, Sahoo T, Lalani SR, Stankiewicz ... genomic disorders from the duplication architecture of the human genome. Nat Genet. 2006 Sep;38(9):1038- ...

  16. Rectal duplication cyst in a cat.

    Science.gov (United States)

    Kook, Peter H; Hagen, Regine; Willi, Barbara; Ruetten, Maja; Venzin, Claudio

    2010-12-01

    Enteric duplication is a rare developmental malformation in people, dogs and cats. The purpose of the present report is to describe the first case of a rectal duplication cyst in a 7-year-old domestic shorthair cat presenting for acute constipation and tenesmus. On rectal palpation a spherical mass compressing the lumen of the rectum could be felt in the dorsal wall of the rectum. A computed tomography (CT) scan confirmed the presence of a well demarcated cystic lesion in the pelvic canal, dorsal to the rectum. The cyst was surgically removed via a perineal approach. No communication with the rectal lumen could be demonstrated. Histopathological examination was consistent with a rectal duplication cyst. Clinical signs resolved completely after excision of this conjoined non-communicating cystic rectal duplicate. Copyright © 2010 ISFM and AAFP. Published by Elsevier Ltd. All rights reserved.

  17. Pattern of Duplicate Presentations at National Hematology-Oncology Meetings: Influence of the Pharmaceutical Industry.

    Science.gov (United States)

    Ramchandren, Radhakrishnan; Schiffer, Charles A

    2016-03-01

    The major large US hematology-oncology meetings sponsored by the American Society of Hematology (ASH) and American Society of Clinical Oncology (ASCO) have specific guidelines in place discouraging submission of scientific information presented previously at other meetings. Nonetheless, duplicate submissions are frequent. The incidence and motivations for duplicate hematologic presentations and the influence of the pharmaceutical industry on this process have not been thoroughly analyzed. Therefore, were viewed four consecutive ASH and ASCO meetings to assess the frequency of duplicate abstract presentations. All abstracts presented at ASCO2010 in the area of malignant hematology were compared with abstracts from ASCO and ASH 2009 and ASH 2010, and funding sources were reviewed. More than half (54%) of all abstracts submitted to ASCO 2010 acknowledged pharmaceutical company support. Almost one third (31%) of ASCO 2010 abstracts were resubmitted in the 2-year time period, and it was notable that a high fraction (75%) of these duplicate abstracts had pharmaceutical industry sponsorship, compared with 42% of the abstracts that were submitted only once. Despite current guidelines prohibiting duplicate abstract presentation, a substantial proportion (31%) of abstracts at large international hematology-oncology meetings are duplicative, with potential negative consequences. In addition, a disproportionate percentage of the duplicate abstracts rely on pharmaceutical industry support (75%), suggesting that marketing strategies may be a motivation for some of these repetitive submissions.

  18. [Rectal duplication cyst--case report].

    Science.gov (United States)

    Turyna, R; Horák, L; Kucera, E; Hejda, V; Krofta, L; Feyereisl, J

    2009-06-01

    The authors demonstrate a rare case of duplication anomaly of the rectum. Case report. Institute for the Care of Mother and Child, Prague. We present a rare case of cystic rectal duplication in adult, completely removed and histologically confirmed. A literature review was summarized. The case was complicated by delay in diagnosis, multiple operations, and by the association with endometriosis, as well. Mentioned anomaly is published in the Czech literature for the very first time.

  19. The detection of large deletions or duplications in genomic DNA.

    Science.gov (United States)

    Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R

    2002-11-01

    While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

  20. Tandem mirror reactor

    International Nuclear Information System (INIS)

    Moir, R.W.; Barr, W.L.; Carlson, G.A.

    1977-01-01

    A parametric analysis and a preliminary conceptual design for a 1000 MWe Tandem Mirror Reactor (TMR) are described. The concept is sufficiently attractive to encourage further work, both for a pure fusion TMR and a low technology TMR Fusion-Fission Hybrid

  1. Recombination and evolution of duplicate control regions in the mitochondrial genome of the Asian big-headed turtle, Platysternon megacephalum.

    Directory of Open Access Journals (Sweden)

    Chenfei Zheng

    Full Text Available Complete mitochondrial (mt genome sequences with duplicate control regions (CRs have been detected in various animal species. In Testudines, duplicate mtCRs have been reported in the mtDNA of the Asian big-headed turtle, Platysternon megacephalum, which has three living subspecies. However, the evolutionary pattern of these CRs remains unclear. In this study, we report the completed sequences of duplicate CRs from 20 individuals belonging to three subspecies of this turtle and discuss the micro-evolutionary analysis of the evolution of duplicate CRs. Genetic distances calculated with MEGA 4.1 using the complete duplicate CR sequences revealed that within turtle subspecies, genetic distances between orthologous copies from different individuals were 0.63% for CR1 and 1.2% for CR2app:addword:respectively, and the average distance between paralogous copies of CR1 and CR2 was 4.8%. Phylogenetic relationships were reconstructed from the CR sequences, excluding the variable number of tandem repeats (VNTRs at the 3' end using three methods: neighbor-joining, maximum likelihood algorithm, and Bayesian inference. These data show that any two CRs within individuals were more genetically distant from orthologous genes in different individuals within the same subspecies. This suggests independent evolution of the two mtCRs within each P. megacephalum subspecies. Reconstruction of separate phylogenetic trees using different CR components (TAS, CD, CSB, and VNTRs suggested the role of recombination in the evolution of duplicate CRs. Consequently, recombination events were detected using RDP software with break points at ≈290 bp and ≈1,080 bp. Based on these results, we hypothesize that duplicate CRs in P. megacephalum originated from heterological ancestral recombination of mtDNA. Subsequent recombination could have resulted in homogenization during independent evolutionary events, thus maintaining the functions of duplicate CRs in the mtDNA of P

  2. Duplication of Key Frames of Video Streams in Wireless Networks

    OpenAIRE

    Sagatov, Evgeny S.; Sukhov, Andrei M.

    2011-01-01

    In this paper technological solutions for improving the quality of video transfer along wireless networks are investigated. Tools have been developed to allow packets to be duplicated with key frames data. In the paper we tested video streams with duplication of all frames, with duplication of key frames, and without duplication. The experiments showed that the best results are obtained by duplication of packages which contain key frames. The paper also provides an overview of the coefficient...

  3. A case report of Ileal duplication

    Energy Technology Data Exchange (ETDEWEB)

    Oh, K K; Suh, J H; Choi, B S [Yonsei University College of Medicine, Seoul (Korea, Republic of)

    1971-10-15

    Since Frankel reported the congenital anomalous intestinal duplication incidentally during autopsy in 1883, about 228 cases has been reported on the literatures. In our severance hospital, one case of ileal duplication was found, and was confirmed by pathology and surgery. This patient of duplication usually reveals the symptoms of abnormal distension, pain and palpable abdominal mass, and sometimes the symptoms of intestinal obstruction. On x-ray flate abdomen, huge occupying mass displaces intestinal gas pattern to left side. Barium enema study reveals elongation and displacement of ileum by large extrinsic mass. And cecum is also displaced upward. On the IVP, this extrinsic mass is not related to kidneys. Also, the literature was reviewed.

  4. [Intestinal volvulus due to yeyunal duplication].

    Science.gov (United States)

    Rodríguez Iglesias, P; Carazo Palacios, M E; Lluna González, J; Ibáñez Pradas, V; Rodríguez Caraballo, L

    2014-10-01

    Duplications of the alimentary tract are congenital malformations. The ileum is the most commonly affected organ. A lot of duplications are incidentally diagnosed but most of patients present a combination of pain or complications such as obstructive symptoms, intestinal intussusception, perforation or volvulus. We report the case of a 6-years-old girl, with intermittent abdominal pain and vomits for two months long. Laboratory work was completely normal and in the radiology analysis (abdominal sonography and magnetic resonance) a cystic image with intestinal volvulus was observed. The patient underwent laparotomy, Ladd's procedure was done and the cyst was resected. In conclusion, if a patient is admitted with abdominal pain and obstructive symptoms, it is important to consider duplication of the alimentary tract as a possible diagnosis.

  5. Prevalence of lower extremity venous duplication

    Directory of Open Access Journals (Sweden)

    Simpson William

    2010-01-01

    Full Text Available Purpose: This retrospective study was performed to determine the prevalence of lower extremity venous duplication using duplex ultrasound in the patient population of a large urban medical center. Materials and Methods: The reports of all lower extremity venous ultrasound examinations performed at our institution between January 1, 2002 and December 31, 2002 were reviewed. Ultrasound examinations that were performed for purposes other than the detection of lower extremity deep vein thrombosis were excluded. The prevalence of duplication and its specific location were recorded. In addition, the prevalence of thrombus and its specific location were also recorded. Results: A total of 3118 exams were performed in 2664 patients. Of the 2664 patients, 2311 had only one examination performed during the study period; 353 patients had more than one examination performed. We found that 10.1% of patients (270/2664 had at least one venous segment duplicated and 5.4% of patients (143/2664 had a thrombus in at least one venous segment. There was a statistically significant difference in the prevalence of both duplication and thrombus with a change in venous segment. Only 0.4% of patients (11/2664 had thrombus within a duplicated segment. Of those who had more than one examination performed, 15.3% (54/353 had the same venous segment(s seen on one examination but not another. Conclusion: Lower extremity venous duplication is a frequent anatomic variant that is seen in 10.1% of patients, but it may not be as common as is generally believed. It can result in a false negative result for deep vein thrombosis.

  6. Segmental Duplication, Microinversion, and Gene Loss Associated with a Complex Inversion Breakpoint Region in Drosophila

    Science.gov (United States)

    Calvete, Oriol; González, Josefa; Betrán, Esther; Ruiz, Alfredo

    2012-01-01

    Chromosomal inversions are usually portrayed as simple two-breakpoint rearrangements changing gene order but not gene number or structure. However, increasing evidence suggests that inversion breakpoints may often have a complex structure and entail gene duplications with potential functional consequences. Here, we used a combination of different techniques to investigate the breakpoint structure and the functional consequences of a complex rearrangement fixed in Drosophila buzzatii and comprising two tandemly arranged inversions sharing the middle breakpoint: 2m and 2n. By comparing the sequence in the breakpoint regions between D. buzzatii (inverted chromosome) and D. mojavensis (noninverted chromosome), we corroborate the breakpoint reuse at the molecular level and infer that inversion 2m was associated with a duplication of a ∼13 kb segment and likely generated by staggered breaks plus repair by nonhomologous end joining. The duplicated segment contained the gene CG4673, involved in nuclear transport, and its two nested genes CG5071 and CG5079. Interestingly, we found that other than the inversion and the associated duplication, both breakpoints suffered additional rearrangements, that is, the proximal breakpoint experienced a microinversion event associated at both ends with a 121-bp long duplication that contains a promoter. As a consequence of all these different rearrangements, CG5079 has been lost from the genome, CG5071 is now a single copy nonnested gene, and CG4673 has a transcript ∼9 kb shorter and seems to have acquired a more complex gene regulation. Our results illustrate the complex effects of chromosomal rearrangements and highlight the need of complementing genomic approaches with detailed sequence-level and functional analyses of breakpoint regions if we are to fully understand genome structure, function, and evolutionary dynamics. PMID:22328714

  7. Quantification of endogenous metabolites by the postcolumn infused-internal standard method combined with matrix normalization factor in liquid chromatography-electrospray ionization tandem mass spectrometry.

    Science.gov (United States)

    Liao, Hsiao-Wei; Chen, Guan-Yuan; Wu, Ming-Shiang; Liao, Wei-Chih; Tsai, I-Lin; Kuo, Ching-Hua

    2015-01-02

    Quantification of endogenous metabolites has enabled the discovery of biomarkers for diagnosis and provided for an understanding of disease etiology. The standard addition and stable isotope labeled-internal standard (SIL-IS) methods are currently the most widely used approaches to quantifying endogenous metabolites, but both have some limitations for clinical measurement. In this study, we developed a new approach for endogenous metabolite quantification by the postcolumn infused-internal standard (PCI-IS) method combined with the matrix normalization factor (MNF) method. MNF was used to correct the difference in MEs between standard solution and biofluids, and PCI-IS additionally tailored the correction of the MEs for individual samples. Androstenedione and testosterone were selected as test articles to verify this new approach to quantifying metabolites in plasma. The repeatability (n=4 runs) and intermediate precision (n=3 days) in terms of the peak area of androstenedione and testosterone at all tested concentrations were all less than 11% relative standard deviation (RSD). The accuracy test revealed that the recoveries were between 95.72% and 113.46%. The concentrations of androstenedione and testosterone in fifty plasma samples obtained from healthy volunteers were quantified by the PCI-IS combined with the MNF method, and the quantification results were compared with the results of the SIL-IS method. The Pearson correlation test showed that the correlation coefficient was 0.98 for both androstenedione and testosterone. We demonstrated that the PCI-IS combined with the MNF method is an effective and accurate method for quantifying endogenous metabolites. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. The tandem betatron accelerator

    International Nuclear Information System (INIS)

    Keinigs, R.

    1991-01-01

    This paper reports that the tandem betatron is a compact, high-current induction accelerator that has the capability to accelerate electrons to an energy of order one gigavolt. Based upon the operating principle of a conventional betatron, the tandem betatron employs two synchronized induction cores operating 180 degrees out of phase. Embedded within the cores are the vacuum chambers, and these are connected by linear transport sections to allow for moving the beam back and forth between the two betatrons. The 180 degree phase shift between the core fluxes permits the circumvention of the flux swing constraint that limits the maximum energy gain of a conventional betatron. By transporting the beam between the synchronized cores, an electron can access more than one acceleration cycle, and thereby continue to gain energy. This added degree of freedom also permits a significant decrease in the size of the magnet system. Biasing coils provide independent control of the confining magnetic field. Provided that efficient beam switching can be performed, it appears feasible that a one gigavolt electron beam can be generated and confined. At this energy, a high current electron beam circulating in a one meter radius orbit could provide a very intense source of short wavelength (λ < 10 nm) synchrotron radiation. This has direct application to the emerging field of x-ray lithography. At more modest energies (10 MeV-30 MEV) a compact tandem betatron could be employed in the fields of medical radiation therapy, industrial radiography, and materials processing

  9. Translocations used to generate chromosome segment duplications ...

    Indian Academy of Sciences (India)

    a duplication (Dp) of the translocated segment and four inviable (white, W) ascospores with .... of this work, namely, the definition of breakpoint junction sequences of 12 ..... then our results would place supercontig 10.9 in distal. LG VIR. A third ...

  10. Incomplete urethral duplication in an adult male.

    LENUS (Irish Health Repository)

    Davis, N F

    2012-09-01

    Urethral duplication is a rare congenital anomaly with less than 200 cases reported. It predominantly occurs in males and is nearly always diagnosed in childhood or adolescence. It is defined as a complete second passage from the bladder to the dorsum of the penis or as an accessory pathway that ends blindly on the dorsal or ventral surface.

  11. 20 CFR 410.705 - Duplicate claims.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Duplicate claims. 410.705 Section 410.705 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, TITLE IV-BLACK LUNG BENEFITS (1969- ) Rules for the Review of Denied and Pending Claims Under the Black Lung...

  12. Bladder exstrophy associated with complete urethral duplication ...

    African Journals Online (AJOL)

    J.E. Mensah

    ees.elsevier.com/afju · www.sciencedirect.com. Case report. Bladder exstrophy associated with complete urethral duplication: Bladder can be augmented with dorsal urethral mucosa. J.E. Mensaha,∗. , K.N. Ampadua, M.Y. Kyeia, B. Edusieb.

  13. Rectal duplication cyst presenting as rectal prolapse in an infant

    Directory of Open Access Journals (Sweden)

    Maher Zaiem

    2018-05-01

    Full Text Available Rectal duplication is a rare variety of gastrointestinal duplication. It accounts 4% of the total gastrointestinal duplications.In this paper, we are reporting a case of an 8 months old male who presented with rectal prolapse. Digital rectal examination revealed a soft mass bulging through the posterior wall of rectum. Computed tomography (CT scan showed a cystic mass compressing the posterior wall of the rectum. The mass was excised using a Muscle Complex Saving Posterior Sagittal approach (MCS-PSA. The pathology report confirmed the diagnosis of the rectal duplication cyst. The postoperative recovery was uneventful. Keywords: Intestinal duplication, Cystic rectal duplication, Rectal prolapse

  14. Tandem accelerator operation and improvements

    International Nuclear Information System (INIS)

    Yang Bingfan; Zhang Canzhe; Qin Jiuchang; Hu Yueming; Zhang Guilian; Jiang Yongliang; Hou Deyi; Yang Weimin; Yang Zhiren; Su Shengyong; Kan Chaoxin; Liu Dezhong; Wang Liyong; Bao Yiwen; You Qubo; Yang Tao; Zhang Yan; Zhou Lipeng; Chai Shiqin; Wang Meiyan

    1998-01-01

    The scheduled operation of HI-13 tandem accelerator for various experiments was performed well in 1996 and 1997. The machine running time was 4600 h and 4182 h while the beam time was 3845 h and 3712 h in 1996 and 1997, respectively. The operation of HI-13 tandem accelerator is pretty well. The beam distribution with terminal voltage and the distribution of beam time with ion species are shown out. The development of accelerating tubes for HI-13 tandem is in progress

  15. Our experience with unusual gastrointestinal tract duplications in infants

    Directory of Open Access Journals (Sweden)

    Bilal Mirza

    2014-01-01

    Full Text Available Background: Classical duplications may present along any part of gastrointestinal tract (GIT from mouth to anus. Atypical or unusual rare varieties of GIT duplications may also occur, but with different anatomical features. Materials and Methods: We reviewed our 5-year record (February 2008-January 2013 to describe clinical profile of unusual GIT duplications in neonates and small infants. Results: Three patients with atypical variety of GIT duplications were managed in our department during this tenure. Two were females and one male. Age was ranged between 11 days and 2 months. All patients presented with massive abdominal distension causing respiratory embarrassment in two of them. In all patients, the pre-operative differential diagnoses also included GIT duplication cysts. Computerized tomography (CT scan showed single huge cyst in one and multiple cysts in two patients. In one patient the CT scan also depicted a thoracic cyst in relation to posterior mediastinum. At operation, one patient had colonic tubular duplication cyst along with another isolated duplication cyst, the second case had a tubular duplication cyst of ileum with its segmental dilatation, and in the third case two isolated duplications were found. Duplication cysts were excised along with mucosal stripping in one patient, cyst excision and intestinal resection and anastomosis in one patient, and only cysts excision in one. All patients did well post-operatively. Conclusion: We presented unusual GIT duplications. These duplications are managed on similar lines as classical duplications with good prognosis when dealt early.

  16. The evolution of pepsinogen C genes in vertebrates: duplication, loss and functional diversification.

    Directory of Open Access Journals (Sweden)

    Luís Filipe Costa Castro

    Full Text Available BACKGROUND: Aspartic proteases comprise a large group of enzymes involved in peptide proteolysis. This collection includes prominent enzymes globally categorized as pepsins, which are derived from pepsinogen precursors. Pepsins are involved in gastric digestion, a hallmark of vertebrate physiology. An important member among the pepsinogens is pepsinogen C (Pgc. A particular aspect of Pgc is its apparent single copy status, which contrasts with the numerous gene copies found for example in pepsinogen A (Pga. Although gene sequences with similarity to Pgc have been described in some vertebrate groups, no exhaustive evolutionary framework has been considered so far. METHODOLOGY/PRINCIPAL FINDINGS: By combining phylogenetics and genomic analysis, we find an unexpected Pgc diversity in the vertebrate sub-phylum. We were able to reconstruct gene duplication timings relative to the divergence of major vertebrate clades. Before tetrapod divergence, a single Pgc gene tandemly expanded to produce two gene lineages (Pgbc and Pgc2. These have been differentially retained in various classes. Accordingly, we find Pgc2 in sauropsids, amphibians and marsupials, but not in eutherian mammals. Pgbc was retained in amphibians, but duplicated in the ancestor of amniotes giving rise to Pgb and Pgc1. The latter was retained in mammals and probably in reptiles and marsupials but not in birds. Pgb was kept in all of the amniote clade with independent episodes of loss in some mammalian species. Lineage specific expansions of Pgc2 and Pgbc have also occurred in marsupials and amphibians respectively. We find that teleost and tetrapod Pgc genes reside in distinct genomic regions hinting at a possible translocation. CONCLUSIONS: We conclude that the repertoire of Pgc genes is larger than previously reported, and that tandem duplications have modelled the history of Pgc genes. We hypothesize that gene expansion lead to functional divergence in tetrapods, coincident with the

  17. Comprehensive profiling of mercapturic acid metabolites from dietary acrylamide as short-term exposure biomarkers for evaluation of toxicokinetics in rats and daily internal exposure in humans using isotope dilution ultra-high performance liquid chromatography tandem mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yu [Department of Food Science and Nutrition, College of Biosystems Engineering and Food Science, Zhejiang University, Hangzhou 310058, Zhejiang (China); Zhejiang Key Laboratory for Agro-Food Processing, Zhejiang R & D Center for Food Technology and Equipment, Fuli Institute of Food Science, Zhejiang University, Hangzhou 310058, Zhejiang (China); Wang, Qiao; Cheng, Jun [Department of Food Science and Nutrition, College of Biosystems Engineering and Food Science, Zhejiang University, Hangzhou 310058, Zhejiang (China); Zhang, Jingshun; Xu, Jiaojiao [Zhejiang Provincial Center for Disease Control and Prevention, Hangzhou 310051, Zhejiang (China); Ren, Yiping, E-mail: renyiping@263.net [Zhejiang Provincial Center for Disease Control and Prevention, Hangzhou 310051, Zhejiang (China)

    2015-09-24

    Mercapturic acid metabolites from dietary acrylamide are important short-term exposure biomarkers for evaluating the in vivo toxicity of acrylamide. Most of studies have focused on the measurement of two metabolites, N-acetyl-S-(2-carbamoylethyl)-L-cysteine (AAMA) and N-acetyl-S-(2-carbamoyl-2-hydroxyethyl)-L-cysteine (GAMA). Thus, the comprehensive profile of acrylamide urinary metabolites cannot be fully understood. We developed an isotope dilution ultra-high performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) method for the simultaneous determination of all four mercapturic acid adducts of acrylamide and its primary metabolite glycidamide under the electroscopy ionization negative (ESI-) mode in the present study. The limit of detection (LOD) and limit of quantification (LOQ) of the analytes ranged 0.1–0.3 ng/mL and 0.4–1.0 ng/mL, respectively. The recovery rates with low, intermediate and high spiking levels were calculated as 95.5%–105.4%, 98.2%–114.0% and 92.2%–108.9%, respectively. Acceptable within-laboratory reproducibility (RSD < 7.0%) substantially supported the use of current method for robust analysis. Rapid pretreatment procedures and short run time (8 min per sample) ensured good efficiency of metabolism profiling, indicating a wide application for investigating short-term internal exposure of dietary acrylamide. Our proposed UHPLC-MS/MS method was successfully applied to the toxicokinetic study of acrylamide in rats. Meanwhile, results of human urine analysis indicated that the levels of N-acetyl-S-(2-carbamoylethyl)-L-cysteine-sulfoxide (AAMA-sul), which did not appear in the mercapturic acid metabolites in rodents, were more than the sum of GAMA and N-acetyl-S-(1-carbamoyl-2-hydroxyethyl)-L-cysteine (iso-GAMA). Thus, AAMA-sul may alternatively become a specific biomarker for investigating the acrylamide exposure in humans. Current proposed method provides a substantial methodology support for comprehensive

  18. Comprehensive profiling of mercapturic acid metabolites from dietary acrylamide as short-term exposure biomarkers for evaluation of toxicokinetics in rats and daily internal exposure in humans using isotope dilution ultra-high performance liquid chromatography tandem mass spectrometry

    International Nuclear Information System (INIS)

    Zhang, Yu; Wang, Qiao; Cheng, Jun; Zhang, Jingshun; Xu, Jiaojiao; Ren, Yiping

    2015-01-01

    Mercapturic acid metabolites from dietary acrylamide are important short-term exposure biomarkers for evaluating the in vivo toxicity of acrylamide. Most of studies have focused on the measurement of two metabolites, N-acetyl-S-(2-carbamoylethyl)-L-cysteine (AAMA) and N-acetyl-S-(2-carbamoyl-2-hydroxyethyl)-L-cysteine (GAMA). Thus, the comprehensive profile of acrylamide urinary metabolites cannot be fully understood. We developed an isotope dilution ultra-high performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) method for the simultaneous determination of all four mercapturic acid adducts of acrylamide and its primary metabolite glycidamide under the electroscopy ionization negative (ESI-) mode in the present study. The limit of detection (LOD) and limit of quantification (LOQ) of the analytes ranged 0.1–0.3 ng/mL and 0.4–1.0 ng/mL, respectively. The recovery rates with low, intermediate and high spiking levels were calculated as 95.5%–105.4%, 98.2%–114.0% and 92.2%–108.9%, respectively. Acceptable within-laboratory reproducibility (RSD < 7.0%) substantially supported the use of current method for robust analysis. Rapid pretreatment procedures and short run time (8 min per sample) ensured good efficiency of metabolism profiling, indicating a wide application for investigating short-term internal exposure of dietary acrylamide. Our proposed UHPLC-MS/MS method was successfully applied to the toxicokinetic study of acrylamide in rats. Meanwhile, results of human urine analysis indicated that the levels of N-acetyl-S-(2-carbamoylethyl)-L-cysteine-sulfoxide (AAMA-sul), which did not appear in the mercapturic acid metabolites in rodents, were more than the sum of GAMA and N-acetyl-S-(1-carbamoyl-2-hydroxyethyl)-L-cysteine (iso-GAMA). Thus, AAMA-sul may alternatively become a specific biomarker for investigating the acrylamide exposure in humans. Current proposed method provides a substantial methodology support for comprehensive

  19. Annual report of Department of Research Reactor and Tandem Accelerator, JFY2007. Operation, utilization and technical development of JRR-3, JRR-4, NSRR and tandem accelerator

    International Nuclear Information System (INIS)

    Miyazaki, Osamu; Awa, Yasuaki; Isaka, Koji; Kutsukake, Kenichi; Komeda, Masao; Shibata, Ko; Hiyama, Kazuhisa; Suzuki, Mayu; Sone, Takuya; Ohuchi, Tomoaki; Terakado, Yuichi; Sataka, Masao

    2009-06-01

    The Department of Research Reactors and Tandem Accelerator is in charge of the operation, utilization and technical development of JRR-3(Japan Research Reactor-3), JRR-4(Japan Research Reactor-4), NSRR(Nuclear Safety Research Reactor) and Tandem Accelerator. This annual report describes a summary of activities of services and technical developments carried out in the period between April 1, 2007 and March 31, 2008. The activities were categorized into five service/development fields: (1) Operation and maintenance of research reactors and tandem accelerator. (2) Utilization of research reactors and tandem accelerator. (3) Upgrading of utilization techniques of research reactors and tandem accelerator. (4) Safety administration for research reactors and tandem accelerator. (5) International cooperation. Also contained are lists of publications, meetings, granted permissions on lows and regulations concerning atomic energy, commendation, plans and outcomes in service and technical developments and so on. (author)

  20. Annual report of Department of Research Reactor and Tandem Accelerator, JFY2010. Operation, utilization and technical development of JRR-3, JRR-4, NSRR and Tandem Accelerator

    International Nuclear Information System (INIS)

    Ishii, Tetsuro; Nakamura, Kiyoshi; Kawamata, Satoshi; Yamada, Yusuke; Kawashima, Kazuhiro; Asozu, Takuhiro; Nakamura, Takemi; Arai, Masaji; Yoshinari, Shuji; Sataka, Masao

    2012-03-01

    The Department of Research Reactors and Tandem Accelerator is in charge of the operation, utilization and technical development of JRR-3(Japan Research Reactor No.3), JRR-4(Japan Research Reactor No.4), NSRR(Nuclear Safety Research Reactor) and Tandem Accelerator. This annual report describes a summary of activities of services and technical developments carried out in the period between April 1, 2010 and March 31, 2011. The activities were categorized into five service/development fields: (1) Operation and maintenance of research reactors and tandem accelerator, (2) Utilization of research reactors and tandem accelerator, (3) Upgrading of utilization techniques of research reactors and tandem accelerator, (4) Safety administration for research reactors and tandem accelerator, (5) International cooperation. Also contained are lists of publications, meetings, granted permissions on lows and regulations concerning atomic energy, commendation, outcomes in service and technical developments and so on. (author)

  1. Simultaneous analysis of gemfibrozil, morphine, and its two active metabolites in different mouse brain structures using solid-phase extraction with ultra-high performance liquid chromatography and tandem mass spectrometry with a deuterated internal standard.

    Science.gov (United States)

    Yang, Zizhao; Wang, Lu; Xu, Mingcheng; Gu, Jingkai; Yu, Lushan; Zeng, Su

    2016-06-01

    A rapid and sensitive bioassay was established and validated to simultaneously determine gemfibrozil, morphine, morphine-3β-glucuronide, and morphine-6β-glucuronide in mouse cerebrum, epencephalon, and hippocampus based on ultra-high performance liquid chromatography and tandem mass spectrometry. The deuterated internal standard, M6G-d3, was mixed with the prepared samples at 10 ng/mL as the final concentration. The samples were transferred into the C18 solid-phase extraction columns with gradient elution for solid-phase extraction. The mobile phase consisted of methanol and 0.05% formic acid (pH 3.2). Multiple reaction monitoring has been applied to analyze gemfibrozil (m/z 249.0 → 121.0) in anion mode, and M6G-d3 (m/z 465.1 → 289.1), morphine (m/z 286.0 → 200.9), and M3G and M6G (m/z 462.1 → 286.1) in the positive ion mode. The method has a linear calibration range from 0.05 to 10 ng for gemfibrozil, morphine, and M3G and M6G with correlation coefficients >0.993. The lower limit of quantitation for all four analytes was 0.05 ng/mL, relative standard deviation of intra- and interday precision was less than 10.5%, and the relative error of accuracy was from -8.2 to 8.3% at low, medium, and high concentrations for all the analytes. In conclusion, gemfibrozil can influence the morphine antinociception after coronary heart disease induced chronic angina by the change in one of morphine metabolites', M3G, distribution in mouse brain. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Presentation and Surgical Management of Duodenal Duplication in Adults

    Directory of Open Access Journals (Sweden)

    Caroline C. Jadlowiec

    2015-01-01

    Full Text Available Duodenal duplications in adults are exceedingly rare and their diagnosis remains difficult as symptoms are largely nonspecific. Clinical presentations include pancreatitis, biliary obstruction, gastrointestinal bleeding from ectopic gastric mucosa, and malignancy. A case of duodenal duplication in a 59-year-old female is presented, and her treatment course is reviewed with description of combined surgical and endoscopic approach to repair, along with a review of historic and current recommendations for management. Traditionally, gastrointestinal duplications have been treated with surgical resection; however, for duodenal duplications, the anatomic proximity to the biliopancreatic ampulla makes surgical management challenging. Recently, advances in endoscopy have improved the clinical success of cystic intraluminal duodenal duplications. Despite these advances, surgical resection is still recommended for extraluminal tubular duplications although combined techniques may be necessary for long tubular duplications. For duodenal duplications, a combined approach of partial excision combined with mucosal stripping may offer advantage.

  3. Duplication of the Left Vertebral Artery Origin: A Case Report

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Sang Wook; Park, Dong Woo; Park, Choong Ki; Lee, Young Jun [Dept. of Radiology, College of Medicine, Hanyang University, Hanyang University Guri Hospital, Guri (Korea, Republic of)

    2013-01-15

    Duplication of vertebral arteries is a very rare but clinically important condition. A duplicated vertebral artery origin can influence hemodynamics, pathogenesis of vascular lesions and treatment options. In cases of vertebral artery duplication, the vertebral arteries generally enter the transverse foramen higher up than normal. Awareness of these vertebral artery variants before procedures, such as neurointervention or surgery, may be beneficial. Here, we describe a case of a 51-year-old female patient with left vertebral artery duplication which was detected incidentally.

  4. Duplication of the Left Vertebral Artery Origin: A Case Report

    International Nuclear Information System (INIS)

    Shin, Sang Wook; Park, Dong Woo; Park, Choong Ki; Lee, Young Jun

    2013-01-01

    Duplication of vertebral arteries is a very rare but clinically important condition. A duplicated vertebral artery origin can influence hemodynamics, pathogenesis of vascular lesions and treatment options. In cases of vertebral artery duplication, the vertebral arteries generally enter the transverse foramen higher up than normal. Awareness of these vertebral artery variants before procedures, such as neurointervention or surgery, may be beneficial. Here, we describe a case of a 51-year-old female patient with left vertebral artery duplication which was detected incidentally.

  5. [Colonic duplication revealed by intestinal obstruction due to fecal impaction].

    Science.gov (United States)

    Azahouani, A; Hida, M; Benhaddou, H

    2015-12-01

    Colonic duplications are very rare in children. With rectal duplications, they are the rarest locations of alimentary tract duplications, most often diagnosed in the first years of life. We report an unusual case of colic duplication with fecal impaction in a 9-month-old boy revealed by intestinal obstruction. We discuss the main diagnostic and therapeutic aspects of this malformation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  6. Establishment of a tandem ionization chamber system in standard mammography beams

    International Nuclear Information System (INIS)

    Silva, Jonas O. da; Caldas, L.V.E.

    2011-01-01

    A double-faced tandem ionization chamber system was developed at the Calibration Laboratory of IPEN. It has different collecting electrode materials: aluminium and graphite. The response repeatability and reproducibility and the energy dependence test of this tandem ionization chamber were evaluated. The chamber response stability is within the ±3% limit recommended in international standards. The energy dependence test of the ionization chamber system using the tandem curve obtained, presented agreement with literature results. (author)

  7. Duplication Cyst of the Sigmoid Colon

    Directory of Open Access Journals (Sweden)

    Bastian Domajnko

    2009-01-01

    Full Text Available A 21-year-old male with developmental delay presented with abdominal pain of two days' duration. He was afebrile and his abdomen was soft with mild diffuse tenderness. There were no peritoneal signs. Plain x-ray demonstrated a large air-filled structure in the right upper quadrant. Computed tomography of the abdomen revealed a 9×8 cm structure adjacent to the hepatic flexure containing an air-fluid level. It did not contain oral contrast and had no apparent communication with the colon. At operation, the cystic lesion was identified as a duplication cyst of the sigmoid colon that was adherent to the right upper quadrant. The cyst was excised with a segment of the sigmoid colon and a stapled colo-colostomy was performed. Recovery was uneventful. Final pathology was consistent with a duplication cyst of the sigmoid colon. The cyst was attached to the colon but did not communicate with the lumen.

  8. Cosmic abundances: The impact of stellar duplicity

    OpenAIRE

    Jorissen, A.; Van Eck, S.

    2004-01-01

    The mass-transfer scenario links chemical peculiarities with stellar duplicity for an increasing number of stellar classes (classical and dwarf barium stars, subgiant and giant CH stars, S stars without technetium, yellow symbiotic stars, WIRRING stars, Abell-35-like nuclei of planetary nebulae...). Despite these successes, the mass-transfer scenario still faces several problems: What is the mass-transfer mode? Why orbital elements of dwarf barium stars do not fully match those of the classic...

  9. Identifying Tracks Duplicates via Neural Network

    CERN Document Server

    Sunjerga, Antonio; CERN. Geneva. EP Department

    2017-01-01

    The goal of the project is to study feasibility of state of the art machine learning techniques in track reconstruction. Machine learning techniques provide promising ways to speed up the pattern recognition of tracks by adding more intelligence in the algorithms. Implementation of neural network to process of track duplicates identifying will be discussed. Different approaches are shown and results are compared to method that is currently in use.

  10. Anterior rectal duplication: a diagnostic challenge.

    Science.gov (United States)

    Amjadi, K; Poenaru, D; Soboleski, D; Hurlbut, D; Kamal, I

    2000-04-01

    The authors present an anterior rectal cyst in a 14-month-old girl. This rare variant of rectal duplications presented with recurrent urinary infections. The diagnosis was challenging in view of the multiple differential diagnoses to be considered. Magnetic resonance imaging appeared to be the most accurate preoperative investigation. The cyst was removed uneventfully by partial excision and mucosal ablation. An awareness of this variant can lead to early diagnosis and curative resection.

  11. Single quadrature duplication and transparent taps

    International Nuclear Information System (INIS)

    Kim, Ajung

    2004-01-01

    The concept of single quadrature duplication, which is the process of producing two outputs with the same homodyne detecting statistics as an input, is addressed. This device has important potential application to optical communications as a transparent optical tap in a local area network environment. The characteristics of the device are examined, and a realization scheme employing a coupler and phase-sensitive amplifiers is proposed

  12. Duplication of the pituitary gland - plus syndrome

    International Nuclear Information System (INIS)

    Sen, Debraj; Arora, Vijinder

    2016-01-01

    Duplication of the pituitary gland (DPG) is a very rare developmental anomaly that is often associated with other anomalies – the DPG-plus syndrome and occurs due to splitting of the rostral notochord and prechordal plate during blastogenesis. DPG with the constellation of associated anomalies as in our patient has not been reported previously. This article illustrates the importance of imaging the brain in all patients with obvious midline facial anomalies and the complementary role of MRI and CT in such cases

  13. Comparing genomes with rearrangements and segmental duplications.

    Science.gov (United States)

    Shao, Mingfu; Moret, Bernard M E

    2015-06-15

    Large-scale evolutionary events such as genomic rearrange.ments and segmental duplications form an important part of the evolution of genomes and are widely studied from both biological and computational perspectives. A basic computational problem is to infer these events in the evolutionary history for given modern genomes, a task for which many algorithms have been proposed under various constraints. Algorithms that can handle both rearrangements and content-modifying events such as duplications and losses remain few and limited in their applicability. We study the comparison of two genomes under a model including general rearrangements (through double-cut-and-join) and segmental duplications. We formulate the comparison as an optimization problem and describe an exact algorithm to solve it by using an integer linear program. We also devise a sufficient condition and an efficient algorithm to identify optimal substructures, which can simplify the problem while preserving optimality. Using the optimal substructures with the integer linear program (ILP) formulation yields a practical and exact algorithm to solve the problem. We then apply our algorithm to assign in-paralogs and orthologs (a necessary step in handling duplications) and compare its performance with that of the state-of-the-art method MSOAR, using both simulations and real data. On simulated datasets, our method outperforms MSOAR by a significant margin, and on five well-annotated species, MSOAR achieves high accuracy, yet our method performs slightly better on each of the 10 pairwise comparisons. http://lcbb.epfl.ch/softwares/coser. © The Author 2015. Published by Oxford University Press.

  14. Exon duplications in the ATP7A gene

    DEFF Research Database (Denmark)

    Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko

    2011-01-01

    the identified duplicated fragments originated from a single or from two different X-chromosomes, polymorphic markers located in the duplicated fragments were analyzed. RESULTS: Partial ATP7A gene duplication was identified in 20 unrelated patients including one patient with Occipital Horn Syndrome (OHS...

  15. Origin of the duplicated regions in the yeast genomes

    DEFF Research Database (Denmark)

    Piskur, Jure

    2001-01-01

    The genome of Saccharomyces cerevisiae contains several duplicated regions. The recent sequencing results of several yeast species suggest that the duplicated regions found in the modern Saccharomyces species are probably the result of a single gross duplication, as well as a series of sporadic...

  16. Effect of Duplicate Genes on Mouse Genetic Robustness: An Update

    Directory of Open Access Journals (Sweden)

    Zhixi Su

    2014-01-01

    Full Text Available In contrast to S. cerevisiae and C. elegans, analyses based on the current knockout (KO mouse phenotypes led to the conclusion that duplicate genes had almost no role in mouse genetic robustness. It has been suggested that the bias of mouse KO database toward ancient duplicates may possibly cause this knockout duplicate puzzle, that is, a very similar proportion of essential genes (PE between duplicate genes and singletons. In this paper, we conducted an extensive and careful analysis for the mouse KO phenotype data and corroborated a strong effect of duplicate genes on mouse genetics robustness. Moreover, the effect of duplicate genes on mouse genetic robustness is duplication-age dependent, which holds after ruling out the potential confounding effect from coding-sequence conservation, protein-protein connectivity, functional bias, or the bias of duplicates generated by whole genome duplication (WGD. Our findings suggest that two factors, the sampling bias toward ancient duplicates and very ancient duplicates with a proportion of essential genes higher than that of singletons, have caused the mouse knockout duplicate puzzle; meanwhile, the effect of genetic buffering may be correlated with sequence conservation as well as protein-protein interactivity.

  17. Duplicate origin of the posterior communicating artery diagnosed by magnetic resonance angiography.

    Science.gov (United States)

    Uchino, Akira; Kamiya, Kouhei; Suzuki, Chihiro

    2013-10-01

    Extremely rarely, a posterior communicating artery (PCoA) of "duplicate origin" occurs when two branches of the PCoA arise separately from the supraclinoid segment of the internal carotid artery (ICA) and quickly fuse to form an arterial ring. Three such cases previously reported were described as "fenestration." We report the case of this rare variation diagnosed by magnetic resonance angiography and discuss the differentiation of PCoA of duplicate origin from PCoA fenestration, supraclinoid ICA fenestration, and hyperplastic anterior choroidal artery.

  18. Tandem accelerators, 1973--1974

    International Nuclear Information System (INIS)

    Howard, F.T.

    1974-01-01

    High voltage tandem accelerators are very important instruments in the field of nuclear physics research, especially in the acceleration of heavy ions. This survey identifies 77 tandems installed in 21 countries; of these, 34 are in the United States. Most installations have supplied data sheets identifying their machines and briefly characterizing their research programs. (U.S.)

  19. MHD stability of tandem mirrors

    International Nuclear Information System (INIS)

    Poulsen, P.; Molvik, A.; Shearer, J.

