Directory of Open Access Journals (Sweden)
Wang Zhen
2011-11-01
Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.
Directory of Open Access Journals (Sweden)
Bingfu Guo
2016-07-01
Full Text Available Molecular characterization of sequences flanking exogenous fragment insertions is essential for safety assessment and labeling of genetically modified organisms (GMO. In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS method. About 21 Gb sequence data (~21× coverage for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundary of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of the genomic insertion site of the G2-EPSPS and GAT transgenes will facilitate the use of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS is a cost-effective and rapid method of identifying sites of T-DNA insertions and flanking sequences in soybean.
DEFF Research Database (Denmark)
Tsangaras, Kyriakos; Wales, Nathan; Sicheritz-Pontén, Thomas
2014-01-01
, a non-negligible fraction of the resulting sequence reads are not homologous to the bait. We demonstrate that during capture, the bait-hybridized library molecules add additional flanking library sequences iteratively, such that baits limited to targeting relatively short regions (e.g. few hundred...... nucleotides) can result in enrichment across entire mitochondrial and bacterial genomes. Our findings suggest that some of the off-target sequences derived in capture experiments are non-randomly enriched, and that CapFlank will facilitate targeted enrichment of large contiguous sequences with minimal prior...
DEFF Research Database (Denmark)
Tsangaras, Kyriakos; Wales, Nathan; Sicheritz-Pontén, Thomas
2014-01-01
nucleotides) can result in enrichment across entire mitochondrial and bacterial genomes. Our findings suggest that some of the off-target sequences derived in capture experiments are non-randomly enriched, and that CapFlank will facilitate targeted enrichment of large contiguous sequences with minimal prior...
Oosumi, Teruko; Ruiz-Rojas, Juan Jairo; Veilleux, Richard E; Dickerman, Allan; Shulaev, Vladimir
2010-09-01
Reverse genetics is used for functional genomics research in model plants. To establish a model system for the systematic reverse genetics research in the Rosaceae family, we analyzed genomic DNA flanking the T-DNA insertions in 191 transgenic plants of the diploid strawberry, Fragaria vesca. One hundred and seventy-six T-DNA flanking sequences were amplified from the right border (RB) and 37 from the left border (LB) by thermal asymmetric interlaced PCR. Analysis of the T-DNA nick positions revealed that T-DNA was most frequently nicked at the cleavage sites. Analysis of 11 T-DNA integration sites indicated that T-DNA was integrated into the F. vesca genome by illegitimate recombination, as reported in other model plants: Arabidopsis, rice and tobacco. First, deletion of DNA was found at T-DNA integration target sites in all transgenic plants tested. Second, microsimilarities of a few base pairs between the left and/or right ends of the T-DNA and genomic sites were found in all transgenic plants tested. Finally, filler DNA was identified in four break-points. Out of 191 transgenic plants, T-DNA flanking sequences of 79 plants (41%) showed significant similarity to genes, elements or proteins of other plant species and 67 (35%) of the sequences are still unknown strawberry gene fragments. T-DNA flanking sequences of 126 plants (66%) showed homology to plant ESTs. This is the first report of T-DNA integration in a sizeable population of a rosaceous species. We have shown in this paper that T-DNA integration in strawberry is not random but directed by sequence microsimilarities in the host genome.
Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.
Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2013-05-01
In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.
Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.
Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2014-01-01
The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.
Directory of Open Access Journals (Sweden)
Strassmann Joan E
2004-03-01
Full Text Available Abstract Background Social wasps in the subfamily Polistinae (Hymenoptera: Vespidae have been important in studies of the evolution of sociality, kin selection, and within colony conflicts of interest. These studies have generally been conducted within species, because a resolved phylogeny among species is lacking. We used nuclear DNA microsatellite flanking sequences, mitochondrial COI sequence, and morphological characters to generate a phylogeny for the Polistinae (Hymenoptera using 69 species. Results Our phylogeny is largely concordant with previous phylogenies at higher levels, and is more resolved at the species level. Our results support the monophyly of the New World subgenera of Polistini, while the Old World subgenera are a paraphyletic group. All genera for which we had more than one exemplar were supported as monophyletic except Polybia which is not resolved, and may be paraphyletic. Conclusion The combination of DNA sequences from flanks of microsatellite repeats with mtCOI sequences and morphological characters proved to be useful characters establishing relationships among the different subgenera and species of the Polistini. This is the first detailed hypothesis for the species of this important group.
Integration of hepatitis B virus DNA in chromosome-specific satellite sequences
International Nuclear Information System (INIS)
Shaul, Y.; Garcia, P.D.; Schonberg, S.; Rutter, W.J.
1986-01-01
The authors previously reported the cloning and detailed analysis of the integrated hepatitis B virus sequences in a human hepatoma cell line. They report here the integration of at least one of hepatitis B virus at human satellite DNA sequences. The majority of the cellular sequences identified by this satellite were organized as a multimeric composition of a 0.6-kilobase EcoRI fragment. This clone hybridized in situ almost exclusively to the centromeric heterochromatin of chromosomes 1 and 16 and to a lower extent to chromosome 2 and to the heterochromatic region of the Y chromosome. The immediate flanking host sequence appeared as a hierarchy of repeating units which were almost identical to a previously reported human satellite III DNA sequence
Directory of Open Access Journals (Sweden)
Nagib eAhsan
2012-07-01
Full Text Available The mitochondrial pyruvate dehydrogenase complex is regulated by reversible seryl-phosphorylation of the E1α subunit by a dedicated, intrinsic kinase. The phospho-complex is reactivated when dephosphorylated by an intrinsic PP2C-type protein phosphatase. Both the position of the phosphorylated Ser-residue and the sequences of the flanking amino acids are highly conserved. We have used the synthetic peptide-based kinase client assay plus recombinant pyruvate dehydrogenase E1α and E1α-kinase to perform scanning mutagenesis of the residues flanking the site of phosphorylation. Consistent with the results from phylogenetic analysis of the flanking sequences, the direct peptide-based kinase assays tolerated very few changes. Even conservative changes such as Leu, Ile, or Val for Met, or Glu for Asp, gave very marked reductions in phosphorylation. Overall the results indicate that regulation of the mitochondrial pyruvate dehydrogenase complex by reversible phosphorylation is an extreme example of multiple, interdependent instances of co-evolution.
Ustek, Duran; Sirma, Sema; Gumus, Ergun; Arikan, Muzaffer; Cakiris, Aris; Abaci, Neslihan; Mathew, Jaicy; Emrence, Zeliha; Azakli, Hulya; Cosan, Fulya; Cakar, Atilla; Parlak, Mahmut; Kursun, Olcay
2012-10-01
One application of next-generation sequencing (NGS) is the targeted resequencing of interested genes which has not been used in viral integration site analysis of gene therapy applications. Here, we combined targeted sequence capture array and next generation sequencing to address the whole genome profiling of viral integration sites. Human 293T and K562 cells were transduced with a HIV-1 derived vector. A custom made DNA probe sets targeted pLVTHM vector used to capture lentiviral vector/human genome junctions. The captured DNA was sequenced using GS FLX platform. Seven thousand four hundred and eighty four human genome sequences flanking the long terminal repeats (LTR) of pLVTHM fragment sequences matched with an identity of at least 98% and minimum 50 bp criteria in both cells. In total, 203 unique integration sites were identified. The integrations in both cell lines were totally distant from the CpG islands and from the transcription start sites and preferentially located in introns. A comparison between the two cell lines showed that the lentiviral-transduced DNA does not have the same preferred regions in the two different cell lines. Copyright © 2012 Elsevier B.V. All rights reserved.
Microsatellites grant more stable flanking genes
Directory of Open Access Journals (Sweden)
Joukhadar Reem
2012-10-01
Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are DNA sequences that include tandem copies of specific sequences no longer than six bases. SSRs are ubiquitous in all genomes and highly mutable. Presentation of the hypothesis Results from previous studies suggest that flanking regions of SSR are exhibit high stability in a wide range of organisms. We hypothesized that the SSRs ability to discard weak DNA polymerases could be responsible for this unusual stability. . When the weak polymerases are being decayed over SSRs, the flanking sequences would have higher opportunity to be replicated by more stable DNA polymerases. We present evidence of the molecular basis of our hypothesis. Testing the hypothesis The hypothesis could be tested by examining the activity of DNA polymerase during and after a number of PCRs. The PCR reactions should be run with the same SSR locus possessing differences in the SSR length. The hypothesis could also be tested by comparing the mutational rate of a transferred gene between two transformations. The first one has a naked T-DNA (transferred DNA, while the second one has the same T-DNA flanked with two SSRs. Implications of the hypothesis In any transformation experiment, flanking the T-DNA fragment with SSR sequences would result in more stably transferred genes. This process would decrease the unpredictable risks that may occur because of the mutational pressure on this foreign segment.
Identification of functional SNPs in the 5-prime flanking sequences of human genes
Directory of Open Access Journals (Sweden)
Lenhard Boris
2005-02-01
Full Text Available Abstract Background Over 4 million single nucleotide polymorphisms (SNPs are currently reported to exist within the human genome. Only a small fraction of these SNPs alter gene function or expression, and therefore might be associated with a cell phenotype. These functional SNPs are consequently important in understanding human health. Information related to functional SNPs in candidate disease genes is critical for cost effective genetic association studies, which attempt to understand the genetics of complex diseases like diabetes, Alzheimer's, etc. Robust methods for the identification of functional SNPs are therefore crucial. We report one such experimental approach. Results Sequence conserved between mouse and human genomes, within 5 kilobases of the 5-prime end of 176 GPCR genes, were screened for SNPs. Sequences flanking these SNPs were scored for transcription factor binding sites. Allelic pairs resulting in a significant score difference were predicted to influence the binding of transcription factors (TFs. Ten such SNPs were selected for mobility shift assays (EMSA, resulting in 7 of them exhibiting a reproducible shift. The full-length promoter regions with 4 of the 7 SNPs were cloned in a Luciferase based plasmid reporter system. Two out of the 4 SNPs exhibited differential promoter activity in several human cell lines. Conclusions We propose a method for effective selection of functional, regulatory SNPs that are located in evolutionary conserved 5-prime flanking regions (5'-FR regions of human genes and influence the activity of the transcriptional regulatory region. Some SNPs behave differently in different cell types.