    1982-01-01

    The TMX-Upgrade experiment was described, and the manner in which various plasma parameters could be affected was discussed. The initial analysis of the MHD stability of the tandem mirror was also discussed, with emphasis on the negative tandem configuration

  20. Tandems as injectors for synchrotrons

    International Nuclear Information System (INIS)

    Ruggiero, A.G.

    1993-01-01

    This is a review on the use of tandem electrostatic accelerators for injection and fitting of synchrotrons to accelerate intense beams of heavy ions to relativistic energies. The paper emphasizes the need of operating the tandems in pulsed mode for this application. It has been experimentally demonstrated that at present this type of accelerator still provides the most reliable and best performance. (orig.)

  1. JAERI tandem-accelerator and tandem-booster

    Energy Technology Data Exchange (ETDEWEB)

    Yoshida, Tadashi [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    1998-03-01

    In 1982, aiming at the new development of atomic energy research, the tandem accelerator of Japan Atomic Energy Research Institute (JAERI) was installed. In fiscal year 1993, the superconducting boosters which can increase the ion energy by up to 4 times were added, and the research in the region below 1000 MeV became possible. Those are electrostatic type accelerators which are easy to be used especially in basic research field, and are useful for future research. The tandem accelerator has been operated while maintaining the first class performance as the accelerator for various kinds of heavy ion beam. It has the special shape among electrostatic type accelerators, and is excellent in the easiness of control and stability. The main particulars of the tandem accelerator are shown. As for the ion sources of the tandem accelerator, three cesium sputter type ion sources are installed on two high voltage stands. The kinds of the ions which can be accelerated are mainly negative ions. As the improvement, electron cyclotron resonance (ECR) ion sources are expected to be adopted. As for the tandem boosters, the 1/4 wavelength type resonance hollow cylinder was adopted. The constitution of the tandem boosters is explained. The way of utilizing the tandem accelerator system and the aim for hereafter are reported. (K.I.)

  2. Laparoscopic excision of a newborn rectal duplication cyst.

    Science.gov (United States)

    Hartin, Charles W; Lau, Stanley T; Escobar, Mauricio A; Glick, Philip L

    2008-08-01

    Congenital rectal duplication cyst is a rare entity treated with surgical excision. Without treatment, a rectal duplication cyst may cause a variety of complications, most notably, transforming into a malignancy. We report on a 7-week-old girl who was found to have a rectal duplication cyst. The rectal duplication cyst was successfully excised laparoscopically. Rectal duplication cysts are rare alimentary tract anomalies generally discovered during childhood. Complications include symptoms arising from the cyst and the possibility of malignant degeneration. They are typically managed by surgical excision.

  3. Surgical management of complete penile duplication accompanied by multiple anomalies.

    Science.gov (United States)

    Karaca, Irfan; Turk, Erdal; Ucan, A Basak; Yayla, Derya; Itirli, Gulcin; Ercal, Derya

    2014-09-01

    Diphallus (penile duplication) is very rare and seen once every 5.5 million births. It can be isolated, but is usually accompanied by other congenital anomalies. Previous studies have reported many concurrent anomalies, such as bladder extrophy, cloacal extrophy, duplicated bladder, scrotal abnormalities, hypospadias, separated symphysis pubis, intestinal anomalies and imperforate anus; no penile duplication case accompanied by omphalocele has been reported. We present the surgical management of a patient with multiple anomalies, including complete penile duplication, hypo-gastric omphalocele and extrophic rectal duplication.

  4. Perforated ileal duplication cyst with haemorrhagic pseudocyst formation

    International Nuclear Information System (INIS)

    Hwang, Im Kyung; Kim, Bong Soo; Kim, Heung Chul; Lee, In Sun; Hwang, Woo Chul; Namkung, Sook

    2003-01-01

    Duplication cysts of the gastrointestinal tract are rare congenital abnormalities. Ectopic gastric mucosa, which can be found in duplications, may cause peptic ulceration, gastrointestinal bleeding or perforation. We report a 1-year-old boy with a perforated ileal duplication cyst with haemorrhagic pseudocyst formation caused by peptic ulceration of the duplication cyst. It presented a snowman-like appearance consisting of a small, thick-walled, true enteric cyst and a large, thin-walled haemorrhagic pseudocyst on US and CT. It is an unusual manifestation of a duplication cyst, which has not been reported in the English language literature. (orig.)

  5. The odds of duplicate gene persistence after polyploidization

    Directory of Open Access Journals (Sweden)

    Chain Frédéric JJ

    2011-12-01

    Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.

  6. SANCTIONING DUPLICATION IN ADMINISTRATIVE AND PENAL AREAS

    Directory of Open Access Journals (Sweden)

    José Manuel Cabrera Delgado

    2014-12-01

    Full Text Available This article provides a first approach from the point of view of jurisprudence, to the recurring problem of concurrency sanctions in cases where further intervention of the courts has become necessary for administrative action. In this regard, the main judgments of both the Constitutional Court and the Supreme Court is, that have shaped the decisions that must be applied from the administrative level, in particular by educational inspectors, when it is foreseeable that it can produce a duplication of disciplinary procedures in the two areas, penal and administrative.

  7. Rectal duplication presenting as colonic subocclusion.

    Science.gov (United States)

    Vuilleumier, H; Maternini, M

    2006-04-01

    Rectal duplication cyst is a rare congenital lesion which is known to be associated with other congenital defects, especially genitourinary and vertebral anomalies. Infections with fistulization, bleeding, and malignant degeneration are the major complications of developmental cysts. The case of an 83-year-old woman referred for acute constipation associated with abdominal distension is reported. CT and MRI showed a large cystic mass of the pelvis with extrinsic compression of the rectum. Surgical excision would have been the treatment of choice. In this case, the patient was unfortunately not eligible for surgery due to her poor general condition but responded well to conservative treatment.

  8. Duplication of the pituitary gland - plus syndrome

    Directory of Open Access Journals (Sweden)

    Debraj Sen

    2016-01-01

    Full Text Available Duplication of the pituitary gland (DPG is a very rare developmental anomaly that is often associated with other anomalies - the DPG-plus syndrome and occurs due to splitting of the rostral notochord and prechordal plate during blastogenesis. DPG with the constellation of associated anomalies as in our patient has not been reported previously. This article illustrates the importance of imaging the brain in all patients with obvious midline facial anomalies and the complementary role of MRI and CT in such cases.

  9. A 12.3-kb Duplication Within the VWF Gene in Pigs Affected by Von Willebrand Disease Type 3

    Directory of Open Access Journals (Sweden)

    Stefanie Lehner

    2018-02-01

    Full Text Available Von Willebrand Disease (VWD type 3 is a serious and sometimes fatal hereditary bleeding disorder. In pigs, the disease has been known for decades, and affected animals are used as models for the human disease. Due to the recessive mode of inheritance of VWD type 3, severe bleeding is typically seen in homozygous individuals. We sequenced the complete porcine VWF (Von Willebrand Factor complementary DNA (cDNA and detected a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3 in the affected pig. Subsequent next generation sequencing on genomic DNA proved the existence of a 12.3-kb tandem duplication associated with VWD. This duplication putatively originates from porcine Short Interspersed Nuclear Elements (SINEs located within VWF introns 16 and 18 with high identity. The premature termination truncates the VWF open reading frame by a large part, resulting in an almost entire loss of the mature peptide. It is therefore supposed to account for the severe VWD type 3. Our results further indicate the presence of strong, nonsense-mediated decay in VWF messenger RNA (mRNA containing the duplication, which was supported by the almost complete absence of the complete VWF protein in immunohistochemistry analysis of the VWD-affected pig. In the past, differentiation of wild-type and heterozygous pigs in this VWD colony had to rely on clinical examinations and additional laboratory methods. The present study provides the basis to distinguish both genotypes by performing a rapid and simple genetic analysis.

  10. Duplicated Enhancer Region Increases Expression of CTSB and Segregates with Keratolytic Winter Erythema in South African and Norwegian Families.

    Science.gov (United States)

    Ngcungcu, Thandiswa; Oti, Martin; Sitek, Jan C; Haukanes, Bjørn I; Linghu, Bolan; Bruccoleri, Robert; Stokowy, Tomasz; Oakeley, Edward J; Yang, Fan; Zhu, Jiang; Sultan, Marc; Schalkwijk, Joost; van Vlijmen-Willems, Ivonne M J J; von der Lippe, Charlotte; Brunner, Han G; Ersland, Kari M; Grayson, Wayne; Buechmann-Moller, Stine; Sundnes, Olav; Nirmala, Nanguneri; Morgan, Thomas M; van Bokhoven, Hans; Steen, Vidar M; Hull, Peter R; Szustakowski, Joseph; Staedtler, Frank; Zhou, Huiqing; Fiskerstrand, Torunn; Ramsay, Michele

    2017-05-04

    Keratolytic winter erythema (KWE) is a rare autosomal-dominant skin disorder characterized by recurrent episodes of palmoplantar erythema and epidermal peeling. KWE was previously mapped to 8p23.1-p22 (KWE critical region) in South African families. Using targeted resequencing of the KWE critical region in five South African families and SNP array and whole-genome sequencing in two Norwegian families, we identified two overlapping tandem duplications of 7.67 kb (South Africans) and 15.93 kb (Norwegians). The duplications segregated with the disease and were located upstream of CTSB, a gene encoding cathepsin B, a cysteine protease involved in keratinocyte homeostasis. Included in the 2.62 kb overlapping region of these duplications is an enhancer element that is active in epidermal keratinocytes. The activity of this enhancer correlated with CTSB expression in normal differentiating keratinocytes and other cell lines, but not with FDFT1 or NEIL2 expression. Gene expression (qPCR) analysis and immunohistochemistry of the palmar epidermis demonstrated significantly increased expression of CTSB, as well as stronger staining of cathepsin B in the stratum granulosum of affected individuals than in that of control individuals. Analysis of higher-order chromatin structure data and RNA polymerase II ChIA-PET data from MCF-7 cells did not suggest remote effects of the enhancer. In conclusion, KWE in South African and Norwegian families is caused by tandem duplications in a non-coding genomic region containing an active enhancer element for CTSB, resulting in upregulation of this gene in affected individuals. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  11. Functional diversification upon leader protease domain duplication in the Citrus tristeza virus genome: Role of RNA sequences and the encoded proteins.

    Science.gov (United States)

    Kang, Sung-Hwan; Atallah, Osama O; Sun, Yong-Duo; Folimonova, Svetlana Y

    2018-01-15

    Viruses from the family Closteroviridae show an example of intra-genome duplications of more than one gene. In addition to the hallmark coat protein gene duplication, several members possess a tandem duplication of papain-like leader proteases. In this study, we demonstrate that domains encoding the L1 and L2 proteases in the Citrus tristeza virus genome underwent a significant functional divergence at the RNA and protein levels. We show that the L1 protease is crucial for viral accumulation and establishment of initial infection, whereas its coding region is vital for virus transport. On the other hand, the second protease is indispensable for virus infection of its natural citrus host, suggesting that L2 has evolved an important adaptive function that mediates virus interaction with the woody host. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Tandem Van de Graaff facility

    Data.gov (United States)

    Federal Laboratory Consortium — Completed in 1970, the Tandem Van de Graaff facility was for many years the world's largest electrostatic accelerator facility. It can provide researchers with beams...

  13. Potential measurements in tandem mirrors

    International Nuclear Information System (INIS)

    Glowienka, J.C.

    1985-11-01

    The US mirror program has begun conducting experiments with a thermal barrier tandem mirror configuration. This configuration requires a specific axial potential profile and implies measurements of potential for documentation and optimization of the configuration. This report briefly outlines the motivation for the thermal barrier tandem mirror and then outlines the techniques used to document the potential profile in conventional and thermal barrier tandem mirrors. Examples of typical data sets from the world's major tandem mirror experiments, TMX and TMX-U at Lawrence Livermore National Laboratory (LLNL) and Gamma 10 at Tsukuba University in Japan, and the current interpretation of the data are discussed together with plans for the future improvement of measurements of plasma potential

  14. Superconducting linacs used with tandems

    International Nuclear Information System (INIS)

    Ben-Zvi, I.

    1984-01-01

    The main features of superconducting linacs used as post-accelerators of tandems are reviewed. Various aspects of resonators, cryogenics and electronics are discussed, and recent advances in the field are presented. (orig.)

  15. Dealing with duplicate regulations and conflicting jurisdictions

    International Nuclear Information System (INIS)

    Aamodt, P.L.

    1991-01-01

    There are a number of situations where mixed wastes are regulated by dual regulations and regulators. This presentation attempts to show where such duplication exists and how it evolved historically through legislative actions. The presentation includes a discussion of strategies that have been used to deal with the problems that result from duplicate regulations and jurisdictional conflicts. The RCRA and AEA regulations are really more similar than dissimilar. There are significant issues that must be worked through with the regulators. It is most important to work with your regulators early in process. The following are suggestions for dealing with the regulators. (1) Know the regulations in advance of discussions. (2) Begin dialogue with the regulator(s) as early as possible and get to know the people you will be dealing with -- and let them know you. (3) Explain the technical/regulatory issues/problems that you face at your facility in sufficient detail that they are clearly understood, and work with the regulator(s) to reasonably address them in the language/requirements of the permit. (4) Always attempt to comply with the regulations first before going in with a variance request -- document your efforts, and be honest with your assessment of issues. (5) Don't be adversarial -- remember that the regulator has the same objectives as you do. 1 tab

  16. Chromosome duplication in Lolium multiflorum Lam.

    Directory of Open Access Journals (Sweden)

    Roselaine Cristina Pereira

    2014-11-01

    Full Text Available Artificial chromosome duplication of diploid genotypes of Lolium multiflorum (2n=2x=14 is worthy to breeding, and aims to increase the expression of traits with agronomic interest. The purpose of this study was to obtain polyploid plants of L. multiflorum from local diploid populations in order to exploit adaptation and future verification of the effects of polyploidy in agronomic traits. Seedlings were immersed in different colchicine solutions for an exposure time of 3h and 24h. Ploidy determination was made by the DNA content and certified by chromosomes counts. The plants confirmed as tetraploids were placed in a greenhouse, and, at flowering, pollen viability was evaluated, and seeds were harvested to assess the stability of the progenies. The percentage of polyploids obtained was 20%. Pollen viability of the tetraploids generated ranged from 58% to 69%. The tetraploid plants obtained in the experiment generated 164 progenies, of which 109 presented DNA content compatible with the tetraploid level, showing stability of chromosome duplication in the filial generation.

  17. Concomitant urethral triplication, bladder, and colon duplication.

    Science.gov (United States)

    Tourchi, Ali; Kajbafzadeh, Abdol-Mohammad; Khakpour, Mahshid; Mohammadi Nejad, Payam; Mousavian, Amir-Abbas; Kalantary, Mahdi

    2012-02-01

    The concomitant presence of urethral triplication and caudal duplication is extremely rare with no previous reported cases. We report a case of urethral triplication associated with bladder, sigmoid, and rectum duplication. The patient was initially referred with a history of fecaluria and recurrent urinary tract infection. Physical examination revealed 2 meatal opening on the glans penis. Further investigation revealed three distinct urinary streams, two terminating on the glans penis, and one in the rectum in voiding cystourethrography and retrograde urethrography. Computed tomography demonstrated the bladder divided into two compartments by a complete sagittal septum. The patient was managed by the excision of the rectal ending urethra and removal of the bladder sagittal septum during which, two sigmoidal and rectal segments (the right one filled with fecal) were revealed. The right sigmoid and rectum was resected. The two ventral urethras were kept intact. The postoperative course was uneventful. At his 4 month readmission for colostomy closure, the patient reported good urethral voiding with no complication and recurrence of urinary tract infection and the colostomy was closed with no major complication.

  18. Tandem Terminal Ion Source

    International Nuclear Information System (INIS)

    Harper, G.C.; Lindner, C.E.; Myers, A.W.; Wechel, T.D. van

    2000-01-01

    OAK-B135 Tandem Terminal Ion Source. The terminal ion source (TIS) was used in several experiments during this reporting period, all for the 7 Be(γ) 8 B experiment. Most of the runs used 1 H + at terminal voltages from 0.3 MV to 1.5 MV. One of the runs used 2 H + at terminal voltage of 1.4 MV. The other run used 4 He + at a terminal voltage of 1.37 MV. The list of experiments run with the TIS to date is given in table 1 below. The tank was opened four times for unscheduled source repairs. On one occasion the tank was opened to replace the einzel lens power supply which had failed. The 10 kV unit was replaced with a 15 kV unit. The second time the tank was opened to repair the extractor supply which was damaged by a tank spark. On the next occasion the tank was opened to replace a source canal which had sputtered away. Finally, the tank was opened to replace the discharge bottle which had been coated with aluminum sputtered from the exit canal

  19. Tandem Terminal Ion Source

    International Nuclear Information System (INIS)

    None

    2000-01-01

    OAK-B135 Tandem Terminal Ion Source. The terminal ion source (TIS) was used in several experiments during this reporting period, all for the(sup 7)Be((gamma))(sup 8)B experiment. Most of the runs used(sup 1)H(sup+) at terminal voltages from 0.3 MV to 1.5 MV. One of the runs used(sup 2)H(sup+) at terminal voltage of 1.4 MV. The other run used(sup 4)He(sup+) at a terminal voltage of 1.37 MV. The list of experiments run with the TIS to date is given in table 1 below. The tank was opened four times for unscheduled source repairs. On one occasion the tank was opened to replace the einzel lens power supply which had failed. The 10 kV unit was replaced with a 15 kV unit. The second time the tank was opened to repair the extractor supply which was damaged by a tank spark. On the next occasion the tank was opened to replace a source canal which had sputtered away. Finally, the tank was opened to replace the discharge bottle which had been coated with aluminum sputtered from the exit canal

  20. Cholecystitis of a duplicated gallbladder complicated by a cholecystoenteric fistula

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Brady K. [University of Rochester Medical Center, Department of Imaging Sciences, Rochester, NY (United States); Chess, Mitchell A. [University of Rochester Medical Center, Department of Imaging Sciences, Rochester, NY (United States); Advanced Imaging, Batavia, NY (United States)

    2009-04-15

    Gallbladder duplications are uncommon anatomic variants that are sometimes mistaken for other entities on imaging. We present a surgically confirmed case of cholecystitis in a ductular-type duplicated gallbladder complicated by the formation of an inflammatory fistula to the adjacent duodenum. Both US and magnetic resonance cholangiopancreatography were performed preoperatively, in addition to intraoperative cholangiography, which confirmed the presence of a duplicated gallbladder. (orig.)

  1. Spinal Accessory Nerve Duplication: A Case Report and Literature Review

    OpenAIRE

    Papagianni, Eleni; Kosmidou, Panagiota; Fergadaki, Sotiria; Pallantzas, Athanasios; Skandalakis, Panagiotis; Filippou, Dimitrios

    2018-01-01

    Aim of the present study is to expand our knowledge of the anatomy of the 11th cranial nerve and discuss the clinical importance and literature pertaining to accessory nerve duplication. We present one case of duplicated spinal accessory nerve in a patient undergoing neck dissection for oral cavity cancer. The literature review confirms the extremely rare diagnosis of a duplicated accessory nerve. Its clinical implication is of great importance. From this finding, a further extension to our k...

  2. Duplication of the Portal Vein: A Case Report

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sang Won; Shin, Hyeong Cheol; Jou, Sung Shick; Han, Jong Kyu; Kim, Il Young [Soonchunhyang University Cheonan Hospital, Cheonan (Korea, Republic of)

    2009-12-15

    The duplication of the portal vein is an uncommon congenital anomaly. To date, only four cases have been reported in the medical literature. This anomaly can cause portal hypertension in pediatric patients. In addition, duplication of the portal vein has various patterns of connection with a splenic vein or mesenteric veins, and it can lie anterior or posterior to the duodenum. We report the MDCT findings of an adult patient with duplication of the portal vein that was found incidentally

  3. Long segment ileal duplication with extensive gastric heterotopia

    Directory of Open Access Journals (Sweden)

    Jacob Sunitha

    2009-07-01

    Full Text Available Duplications of the alimentary tract are rare congenital anomalies which can be found at all levels of the alimentary tract. Majority of the duplications present as spherical cysts and usually range from a few millimeters to less than ten centimeters in size. Duplications produce complications such as intestinal obstruction or hemorrhage. A two-month-old infant presented with recurrent episodes of bleeding per rectum. Laparotomy revealed a giant ileal duplicated bowel segment which exhibited extensive gastric heterotopia with focal ulceration.

  4. Functional requirements driving the gene duplication in 12 Drosophila species.

    Science.gov (United States)

    Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui

    2013-08-15

    Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.

  5. Chromosomal duplication strains of Aspergillus nidulans and their instability

    International Nuclear Information System (INIS)

    Azevedo, J.L. de; Almeida Okino, L.M. de

    1981-01-01

    Strains of Aspergillus nidulans with chromosomal duplication were obtained after gamma irradiation followed by crossing of the translocated strains with normal strains. From 20 analysed colonies, 12 have shown translocations induced by irradiation. Segregants from four of these translocation strains crossed to normal strains have shown to be unstable although presenting normal morphology. Two segregants were genetically analysed. The first one has shown a duplication of part of linkage groups VIII and the second one presented a duplication of a segment of linkage group V. These new duplication strains in A. nidulans open new perspectives of a more detailed study of the instability phenomenon in this fungus. (Author) [pt

  6. Duodenal duplication cyst extending into the posterior mediastinum

    Directory of Open Access Journals (Sweden)

    Tuzun Sefa

    2015-01-01

    Conclusion: Duodenal and the other intestinal duplication cysts should be considered in the differential diagnosis of oral contrast enhanced intrathoracic lesions in thorocoabdominal computerised tomography imaging.

  7. The Centrosome and Its Duplication Cycle

    Science.gov (United States)

    Fu, Jingyan; Hagan, Iain M.; Glover, David M.

    2015-01-01

    The centrosome was discovered in the late 19th century when mitosis was first described. Long recognized as a key organelle of the spindle pole, its core component, the centriole, was realized more than 50 or so years later also to comprise the basal body of the cilium. Here, we chart the more recent acquisition of a molecular understanding of centrosome structure and function. The strategies for gaining such knowledge were quickly developed in the yeasts to decipher the structure and function of their distinctive spindle pole bodies. Only within the past decade have studies with model eukaryotes and cultured cells brought a similar degree of sophistication to our understanding of the centrosome duplication cycle and the multiple roles of this organelle and its component parts in cell division and signaling. Now as we begin to understand these functions in the context of development, the way is being opened up for studies of the roles of centrosomes in human disease. PMID:25646378

  8. Duplication of an upstream silencer of FZP increases grain yield in rice.

    Science.gov (United States)

    Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong

    2017-11-01

    Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.

  9. Sorting cancer karyotypes using double-cut-and-joins, duplications and deletions.

    Science.gov (United States)

    Zeira, Ron; Shamir, Ron

    2018-05-03

    Problems of genome rearrangement are central in both evolution and cancer research. Most genome rearrangement models assume that the genome contains a single copy of each gene and the only changes in the genome are structural, i.e., reordering of segments. In contrast, tumor genomes also undergo numerical changes such as deletions and duplications, and thus the number of copies of genes varies. Dealing with unequal gene content is a very challenging task, addressed by few algorithms to date. More realistic models are needed to help trace genome evolution during tumorigenesis. Here we present a model for the evolution of genomes with multiple gene copies using the operation types double-cut-and-joins, duplications and deletions. The events supported by the model are reversals, translocations, tandem duplications, segmental deletions, and chromosomal amplifications and deletions, covering most types of structural and numerical changes observed in tumor samples. Our goal is to find a series of operations of minimum length that transform one karyotype into the other. We show that the problem is NP-hard and give an integer linear programming formulation that solves the problem exactly under some mild assumptions. We test our method on simulated genomes and on ovarian cancer genomes. Our study advances the state of the art in two ways: It allows a broader set of operations than extant models, thus being more realistic, and it is the first study attempting to reconstruct the full sequence of structural and numerical events during cancer evolution. Code and data are available in https://github.com/Shamir-Lab/Sorting-Cancer-Karyotypes. ronzeira@post.tau.ac.il, rshamir@tau.ac.il. Supplementary data are available at Bioinformatics online.

  10. Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.

    Directory of Open Access Journals (Sweden)

    Nemanja Vukašinović

    Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.

  11. Optochemokine Tandem for Light-Control of Intracellular Ca2.

    Directory of Open Access Journals (Sweden)

    Katrin Feldbauer

    Full Text Available An optochemokine tandem was developed to control the release of calcium from endosomes into the cytosol by light and to analyze the internalization kinetics of G-protein coupled receptors (GPCRs by electrophysiology. A previously constructed rhodopsin tandem was re-engineered to combine the light-gated Ca2+-permeable cation channel Channelrhodopsin-2(L132C, CatCh, with the chemokine receptor CXCR4 in a functional tandem protein tCXCR4/CatCh. The GPCR was used as a shuttle protein to displace CatCh from the plasma membrane into intracellular areas. As shown by patch-clamp measurements and confocal laser scanning microscopy, heterologously expressed tCXCR4/CatCh was internalized via the endocytic SDF1/CXCR4 signaling pathway. The kinetics of internalization could be followed electrophysiologically via the amplitude of the CatCh signal. The light-induced release of Ca2+ by tandem endosomes into the cytosol via CatCh was visualized using the Ca2+-sensitive dyes rhod2 and rhod2-AM showing an increase of intracellular Ca2+ in response to light.

  12. Cis-acting mutation and duplication: History of molecular evolution in a P450 haplotype responsible for insecticide resistance in Culex quinquefasciatus.

    Science.gov (United States)

    Itokawa, Kentaro; Komagata, Osamu; Kasai, Shinji; Masada, Masahiro; Tomita, Takashi

    2011-07-01

    A cytochrome P450 gene, Cyp9m10, is more than 200-fold overexpressed in a pyrethroid resistant strain of Culex quinquefasciatus, JPal-per. The haplotype of this strain contains two copies of Cyp9m10 resulted from recent tandem duplication. In this study, we discovered and isolated a Cyp9m10 haplotype closely related to this duplicated Cyp9m10 haplotype from JHB, a strain used for the recent genome project for this mosquito species. The isolated haplotype (JHB-NIID-B haplotype) shared the same insertion of a transposable element upstream of the coding region with JPal-per strain but not duplicated. The JHB-NIID-B haplotype was considered to have diverged from the JPal-per lineage just before the duplication event. Cyp9m10 was moderately overexpressed in larvae with the JHB-NIID-B haplotype. The overexpressions in JHB-NIID-B and JPal-per haplotypes were developmentally regulated in similar pattern indicating both haplotypes share a common cis-acting mutation responsible for the overexpressions. The isolated moderately overexpressed haplotype conferred resistance, however, its efficacy was relatively small. We hypothesized that the first cis-acting mutation modified the consequence of the subsequent duplication in JPal-per lineage to confer stronger phenotypic effect than that if it occurred before the first cis-acting mutation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  13. JAERI 20 MV tandem accelerator

    International Nuclear Information System (INIS)

    Tsukada, Kineo; Harada, Kichinosuke

    1977-01-01

    Accelerators have been developed as the experimental apparatuses for the studies on nuclei and elementary particles. One direction of the development is the acceleration of protons and electrons to more and more high energy, and another direction is the acceleration of heavy ions up to uranium to several MeV up to several hundreds MeV. However recently, accelerators are used as the useful tools for the studies in wider fields. There are electrostatic acceleration and high frequency acceleration in ion acceleration, and at present, super-large accelerators are high frequency acceleration type. In Japan Atomic Energy Research Institute, it was decided in 1975 to construct an electrostatic accelerator of tandem type in order to accelerate heavy ions. In case of the electrostatic acceleration, the construction is relatively simple, the acceleration of heavy ions is easy, the property of the ion beam is very good, and the energy is stable. Especially, the tandem type is convenient for obtaining high energy. The tandem accelerator of 20 MV terminal voltage was ordered from the National Electrostatics Corp., USA, and is expected to be completed in 1978. The significance of heavy ion acceleration in the development and research of atomic energy, tandem van de Graaff accelerators, the JAERI 20MV tandem accelerator, and the research project with this accelerator are described. (Kako, I.)

  14. Conjoined twin piglets with duplicated cranial and caudal axes.

    Science.gov (United States)

    McManus, C A; Partlow, G D; Fisher, K R

    1994-06-01

    Twins with doubling of the cranial and caudal poles, yet having a single thorax, are rare. One set of diprosopus, dipygus porcine conjoined twins was studied. In addition to the conjoining anomaly, these twins also exhibited ambiguous internal reproductive features. The twins had two snouts, three eyes, a single thorax, and were duplicated from the umbilicus caudally. Radiography indicated a single vertebral column in the cervical region. The vertebral columns were separate caudally from this point. There was a total of six limbs--one pair of forelimbs and two pairs of hindlimbs. Many medial structures failed to develop in these twins. Medial cranial nerves V-XII were absent or displaced although apparently normal laterally. The medial palates were present but shortened, whereas the medial mandibular rami had folded back on themselves rostrally to form a midline mass between the two chins. Each twin had only one lateral kidney and one lateral testis. Medial scrotal sacs were present but devoid of a testis. There was a midline, "uterine"-like structure which crossed between the twins. However, histological analysis of this structure revealed it to be dysplastic testicular tissue. The relationship between the abnormal reproductive features in these twins and the conjoining is unclear. The anatomy of these twins, in addition to the literature reviewed, illustrates the internal anatomical heterogeneity of grossly similar conjoined twins. A review of the literature also suggests that conjoined twinning may be more common in swine than was previously suspected.

  15. Defining the Effect of the 16p11.2 Duplication on Cognition, Behavior, and Medical Comorbidities

    Science.gov (United States)

    D’Angelo, Debra; Lebon, Sébastien; Chen, Qixuan; Martin-Brevet, Sandra; Snyder, LeeAnne Green; Hippolyte, Loyse; Hanson, Ellen; Maillard, Anne M.; Faucett, W. Andrew; Macé, Aurélien; Pain, Aurélie; Bernier, Raphael; Chawner, Samuel J. R. A.; David, Albert; Andrieux, Joris; Aylward, Elizabeth; Baujat, Genevieve; Caldeira, Ines; Conus, Philippe; Ferrari, Carrina; Forzano, Francesca; Gérard, Marion; Goin-Kochel, Robin P.; Grant, Ellen; Hunter, Jill V.; Isidor, Bertrand; Jacquette, Aurélia; Jønch, Aia E.; Keren, Boris; Lacombe, Didier; Caignec, Cédric Le; Martin, Christa Lese; Männik, Katrin; Metspalu, Andres; Mignot, Cyril; Mukherjee, Pratik; Owen, Michael J.; Passeggeri, Marzia; Rooryck-Thambo, Caroline; Rosenfeld, Jill A.; Spence, Sarah J.; Steinman, Kyle J.; Tjernagel, Jennifer; Van Haelst, Mieke; Shen, Yiping; Draganski, Bogdan; Sherr, Elliott H.; Ledbetter, David H.; van den Bree, Marianne B. M.; Beckmann, Jacques S.; Spiro, John E.; Reymond, Alexandre; Jacquemont, Sébastien; Chung, Wendy K.

    2018-01-01

    IMPORTANCE The 16p11.2 BP4-BP5 duplication is the copy number variant most frequently associated with autism spectrum disorder (ASD), schizophrenia, and comorbidities such as decreased body mass index (BMI). OBJECTIVES To characterize the effects of the 16p11.2 duplication on cognitive, behavioral, medical, and anthropometric traits and to understand the specificity of these effects by systematically comparing results in duplication carriers and reciprocal deletion carriers, who are also at risk for ASD. DESIGN, SETTING, AND PARTICIPANTS This international cohort study of 1006 study participants compared 270 duplication carriers with their 102 intrafamilial control individuals, 390 reciprocal deletion carriers, and 244 deletion controls from European and North American cohorts. Data were collected from August 1, 2010, to May 31, 2015 and analyzed from January 1 to August 14, 2015. Linear mixed models were used to estimate the effect of the duplication and deletion on clinical traits by comparison with noncarrier relatives. MAIN OUTCOMES AND MEASURES Findings on the Full-Scale IQ (FSIQ), Nonverbal IQ, and Verbal IQ; the presence of ASD or other DSM-IV diagnoses; BMI; head circumference; and medical data. RESULTS Among the 1006 study participants, the duplication was associated with a mean FSIQ score that was lower by 26.3 points between proband carriers and noncarrier relatives and a lower mean FSIQ score (16.2-11.4 points) in nonproband carriers. The mean overall effect of the deletion was similar (−22.1 points; P 100) compared with the deletion group (P < .001). Parental FSIQ predicted part of this variation (approximately 36.0% in hereditary probands). Although the frequency of ASD was similar in deletion and duplication proband carriers (16.0% and 20.0%, respectively), the FSIQ was significantly lower (by 26.3 points) in the duplication probands with ASD. There also were lower head circumference and BMI measurements among duplication carriers, which is

  16. First Worldwide Proficiency Study on Variable-Number Tandem-Repeat Typing of Mycobacterium tuberculosis Complex Strains

    Science.gov (United States)

    de Beer, Jessica L.; Kremer, Kristin; Ködmön, Csaba; Supply, Philip

    2012-01-01

    Although variable-number tandem-repeat (VNTR) typing has gained recognition as the new standard for the DNA fingerprinting of Mycobacterium tuberculosis complex (MTBC) isolates, external quality control programs have not yet been developed. Therefore, we organized the first multicenter proficiency study on 24-locus VNTR typing. Sets of 30 DNAs of MTBC strains, including 10 duplicate DNA samples, were distributed among 37 participating laboratories in 30 different countries worldwide. Twenty-four laboratories used an in-house-adapted method with fragment sizing by gel electrophoresis or an automated DNA analyzer, nine laboratories used a commercially available kit, and four laboratories used other methods. The intra- and interlaboratory reproducibilities of VNTR typing varied from 0% to 100%, with averages of 72% and 60%, respectively. Twenty of the 37 laboratories failed to amplify particular VNTR loci; if these missing results were ignored, the number of laboratories with 100% interlaboratory reproducibility increased from 1 to 5. The average interlaboratory reproducibility of VNTR typing using a commercial kit was better (88%) than that of in-house-adapted methods using a DNA analyzer (70%) or gel electrophoresis (50%). Eleven laboratories using in-house-adapted manual typing or automated typing scored inter- and intralaboratory reproducibilities of 80% or higher, which suggests that these approaches can be used in a reliable way. In conclusion, this first multicenter study has documented the worldwide quality of VNTR typing of MTBC strains and highlights the importance of international quality control to improve genotyping in the future. PMID:22170917

  17. Dynamic Delayed Duplicate Detection for External Memory Model Checking

    DEFF Research Database (Denmark)

    Evangelista, Sami

    2008-01-01

    Duplicate detection is an expensive operation of disk-based model checkers. It consists of comparing some potentially new states, the candidate states, to previous visited states. We propose a new approach to this technique called dynamic delayed duplicate detection. This one exploits some typical...

  18. Double-blind ureteral duplication: report of two cases

    International Nuclear Information System (INIS)

    Choi, Ja-Young; Kim, Seung Hyup; Kim, Sun Ho

    2002-01-01

    Blind ending of ureteral duplication is one of the most rare anomalies of the upper urinary tract. We report two cases of ureteral duplication with a blind ending both superiorly and inferiorly, and with no definite communication with the urinary tract. (orig.)

  19. Female Urethral Duplication: Rare Anomaly with Unusual Presentation

    African Journals Online (AJOL)

    UD is classified according to plane (frontal or sagittal) of duplication into different types: (1) Double urethra and double bladder, (2) double urethra with single bladder,. (3) accessory urethra posterior to the normal channel,. (4) double proximal urethra and single distal urethra, and. (5) single proximal urethra and duplicated ...

  20. A rare case of congenital Y-type urethral duplication

    Directory of Open Access Journals (Sweden)

    Charu Tiwari

    2015-11-01

    Full Text Available Duplication of urethra is a rare congenital anomaly. We report a case of Y-type of urethral duplication with the accessory urethra arising from posterior urethra and opening in the perineum. The orthotopic urethra was normal. The accessory urethral tract was cored, transfixed and divided. At 1 year of follow-up, the patient has no urinary complaints

  1. 10 CFR 7.21 - Cost of duplication of documents.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Cost of duplication of documents. 7.21 Section 7.21 Energy NUCLEAR REGULATORY COMMISSION ADVISORY COMMITTEES § 7.21 Cost of duplication of documents. Copies of the records, reports, transcripts, minutes, appendices, working papers, drafts, studies, agenda, or other...

  2. Ruptured rectal duplication with urogenital abnormality: Unusual presentation

    Directory of Open Access Journals (Sweden)

    Shailesh Solanki

    2015-01-01

    Full Text Available Rectal duplication (RD accounts for 5% of alimentary tract duplication. A varied presentation and associated anomalies have been described in the literature. Antenatal rupture of the RD is very rare. We present an unusual case of a ruptured RD associated with urogenital abnormalities in newborn male. We are discussing diagnosis, embryology, management and literature review of ruptured RD.

  3. Rectal Duplication%直肠重复畸形

    Institute of Scientific and Technical Information of China (English)

    张道荣; 牟弦琴; 李振东; 李恭才; 王修忠; 代蕊霜

    1983-01-01

    @@ 我们两院近10年来共收治先天性直肠重复畸形17例(其中河北医学院11例,西安医学院6例).均经手术及病理证实.现总结如下:临床资料本组男性6例,女性11例,最小年龄4天,最大年龄14岁.%This paper reports 17 cases of rectal duplication. There were 6 males and 11rectal duplications were divided into three bordered by a common wall.9 patients in this series were found to have this condition.a rectovestitubular fistula.B.Pararectal duplication.The duplicated bowel lies near elliptical in shape and filled with fluid.In Complicated rectal duplication.The dupticated bowel is located at the perineum near the abnormal anus and is usually associated with hypospadia.Two cases were of this type.between the duplicated bowel and normal rectum must be partially resected at the distal end.The rectovestitubular fistula should be repaired at the same time.Pararectal duplication can be completely resected.resect the duplicated bowel from perineum but leave the genital anomaly for later treatment.

  4. Rectosigmoid tubular duplication presenting as perineal sepsis in a neonate.

    Science.gov (United States)

    Zhang, Zhibo; Huang, Ying; Wang, Dajia; Su, Pengjun

    2010-03-01

    Tubular rectal duplication is a very rare congenital anomaly. We report a case of tubular rectal duplication in a newborn baby who presented with perianal sepsis. The diagnosis was confirmed by barium enema, magnetic resonance imaging, and at operation. We performed total mucosectomy through a posterior sagittal incision combined with laparotomy. The patient was doing quite well at 17-month follow-up examination.

  5. Rectal duplication cyst: a combined abdominal and endoanal operative approach.

    Science.gov (United States)

    Rees, Clare M; Woodward, Mark; Grier, David; Cusick, Eleri

    2007-04-01

    Rectal duplication cysts are rare, comprising duplications. Early excision is the treatment of choice and a number of surgical approaches have been described. We present a 3-week-old infant with a 3 cm cyst that was excised using a previously unreported combined abdominal and endoanal approach.

  6. Ruptured rectal duplication with urogenital abnormality: Unusual presentation.

    Science.gov (United States)

    Solanki, Shailesh; Babu, M Narendra; Jadhav, Vinay; Shankar, Gowri; Santhanakrishnan, Ramesh

    2015-01-01

    Rectal duplication (RD) accounts for 5% of alimentary tract duplication. A varied presentation and associated anomalies have been described in the literature. Antenatal rupture of the RD is very rare. We present an unusual case of a ruptured RD associated with urogenital abnormalities in newborn male. We are discussing diagnosis, embryology, management and literature review of ruptured RD.

  7. Dynamic Delayed Duplicate Detection for External Memory Model Checking

    DEFF Research Database (Denmark)

    Evangelista, Sami

    2008-01-01

    Duplicate detection is an expensive operation of disk-based model checkers. It consists of comparing some potentially new states, the candidate states, to previous visited states. We propose a new approach to this technique called dynamic delayed duplicate detection. This one exploits some typica...... significantly better than some previously published algorithms....

  8. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.

    Directory of Open Access Journals (Sweden)

    Qingyu Chen

    Full Text Available First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases.We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  9. Hypospadiac Duplication of Anterior Urethra-a Rare Congenital Anomaly.

    Science.gov (United States)

    Goyal, Bhawana; Gupta, Suresh; Goyal, Parag

    2017-02-01

    Duplication of the urethra is a complex and rarely seen congenital anomaly with three anatomic variants: epispadiac (dorsal), hypospadiac (ventral), and Y-type. We report here a case of hypospadiac duplication of anterior urethra with dorsal blind ending urethra in a 9-year-old boy who presented with complaint of passing urine from the ventral aspect of penis.

  10. 40 CFR 25.13 - Coordination and non-duplication.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Coordination and non-duplication. 25.13 Section 25.13 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL PUBLIC PARTICIPATION IN... ACT § 25.13 Coordination and non-duplication. The public participation activities and materials that...

  11. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.

    Science.gov (United States)

    Chen, Qingyu; Zobel, Justin; Zhang, Xiuzhen; Verspoor, Karin

    2016-01-01

    First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases. We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  12. Introduction to tandem mirror physics

    International Nuclear Information System (INIS)

    Kesner, J.; Gerver, M.J.; Lane, B.G.; McVey, B.D.; Catto, P.J.; D'Ippolito, D.A.; Myra, J.R.