Directory of Open Access Journals (Sweden)
Sanggu Kim
Full Text Available Xenotropic murine leukemia virus (MLV-related virus (XMRV is a new human retrovirus associated with prostate cancer and chronic fatigue syndrome. The causal relationship of XMRV infection to human disease and the mechanism of pathogenicity have not been established. During retrovirus replication, integration of the cDNA copy of the viral RNA genome into the host cell chromosome is an essential step and involves coordinated joining of the two ends of the linear viral DNA into staggered sites on target DNA. Correct integration produces proviruses that are flanked by a short direct repeat, which varies from 4 to 6 bp among the retroviruses but is invariant for each particular retrovirus. Uncoordinated joining of the two viral DNA ends into target DNA can cause insertions, deletions, or other genomic alterations at the integration site. To determine the fidelity of XMRV integration, cells infected with XMRV were clonally expanded and DNA sequences at the viral-host DNA junctions were determined and analyzed. We found that a majority of the provirus ends were correctly processed and flanked by a 4-bp direct repeat of host DNA. A weak consensus sequence was also detected at the XMRV integration sites. We conclude that integration of XMRV DNA involves a coordinated joining of two viral DNA ends that are spaced 4 bp apart on the target DNA and proceeds with high fidelity.
International Nuclear Information System (INIS)
Andrade, S.M. de; Camarco, P.E.N.
1982-01-01
The analyses of the already existent geological data of the northeastern flank of the Parana Basin and the Southwestern flank of the Parnaiba Basin, added to new data from drilling and geological mapping allowed a better knowledge of the stratigraphy of the pre-carboniferous sedimentary sequences (silurian and devonian ages) as well as provided subsidies for the definition of its uranium possibilites. Besides the already known uranium deposits of the Ponta Grossa Formation, is should be considered as worth while of prospecting the Pimenteiras Formation. (Author) [pt
International Nuclear Information System (INIS)
Hickey, M.J.; Williams, S.A.; Roth, G.J.
1989-01-01
The glycoprotein (GP) Ib-IX complex on the surface of human platelets functions as the von Willebrand factor receptor and mediates von Willebrand factor-dependent platelet adhesion to blood vessels. GPIX is a relatively small (M r , 17,000) protein that may provide for membrane insertion and orientation of the larger component of the complex. GPIb (M r , 165,000). Using antibody screening, the authors cloned a cDNA encoding GPIX from a human erythroleukemia cell cDNA library constructed in phage λgt11. Lacking a 5' untranslated region and start codon, the cDNA sequence includes 604 nucleotides, beginning with 495 bases at the 5' end coding for 165 amino acids, followed by a stop codon and 106 noncoding bases at the 3' end. By Northern blot analysis, the GPIX cDNA hybridizes with a single 1.0-kilobase species of platelet poly(A) + RNA. Translation of the cDNA sequence gives a predicted protein sequence beginning with a truncated putative signal sequence of 5 amino acids followed by a sequence of 17 amino acids matching that determined directly by Edman degradation of intact GPIX. GPIX contains a leucine-rich glycoprotein (LRG) sequence of 24 amino acids similar to conserved LRG sequences in GPIb and other proteins from humans, Drosophila, and yeast. The role of the flank-LRG center-flank structure in the evolution and function of the LRG proteins remains to be defined
An integrated SNP mining and utilization (ISMU) pipeline for next generation sequencing data.
Azam, Sarwar; Rathore, Abhishek; Shah, Trushar M; Telluri, Mohan; Amindala, BhanuPrakash; Ruperao, Pradeep; Katta, Mohan A V S K; Varshney, Rajeev K
2014-01-01
Open source single nucleotide polymorphism (SNP) discovery pipelines for next generation sequencing data commonly requires working knowledge of command line interface, massive computational resources and expertise which is a daunting task for biologists. Further, the SNP information generated may not be readily used for downstream processes such as genotyping. Hence, a comprehensive pipeline has been developed by integrating several open source next generation sequencing (NGS) tools along with a graphical user interface called Integrated SNP Mining and Utilization (ISMU) for SNP discovery and their utilization by developing genotyping assays. The pipeline features functionalities such as pre-processing of raw data, integration of open source alignment tools (Bowtie2, BWA, Maq, NovoAlign and SOAP2), SNP prediction (SAMtools/SOAPsnp/CNS2snp and CbCC) methods and interfaces for developing genotyping assays. The pipeline outputs a list of high quality SNPs between all pairwise combinations of genotypes analyzed, in addition to the reference genome/sequence. Visualization tools (Tablet and Flapjack) integrated into the pipeline enable inspection of the alignment and errors, if any. The pipeline also provides a confidence score or polymorphism information content value with flanking sequences for identified SNPs in standard format required for developing marker genotyping (KASP and Golden Gate) assays. The pipeline enables users to process a range of NGS datasets such as whole genome re-sequencing, restriction site associated DNA sequencing and transcriptome sequencing data at a fast speed. The pipeline is very useful for plant genetics and breeding community with no computational expertise in order to discover SNPs and utilize in genomics, genetics and breeding studies. The pipeline has been parallelized to process huge datasets of next generation sequencing. It has been developed in Java language and is available at http://hpc.icrisat.cgiar.org/ISMU as a standalone
Chen, Zhuo; Xu, Shixia; Zhou, Kaiya; Yang, Guang
2011-10-27
A diversity of hypotheses have been proposed based on both morphological and molecular data to reveal phylogenetic relationships within the order Cetacea (dolphins, porpoises, and whales), and great progress has been made in the past two decades. However, there is still some controversy concerning relationships among certain cetacean taxa such as river dolphins and delphinoid species, which needs to be further addressed with more markers in an effort to address unresolved portions of the phylogeny. An analysis of additional SINE insertions and SINE-flanking sequences supported the monophyly of the order Cetacea as well as Odontocete, Delphinoidea (Delphinidae + Phocoenidae + Mondontidae), and Delphinidae. A sister relationship between Delphinidae and Phocoenidae + Mondontidae was supported, and members of classical river dolphins and the genera Tursiops and Stenella were found to be paraphyletic. Estimates of divergence times revealed rapid divergences of basal Odontocete lineages in the Oligocene and Early Miocene, and a recent rapid diversification of Delphinidae in the Middle-Late Miocene and Pliocene within a narrow time frame. Several novel SINEs were found to differentiate Delphinidae from the other two families (Monodontidae and Phocoenidae), whereas the sister grouping of the latter two families with exclusion of Delphinidae was further revealed using the SINE-flanking sequences. Interestingly, some anomalous PCR amplification patterns of SINE insertions were detected, which can be explained as the result of potential ancestral SINE polymorphisms and incomplete lineage sorting. Although a few loci were potentially anomalous, this study demonstrated that the SINE-based approach is a powerful tool in phylogenetic studies. Identifying additional SINE elements that resolve the relationships in the superfamily Delphinoidea and family Delphinidae will be important steps forward in completely resolving cetacean phylogenetic relationships in the future.
Directory of Open Access Journals (Sweden)
Zhou Kaiya
2011-10-01
Full Text Available Abstract Background A diversity of hypotheses have been proposed based on both morphological and molecular data to reveal phylogenetic relationships within the order Cetacea (dolphins, porpoises, and whales, and great progress has been made in the past two decades. However, there is still some controversy concerning relationships among certain cetacean taxa such as river dolphins and delphinoid species, which needs to be further addressed with more markers in an effort to address unresolved portions of the phylogeny. Results An analysis of additional SINE insertions and SINE-flanking sequences supported the monophyly of the order Cetacea as well as Odontocete, Delphinoidea (Delphinidae + Phocoenidae + Mondontidae, and Delphinidae. A sister relationship between Delphinidae and Phocoenidae + Mondontidae was supported, and members of classical river dolphins and the genera Tursiops and Stenella were found to be paraphyletic. Estimates of divergence times revealed rapid divergences of basal Odontocete lineages in the Oligocene and Early Miocene, and a recent rapid diversification of Delphinidae in the Middle-Late Miocene and Pliocene within a narrow time frame. Conclusions Several novel SINEs were found to differentiate Delphinidae from the other two families (Monodontidae and Phocoenidae, whereas the sister grouping of the latter two families with exclusion of Delphinidae was further revealed using the SINE-flanking sequences. Interestingly, some anomalous PCR amplification patterns of SINE insertions were detected, which can be explained as the result of potential ancestral SINE polymorphisms and incomplete lineage sorting. Although a few loci were potentially anomalous, this study demonstrated that the SINE-based approach is a powerful tool in phylogenetic studies. Identifying additional SINE elements that resolve the relationships in the superfamily Delphinoidea and family Delphinidae will be important steps forward in completely resolving
Analysis of T-DNA/Host-Plant DNA Junction Sequences in Single-Copy Transgenic Barley Lines
Directory of Open Access Journals (Sweden)
Joanne G. Bartlett
2014-01-01
Full Text Available Sequencing across the junction between an integrated transfer DNA (T-DNA and a host plant genome provides two important pieces of information. The junctions themselves provide information regarding the proportion of T-DNA which has integrated into the host plant genome, whilst the transgene flanking sequences can be used to study the local genetic environment of the integrated transgene. In addition, this information is important in the safety assessment of GM crops and essential for GM traceability. In this study, a detailed analysis was carried out on the right-border T-DNA junction sequences of single-copy independent transgenic barley lines. T-DNA truncations at the right-border were found to be relatively common and affected 33.3% of the lines. In addition, 14.3% of lines had rearranged construct sequence after the right border break-point. An in depth analysis of the host-plant flanking sequences revealed that a significant proportion of the T-DNAs integrated into or close to known repetitive elements. However, this integration into repetitive DNA did not have a negative effect on transgene expression.
The role of heterologous chloroplast sequence elements in transgene integration and expression.
Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry
2010-04-01
Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5' untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5' UTR and 3' UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5' UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5' UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation.
Wong, S W; Schaffer, P A
1991-05-01
Like other DNA-containing viruses, the three origins of herpes simplex virus type 1 (HSV-1) DNA replication are flanked by sequences containing transcriptional regulatory elements. In a transient plasmid replication assay, deletion of sequences comprising the transcriptional regulatory elements of ICP4 and ICP22/47, which flank oriS, resulted in a greater than 80-fold decrease in origin function compared with a plasmid, pOS-822, which retains these sequences. In an effort to identify specific cis-acting elements responsible for this effect, we conducted systematic deletion analysis of the flanking region with plasmid pOS-822 and tested the resulting mutant plasmids for origin function. Stimulation by cis-acting elements was shown to be both distance and orientation dependent, as changes in either parameter resulted in a decrease in oriS function. Additional evidence for the stimulatory effect of flanking sequences on origin function was demonstrated by replacement of these sequences with the cytomegalovirus immediate-early promoter, resulting in nearly wild-type levels of oriS function. In competition experiments, cotransfection of cells with the test plasmid, pOS-822, and increasing molar concentrations of a competitor plasmid which contained the ICP4 and ICP22/47 transcriptional regulatory regions but lacked core origin sequences resulted in a significant reduction in the replication efficiency of pOS-822, demonstrating that factors which bind specifically to the oriS-flanking sequences are likely involved as auxiliary proteins in oriS function. Together, these studies demonstrate that trans-acting factors and the sites to which they bind play a critical role in the efficiency of HSV-1 DNA replication from oriS in transient-replication assays.