    1983-09-01

    This monograph, prepared jointly by the MIT Plasma Fusion Center Mirror Fusion group and SAI, Boulder, Colorado, presents a review of the development of mirror fusion theory from its conception some thirty years ago to the present. Pertinent historic experiments and their contribution are discussed to set the stage for a detailed analysis of current experiments and the problems which remain to be solved in bringing tandem mirror magnetic confinement fusion to fruition. In particular, Chapter III discusses in detail the equilibrium and stability questions which must be dealt with before tandem mirror reactors become feasible, while Chapters IV and V discuss some of the current machines and those under construction which will help to resolve critical issues in both physics and engineering whose solutions are necessary to the commercialization of tandem mirror fusion

  13. Complete cloacal duplication imaged before and during pregnancy.

    Science.gov (United States)

    Ragab, Omar; Landay, Melanie; Shriki, Jabi

    2009-01-01

    The authors describe a 31 year-old female who presented emergently with abdominal pain and was found at CT to have complete genitourinary duplication including separate urinary bladders, uteri, cervices, and vaginas, and also duplication of the rectum. No etiology for abdominal pain was identified. The patient was referred to urology for further evaluation, and an intravenous urographic study was obtained, which confirmed complete lower urinary tract duplication. The patient presented emergently 9 months later during a subsequent pregnancy for further evaluation of abdominal pain. A second CT scan was ordered to rule out appendicitis. Findings consistent with cloacal duplication were again noted. There was also dilatation of the urinary collecting systems, more prominently on the right side. A Cesarean section was performed and confirmed total genitourinary and rectal duplication.

  14. Rectal duplication cyst in adults treated with transanal endoscopic microsurgery.

    Science.gov (United States)

    Ben-Ishay, O; Person, B; Eran, B; Hershkovitz, D; Duek, D Simon

    2011-12-01

    Rectal duplication cyst is a rare entity that accounts for approximately 4% of all alimentary tract duplications. To the best of our knowledge, the presented cases are the first reports in the English literature of rectal duplication cyst resection by transanal endoscopic microsurgery. We present two patients; both are 41-year-old women with a palpable rectal mass. Workup revealed a submucosal posterior mass that was then resected by transanal endoscopic microsurgery. The pathology report described cystic lesions with squamous and columnar epithelium and segments of smooth muscle. These findings were compatible with rectal duplication cyst. Our limited experience showed good results with minimal morbidity and mortality for resection of rectal duplication cysts of limited size with no evidence of malignancy.

  15. Endoscopic ultrasonography and rectal duplication cyst in an adult.

    Science.gov (United States)

    Castro-Poças, Fernando M; Araújo, Tarcísio P; Silva, Jorge D; Gonçalves, Vicente S

    2017-01-01

    Rectal duplication cysts account for 4% of all duplications of the alimentary tract. Presentation in adulthood is rare. An asymptomatic 54-year-old man was referred for endoscopic colorectal cancer screening. A bulging mass covered by normal mucosa was identified in the rectum. Endoscopic ultrasonography (EUS) with fine needle aspiration (FNA) was made for a diagnosis of rectal duplication cyst. The patient was operated and the diagnosis was confirmed. The diagnosis of the rectal duplication cyst is a challenge. EUS may have a singular role when identifying a muscular layer, because this is the only absolutely necessary criterion for the diagnosis. FNA by EUS may eventually identify colorectal and/or heterotypic epithelium that are the other diagnostic criteria of the duplication cyst.

  16. Quantitative fluorescence-polymerase chain reaction assay for the detection of the duplication of the Charcot Marie Tooth disease type 1A critical region.

    Science.gov (United States)

    De Toffol, Simona; Bellone, Emilia; Dulcetti, Francesca; Ruggeri, Anna Maria; Maggio, Pietro Paolo; Pulimeno, Maria Rosaria; Mandich, Paola; Maggi, Federico; Simoni, Giuseppe; Grati, Francesca Romana

    2010-04-01

    Charcot Marie Tooth (CMT) syndrome is the most common hereditary peripheral neuropathy, with an incidence of about 1 in 2500. The subtype 1A (CMT1A) is caused by a tandem duplication of a 1.5-Mb region encompassing the PMP22 gene. Conventional short tandem repeat (STR) analysis can reveal this imbalance if a triallelic pattern, defining with certainty the presence of duplication, is present. In case of duplication with a biallelic pattern, it can only indicate a semiquantitative dosage of the fluorescence intensity ratio of the two fragments. In this study we developed a quantitative fluorescence-PCR using seven highly informative STRs within the CMT1A critical region that successfully disclosed or excluded the presence of the pathogenic imbalance in a cohort of 60 samples including 40 DNAs from samples with the CMT1A duplication previously characterized with two different molecular approaches, and 20 diagnostic samples from 10 members of a five-generation pedigree segregating CMT1A, 8 unrelated cases and 2 prenatal samples. The application of the quantitative fluorescence-PCR using STRs located in the critical region could be a reliable method to evaluate the presence of the PMP22 duplication for the diagnosis and classification of hereditary neuropathies in asymptomatic subjects with a family history of inherited neuropathy, in prenatal samples in cases with one affected parent, and in unrelated patients with a sporadic demyelinating neuropathy with clinical features resembling CMT (i.e., pes cavus with hammer toes) or with conduction velocities in the range of CMT1A.

  17. A Case of Duplicated Right Vertebral Artery.

    Science.gov (United States)

    Motomura, Mayuko; Watanabe, Koichi; Tabira, Yoko; Iwanaga, Joe; Matsuuchi, Wakako; Yoshida, Daichi; Saga, Tsuyoshi; Yamaki, Koh-Ichi

    2018-04-27

    We encountered a case of duplicated right vertebral artery during an anatomical dissection course for medical students in 2015. Two vertebral arteries were found in the right neck of a 91-year-old female cadaver. The proximal leg of the arteries arose from the area between the right subclavian artery and the right common carotid artery that diverged from the brachiocephalic artery. The distal leg arose from the right subclavian artery as expected. The proximal leg entered the transverse foramen of the fourth cervical vertebra and the distal leg entered the transverse foramen of the sixth cervical vertebra. The two right vertebral arteries joined to form one artery just after the origin of the right vertebral artery of the brachiocephalic artery entered the transverse foramen of the fourth cervical vertebra. This artery then traveled up in the transverse foramina and became the basilar artery, joining with the left vertebral artery. We discuss the embryological origin of this case and review previously reported cases.

  18. JAERI tandem annual report, 1982

    International Nuclear Information System (INIS)

    Harada, Kichinosuke; Maruyama, Michio; Ozawa, Kunio; Shikazono, Naomoto; Tamura, Tsutomu; Tanaka, Shigeya

    1983-06-01

    This annual report describes research activities which have been performed with JAERI tandem accelerator from September 1, 1981 to March 31, 1983. Summary reports of 38 papers, publications, personnel and a list of co-operative researches with universities are contained. (author)

  19. JAERI Tandem annual report 1983

    International Nuclear Information System (INIS)

    Harada, Kichinosuke; Maruyama, Michio; Okashita, Hiroshi; Ozawa, Kunio; Shikazono, Naomoto; Tanaka, Shigeya

    1984-07-01

    This annual report describes research activities which have been performed with JAERI tandem accelerator from April 1, 1983 to March 31, 1984. Summary reports of 32 papers, publications, personnel and a list of co-operative reserches with universities are contained. (author)

  20. Status of tandem mirror theory

    International Nuclear Information System (INIS)

    Baldwin, D.E.

    1979-01-01

    This report contains the text and slides used for the review talk on tandem mirror theory presented at the meeting of the Division of Plasma Physics, A.P.S., Boston, MA, November 12-16, 1979. Topics covered include classical confinement, equilibria, MHD- and micro-stability, radial transport, and thermal barriers

  1. Annelid Distal-less/Dlx duplications reveal varied post-duplication fates

    Directory of Open Access Journals (Sweden)

    Korchagina Natalia

    2011-08-01

    Full Text Available Abstract Background Dlx (Distal-less genes have various developmental roles and are widespread throughout the animal kingdom, usually occurring as single copy genes in non-chordates and as multiple copies in most chordate genomes. While the genomic arrangement and function of these genes is well known in vertebrates and arthropods, information about Dlx genes in other organisms is scarce. We investigate the presence of Dlx genes in several annelid species and examine Dlx gene expression in the polychaete Pomatoceros lamarckii. Results Two Dlx genes are present in P. lamarckii, Capitella teleta and Helobdella robusta. The C. teleta Dlx genes are closely linked in an inverted tail-to-tail orientation, reminiscent of the arrangement of vertebrate Dlx pairs, and gene conversion appears to have had a role in their evolution. The H. robusta Dlx genes, however, are not on the same genomic scaffold and display divergent sequences, while, if the P. lamarckii genes are linked in a tail-to-tail orientation they are a minimum of 41 kilobases apart and show no sign of gene conversion. No expression in P. lamarckii appendage development has been observed, which conflicts with the supposed conserved role of these genes in animal appendage development. These Dlx duplications do not appear to be annelid-wide, as the polychaete Platynereis dumerilii likely possesses only one Dlx gene. Conclusions On the basis of the currently accepted annelid phylogeny, we hypothesise that one Dlx duplication occurred in the annelid lineage after the divergence of P. dumerilii from the other lineages and these duplicates then had varied evolutionary fates in different species. We also propose that the ancestral role of Dlx genes is not related to appendage development.

  2. Are duplicated genes responsible for anthracnose resistance in common bean?

    Science.gov (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

    2017-01-01

    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  3. Annual report of Department of Research Reactor and Tandem Accelerator, JFY2012. Operation, utilization and technical development of JRR-3, JRR-4, NSRR, Tandem Accelerator and RI Production Facility

    International Nuclear Information System (INIS)

    Murayama, Yoji; Ishii, Tetsuro; Nakamura, Kiyoshi; Uno, Yuki; Ishikuro, Yasuhiro; Kawashima, Kazuhito; Ishizaki, Nobuhiro; Matsumura, Taichi; Nagahori, Kazuhisa; Odauchi, Shouji; Maruo, Takeshi

    2014-03-01

    The Department of Research Reactor and Tandem Accelerator is in charge of the operation, utilization and technical development of JRR-3(Japan Research Reactor No.3), JRR-4(Japan Research Reactor No.4), NSRR(Nuclear Safety Research Reactor), Tandem Accelerator and RI Production Facility. This annual report describes a summary of activities of services and technical developments carried out in the period between April 1, 2012 and March 31, 2013. The activities were categorized into five service/development fields: (1) Operation and maintenance of research reactors and tandem accelerator, (2) Utilization of research reactors and tandem accelerator, (3) Upgrading of utilization techniques of research reactors and tandem accelerator, (4) Safety administration for department of research reactor and tandem accelerator, (5) International cooperation. Also contained are lists of publications, meetings, granted permissions on laws and regulations concerning atomic energy, number of staff members dispatched to Fukushima for the technical assistance, outcomes in service and technical developments and so on. (author)

  4. Gastric duplication cyst: A cause of rectal bleeding in a young child.

    Science.gov (United States)

    Surridge, Clare A; Goodier, Matthew D

    2014-01-01

    Gastric duplication cysts are an uncommon congenital anomaly and rectal bleeding is a rare presentation of a complicated gastric duplication cyst. This case report describes the radiological findings in a child with a complicated gastric duplication cyst.

  5. Gastric duplication cyst: A cause of rectal bleeding in a young child

    Directory of Open Access Journals (Sweden)

    Clare A Surridge

    2014-01-01

    Full Text Available Gastric duplication cysts are an uncommon congenital anomaly and rectal bleeding is a rare presentation of a complicated gastric duplication cyst. This case report describes the radiological findings in a child with a complicated gastric duplication cyst.

  6. Testing Hypotheses on Risk Factors for Scientific Misconduct via Matched-Control Analysis of Papers Containing Problematic Image Duplications.

    Science.gov (United States)

    Fanelli, Daniele; Costas, Rodrigo; Fang, Ferric C; Casadevall, Arturo; Bik, Elisabeth M

    2018-02-19

    It is commonly hypothesized that scientists are more likely to engage in data falsification and fabrication when they are subject to pressures to publish, when they are not restrained by forms of social control, when they work in countries lacking policies to tackle scientific misconduct, and when they are male. Evidence to test these hypotheses, however, is inconclusive due to the difficulties of obtaining unbiased data. Here we report a pre-registered test of these four hypotheses, conducted on papers that were identified in a previous study as containing problematic image duplications through a systematic screening of the journal PLoS ONE. Image duplications were classified into three categories based on their complexity, with category 1 being most likely to reflect unintentional error and category 3 being most likely to reflect intentional fabrication. We tested multiple parameters connected to the hypotheses above with a matched-control paradigm, by collecting two controls for each paper containing duplications. Category 1 duplications were mostly not associated with any of the parameters tested, as was predicted based on the assumption that these duplications were mostly not due to misconduct. Categories 2 and 3, however, exhibited numerous statistically significant associations. Results of univariable and multivariable analyses support the hypotheses that academic culture, peer control, cash-based publication incentives and national misconduct policies might affect scientific integrity. No clear support was found for the "pressures to publish" hypothesis. Female authors were found to be equally likely to publish duplicated images compared to males. Country-level parameters generally exhibited stronger effects than individual-level parameters, because developing countries were significantly more likely to produce problematic image duplications. This suggests that promoting good research practices in all countries should be a priority for the international

  7. Colonic duplications: Clinical presentation and radiologic features of five cases

    International Nuclear Information System (INIS)

    Blickman, J.G.; Rieu, P.H.M.; Buonomo, C.; Hoogeveen, Y.L.; Boetes, C.

    2006-01-01

    Diagnosis of colonic duplication can pose a potential problem even for those familiar with gastro-intestinal tract duplications in general but unaware of the condition due to its rarity and its apparently bimodal clinical presentation. In this report of five cases of surgically proven pediatric colonic duplication, we illustrate how the condition manifests clinically and describe the imaging features in an attempt to illustrate this bimodal presentation of the condition. The possible etiology, associated congenital anomalies and modes of clinical presentation are reviewed based on literature review as well as on our own experience

  8. Partial duplication of head--a rare congenital anomaly.

    Science.gov (United States)

    Hemachandran, Manikkapurath; Radotra, Bishan Dass

    2004-10-01

    Duplication of notochord results in rare congenital anomalies like double headed monsters, with or without trunk/limb duplication, depending upon the extent of notochordal abnormality. Here we describe the morphological abnormalities in a case of partial duplication of cranial structures with fusion of the two. Autopsy findings suggest that the bifurcation of the neural tube took place around 4th to 6th week of gestation. There are only few reports in English literature describing the autopsy findings of such an anomaly, which is termed as Diprosopus triophthalmus in the modern literature.

  9. The large soybean (Glycine max) WRKY TF family expanded by segmental duplication events and subsequent divergent selection among subgroups.

    Science.gov (United States)

    Yin, Guangjun; Xu, Hongliang; Xiao, Shuyang; Qin, Yajuan; Li, Yaxuan; Yan, Yueming; Hu, Yingkao

    2013-10-03

    WRKY genes encode one of the most abundant groups of transcription factors in higher plants, and its members regulate important biological process such as growth, development, and responses to biotic and abiotic stresses. Although the soybean genome sequence has been published, functional studies on soybean genes still lag behind those of other species. We identified a total of 133 WRKY members in the soybean genome. According to structural features of their encoded proteins and to the phylogenetic tree, the soybean WRKY family could be classified into three groups (groups I, II, and III). A majority of WRKY genes (76.7%; 102 of 133) were segmentally duplicated and 13.5% (18 of 133) of the genes were tandemly duplicated. This pattern was not apparent in Arabidopsis or rice. The transcriptome atlas revealed notable differential expression in either transcript abundance or in expression patterns under normal growth conditions, which indicated wide functional divergence in this family. Furthermore, some critical amino acids were detected using DIVERGE v2.0 in specific comparisons, suggesting that these sites have contributed to functional divergence among groups or subgroups. In addition, site model and branch-site model analyses of positive Darwinian selection (PDS) showed that different selection regimes could have affected the evolution of these groups. Sites with high probabilities of having been under PDS were found in groups I, II c, II e, and III. Together, these results contribute to a detailed understanding of the molecular evolution of the WRKY gene family in soybean. In this work, all the WRKY genes, which were generated mainly through segmental duplication, were identified in the soybean genome. Moreover, differential expression and functional divergence of the duplicated WRKY genes were two major features of this family throughout their evolutionary history. Positive selection analysis revealed that the different groups have different evolutionary rates

  10. A study of reflex tandem accelerator

    Energy Technology Data Exchange (ETDEWEB)

    Nakajima, Takao; Morinobu, Shunpei; Gono, Yasuyuki; Sagara, Kenji; Sugimitsu, Tsuyoshi; Mitarai, Shiro; Nakamura, Hiroyuki; Ikeda, Nobuo; Morikawa, Tsuneyasu [Kyushu Univ., Fukuoka (Japan). Faculty of Science

    1996-12-01

    An investigation on `developing research theme and its realizing experimental apparatus` based on the tandem accelerator facility is executed. At a standpoint of recognition on essentiality of preparation, improvement or novel technical development capable of extreme increase in capacity of the tandem accelerator facility to form COE with high uniqueness, proposal of numerous ideas and their investigations and searches were conducted. In this paper, consideration results of `beam reacceleration using tandem accelerator` were shown as follows: (1) Short life unstable nuclei formed by nuclear reaction using tandem acceleration primary beam is ionized to negative and to reaccelerate by using the same tandem accelerator. And (2) by combination of plural electrons with the tandem primary accelerated beam, numbers of charge is reduced to reaccelerate by the tandem. (G.K.)

  11. Magnet system for a thermal barrier Tandem Mirror Reactor

    International Nuclear Information System (INIS)

    Kim, N.S.; Conn, R.W.

    1981-01-01

    The magnet system for a thermal barrier D-D tandem mirror reactor has been studied as part of the UCLA tandem mirror reactor design study SATYR. Three main considerations in designing the SATYR magnet system are to obtain the desired field strength variation throughout the system, to have proper space for plasma and neutron shielding, and to satisfy the MHD stability to achieve maximum central cell /beta/. Due to the importance and the complexity, the 'internal' field reversal magnet is the main concern in the entire magnet system for SATYR. Two different magnet designs, a non-uniform current density solenoid and a higher-order solenoid, are discussed. Coil levitation for the internal field reversal magnet has been analyzed

  12. p53 protects against genome instability following centriole duplication failure

    Science.gov (United States)

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield

    2015-01-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  13. Obstetric significance of fetal craniofacial duplication. A case report.

    Science.gov (United States)

    Chervenak, F A; Pinto, M M; Heller, C I; Norooz, H

    1985-01-01

    Craniofacial duplication (diprosopus) is a rare form of conjoined twins. Whenever fetal hydrocephalus is diagnosed, a careful search for other anomalies, such as diprosopus, is mandatory. The obstetric management depends upon the time of the diagnosis.

  14. Genetics Home Reference: 7q11.23 duplication syndrome

    Science.gov (United States)

    ... Duplication Syndrome. 2015 Nov 25. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Ledbetter N, Mefford HC, Smith RJH, Stephens K, editors. GeneReviews® [Internet]. Seattle (WA): ...

  15. The duplication 17p13.3 phenotype

    DEFF Research Database (Denmark)

    Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica

    2013-01-01

    . Older patients were often overweight. Three variant phenotypes included cleft lip/palate (CLP), split hand/foot with long bone deficiency (SHFLD), and a connective tissue phenotype resembling Marfan syndrome. The duplications in patients with clefts appear to disrupt ABR, while the SHFLD phenotype......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...... was associated with duplication of BHLHA9 as noted in two recent reports. The connective tissue phenotype did not have a convincing critical region. Our experience with this large cohort expands knowledge of this diverse duplication syndrome....

  16. Sorting by Cuts, Joins, and Whole Chromosome Duplications.

    Science.gov (United States)

    Zeira, Ron; Shamir, Ron

    2017-02-01

    Genome rearrangement problems have been extensively studied due to their importance in biology. Most studied models assumed a single copy per gene. However, in reality, duplicated genes are common, most notably in cancer. In this study, we make a step toward handling duplicated genes by considering a model that allows the atomic operations of cut, join, and whole chromosome duplication. Given two linear genomes, [Formula: see text] with one copy per gene and [Formula: see text] with two copies per gene, we give a linear time algorithm for computing a shortest sequence of operations transforming [Formula: see text] into [Formula: see text] such that all intermediate genomes are linear. We also show that computing an optimal sequence with fewest duplications is NP-hard.

  17. Endorectal magnetic resonance imaging of a rectal duplication cyst.

    Science.gov (United States)

    Beattie, C H; Garvey, C J; Hershman, M J

    1999-09-01

    A case of a duplication cyst of the rectum is presented. This case highlights the potential role of endoluminal magnetic resonance imaging in the diagnosis of this uncommon condition. Alternative imaging modalities and differential diagnoses are discussed.

  18. Immunohistochemical findings in rectal duplication mimicking rectal prolapse.

    Science.gov (United States)

    Cortese, M G; Pucci, A; Macchieraldo, R; Sacco Casamassima, M G; Canavese, F

    2008-08-01

    Alimentary tract duplications represent rare anomalies, with only 5 % occurring in the rectum. The variety in clinical presentation may lead to a delay in diagnosis or to incorrect and multiple surgical procedures. We report the clinical, histological and immunohistochemical characteristics of a rectal duplication occurring in a 3-month-old male with an unusual clinical presentation. Using routine histology and immunohistochemistry, the rectal duplication showed the diffuse presence of gastric mucosa with a characteristic immunophenotype (i.e., diffuse cytokeratin 7 positivity and scattered chromogranin immunoreactivity). As far as we know, this is the first report showing an immunohistochemical differentiation pattern of gastric lining in a rectal duplication. Our results, showing the presence of gastric mucosa, are suggestive of a possible origin from the embryonic foregut.

  19. Duplicate laboratory test reduction using a clinical decision support tool.

    Science.gov (United States)

    Procop, Gary W; Yerian, Lisa M; Wyllie, Robert; Harrison, A Marc; Kottke-Marchant, Kandice

    2014-05-01

    Duplicate laboratory tests that are unwarranted increase unnecessary phlebotomy, which contributes to iatrogenic anemia, decreased patient satisfaction, and increased health care costs. We employed a clinical decision support tool (CDST) to block unnecessary duplicate test orders during the computerized physician order entry (CPOE) process. We assessed laboratory cost savings after 2 years and searched for untoward patient events associated with this intervention. This CDST blocked 11,790 unnecessary duplicate test orders in these 2 years, which resulted in a cost savings of $183,586. There were no untoward effects reported associated with this intervention. The movement to CPOE affords real-time interaction between the laboratory and the physician through CDSTs that signal duplicate orders. These interactions save health care dollars and should also increase patient satisfaction and well-being.

  20. Noncommunicating isolated enteric duplication cyst in the abdomen ...

    African Journals Online (AJOL)

    ... Surgery 2013, 9:124–126. Keywords: abdomen, children, duplication, isolated, noncommunicating. Department of Pediatric Surgery, Seoul National University College of Medicine, .... M Abdominal pain, anorexia, fever. Ileum. Respiratory.

  1. Duplicate Health Insurance Coverage: Determinants of Variation Across States

    OpenAIRE

    Luft, Harold S.; Maerki, Susan C.

    1982-01-01

    Although it is recognized that many people have duplicate private health insurance coverage, either through separate purchase or as health benefits in multi-earner families, there has been little analysis of the factors determining duplicate coverage rates. A new data source, the Survey of Income and Education, offers a comparison with the only previous source of state level data, the estimates from the Health Insurance Association of America. The R2 between the two sets is only .3 and certai...

  2. Familial partial duplication (1)(p21p31)

    Energy Technology Data Exchange (ETDEWEB)

    Hoechstetter, L.; Soukup, S.; Schorry, E.K. [Children`s Hospital Research Foundation, Cincinnati, OH (United States)

    1995-11-20

    A partial duplication (1)(p21p31), resulting from a maternal direct insertion (13,1) (q22p21p31), was found in a 30-year-old woman with mental retardation, cleft palate, and multiple minor anomalies. Two other affected and deceased relatives were presumed to have the same chromosome imbalance. Duplication 1p cases are reviewed. 8 refs., 5 figs., 1 tab.

  3. Malrotation with midgut volvulus associated with perforated ileal duplication

    Directory of Open Access Journals (Sweden)

    Anand Pandey

    2013-01-01

    Full Text Available Duplication of the alimentary tract is an important surgical condition. It may occur anywhere in the gastrointestinal tract. An important complication of this entity is perforation of the normal or abnormal gut. Malrotation with midgut volvulus can be a surgical emergency. We present a patient, who presented as malrotation with midgut volvulus associated with perforated ileal duplication. The patient was successfully managed.

  4. Tandem electrostatic accelerators for BNCT

    International Nuclear Information System (INIS)

    Ma, J.C.

    1994-01-01

    The development of boron neutron capture therapy (BNCT) into a viable therapeutic modality will depend, in part, on the availability of suitable neutron sources compatible with installation in a hospital environment. Low-energy accelerator-based intense neutron sources, using electrostatic or radio frequency quadrupole proton accelerators have been suggested for this purpose and are underdevelopment at several laboratories. New advances in tandem electrostatic accelerator technology now allow acceleration of the multi-milliampere proton beams required to produce therapeutic neutron fluxes for BNCT. The relatively compact size, low weight and high power efficiency of these machines make them particularly attractive for installation in a clinical or research facility. The authors will describe the limitations on ion beam current and available neutron flux from tandem accelerators relative to the requirements for BNCT research and therapy. Preliminary designs and shielding requirements for a tandern accelerator-based BNCT research facility will also be presented

  5. MINIMARS tandem mirror reactor study

    International Nuclear Information System (INIS)

    Perkins, L.J.; Logan, B.G.; Doggett, J.N.

    1986-01-01

    During 1985-1986, Lawrence Livermore National Lab., in partnership with the Fusion Engineering Design Center of Oak Ridge National Lab., the Univ. of Wisconsin, TRW, Grumman Aerospace Corporation, General Dynamics/Convair, Argonne National Lab., and the Canadian Fusion Fuels Technology Project, has conducted the conceptual design of MINIMARS, a small commercial tandem mirror reactor with novel octopole end plugs. With a net electric output of 600 MW(e), MINIMARS is expressly designed for short (∼4- to 5-yr) construction time, factory-built modules, and a passively safe blanket and thermal cycle. In this way, we intend to achieve a small reactor based on the tandem mirror principle that will minimize utility financial risk, thereby providing an attractive alternative to the more conventional large fusion plant designs encountered to date

  6. An unusual presentation of a rectal duplication cyst.

    Science.gov (United States)

    Jackson, Katharine L; Peche, William J; Rollins, Michael D

    2012-01-01

    Intestinal duplications are rare developmental anomalies that can occur anywhere along the gastrointestinal tract. Rectal duplication cysts account for approximately 4% of all duplication cysts. They usually present in childhood with symptoms of mass effect, local infection or more rarely with rectal bleeding from ectopic gastric mucosa. A 26year old male presented with a history of bright red blood per rectum. On examination a mucosal defect with an associated cavity adjacent to the rectum was identified. This was confirmed with rigid proctoscopy and CT scan imaging. A complete transanal excision was performed. Rectal duplication cysts are more common in pediatric patients. They more frequently present with symptoms of mass effect or local infection than with rectal bleeding. In adult patients they are a rare cause of rectal bleeding. Definitive treatment is with surgical excision. A transanal, transcoccygeal, posterior sagittal or a combined abdominoperineal approach may be used depending on anatomic characteristics of the duplication cyst. We present a rare case of a rectal duplication cyst presenting in adulthood with rectal bleeding, managed with transanal excision. Published by Elsevier Ltd.

  7. Duplicate retention in signalling proteins and constraints from network dynamics.

    Science.gov (United States)

    Soyer, O S; Creevey, C J

    2010-11-01

    Duplications are a major driving force behind evolution. Most duplicates are believed to fix through genetic drift, but it is not clear whether this process affects all duplications equally or whether there are certain gene families that are expected to show neutral expansions under certain circumstances. Here, we analyse the neutrality of duplications in different functional classes of signalling proteins based on their effects on response dynamics. We find that duplications involving intermediary proteins in a signalling network are neutral more often than those involving receptors. Although the fraction of neutral duplications in all functional classes increase with decreasing population size and selective pressure on dynamics, this effect is most pronounced for receptors, indicating a possible expansion of receptors in species with small population size. In line with such an expectation, we found a statistically significant increase in the number of receptors as a fraction of genome size in eukaryotes compared with prokaryotes. Although not confirmative, these results indicate that neutral processes can be a significant factor in shaping signalling networks and affect proteins from different functional classes differently. © 2010 The Authors. Journal Compilation © 2010 European Society For Evolutionary Biology.

  8. Maintenance and Loss of Duplicated Genes by Dosage Subfunctionalization.

    Science.gov (United States)

    Gout, Jean-Francois; Lynch, Michael

    2015-08-01

    Whole-genome duplications (WGDs) have contributed to gene-repertoire enrichment in many eukaryotic lineages. However, most duplicated genes are eventually lost and it is still unclear why some duplicated genes are evolutionary successful whereas others quickly turn to pseudogenes. Here, we show that dosage constraints are major factors opposing post-WGD gene loss in several Paramecium species that share a common ancestral WGD. We propose a model where a majority of WGD-derived duplicates preserve their ancestral function and are retained to produce enough of the proteins performing this same ancestral function. Under this model, the expression level of individual duplicated genes can evolve neutrally as long as they maintain a roughly constant summed expression, and this allows random genetic drift toward uneven contributions of the two copies to total expression. Our analysis suggests that once a high level of imbalance is reached, which can require substantial lengths of time, the copy with the lowest expression level contributes a small enough fraction of the total expression that selection no longer opposes its loss. Extension of our analysis to yeast species sharing a common ancestral WGD yields similar results, suggesting that duplicated-gene retention for dosage constraints followed by divergence in expression level and eventual deterministic gene loss might be a universal feature of post-WGD evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Endoscopic Decompression and Marsupialization of A Duodenal Duplication Cyst

    Directory of Open Access Journals (Sweden)

    Eliza I-Lin Sin

    2018-06-01

    Full Text Available Introduction: Duodenal duplication cysts are rare congenital foregut anomalies, accounting for 2%–12% of all gastrointestinal tract duplications. Surgical excision entails risk of injury to the pancreaticobiliary structures due to proximity or communication with the cyst. We present a case of duodenal duplication cyst in a 3 year-old boy who successfully underwent endoscopic decompression. Case report: AT is a young boy who first presented at 15 months of age with abdominal pain. There was one subsequent episode of pancreatitis. Ultrasonography showed the typical double wall sign of a duplication cyst and magnetic resonance cholangio-pancreatography showed a large 5 cm cyst postero-medial to the second part of the duodenum, communicating with the pancreaticobiliary system and causing dilatation of the proximal duodenum. He subsequently underwent successful endoscopic ultrasound guided decompression at 3 years of age under general anesthesia, and had an uneventful postoperative recovery. Conclusion: Endoscopic ultrasound guided assessment and treatment of gastrointestinal duplication cysts is increasingly reported in adults. To the best of our knowledge, only one case of endoscopic treatment of duodenal duplication cyst, in an older child, has been reported thus far in the paediatric literature. In this paper, we review the current literature and discuss the therapeutic options of this rare condition.

  10. Identification of approximately duplicate material records in ERP systems

    Science.gov (United States)

    Zong, Wei; Wu, Feng; Chu, Lap-Keung; Sculli, Domenic

    2017-03-01

    The quality of master data is crucial for the accurate functioning of the various modules of an enterprise resource planning (ERP) system. This study addresses specific data problems arising from the generation of approximately duplicate material records in ERP databases. Such problems are mainly due to the firm's lack of unique and global identifiers for the material records, and to the arbitrary assignment of alternative names for the same material by various users. Traditional duplicate detection methods are ineffective in identifying such approximately duplicate material records because these methods typically rely on string comparisons of each field. To address this problem, a machine learning-based framework is developed to recognise semantic similarity between strings and to further identify and reunify approximately duplicate material records - a process referred to as de-duplication in this article. First, the keywords of the material records are extracted to form vectors of discriminating words. Second, a machine learning method using a probabilistic neural network is applied to determine the semantic similarity between these material records. The approach was evaluated using data from a real case study. The test results indicate that the proposed method outperforms traditional algorithms in identifying approximately duplicate material records.

  11. "Nanocrystal bilayer for tandem catalysis"

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Yusuke; Tsung, Chia Kuang; Huang, Wenyu; Huo, Ziyang; E.Habas, Susan E; Soejima, Tetsuro; Aliaga, Cesar E; Samorjai, Gabor A; Yang, Peidong

    2011-01-24

    Supported catalysts are widely used in industry and can be optimized by tuning the composition and interface of the metal nanoparticles and oxide supports. Rational design of metal-metal oxide interfaces in nanostructured catalysts is critical to achieve better reaction activities and selectivities. We introduce here a new class of nanocrystal tandem catalysts that have multiple metal-metal oxide interfaces for the catalysis of sequential reactions. We utilized a nanocrystal bilayer structure formed by assembling platinum and cerium oxide nanocube monolayers of less than 10 nm on a silica substrate. The two distinct metal-metal oxide interfaces, CeO2-Pt and Pt-SiO2, can be used to catalyse two distinct sequential reactions. The CeO2-Pt interface catalysed methanol decomposition to produce CO and H2, which were subsequently used for ethylene hydroformylation catalysed by the nearby Pt-SiO2 interface. Consequently, propanal was produced selectively from methanol and ethylene on the nanocrystal bilayer tandem catalyst. This new concept of nanocrystal tandem catalysis represents a powerful approach towards designing high-performance, multifunctional nanostructured catalysts

  12. Prenatal detection of a de novo terminal inverted duplication 4p in a fetus with the Wolf-Hirschhorn syndrome phenotype.

    Science.gov (United States)

    Beaujard, M-P; Jouannic, J-M; Bessières, B; Borie, C; Martin-Luis, I; Fallet-Bianco, C; Portnoï, M-F

    2005-06-01

    To present the prenatal diagnosis of a de novo terminal inversion duplication of the short arm of chromosome 4 and a review of the literature. An amniocentesis for chromosome analysis was performed at 33 weeks' gestation because ultrasound examination showed a female fetus with multiple abnormalities consisting of severe intrauterine growth retardation, microcephaly, a cleft lip and renal hypoplasia. Cytogenetic analysis and FISH studies of the cultured amniocytes revealed a de novo terminal inversion duplication of the short arm of chromosome 4 characterized by a duplication of 4p14-p16.1 chromosome region concomitant with a terminal deletion 4p16.1-pter. The karyotype was thus: 46,XX, inv dup del (4)(:p14-->p16.1::p16.1-->qter). The parents opted to terminate the pregnancy. Fetopathological examination showed dysmorphic features and abnormalities consistent with a Wolf-Hirschhorn syndrome (WHS) diagnosis, clinical manifestations of partial 4p trisomy being mild. Although relatively rare, inverted duplications have been reported repeatedly in an increasing number of chromosomes. Only two previous cases with de novo inv dup del (4p) and one with tandem dup 4p have been reported, all of them associated with a 4pter deletion. We report the first case diagnosed prenatally. Breakpoints are variable, resulting in different abnormal phenotype. In our case, clinical manifestations resulted in a WHS phenotype.

  13. Role of computed tomography in oesophageal duplications. Report of two cases; Duplications oesophagiennes: place de la tomodensitometrie

    Energy Technology Data Exchange (ETDEWEB)

    Jouini, S.; Menif, E.; Azaiez, N.; Ben Hajel, H.; Cheikh, I.; Ben Ammar, A.; Sellami, M.; Ben Jaafar, M. [Hopital La Rabta, Tunis (Tunisia)

    1995-12-31

    The authors present two cases of esophageal duplication: tubular in one case and cystic in the other. This rare anomaly was identified in both cases by CT scan. A review of literature is proposed. (authors). 22 refs., 10 figs.

  14. Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

    Science.gov (United States)

    Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

    2012-11-02

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

  15. Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

    Science.gov (United States)

    Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

    2012-01-01

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

  16. A Korean boy with 46,XX testicular disorder of sex development caused by SOX9 duplication.

    Science.gov (United States)

    Lee, Gyung Min; Ko, Jung Min; Shin, Choong Ho; Yang, Sei Won

    2014-06-01

    The 46,XX testicular disorder of sex development (DSD), also known as 46,XX male syndrome, is a rare form of DSD and clinical phenotype shows complete sex reversal from female to male. The sex-determining region Y (SRY) gene can be identified in most 46,XX testicular DSD patients; however, approximately 20% of patients with 46,XX testicular DSD are SRY-negative. The SRY-box 9 (SOX9) gene has several important functions during testis development and differentiation in males, and overexpression of SOX9 leads to the male development of 46,XX gonads in the absence of SRY. In addition, SOX9 duplication has been found to be a rare cause of 46,XX testicular DSD in humans. Here, we report a 4.2-year-old SRY-negative 46,XX boy with complete sex reversal caused by SOX9 duplication for the first time in Korea. He showed normal external and internal male genitalia except for small testes. Fluorescence in situ hybridization and polymerase chain reaction (PCR) analyses failed to detect the presence of SRY, and SOX9 intragenic mutation was not identified by direct sequencing analysis. Therefore, we performed real-time PCR analyses with specific primer pairs, and duplication of the SOX9 gene was revealed. Although SRY-negative 46,XX testicular DSD is a rare condition, an effort to make an accurate diagnosis is important for the provision of proper genetic counseling and for guiding patients in their long-term management.

  17. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G

    2014-01-01

    Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  18. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Directory of Open Access Journals (Sweden)

    Jill C Preston

    Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  19. Analysis of the 9p21.3 sequence associated with coronary artery disease reveals a tendency for duplication in a CAD patient

    Science.gov (United States)

    Kouprina, Natalay; Noskov, Vladimir N.; Waterfall, Joshua J.; Walker, Robert L.; Meltzer, Paul S.; Topol, Eric J.; Larionov, Vladimir

    2018-01-01

    Tandem segmental duplications (SDs) greater than 10 kb are widespread in complex genomes. They provide material for gene divergence and evolutionary adaptation, while formation of specific de novo SDs is a hallmark of cancer and some human diseases. Most SDs map to distinct genomic regions termed ‘duplication blocks’. SDs organization within these blocks is often poorly characterized as they are mosaics of ancestral duplicons juxtaposed with younger duplicons arising from more recent duplication events. Structural and functional analysis of SDs is further hampered as long repetitive DNA structures are underrepresented in existing BAC and YAC libraries. We applied Transformation-Associated Recombination (TAR) cloning, a versatile technique for large DNA manipulation, to selectively isolate the coronary artery disease (CAD) interval sequence within the 9p21.3 chromosome locus from a patient with coronary artery disease and normal individuals. Four tandem head-to-tail duplicons, each ∼50 kb long, were recovered in the patient but not in normal individuals. Sequence analysis revealed that the repeats varied by 10-15 SNPs between each other and by 82 SNPs between the human genome sequence (version hg19). SNPs polymorphism within the junctions between repeats allowed two junction types to be distinguished, Type 1 and Type 2, which were found at a 2:1 ratio. The junction sequences contained an Alu element, a sequence previously shown to play a role in duplication. Knowledge of structural variation in the CAD interval from more patients could help link this locus to cardiovascular diseases susceptibility, and maybe relevant to other cases of regional amplification, including cancer. PMID:29632643

  20. Tandem repeat regions within the Burkholderia pseudomallei genome and their application for high resolution genotyping

    Directory of Open Access Journals (Sweden)

    Harvey Steven P

    2007-03-01

    Full Text Available Abstract Background The facultative, intracellular bacterium Burkholderia pseudomallei is the causative agent of melioidosis, a serious infectious disease of humans and animals. We identified and categorized tandem repeat arrays and their distribution throughout the genome of B. pseudomallei strain K96243 in order to develop a genetic typing method for B. pseudomallei. We then screened 104 of the potentially polymorphic loci across a diverse panel of 31 isolates including B. pseudomallei, B. mallei and B. thailandensis in order to identify loci with varying degrees of polymorphism. A subset of these tandem repeat arrays were subsequently developed into a multiple-locus VNTR analysis to examine 66 B. pseudomallei and 21 B. mallei isolates from around the world, as well as 95 lineages from a serial transfer experiment encompassing ~18,000 generations. Results B. pseudomallei contains a preponderance of tandem repeat loci throughout its genome, many of which are duplicated elsewhere in the genome. The majority of these loci are composed of repeat motif lengths of 6 to 9 bp with 4 to 10 repeat units and are predominately located in intergenic regions of the genome. Across geographically diverse B. pseudomallei and B.mallei isolates, the 32 VNTR loci displayed between 7 and 28 alleles, with Nei's diversity values ranging from 0.47 and 0.94. Mutation rates for these loci are comparable (>10-5 per locus per generation to that of the most diverse tandemly repeated regions found in other less diverse bacteria. Conclusion The frequency, location and duplicate nature of tandemly repeated regions within the B. pseudomallei genome indicate that these tandem repeat regions may play a role in generating and maintaining adaptive genomic variation. Multiple-locus VNTR analysis revealed extensive diversity within the global isolate set containing B. pseudomallei and B. mallei, and it detected genotypic differences within clonal lineages of both species that were

  1. Intussusception due to a cecal duplication cyst: a rare cause of acute abdomen. Case report.

    Science.gov (United States)

    Corroppolo, M; Zampieri, N; Erculiani, E; Cecchetto, M; Camoglio, F S

    2007-01-01

    Duplications of the alimentary tract are rare congenital anomalies. The ileum is the most common site, whereas rectal, duodenal, gastric and cecal duplications are extremely rare. Duplication cysts of the cecum, in a neonate, are even rarer, with only 19 cases reported in medical literature to date. We report a case of intestinal intussusception due to a cecal duplication cyst.

  2. Annual report of Department of Research Reactor and Tandem Accelerator, JFY2011. Operation, utilization and technical development of JRR-3, JRR-4, NSRR and tandem accelerator

    International Nuclear Information System (INIS)

    Ishii, Tetsuro; Nakamura, Kiyoshi; Kawamata, Satoshi; Ishikuro, Yasuhiro; Kawashima, Kazuhito; Kabumoto, Hiroshi; Nakamura, Takemi; Tamura, Itaru; Kawasaki, Sayuri; Sataka, Masao

    2013-03-01

    The Department of Research Reactors and Tandem Accelerator is in charge of the operation, utilization and technical development of JRR-3(Japan Research Reactor No.3), JRR-4(Japan Research Reactor No.4), NSRR(Nuclear Safety Research Reactor) and Tandem Accelerator. This annual report describes a summary of activities of services and technical developments carried out in the period between April 1, 2011 and March 31, 2012. The activities were categorized into six service/development fields: (1) Recovery from the Great East Japan Earthquake, (2) Operation and maintenance of research reactors and tandem accelerator, (3) Utilization of research reactors and tandem accelerator, (4) Upgrading of utilization techniques of research reactors and tandem accelerator, (5) Safety administration for research reactors and tandem accelerator, (6) International cooperation. Also contained are lists of publications, meetings, granted permissions on lows and regulations concerning atomic energy, number of staff members dispatched to Fukushima for the technical assistance, commendation, outcomes in service and technical developments and so on. (author)

  3. [Anterior rectal duplication in adult patient: a case report].

    Science.gov (United States)

    Rodríguez-Cabrera, J; Villanueva-Sáenz, E; Bolaños-Badillo, L E

    2009-01-01

    To report a case of rectal duplication in the adult and make a literature review. The intestinal duplications are injuries of congenital origin that can exist from the base of the tongue to the anal verge, being the most frequent site at level of terminal ileum (22%) and at the rectal level in 5% To date approximately exist 80 reports in world-wide Literature generally in the pediatric population being little frequent in the adult age. Its presentation could be tubular or cystic. The recommended treatment is the surgical resection generally in block with coloanal anastomosis. A case review of rectal duplication in the adult and the conducted treatment. The case of a patient appears with diagnose of rectal duplication with tubular type,whose main symptom was constipation and fecal impactation. In the exploration was detect double rectal lumen (anterior and posterior) that it above initiates by of the anorectal ring with fibrous ulcer of fibrinoid aspect of 3 approx cm of length x 1 cm wide, at level of the septum that separates both rectal lumina. The rectal duplication is a rare pathology in the adult nevertheless is due to suspect before the existence of alterations in the mechanics of the defecation, rectal prolapse and rectal bleeding,the election treatment is a protectomy with colonic pouch in "J" and coloanal anastomosis.

  4. Tandem mirror technology demonstration facility

    Energy Technology Data Exchange (ETDEWEB)

    1983-10-01

    This report describes a facility for generating engineering data on the nuclear technologies needed to build an engineering test reactor (ETR). The facility, based on a tandem mirror operating in the Kelley mode, could be used to produce a high neutron flux (1.4 MW/M/sup 2/) on an 8-m/sup 2/ test area for testing fusion blankets. Runs of more than 100 h, with an average availability of 30%, would produce a fluence of 5 mW/yr/m/sup 2/ and give the necessary experience for successful operation of an ETR.

  5. Tandem mirror technology demonstration facility

    International Nuclear Information System (INIS)

    1983-10-01

    This report describes a facility for generating engineering data on the nuclear technologies needed to build an engineering test reactor (ETR). The facility, based on a tandem mirror operating in the Kelley mode, could be used to produce a high neutron flux (1.4 MW/M 2 ) on an 8-m 2 test area for testing fusion blankets. Runs of more than 100 h, with an average availability of 30%, would produce a fluence of 5 mW/yr/m 2 and give the necessary experience for successful operation of an ETR

  6. Penile Duplication and Two Anal Openings; Report of a Very Rare Case

    OpenAIRE

    Bakheet, Mohamed Abdel Al M.; Refaei, Mohammad

    2012-01-01

    Background Penile duplication (diphallus) is an extremely rare disorder. It is almost always associated with other malformations like double bladder, exstrophy of the cloacae, imperforate anus, duplication of the rectosigmoid and vertebral deformities. Meanwhile anal canal duplication, the most distal and least common duplication of the digestive tube and is a very rare congenital malformation. Case Presentation A 21 days old Egyptian neonate is reported with complete penile duplication and t...

  7. Rhodium-Biphephos-Catalyzed Tandem Isomerization–Hydroformylation of Oleonitrile

    Directory of Open Access Journals (Sweden)

    Lucas Le Goanvic

    2018-01-01

    Full Text Available Tandem isomerization–hydroformylation of oleonitrile (an 18-carbon nitrile with a remote internal (9-C=C bond has been studied using Rh-bisphosphite catalyst systems, targeting formation of the linear aldehyde. The best compromise between regioselectivity (l/b = 58:42 and chemoselectivity (60% was obtained at 120 °C and 10 bar CO/H2 (1:1 with a catalyst based on Biphephos at a 0.5 mol % catalyst load and a low ligand excess (2 equiv. versus Rh. These values stand among the better reported ones for the tandem isomerization–hydroformylation of long chain olefins with a single-component catalyst system.

  8. International

    International Nuclear Information System (INIS)

    Anon.

    1997-01-01

    This rubric reports on 10 short notes about international economical facts about nuclear power: Electricite de France (EdF) and its assistance and management contracts with Eastern Europe countries (Poland, Hungary, Bulgaria); Transnuclear Inc. company (a 100% Cogema daughter company) acquired the US Vectra Technologies company; the construction of the Khumo nuclear power plant in Northern Korea plays in favour of the reconciliation between Northern and Southern Korea; the delivery of two VVER 1000 Russian reactors to China; the enforcement of the cooperation agreement between Euratom and Argentina; Japan requested for the financing of a Russian fast breeder reactor; Russia has planned to sell a floating barge-type nuclear power plant to Indonesia; the control of the Swedish reactor vessels of Sydkraft AB company committed to Tractebel (Belgium); the renewal of the nuclear cooperation agreement between Swiss and USA; the call for bids from the Turkish TEAS electric power company for the building of the Akkuyu nuclear power plant answered by three candidates: Atomic Energy of Canada Limited (AECL), Westinghouse (US) and the French-German NPI company. (J.S.)

  9. Rectal duplication cyst in an adult: the laparoscopic approach.

    Science.gov (United States)

    Salameh, Jihad R; Votanopoulos, Konstantinos I; Hilal, Raouf E; Essien, Francis A; Williams, Michael D; Barroso, Alberto O; Sweeney, John F; Brunicardi, F Charles

    2002-12-01

    Rectal duplication cyst (RDC) is a rare congenital anomaly representing 1% to 8% of all intestinal duplications. The case presented here is the first report of the laparoscopic resection of an RDC. We report the case of a 49-year-old white woman in whom a retrorectal cystic mass measuring 5 x 5.3 x 6 cm was diagnosed. The mass was completely resected by means of laparoscopic techniques. Pathologic findings revealed a cystic structure partially lined with squamous as well as respiratory- and gastrointestinal-type epithelium. Muscularis propria was identified in the outer portions of the wall of the specimen. No atypia or malignancy was identified. The overall findings were consistent with an RDC. Laparoscopic resection constitutes an excellent and patient-friendly approach to the management of large adult cystic duplication of the rectum.

  10. The sequence and analysis of duplication rich human chromosome 16

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-08-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  11. The Sequence and Analysis of Duplication Rich Human Chromosome 16

    Science.gov (United States)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-01-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  12. Enteric Duplication Cysts in Children: A Clinicopathological Dilemma.

    Science.gov (United States)

    Sharma, Sonam; Yadav, Amit K; Mandal, Ashish K; Zaheer, Sufian; Yadav, Devendra K; Samie, Amat

    2015-08-01

    Enteric duplication cysts are rare and uncommon congenital malformations formed during the embryonic period of the development of human digestive system and are mainly encountered during infancy or early childhood, but seldom in adults. The clinical presentation is extremely variable depending upon its size, location and type. We present six cases of enteric duplication cysts with diverse clinico-pathological features. This study was carried out in the Department of Pathology and Department of Paediatric Surgery, Vardhman Mahavir Medical College and Safdarjung Hospital, New Delhi, India for a period of 2 years (January 2013 - December 2014). We retrospectively analyzed six patients of enteric duplication cysts based on data obtained, which consisted of patient's age, sex, clinical presentation, radiological features, operative findings and histopathology report. The data collected was analyzed by descriptive statistics. Six children between age range of 3 days to 10 years had enteric duplication cysts. Two had ileal and one each were of pyloroduodenal, colonic and rectal duplication cyst. In one patient a presumptive diagnosis of enteric duplication cyst was made. Radiology played an important contributory role in diagnosis of these cysts in all the patients but histopathology proved to be gold standard for its confirmation. All these patients were managed by surgical excision. The postoperative and follow up period in all the cases was uneventful. It is important to be aware and make a definitive diagnosis of this rare congenital anomaly as they can present in various clinical forms and can cause significant morbidity and even mortality if left untreated by causing life threatening complications.

  13. Strain of Synechocystis PCC 6803 with Aberrant Assembly of Photosystem NN Contains Tandem Duplication of a Large Chromosomal Region

    Czech Academy of Sciences Publication Activity Database

    Tichý, Martin; Bečková, Martina; Kopečná, Jana; Noda, J.; Sobotka, Roman; Komenda, Josef

    2016-01-01

    Roč. 7, May 12 (2016), s. 648 ISSN 1664-462X R&D Projects: GA MŠk(CZ) LO1416 Institutional support: RVO:61388971 Keywords : Synechocystis 6803 * chlorophyll * photosystem I Subject RIV: EE - Microbiology, Virology Impact factor: 4.298, year: 2016

  14. A retroperitoneal foregut duplication cyst: a case report

    International Nuclear Information System (INIS)

    Kim, Yong Woon; Lee, Jin Hee; Byun, Kyung Hwan; Kim, Byung Ki; Sohn, Kyung Sik; Kee, Se Kook; Jeon, Jin Min; Yun, Young Kook

    2006-01-01

    Retroperitoneal foregut duplication cyst is an extremely rare congenital malformation. Pathologically, this lesion contains both gastric mucosa and respiratory type mucosa; radiologically, it is often challenging to differentiate it from the other cystic neoplasms that present a similar appearance. We report on a case of retroperitoneal foregut duplication cyst that was lined by both gastric and pseudostratified ciliated columnar epithelium, and it was also accompanied by a pancreatic pseudocyst. Initially, it presented with peripancreatic and intrapancreatic cystic masses in an asymptomatic 30-year-old man, and this man has since undergone surgical resection

  15. Urethral duplication with unusual cause of bladder outlet obstruction

    Directory of Open Access Journals (Sweden)

    Vivek Venkatramani

    2016-01-01

    Full Text Available A 12-year-old boy presented with poor flow and recurrent urinary tract infections following hypospadias repair at the age of 3 years. The evaluation revealed urethral duplication with a hypoplastic dorsal urethra and patent ventral urethra. He also had duplication of the bladder neck, and on voiding cystourethrogram the ventral bladder neck appeared hypoplastic and compressed by the dorsal bladder neck during voiding. The possibility of functional obstruction of the ventral urethra by the occluded dorsal urethra was suspected, and he underwent a successful urethro-urethrostomy.

  16. Recurrent duplications of 17q12 associated with variable phenotypes

    DEFF Research Database (Denmark)

    Mitchell, Elyse; Douglas, Andrew; Kjaegaard, Susanne

    2015-01-01

    The ability to identify the clinical nature of the recurrent duplication of chromosome 17q12 has been limited by its rarity and the diverse range of phenotypes associated with this genomic change. In order to further define the clinical features of affected patients, detailed clinical information......, potentially contributory copy number changes in a subset of patients, including one patient each with 16p11.2 deletion and 15q13.3 deletion. Our data further define and expand the clinical spectrum associated with duplications of 17q12 and provide support for the role of genomic modifiers contributing...... to phenotypic variability....

  17. Ruptured rectal duplication cyst with classical bladder exstrophy.

    Science.gov (United States)

    Gupta, Rahul K; Oak, Sanjay; Parelkar, Sandesh V; Sanghvi, Beejal; Kaltari, Deepak K; Prakash, Advait; Patil, Rajashekhar; Bachani, Mitesh

    2010-07-01

    A newborn boy was brought to us, 2 hours after birth, with a mucosal-lined left hemiperineal lesion associated with classical bladder exstrophy and an anterolaterally displaced anus. Perineal anatomy was restored by excising the mucosa lined lesion. The bladder closure for classical bladder exstrophy was done at the same time. Histologically, gastric, respiratory, and small intestinal epithelia were present in the mucosa. A rectal duplication cyst that had ruptured in utero through the hemiperineum could explain the anomaly. The association of classical bladder exstrophy with ruptured rectal duplication cyst has never previously been described in the literature. Copyright 2010 Elsevier Inc. All rights reserved.

  18. Duplication of the Hindgut and Lower Urinary. Tract. Case Report

    International Nuclear Information System (INIS)

    Garcia, Vanessa; Tamayo, Margarita; Montoya, Claudia; Acosta, Federico; Cano, Julian; Mejia, Francisco

    2010-01-01

    A 13 year female consulted to Heatup Pad's surgery department with a history of pelvic malformations since she was born and complaining about a colostomy done five years ago. On clinical examination an anal fistula was seen as well as perineal organs duplicated including: vulva - four labia, clitoris, vaginal canal, urethra, also double gluteal cleft. Several diagnostic modalities were performed (voiding cystourethrography, urodynamic, renal scan, CT and MRI) having a diagnosis of complete duplication of the hindgut and lower urinary tract, a rare congenital anomaly that has fewer than 50 cases reported in the literature. During hospitalization she underwent successful abdominopelvic surgical Correction.

  19. Incomplete urethral duplication with cyst formation in a dog

    International Nuclear Information System (INIS)

    Duffey, M.H.; Barnhart, M.D.; Barthez, P.Y.; Smeak, D.D.

    1998-01-01

    Incomplete urethral duplication with cyst formation was diagnosed in a dog that had soft, fluctuant, subcutaneous swellings in the ventral perineal and penile areas and a history of nocturia and incontinence during recumbency that were unresponsive to treatment with antibiotics. Retrograde urethrocystography, voiding urethrography, double-contrast cystography, radiography after direct administration of contrast medium into cystic structures, and excretory urography were performed to evaluate the urinary tract. Communication between the cysts and the urethra was demonstrated radiographically only after intralesional injection of contrast medium. Nocturia and incontinence resolved after surgical removal of the urethral duplication and cysts. The dog was clinically normal 1 year after surgery

  20. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Science.gov (United States)

    Martínez-Alberola, Fernando; Del Campo, Eva M; Lázaro-Gimeno, David; Mezquita-Claramonte, Sergio; Molins, Arantxa; Mateu-Andrés, Isabel; Pedrola-Monfort, Joan; Casano, Leonardo M; Barreno, Eva

    2013-01-01

    Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt) in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  1. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Directory of Open Access Journals (Sweden)

    Fernando Martínez-Alberola

    Full Text Available Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  2. Injector of the Utrecht EN tandem

    Energy Technology Data Exchange (ETDEWEB)

    Borg, K. van der; Haas, A.P. de; Hoogenboom, A.M.; Strasters, B.A.; Vermeer, A.; Zwol, N.A. van (Rijksuniversiteit Utrecht (Netherlands). Fysisch Lab.)

    1984-02-15

    An injector has been built to obtain improved beam transmission through the EN tandem. The injector has been provided with a 90/sup 0/ analysing magnet, m/..delta..m=300, and 130 kV preacceleration. Beam optics calculations have been made for the injector and tandem. The injector has been equipped with a fiber optics control and data acquisition system.

  3. The injector of the Utrecht EN tandem

    International Nuclear Information System (INIS)

    Borg, K. van der; Haas, A.P. de; Hoogenboom, A.M.; Strasters, B.A.; Vermeer, A.; Zwol, N.A. van

    1984-01-01

    An injector has been built to obtain improved beam transmission through the EN tandem. The injector has been provided with a 90 0 analysing magnet, m/Δm=300, and 130 kV preacceleration. Beam optics calculations have been made for the injector and tandem. The injector has been equipped with a fiber optics control and data acquisition system. (orig.)

  4. The Kyoto University tandem upgrading project

    International Nuclear Information System (INIS)

    Nakamura, Masanobu; Shimoura, Susumu; Takimoto, Kiyohiko; Sakaguchi, Harutaka; Kobayashi, Shinsaku

    1988-01-01

    A brief description on the Kyoto University tandem upgrading project. The project consists of replacing the old 5 MV tandem Van de Graaff by an 8UDH pelletron. The old pressure vessel and beam lines are used again without significant modification. The project is planned to be completed at the end of 1989. (orig.)

  5. Parametric studies of tandem mirror reactors

    International Nuclear Information System (INIS)

    Carlson, G.A.; Boghosian, B.M.; Fink, J.H.; Myall, J.O.; Neef, W.S. Jr.

    1979-01-01

    This report, along with its companion, An Improved Tandem Mirror Reactor, discusses the recent progress and present status of our tandem mirror reactor studies. This report presents the detailed results of parametric studies up to, but not including, the very new ideas involving thermal barriers

  6. Packet models revisited: tandem and priority systems

    NARCIS (Netherlands)

    M.R.H. Mandjes (Michel)

    2004-01-01

    textabstractWe examine two extensions of traditional single-node packet-scale queueing models: tandem networks and (strict) priority systems. Two generic input processes are considered: periodic and Poisson arrivals. For the two-node tandem, an exact expression is derived for the joint distribution

  7. Device operation of organic tandem solar cells

    NARCIS (Netherlands)

    Hadipour, A.; de Boer, B.; Blom, P. W. M.

    2008-01-01

    A generalized methodology is developed to obtain the current-voltage characteristic of polymer tandem solar cells by knowing the electrical performance of both sub cells. We demonstrate that the electrical characteristics of polymer tandem solar cells are correctly predicted for both the series and

  8. A new resource for characterizing X-linked genes in Drosophila melanogaster: systematic coverage and subdivision of the X chromosome with nested, Y-linked duplications.

    Science.gov (United States)

    Cook, R Kimberley; Deal, Megan E; Deal, Jennifer A; Garton, Russell D; Brown, C Adam; Ward, Megan E; Andrade, Rachel S; Spana, Eric P; Kaufman, Thomas C; Cook, Kevin R

    2010-12-01

    Interchromosomal duplications are especially important for the study of X-linked genes. Males inheriting a mutation in a vital X-linked gene cannot survive unless there is a wild-type copy of the gene duplicated elsewhere in the genome. Rescuing the lethality of an X-linked mutation with a duplication allows the mutation to be used experimentally in complementation tests and other genetic crosses and it maps the mutated gene to a defined chromosomal region. Duplications can also be used to screen for dosage-dependent enhancers and suppressors of mutant phenotypes as a way to identify genes involved in the same biological process. We describe an ongoing project in Drosophila melanogaster to generate comprehensive coverage and extensive breakpoint subdivision of the X chromosome with megabase-scale X segments borne on Y chromosomes. The in vivo method involves the creation of X inversions on attached-XY chromosomes by FLP-FRT site-specific recombination technology followed by irradiation to induce large internal X deletions. The resulting chromosomes consist of the X tip, a medial X segment placed near the tip by an inversion, and a full Y. A nested set of medial duplicated segments is derived from each inversion precursor. We have constructed a set of inversions on attached-XY chromosomes that enable us to isolate nested duplicated segments from all X regions. To date, our screens have provided a minimum of 78% X coverage with duplication breakpoints spaced a median of nine genes apart. These duplication chromosomes will be valuable resources for rescuing and mapping X-linked mutations and identifying dosage-dependent modifiers of mutant phenotypes.

  9. Genome Mutational and Transcriptional Hotspots Are Traps for Duplicated Genes and Sources of Adaptations.

    Science.gov (United States)

    Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina

    2017-05-01

    Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. Duplication of lower lip and mandible--a rare diprosopus.

    Science.gov (United States)

    Suhaili, D N Pengiran; Somasundaram, S; Lau, S H; Ajura, A J; Roslan, A R; Ramli, R

    2011-01-01

    Diprosopus or duplication of the lower lip and mandible is a very rare congenital anomaly. We report this unusual case occurring in a girl who presented to our hospital at the age of 4 months. Surgery and problems related to this anomaly are discussed. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  11. Exposing region duplication through local geometrical color invariant features

    Science.gov (United States)

    Gong, Jiachang; Guo, Jichang

    2015-05-01

    Many advanced image-processing softwares are available for tampering images. How to determine the authenticity of an image has become an urgent problem. Copy-move is one of the most common image forgery operations. Many methods have been proposed for copy-move forgery detection (CMFD). However, most of these methods are designed for grayscale images without any color information used. They are usually not suitable when the duplicated regions have little structure or have undergone various transforms. We propose a CMFD method using local geometrical color invariant features to detect duplicated regions. The method starts by calculating the color gradient of the inspected image. Then, we directly take the color gradient as the input for scale invariant features transform (SIFT) to extract color-SIFT descriptors. Finally, keypoints are matched and clustered before their geometrical relationship is estimated to expose the duplicated regions. We evaluate the detection performance and computational complexity of the proposed method together with several popular CMFD methods on a public database. Experimental results demonstrate the efficacy of the proposed method in detecting duplicated regions with various transforms and poor structure.

  12. Recombination facilitates neofunctionalization of duplicate genes via originalization

    Directory of Open Access Journals (Sweden)

    Huang Ren

    2010-06-01

    Full Text Available Abstract Background Recently originalization was proposed to be an effective way of duplicate-gene preservation, in which recombination provokes the high frequency of original (or wild-type allele on both duplicated loci. Because the high frequency of wild-type allele might drive the arising and accumulating of advantageous mutation, it is hypothesized that recombination might enlarge the probability of neofunctionalization (Pneo of duplicate genes. In this article this hypothesis has been tested theoretically. Results Results show that through originalization recombination might not only shorten mean time to neofunctionalizaiton, but also enlarge Pneo. Conclusions Therefore, recombination might facilitate neofunctionalization via originalization. Several extensive applications of these results on genomic evolution have been discussed: 1. Time to nonfunctionalization can be much longer than a few million generations expected before; 2. Homogenization on duplicated loci results from not only gene conversion, but also originalization; 3. Although the rate of advantageous mutation is much small compared with that of degenerative mutation, Pneo cannot be expected to be small.

  13. Intragenic duplication: a novel mutational mechanism in hereditary pancreatitis

    DEFF Research Database (Denmark)

    Joergensen, Maiken T; Geisz, Andrea; Brusgaard, Klaus

    2011-01-01

    In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide of cationic...

  14. Antegrade pyelography in ureteric duplications with obstructed upper segments

    International Nuclear Information System (INIS)

    Macpherson, R.I.; Kaufman, J.M.

    1983-01-01

    Percutaneous puncture under fluoroscopic control followed by antegrade pyelography was employed in three children, two of them neonates, suspected of having complete duplication of the ureter with obstructed upper segments on the basis of the excretory pyelographic and ultrasonographic findings. This simple, uncomplicated and definitive method confirmed the diagnosis and demonstrated the course, termination and effects of the dilated ectopic ureter

  15. Cryptorchidism due to chromosome 5q inversion duplication.

    Science.gov (United States)

    Dutta, M K; Gundgurthi, A; Garg, M K; Pakhetr, R

    2013-12-01

    We present a 15 year old boy who was born out of a non consanguineous marriage, and presented with bilateral cryptorchidism, mental retardation, facial dysmorphism, hypergonadotrophic hypogonadism with failure of anatomical and biochemical localisation of testes. Karyotype analysis showed 46 XY with inverted duplication on chromosome 5q22-31.

  16. Verification and characterization of chromosome duplication in haploid maize.

    Science.gov (United States)

    de Oliveira Couto, E G; Resende Von Pinho, E V; Von Pinho, R G; Veiga, A D; de Carvalho, M R; de Oliveira Bustamante, F; Nascimento, M S

    2015-06-26

    Doubled haploid technology has been used by various private companies. However, information regarding chromosome duplication methodologies, particularly those concerning techniques used to identify duplication in cells, is limited. Thus, we analyzed and characterized artificially doubled haploids using microsatellites molecular markers, pollen viability, and flow cytometry techniques. Evaluated material was obtained using two different chromosome duplication protocols in maize seeds considered haploids, resulting from the cross between the haploid inducer line KEMS and 4 hybrids (GNS 3225, GNS 3032, GNS 3264, and DKB 393). Fourteen days after duplication, plant samples were collected and assessed by flow cytometry. Further, the plants were transplanted to a field, and samples were collected for DNA analyses using microsatellite markers. The tassels were collected during anthesis for pollen viability analyses. Haploid, diploid, and mixoploid individuals were detected using flow cytometry, demonstrating that this technique was efficient for identifying doubled haploids. The microsatellites markers were also efficient for confirming the ploidies preselected by flow cytometry and for identifying homozygous individuals. Pollen viability showed a significant difference between the evaluated ploidies when the Alexander and propionic-carmin stains were used. The viability rates between the plodies analyzed show potential for fertilization.

  17. Association of anorectal malformation with anal and rectal duplication

    Directory of Open Access Journals (Sweden)

    Karla A. Santos-Jasso

    2014-08-01

    We present three cases of rectal duplications with anorectal malforma- tion with recto-perineal fistula and colonic duplication. Two of them with delayed diagnosis and bowel obstruction, treated with laparotomy, colostomy and side-to-side anastomosis of the proximal colonic duplica- tion; in the third case the diagnosis of the colonic and rectal duplication was made during a colostomy opening. For definitive correction, the three patients underwent abdomino-perineal approach and side-to-side anastomosis of the rectal duplication, placement of the rectum within the muscle complex, and later on colostomy closure. In a fourth patient with anorectal malformation and colostomy after birth, the perineal electro-stimulation showed two muscle complexes. A posterior sagittal approach in both showed two separate blind rectal pouches; an end- to-side anastomosis of the dilated rectum was made, and the muscle complex with stronger contraction was used for the anoplasty. The posterior sagittal approach is the best surgical option to preserve the muscle complex, with a better prognosis for rectal continence.

  18. Obscure bleeding colonic duplication responds to proton pump inhibitor therapy.

    Science.gov (United States)

    Jacques, Jérémie; Projetti, Fabrice; Legros, Romain; Valgueblasse, Virginie; Sarabi, Matthieu; Carrier, Paul; Fredon, Fabien; Bouvier, Stéphane; Loustaud-Ratti, Véronique; Sautereau, Denis

    2013-09-21

    We report the case of a 17-year-old male admitted to our academic hospital with massive rectal bleeding. Since childhood he had reported recurrent gastrointestinal bleeding and had two exploratory laparotomies 5 and 2 years previously. An emergency abdominal computed tomography scan, gastroscopy and colonoscopy, performed after hemodynamic stabilization, were considered normal. High-dose intravenous proton pump inhibitor (PPI) therapy was initiated and bleeding stopped spontaneously. Two other massive rectal bleeds occurred 8 h after each cessation of PPI which led to a hemostatic laparotomy after negative gastroscopy and small bowel capsule endoscopy. This showed long tubular duplication of the right colon, with fresh blood in the duplicated colon. Obscure lower gastrointestinal bleeding is a difficult medical situation and potentially life-threatening. The presence of ulcerated ectopic gastric mucosa in the colonic duplication explains the partial efficacy of PPI therapy. Obscure gastrointestinal bleeding responding to empiric anti-acid therapy should probably evoke the diagnosis of bleeding ectopic gastric mucosa such as Meckel's diverticulum or gastrointestinal duplication, and gastroenterologists should be aware of this potential medical situation.

  19. Duplication of the urethra with communication to the rectum

    International Nuclear Information System (INIS)

    Bruce, R.; Alton, D.

    1986-01-01

    The posterior channel of duplicated urethrae usually follows a straight course to end in the perineum just inside the anal verge. This unique urethra dipped into the perineum and then turned cephalad to enter the rectum above the anus. Delineation of the course of the urethra simplified management by assisting the urologist to convert the rectal passage to a hypospadiac urethra. (orig.)

  20. Cystic rectal duplication: a rare cause of neonatal intestinal obstruction.

    Science.gov (United States)

    Mboyo, A; Monek, O; Massicot, R; Martin, L; Destuynder, O; Lemouel, A; Aubert, D

    1997-07-01

    A case of cystic rectal duplication revealed on day 2 of life by a low intestinal occluding syndrome is reported. Radiologic imaging (ultrasonography, cystography, rectography) showed a large, retrorectal liquid formation in the pelvis and abdomen, with pelvic compression of the terminal alimentary canal and lower urinary tract. Magnetic resonance imaging demonstrated a liquid formation with clearly defined edges and no medullary involvement, thus ruling out the possibility of a previous meningeal hernia. Biological markers were within normal limits. On day 4, a 9 x 6-cm cystic rectal duplication was removed, followed by a temporary colostomy. Pathologic examination demonstrated typical rectal architecture with ciliated cells. Radiologic and clinical findings at 2-month follow-up were reassuring. This case report is exceptional for the following reasons: (1) As a rule, rectal duplications are relatively rare (70 cases reported in the literature); (2) The means of disclosing a neonatal rectal duplication is unusual (4 cases reported in the literature); (3) The volume of the malformation was considerable; and (4) Heterotopic ciliated epithelium was present.

  1. Different clinical presentations, diagnostic difficulties, and management of cecal duplication.

    Science.gov (United States)

    Temiz, Abdulkerim; Oğuzkurt, Pelin; Ezer, Semire Serin; İnce, Emine; Gezer, Hasan Özkan; Hiçsönmez, Akgün

    2013-03-01

    Cecal duplications (CDs) are very rare, representing 0.4% of all gastrointestinal duplications. This study evaluates the variable clinical presentations, imaging workup, and surgical management of CDs. The records of 7 patients who underwent surgery between April 2001 and December 2011 for CD were retrospectively reviewed. Sex, age, duration of complaints, diagnostic studies, surgical intervention, and pathologic findings were recorded. The median age was 8 months, and mean age was 1.65 ± 2.88 years. Complaints were abdominal pain, rectal bleeding, vomiting, cough and dyspnea, and a prenatally detected cystic mass. The patients were referred with the diagnosis of appendicular abscess, necrotizing enterocolitis, gastrointestinal lymphoma, and intraabdominal cystic mass. Abdominal distention, signs of peritonitis, substernal retraction, fullness at right lower quadrant, and normal findings were detected on physical examination. Diagnostic imaging included plain abdominal radiography (7), ultrasonography (7), computed tomography (3), and magnetic resonance imaging (2). A cystic mass was reported on radiologic studies in 6 patients and appendicular abscess in 1. Cyst and cecum were resected, ileocolostomy was performed in 6 patients, and cyst excision was performed in 1. The diagnosis of duplication cyst was made by pathologic examination in all patients. Cecal duplications may be detected incidentally; however, they may mimic appendicular abscess, a tumor mass, or necrotizing enterocolitis. Whether cystic lesions are symptomatic, they should be excised when detected because of possible complications. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Type IIA2 urethral duplication: report of an unusual case

    African Journals Online (AJOL)

    ultrasonography (US) showed left-sided hydroureterone- phrosis with a distended thick-walled bladder. US showed the right testis to be enlarged with increased vascularity suggestive of epididymo-orchitis. A retrograde urethro- gram showed a sagittal duplication of urethra, with the narrow dorsal urethra originating from the ...

  3. 48 CFR 1352.231-71 - Duplication of effort.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Duplication of effort. 1352.231-71 Section 1352.231-71 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE CLAUSES... benefit of the Government, and not incidental to any other work, pursuit, research, or purpose of the...

  4. The functions of word duplication in Indonesian languages

    NARCIS (Netherlands)

    Gonda, J.

    1949-01-01

    Abstract In this paper, which is not intended to give an exhaustive collection of word-types, the author tries to review and to systematize a number of the most characteristic meanings of duplication (and reduplication) in Indonesian languages and to look more closely into some aspects of these

  5. Alimentary tract duplications in children: Report of 16 years′ experience

    Directory of Open Access Journals (Sweden)

    Mohamed Zouari

    2014-01-01

    Full Text Available Background: Alimentary tract duplications (ATDs are a rare condition in children, characterised by a large pathogenic, clinical, and histological polymorphism. Surgical observation and pathologic evaluation of the resected specimens are the only way to confirm the diagnosis. In this study, we want to analyse the anatomical, clinical and therapeutic aspects of this entity. Patients and Methods: A total of 12 cases of ATD were diagnosed over a 16-year period at paediatric surgery department. The diagnosis was evoked on clinical and radiological data. Histological study of the resected specimens confirmed the diagnosis in all cases. Results: The mean age of patients at diagnosis was 41 months with a peak of incidence at the 1 st year of life (42%. Out of a total 12 cases, 10 were girls and 2 were boys. Abdominal pain and vomiting were the most frequent presenting features. Ultrasonography, tomodensitometry and magnetic resonance imaging were useful for diagnosis. ATDs were localised on the oesophagus in one case, the stomach in one case, the duodenum in four cases, the ileum in five cases, and the colon in one case. All these duplications were cystic, with three communicating duplications. All patients underwent surgery, and resection procedure was chosen according to duplication type and site. Histological study confirmed the diagnosis in all cases. Conclusion: ATDs are a rare condition in children. Diagnosis relies on histology, and treatment can only be by means of surgery. The outcome after surgery is generally favourable. Diagnosis and precocious surgery of ATDs can warn serious complications.

  6. “Clavicular duplication causing thoracic outlet obstruction”: Unique ...

    African Journals Online (AJOL)

    A 22‑year‑old female student reported with features of neurogenic thoracic outlet syndrome mainly involving C8‑T1 components of the brachial plexus, seemingly originating from involvement in costo‑clavicular space. Radiograph of the shoulder revealed clavicular duplication. Neuro‑physiological studies corroborated the ...

  7. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...

  8. Status of JAERI tandem accelerator

    Energy Technology Data Exchange (ETDEWEB)

    Yoshida, Tadashi; Kanda, Susumu; Takeuchi, Suehiro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment] (and others)

    2001-02-01

    JAERI Tandem Accelerator had been operated approximately 230 days in fiscal year of 1999. Meanwhile, we had three times of maintenance period with vent. Total operation-times were 5273 hours. We could not carry out the experiment using rare gas, due to malfunction of the RF power supply for the ECR ion source. The type of the RF power supply is peculiar and it is impossible to get spare parts for repair. We are now investigating the backup RF power supply. The power supply for the magnet became unstable due to degradation of insulation in the shunt resistance, which is used for feedback stabilization. Stability was recovered after cleaning. The acrylic resin shaft was cracked. This cracks have a potential for severe accidents. So far bearing of the shaft has no problem. The reason of cracks may be self-destruction by charge accumulation in the shaft. JAERI Tandem Accelerator is approximately 20 years old. There appear requirements on the higher ion currents for additional ion species. Therefore, authors are investigating cost effective improvement plans of RFQ (Radio Frequency Quadra-pole) and IH type accelerator based on KEK (High Energy Accelerator Research Organization) R and D. As a whole, maintenance services for the control system are increasing due to some changes of computer programs. There are some difficulties to keep skilled personnel for facilities operation. Authors are gradually increasing hired personnel with contract from 1993. However, loads for JAERI permanent staffs are still heavy. It takes much longer time to educate skilled persons especially for safety. (Y. Tanaka)

  9. Oak Ridge 25URC tandem accelerator 1994 SNEAP lab report

    International Nuclear Information System (INIS)

    Alton, G.D.; Dinehart, M.R.; Dowling, D.T.

    1994-01-01

    The 25URC tandem accelerator is still in shut-down mode until the facility is reconfigured to produce radioactive ion beams (RIBs). Again, the authors have operated approximately 200 hours for ion implantation studies in support of RIB development. Operation of the accelerator has been generally very reliable with most problems being associated with power supplies and components located outside the accelerator. The major operational problem this year was the development of internal shorts in the coils of the energy-analyzing magnet which caused beam instability. The major development activity for the tandem accelerator was the replacement of the corona-point voltage-grading system with resistors. Several milestones for the RIB project have been met since SNEAP 1993. The high-voltage platforms have been built and tested at the required 300 kV. Most equipment has been installed on the platforms so that the first beam can be developed using the Mark I target-ion source. This ion source was characterized on the ion source test facility before moving it to the platform. The second-stage mass-separator magnets have been specified and the contract has been awarded to Sigma Phi. The final optics design for the beam line from the second-stage separator to the tandem accelerator is being completed and equipment and controls are being procured

  10. Tandem collimators for the JET tangential gamma-ray spectrometer

    International Nuclear Information System (INIS)

    Soare, Sorin; Balshaw, Nick; Blanchard, Patrick; Craciunescu, Teddy; Croft, David; Curuia, Marian; Edlington, Trevor; Kiptily, Vasily; Murari, Andrea; Prior, Phil; Sanders, Steven; Syme, Brian; Zoita, Vasile

    2011-01-01

    The tangential gamma-ray spectrometer (TGRS) of the JET tokamak fusion facility is an important diagnostics for investigating the fast particle evolution. A well defined field of view for the TGRS diagnostics is essential for its proper operation and this is to be determined by a rather complex system of collimators and shields both for the neutron and gamma radiations. A conceptual design for this system has been carried out with the main design target set to maximize the signal-to-background ratio at the spectrometer detector, the ratio being defined in terms of the plasma emitted gamma radiation and the gamma-ray background. As a first phase of the TGRS diagnostics upgrade a set of two tandem collimators has been designed with the aim of determining a quasi-tangential field of view through JET tokamak plasmas. A modular design of the tandem system has been developed in order to allow for the construction of different configurations for deuterium and deuterium-tritium discharges. The internal structure of the collimators consists of nuclear grade lead and high density polyethylene slabs arranged in an optimized pattern. The performance of a simplified geometry of the tandem collimator configuration has been evaluated by neutron and photon transport calculations and the numerical results show that the design parameters can be attained.

  11. FUNCTIONAL SPECIALIZATION OF DUPLICATED FLAVONOID BIOSYNTHESIS GENES IN WHEAT

    Directory of Open Access Journals (Sweden)

    Khlestkina E.

    2012-08-01

    Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.

  12. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  13. Tandem catalysis: a new approach to polymers.

    Science.gov (United States)

    Robert, Carine; Thomas, Christophe M

    2013-12-21

    The creation of polymers by tandem catalysis represents an exciting frontier in materials science. Tandem catalysis is one of the strategies used by Nature for building macromolecules. Living organisms generally synthesize macromolecules by in vivo enzyme-catalyzed chain growth polymerization reactions using activated monomers that have been formed within cells during complex metabolic processes. However, these biological processes rely on highly complex biocatalysts, thus limiting their industrial applications. In order to obtain polymers by tandem catalysis, homogeneous and enzyme catalysts have played a leading role in the last two decades. In the following feature article, we will describe selected published efforts to achieve these research goals.

  14. Tandem Mirror Reactor Systems Code (Version I)

    International Nuclear Information System (INIS)

    Reid, R.L.; Finn, P.A.; Gohar, M.Y.

    1985-09-01

    A computer code was developed to model a Tandem Mirror Reactor. Ths is the first Tandem Mirror Reactor model to couple, in detail, the highly linked physics, magnetics, and neutronic analysis into a single code. This report describes the code architecture, provides a summary description of the modules comprising the code, and includes an example execution of the Tandem Mirror Reactor Systems Code. Results from this code for two sensitivity studies are also included. These studies are: (1) to determine the impact of center cell plasma radius, length, and ion temperature on reactor cost and performance at constant fusion power; and (2) to determine the impact of reactor power level on cost

  15. Instruction manual for ORNL tandem high abundance sensitivity mass spectrometer

    International Nuclear Information System (INIS)

    Smith, D.H.; McKown, H.S.; Chrisite, W.H.; Walker, R.L.; Carter, J.A.

    1976-06-01

    This manual describes the physical characteristics of the tandem mass spectrometer built by Oak Ridge National Laboratory for the International Atomic Energy Agency. Specific requirements met include ability to run small samples, high abundance sensitivity, good precision and accuracy, and adequate sample throughput. The instrument is capable of running uranium samples as small as 10 -12 g and has an abundance sensitivity in excess of 10 6 . Precision and accuracy are enhanced by a special sweep control circuit. Sample throughput is 6 to 12 samples per day. Operating instructions are also given

  16. Discovery of previously unidentified genomic disorders from the duplication architecture of the human genome

    NARCIS (Netherlands)

    Sharp, Andrew J.; Hansen, Sierra; Selzer, Rebecca R.; Cheng, Ze; Regan, Regina; Hurst, Jane A.; Stewart, Helen; Price, Sue M.; Blair, Edward; Hennekam, Raoul C.; Fitzpatrick, Carrie A.; Segraves, Rick; Richmond, Todd A.; Guiver, Cheryl; Albertson, Donna G.; Pinkel, Daniel; Eis, Peggy S.; Schwartz, Stuart; Knight, Samantha J. L.; Eichler, Evan E.

    2006-01-01

    Genomic disorders are characterized by the presence of flanking segmental duplications that predispose these regions to recurrent rearrangement. Based on the duplication architecture of the genome, we investigated 130 regions that we hypothesized as candidates for previously undescribed genomic

  17. Efficient Algorithms for Analyzing Segmental Duplications, Deletions, and Inversions in Genomes

    Science.gov (United States)

    Kahn, Crystal L.; Mozes, Shay; Raphael, Benjamin J.

    Segmental duplications, or low-copy repeats, are common in mammalian genomes. In the human genome, most segmental duplications are mosaics consisting of pieces of multiple other segmental duplications. This complex genomic organization complicates analysis of the evolutionary history of these sequences. Earlier, we introduced a genomic distance, called duplication distance, that computes the most parsimonious way to build a target string by repeatedly copying substrings of a source string. We also showed how to use this distance to describe the formation of segmental duplications according to a two-step model that has been proposed to explain human segmental duplications. Here we describe polynomial-time exact algorithms for several extensions of duplication distance including models that allow certain types of substring deletions and inversions. These extensions will permit more biologically realistic analyses of segmental duplications in genomes.

  18. Laparoscopic excision of an ascending colon duplication cyst in an adolescent

    Directory of Open Access Journals (Sweden)

    Heather R. Nolan

    2016-01-01

    Full Text Available Colonic intestinal duplications are infrequent and rarely present past early childhood. We present the case of a large, ascending colon duplication in a 17-year-old boy resected using minimally invasive techniques. This appears to be the first reported case of a laparoscopic en-bloc ascending colon duplication resection in an adolescent. The diagnosis and management of colonic duplications are discussed.