Jia, Xianbo; Lin, Xinjian; Chen, Jichen
2017-11-02
Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.
Human renin 5'-flanking DNA to nucleotide-2750.
Smith, D L; Jeyapalan, S; Lang, J A; Guo, X H; Sigmund, C D; Morris, B J
1995-01-01
Renin is one of the most important factors in blood pressure and electrolyte regulation in mammals and the renin locus has been implicated in hypertension. To assist studies of promoter control we therefore determined the 5'-flanking sequence of the human gene (REN) to residue -2750 relative to the transcription start site (+1). Sites of homology to consensus sequences for binding of trans-acting factors involved in transcriptional control of other genes were identified, and functionality for two of these (a CRE and Pit-1 site) have so far been demonstrated.
International Nuclear Information System (INIS)
Andrade, S.M. de; Camarco, P.E.N.
1984-01-01
The Carboniferous sequences of the northeast flank of the Parana Basin and those of the southwest flank of the Parnaiba Basin have been the subject of discussion and polemics for quite a long time, especially in terms of their stratigraphic relations and depositional environments. Thus, we reinforce our main objective, which is to furnish data for the definition of the uranium potential in these Carboniferous sediments, by adding recently acquired information that should aid in the clarification of the existing controversies. The Carboniferous along the northeast flank of the Parana Basin is represented by the Aquidauana Formation which has been informally divided into three members: lower, middle and upper members. The middle member, of marine origin, constitutes a prospective target for uranium and phosphate associations, in which sandstones interbedded with shales constitute the host rocks. On the other hand, the Carboniferous of the southwest margin of the Parnaiba Basin, which encompasses the Longa, Poti and Piaui Formations has shown very remote possibilities of uranium occurrences. The regional structural framework, as reflected by the Carboniferous rocks along both basin flanks, is characterized by homoclines cut by gravity faults. The faults along these weakness zones were occasionally intruded by basic rocks of Cretaceous age. Superimposed on the regional structure, open folds appear in the form of anticlines and domes. These folds are discontinuous structures resulting from uplift due to vertical stresses or result from differential subsidence along the limbs of the folds. (Author) [pt
Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry
2010-01-01
Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5′ untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5′ UTR and 3′ UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5′ UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5′ UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation. PMID:20130101
Targeted assembly of short sequence reads.
Directory of Open Access Journals (Sweden)
René L Warren
Full Text Available As next-generation sequence (NGS production continues to increase, analysis is becoming a significant bottleneck. However, in situations where information is required only for specific sequence variants, it is not necessary to assemble or align whole genome data sets in their entirety. Rather, NGS data sets can be mined for the presence of sequence variants of interest by localized assembly, which is a faster, easier, and more accurate approach. We present TASR, a streamlined assembler that interrogates very large NGS data sets for the presence of specific variants by only considering reads within the sequence space of input target sequences provided by the user. The NGS data set is searched for reads with an exact match to all possible short words within the target sequence, and these reads are then assembled stringently to generate a consensus of the target and flanking sequence. Typically, variants of a particular locus are provided as different target sequences, and the presence of the variant in the data set being interrogated is revealed by a successful assembly outcome. However, TASR can also be used to find unknown sequences that flank a given target. We demonstrate that TASR has utility in finding or confirming genomic mutations, polymorphisms, fusions and integration events. Targeted assembly is a powerful method for interrogating large data sets for the presence of sequence variants of interest. TASR is a fast, flexible and easy to use tool for targeted assembly.
Polymorphism Sequence - JSNP | LSDB Archive [Life Science Database Archive metadata
Lifescience Database Archive (English)
Full Text Available List Contact us JSNP Polymorphism Sequence Data detail Data name Polymorphism Sequence DOI 10.18908/lsdba.nb...dc00114-001 Description of data contents Information on polymorphisms (SNPs and insertions/deletions) and th...se Name database name JSNP_SNP: single nucleotide polymorphism JSNP_InsDel_IND: insertion/deletion JSNP_InsD...ved allele observed 3' Flanking Sequence 3' flanking sequence Offset in Flanking Sequence position of the polymorphism...uence Accession No. accession No. of the sequence for polymorphism screening Offset in Record position of the polymorphism
... how to do these exercises at home. Nonsteroidal anti-inflammatory drugs (NSAIDs) and physical therapy may be prescribed for flank pain caused by spinal arthritis. Antibiotics are used to treat most kidney infections. You ...
Understanding Etna flank instability through numerical models
Apuani, Tiziana; Corazzato, Claudia; Merri, Andrea; Tibaldi, Alessandro
2013-02-01
As many active volcanoes, Mount Etna shows clear evidence of flank instability, and different mechanisms were suggested to explain this flank dynamics, based on the recorded deformation pattern and character. Shallow and deep deformations, mainly associated with both eruptive and seismic events, are concentrated along recognised fracture and fault systems, mobilising the eastern and south-eastern flank of the volcano. Several interacting causes were postulated to control the phenomenon, including gravity force, magma ascent along the feeding system, and a very complex local and/or regional tectonic activity. Nevertheless, the complexity of such dynamics is still an open subject of research and being the volcano flanks heavily urbanised, the comprehension of the gravitative dynamics is a major issue for public safety and civil protection. The present research explores the effects of the main geological features (in particular the role of the subetnean clays, interposed between the Apennine-Maghrebian flysch and the volcanic products) and the role of weakness zones, identified by fracture and fault systems, on the slope instability process. The effects of magma intrusions are also investigated. The problem is addressed by integrating field data, laboratory tests and numerical modelling. A bi- and tri-dimensional stress-strain analysis was performed by a finite difference numerical code (FLAC and FLAC3D), mainly aimed at evaluating the relationship among geological features, volcano-tectonic structures and magmatic activity in controlling the deformation processes. The analyses are well supported by dedicated structural-mechanical field surveys, which allowed to estimate the rock mass strength and deformability parameters. To take into account the uncertainties which inevitably occur in a so complicated model, many efforts were done in performing a sensitivity analysis along a WNW-ESE section crossing the volcano summit and the Valle del Bove depression. This was
Design and control of integrated chromatography column sequences.
Andersson, Niklas; Löfgren, Anton; Olofsson, Marianne; Sellberg, Anton; Nilsson, Bernt; Tiainen, Peter
2017-07-01
To increase the productivity in biopharmaceutical production, a natural step is to introduce integrated continuous biomanufacturing which leads to fewer buffer and storage tanks, smaller sizes of integrated unit operations, and full automation of the operation. The main contribution of this work is to illustrate a methodology for design and control of a downstream process based on integrated column sequences. For small scale production, for example, pre-clinical studies, integrated column sequences can be implemented on a single chromatography system. This makes for a very efficient drug development platform. The proposed methodology is composed of four steps and is governed by a set of tools, that is presented, that makes the transition from batch separations to a complete integrated separation sequence as easy as possible. This methodology, its associated tools and the physical implementation is presented and illustrated on a case study where the target protein is separated from impurities through an integrated four column sequence. This article shows that the design and control of an integrated column sequence was successfully implemented for a tertiary protein separation problem. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:923-930, 2017. © 2017 American Institute of Chemical Engineers.
Integrated sequence analysis. Final report
International Nuclear Information System (INIS)
Andersson, K.; Pyy, P.
1998-02-01
The NKS/RAK subprojet 3 'integrated sequence analysis' (ISA) was formulated with the overall objective to develop and to test integrated methodologies in order to evaluate event sequences with significant human action contribution. The term 'methodology' denotes not only technical tools but also methods for integration of different scientific disciplines. In this report, we first discuss the background of ISA and the surveys made to map methods in different application fields, such as man machine system simulation software, human reliability analysis (HRA) and expert judgement. Specific event sequences were, after the surveys, selected for application and testing of a number of ISA methods. The event sequences discussed in the report were cold overpressure of BWR, shutdown LOCA of BWR, steam generator tube rupture of a PWR and BWR disturbed signal view in the control room after an external event. Different teams analysed these sequences by using different ISA and HRA methods. Two kinds of results were obtained from the ISA project: sequence specific and more general findings. The sequence specific results are discussed together with each sequence description. The general lessons are discussed under a separate chapter by using comparisons of different case studies. These lessons include areas ranging from plant safety management (design, procedures, instrumentation, operations, maintenance and safety practices) to methodological findings (ISA methodology, PSA,HRA, physical analyses, behavioural analyses and uncertainty assessment). Finally follows a discussion about the project and conclusions are presented. An interdisciplinary study of complex phenomena is a natural way to produce valuable and innovative results. This project came up with structured ways to perform ISA and managed to apply the in practice. The project also highlighted some areas where more work is needed. In the HRA work, development is required for the use of simulators and expert judgement as
Integrated sequence analysis. Final report
Energy Technology Data Exchange (ETDEWEB)
Andersson, K.; Pyy, P
1998-02-01