  19. Recurrent rectal prolapse caused by colonic duplication in a dog.

    Science.gov (United States)

    Landon, B P; Abraham, L A; Charles, J A; Edwards, G A

    2007-09-01

    A 9-month-old female Shar Pei cross-bred dog was presented with a history of recurrent rectal prolapse over 7 months. Repeated reduction and anal purse string sutures and subsequent incisional colopexy failed to prevent recurrent rectal prolapse. Digital rectal examination following reduction of the prolapse identified a faeces-filled sac within the ventral wall of the rectum and an orifice in the ventral colonic wall, cranial to the pubic brim. A ventral, communicating tubular colonic duplication was diagnosed by means of a barium enema. Surgical excision of the duplicated colonic tube was performed via a caudal ventral midline laparotomy. At 20 weeks post-operation, there has been no recurrence of rectal prolapse.

  20. Reversion in variants from a duplication strain of Aspergillus nidulans

    International Nuclear Information System (INIS)

    Menezes, E.M.; Azevedo, J.L.

    1978-01-01

    Strains of Aspergillus nidulans with a chromosome segment in duplicate, one in normal position and one translocated to another chromosome, are unstable at mitosis. In addition to variants which result from deletions in either of the duplicate segments, which usually have improved morphology, they produce variants with deteriorated morphology. Three deteriorated variants reverted frequently to parental type morphology, both spontaneously and after ultra-violet treatment. Of six reversions analysed genetically, five were due to suppressors and one was probably due to back mutation. The suppressors segregated as single genes and were not linked to the mutation which they suppress. The instability of these so-called 'deteriorated' variants is discussed in relation to mitotic instability phenomena in A. nidulans. (orig.) [de

  1. TASKA - Tandem Spiegelmaschine Karlsruhe. Vol. 1

    International Nuclear Information System (INIS)

    1982-06-01

    TASKA (Tandem Spiegelmaschine Karlsruhe) is a near term engineering test facility based on a tandem mirror concept with thermal barriers. The main objectives of this study were to develop a preconceptual design of a facility that could provide engineering design information for a Demonstration Fusion Power Reactor. Thus TASKA has to serve as testbed for technologies of plasma engineering, superconducting magnets, materials, plasma heating, breeding and test blankets, tritium technology, and remote handling. (orig.) [de

  2. Feasibility study on tandem fuel cycle

    International Nuclear Information System (INIS)

    Han, P.S.; Suh, I.S.; Rim, C.S.; Kim, B.K.; Suh, K.S.; Ro, S.K.; Juhn, P.I.; Kim, S.Y.

    1983-01-01

    The objective of this feasibility study is to review and assess the current state of technology concerning the tandem fuel cycle. Based on the results from this study, a long-term development plan suitable for Korea has been proposed for this cycle, i.e., the PWR → CANDU tandem fuel cycle which used plutonium and uranium, recovered from spent PWR fuel by co-processing, as fuel material for CANDU reactors. (Author)

  3. TASKA - Tandem Spiegelmaschine Karlsruhe. Vol. 2

    International Nuclear Information System (INIS)

    1982-06-01

    TASKA (Tandem Spiegelmaschine Karlsruhe) is a near term engineering test facility based on a tandem mirror concept with thermal barriers. The main objectives of this study were to develop a preconceptual design of a facility that could provide engineering design information for a Demonstration Fusion Power Reactor. Thus TASKA has to serve as testbed for technologies of plasma engineering, superconducting magnets, materials, plasma heating, breeding and test blankets, tritium technology, and remote handling. (orig.) [de

  4. North-American MP Tandem accelerators

    International Nuclear Information System (INIS)

    Wegner, H.E.; Thieberger, P.

    1977-01-01

    There are six North-American MP Tandem accelerators: Yale; Minnesota; Chalk River; Rochester; and two at Brookhaven. The current status and operating characteristics of these six tandem accelerators are discussed. Upgrade and special improvements of the different machines is reviewed and new developments since the last Electrostatic Conference are discussed in detail. The overall operating characteristics of the different machines during the last year of operation are compared

  5. Duplication of the glans penis manifested at puberty.

    Science.gov (United States)

    Gentileschi, S; Bracaglia, R; Seccia, A; Farallo, E

    2006-01-01

    We report the case of a complete duplication of the glans, with prepuce and a blind end urethra just proximal to the dorsal aspect of the balanopreputial fold. The malformation was not evident at birth and during childhood, and became manifest only at puberty, with the growth of the external genitalia. It was not associated with other urinary malformations. Surgical excision was easy and uneventful.

  6. Delusion of fetal duplication in a Capgras patient.

    Science.gov (United States)

    Silva, J A; Leong, G B; Longhitano, M; Botello, T E

    1991-02-01

    A case of Capgras syndrome in a pregnant patient is described. In addition to perceiving living family members as impostors, she believed that there was a double or twin of her fetus. She conceptualized her "twins" differently than the way she viewed doubles of family members. Her fetus may represent the youngest "person" to have been duplicated. The relationship of Capgras syndrome to misidentification phenomena is discussed.

  7. Grebe syndrome with bilateral fibular hemimelia and thumb duplication

    International Nuclear Information System (INIS)

    Rao, Narasimha; Joseph, Benjamin

    2002-01-01

    Grebe syndrome is a rare recessively inherited form of short-limbed dwarfism. Among the skeletal anomalies reported in the past, complete fibular hemimelia and thumb duplication have not been documented. We report a case of Grebe syndrome with these associated anomalies and review the various skeletal anomalies reported in the literature related to this syndrome. Awareness of the skeletal anomalies that can occur in this syndrome should enable an accurate diagnosis. (orig.)

  8. Grebe syndrome with bilateral fibular hemimelia and thumb duplication

    Energy Technology Data Exchange (ETDEWEB)

    Rao, Narasimha; Joseph, Benjamin [Department of Orthopaedics, Kasturba Medical College, Karnataka State (India)

    2002-03-01

    Grebe syndrome is a rare recessively inherited form of short-limbed dwarfism. Among the skeletal anomalies reported in the past, complete fibular hemimelia and thumb duplication have not been documented. We report a case of Grebe syndrome with these associated anomalies and review the various skeletal anomalies reported in the literature related to this syndrome. Awareness of the skeletal anomalies that can occur in this syndrome should enable an accurate diagnosis. (orig.)

  9. Efficient image duplicated region detection model using sequential block clustering

    Czech Academy of Sciences Publication Activity Database

    Sekeh, M. A.; Maarof, M. A.; Rohani, M. F.; Mahdian, Babak

    2013-01-01

    Roč. 10, č. 1 (2013), s. 73-84 ISSN 1742-2876 Institutional support: RVO:67985556 Keywords : Image forensic * Copy–paste forgery * Local block matching Subject RIV: IN - Informatics, Computer Science Impact factor: 0.986, year: 2013 http://library.utia.cas.cz/separaty/2013/ZOI/mahdian-efficient image duplicated region detection model using sequential block clustering.pdf

  10. Partial craniofacial duplication: a review of the literature and case report.

    Science.gov (United States)

    Costa, Melinda A; Borzabadi-Farahani, Ali; Lara-Sanchez, Pedro A; Schweitzer, Daniela; Jacobson, Lia; Clarke, Noreen; Hammoudeh, Jeffery; Urata, Mark M; Magee, William P

    2014-06-01

    Diprosopus (Greek; di-, "two" + prosopon, "face"), or craniofacial duplication, is a rare craniofacial anomaly referring to the complete duplication of facial structures. Partial craniofacial duplication describes a broad spectrum of congenital anomalies, including duplications of the oral cavity. This paper describes a 15 month-old female with a duplicated oral cavity, mandible, and maxilla. A Tessier type 7 cleft, midline meningocele, and duplicated hypophysis were also present. The preoperative evaluation, surgical approach, postoperative results, and a review of the literature are presented. The surgical approach was designed to preserve facial nerve innervation to the reconstructed cheek and mouth. The duplicated mandible and maxilla were excised and the remaining left maxilla was bone grafted. Soft tissue repair included closure of the Tessier type VII cleft. Craniofacial duplication remains a rare entity that is more common in females. The pathophysiology remains incompletely characterized, but is postulated to be due to duplication of the notochord, as well as duplication of mandibular growth centres. While diprosopus is a severe deformity often associated with anencephaly, patients with partial duplication typically benefit from surgical treatment. Managing craniofacial duplication requires a detailed preoperative evaluation as well as a comprehensive, staged treatment plan. Long-term follow up is needed appropriately to address ongoing craniofacial deformity. Published by Elsevier Ltd.

  11. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    NARCIS (Netherlands)

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes.

  12. Adenocarcinoma within a rectal duplication cyst: case report and literature review.

    Science.gov (United States)

    Michael, D; Cohen, C R; Northover, J M

    1999-05-01

    Intestinal duplications are uncommon but recognised developmental anomalies. Duplications of the rectum are the most uncommon of these anomalies. They may present with perianal fistulae, bleeding, a pelvic mass or symptoms produced by a mass, or, rarely, malignant change. We present a case of an adenocarcinoma within a rectal duplication cyst which was initially thought to be inoperable but was treated by radical surgery.

  13. Vortex shedding from tandem cylinders

    Science.gov (United States)

    Alam, Md. Mahbub; Elhimer, Mehdi; Wang, Longjun; Jacono, David Lo; Wong, C. W.

    2018-03-01

    An experimental investigation is conducted on the flow around tandem cylinders for ranges of diameter ratio d/ D = 0.25-1.0, spacing ratio L/ d = 5.5-20, and Reynolds number Re = 0.8 × 104-2.42 × 104, where d and D are the diameters of the upstream and downstream cylinders, respectively, L is the distance from the upstream cylinder center to the forward stagnation point of the downstream one. The focus is given on examining the effects of d/ D, L/ d and Re on Strouhal number St, flow structures and fluid forces measured using hotwire, particle image velocimetry (PIV) and load cell measurement techniques, respectively. Changes in d/ D and L/ d in the ranges examined lead to five flow regimes, namely lock-in, intermittent lock-in, no lock-in, subharmonic lock-in and shear-layer reattachment regimes. Time-mean drag coefficient ( C D) and fluctuating drag and lift coefficients ({C^'D} and {C^'L}) are more sensitive to L/ d than d/ D. The scenario is opposite for St where d/ D is more prominent than L/ d to change the St. The detailed facet of the dependence on d/ D and L/ d of C D, {C^'D}, {C^'L} and St is discussed based on shear-layer velocity, approaching velocity, vortex formation length, and wake width.

  14. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  15. Intake of radioactive materials as assessed by the duplicate diet method in Fukushima

    International Nuclear Information System (INIS)

    Sato, Osamu; Nonaka, Shunkichi; Tada, Jun Ichiro

    2013-01-01

    A large quantity of radioactive materials was released from Reactor-II of the Fukushima Daiichi Nuclear Power Plant (F-1 NPP). People living in the area affected by the release are concerned about internal exposures from the daily intakes of contaminated foodstuffs. In order to assess whether the people should be concerned, Co-op Fukushima (Consumer Co-operative in Fukushima Prefecture) conducted a broad survey of radiocaesium in daily meals for which local inhabitants voluntarily provided a set of duplicate meals. Analyses by the duplicate diet method were conducted from November 2011 to March 2012 and from June 2012 to September 2012, each covering 100 families throughout the prefecture. Among the 200 meals thus analysed, 12 were found to have 134 Cs and/or 137 Cs concentrations exceeding 1 Bq kg −1 . Even with the largest radiocaesium value in our survey, daily consumption of such meals throughout a year gave an annual committed effective dose that did not exceed 0.1 mSv. (paper)

  16. Cep63 and cep152 cooperate to ensure centriole duplication.

    Directory of Open Access Journals (Sweden)

    Nicola J Brown

    Full Text Available Centrosomes consist of two centrioles embedded in pericentriolar material and function as the main microtubule organising centres in dividing animal cells. They ensure proper formation and orientation of the mitotic spindle and are therefore essential for the maintenance of genome stability. Centrosome function is crucial during embryonic development, highlighted by the discovery of mutations in genes encoding centrosome or spindle pole proteins that cause autosomal recessive primary microcephaly, including Cep63 and Cep152. In this study we show that Cep63 functions to ensure that centriole duplication occurs reliably in dividing mammalian cells. We show that the interaction between Cep63 and Cep152 can occur independently of centrosome localisation and that the two proteins are dependent on one another for centrosomal localisation. Further, both mouse and human Cep63 and Cep152 cooperate to ensure efficient centriole duplication by promoting the accumulation of essential centriole duplication factors upstream of SAS-6 recruitment and procentriole formation. These observations describe the requirement for Cep63 in maintaining centriole number in dividing mammalian cells and further establish the order of events in centriole formation.

  17. Operative correction and follow-up of craniofacial duplication.

    Science.gov (United States)

    Kotrikova, Bibiana; Hassfeld, Stefan; Steiner, Hans H; Hähnel, Stefan; Krempien, Robert; Mühling, Joachim

    2007-03-01

    Anterior craniofacial duplication (diprosopus) is an extremely rare form of conjoined twins. The children share a single trunk with normal extremities and varying degrees of facial malformation. Duplication of specific structures, such as the nose (diprosopus dirrhinus), eyes (diprosopus tetraophthalmus), and ears, is possible. The authors present a case of partial facial duplication (diprosopus dirrhinus) in a male infant. The clinical and radiographic findings and the surgical correction and follow-up are described. In a single surgical session, the authors were able to achieve not only a functionally but also an aesthetically acceptable result. In the postoperative course, the child showed nearly normal growth and satisfactory psychosocial and motor development. However, 40 months postoperatively, we noticed a tendency of the orbitae to diverge (i.e., toward hypertelorism). The surgical management of complex craniofacial malformations such as diprosopus needs a precise morphologic analysis of the patient's deformity followed by a clear treatment plan. A staged reconstructive approach is carried out to coincide with facial growth patterns and brain and eye function. If the interorbital distance in our patient increases progressively, a second operation for reduction of the interorbital distance may be necessary.

  18. Using sea urchin gametes and zygotes to investigate centrosome duplication.

    Science.gov (United States)

    Sluder, Greenfield

    2016-01-01

    Centriole structure and function in the sea urchin zygote parallel those in mammalian somatic cells. Here, I briefly introduce the properties and attributes of the sea urchin system that make it an attractive platform for the study of centrosome and centriole duplication. These attributes apply to all echinoderms readily available from commercial suppliers: sea urchins, sand dollars, and starfish. I list some of the practical aspects of the system that make it a cost- and time-effective system for experimental work and then list properties that are a "tool kit" that can be used to conduct studies that would not be practical, or in some cases not possible, with mammalian somatic cells. Since centrioles organize and localize the pericentriolar material that nucleates the astral arrays of microtubules (Bobinnec et al. in J Cell Biol 143(6):1575-1589, 1998), the pattern of aster duplication over several cell cycles can be used as a reliable measure for centriole duplication (Sluder and Rieder in J Cell Biol 100(3):887-896, 1985). Descriptions of the methods my laboratory has used to handle and image echinoderm zygotes are reviewed in Sluder et al. (Methods Cell Biol 61:439-472, 1999). Also included is a bibliography of papers that describe additional methods.

  19. Williams Syndrome and 15q Duplication: Coincidence versus Association.

    Science.gov (United States)

    Khokhar, Aditi; Agarwal, Swashti; Perez-Colon, Sheila

    2017-01-01

    Williams syndrome is a multisystem disorder caused by contiguous gene deletion in 7q11.23, commonly associated with distinctive facial features, supravalvular aortic stenosis, short stature, idiopathic hypercalcemia, developmental delay, joint laxity, and a friendly personality. The clinical features of 15q11q13 duplication syndrome include autism, mental retardation, ataxia, seizures, developmental delay, and behavioral problems. We report a rare case of a girl with genetically confirmed Williams syndrome and coexisting 15q duplication syndrome. The patient underwent treatment for central precocious puberty and later presented with primary amenorrhea. The karyotype revealed 47,XX,+mar. FISH analysis for the marker chromosome showed partial trisomy/tetrasomy for proximal chromosome 15q (15p13q13). FISH using an ELN -specific probe demonstrated a deletion in the Williams syndrome critical region in 7q11.23. To our knowledge, a coexistence of Williams syndrome and 15q duplication syndrome has not been reported in the literature. Our patient had early pubertal development, which has been described in some patients with Williams syndrome. However, years later after discontinuing gonadotropin-releasing hormone analogue treatment, she developed primary amenorrhea.

  20. A salmonid EST genomic study: genes, duplications, phylogeny and microarrays

    Directory of Open Access Journals (Sweden)

    Brahmbhatt Sonal

    2008-11-01

    Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is

  1. Simultaneous quantification of α-lactalbumin and β-casein in human milk using ultra-performance liquid chromatography with tandem mass spectrometry based on their signature peptides and winged isotope internal standards.

    Science.gov (United States)

    Chen, Qi; Zhang, Jingshun; Ke, Xing; Lai, Shiyun; Li, Duo; Yang, Jinchuan; Mo, Weimin; Ren, Yiping

    2016-09-01

    In recent years, there is an increasing need to measure the concentration of individual proteins in human milk, instead of total human milk proteins. Due to lack of human milk protein standards, there are only few quantification methods established. The objective of the present work was to develop a simple and rapid quantification method for simultaneous determination of α-lactalbumin and β-casein in human milk using signature peptides according to a modified quantitative proteomics strategy. The internal standards containing the signature peptide sequences were synthesized with isotope-labeled amino acids. The purity of synthesized peptides as standards was determined by amino acid analysis method and area normalization method. The contents of α-lactalbumin and β-casein in human milk were measured according to the equimolar relationship between the two proteins and their corresponding signature peptides. The method validation results showed a satisfied linearity (R(2)>0.99) and recoveries (97.2-102.5% for α-lactalbumin and 99.5-100.3% for β-casein). The limit of quantification for α-lactalbumin and β-casein was 8.0mg/100g and 1.2mg/100g, respectively. CVs for α-lactalbumin and β-casein in human milk were 5.2% and 3.0%. The contents of α-lactalbumin and β-casein in 147 human milk samples were successfully determined by the established method and their contents were 205.5-578.2mg/100g and 116.4-467.4mg/100g at different lactation stages. The developed method allows simultaneously determination of α-lactalbumin and β-casein in human milk. The quantitative strategy based on signature peptide should be applicable to other endogenous proteins in breast milk and other body fluids. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Robust Tension Control of Strip for 5-Stand Tandem Cold Mills

    Directory of Open Access Journals (Sweden)

    Behrooz Shafiei

    2014-01-01

    Full Text Available Tandem cold rolling process is a nonlinear complex system with external and internal uncertainties and significant disturbances. The improvement in the quality of the final output depends on the control strategy of centerline thickness and interstand tension. This paper focuses on interstand tension control problem in 5-stand tandem cold rolling mills. Tension dynamics can be described by a nominal model perturbed by parametric uncertainties. In order to overcome the model uncertainties and external disturbances, suboptimal H∞ and μ controllers are proposed and the Hankel-norm approximation is used to reduce the order of μ controller. The performance of the proposed controllers is demonstrated by some simulations.

  3. Glucose and glycerol concentrations and their tracer enrichment measurements using liquid chromatography tandem mass spectrometry

    DEFF Research Database (Denmark)

    Bornø, Andreas; Foged, Lene; van Hall, Gerrit

    2014-01-01

    The present study describes a new liquid chromatography tandem mass spectrometry method for high-throughput quantification of glucose and glycerol in human plasma using stable isotopically labeled internal standards and is suitable for simultaneous measurements of glucose and glycerol enrichments...... of variation were 2.0% and 9.7%, respectively. After derivatization, plasma samples were stable for at least 14 days. In conclusion, we have developed and validated a novel, accurate, and sensitive high-throughput liquid chromatography tandem mass spectrometry method for simultaneous determination of glucose...

  4. Adenocarcinoma arising in rectal duplication cyst: case report and review of the literature.

    Science.gov (United States)

    Shivnani, Anand T; Small, William; Benson, Al; Rao, Sambasiva; Talamonti, Mark S

    2004-11-01

    Duplication cyst of the gastrointestinal (GI) tract is a rare congenital anomaly, and rectal duplication cysts comprise a small fraction these cases. Most patients present for the first time in adulthood, and the origin of rectal duplication cysts is unclear. Prior series document malignant transformation in approximately 20 per cent of cases. The following case report describes a carcinoma arising in a rectal duplication cyst. Given the lack of data demonstrating adequate control for patients with adenocarcinoma arising in a rectal duplication cyst and our experience with this patient, we recommend all patients undergo multidisciplinary evaluation prior to any therapy.

  5. The evolutionary duplication and probable demise of an endodermal GATA factor in Caenorhabditis elegans.

    Science.gov (United States)

    Fukushige, Tetsunari; Goszczynski, Barbara; Tian, Helen; McGhee, James D

    2003-10-01

    WGATAR sequences); ELT-4 protein neither enhanced nor inhibited the strong sequence-specific binding of the ELT-2 protein. Whereas ELT-2 protein is a strong transcriptional activator in yeast, ELT-4 protein has no such activity under similar conditions, nor does it influence the transcriptional activity of coexpressed ELT-2 protein. Although an elt-2 homolog was easily identified in the genomic sequence of the related nematode C. briggsae, no elt-4 homolog could be identified. Analysis of the changes in silent third codon positions within the DNA-binding domains indicates that elt-4 arose as a duplication of elt-2, some 25-55 MYA. Thus, elt-4 has survived far longer than the average duplicated gene in C. elegans, even though no obvious biological function could be detected. elt-4 provides an interesting example of a tandemly duplicated gene that may originally have been the same size as elt-2 but has gradually been whittled down to its present size of little more than a zinc finger. Although elt-4 must confer (or must have conferred) some selective advantage to C. elegans, we suggest that its ultimate evolutionary fate will be disappearance from the C. elegans genome.

  6. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes.

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu

    2016-09-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.

  7. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes1[OPEN

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu

    2016-01-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883

  8. Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.

    Science.gov (United States)

    Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M

    2017-08-01

    Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.

  9. Bias and efficiency loss in regression estimates due to duplicated observations: a Monte Carlo simulation

    Directory of Open Access Journals (Sweden)

    Francesco Sarracino

    2017-04-01

    Full Text Available Recent studies documented that survey data contain duplicate records. We assess how duplicate records affect regression estimates, and we evaluate the effectiveness of solutions to deal with duplicate records. Results show that the chances of obtaining unbiased estimates when data contain 40 doublets (about 5% of the sample range between 3.5% and 11.5% depending on the distribution of duplicates. If 7 quintuplets are present in the data (2% of the sample, then the probability of obtaining biased estimates ranges between 11% and 20%. Weighting the duplicate records by the inverse of their multiplicity, or dropping superfluous duplicates outperform other solutions in all considered scenarios. Our results illustrate the risk of using data in presence of duplicate records and call for further research on strategies to analyze affected data.

  10. Tandem mass spectrometry at low kinetic energy

    International Nuclear Information System (INIS)

    Cooks, R.G.; Hand, O.W.

    1987-01-01

    Recent progress in mass spectrometry, as applied to molecular analysis, is reviewed with emphasis on tandem mass spectrometry. Tandem instruments use multiple analyzers (sector magnets, quadrupole mass filters and time-of-flight devices) to select particular molecules in ionic form, react them in the gas-phase and then record the mass, momenta or kinetic energies of their products. The capabilities of tandem mass spectrometry for identification of individual molecules or particular classes of compounds in complex mixtures are illustrated. Several different types of experiments can be run using a tandem mass spectrometer; all share the feature of sifting the molecular mixture being analyzed on the basis of chemical properties expressed in terms of ionic mass, kinetic energy or charge state. Applications of mass spectrometry to biological problems often depend upon desorption methods of ionization in which samples are bombarded with particle beams. Evaporation of preformed charged species from the condensed phase into the vacuum is a particularly effective method of ionization. It is suggested that the use of accelerator mass spectrometers be extended to include problems of molecular analysis. In such experiments, low energy tandem mass spectrometry conducted in the eV or keV range of energies, would be followed by further characterization of the production ion beam using high selective MeV collision processes

  11. No significant effect of monosomy for distal 21q22. 3 on the Down syndrom phenotype in mirror' duplications of chromosome 21

    Energy Technology Data Exchange (ETDEWEB)

    Pangalos, C.; Prieur, M.; Rethore, M.O.; Lejeune, J. (Institut de Progenese, Paris (France)); Theophile, D.; Sinet, P.M.; Chettouh, Z.; Delabar, J.M. (Hopital Necker Enfants Malades, Paris (France)); Marks, A. (Univ. of Toronto, Ontario (Canada)); Stamboulieh-Abazis, D. (Diagnostic Genetic Center, Athens (Greece)); Verellen, C. (Centre de Genetique Humaine, Brussels (Belgium))

    1992-12-01

    Three Down syndrome patients for whom karyotypic analysis showed a mirror' (reverse tandem) duplication of chromosome 21 were studied by phenotypic, cytogenetic, and molecular methods. On high-resolution R-banding analysis performed in two cases, the size of the fusion 21q22.3 band was apparently less than twice the size of the normal 21q22.3, suggesting a partial deletion of distal 21q. The evaluation of eight chromosome 21 single-copy sequences of the 21q22 region - namely, SOD1, D21S15, D21S42, CRYA1, PFKL, CD18, COL6A1, and S100B - by a slot blot method showed in all three cases a partial deletion of 21q22.3 and partial monosomy. The translocation breakpoints were different in each patient, and in two cases the rearranged chromosome was found to be asymmetrical. The molecular definition of the monosomy 21 in each patient was, respectively, COL6A1-S100B, CD18-S100B, and PFKL-S100B. DNA polymorphism analysis indicated in all cases a homozygosity of the duplicated material. The duplicated region was maternal in two patients and paternal in one patient. These data suggest that the reverse tandem chromosomes did not result from a telomeric fusion between chromosomes 21 but from a translocation between sister chromatids. The phenotypes of these patients did not differ significantly from that of individuals with full trisomy 21, except in one case with large ears with an unfolded helix. The fact that monosomy of distal 21q22.3 in these patients resulted in a phenotype very similar to Down syndrome suggests that the duplication of the genes located in this part of chromosome 21 is not necessary for the pathogenesis of the Down syndrome features observed in these patients, including most of the facial and hand features, muscular hypotonia, cardiopathy of the Fallot tetralogy type, and part of the mental retardation. 54 refs., 5 figs., 3 tabs.

  12. On Computing Breakpoint Distances for Genomes with Duplicate Genes.

    Science.gov (United States)

    Shao, Mingfu; Moret, Bernard M E

    2017-06-01

    A fundamental problem in comparative genomics is to compute the distance between two genomes in terms of its higher level organization (given by genes or syntenic blocks). For two genomes without duplicate genes, we can easily define (and almost always efficiently compute) a variety of distance measures, but the problem is NP-hard under most models when genomes contain duplicate genes. To tackle duplicate genes, three formulations (exemplar, maximum matching, and any matching) have been proposed, all of which aim to build a matching between homologous genes so as to minimize some distance measure. Of the many distance measures, the breakpoint distance (the number of nonconserved adjacencies) was the first one to be studied and remains of significant interest because of its simplicity and model-free property. The three breakpoint distance problems corresponding to the three formulations have been widely studied. Although we provided last year a solution for the exemplar problem that runs very fast on full genomes, computing optimal solutions for the other two problems has remained challenging. In this article, we describe very fast, exact algorithms for these two problems. Our algorithms rely on a compact integer-linear program that we further simplify by developing an algorithm to remove variables, based on new results on the structure of adjacencies and matchings. Through extensive experiments using both simulations and biological data sets, we show that our algorithms run very fast (in seconds) on mammalian genomes and scale well beyond. We also apply these algorithms (as well as the classic orthology tool MSOAR) to create orthology assignment, then compare their quality in terms of both accuracy and coverage. We find that our algorithm for the "any matching" formulation significantly outperforms other methods in terms of accuracy while achieving nearly maximum coverage.

  13. Enhancement of RNA synthesis by promoter duplication in tombusviruses

    International Nuclear Information System (INIS)

    Panavas, T.; Panaviene, Z.; Pogany, J.; Nagy, P.D.

    2003-01-01

    Replication of tombusviruses, small plus-strand RNA viruses of plants, is regulated by cis-acting elements present in the viral RNA. The role of cis-acting elements can be studied in vitro by using a partially purified RNA-dependent RNA polymerase (RdRp) preparation obtained from tombusvirus-infected plants , Virology 276, 279- 288). Here, we demonstrate that the minus-strand RNA of tombusviruses contains, in addition to the 3'-terminal minimal plus-strand initiation promoter, a second cis-acting element, termed the promoter proximal enhancer (PPE). The PPE element enhanced RNA synthesis by almost threefold from the adjacent minimal promoter in the in vitro assay. The sequence of the PPE element is 70% similar to the minimal promoter, suggesting that sequence duplication of the minimal promoter may have been the mechanism leading to the generation of the PPE. Consistent with this proposal, replacement of the PPE element with the minimal promoter, which resulted in a perfectly duplicated promoter region, preserved its enhancer-like function. In contrast, mutagenesis of the PPE element or its replacement with an artificial G/C-rich sequence abolished its stimulative effect on initiation of RNA synthesis in vitro. In vivo experiments are also consistent with the role of the PPE element in enhancement of tombusvirus replication. Sequence comparison of several tombusviruses and related carmoviruses further supports the finding that duplication of minimal promoter sequences may have been an important mechanism during the evolution of cis-acting elements in tombusviruses and related RNA viruses

  14. Dietary intakes of pesticides based on community duplicate diet samples.

    Science.gov (United States)

    Melnyk, Lisa Jo; Xue, Jianping; Brown, G Gordon; McCombs, Michelle; Nishioka, Marcia; Michael, Larry C

    2014-01-15

    The calculation of dietary intake of selected pesticides was accomplished using food samples collected from individual representatives of a defined demographic community using a community duplicate diet approach. A community of nine participants was identified in Apopka, FL from which intake assessments of organophosphate (OP) and pyrethroid pesticides were made. From these nine participants, sixty-seven individual samples were collected and subsequently analyzed by gas chromatography/mass spectrometry. Measured concentrations were used to estimate dietary intakes for individuals and for the community. Individual intakes of total OP and pyrethroid pesticides ranged from 6.7 to 996 ng and 1.2 to 16,000 ng, respectively. The community intake was 256 ng for OPs and 3430 ng for pyrethroid pesticides. The most commonly detected pesticide was permethrin, but the highest overall intake was of bifenthrin followed by esfenvalerate. These data indicate that the community in Apopka, FL, as represented by the nine individuals, was potentially exposed to both OP and pyrethroid pesticides at levels consistent with a dietary model and other field studies in which standard duplicate diet samples were collected. Higher levels of pyrethroid pesticides were measured than OPs, which is consistent with decreased usage of OPs. The diversity of pyrethroid pesticides detected in food samples was greater than expected. Continually changing pesticide usage patterns need to be considered when determining analytes of interest for large scale epidemiology studies. The Community Duplicate Diet Methodology is a tool for researchers to meet emerging exposure measurement needs that will lead to more accurate assessments of intake which may enhance decisions for chemical regulation. Successfully determining the intake of pesticides through the dietary route will allow for accurate assessments of pesticide exposures to a community of individuals, thereby significantly enhancing the research benefit

  15. Evolutionary diversification of plant shikimate kinase gene duplicates.

    Directory of Open Access Journals (Sweden)

    Geoffrey Fucile

    2008-12-01

    Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.

  16. TRStalker: an efficient heuristic for finding fuzzy tandem repeats.

    Science.gov (United States)

    Pellegrini, Marco; Renda, M Elena; Vecchio, Alessio

    2010-06-15

    Genomes in higher eukaryotic organisms contain a substantial amount of repeated sequences. Tandem Repeats (TRs) constitute a large class of repetitive sequences that are originated via phenomena such as replication slippage and are characterized by close spatial contiguity. They play an important role in several molecular regulatory mechanisms, and also in several diseases (e.g. in the group of trinucleotide repeat disorders). While for TRs with a low or medium level of divergence the current methods are rather effective, the problem of detecting TRs with higher divergence (fuzzy TRs) is still open. The detection of fuzzy TRs is propaedeutic to enriching our view of their role in regulatory mechanisms and diseases. Fuzzy TRs are also important as tools to shed light on the evolutionary history of the genome, where higher divergence correlates with more remote duplication events. We have developed an algorithm (christened TRStalker) with the aim of detecting efficiently TRs that are hard to detect because of their inherent fuzziness, due to high levels of base substitutions, insertions and deletions. To attain this goal, we developed heuristics to solve a Steiner version of the problem for which the fuzziness is measured with respect to a motif string not necessarily present in the input string. This problem is akin to the 'generalized median string' that is known to be an NP-hard problem. Experiments with both synthetic and biological sequences demonstrate that our method performs better than current state of the art for fuzzy TRs and that the fuzzy TRs of the type we detect are indeed present in important biological sequences. TRStalker will be integrated in the web-based TRs Discovery Service (TReaDS) at bioalgo.iit.cnr.it. Supplementary data are available at Bioinformatics online.

  17. Duplicated facial nerve trunk with a first branchial cleft cyst.

    Science.gov (United States)

    Hinson, Drew; Poteet, Perry; Bower, Charles

    2014-03-01

    First branchial cleft anomalies are rare and their various anatomical relationships to the facial nerve have been described. We encountered a 15-year-old female with a type II first branchial cleft cyst presenting as a right neck mass that we found during surgical excision to transverse two main facial nerve trunks. To our knowledge, this is the first reported case of a first branchial cleft anomaly in conjunction with a duplicated facial nerve trunk. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.

  18. 10p Duplication characterized by fluorescence in situ hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Wiktor, A.; Feldman, G.L.; Van Dyke, D.L.; Kratkoczki, P.; Ditmars, D.M. Jr. [Henry Ford Hospital, Detroit, MI (United States)

    1994-09-01

    We describe a patient with severe failure to thrive, mild-moderate developmental delay, cleft lip and palate, and other anomalies. Routine cytogenetic analysis documented a de novo chromosome rearrangement involving chromosome 4, but the origin of the derived material was unknown. Using chromosome specific painting probes, the karyotype was defined as 46,XY,der(4)t(4;10)(q35;p11.23). Characterization of the dup(10p) by fluorescence in situ hybridization (FISH) analysis provides another example of the usefulness of this technology in identifying small deletions, duplications, or supernumerary marker chromosomes. 19 refs., 4 figs.

  19. Intragenic Duplication A Novel Mutational Mechanism in Hereditary Pancreatitis

    DEFF Research Database (Denmark)

    Joergensen, M. T.; Geisz, A.; Brusgaard, K.

    2011-01-01

    OBJECTIVES: In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide...... pancreatitis. The accelerated activation of p.K23_I24insIDK by cathepsin B is a unique biochemical property not found in any other pancreatitis-associated trypsinogen mutant. In contrast, the robust autoactivation of the novel mutant confirms the notion that increased autoactivation is a disease......-relevant mechanism in hereditary pancreatitis....

  20. Urethral Triplication Without Bladder Duplication: Endourologic Diagnosis and Management

    Science.gov (United States)

    Ortiz, Ruben; Burgos, Laura; Angulo, Jose Maria

    2018-01-01

    Abstract Urethral triplication is a rare congenital anomaly of the lower urinary system, with urethra ending in glans. At the beginning of toilet training, urine output was observed along the rectum. Rigid cystoscopy shows a perineal urethra starting in the posterior urethra. Subsequently, flexible cystoscopy showed entry of epispadic urethra in the bladder immediately superior to the bladder neck. It was running parallel to primary urethra. Then, we observed two most frequent types of urethral duplication in the sagittal plane in a single patient. PMID:29675475

  1. Bionic Duplication of Fresh Navodon septentrionalis Fish Surface Structures

    Directory of Open Access Journals (Sweden)

    Bing Qu

    2011-01-01

    Full Text Available Biomimetic superhydrophobic surface was fabricated by replicating topography of the fresh fish skin surface of Navodon septentrionalis with polydimethylsiloxane (PDMS elastomer. A two-step replicating method was developed to make the surface structure of the fresh fish skin be replicated with high fidelity. After duplication, it was found that the static contact angle of the replica was as large as 173°. Theoretic analysis based on Young's and Cassie-Baxter (C-B model was performed to explain the relationship between structure and hydrophobicity.

  2. Tracheal Atresia with Segmental Esophageal Duplication: An Unusual Anatomic Arrangement.

    Science.gov (United States)

    Gaerty, Kirsten; Thomas, Joseph T; Petersen, Scott; Tan, Edwin; Kumar, Sailesh; Gardener, Glenn; Armes, Jane

    2016-01-01

    An unusual anatomic configuration of segmental tracheal agenesis/atresia with esophageal duplication on autopsy in a fetus that demised in utero at 29 weeks is reported. The mother was scanned initially for a cardiac anomaly at 20 weeks and on follow-up scan at 27 weeks had polyhydramnios and underwent amnioreduction. The final autopsy diagnosis was vertebral, ano-rectal, cardiac, tracheoesophageal, renal, and limb malformations (VACTERL). We discuss the autopsy findings along with the embryological mechanisms and compare the configuration with Floyd's classification for tracheal agenesis. The difficulties in prenatal diagnosis are discussed.

  3. Esophageal carcinoma originating in a duplication cyst: case report

    Directory of Open Access Journals (Sweden)

    Pimenta Amadeu P. A.

    1997-01-01

    Full Text Available The authors present the case report of a 61-year-old man, admitted with middle third squamous cell esophageal carcinoma. He was submitted to a curative gastroesophageal resection via a medium laparotomy and a right thoracotomy. An intrathoracic esophagogastric anastomosis was performed. The pathological analysis of the surgical specimen revealed a squamous cell carcinoma clearly originating from the epithelial lining of an esophageal duplication cyst. Immunohistochemitry showed p 53 staining of the tumor cells. The patient at 11 month follow up was asymptomatic.

  4. Method of duplicating film using the CR system. Evaluation of detectability in a simulated nodule

    International Nuclear Information System (INIS)

    Fukuyama, Atsushi; Ando, Satoshi; Maeda, Kayoko; Ida, Kazushi; Suzuki, Tomoaki; Fukuyama, Kouichi; Hasegawa, Takeo

    2005-01-01

    Since film processors used for screen-film systems have been decreasing recently, it is becoming difficult to develop duplicating film (Dup film) used conventionally. The purpose of this study was to evaluate the usefulness of the method of duplicating film using a computed radiography (CR) system. The process of duplicating film using CR is to eliminate energy accumulated on the imaging plate (IP) using white light, to accumulate energy on the whole surface, and to place the original film in piles. After an exposure of white light, duplicated films can be obtained by CR system. In order to evaluate the reproducibiliy of our system, duplicated films were read by experienced observers and receiver operating characteristic (ROC) analysis was carried out. Observers read 50 images with a simulated nodule and 50 images without a simulated nodule. The average Az values were 0.94 for the original films, 0.91 for films duplicated using Dup film, and 0.90 for films duplicated using the CR system. When the two-tailed paired-T test was performed for each result, there were no statistically significant differences at p<0.05. The detectability of a simulated nodule for films duplicated using the CR system did not differ from the detectability of films duplicated using Dup film. This method may be a reasonable substitute for the conventional duplication system. (author)

  5. Recurrent Gene Duplication Leads to Diverse Repertoires of Centromeric Histones in Drosophila Species.

    Science.gov (United States)

    Kursel, Lisa E; Malik, Harmit S

    2017-06-01

    Despite their essential role in the process of chromosome segregation in most eukaryotes, centromeric histones show remarkable evolutionary lability. Not only have they been lost in multiple insect lineages, but they have also undergone gene duplication in multiple plant lineages. Based on detailed study of a handful of model organisms including Drosophila melanogaster, centromeric histone duplication is considered to be rare in animals. Using a detailed phylogenomic study, we find that Cid, the centromeric histone gene, has undergone at least four independent gene duplications during Drosophila evolution. We find duplicate Cid genes in D. eugracilis (Cid2), in the montium species subgroup (Cid3, Cid4) and in the entire Drosophila subgenus (Cid5). We show that Cid3, Cid4, and Cid5 all localize to centromeres in their respective species. Some Cid duplicates are primarily expressed in the male germline. With rare exceptions, Cid duplicates have been strictly retained after birth, suggesting that they perform nonredundant centromeric functions, independent from the ancestral Cid. Indeed, each duplicate encodes a distinct N-terminal tail, which may provide the basis for distinct protein-protein interactions. Finally, we show some Cid duplicates evolve under positive selection whereas others do not. Taken together, our results support the hypothesis that Drosophila Cid duplicates have subfunctionalized. Thus, these gene duplications provide an unprecedented opportunity to dissect the multiple roles of centromeric histones. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  6. Mass spectrometry by means of tandem accelerators

    International Nuclear Information System (INIS)

    Tuniz, C.

    1985-01-01

    Mass spectrometry based on an accelerator allows to measure rare cosmogenic isotopes found in natural samples with isotopic abundances up to 10E-15. The XTU Tandem of Legnaro National Laboratories can measure mean heavy isotopes (36Cl, 41Ca, 129I) in applications interesting cosmochronology and Medicine. The TTT-3 Tandem of the Naples University has been modified in view of precision studies of C14 in Archeology, Paleantology and Geology. In this paper a review is made of principles and methodologies and of some applicationy in the framework of the National Program for mass spectrametry research with the aid of accelerators

  7. Drosophila duplication hotspots are associated with late-replicating regions of the genome.

    Directory of Open Access Journals (Sweden)

    Margarida Cardoso-Moreira

    2011-11-01

    Full Text Available Duplications play a significant role in both extremes of the phenotypic spectrum of newly arising mutations: they can have severe deleterious effects (e.g. duplications underlie a variety of diseases but can also be highly advantageous. The phenotypic potential of newly arisen duplications has stimulated wide interest in both the mutational and selective processes shaping these variants in the genome. Here we take advantage of the Drosophila simulans-Drosophila melanogaster genetic system to further our understanding of both processes. Regarding mutational processes, the study of two closely related species allows investigation of the potential existence of shared duplication hotspots, and the similarities and differences between the two genomes can be used to dissect its underlying causes. Regarding selection, the difference in the effective population size between the two species can be leveraged to ask questions about the strength of selection acting on different classes of duplications. In this study, we conducted a survey of duplication polymorphisms in 14 different lines of D. simulans using tiling microarrays and combined it with an analogous survey for the D. melanogaster genome. By integrating the two datasets, we identified duplication hotspots conserved between the two species. However, unlike the duplication hotspots identified in mammalian genomes, Drosophila duplication hotspots are not associated with sequences of high sequence identity capable of mediating non-allelic homologous recombination. Instead, Drosophila duplication hotspots are associated with late-replicating regions of the genome, suggesting a link between DNA replication and duplication rates. We also found evidence supporting a higher effectiveness of selection on duplications in D. simulans than in D. melanogaster. This is also true for duplications segregating at high frequency, where we find evidence in D. simulans that a sizeable fraction of these mutations is

  8. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms.