The NKS/RAK subprojet 3 `integrated sequence analysis` (ISA) was formulated with the overall objective to develop and to test integrated methodologies in order to evaluate event sequences with significant human action contribution. The term `methodology` denotes not only technical tools but also methods for integration of different scientific disciplines. In this report, we first discuss the background of ISA and the surveys made to map methods in different application fields, such as man machine system simulation software, human reliability analysis (HRA) and expert judgement. Specific event sequences were, after the surveys, selected for application and testing of a number of ISA methods. The event sequences discussed in the report were cold overpressure of BWR, shutdown LOCA of BWR, steam generator tube rupture of a PWR and BWR disturbed signal view in the control room after an external event. Different teams analysed these sequences by using different ISA and HRA methods. Two kinds of results were obtained from the ISA project: sequence specific and more general findings. The sequence specific results are discussed together with each sequence description. The general lessons are discussed under a separate chapter by using comparisons of different case studies. These lessons include areas ranging from plant safety management (design, procedures, instrumentation, operations, maintenance and safety practices) to methodological findings (ISA methodology, PSA,HRA, physical analyses, behavioural analyses and uncertainty assessment). Finally follows a discussion about the project and conclusions are presented. An interdisciplinary study of complex phenomena is a natural way to produce valuable and innovative results. This project came up with structured ways to perform ISA and managed to apply the in practice. The project also highlighted some areas where more work is needed. In the HRA work, development is required for the use of simulators and expert judgement as
Flanking signal and mature peptide residues influence signal peptide cleavage
Directory of Open Access Journals (Sweden)
Ranganathan Shoba
2008-12-01
Full Text Available Abstract Background Signal peptides (SPs mediate the targeting of secretory precursor proteins to the correct subcellular compartments in prokaryotes and eukaryotes. Identifying these transient peptides is crucial to the medical, food and beverage and biotechnology industries yet our understanding of these peptides remains limited. This paper examines the most common type of signal peptides cleavable by the endoprotease signal peptidase I (SPase I, and the residues flanking the cleavage sites of three groups of signal peptide sequences, namely (i eukaryotes (Euk (ii Gram-positive (Gram+ bacteria, and (iii Gram-negative (Gram- bacteria. Results In this study, 2352 secretory peptide sequences from a variety of organisms with amino-terminal SPs are extracted from the manually curated SPdb database for analysis based on physicochemical properties such as pI, aliphatic index, GRAVY score, hydrophobicity, net charge and position-specific residue preferences. Our findings show that the three groups share several similarities in general, but they display distinctive features upon examination in terms of their amino acid compositions and frequencies, and various physico-chemical properties. Thus, analysis or prediction of their sequences should be separated and treated as distinct groups. Conclusion We conclude that the peptide segment recognized by SPase I extends to the start of the mature protein to a limited extent, upon our survey of the amino acid residues surrounding the cleavage processing site. These flanking residues possibly influence the cleavage processing and contribute to non-canonical cleavage sites. Our findings are applicable in defining more accurate prediction tools for recognition and identification of cleavage site of SPs.
Lawatscheck, R.; Aleksaite, E.; Schenk, J.A.; Micheel, B.; Jandrig, B.; Holland, G.; Sasnauskas, K.; Gedvilaite, A.; Ulrich, R.G.
2007-01-01
We inserted the sequence of the carcinoembryonic antigen-derived T cell epitope CAP-1-6D (CEA) into different positions of the hamster polyomavirus major capsid protein VP1. Independently from additional flanking linkers, yeast-expressed VP1 proteins harboring the CEA insertion between VP1 amino acid residues 80 and 89 (site 1) or 288 and 295 (site 4) or simultaneously at both positions assembled to chimeric virus-like particles (VLPs). BALB/c mice immunized with adjuvant-free VLPs developed ...
International Nuclear Information System (INIS)
Gentile, R.; Fucks, E.; De Francesco, F.
2004-01-01
Pleistocene and Holocene superficial deposits, which have been recognized in an area of 1500 km2 in the northeast flank of Sierras Australes, are characterized. In divide they are underlain by silts and siltstone which are called Sediments Pampeanas. There, a lower sequence, consisting mainly of aeolian sediments (loess) with scarce fluvial deposits and diamictons, was recognized. In some places an upper sequence that is product of aeolian and anthropogenic activity, was also recognized. In the valley sequences, the loess deposits can not only be underlain by fluvial sediments but can also overlain them. The more recent fluvial deposits which have eroded loess sequences are of the post conquest age [es
Modeling the integration of bacterial rRNA fragments into the human cancer genome.
Sieber, Karsten B; Gajer, Pawel; Dunning Hotopp, Julie C
2016-03-21
Cancer is a disease driven by the accumulation of genomic alterations, including the integration of exogenous DNA into the human somatic genome. We previously identified in silico evidence of DNA fragments from a Pseudomonas-like bacteria integrating into the 5'-UTR of four proto-oncogenes in stomach cancer sequencing data. The functional and biological consequences of these bacterial DNA integrations remain unknown. Modeling of these integrations suggests that the previously identified sequences cover most of the sequence flanking the junction between the bacterial and human DNA. Further examination of these reads reveals that these integrations are rich in guanine nucleotides and the integrated bacterial DNA may have complex transcript secondary structures. The models presented here lay the foundation for future experiments to test if bacterial DNA integrations alter the transcription of the human genes.
Length and sequence dependence in the association of Huntingtin protein with lipid membranes
Jawahery, Sudi; Nagarajan, Anu; Matysiak, Silvina
2013-03-01
There is a fundamental gap in our understanding of how aggregates of mutant Huntingtin protein (htt) with overextended polyglutamine (polyQ) sequences gain the toxic properties that cause Huntington's disease (HD). Experimental studies have shown that the most important step associated with toxicity is the binding of mutant htt aggregates to lipid membranes. Studies have also shown that flanking amino acid sequences around the polyQ sequence directly affect interactions with the lipid bilayer, and that polyQ sequences of greater than 35 glutamine repeats in htt are a characteristic of HD. The key steps that determine how flanking sequences and polyQ length affect the structure of lipid bilayers remain unknown. In this study, we use atomistic molecular dynamics simulations to study the interactions between lipid membranes of varying compositions and polyQ peptides of varying lengths and flanking sequences. We find that overextended polyQ interactions do cause deformation in model membranes, and that the flanking sequences do play a role in intensifying this deformation by altering the shape of the affected regions.