    Science.gov (United States)

    Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet

    2016-02-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.

  9. Partial facial duplication (diprosopus) in a goat kid.

    Science.gov (United States)

    Mukaratirwa, S; Sayi, S T

    2006-03-01

    The anatomical and clinical features of a live-born diprosopic goat kid are described. The kid had two faces with two eyes each, two complete oral cavities and nostrils and two ears. Caudal to the neck, the kid grossly appeared normal. Both mouths of the kid showed synchronous suckling motions. Elevated respiratory and heart rates were recorded and the temperature was subnormal. Radiological examination showed a single trunk and vertebral column, normal limbs, two sets of jaws, three orbits, and contrast radiography revealed a single patent oesophagus. There was maxillary and mandibular duplication resulting in two faces. There was a cleft palate. The oropharyngeal regions of each face merged to form a single laryngopharynx and oesophagus. There was a single brain with hypoplasia of the cerebellum. The left and right cerebral hemispheres were fused rostrally, and there was duplication of the optic chiasma and the pituitary gland. The olfactory tract was absent and the superficial origins of most of the cranial nerves were not discernible.

  10. Partial facial duplication (diprosopus in a goat kid : clinical communication

    Directory of Open Access Journals (Sweden)

    S. Mukaratirwa

    2006-06-01

    Full Text Available The anatomical and clinical features of a live-born diprosopic goat kid are described. The kid had two faces with two eyes each, two complete oral cavities and nostrils and two ears. Caudal to the neck, the kid grossly appeared normal. Both mouths of the kid showed synchronous suckling motions. Elevated respiratory and heart rates were recorded and the temperature was subnormal. Radiological examination showed a single trunk and vertebral column, normal limbs, two sets of jaws, three orbits, and contrast radiography revealed a single patent oesophagus. There was maxillary and mandibular duplication resulting in two faces. There was a cleft palate. The oropharyngeal regions of each face merged to form a single laryngopharynx and oesophagus. There was a single brain with hypoplasia of the cerebellum. The left and right cerebral hemispheres were fused rostrally, and there was duplication of the optic chiasma and the pituitary gland. The olfactory tract was absent and the superficial origins of most of the cranial nerves were not discernible.

  11. STRIDE: Species Tree Root Inference from Gene Duplication Events.

    Science.gov (United States)

    Emms, David M; Kelly, Steven

    2017-12-01

    The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent PCR.

    Directory of Open Access Journals (Sweden)

    Xiangdong Kong

    Full Text Available The aim of this study was use a simple and rapid procedure, called segmental duplication quantitative fluorescent polymerase chain reaction (SD-QF-PCR, for the prenatal diagnosis of fetal chromosomal aneuploidies. This method is based on the co-amplification of segmental duplications located on two different chromosomes using a single pair of fluorescent primers. The PCR products of different sizes were subsequently analyzed through capillary electrophoresis, and the aneuploidies were determined based on the relative dosage between the two chromosomes. Each primer set, containing five pairs of primers, was designed to simultaneously detect aneuploidies located on chromosomes 21, 18, 13, X and Y in a single reaction. We applied these two primer sets to DNA samples isolated from individuals with trisomy 21 (n = 36; trisomy 18 (n = 6; trisomy 13 (n = 4; 45, X (n = 5; 47, XXX (n = 3; 48, XXYY (n = 2; and unaffected controls (n = 40. We evaluated the performance of this method using the karyotyping results. A correct and unambiguous diagnosis with 100% sensitivity and 100% specificity, was achieved for clinical samples examined. Thus, the present study demonstrates that SD-QF-PCR is a robust, rapid and sensitive method for the diagnosis of common aneuploidies, and these analyses can be performed in less than 4 hours for a single sample, providing a competitive alternative for routine use.

  13. Enteric duplication in children: clinical presentation and outcome.

    Science.gov (United States)

    Rasool, Naima; Safdar, Chaudhry Aqeel; Ahmad, Asrar; Kanwal, Shehla

    2013-06-01

    Enteric duplication (ED) is an anomaly with varied presentations and possible involvement of the alimentary tract. Once diagnosed, resection of the lesion and the involved part of the gut is usually required. The aim of this study was to evaluate the clinical presentations, diagnostic investigations, management and outcomes of patients with ED. This was a descriptive case study conducted at the Department of Paediatric Surgery, Military Hospital, Rawalpindi, Pakistan, from January 2005 to January 2011. The medical records of all patients diagnosed with ED were retrospectively analysed with respect to age, presentation, investigations, site and type of lesion, surgical procedures, histological findings and complications. A total of nine patients were managed during the study period. The patients' ages ranged from three months to five years. Four out of nine EDs were rectal duplications. Three EDs were of the cystic type, five were of the tubular type and one was a complex mixed anomaly. Patients presented with varied symptoms, with the two most common being the presence of an abdominal mass and bleeding per rectum. Diagnosis was mainly achieved based on magnetic resonance imaging and computed tomography, although Meckel's scan provided accurate diagnosis in three of the nine patients. All the cysts were resected without any major complications, and patients were event-free during the five-year follow-up. EDs should be kept in mind when examining patients with an abdominal mass and bleeding per rectum. Meckel's scan can provide accurate diagnosis of EDs with bleeding. Prompt diagnosis and management results in satisfactory outcomes.

  14. Motion analysis for duplicate frame removal in wireless capsule endoscope

    Science.gov (United States)

    Lee, Hyun-Gyu; Choi, Min-Kook; Lee, Sang-Chul

    2011-03-01

    Wireless capsule endoscopy (WCE) has been intensively researched recently due to its convenience for diagnosis and extended detection coverage of some diseases. Typically, a full recording covering entire human digestive system requires about 8 to 12 hours for a patient carrying a capsule endoscope and a portable image receiver/recorder unit, which produces 120,000 image frames on average. In spite of the benefits of close examination, WCE based test has a barrier for quick diagnosis such that a trained diagnostician must examine a huge amount of images for close investigation, normally over 2 hours. The main purpose of our work is to present a novel machine vision approach to reduce diagnosis time by automatically detecting duplicated recordings caused by backward camera movement, typically containing redundant information, in small intestine. The developed technique could be integrated with a visualization tool which supports intelligent inspection method, such as automatic play speed control. Our experimental result shows high accuracy of the technique by detecting 989 duplicate image frames out of 10,000, equivalently to 9.9% data reduction, in a WCE video from a real human subject. With some selected parameters, we achieved the correct detection ratio of 92.85% and the false detection ratio of 13.57%.

  15. Use of TANDEM methodology for quality control in radiation protection

    International Nuclear Information System (INIS)

    Mello, O.A.; Oliveira, I.R.; Leyton, F.; Nogueira, M.S.; Borges, F.L.S.; Joana, G.S.

    2014-01-01

    Recent studies have indicated the increase of the incidence of lens opacities for low radiation doses. Considering epidemiological data, the International Commission on Radiological Protection (ICRP) issued a statement that changed the absorbed dose threshold for the eye lens. The statement also recommends a reduction in the dose limits to the eye lens for occupationally exposed persons; now it is considered to be 20 mSv in a year averaged over five years. For this research two types of thermoluminescent dosimeters TL were used in the construction of the curve tandem. (LiF-100H e LiF-200). For system calibration three monitors were irradiated for each radiation beam. The monitors were irradiated with 4 mGy kerma at 1.5 m from the focal point. The Tandem curve was obtained by the ratio between the values of the energy dependence curves of each dosimeter. Data obtained for the corresponding x-ray beams to radiation reference N60 to N120 are more accurate for determining the energy - steepest part of the curve. The results are shown similar to similar studies and confirm the possibility of using the method for determining the unknown energy radiation fields. (author)

  16. Comparative inference of duplicated genes produced by polyploidization in soybean genome.

    Science.gov (United States)

    Yang, Yanmei; Wang, Jinpeng; Di, Jianyong

    2013-01-01

    Soybean (Glycine max) is one of the most important crop plants for providing protein and oil. It is important to investigate soybean genome for its economic and scientific value. Polyploidy is a widespread and recursive phenomenon during plant evolution, and it could generate massive duplicated genes which is an important resource for genetic innovation. Improved sequence alignment criteria and statistical analysis are used to identify and characterize duplicated genes produced by polyploidization in soybean. Based on the collinearity method, duplicated genes by whole genome duplication account for 70.3% in soybean. From the statistical analysis of the molecular distances between duplicated genes, our study indicates that the whole genome duplication event occurred more than once in the genome evolution of soybean, which is often distributed near the ends of chromosomes.

  17. Colonic duplication in adults: Report of two cases presenting with rectal bleeding

    Institute of Scientific and Technical Information of China (English)

    C Fotiadis; M Genetzakis; I Papandreou; EP Misiakos; E Agapitos; GC Zografos

    2005-01-01

    Gastrointestinal duplication is an uncommon congenital abnormality in two-thirds of cases manifesting before the age of 2 years. Ileal duplication is common while colonic duplication, either cystic or tubular, is a rather unusual clinical entity that remains asymptomatic and undiagnosed in most cases. Mostly occurring in pediatric patients,colonic duplication is encountered in adults only in a few cases. This study reports two cases of colonic duplication in adults. Both cases presented with rectal bleeding on admission. The study was focused on clinical, imaging,histological, and therapeutical aspects of the presenting cases. Gastrografin enema established the diagnosis in both cases. The cystic structure and the adjacent part of the colon were excised en-block. The study implies that colonic duplication, though uncommon, should be included in the differential diagnosis of rectal bleeding.

  18. Colonic duplication in adults: report of two cases presenting with rectal bleeding.

    Science.gov (United States)

    Fotiadis, C; Genetzakis, M; Papandreou, I; Misiakos, E P; Agapitos, E; Zografos, G C

    2005-08-28

    Gastrointestinal duplication is an uncommon congenital abnormality in two-thirds of cases manifesting before the age of 2 years. Ileal duplication is common while colonic duplication, either cystic or tubular, is a rather unusual clinical entity that remains asymptomatic and undiagnosed in most cases. Mostly occurring in pediatric patients, colonic duplication is encountered in adults only in a few cases. This study reports two cases of colonic duplication in adults. Both cases presented with rectal bleeding on admission. The study was focused on clinical, imaging, histological, and therapeutical aspects of the presenting cases. Gastrografin enema established the diagnosis in both cases. The cystic structure and the adjacent part of the colon were excised en-block. The study implies that colonic duplication, though uncommon, should be included in the differential diagnosis of rectal bleeding.

  19. Thirty years of physics at the Bucharest tandem accelerator

    International Nuclear Information System (INIS)

    Dobrescu, S.; Marinescu, L.; Dumitru, G.; Cata-Danil, Gh.

    2003-01-01

    The main parameters of the Bucharest tandem accelerator, as well as the main milestones of its history since March 1973 when it was commissioned are shortly presented. A general presentation of the main basic and applied physics research so far undertaken at the tandem is given, ending with some ideas related with the future perspectives of the tandem. (authors)

  20. STATIONARY DISTRIBUTION OF A TANDEM QUEUE WITH ADDITIONAL FLOWS ON THE STATIONS OF THE TANDEM

    Directory of Open Access Journals (Sweden)

    V. I. Klimenok

    2017-01-01

    Full Text Available A tandem queueing system consisting of a finite number of multi-server stations without buffers is analized. The input flow at the first station is a ???????????? (Markovian arrival process. The customers from this flow aim to be served at all stations of the tandem. For any station, besides transit customers proceeding from the previous station, an additional ???????????? flow of new customers arrives at this station directly. Customers from this flow aim to be served at this station and all subsequent stations of the tandem. The service times of customer at the stations are exponentially distributed with the service rate depending of number of the station. The algorithms for culculation of stationary distributions and the loss probabilities associated with the tandem are given.

  1. A tandem queue with delayed server release

    NARCIS (Netherlands)

    Nawijn, W.M.

    1997-01-01

    We consider a tandem queue with two stations. The rst station is an s-server queue with Poisson arrivals and exponential service times. After terminating his service in the rst station, a customer enters the second station to require service at an exponential single server, while in the meantime he

  2. The PSI/ETH tandem accelerator facility

    Energy Technology Data Exchange (ETDEWEB)

    Synal, H.A.; Doebeli, M.; Fuhrmann, H.; Kubik, P.W.; Nebiker, P.W. [Paul Scherrer Inst. (PSI), Villigen (Switzerland)] [and others

    1997-09-01

    The 1996 operation of the PSI/ETH tandem accelerator at ETH Hoenggerberg is summarised with a detailed compilation of the beam time statistics and the statistics of AMS samples for the different radioisotopes and for the major fields of research. (author) 2 tab.

  3. Optimal dispatching in a tandem queue

    NARCIS (Netherlands)

    van Leeuwen, D.; Núñez Queija, R.

    2017-01-01

    We investigate a Markovian tandem queueing model in which service to the first queue is provided in batches. The main goal is to choose the batch sizes so as to minimize a linear cost function of the mean queue lengths. This model can be formulated as a Markov Decision Process (MDP) for which the

  4. Edge diagnostics for tandem mirror machines

    International Nuclear Information System (INIS)

    Allen, S.L.

    1984-01-01

    The edge plasma in a tandem mirror machine shields the plasma core from cold neutral gas and impurities. A variety of diagnostics are used to measure the fueling, shielding, and confinement of the edge plasma in both the end plug and central cell regions. Fast ion gauges and residual gas analyzers measure the gas pressure and composition outside of the plasma. An array of Langmuir probes is used to measure the electron density and temperature. Extreme ultraviolet (euv) and visible spectroscopy are used to measure both the impurity and deuterium densities and to estimate the shielding factor for the core plasma. The linear geometry of a tandem mirror also allows direct measurements of the edge plasma by sampling the ions and electrons lost but the ends of the machine. Representative data obtained by these diagnostics during operation of the Tandem Mirror Experiment (TMX) and Tandem Mirror Experiment-Upgrade (TMX-U) experiments are presented. Diagnostics that are currently being developed to diagnose the edge plasma are also discussed

  5. Tandem queue with server slow-down

    NARCIS (Netherlands)

    Miretskiy, D.I.; Scheinhardt, W.R.W.; Mandjes, M.R.H.

    2007-01-01

    We study how rare events happen in the standard two-node tandem Jackson queue and in a generalization, the socalled slow-down network, see [2]. In the latter model the service rate of the first server depends on the number of jobs in the second queue: the first server slows down if the amount of

  6. 25 MV tandem accelerator at Oak Ridge

    International Nuclear Information System (INIS)

    Jones, C.M.

    1980-01-01

    A new heavy-ion accelerator facility is under construction at the Oak Ridge National Laboratory. A brief description of the scope and status of this project is presented with emphasis on the first operational experience with the 25 MV tandem accelerator

  7. Modelling of tandem cell temperature coefficients

    Energy Technology Data Exchange (ETDEWEB)

    Friedman, D.J. [National Renewable Energy Lab., Golden, CO (United States)

    1996-05-01

    This paper discusses the temperature dependence of the basic solar-cell operating parameters for a GaInP/GaAs series-connected two-terminal tandem cell. The effects of series resistance and of different incident solar spectra are also discussed.

  8. Tandem mirror next step conceptual design

    International Nuclear Information System (INIS)

    Doggett, J.N.; Damm, C.C.; Bulmer, R.H.

    1980-01-01

    A study was made to define the features of the experimental mirror fusion device - The Tandem Mirror Next Step, or TMNS - that will bridge the gap between present mirror confinement experiments and a power-producing reactor. We outline the project goals, describe some initial device parameters, and relate the technological requirements to ongoing development programs

  9. Duplication of the vertebral artery: report of two cases and review of the literature

    International Nuclear Information System (INIS)

    Goddard, A.J.P.; Annesley-Williams, D.; Guthrie, J.A.; Weston, M.

    2001-01-01

    Duplication of the vertebral artery is rare. We report two cases in which it was an incidental finding. In the first, duplication of the right vertebral artery was demonstrated by magnetic resonance angiography (MRA) and conventional angiography. The second patient had duplication of the right vertebral artery demonstrated by MRA. We discuss the origin of this abnormality, its radiological implications and its potential clinical significance are discussed. (orig.)

  10. Craniofacial duplication (diprosopus): CT, MR imaging, and MR angiography findings case report.

    Science.gov (United States)

    Hähnel, Stefan; Schramm, Peter; Hassfeld, Stefan; Steiner, Hans H; Seitz, Angelika

    2003-01-01

    Diprosopus is one of the rarest malformations in humans. In addition to the facial structures, the cerebral frontal lobes were duplicated in this case. Three pairs of anterior cerebral arteries were detected, and the rostral parts of the superior sagittal sinus were duplicated. Computed tomography, magnetic resonance (MR) imaging, and MR angiography allowed study of the degree of duplicative changes in diprosopus, especially for planning cosmetic correction. Copyright RSNA, 2002

  11. MECP2 duplication phenotype in symptomatic females: report of three further cases

    OpenAIRE

    Novara, Francesca; Simonati, Alessandro; Sicca, Federico; Battini, Roberta; Fiori, Simona; Contaldo, Annarita; Criscuolo, Lucia; Zuffardi, Orsetta; Ciccone, Roberto

    2014-01-01

    Background Xq28 duplications, including MECP2 (methyl CpG-binding protein 2; OMIM 300005), have been identified in approximately 140 male patients presenting with hypotonia, severe developmental delay/intellectual disability, limited or absent speech and ambulation, and recurrent respiratory infections. Female patients with Xq28 duplication have been rarely reported and are usually asymptomatic. Altogether, only fifteen symptomatic females with Xq28 duplications including MECP2 have been repo...

  12. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    OpenAIRE

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    2014-01-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  13. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    OpenAIRE

    Thomas D Cuypers; Paulien Hogeweg

    2014-01-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  14. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN

    Science.gov (United States)

    Li, Zhen; Van de Peer, Yves; De Smet, Riet

    2016-01-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215

  15. Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants

    OpenAIRE

    Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong

    2010-01-01

    Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...

  16. Detection and correction of false segmental duplications caused by genome mis-assembly

    Science.gov (United States)

    2010-01-01

    Diploid genomes with divergent chromosomes present special problems for assembly software as two copies of especially polymorphic regions may be mistakenly constructed, creating the appearance of a recent segmental duplication. We developed a method for identifying such false duplications and applied it to four vertebrate genomes. For each genome, we corrected mis-assemblies, improved estimates of the amount of duplicated sequence, and recovered polymorphisms between the sequenced chromosomes. PMID:20219098

  17. Gastric Duplication Cyst: A Rare Congenital Disease Often Misdiagnosed in Adults

    Directory of Open Access Journals (Sweden)

    Jessica Falleti

    2013-01-01

    Full Text Available Gastrointestinal duplication is a rare congenital disease which affected more commonly the ileum, while the stomach is rarely involved. Generally diagnosed in paediatric or young age, it could be difficult to suspect a gastrointestinal duplication in adults. Herein, we report a 55-year-old male with a gastric duplication cyst found on routinely checkup for chronic hepatitis and first misdiagnosed as a gastrointestinal stromal tumor (GIST; we also discuss its embryology.

  18. Use of TANDEM methodology for quality control in radiation protection; Aplicacao de metodologia TANDEM para controle de qualidade em radioprotecao

    Energy Technology Data Exchange (ETDEWEB)

    Mello, O.A.; Oliveira, I.R.; Leyton, F.; Nogueira, M.S., E-mail: mnogueira@cdtn.br [Centro de Desenvolvimeto da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Borges, F.L.S., E-mail: flavialuizaborges@yahoo.com.br [Vigilancia Sanitaria de Minas Gerais, Belo Horizonte, MG (Brazil); Joana, G.S., E-mail: georgia.joana@gmail.com [Universidade Federal de Minas Gerais (DEN/UFMG), Belo Horizonte, MG (Brazil)

    2014-07-01

    Recent studies have indicated the increase of the incidence of lens opacities for low radiation doses. Considering epidemiological data, the International Commission on Radiological Protection (ICRP) issued a statement that changed the absorbed dose threshold for the eye lens. The statement also recommends a reduction in the dose limits to the eye lens for occupationally exposed persons; now it is considered to be 20 mSv in a year averaged over five years. For this research two types of thermoluminescent dosimeters TL were used in the construction of the curve tandem. (LiF-100H e LiF-200). For system calibration three monitors were irradiated for each radiation beam. The monitors were irradiated with 4 mGy kerma at 1.5 m from the focal point. The Tandem curve was obtained by the ratio between the values of the energy dependence curves of each dosimeter. Data obtained for the corresponding x-ray beams to radiation reference N60 to N120 are more accurate for determining the energy - steepest part of the curve. The results are shown similar to similar studies and confirm the possibility of using the method for determining the unknown energy radiation fields. (author)

  19. Quality evaluation of tandem mass spectral libraries.

    Science.gov (United States)

    Oberacher, Herbert; Weinmann, Wolfgang; Dresen, Sebastian

    2011-06-01

    Tandem mass spectral libraries are gaining more and more importance for the identification of unknowns in different fields of research, including metabolomics, forensics, toxicology, and environmental analysis. Particularly, the recent invention of reliable, robust, and transferable libraries has increased the general acceptance of these tools. Herein, we report on results obtained from thorough evaluation of the match reliabilities of two tandem mass spectral libraries: the MSforID library established by the Oberacher group in Innsbruck and the Weinmann library established by the Weinmann group in Freiburg. Three different experiments were performed: (1) Spectra of the libraries were searched against their corresponding library after excluding either this single compound-specific spectrum or all compound-specific spectra prior to searching; (2) the libraries were searched against each other using either library as reference set or sample set; (3) spectra acquired on different mass spectrometric instruments were matched to both libraries. Almost 13,000 tandem mass spectra were included in this study. The MSforID search algorithm was used for spectral matching. Statistical evaluation of the library search results revealed that principally both libraries enable the sensitive and specific identification of compounds. Due to higher mass accuracy of the QqTOF compared with the QTrap instrument, matches to the MSforID library were more reliable when comparing spectra with both libraries. Furthermore, only the MSforID library was shown to be efficiently transferable to different kinds of tandem mass spectrometers, including "tandem-in-time" instruments; this is due to the coverage of a large range of different collision energy settings-including the very low range-which is an outstanding characteristics of the MSforID library.

  20. Wide rectal duplication cyst in an adult resected by anterior approach: efficacy and recurrence.

    Science.gov (United States)

    Ceriotti, Michela; Saccomani, Giorgia; Lacelli, Francesca; Saccomani, Giovanni E

    2017-06-01

    Alimentary tract duplications are uncommon congenital abnormalities usually diagnosed and treated in childhood. Rectal involvement is extremely rare. We report the case of a 22-year-old female who presented with chronic abdominal and perianal pain; feeling of rectal fullness. Workup revealed a rectal duplication cyst. The patient underwent a complete transabdominal excision of the cyst: an hybrid laparoscopic and laparotomic technique was adopted. The hybrid isolated anterior abdominal approach is safe and feasible even for the treatment of wide rectal duplication cysts. Real recurrence in rectal duplication cysts is uncommon when the first operation was performed with radical intent.

  1. The ethics of scholarly publishing: exploring differences in plagiarism and duplicate publication across nations*

    Science.gov (United States)

    Amos, Kathleen A.

    2014-01-01

    This study explored national differences in plagiarism and duplicate publication in retracted biomedical literature. The national affiliations of authors and reasons for retraction of papers accessible through PubMed that were published from 2008 to 2012 and subsequently retracted were determined in order to identify countries with the largest numbers and highest rates of retraction due to plagiarism and duplicate publication. Authors from more than fifty countries retracted papers. While the United States retracted the most papers, China retracted the most papers for plagiarism and duplicate publication. Rates of plagiarism and duplicate publication were highest in Italy and Finland, respectively. Unethical publishing practices cut across nations. PMID:24860263

  2. The ethics of scholarly publishing: exploring differences in plagiarism and duplicate publication across nations.

    Science.gov (United States)

    Amos, Kathleen A

    2014-04-01

    This study explored national differences in plagiarism and duplicate publication in retracted biomedical literature. The national affiliations of authors and reasons for retraction of papers accessible through PubMed that were published from 2008 to 2012 and subsequently retracted were determined in order to identify countries with the largest numbers and highest rates of retraction due to plagiarism and duplicate publication. Authors from more than fifty countries retracted papers. While the United States retracted the most papers, China retracted the most papers for plagiarism and duplicate publication. Rates of plagiarism and duplicate publication were highest in Italy and Finland, respectively. Unethical publishing practices cut across nations.

  3. Error analysis of filtering operations in pixel-duplicated images of diabetic retinopathy

    Science.gov (United States)

    Mehrubeoglu, Mehrube; McLauchlan, Lifford

    2010-08-01

    In this paper, diabetic retinopathy is chosen for a sample target image to demonstrate the effectiveness of image enlargement through pixel duplication in identifying regions of interest. Pixel duplication is presented as a simpler alternative to data interpolation techniques for detecting small structures in the images. A comparative analysis is performed on different image processing schemes applied to both original and pixel-duplicated images. Structures of interest are detected and and classification parameters optimized for minimum false positive detection in the original and enlarged retinal pictures. The error analysis demonstrates the advantages as well as shortcomings of pixel duplication in image enhancement when spatial averaging operations (smoothing filters) are also applied.

  4. Delusional misidentifications and duplications: right brain lesions, left brain delusions.

    Science.gov (United States)

    Devinsky, Orrin

    2009-01-06

    When the delusional misidentification syndromes reduplicative paramnesia and Capgras syndromes result from neurologic disease, lesions are usually bifrontal and/or right hemispheric. The related disorders of confabulation and anosognosis share overlapping mechanisms and anatomic pathology. A dual mechanism is postulated for the delusional misidentification syndromes: negative effects from right hemisphere and frontal lobe dysfunction as well as positive effects from release (i.e., overactivity) of preserved left hemisphere areas. Negative effects of right hemisphere injury impair self-monitoring, ego boundaries, and attaching emotional valence and familiarity to stimuli. The unchecked left hemisphere unleashes a creative narrator from the monitoring of self, memory, and reality by the frontal and right hemisphere areas, leading to excessive and false explanations. Further, the left hemisphere's cognitive style of categorization, often into dual categories, leads it to invent a duplicate or impostor to resolve conflicting information. Delusions result from right hemisphere lesions. But it is the left hemisphere that is deluded.

  5. On face antimagic labeling of double duplication of graphs

    Science.gov (United States)

    Shobana, L.; Kuppan, R.

    2018-04-01

    A Labeling of a plane graph G is called d-antimagic if every numbers, the set of s-sided face weights is Ws={as,as+d,as+2d,...,as+(fs-1)d} for some integers as and d (as>0,d≥0),where fs is the number of s-sided faces. We allow differentsets ws of different s.In this paper, we proved the existence of face antimagic labeling of types (1,0,0),(1,0,1),(1,1,0),(0,1,1) and (1,1,1) of double duplication of all vertices by edges of a cycle graph Cn: n≥3 and a tree of order n.

  6. Bibliographic review of intestinal duplication in the pediatric patient

    International Nuclear Information System (INIS)

    Molina Campos, Cesar

    2013-01-01

    An exhaustive bibliographical review was carried out on all the clinical, diagnostic and therapeutic aspects related to intestinal duplication, to update the concepts that are exposed in the literature. An observational and descriptive study of the literature found was carried out, using as source the articles found in the National Library of Health and Social Security (BINAS) and on the Internet, in addition to the official textbook of the pediatric surgery graduate in Costa Rica. A study of updating of the clinical findings, approach and therapeutic of the pathology was carried out. A protocolization of all diagnosis, can be considered as a valuable tool to help make this diagnosis as expeditious and accurate as possible, in order to provide adequate and safe treatment to the patient, significantly reducing the risks and morbidity in surgery as definitive treatment [es

  7. Gene duplications in prokaryotes can be associated with environmental adaptation.

    Science.gov (United States)

    Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn

    2010-10-20

    Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate

  8. Gene duplications in prokaryotes can be associated with environmental adaptation

    Directory of Open Access Journals (Sweden)

    Lempicki Richard A

    2010-10-01

    Full Text Available Abstract Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive

  9. In situ detection of tandem DNA repeat length

    Energy Technology Data Exchange (ETDEWEB)

    Yaar, R.; Szafranski, P.; Cantor, C.R.; Smith, C.L. [Boston Univ., MA (United States)

    1996-11-01

    A simple method for scoring short tandem DNA repeats is presented. An oligonucleotide target, containing tandem repeats embedded in a unique sequence, was hybridized to a set of complementary probes, containing tandem repeats of known lengths. Single-stranded loop structures formed on duplexes containing a mismatched (different) number of tandem repeats. No loop structure formed on duplexes containing a matched (identical) number of tandem repeats. The matched and mismatched loop structures were enzymatically distinguished and differentially labeled by treatment with S1 nuclease and the Klenow fragment of DNA polymerase. 7 refs., 4 figs.

  10. Oculocutaneous albinism in a patient with 17p13.2-pter duplication - a review on the molecular syndromology of 17p13 duplication.

    Science.gov (United States)

    Kucharczyk, Marzena; Jezela-Stanek, Aleksandra; Gieruszczak-Bialek, Dorota; Kugaudo, Monika; Cieslikowska, Agata; Pelc, Magdalena; Krajewska-Walasek, Malgorzata

    2015-06-01

    Chromosomal duplications involving 17p13.3 have recently been defined as a new distinctive syndrome with several diagnosed patients. Some variation is known to occur in the breakpoints of the duplicated region and, consequently, in the phenotype as well. We report on a patient, the fifth to our knowledge, a 4-year-old girl with a pure de novo subtelomeric 17p13.2-pter duplication. She presents all of the facial features described so far for this duplication and in addition, a unilateral palmar transversal crease and oculocutaneous albinism which has not been reported previously. A detailed molecular description of the reported aberration and correlation with the observed phenotypical features based on a literature review. We discuss the possible molecular etiology of albinism in regard to the mode of inheritance. The new data provided here may be useful for further genotype correlations in syndromes with oculocutaneous albinism, especially of autosomal dominant inheritance.

  11. Antenatal diagnosis of complete facial duplication--a case report of a rare craniofacial defect.

    Science.gov (United States)

    Rai, V S; Gaffney, G; Manning, N; Pirrone, P G; Chamberlain, P F

    1998-06-01

    We report a case of the prenatal sonographic detection of facial duplication, the diprosopus abnormality, in a twin pregnancy. The characteristic sonographic features of the condition include duplication of eyes, mouth, nose and both mid- and anterior intracranial structures. A heart-shaped abnormality of the cranial vault should prompt more detailed examination for other supportive features of this rare condition.

  12. Gene duplication, tissue-specific gene expression and sexual conflict in stalk-eyed flies (Diopsidae).

    Science.gov (United States)

    Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S

    2012-08-19

    Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.

  13. Evolution of vertebrate central nervous system is accompanied by novel expression changes of duplicate genes.

    Science.gov (United States)

    Chen, Yuan; Ding, Yun; Zhang, Zuming; Wang, Wen; Chen, Jun-Yuan; Ueno, Naoto; Mao, Bingyu

    2011-12-20

    The evolution of the central nervous system (CNS) is one of the most striking changes during the transition from invertebrates to vertebrates. As a major source of genetic novelties, gene duplication might play an important role in the functional innovation of vertebrate CNS. In this study, we focused on a group of CNS-biased genes that duplicated during early vertebrate evolution. We investigated the tempo-spatial expression patterns of 33 duplicate gene families and their orthologs during the embryonic development of the vertebrate Xenopus laevis and the cephalochordate Brachiostoma belcheri. Almost all the identified duplicate genes are differentially expressed in the CNS in Xenopus embryos, and more than 50% and 30% duplicate genes are expressed in the telencephalon and mid-hindbrain boundary, respectively, which are mostly considered as two innovations in the vertebrate CNS. Interestingly, more than 50% of the amphioxus orthologs do not show apparent expression in the CNS in amphioxus embryos as detected by in situ hybridization, indicating that some of the vertebrate CNS-biased duplicate genes might arise from non-CNS genes in invertebrates. Our data accentuate the functional contribution of gene duplication in the CNS evolution of vertebrate and uncover an invertebrate non-CNS history for some vertebrate CNS-biased duplicate genes. Copyright © 2011. Published by Elsevier Ltd.

  14. Incidentally found rectal duplication during surgery for rectovestibular fistula and its management.

    Science.gov (United States)

    Balaji, Dhiraj K; Basavaraju, Mamatha

    2015-01-01

    Association of rectal duplication with rectovestibular fistula is rare. A 3-month-old patient underwent primary posterior sagittal anorectoplasty (PSARP) for rectovestibular fistula. During surgery the patient was found to have a rectal duplication (RD). We managed the case by excising the common wall and fenestrating the two lumens together and completed the PSARP.

  15. A rare association of rectal and genitourinary duplication and anorectal malformation

    Institute of Scientific and Technical Information of China (English)

    王俊; 施诚仁; 余世耀; 吴燕; 徐长辉

    2003-01-01

    @@ It is very rare to see multiple malformations occurring in both the urogenital and digestive systems in a case of congenital anorectal malformation. In this particular care, an imperforated anus occurred with other multiple malformations, including a double kidney, urethral duplication and rectal duplication, etc.

  16. Incidentally found rectal duplication during surgery for rectovestibular fistula and its management

    Directory of Open Access Journals (Sweden)

    Dhiraj K Balaji

    2015-01-01

    Full Text Available Association of rectal duplication with rectovestibular fistula is rare. A 3-month-old patient underwent primary posterior sagittal anorectoplasty (PSARP for rectovestibular fistula. During surgery the patient was found to have a rectal duplication (RD. We managed the case by excising the common wall and fenestrating the two lumens together and completed the PSARP.

  17. Tail-like Congenital Duplication of Lower Extremity (Extra Leg or ...

    African Journals Online (AJOL)

    2018-01-01

    Jan 1, 2018 ... ABSTRACT. BACKGROUND: Congenital duplication of lower extremity, either complete or incomplete is extremely rare. Only 26 cases had been reported till 2010, of which only 5 cases had feature of complete duplication. Theories have been proposed that the cause of this abnormality includes maternal ...

  18. Social network analysis of duplicative prescriptions: One-month analysis of medical facilities in Japan.

    Science.gov (United States)

    Takahashi, Yoshimitsu; Ishizaki, Tatsuro; Nakayama, Takeo; Kawachi, Ichiro

    2016-03-01

    Duplicative prescriptions refer to situations in which patients receive medications for the same condition from two or more sources. Health officials in Japan have expressed concern about medical "waste" resulting from this practices. We sought to conduct descriptive analysis of duplicative prescriptions using social network analysis and to report their prevalence across ages. We analyzed a health insurance claims database including 1.24 million people from December 2012. Through social network analysis, we examined the duplicative prescription networks, representing each medical facility as nodes, and individual prescriptions for patients as edges. The prevalence of duplicative prescription for any drug class was strongly correlated with its frequency of prescription (r=0.90). Among patients aged 0-19, cough and colds drugs showed the highest prevalence of duplicative prescriptions (10.8%). Among people aged 65 and over, antihypertensive drugs had the highest frequency of prescriptions, but the prevalence of duplicative prescriptions was low (0.2-0.3%). Social network analysis revealed clusters of facilities connected via duplicative prescriptions, e.g., psychotropic drugs showed clustering due to a few patients receiving drugs from 10 or more facilities. Overall, the prevalence of duplicative prescriptions was quite low - less than 10% - although the extent of the problem varied by drug class and age group. Our approach illustrates the potential utility of using a social network approach to understand these practices. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  19. Intestinal Duplication Cyst presenting as Volvulus: A rare case report with Review of Literatures

    Directory of Open Access Journals (Sweden)

    Prasan Kumar Hota

    2015-03-01

    Full Text Available Intestinal duplication cyst is a rare congenital anomaly occurring any where along the alimentary tract, from mouth to anus. They can present with numerous complications like perforation, bleeding or intestinal obstruction. We report a rare case  of intestinal duplication cyst of ileum with acute intestinal obstruction due to volvulus with review of literature.

  20. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  1. Duplication and Diversification of the Hypoxia-Inducible IGFBP-1 Gene in Zebrafish

    DEFF Research Database (Denmark)

    Kamei, Hiroyasu; Lu, Ling; Jiao, Shuang

    2008-01-01

    Background: Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenabilit...

  2. 46 CFR Sec. 5 - Responsibility for duplicating copies of NSA-WORKSMALREP Contract.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Responsibility for duplicating copies of NSA-WORKSMALREP Contract. Sec. 5 Section 5 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION A-NATIONAL... INDIVIDUAL CONTRACT FOR MINOR REPAIRS-NSA-WORKSMALREP Sec. 5 Responsibility for duplicating copies of NSA...

  3. Current results of the tandem mirror experiment

    International Nuclear Information System (INIS)

    Drake, R.P.

    1980-01-01

    The basic operating characteristics of the Tandem Mirror Experiment, (TMX) at the Lawrence Livermore Laboratory in the USA have been established. Tandem-mirror plasmas have been produced using neutral-beam-fueled end plugs and a gas-fueled center cell. An axial potential well between the end plugs has been measured. There is direct evidence that this potential well enhances the axial confinement of the center-cell ions. The observed densities and loss currents are consistent with preliminary studies of the particle sources and losses near the magnetic axis. The observed confinement is consistent with theory when plasma fluctuations are low. When the requirement of drift-cyclotron loss-cone mode stability is violated, the plasma fluctuations degrade the center-cell confinement

  4. Operation of the tandem-linac accelerator

    International Nuclear Information System (INIS)

    Anon.

    1985-01-01

    The tandem-linac accelerator system is operated as a source of energetic heavy-ion projectiles for research in several areas of nuclear physics and occasionally in other areas of science. The accelerator system consists of a 9-MV tandem electrostatic accelerator and a superconducting-linac energy booster that can provide an additional 20 MV of acceleration. A figure shows the layout of this system, which will be operated in its present form until September 1985, when it will be incorporated into the larger ATLAS system. In both the present and future forms the accelerator is designed to provide the exceptional beam quality and overall versatility required for precision nuclear-structure research

  5. Moment approach to tandem mirror radial transport

    International Nuclear Information System (INIS)

    Siebert, K.D.; Callen, J.D.

    1986-02-01

    A moment approach is proposed for the study of tandem mirror radial transport in the resonant plateau regime. The salient features of the method are described with reference to axisymmetric tokamak transport theory. In particular, the importance of momentum conservation to the establishment of the azimuthal variations in the electrostatic potential is demonstrated. Also, an ad hoc drift kinetic equation is solved to determine parallel viscosity coefficients which are required to close the moment system

  6. Designs of tandem-mirror fusion reactors

    International Nuclear Information System (INIS)

    Carlson, G.A.; Barr, W.L.; Boghosian, B.M.

    1981-01-01

    We have completed a comparative evaluation of several end plug configurations for tandem mirror fusion reactors with thermal barriers. The axi-cell configuration has been selected for further study and will be the basis for a detailed conceptual design study to be carried out over the next two years. The axi-cell end plug has a simple mirror cell produced by two circular coils followed by a transition coil and a yin-yang pair, which provides for MHD stability

  7. Tandem mirror next step: remote maintenance

    International Nuclear Information System (INIS)

    Doggett, J.N.; Damm, C.C.; Hanson, C.L.

    1980-01-01

    This study of the next proposed experiment in the Mirror Fusion Program, the Tandem Mirror Next Step (TMNS), has included serious consideration of the maintenance requirements of such a large source of high energy neutrons with its attendant throughput of tritium. Although maintenance will be costly in time and money, our conclusion is that with careful attention to a design for maintenance plan such a device can be reliably operated

  8. Cold Climate Heat Pumps Using Tandem Compressors

    Energy Technology Data Exchange (ETDEWEB)

    Shen, Bo [ORNL; Abdelaziz, Omar [ORNL; Rice, C Keith [ORNL; Baxter, Van D [ORNL

    2016-01-01

    In cold climate zones, e.g. ASHRAE climate regions IV and V, conventional electric air-source heat pumps (ASHP) do not work well, due to high compressor discharge temperatures, large pressure ratios and inadequate heating capacities at low ambient temperatures. Consequently, significant use of auxiliary strip heating is required to meet the building heating load. We introduce innovative ASHP technologies as part of continuing efforts to eliminate auxiliary strip heat use and maximize heating COP with acceptable cost-effectiveness and reliability. These innovative ASHP were developed using tandem compressors, which are capable of augmenting heating capacity at low temperatures and maintain superior part-load operation efficiency at moderate temperatures. Two options of tandem compressors were studied; the first employs two identical, single-speed compressors, and the second employs two identical, vapor-injection compressors. The investigations were based on system modeling and laboratory evaluation. Both designs have successfully met the performance criteria. Laboratory evaluation showed that the tandem, single-speed compressor ASHP system is able to achieve heating COP = 4.2 at 47 F (8.3 C), COP = 2.9 at 17 F (-8.3 C), and 76% rated capacity and COP = 1.9 at -13 F (-25 C). This yields a HSPF = 11.0 (per AHRI 210/240). The tandem, vapor-injection ASHP is able to reach heating COP = 4.4 at 47 F, COP = 3.1 at 17 F, and 88% rated capacity and COP = 2.0 at -13 F. This yields a HSPF = 12.0. The system modeling and further laboratory evaluation are presented in the paper.

  9. Rectal duplication in an adult: unusual cause of a buttock mass. Report of a case.

    Science.gov (United States)

    Monek, O; Martin, L; Heyd, B; Mantion, G

    1999-06-01

    Duplications of the rectum are extremely rare embryologic events, with almost 70 cases reported in the world literature. We report on a 39-year-old female patient with a duplication of the rectum. Physical examination showed a left buttock mass; rectal examination revealed the presence of a painless mass compressing the rectum posterolaterally, confirmed by computerized tomography. The patient was operated on with a abdominal then a sacrococcygeal approach. After a complete excision, the postoperative course was unremarkable. Histology revealed a rectal duplication lined with heterotopic cylindric ciliated epithelium. This case shows that the diagnosis of rectal duplication is difficult and can be confused with other types of anorectal pathology. The presence of heterotopic ciliated epithelium has rarely been described. Complete excision of the duplication should be possible in most cases using a transcoccygeal, transanal, or abdominoperineal approach, depending on anatomic considerations.

  10. Large tubular colonic duplication in an adult treated with a small midline incision

    Science.gov (United States)

    Yong, Yuen Geng; Jung, Kyung Uk; Cho, Yong Beom; Yun, Seong Hyeon; Kim, Hee Cheol; Lee, Woo Yong

    2012-01-01

    Tubular colonic duplication presenting in adults is rare and difficult to diagnose preoperatively. Only a few cases have been reported in the literature. We report a case of a 29-year-old lady presenting with a long history of chronic constipation, abdominal mass and repeated episodes of abdominal pain. The abdominal-pelvic computed tomography scan showed segmental bowel wall thickening thought to be small bowel, and dilatation with stasis of intraluminal content. The provisional diagnosis was small bowel duplication. She was scheduled for single port laparoscopic resection. However, a T-shaped tubular colonic duplication at sigmoid colon was found intraoperatively. Resection of the large T-shaped tubular colonic duplication containing multiple impacted large fecaloma and primary anastomosis was performed. There was no perioperative complication. We report, herein, the case of a T-shaped tubular colonic duplication at sigmoid colon in an adult who was successfully treated through mini-laparotomy assisted by single port laparoscopic surgery. PMID:22403754

  11. Duplicated collecting system of a kidney complicated with hydronephrosis - diagnostic methods review: A case report

    International Nuclear Information System (INIS)

    Osmanski, P.; Plucinska, I.; Calka, K.; Kedzierski, B.; Jazwiec, P.

    2008-01-01

    Duplicated collecting system of a kidney occurs in 1.7-4.2% of the population. It is a complex, unilateral or bilateral, congenital abnormality of the pyelocalyceal system and the ureter. The 2 ureters fuse to form a single ureteral orifice or empty separately into the bladder (ureter duplex). Duplicated collecting systems with complete ureteric duplication may lead to developing vesicoureteral reflux, hydronephrosis, and urinary infection. This article presents a case of a 49-year-old woman with duplicated collecting system and hydronephrosis in the upper pole. The anomaly was diagnosed using urography, ultrasonography and computed tomography examination.The best method for diagnostics of the duplicated pyelocalyceal system complicated by hydronephrosis is computed tomography examination, especially multislice computed tomography. The authors present also the options for therapy (author)

  12. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

    Science.gov (United States)

    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

    2016-10-13

    PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  13. TandEM: Titan and Enceladus mission

    Science.gov (United States)

    Coustenis, A.; Atreya, S.K.; Balint, T.; Brown, R.H.; Dougherty, M.K.; Ferri, F.; Fulchignoni, M.; Gautier, D.; Gowen, R.A.; Griffith, C.A.; Gurvits, L.I.; Jaumann, R.; Langevin, Y.; Leese, M.R.; Lunine, J.I.; McKay, C.P.; Moussas, X.; Muller-Wodarg, I.; Neubauer, F.; Owen, T.C.; Raulin, F.; Sittler, E.C.; Sohl, F.; Sotin, Christophe; Tobie, G.; Tokano, T.; Turtle, E.P.; Wahlund, J.-E.; Waite, J.H.; Baines, K.H.; Blamont, J.; Coates, A.J.; Dandouras, I.; Krimigis, T.; Lellouch, E.; Lorenz, R.D.; Morse, A.; Porco, C.C.; Hirtzig, M.; Saur, J.; Spilker, T.; Zarnecki, J.C.; Choi, E.; Achilleos, N.; Amils, R.; Annan, P.; Atkinson, D.H.; Benilan, Y.; Bertucci, C.; Bezard, B.; Bjoraker, G.L.; Blanc, M.; Boireau, L.; Bouman, J.; Cabane, M.; Capria, M.T.; Chassefiere, E.; Coll, P.; Combes, M.; Cooper, J.F.; Coradini, A.; Crary, F.; Cravens, T.; Daglis, I.A.; de Angelis, E.; De Bergh, C.; de Pater, I.; Dunford, C.; Durry, G.; Dutuit, O.; Fairbrother, D.; Flasar, F.M.; Fortes, A.D.; Frampton, R.; Fujimoto, M.; Galand, M.; Grasset, O.; Grott, M.; Haltigin, T.; Herique, A.; Hersant, F.; Hussmann, H.; Ip, W.; Johnson, R.; Kallio, E.; Kempf, S.; Knapmeyer, M.; Kofman, W.; Koop, R.; Kostiuk, T.; Krupp, N.; Kuppers, M.; Lammer, H.; Lara, L.-M.; Lavvas, P.; Le, Mouelic S.; Lebonnois, S.; Ledvina, S.; Li, Ji; Livengood, T.A.; Lopes, R.M.; Lopez-Moreno, J. -J.; Luz, D.; Mahaffy, P.R.; Mall, U.; Martinez-Frias, J.; Marty, B.; McCord, T.; Salvan, C.M.; Milillo, A.; Mitchell, D.G.; Modolo, R.; Mousis, O.; Nakamura, M.; Neish, Catherine D.; Nixon, C.A.; Mvondo, D.N.; Orton, G.; Paetzold, M.; Pitman, J.; Pogrebenko, S.; Pollard, W.; Prieto-Ballesteros, O.; Rannou, P.; Reh, K.; Richter, L.; Robb, F.T.; Rodrigo, R.; Rodriguez, S.; Romani, P.; Bermejo, M.R.; Sarris, E.T.; Schenk, P.; Schmitt, B.; Schmitz, N.; Schulze-Makuch, D.; Schwingenschuh, K.; Selig, A.; Sicardy, B.; Soderblom, L.; Spilker, L.J.; Stam, D.; Steele, A.; Stephan, K.; Strobel, D.F.; Szego, K.; Szopa,

    2009-01-01

    TandEM was proposed as an L-class (large) mission in response to ESA’s Cosmic Vision 2015–2025 Call, and accepted for further studies, with the goal of exploring Titan and Enceladus. The mission concept is to perform in situ investigations of two worlds tied together by location and properties, whose remarkable natures have been partly revealed by the ongoing Cassini–Huygens mission. These bodies still hold mysteries requiring a complete exploration using a variety of vehicles and instruments. TandEM is an ambitious mission because its targets are two of the most exciting and challenging bodies in the Solar System. It is designed to build on but exceed the scientific and technological accomplishments of the Cassini–Huygens mission, exploring Titan and Enceladus in ways that are not currently possible (full close-up and in situ coverage over long periods of time). In the current mission architecture, TandEM proposes to deliver two medium-sized spacecraft to the Saturnian system. One spacecraft would be an orbiter with a large host of instruments which would perform several Enceladus flybys and deliver penetrators to its surface before going into a dedicated orbit around Titan alone, while the other spacecraft would carry the Titan in situ investigation components, i.e. a hot-air balloon (Montgolfière) and possibly several landing probes to be delivered through the atmosphere.

  14. Feedback stabilized tandem Fabry-Perot interferometer

    International Nuclear Information System (INIS)

    Fukushima, Hiroyuki; Ito, Mikio; Shirasu, Hiroshi.

    1986-01-01

    A new system for measuring the isotopic ratio of uranium, in which two plane-type Fabry-Perot interferometers (tandem FP) are connected in series. The parallelism between the two FPs is achieved automatically by a feedback control mechanism based on laser interference fringe monitoring. The structure of the tandem FP, feedback control system, automatic parallelism adjustment mechanism and wavelength synchronization mechanism are described in detail. For experiments, a hollow cathode discharge tube of a pulse discharge type is employed. Measurements are made to determine the effects of pulse width on the 238 U peak height of 502.7 nm line, recorder traces of 235 U and 238 U lines, half width for 238 U component of the 502.7 nm line, SN ratio, reproducibility of the 235 U/ 238 U peak height ratio and 235 U/ 238 U intensity ratio. Considerations are made on the spectral line width, contrast, transmission factor, and stability of automatic parallelism control and wavelength synchronization. Results obtained indicates that a single-type interferometer would serve adequately for measuring the 235 U/ 238 U ratio if the automatic parallelism control developed here is used. The ultimate object of the tandem system is to make measurement of 236 U. Satisfactory results have not obtained as yet, but most likely the present system would make it possible if a light source of a higher intensity and advanced photometric techniques are developed. (Nogami, K.)

  15. ORNL 25 MV tandem accelerator control system

    International Nuclear Information System (INIS)

    Juras, R.C.; Biggerstaff, J.A.; Hoglund, D.E.

    1985-01-01

    The CAMAC-based control system for the 25 MV tandem electrostatic accelerator of the Holifield Heavy Ion Research Facility at Oak Ridge National Laboratory (ORNL) was specified by ORNL and built by the National Electrostatics Corporation. Two Perkin-Elmer 32-bit minicomputers are used in the system, a message switching computer and a supervisory computer. The message switching computer transmits and receives control information on six serial highways. This computer shares memory with the supervisory computer. Operator consoles are located on a serial highway; control is by means of a console CRT, trackball, and assignable shaft encoders and meters. Two identical consoles operate simultaneously: one is located in the tandem control room; the other is located in the cyclotron control room to facilitate operation during injection of tandem beams into the cyclotron or when beam lines under control of the cyclotron control system are used. The supervisory computer is used for accelerator parameter setup calculations, actual accelerator setup for new beams based on scaled, recorded parameters from previously run beams, and various other functions. Nearly seven years of control system operation and improvements will be discussed

  16. Liquid chromatography-tandem mass spectrometry determination of synthetic cathinones and phenethylamines in influent wastewater of eight European cities

    DEFF Research Database (Denmark)

    Bade, Richard; Bijlsma, Lubertus; Sancho, Juan V.

    2017-01-01

    (SPE) with Oasis MCX cartridges. Isotopically labelled internal standards were used to correct for matrix effects and potential SPE losses. Following chromatographic separation on a C18 column within 6 min, the compounds were measured by tandem mass spectrometry in positive ionization mode. The method...

  17. Thermodynamic characterization of tandem mismatches found in naturally occurring RNA

    Science.gov (United States)

    Christiansen, Martha E.; Znosko, Brent M.

    2009-01-01

    Although all sequence symmetric tandem mismatches and some sequence asymmetric tandem mismatches have been thermodynamically characterized and a model has been proposed to predict the stability of previously unmeasured sequence asymmetric tandem mismatches [Christiansen,M.E. and Znosko,B.M. (2008) Biochemistry, 47, 4329–4336], experimental thermodynamic data for frequently occurring tandem mismatches is lacking. Since experimental data is preferred over a predictive model, the thermodynamic parameters for 25 frequently occurring tandem mismatches were determined. These new experimental values, on average, are 1.0 kcal/mol different from the values predicted for these mismatches using the previous model. The data for the sequence asymmetric tandem mismatches reported here were then combined with the data for 72 sequence asymmetric tandem mismatches that were published previously, and the parameters used to predict the thermodynamics of previously unmeasured sequence asymmetric tandem mismatches were updated. The average absolute difference between the measured values and the values predicted using these updated parameters is 0.5 kcal/mol. This updated model improves the prediction for tandem mismatches that were predicted rather poorly by the previous model. This new experimental data and updated predictive model allow for more accurate calculations of the free energy of RNA duplexes containing tandem mismatches, and, furthermore, should allow for improved prediction of secondary structure from sequence. PMID:19509311

  18. Independent Origin and Global Distribution of Distinct Plasmodium vivax Duffy Binding Protein Gene Duplications.

    Directory of Open Access Journals (Sweden)

    Jessica B Hostetler

    2016-10-01

    Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.

  19. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou

    2009-07-01

    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  20. Annual report of Department of Research Reactor and Tandem Accelerator, JFY2014. Operation, Utilization and Technical Development of JRR-3, JRR-4, NSRR, Tandem Accelerator and RI Production Facility

    International Nuclear Information System (INIS)

    Osa, Akihiko; Imahashi, Masaki; Hirane, Nobuhiko; Motome, Yuiko; Tayama, Hidekazu; Tamura, Itaru; Harada, Yuko; Sakata, Mami; Kadokura, Masakazu; Takita, Chiharu

    2017-02-01

    The Department of Research Reactor and Tandem Accelerator is in charge of the operation, utilization and technical development of JRR-3 (Japan Research Reactor No.3), JRR-4 (Japan Research Reactor No.4), NSRR (Nuclear Safety Research Reactor), Tandem Accelerator and RI Production Facility. This annual report describes the activities of our department in fiscal year of 2014. We carried out the operation and maintenance, utilization, upgrading of utilization techniques, safety administration, and international cooperation. Also contained are lists of publications, meetings, granted permissions on laws and regulations concerning atomic energy, outcomes in service and technical developments and so on. (author)

  1. Annual report of Department of Research Reactor and Tandem Accelerator, JFY2013. Operation, Utilization and Technical Development of JRR-3, JRR-4, NSRR, Tandem Accelerator and RI Production Facility

    International Nuclear Information System (INIS)

    Kashima, Yoichi; Murayama, Yoji; Nakamura, Kiyoshi; Uno, Yuki; Hirane, Nobuhiko; Ohuchi, Hitoshi; Ishizaki, Nobuhiro; Matsumura, Taichi; Nagahori, Kazuhisa; Harada, Yuko; Kadokura, Masakazu; Machi, Sumire; Takita, Chiharu

    2015-02-01

    The Department of Research Reactor and Tandem Accelerator is in charge of the operation, utilization and technical development of JRR-3(Japan Research Reactor No.3), JRR-4(Japan Research Reactor No.4), NSRR(Nuclear Safety Research Reactor), Tandem Accelerator and RI Production Facility. This annual report describes the activities of our department in fiscal year of 2013. We carried out the operation and maintenance, utilization, upgrading of utilization techniques, safety administration and international cooperation. Also contained are lists of publications, meetings, granted permissions on laws and regulations concerning atomic energy, outcomes in service and technical developments and so on. (author)

  2. Post-duplication charge evolution of phosphoglucose isomerases in teleost fishes through weak selection on many amino acid sites

    Directory of Open Access Journals (Sweden)

    Sato Yukuto

    2007-10-01

    Full Text Available Abstract Background The partitioning of ancestral functions among duplicated genes by neutral evolution, or subfunctionalization, has been considered the primary process for the evolution of novel proteins (neofunctionalization. Nonetheless, how a subfunctionalized protein can evolve into a more adaptive protein is poorly understood, mainly due to the limitations of current analytical methods, which can detect only strong selection for amino acid substitutions involved in adaptive molecular evolution. In this study, we employed a comparative evolutionary approach to this question, focusing on differences in the structural properties of a protein, specifically the electric charge, encoded by fish-specific duplicated phosphoglucose isomerase (Pgi genes. Results Full-length cDNA cloning, RT-PCR based gene expression analyses, and comparative sequence analyses showed that after subfunctionalization with respect to the expression organ of duplicate Pgi genes, the net electric charge of the PGI-1 protein expressed mainly in internal tissues became more negative, and that of PGI-2 expressed mainly in muscular tissues became more positive. The difference in net protein charge was attributable not to specific amino acid sites but to the sum of various amino acid sites located on the surface of the PGI molecule. Conclusion This finding suggests that the surface charge evolution of PGI proteins was not driven by strong selection on individual amino acid sites leading to permanent fixation of a particular residue, but rather was driven by weak selection on a large number of amino acid sites and consequently by steady directional and/or purifying selection on the overall structural properties of the protein, which is derived from many modifiable sites. The mode of molecular evolution presented here may be relevant to various cases of adaptive modification in proteins, such as hydrophobic properties, molecular size, and electric charge.

  3. The Prevalence of Inappropriate Image Duplication in Biomedical Research Publications

    Science.gov (United States)

    Casadevall, Arturo; Fang, Ferric C.

    2016-01-01

    ABSTRACT Inaccurate data in scientific papers can result from honest error or intentional falsification. This study attempted to determine the percentage of published papers that contain inappropriate image duplication, a specific type of inaccurate data. The images from a total of 20,621 papers published in 40 scientific journals from 1995 to 2014 were visually screened. Overall, 3.8% of published papers contained problematic figures, with at least half exhibiting features suggestive of deliberate manipulation. The prevalence of papers with problematic images has risen markedly during the past decade. Additional papers written by authors of papers with problematic images had an increased likelihood of containing problematic images as well. As this analysis focused only on one type of data, it is likely that the actual prevalence of inaccurate data in the published literature is higher. The marked variation in the frequency of problematic images among journals suggests that journal practices, such as prepublication image screening, influence the quality of the scientific literature. PMID:27273827

  4. Duplicate Address Detection Table in IPv6 Mobile Networks

    Science.gov (United States)

    Alisherov, Farkhod; Kim, Taihoon

    In IP networks, each computer or communication equipment needs an IP address. To supply enough IP addresses, the new Internet protocol IPv6 is used in next generatoion mobile communication. Although IPv6 improves the existing IPv4 Internet protocol, Duplicate Address Detection (DAD) mechanism may consume resources and suffer from long delay. DAD is used to ensure whether the IP address is unique or not. When a mobile node performs an inter-domain handoff, it will first generate a new IP and perform a DAD procedure. The DAD procedure not only wastes time but also increases the signaling load on Internet. In this paper, the author proposes a new DAD mechanism to speed up the DAD procedure. A DAD table is created in access or mobility routers in IP networks and record all IP addresses of the area. When a new IP address needs to perform DAD, it can just search in the DAD table to confirm the uniqueness of the address.

  5. Gene duplication and divergence affecting drug content in Cannabis sativa.

    Science.gov (United States)

    Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David

    2015-12-01

    Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  6. Differential retention of metabolic genes following whole-genome duplication.

    Science.gov (United States)

    Gout, Jean-François; Duret, Laurent; Kahn, Daniel

    2009-05-01

    Classical studies in Metabolic Control Theory have shown that metabolic fluxes usually exhibit little sensitivity to changes in individual enzyme activity, yet remain sensitive to global changes of all enzymes in a pathway. Therefore, little selective pressure is expected on the dosage or expression of individual metabolic genes, yet entire pathways should still be constrained. However, a direct estimate of this selective pressure had not been evaluated. Whole-genome duplications (WGDs) offer a good opportunity to address this question by analyzing the fates of metabolic genes during the massive gene losses that follow. Here, we take advantage of the successive rounds of WGD that occurred in the Paramecium lineage. We show that metabolic genes exhibit different gene retention patterns than nonmetabolic genes. Contrary to what was expected for individual genes, metabolic genes appeared more retained than other genes after the recent WGD, which was best explained by selection for gene expression operating on entire pathways. Metabolic genes also tend to be less retained when present at high copy number before WGD, contrary to other genes that show a positive correlation between gene retention and preduplication copy number. This is rationalized on the basis of the classical concave relationship relating metabolic fluxes with enzyme expression.

  7. Detection and analysis of ancient segmental duplications in mammalian genomes.

    Science.gov (United States)

    Pu, Lianrong; Lin, Yu; Pevzner, Pavel A

    2018-05-07

    Although segmental duplications (SDs) represent hotbeds for genomic rearrangements and emergence of new genes, there are still no easy-to-use tools for identifying SDs. Moreover, while most previous studies focused on recently emerged SDs, detection of ancient SDs remains an open problem. We developed an SDquest algorithm for SD finding and applied it to analyzing SDs in human, gorilla, and mouse genomes. Our results demonstrate that previous studies missed many SDs in these genomes and show that SDs account for at least 6.05% of the human genome (version hg19), a 17% increase as compared to the previous estimate. Moreover, SDquest classified 6.42% of the latest GRCh38 version of the human genome as SDs, a large increase as compared to previous studies. We thus propose to re-evaluate evolution of SDs based on their accurate representation across multiple genomes. Toward this goal, we analyzed the complex mosaic structure of SDs and decomposed mosaic SDs into elementary SDs, a prerequisite for follow-up evolutionary analysis. We also introduced the concept of the breakpoint graph of mosaic SDs that revealed SD hotspots and suggested that some SDs may have originated from circular extrachromosomal DNA (ecDNA), not unlike ecDNA that contributes to accelerated evolution in cancer. © 2018 Pu et al.; Published by Cold Spring Harbor Laboratory Press.

  8. Actualization of the Tandem-E N Accelerator of the Nuclear Centre of Mexico

    International Nuclear Information System (INIS)

    Villasenor S, P.; Aguilera R, E.; Aspiazu F, J.; Fernandez A, J.; Fernandez B, M.; Garcia R, B.; Lopez M, J.; Martinez Q, E.; Mendez G, B.; Moreno B, E.; Murillo O, G.; Policroniades R, R.; Ramirez T, J.; Reynoso V, R.; Varela G, A.; Vega C, J.

    2004-01-01

    In this work, the activities are described carried out to change the tubes accelerators and original resistances of the accelerator Tandem-E N of the Nuclear Center, for tubes DOWLISH and resistances again design, both donated ones for ORNL. This way same, the problem is described that imply this changes, and like it was solved by the personnel of the laboratory, without having to appeal to external services, what there is redounded in a considerable increment in the costs. In form preliminary the improvements are described observed after the rehabilitation of the Accelerator. (Author)

  9. [Partial facial duplication (a rare diprosopus): Case report and review of the literature].

    Science.gov (United States)

    Es-Seddiki, A; Rkain, M; Ayyad, A; Nkhili, H; Amrani, R; Benajiba, N

    2015-12-01

    Diprosopus, or partial facial duplication, is a very rare congenital abnormality. It is a rare form of conjoined twins. Partial facial duplication may be symmetric or not and may involve the nose, the maxilla, the mandible, the palate, the tongue and the mouth. A male newborn springing from inbred parents was admitted at his first day of life for facial deformity. He presented with hypertelorism, 2 eyes, a tendency to nose duplication (flatted large nose, 2 columellae, 2 lateral nostrils separated in the midline by a third deformed hole), two mouths and a duplicated maxilla. Laboratory tests were normal. The cranio-facial CT confirmed the maxillary duplication. This type of cranio-facial duplication is a rare entity with about 35 reported cases in the literature. Our patient was similar to a rare case of living diprosopus reported by Stiehm in 1972. Diprosopus is often associated with abnormalities of the gastrointestinal tract, the central nervous system, the cardiovascular and respiratory systems and with a high incidence of cleft lip and palate. Surgical treatment consists in the resection of the duplicated components. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  10. Horizontal transfer, not duplication, drives the expansion of protein families in prokaryotes.

    Directory of Open Access Journals (Sweden)

    Todd J Treangen

    2011-01-01

    Full Text Available Gene duplication followed by neo- or sub-functionalization deeply impacts the evolution of protein families and is regarded as the main source of adaptive functional novelty in eukaryotes. While there is ample evidence of adaptive gene duplication in prokaryotes, it is not clear whether duplication outweighs the contribution of horizontal gene transfer in the expansion of protein families. We analyzed closely related prokaryote strains or species with small genomes (Helicobacter, Neisseria, Streptococcus, Sulfolobus, average-sized genomes (Bacillus, Enterobacteriaceae, and large genomes (Pseudomonas, Bradyrhizobiaceae to untangle the effects of duplication and horizontal transfer. After removing the effects of transposable elements and phages, we show that the vast majority of expansions of protein families are due to transfer, even among large genomes. Transferred genes--xenologs--persist longer in prokaryotic lineages possibly due to a higher/longer adaptive role. On the other hand, duplicated genes--paralogs--are expressed more, and, when persistent, they evolve slower. This suggests that gene transfer and gene duplication have very different roles in shaping the evolution of biological systems: transfer allows the acquisition of new functions and duplication leads to higher gene dosage. Accordingly, we show that paralogs share most protein-protein interactions and genetic regulators, whereas xenologs share very few of them. Prokaryotes invented most of life's biochemical diversity. Therefore, the study of the evolution of biology systems should explicitly account for the predominant role of horizontal gene transfer in the diversification of protein families.

  11. Use of diagnostic imaging in the evaluation of gastrointestinal tract duplications.

    Science.gov (United States)

    Laskowska, Katarzyna; Gałązka, Przemysław; Daniluk-Matraś, Irena; Leszczyński, Waldemar; Serafin, Zbigniew

    2014-01-01

    Gastrointestinal tract duplication is a rare malformation associated with the presence of additional segment of the fetal gut. The aim of this study was to retrospectively review clinical features and imaging findings in intraoperatively confirmed cases of gastrointestinal tract duplication in children. The analysis included own material from the years 2002-2012. The analyzed group included 14 children, among them 8 boys and 6 girls. The youngest patient was diagnosed at the age of three weeks, and the oldest at 12 years of age. The duplication cysts were identified in the esophagus (n=2), stomach (n=5), duodenum (n=1), terminal ileum (n=5), and rectum (n=1). In four cases, the duplication coexisted with other anomalies, such as patent urachus, Meckel's diverticulum, mesenteric cyst, and accessory pancreas. Clinical manifestation of gastrointestinal duplication cysts was variable, and some of them were detected accidently. Thin- or thick-walled cystic structures adjacent to the wall of neighboring gastrointestinal segment were documented on diagnostic imaging. Ultrasound and computed tomography are the methods of choice in the evaluation of gastrointestinal duplication cysts. Apart from the diagnosis of the duplication cyst, an important issue is the detection of concomitant developmental pathologies, including pancreatic heterotopy.

  12. Penile duplication and two anal openings; report of a very rare case.

    Science.gov (United States)

    Bakheet, Mohamed Abdel Al M; Refaei, Mohammad

    2012-03-01

    Penile duplication (diphallus) is an extremely rare disorder. It is almost always associated with other malformations like double bladder, exstrophy of the cloacae, imperforate anus, duplication of the rectosigmoid and vertebral deformities. Meanwhile anal canal duplication, the most distal and least common duplication of the digestive tube and is a very rare congenital malformation. A 21 days old Egyptian neonate is reported with complete penile duplication and two scrotums with each one carrying two palpable testes. Both penises have normal shaft with normally located meatus. Clear urine voids from both meati spontaneously. The child had also a fold of redundant skin about 4×5 cm at the anal region in which two separate anal openings are present. In rectal examination we found two normal anuses passing stool spontaneously. Ascending (voiding) cystourethrography revealed two penises with two separate meatuses and one bladder from which the two urethras go out separately. Intravenous pyelogram (IVP) revealed two normal kidneys and ureters. Barium study revealed duplication of rectum and colon, otherwise normal GIT. In our review of the literature, we did not come across any other case of this variety of the penile duplication and congenital presence of two anuses. Unfortunately the patient expired before any surgical correction.

  13. Craniofacial Duplication (Diprosopus) in the Cat — Case Report and Review of the Literature

    International Nuclear Information System (INIS)

    Sekeles, E.; Aharon, D.C.; Fass, U.

    1985-01-01

    A kitten displaying the features of symmetrical partial duplication of the head (diprosopus) is described. The morphological description of this double monster is compared to three previous similar cases. All four cases were similar in that duplication of the orbits and eyes were not completed and fission of the oral and nasal cavities and their contents were partial. Furthermore, the central nervous systems were duplicated as far caudal as the brain stem. Present case displayed cleft palate in the two faces, a feature that was not described earlier. Though diprosopus is a rare anomaly in cats, it is more common than in the dog, pig and sheep. In cattle, anterior duplications are one of the largest groups of congenital anomalies. Based on generally accepted considerations concerning the mechanism behind the formation of monozyous twins, conjoined twins and anterior duplications, integrated with experimental data on induction of duplications in animals, an hypothesis is proposed for early embryonic fission. It suggests a constant cleaving factor active along the median plane with affinity to midline structures. Its temporal relations with the developing embryo, especially in susceptible species, decide the degree and type of duplication

  14. Multidetector row computed tomography and ultrasound characteristics of caudal vena cava duplication in dogs.

    Science.gov (United States)

    Bertolini, Giovanna; Diana, Alessia; Cipone, Mario; Drigo, Michele; Caldin, Marco

    2014-01-01

    Caudal vena cava duplication has been rarely reported in small animals. The purpose of this retrospective study was to describe characteristics of duplicated caudal vena cava in a large group of dogs. Computed tomography (CT) and ultrasound databases from two hospitals were searched for canine reports having the diagnosis "double caudal vena cava." One observer reviewed CT images for 71 dogs and two observers reviewed ultrasound images for 21 dogs. In all CT cases, the duplication comprised two vessels that were bilaterally symmetrical and approximately the same calibre (similar to Type I complete duplication in humans). In all ultrasound cases, the duplicated caudal vena cava appeared as a distinct vessel running on the left side of the abdominal segment of the descending aorta and extending from the left common iliac vein to the left renal vein. The prevalence of caudal vena cava duplication was 0.46% for canine ultrasound studies and 2.08% for canine CT studies performed at these hospitals. Median body weight for affected dogs was significantly lower than that of unaffected dogs (P dogs, caudal vena cava duplication should be differentiated from other vascular anomalies when planning surgeries and for avoiding misdiagnoses. © 2014 American College of Veterinary Radiology.

  15. Warfarin and Rivaroxaban Duplication: A Case Report and Medication Error Analysis.

    Science.gov (United States)

    Fusco, Julie A; Paulus, Eric J; Shubat, Alexandra R; Miah, Sharminara

    2015-12-01

    A 62-year-old African American man received unintentional duplicate anticoagulation therapy with warfarin 5 mg and rivaroxaban 20 mg daily for the treatment of recurrent pulmonary embolism. The patient presented to the anticoagulation clinic 6 days after hospital discharge with an International Normalized Ratio (INR) of 2.3 and he was instructed to continue warfarin 5 mg daily. Seven days later, he returned to the clinic with an INR >8.0 using a point-of-care device. He denied any signs or symptoms of bleeding. During the interview, he reported starting a new medication for neuropathy 5 days earlier. The clinical pharmacist contacted the dispensing pharmacy and determined rivaroxaban 20 mg was the new medication. The patient denied receiving new prescription counseling at the dispensing pharmacy. Because rivaroxaban can falsely elevate INR results, the actual INR value was unknown. To minimize the risk for recurrent venous thromboembolism, vitamin K was not administered and no warfarin doses were held. Rather, the patient was instructed to stop rivaroxaban and reduce the warfarin dose. Five days later, the patient returned with an INR of 4.3. He still had not experienced any signs or symptoms of bleeding. The patient was quickly stabilized on a warfarin maintenance dose of 22.5 mg weekly. The anticoagulation clinic pharmacist notified management at the clinic and at the dispensing pharmacy in an effort to identify process errors and prevent additional incidents.

  16. Antisense-induced exon skipping for duplications in Duchenne muscular dystrophy

    Directory of Open Access Journals (Sweden)

    van Ommen Gert-Jan B

    2007-07-01

    Full Text Available Abstract Background Antisense-mediated exon skipping is currently one of the most promising therapeutic approaches for Duchenne muscular dystrophy (DMD. Using antisense oligonucleotides (AONs targeting specific exons the DMD reading frame is restored and partially functional dystrophins are produced. Following proof of concept in cultured muscle cells from patients with various deletions and point mutations, we now focus on single and multiple exon duplications. These mutations are in principle ideal targets for this approach since the specific skipping of duplicated exons would generate original, full-length transcripts. Methods Cultured muscle cells from DMD patients carrying duplications were transfected with AONs targeting the duplicated exons, and the dystrophin RNA and protein were analyzed. Results For two brothers with an exon 44 duplication, skipping was, even at suboptimal transfection conditions, so efficient that both exons 44 were skipped, thus generating, once more, an out-of-frame transcript. In such cases, one may resort to multi-exon skipping to restore the reading frame, as is shown here by inducing skipping of exon 43 and both exons 44. By contrast, in cells from a patient with an exon 45 duplication we were able to induce single exon 45 skipping, which allowed restoration of wild type dystrophin. The correction of a larger duplication (involving exons 52 to 62, by combinations of AONs targeting the outer exons, appeared problematic due to inefficient skipping and mistargeting of original instead of duplicated exons. Conclusion The correction of DMD duplications by exon skipping depends on the specific exons targeted. Its options vary from the ideal one, restoring for the first time the true, wild type dystrophin, to requiring more 'classical' skipping strategies, while the correction of multi-exon deletions may need the design of tailored approaches.

  17. The hidden duplication past of the plant pathogen Phytophthora and its consequences for infection

    Directory of Open Access Journals (Sweden)

    Martens Cindy

    2010-06-01

    Full Text Available Abstract Background Oomycetes of the genus Phytophthora are pathogens that infect a wide range of plant species. For dicot hosts such as tomato, potato and soybean, Phytophthora is even the most important pathogen. Previous analyses of Phytophthora genomes uncovered many genes, large gene families and large genome sizes that can partially be explained by significant repeat expansion patterns. Results Analysis of the complete genomes of three different Phytophthora species, using a newly developed approach, unveiled a large number of small duplicated blocks, mainly consisting of two or three consecutive genes. Further analysis of these duplicated genes and comparison with the known gene and genome duplication history of ten other eukaryotes including parasites, algae, plants, fungi, vertebrates and invertebrates, suggests that the ancestor of P. infestans, P. sojae and P. ramorum most likely underwent a whole genome duplication (WGD. Genes that have survived in duplicate are mainly genes that are known to be preferentially retained following WGDs, but also genes important for pathogenicity and infection of the different hosts seem to have been retained in excess. As a result, the WGD might have contributed to the evolutionary and pathogenic success of Phytophthora. Conclusions The fact that we find many small blocks of duplicated genes indicates that the genomes of Phytophthora species have been heavily rearranged following the WGD. Most likely, the high repeat content in these genomes have played an important role in this rearrangement process. As a consequence, the paucity of retained larger duplicated blocks has greatly complicated previous attempts to detect remnants of a large-scale duplication event in Phytophthora. However, as we show here, our newly developed strategy to identify very small duplicated blocks might be a useful approach to uncover ancient polyploidy events, in particular for heavily rearranged genomes.

  18. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong

    2009-11-01

    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  19. Brief-stimulus presentations on multiform tandem schedules

    OpenAIRE

    Reed, Phil

    1994-01-01

    Three experiments examined the influence of a brief stimulus (a light) on the behavior of food-deprived rats whose lever pressing on tandem schedules comprising components of different schedule types resulted in food presentation. In Experiment 1, either a tandem variable-ratio variable-interval or a tandem variable-interval variable-ratio schedule was used. The variable-interval requirement in the tandem variable-ratio variable-interval schedule was yoked to the time taken to complete the va...

  20. Flexible and fragmentable tandem photosensitive nanocrystal skins

    Science.gov (United States)

    Akhavan, S.; Uran, C.; Bozok, B.; Gungor, K.; Kelestemur, Y.; Lesnyak, V.; Gaponik, N.; Eychmüller, A.; Demir, H. V.

    2016-02-01

    We proposed and demonstrated the first account of large-area, semi-transparent, tandem photosensitive nanocrystal skins (PNSs) constructed on flexible substrates operating on the principle of photogenerated potential buildup, which avoid the need for applying an external bias and circumvent the current-matching limitation between junctions. We successfully fabricated and operated the tandem PNSs composed of single monolayers of colloidal water-soluble CdTe and CdHgTe nanocrystals (NCs) in adjacent junctions on a Kapton polymer tape. Owing to the usage of a single NC layer in each junction, noise generation was significantly reduced while keeping the resulting PNS films considerably transparent. In each junction, photogenerated excitons are dissociated at the interface of the semi-transparent Al electrode and the NC layer, with holes migrating to the contact electrode and electrons trapped in the NCs. As a result, the tandem PNSs lead to an open-circuit photovoltage buildup equal to the sum of those of the two single junctions, exhibiting a total voltage buildup of 128.4 mV at an excitation intensity of 75.8 μW cm-2 at 350 nm. Furthermore, we showed that these flexible PNSs could be bent over 3.5 mm radius of curvature and cut out in arbitrary shapes without damaging the operation of individual parts and without introducing any significant loss in the total sensitivity. These findings indicate that the NC skins are promising as building blocks to make low-cost, flexible, large-area UV/visible sensing platforms with highly efficient full-spectrum conversion.We proposed and demonstrated the first account of large-area, semi-transparent, tandem photosensitive nanocrystal skins (PNSs) constructed on flexible substrates operating on the principle of photogenerated potential buildup, which avoid the need for applying an external bias and circumvent the current-matching limitation between junctions. We successfully fabricated and operated the tandem PNSs composed of

  1. Duplication at Xq28 involving IKBKG is associated with progressive macrocephaly, recurrent infections, ectodermal dysplasia, benign tumors, and neuropathy

    NARCIS (Netherlands)

    Asbeck, E. Van; Ramalingam, A.; Dvorak, C.; Chen, T.J.; Morava, E.

    2014-01-01

    Duplications on Xq28 are common, although quite variable in size, but usually include the MECP2 gene. Here, we present a patient with a unique, small, 167-kb duplication at Xq28, not including MECP2. The most important gene in the duplicated region was IKBKG, mutations in which can cause a variety

  2. Caudal Duplication Syndrome: the Vital Role of a Multidisciplinary Approach and Staged Correction

    Science.gov (United States)

    Samuk, Inbal; Levitt, Marc; Dlugy, Elena; Kravarusic, Dragan; Ben-Meir, David; Rajz, Gustavo; Konen, Osnat; Freud, Enrique

    2015-01-01

    Caudal duplication syndrome is a rare entity that describes the association between congenital anomalies involving caudal structures and may have a wide spectrum of clinical manifestations. A full-term male presented with combination of anomalies including anorectal malformation, duplication of the colon and lower urinary tract, split of the lower spine, and lipomyelomeningocele with tethering of the cord. We report this exceptional case of caudal duplication syndrome with special emphasis on surgical strategy and approach combining all disciplines involved. The purpose of this report is to present the pathology, assessment, and management strategy of this complex case. PMID:28018799

  3. Giant T-shaped duplication of the transverse colon. A case report.

    Science.gov (United States)

    Trotovsek, Blaz; Hribernik, Marija; Gvardijancic, Diana; Jelenc, Franc

    2006-01-01

    A case of long diverticular colonic duplication producing acute abdominal pain in a 6-year-old girl is presented. Physical examination showed no signs of acute abdomen at the initial presentation. After a pain-free interval, there was a sudden onset of severe abdominal pain and a large tumor in the lower abdomen was observed. A plain x-ray showed an enormously dilated colonic pouch filled with gas. Excision of the T-shaped duplication and small part of the transverse colon was successful. Because of extensive fibrotic changes in the colon near the opening of duplication, a resection margin of at least 2 cm is recommended.

  4. Caudal Duplication Syndrome: the Vital Role of a Multidisciplinary Approach and Staged Correction.

    Science.gov (United States)

    Samuk, Inbal; Levitt, Marc; Dlugy, Elena; Kravarusic, Dragan; Ben-Meir, David; Rajz, Gustavo; Konen, Osnat; Freud, Enrique

    2016-12-01

    Caudal duplication syndrome is a rare entity that describes the association between congenital anomalies involving caudal structures and may have a wide spectrum of clinical manifestations. A full-term male presented with combination of anomalies including anorectal malformation, duplication of the colon and lower urinary tract, split of the lower spine, and lipomyelomeningocele with tethering of the cord. We report this exceptional case of caudal duplication syndrome with special emphasis on surgical strategy and approach combining all disciplines involved. The purpose of this report is to present the pathology, assessment, and management strategy of this complex case.

  5. Duplication of the pituitary gland in a newborn with median cleft face syndrome and nasal teratoma

    Energy Technology Data Exchange (ETDEWEB)

    Hamon-Kerautret, M.; Ares, G.S.; Demondion, X.; Pruvo, J.P. [Service de Neuroradiologie, Hopital Roger Salengro, CHRU Lille (France); Rouland, V. [Service de Neonatologie, Hopital Roger Salengro, CHRU Lille (France); Francke, J.P. [Departement d`Anatomie, Faculte de Medicine, Universite de Lille (France)

    1998-05-01

    A newborn suffered immediate neonatal respiratory distress because of an obstructive, soft-tissue nasal mass. Clinical examination revealed a cleft palate with a protruding polypoid mass. CT and MRI showed a heterogeneous nasopharyngeal mass and associated intracranial abnormalities - duplication of the hypophysis and hypoplasia of the corpus callosum. Duplication of the hypophysis is a very rare malformation, only 13 cases having been previously described. The suggested pathogenesis is duplication of the prechordal plate and anterior end of the notochord during early embryological development. (orig.) With 2 figs., 3 refs.

  6. Duplication of the pituitary gland in a newborn with median cleft face syndrome and nasal teratoma

    International Nuclear Information System (INIS)

    Hamon-Kerautret, M.; Ares, G.S.; Demondion, X.; Pruvo, J.P.; Rouland, V.; Francke, J.P.

    1998-01-01

    A newborn suffered immediate neonatal respiratory distress because of an obstructive, soft-tissue nasal mass. Clinical examination revealed a cleft palate with a protruding polypoid mass. CT and MRI showed a heterogeneous nasopharyngeal mass and associated intracranial abnormalities - duplication of the hypophysis and hypoplasia of the corpus callosum. Duplication of the hypophysis is a very rare malformation, only 13 cases having been previously described. The suggested pathogenesis is duplication of the prechordal plate and anterior end of the notochord during early embryological development. (orig.)

  7. A case of asymptomatic ileal duplication cyst associated with acute appendicitis

    Directory of Open Access Journals (Sweden)

    Hülya İpek

    2017-07-01

    Full Text Available Duplications of the alimentary tract are infrequent anomalies. They are most frequently located in the terminal ileum, and majority of them became symptomatic before the age of 2. Presenting symptoms may include abdominal mass, intestinal obstruction, intussusception, rectal bleeding, and abdominal pain. Preoperative diagnosis is usually difficult, intra-abdominal duplications are usually diagnosed during surgical explorations of above complications. We presented a 12-year-old girl with asymptomatic ileal duplication cyst associated with non-complicated acute appendicitis, whose imaging studies at admission were compatible with complicated perforated appendicitis.

  8. Scintigraphic detection of 'yo-yo' phenomenon in incomplete ureteric duplication

    International Nuclear Information System (INIS)

    Chu, Winnie C.W.; Chan, Kam-wing; Metreweli, Constantine

    2003-01-01

    'Yo-yo' reflux in an incompletely duplicated renal system was demonstrated on 99m Tc-mercaptoacetyltriglycine (MAG3) renal scintigraphy in a 7-year-old girl presenting with low-grade fever and pyelonephritis. Incomplete duplication and a bifid renal pelvis, which may be seen in up to 4% of the North American population, occasionally causes symptoms because of recurrent urinary tract infection or loin pain. 99m Tc-MAG3 renal scintigraphy can demonstrate 'yo-yo' reflux in patients with incomplete renal duplication and should be considered in cases with unexplained loin pain, even if 99m Tc-dimercaptosuccinic acid (DMSA) renal scintigraphy is normal. (orig.)

  9. Molecular cytogenetic characterization and origin of two de novo duplication 9p cases.

    Science.gov (United States)

    Tsezou, A; Kitsiou, S; Galla, A; Petersen, M B; Karadima, G; Syrrou, M; Sahlèn, S; Blennow, E

    2000-03-13

    We report on two additional cases with duplication of 9p, minor with facial anomalies and developmental delay. Using fluorescence in situ hybridization and single-copy probes, we showed that the first case was a direct duplication, whereas the second case was inverted. The extent of the direct duplication was defined as 9p12 --> p24 by microdissection and microcloning of the aberrant chromosome and subsequent chromosome-specific comparative genomic hybridization. DNA polymorphism analysis with eight microsatellite markers revealed that the origin of the dup(9p) was maternal in the first case, whereas it was paternal in the second. Copyright 2000 Wiley-Liss, Inc.

  10. Anal canal duplication and triplication: a rare entity with different presentations.

    Science.gov (United States)

    Palazon, P; Julia, V; Saura, L; de Haro, I; Bejarano, M; Rovira, C; Tarrado, X

    2017-05-01

    Anal canal duplication (ACD) is the rarest of gastrointestinal duplications. Few cases have been reported. Most cases present as an opening in the midline, posterior to the normal anus. The aim of our revision is to contribute with eight new cases, some of them with unusual presentations: five presented as the typical form, one with a perianal nodule, and two presented as two separate orifices (anal canal triplication). Complete excision was performed in all patients with no complications. ACD is the most distal and the least frequent digestive duplication. Its treatment should be surgical excision, to avoid complications such as abscess, fistulization, or malignization. Anal canal triplication has never been described before.

  11. Can the US shale revolution be duplicated in Europe?

    International Nuclear Information System (INIS)

    Saussay, Aurelien

    2015-04-01

    Over the past decade, the rapid increase in shale gas and shale oil production in the United States has profoundly changed energy markets in North America, and has led to a significant decrease in American natural gas prices. The possible existence of large shale deposits in Europe, mainly in France, Poland and the United Kingdom, has fostered speculation on whether the 'shale revolution', and its accompanying macro-economic impacts, could be duplicated in Europe. However, a number of uncertainties, notably geological, technological and regulatory, make this possibility unclear. We present a techno-economic model, SHERPA (Shale Exploitation and Recovery Projection and Analysis), to analyze the main determinants of the profitability of shale wells and plays. We calibrate our model using production data from the leading American shale plays. We use SHERPA to estimate three shale gas production scenarios exploring different sets of geological and technical hypotheses for the largest potential holder of shale gas deposits in Europe, France. Even considering that the geology of the potential French shale deposits is favorable to commercial extraction, we find that under assumptions calibrated on U.S. production data, natural gas could be produced at a high breakeven price of $8.6 per MMBtu, and over a 45 year time-frame have a net present value of $19.6 billion - less than 1% of 2012 French GDP. However, the specificities of the European context, notably high deposit depth and stricter environmental regulations, could increase drilling costs and further decrease this low profitability. We find that a 40% premium over American drilling costs would make shale gas extraction uneconomical. Absent extreme well productivity, it appears very difficult for shale gas extraction to have an impact on European energy markets comparable to the American shale revolution. (author)

  12. Vacuum vessel for the tandem Mirror Fusion Test Facility

    International Nuclear Information System (INIS)

    Gerich, J.W.

    1986-01-01

    In 1980, the US Department of Energy gave the Lawrence Livermore National Laboratory approval to design and build a tandem Mirror Fusion Test Facility (MFTF-B) to support the goals of the National Mirror Program. We designed the MFTF-B vacuum vessel both to maintain the required ultrahigh vacuum environment and to structurally support the 42 superconducting magnets plus auxiliary internal and external equipment. During our design work, we made extensive use of both simple and complex computer models to arrive at a cost-effective final configuration. As part of this work, we conducted a unique dynamic analysis to study the interaction of the 32,000-tonne concrete-shielding vault with the 2850-tonne vacuum vessel system. To maintain a vacuum of 2 x 10 -8 torr during the physics experiments inside the vessel, we designed a vacuum pumping system of enormous capacity. The vacuum vessel (4200-m 3 internal volume) has been fabricated and erected, and acceptance tests have been completed at the Livermore site. The rest of the machine has been assembled, and individual systems have been successfully checked. On October 1, 1985, we began a series of integrated engineering tests to verify the operation of all components as a complete system

  13. Some new ideas for Tandem Mirror blankets

    International Nuclear Information System (INIS)

    Neef, W.S. Jr.

    1981-01-01

    The Tandem Mirror Reactor, with its cylindrical central cell, has led to numerous blanket designs taking advantage of the simple geometry. Also many new applications for fusion neutrons are now being considered. To the pure fusion electricity producers and hybrids producing fissile fuel, we are adding studies of synthetic fuel producers and fission-suppressed hybrids. The three blanket concepts presented are new ideas and should be considered illustrative of the breadth of Livermore's application studies. They are not meant to imply fully analyzed designs

  14. Tandem mirror and tokamak reactor maintainability comparison

    International Nuclear Information System (INIS)

    Zahn, H.S.

    1981-01-01

    The analysis proceeds through estimates of downtime and resources required for selected maintenance actions and optimization of the replacement fraction, availability and cost of electricity. Scheduled downtime estimates and availability goals provide a basis for determining allowable forced outage downtimes. These analyses have been conducted with the assumption of redundancy wherever feasible but without the impact of maintenance equipment outages. Annual maintenance cost estimates and availabilities for both reactors are found to be approximately equal. However, the tandem mirror reactor capital costs are higher. Reduction of these costs appears feasible with the trend of current design studies toward smaller and more accessible machines

  15. Parametric systems analysis for tandem mirror hybrids

    International Nuclear Information System (INIS)

    Lee, J.D.; Chapin, D.L.; Chi, J.W.H.

    1980-09-01

    Fusion fission systems, consisting of fissile producing fusion hybrids combining a tandem mirror fusion driver with various blanket types and net fissile consuming LWR's, have been modeled and analyzed parametrically. Analysis to date indicates that hybrids can be competitive with mined uranium when U 3 O 8 cost is about 100 $/lb., adding less than 25% to present day cost of power from LWR's. Of the three blanket types considered, uranium fast fission (UFF), thorium fast fission (ThFF), and thorium fission supressed (ThFS), the ThFS blanket has a modest economic advantage under most conditions but has higher support ratios and potential safety advantages under all conditions

  16. NSF tandem stack support structure deflection characteristics

    International Nuclear Information System (INIS)

    Cook, J.

    1979-12-01

    Results are reported of load tests carried out on the glass legs of the insulating stack of the 30 MV tandem Van de Graaff accelerator now under construction at Daresbury Laboratory. The tests to investigate the vulnerability of the legs when subjected to tensile stresses were designed to; establish the angle of rotation of the pads from which the stresses in the glass legs may be calculated, proof-test the structure and at the same time reveal any asymmetry in pad rotations or deflections, and to confirm the validity of the computer design analysis. (UK)

  17. A tandem queue with delayed server release

    OpenAIRE

    Nawijn, W.M.

    1997-01-01

    We consider a tandem queue with two stations. The rst station is an s-server queue with Poisson arrivals and exponential service times. After terminating his service in the rst station, a customer enters the second station to require service at an exponential single server, while in the meantime he is blocking his server in station 1 until he completes service in station 2, whereupon the server in station 1 is released. An analysis of the generating function of the simultaneous probability di...

  18. Negative ion sources for tandem accelerator

    International Nuclear Information System (INIS)

    Minehara, Eisuke

    1980-08-01

    Four kinds of negative ion sources (direct extraction Duoplasmatron ion source, radial extraction Penniing ion source, lithium charge exchange ion source and Middleton-type sputter ion source) have been installed in the JAERI tandem accelerator. The ion sources can generate many negative ions ranging from Hydrogen to Uranium with the exception of Ne, Ar, Kr, Xe and Rn. Discussions presented in this report include mechanisms of negative ion formation, electron affinity and stability of negative ions, performance of the ion sources and materials used for negative ion production. Finally, the author will discuss difficult problems to be overcome in order to get any negative ion sufficiently. (author)

  19. Plasma confinement in the TMX tandem mirror

    International Nuclear Information System (INIS)

    Hooper, E.B. Jr.; Allen, S.L.; Casper, T.A.

    1981-01-01

    Plasma confinement in the Tandem Mirror Experiment (TMX) is described. Axially confining potentials are shown to exist throughout the central 20-cm core of TMX. Axial electron-confinement time is up to 100 times that of single-cell mirror machines. Radial transport of ions is smaller than axial transport near the axis. It has two parts at large radii: nonambipolar, in rough agreement with predictions from resonant-neoclassical transport theory, and ambipolar, observed near the plasma edge under certain conditions, accompanied by a low-frequency, m = 1 instability or strong turbulence

  20. Tandem Carbocupration/Oxygenation of Terminal Alkynes

    Science.gov (United States)

    Zhang, Donghui; Ready, Joseph M.

    2008-01-01

    A direct and general synthesis of α-branched aldehydes and their enol derivatives is described. Carbocupration of terminal alkynes and subsequent oxygenation with lithium tert-butyl peroxide generates a metallo-enolate. Trapping with various electrophiles provides α-branched aldehydes or stereo-defined trisubstituted enol esters or silyl ethers. The tandem carbocupration/oxygenation tolerates alkyl and silyl ethers, esters and tertiary amines. The reaction is effective with organocopper complexes derived from primary, secondary and tertiary Grignard reagents and from n-butyllithium. PMID:16321021

  1. Beam trajectories through the upgraded XTU tandem

    International Nuclear Information System (INIS)

    Guan Xialing

    1988-01-01

    The paper deals with a problem applicable to all electrostatic accelerators with inclined field accelerating tubes, how the trajectory of the central beam particle is affected if one of the accelerating gaps must be shorted out due to insulator failure. For the long tube of the Legnaro XTU tandem the effect of each accelerator gap is calculated and a method of compensation either by shorting out an appropriate gap with reversed incline or by appropriately steering the beam into the entrance of the low energy tube is given. (orig.)

  2. SU-D-BRF-05: A Novel System to Provide Real-Time Image-Guidance for Intrauterine Tandem Insertion and Placement

    Energy Technology Data Exchange (ETDEWEB)

    Price, M; Fontenot, J [pF Biomedical Solutions LLC, Baton Rouge, LA (United States)

    2014-06-01

    Purpose: To develop a system that provides real-time image-guidance for intrauterine tandem insertion and placement for brachytherapy. Methods: The conceptualized system consists of an intrauterine tandem with a transparent, lensed tip, a flexible miniature fiber optic scope, light source and interface for CCD coupling. The tandem tip was designed to act as a lens providing a wide field-of-view (FOV) with minimal image distortion and focus length appropriate for the application. The system is designed so that once inserted, the image-guidance component of the system can be removed and brachytherapy can be administered without interfering with source transport or disturbing tandem placement. Proof-of-principle studies were conducted to assess the conceptualized system's (1) lens functionality (clarity, focus and FOV) (2) and ability to visualize the cervical os of a female placed in the lithotomy position. Results: A prototype of this device was constructed using a commercial tandem modified to incorporate a transparent tip that internally coupled with a 1.9mm diameter fiber optic cable. The 900mm-long cable terminated at an interface that provided illumination as well as facilitated visualization of patient anatomy on a computer. The system provided a 23mm FOV with a focal length of 1cm and provided clear visualization of the cervix, cervical fornix and cervical os. The optical components of the system are easily removed without perturbing the position of a tandem placed in a common fixation clamp. Conclusion: Clinicians frequently encounter difficulty inserting an intrauterine tandem through the cervical os, circumventing fibrotic tissue or masses within the uterus, and positioning the tandem without perforating the uterus. To mitigate these challenges, we have designed and conducted proof-of- principle studies to discern the utility of a prototype device that provides real-time image-guidance for intrauterine tandem placement using fiber optic components.

  3. Chemical modification of DNA: Molecular specificity studied by tandem mass spectrometry and liquid chromatography

    International Nuclear Information System (INIS)

    Chang, Ching-jer; Cooks, R.G.; Chae, Whi-Gun; Wood, J.M.

    1989-01-01

    Chemical modifications of DNA in vitro could be directly studied by C-13 NMR and P-31 NMR, which eliminated all degradation and separation processes. The prospects of utilized the NMR method in the in vitro experiments are limited because of the inherent low sensitivity of NMR and low level of DNA modification. We have developed a reverse-phase ion-paired HPLC method to study DNA modifications by methylating agents. The structural specificity of HPLC is significantly enhanced by conjunction with the specificity of enzymic transformations. The HPLC studies have also revealed the limitation of HPLC method for simultaneous determination of many minor modified nucleosides. This problem has been overcome by tandem mass spectrometry. In conjunction with the resolving power of HPLC in separating isomers, desorption chemical ionization tandem mass spectrometry has been utilized in the determination of the modified nucleosides at the picomole level using stable-isotope labeled compounds as internal references

  4. Radioisotope detection with tandem electrostatic accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Gove, H E; Elmore, D; Ferraro, R [Rochester Univ., NY (USA). Nuclear Structure Research Lab.; Beukens, R P; Chang, K H; Kilius, L R; Lee, H W; Litherland, A E [Toronto Univ., Ontario (Canada). Dept. of Physics; Purser, K H [General Ionex Corp., Newburyport, MA (USA)

    1980-01-01

    An MP tandem Van de Graaff accelerator at the University of Rochester has been employed since May 1977 to detect /sup 14/C in terrestrial samples, /sup 36/Cl in terrestrial and extraterrestrial samples and /sup 10/Be and /sup 26/Al in samples produced by reactor and accelerator irradiation. The sample sizes ranged from about 10 to less than 1 mg and the ratio of the radioisotope to the stable isotopes approached one part in 10/sup 16/ for /sup 14/C and /sup 36/Cl and one part in 10/sup 14/ for /sup 10/Be and /sup 26/Al. /sup 14/C has been measured in a number of samples of geological and archaelogical interest. /sup 36/Cl has been measured in various groundwater samples as well as samples at Antarctic meteorites and ice. Dedicated systems for /sup 14/C dating and geological measurements based on the tandem electrostatic accelerator principle are presently under construction for laboratories in the U.S.A., U.K. and Canada.

  5. Progress in the tandem mirror program

    International Nuclear Information System (INIS)

    Fowler, T.K.; Borchers, R.R.

    1981-01-01

    Experimental results in TMX have confirmed the basic principles of the tandem-mirror concept. A center-cell particle confinement parameter eta tau approx. 10 11 cm -3 s has been obtained at ion temperatures around 100 eV, which is a hundred-fold improvement over single mirrors at the same temperatures. For TMX these results have been obtained at peak beta values in the center cell in the range 10 to 40%, not yet limited by MHD activity; and ion-cyclotron resonant heating (ICRH) in the Phaedrus tandem-mirror experiment has produced beta values approx. 25%, which is several times the ideal MHD limit for that device. In addition, it has been demonstrated that the end fan chambers of TMX simultaneously isolate the hot electrons from the end walls, provide adequate pumping and conveniently dispose of the exhaust plasma energy either by thermal deposition on the end wall or by direct conversion to electricity (at 48% efficiency in agreement with calculations). Also, evidence was obtained for inherent divertor action in TMX, presumably in part responsible for the observed low impurity level

  6. Remote maintenance of tandem mirror hybrid coils

    International Nuclear Information System (INIS)

    Dietz, L.P.

    1983-01-01

    Hybrid Coils (superconducting coils with normal conducting inserts) are being employed with increasing frequency on Tandem Mirror Devices to obtain high field strengths. The normal conducting copper inserts are short lived in comparison to their encircling superconductors. It becomes desirable, therefore, to devise design features and maintenance procedures to replace the inner normal conducting coils without simultaneously replacing the longer lived (and significantly more costly) superconducting coils. The high neutron wall loadings require that the task be accomplished by remote control. The approach is to permanently mount the coil assemblies on track mounted carriages which serve, during machine operation merely as structural supports, but during maintenance procedures as moveable transport devices. The carriages incorporate all necessary provisions to facilitate remote maintenance operations and to adjust and align the coil assemblies with respect to adjacent machine components. The vacuum vessel is severed on both sides of the hybrid coil by means of a remote cutting machine. The entire coil is transported horizontally, normal to the machine axis to a nearby repair station. Prepositioned carriage mounted repair equipment at the repair station withdraws the damaged normal coil as a single entity and inserts a preassembled spare unit. The repaired hybrid coil is reassembled to the reactor. A cost and risk effective procedure has been evolved to maintain one of the more critical components of a Tandem Mirror Machine

  7. Craniofacial duplication (diprosopus): report of a case with a review of the literature.

    Science.gov (United States)

    Amr, S S; Hammouri, M F

    1995-01-01

    A case of craniofacial duplication (diprosopus) is presented. Details on this rare form of conjoined twins are described, and the proposed theories of its embryogenesis are discussed with brief review of the pertinent literature.

  8. Role of computed tomography in oesophageal duplications. Report of two cases

    International Nuclear Information System (INIS)

    Jouini, S.; Menif, E.; Azaiez, N.; Ben Hajel, H.; Cheikh, I.; Ben Ammar, A.; Sellami, M.; Ben Jaafar, M.

    1995-01-01

    The authors present two cases of esophageal duplication: tubular in one case and cystic in the other. This rare anomaly was identified in both cases by CT scan. A review of literature is proposed. (authors). 22 refs., 10 figs

  9. Acute abdominal pain presenting as a rare appendiceal duplication: a case report

    Directory of Open Access Journals (Sweden)

    Mahmood Ali

    2012-03-01

    Full Text Available Abstract Introduction Appendiceal duplication is a rare anomaly that can manifest as right lower quadrant pain. There are several variations described for this condition. We recommend aggressive operative management should this anatomical variation present in the presence of acute appendicitis. Case presentation We report the case of a 15-year-old African American girl who presented to our hospital with right lower quadrant pain and was subsequently found to have appendiceal duplication. Conclusion There are two categorical systems that have described and stratified appendiceal duplication. Both classification systems have been outlined and referenced in this case report. A computed tomography scan has been included to provide a visual aid to help identify true vermiform appendiceal duplication. The presence of this anatomical abnormality is not a reason for surgical intervention; however, should this be found in the setting of acute appendicitis, aggressive resection of both appendices is mandatory.

  10. MLL duplication in a pediatric patient with B-cell lymphoblastic lymphoma.

    Science.gov (United States)

    Mater, David Van; Goodman, Barbara K; Wang, Endi; Gaca, Ana M; Wechsler, Daniel S

    2012-04-01

    Lymphoblastic lymphoma is the second most common type of non-Hodgkin lymphoma seen in children. Approximately, 90% of lymphoblastic lymphomas arise from T cells, with the remaining 10% being B-cell-lineage derived. Although T-cell lymphoblastic lymphoma most frequently occurs in the anterior mediastinum (thymus), B-cell lymphoblastic lymphoma (B-LBL) predominates in extranodal sites such as skin and bone. Here, we describe a pediatric B-LBL patient who presented with extensive abdominal involvement and whose lymphoma cells displayed segmental duplication of the mixed lineage leukemia (MLL) gene. MLL duplication/amplification has been described primarily in acute myeloid leukemia and myelodysplastic syndrome with no published reports of discrete MLL duplication/amplification events in B-LBL. The MLL gene duplication noted in this case may represent a novel mechanism for tumorigenesis in B-LBL.

  11. 48 CFR 1852.208-81 - Restrictions on Printing and Duplicating.

    Science.gov (United States)

    2010-10-01

    ..., presswork, duplicating, silk screen processes, binding, microform, and the end items of such processes and... one sheet, size 8-1/2×11 inches (215×280 mm), one side only, and one color ink. (d) This clause does...

  12. Bilateral inferior vena cava filter insertion in a patient with duplication of the infrarenal vena cava.

    LENUS (Irish Health Repository)

    Leong, S

    2010-06-19

    BACKGROUND: Inferior vena cava (IVC) filter insertion is a commonly performed procedure for indications such as recurrent pulmonary emboli or contraindication to anticoagulation. Symptomatic duplication of the IVC is exceedingly rare with only a handful of cases being described in the literature. AIM: We report an unusual case of a patient with symptomatic duplication of the IVC. RESULT: A 53-year-old woman presented at our hospital for resection of a cerebral metastasis from a non-small cell lung cancer following a recent diagnosis of bilateral lower limb deep venous thrombosis. This required perioperative reversal of anticoagulation and IVC filter insertion. Conventional venography performed during filter insertion documented the existence of a duplicated IVC. CONCLUSION: We present a case of a symptomatic duplication of the IVC requiring filter insertion. We review the developmental anatomy of the IVC along with the diagnostic findings and management strategies available.

  13. Epicardial oesophageal duplication with hiatal hernia in a case of Turner's syndrome

    International Nuclear Information System (INIS)

    Tamburrini, O.; Cigliano, S.; Esposito, G.; Cucchiara, S.

    1983-01-01

    The authors of this paper report the first case of epicardial oesophageal duplication causing hiatal hernia in a patient afflicted with Turner's syndrome, and they discuss its possible etiology. (orig.)

  14. Retroperitoneal duplication cyst with a fistulous tract to the vagina: a case report.

    Science.gov (United States)

    Filmar, Gilad A; Lotze, Peter M; Fisher, Hilaire W

    2012-01-01

    To describe a rare case of a retroperitoneal duplication cyst that fistulized to the vagina. Case description and discussion of a patient found to have an intestinal duplication cyst. A patient presented for a laparoscopic hysterectomy because of menorrhagia and a fibroid uterus. She also complained of recurrent urinary tract infections (UTIs) and a vaginal discharge. A retroperitoneal intestinal duplication cyst that fistulized to the vagina and caused her recurrent UTIs was identified. Surgical resection of the cyst resolved her complaint of recurrent UTIs. Retroperitoneal intestinal duplication cysts are rare congenital anomalies with vague clinical manifestations. The finding of a fistulous communication to the vagina originating from such a structure can be associated with recurrent UTIs.

  15. Neutral and Non-Neutral Evolution of Duplicated Genes with Gene Conversion

    Directory of Open Access Journals (Sweden)

    Jeffrey A. Fawcett

    2011-02-01

    Full Text Available Gene conversion is one of the major mutational mechanisms involved in the DNA sequence evolution of duplicated genes. It contributes to create unique patters of DNA polymorphism within species and divergence between species. A typical pattern is so-called concerted evolution, in which the divergence between duplicates is maintained low for a long time because of frequent exchanges of DNA fragments. In addition, gene conversion affects the DNA evolution of duplicates in various ways especially when selection operates. Here, we review theoretical models to understand the evolution of duplicates in both neutral and non-neutral cases. We also explain how these theories contribute to interpreting real polymorphism and divergence data by using some intriguing examples.

  16. 9 CFR 201.28 - Duplicates of bonds or equivalents to be filed with Regional Supervisors.

    Science.gov (United States)

    2010-01-01

    ... duplicates of all endorsements, amendments, riders, indemnity agreements, and other attachments thereto, and photographically reproduced copies of any letter of credit or amendment thereto, shall be filed with the Regional...

  17. Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes

    Science.gov (United States)

    Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.

    2011-01-01

    vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289

  18. Duplicate Recording of Contracts in the Mechanization of Contract Administration Services System

    National Research Council Canada - National Science Library

    Lane, F

    1996-01-01

    ... in more than one of the system's data bases. We also evaluated whether the Mechanization of Contract Administration Services system had adequate controls to detect and prevent duplicate contract payments, and whether database errors...

  19. Volvulus U-Shaped transverse colonic duplication: Report of a case and literature review

    Directory of Open Access Journals (Sweden)

    Ruankha Bilommi

    2017-05-01

    Full Text Available Tubular duplication of the colon is very rare especially in adulthood, because it is frequently symptomatic earlier in newborn life, so only few cases are reported in literature. Several theories are proposed to explain the onset and the evolution of gut malformations as the aberrant lumen recanalization or the diverticular theory, the alteration of the lateral closure of the embryonal disk or finally the dorsal protrusion of the yolk-sac for herniation or adhesion to the ectoderm for an abnormality of the longitudinal line, but none clarifies the exact genesis of duplication [1–3]. U Shaped transverse colonic duplication with volvulus has never been reported before and very rare in condition in gastrointestinal duplication.

  20. Array comparative genomic hybridization analysis of a familial duplication of chromosome 13q: A recognizable syndrome

    NARCIS (Netherlands)

    Mathijssen, Inge B.; Hoovers, Jan M. N.; Mul, Adri N. P. M.; Man, Hai-Yen; Ket, Jan L.; Hennekam, Raoul C. M.

    2005-01-01

    We report on a family with six persons in three generations who have mild mental retardation, behavioral problems, seizures, hearing loss, strabismus, dental anomalies, hypermobility, juvenile hallux valgus, and mild dysmorphic features. Classical cytogenetic analysis showed a partial duplication of

  1. The fate of the duplicated androgen receptor in fishes: a late neofunctionalization event?

    Directory of Open Access Journals (Sweden)

    Haendler Bernard

    2008-12-01

    Full Text Available Abstract Background Based on the observation of an increased number of paralogous genes in teleost fishes compared with other vertebrates and on the conserved synteny between duplicated copies, it has been shown that a whole genome duplication (WGD occurred during the evolution of Actinopterygian fish. Comparative phylogenetic dating of this duplication event suggests that it occurred early on, specifically in teleosts. It has been proposed that this event might have facilitated the evolutionary radiation and the phenotypic diversification of the teleost fish, notably by allowing the sub- or neo-functionalization of many duplicated genes. Results In this paper, we studied in a wide range of Actinopterygians the duplication and fate of the androgen receptor (AR, NR3C4, a nuclear receptor known to play a key role in sex-determination in vertebrates. The pattern of AR gene duplication is consistent with an early WGD event: it has been duplicated into two genes AR-A and AR-B after the split of the Acipenseriformes from the lineage leading to teleost fish but before the divergence of Osteoglossiformes. Genomic and syntenic analyses in addition to lack of PCR amplification show that one of the duplicated copies, AR-B, was lost in several basal Clupeocephala such as Cypriniformes (including the model species zebrafish, Siluriformes, Characiformes and Salmoniformes. Interestingly, we also found that, in basal teleost fish (Osteoglossiformes and Anguilliformes, the two copies remain very similar, whereas, specifically in Percomorphs, one of the copies, AR-B, has accumulated substitutions in both the ligand binding domain (LBD and the DNA binding domain (DBD. Conclusion The comparison of the mutations present in these divergent AR-B with those known in human to be implicated in complete, partial or mild androgen insensitivity syndrome suggests that the existence of two distinct AR duplicates may be correlated to specific functional differences that may be

  2. The conversion of centrioles to centrosomes: essential coupling of duplication with segregation

    OpenAIRE

    Wang, Won-Jing; Soni, Rajesh Kumar; Uryu, Kunihiro; Bryan Tsou, Meng-Fu

    2011-01-01

    Centrioles are self-reproducing organelles that form the core structure of centrosomes or microtubule-organizing centers (MTOCs). However, whether duplication and MTOC organization reflect innate activities of centrioles or activities acquired conditionally is unclear. In this paper, we show that newly formed full-length centrioles had no inherent capacity to duplicate or to organize pericentriolar material (PCM) but acquired both after mitosis through a Plk1-dependent modification that occur...

  3. Extreme fenestration of the basilar artery associated with cleft palate, nasopharyngeal mature teratoma, and hypophyseal duplication

    Energy Technology Data Exchange (ETDEWEB)

    Uchino, A.; Sawada, A.; Takase, Y.; Kudo, S. [Department of Radiology, Saga Medical School, 5-1-1, Nabeshima, Saga 849-8501 (Japan); Fujita, I. [Department of Pediatrics, Saga Medical School, 5-1-1, Nabeshima, Saga 849-8501 (Japan)

    2002-08-01

    The authors present the case of a newborn girl with extreme fenestration of the basilar artery. This anomaly was found incidentally during MR imaging study for cleft palate and nasopharyngeal teratoma. Magnetic resonance angiography showed a totally duplicated basilar artery with connections at the proximal and distal ends of the artery, suggesting an extreme fenestration. Duplicated pituitary gland was also found on MR imaging. (orig.)

  4. Extreme fenestration of the basilar artery associated with cleft palate, nasopharyngeal mature teratoma, and hypophyseal duplication

    International Nuclear Information System (INIS)

    Uchino, A.; Sawada, A.; Takase, Y.; Kudo, S.; Fujita, I.

    2002-01-01

    The authors present the case of a newborn girl with extreme fenestration of the basilar artery. This anomaly was found incidentally during MR imaging study for cleft palate and nasopharyngeal teratoma. Magnetic resonance angiography showed a totally duplicated basilar artery with connections at the proximal and distal ends of the artery, suggesting an extreme fenestration. Duplicated pituitary gland was also found on MR imaging. (orig.)

  5. Intestinal duplication and retroperitoneal teratoma in child hoof: a case report

    International Nuclear Information System (INIS)

    Atzingen, Augusto Castelli Von; Bazzano, Felix Carlos Ocariz; Tiburzio, Nicolas Biagione; Grande, Rogerio Mendes; Juntolli Netto, Joao Diniz

    2007-01-01

    The authors present a case of intestinal duplication and retroperitoneal teratoma in a 7-year-old patient with evident mass and abdominal pain to explain; that it was submitted to study conventional X-ray, ultrasonography, computed tomography and subsequent exploiting laparotomia. The anatomopathological study verified intestinal duplication and ripe teratoma. In the existent medical literature it was not found any similar case. (author)

  6. Duodenal duplication cyst and pancreas divisum causing acute pancreatitis in an adult male

    OpenAIRE

    Redondo-Cerezo, Eduardo; Pleguezuelo-Díaz, Julio; de Hierro, Mercedes López; Macias-Sánchez, José F; Ubiña, Cristina Viñolo; Martín-Rodríguez, María Del Mar; Teresa-Galván, Javier De

    2010-01-01

    Duodenal duplication cysts are rare congenital abnormalities which are more commonly diagnosed in infancy and childhood. However, in rare cases, these lesions can remain asymptomatic until adulthood. The combination of duplication cyst and pancreas divisum is extremely rare and both conditions have been linked with acute recurrent pancreatitis. We present the case of a 37 years-old patient who presented with repeated episodes of acute pancreatitis. By means of magnetic resonance imaging and e...

  7. Duplication of the cervical esophagus: a case report and review of the literature

    International Nuclear Information System (INIS)

    Wootton-Gorges, Sandra L.; Eckel, Gregory M.; Poulos, Nicholas D.; Kappler, Sherri; Milstein, Jay M.

    2002-01-01

    This report describes a newborn with a cervical esophageal duplication cyst, a rare developmental anomaly of the neck. Only a few cases of this cystic entity have been described in the literature to date. This case is unique in that the patient had an air-fluid level within the lesion as a result of communication of the duplication cyst with the native esophagus. (orig.)

  8. Perineal mass protrusion with rectal mucosa: a rectal duplication that underwent exstrophy.

    Science.gov (United States)

    Sun, Junjie; Vongphet, Soulithone; Zhang, Zhichong; Mo, Jiacong

    2011-08-01

    We present a rare case of a male neonate with a perineal mass with rectal mucosa, diagnosed as an exstrophic duplication of the rectum. It was accompanied by a cord that was deeply invested in the pelvic diaphragm and was composed of smooth muscle, fibrous tissue, and some rectal glands. The association of exstrophic rectal duplication with a bifid scrotum, hypospadias, and normal anus has not been described previously in the literature. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. Diphallus with Imperforate Anus and Complete Duplication of Recto-Sigmoid Colon and Lower Urinary Tract

    OpenAIRE

    Mirshemirani, Alireza; Roshanzamir, Fatollah; Shayeghi, Shahnaz; Mohajerzadeh, Leily; Hasas-yeganeh, Shaghayegh

    2010-01-01

    Background:Diphallus is a rare anomaly and accompanying anomalies vary from bifid scrotum, bladder exstrophy, imperforate anus and colo-rectal anomaly such as duplication, and other associated anomalies. Case Presentation:A 2-day old infant is reported with imperforate anus and complete duplication of recto-sigmoid colon, rectal pouch, doubling of the genitalia with completely formed penis (diphallus), double bladder, urethra and hypospadias. No family history of abnormalities was noted. The ...

  10. Completely Isolated Retroperitoneal Enteric Duplication Cyst with Adenocarcinoma Transformation Managed with Robotic Radical Nephrectomy

    OpenAIRE

    Faraj, Kassem; Edwards, Luke; Gupta, Alia; Seifman, Brian

    2017-01-01

    Abstract Background: Enteric duplication cysts are congenital malformations that typically affect children in infancy, but can also affect adults. Rarely, these cysts can be complicated by malignancy. We present the first case of retroperitoneal duplication cyst that was complicated by malignancy transformation and managed by robot-assisted excision. Case presentation: A 64-year-old female with a history of a left-sided renal cyst presented with a 4-month history of abdominal pain and fatigue...

  11. A Retroperitoneal Isolated Enteric Duplication Cyst Mimicking a Teratoma: A Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Daichi Momosaka

    2016-01-01

    Full Text Available Enteric duplication cysts lacking anatomic association with the gastrointestinal tract are called isolated enteric duplication cysts (IEDCs. We present an atypical case of a retroperitoneal IEDC with a tortuous tubular complex shape that enfolded the surrounding retroperitoneal fat and mimicked a retroperitoneal teratoma. Multiplanar reconstruction images should be used to evaluate such a lesion correctly. A tortuous tubular complex shape could be a key finding to differentiate from other retroperitoneal cysts.

  12. The prevalence of gene duplications and their ancient origin in Rhodobacter sphaeroides 2.4.1

    Directory of Open Access Journals (Sweden)

    Cho Hyuk

    2010-12-01

    Full Text Available Abstract Background Rhodobacter sphaeroides 2.4.1 is a metabolically versatile organism that belongs to α-3 subdivision of Proteobacteria. The present study was to identify the extent, history, and role of gene duplications in R. sphaeroides 2.4.1, an organism that possesses two chromosomes. Results A protein similarity search (BLASTP identified 1247 orfs (~29.4% of the total protein coding orfs that are present in 2 or more copies, 37.5% (234 gene-pairs of which exist in duplicate copies. The distribution of the duplicate gene-pairs in all Clusters of Orthologous Groups (COGs differed significantly when compared to the COG distribution across the whole genome. Location plots revealed clusters of gene duplications that possessed the same COG classification. Phylogenetic analyses were performed to determine a tree topology predicting either a Type-A or Type-B phylogenetic relationship. A Type-A phylogenetic relationship shows that a copy of the protein-pair matches more with an ortholog from a species closely related to R. sphaeroides while a Type-B relationship predicts the highest match between both copies of the R. sphaeroides protein-pair. The results revealed that ~77% of the proteins exhibited a Type-A phylogenetic relationship demonstrating the ancient origin of these gene duplications. Additional analyses on three other strains of R. sphaeroides revealed varying levels of gene loss and retention in these strains. Also, analyses on common gene pairs among the four strains revealed that these genes experience similar functional constraints and undergo purifying selection. Conclusions Although the results suggest that the level of gene duplication in organisms with complex genome structuring (more than one chromosome seems to be not markedly different from that in organisms with only a single chromosome, these duplications may have aided in genome reorganization in this group of eubacteria prior to the formation of R. sphaeroides as gene

  13. De novo 12q22.q23.3 duplication associated with temporal lobe epilepsy.

    Science.gov (United States)

    Stella Vari, Maria; Traverso, Monica; Bellini, Tommaso; Madia, Francesca; Pinto, Francesca; Striano, Pasquale; Minetti, Carlo; Zara, Federico

    2018-04-01

    The Publisher regrets that this article is an accidental duplication of an article that has already been published in Seizure 50 (2017) 80-82, http://dx.doi.org/10.1016/j.seizure.2017.06.011. The duplicate article has therefore been withdrawn. The full Elsevier Policy on Article Withdrawal can be found at https://www.elsevier.com/about/our-business/policies/article-withdrawal. Copyright © 2018 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  14. Negotiating Multiple Identities through eTandem Learning Experiences

    Science.gov (United States)

    Yang, Se Jeong; Yi, Youngjoo

    2017-01-01

    Much of eTandem research has investigated either linguistic or cross-cultural aspects of second language (L2) learning, but relatively little is known about issues of identity construction in an eTandem context. Situating the study within theories and research of language learner identity, we examined ways in which two adult L2 learners (a Korean…

  15. Recent improvements of the tandem facility at LNS

    International Nuclear Information System (INIS)

    Ciavola, G.; Calabretta, L.; Cuttone, G.; Gammino, S.; Raia, G.; Rifuggiato, D.; Rovelli, A.; Scuderi, V.

    1993-01-01

    The Laboratorio Nazionale del Sud (LNS) of Catania is equipped with an upgraded 15 MV SMP tandem that is going to be coupled to a k=800 superconducting cyclotron. The status of the facility and the performances of the upgraded tandem are presented. (orig.)

  16. Status report on the folded tandem ion accelerator at BARC

    Indian Academy of Sciences (India)

    Folded tandem ion accelerator; charged particle beams; voltage stability; Rutherford backscattering; ion optics; beam lines. Abstract. The folded tandem ion accelerator (FOTIA) facility set up at BARC has become operational. At present, it is used for elemental analysis studies using the Rutherford backscattering technique.

  17. High-sensitivity mass spectrometry with a tandem accelerator

    International Nuclear Information System (INIS)

    Henning, W.

    1984-01-01

    The characteristic features of accelerator mass spectrometry are discussed. A short overview is given of the current status of mass spectrometry with high-energy (MeV/nucleon) heavy-ion accelerators. Emphasis is placed on studies with tandem accelerators and on future mass spectrometry of heavier isotopes with the new generation of higher-voltage tandems

  18. Performance analysis of tandem queues with small buffers

    NARCIS (Netherlands)

    Vuuren, van M.; Adan, I.J.B.F.; Papadopoulos, C.T.

    2005-01-01

    In this paper we present an approximation for the performance analysis of single-server tandem queues with small buffers and generally distributed service times. The approximation is based on decomposition of the tandem queue in subsystems, the parameters of which are determined by an iterative

  19. The Asian Rice Gall Midge (Orseolia oryzae Mitogenome Has Evolved Novel Gene Boundaries and Tandem Repeats That Distinguish Its Biotypes.

    Directory of Open Access Journals (Sweden)

    Isha Atray

    Full Text Available The complete mitochondrial genome of the Asian rice gall midge, Orseolia oryzae (Diptera; Cecidomyiidae was sequenced, annotated and analysed in the present study. The circular genome is 15,286 bp with 13 protein-coding genes, 22 tRNAs and 2 ribosomal RNA genes, and a 578 bp non-coding control region. All protein coding genes used conventional start codons and terminated with a complete stop codon. The genome presented many unusual features: (1 rearrangement in the order of tRNAs as well as protein coding genes; (2 truncation and unusual secondary structures of tRNAs; (3 presence of two different repeat elements in separate non-coding regions; (4 presence of one pseudo-tRNA gene; (5 inversion of the rRNA genes; (6 higher percentage of non-coding regions when compared with other insect mitogenomes. Rearrangements of the tRNAs and protein coding genes are explained on the basis of tandem duplication and random loss model and why intramitochondrial recombination is a better model for explaining rearrangements in the O. oryzae mitochondrial genome is discussed. Furthermore, we evaluated the number of iterations of the tandem repeat elements found in the mitogenome. This led to the identification of genetic markers capable of differentiating rice gall midge biotypes and the two Orseolia species investigated.

  20. Partial duplication of the APBA2 gene in chromosome 15q13 corresponds to duplicon structures

    Directory of Open Access Journals (Sweden)

    Kesterson Robert A

    2003-04-01

    Full Text Available Abstract Background Chromosomal abnormalities affecting human chromosome 15q11-q13 underlie multiple genomic disorders caused by deletion, duplication and triplication of intervals in this region. These events are mediated by highly homologous segments of DNA, or duplicons, that facilitate mispairing and unequal cross-over in meiosis. The gene encoding an amyloid precursor protein-binding protein (APBA2 was previously mapped to the distal portion of the interval commonly deleted in Prader-Willi and Angelman syndromes and duplicated in cases of autism. Results We show that this gene actually maps to a more telomeric location and is partially duplicated within the broader region. Two highly homologous copies of an interval containing a large 5' exon and downstream sequence are located ~5 Mb distal to the intact locus. The duplicated copies, containing the first coding exon of APBA2, can be distinguished by single nucleotide sequence differences and are transcriptionally inactive. Adjacent to APBA2 maps a gene termed KIAA0574. The protein encoded by this gene is weakly homologous to a protein termed X123 that in turn maps adjacent to APBA1 on 9q21.12; APBA1 is highly homologous to APBA2 in the C-terminal region and is distinguished from APBA2 by the N-terminal region encoded by this duplicated exon. Conclusion The duplication of APBA2 sequences in this region adds to a complex picture of different low copy repeats present across this region and elsewhere on the chromosome.