DEFF Research Database (Denmark)
Jensen, E O; Marcker, K A; Villadsen, IS
1986-01-01
The TM1 yeast mutant was transformed with a 2 micron-derived plasmid (YEp24) which carries a chimaeric gene containing the Escherichia coli chloramphenicol acetyl transferase (CAT) gene fused to the 5'- and 3'-flanking regions of the soybean leghemoglobin (Lb) c3 gene. Expression of the chimaeric...
Cloning and characterization of the 5'-flanking region of the Ehox gene
International Nuclear Information System (INIS)
Lee, Woon Kyu; Kim, Yong-Man; Malik, Nasir; Ma Chang; Westphal, Heiner
2006-01-01
The paired-like homeobox-containing gene Ehox plays a role in embryonic stem cell differentiation and is highly expressed in the developing placenta and thymus. To understand the mechanisms of regulation of Ehox gene expression, the 5'-flanking region of the Ehox gene was isolated from a mouse BAC library. 5'-RACE analysis revealed a single transcriptional start site 130 nucleotides upstream of the translation initiation codon. Transient transfection with a luciferase reporter gene under the control of serially deleted 5'-flanking sequences revealed that the nt -84 to -68 region contained a positive cis-acting element for efficient expression of the Ehox gene. Mutational analysis of this region and oligonucleotide competition in the electrophoretic mobility shift assay revealed the presence of a CCAAT box, which is a target for transcription nuclear factor Y (NFY). NFY is essential for positive gene regulation. No tissue-specific enhancer was identified in the 1.9-kb 5'-flanking region of the Ehox gene. Ehox is expressed during the early stages of embryo development, specifically in Brain at 9.5 dpc, as well as during the late stages of embryo development. These results suggest that NFY is an essential regulatory factor for Ehox transcriptional activity, which is important for the post-implantation stage of the developing embryo
DNA sequence responsible for the amplification of adjacent genes.
Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K
1987-10-01
A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.
Amplification and chromosomal dispersion of human endogenous retroviral sequences
International Nuclear Information System (INIS)
Steele, P.E.; Martin, M.A.; Rabson, A.B.; Bryan, T.; O'Brien, S.J.
1986-01-01
Endogenous retroviral sequences have undergone amplification events involving both viral and flanking cellular sequences. The authors cloned members of an amplified family of full-length endogenous retroviral sequences. Genomic blotting, employing a flanking cellular DNA probe derived from a member of this family, revealed a similar array of reactive bands in both humans and chimpanzees, indicating that an amplification event involving retroviral and associated cellular DNA sequences occurred before the evolutionary separation of these two primates. Southern analyses of restricted somatic cell hybrid DNA preparations suggested that endogenous retroviral segments are widely dispersed in the human genome and that amplification and dispersion events may be linked
International Nuclear Information System (INIS)
Zhou, Y.Z.; Slagle, B.L.; Donehower, L.A.; van Tuinen, P.; Ledbetter, D.H.; Butel, J.S.
1988-01-01
Hepatitis B virus (HBV) is clearly a factor in the development of hepatocellular carcinoma, but its mechanism of action remains obscure. One possibility is that the HBV integration event alters the expression of a nearby growth-regulatory cellular gene. A 9-kilobase (kb) DNA fragment containing an HBV insert plus flanking cellular sequences was cloned from a hepatoma specimen from Shanghai, People's Republic of China. Restriction mapping of the insert revealed a large inverted repeat structure consisting of both viral sequences (encompassing all of the core and pre-S regions and portions of the X and S genes) and at least 3 kb of unique cellular sequences. The virus-cell junction mapped 11 nucleotides from the DRI region, in a position within the HBV X gene and included in the cohesive overlap region. A probe generated from 1.0 kb of the flanking cellular DNA mapped the viral insert to chromosome 17 in the region designated 17p11.2-17p12, which is near the human proto-oncogene p53. Sequence data from a portion of the flanking cellular DNA revealed a stretch of approximately 70 base pairs that showed highly significant homology with a conserved region of a number of functional mammalian DNA, including the human autonomously replicating sequence 1 (ASRI)
DEFF Research Database (Denmark)
Friis, Susanne L; Buchard, Anders; Rockenbauer, Eszter
2016-01-01
This work introduces the in-house developed Python application STRinNGS for analysis of STR sequence elements in BAM or FASTQ files. STRinNGS identifies sequence reads with STR loci by their flanking sequences, it analyses the STR sequence and the flanking regions, and generates a report with the......This work introduces the in-house developed Python application STRinNGS for analysis of STR sequence elements in BAM or FASTQ files. STRinNGS identifies sequence reads with STR loci by their flanking sequences, it analyses the STR sequence and the flanking regions, and generates a report...
Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta
Energy Technology Data Exchange (ETDEWEB)
Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))
1988-09-26
The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.
Outline of a genome navigation system based on the properties of GA-sequences and their flanks.
Directory of Open Access Journals (Sweden)
Guenter Albrecht-Buehler
Full Text Available Introducing a new method to visualize large stretches of genomic DNA (see Appendix S1 the article reports that most GA-sequences [1] shared chains of tetra-GA-motifs and contained upstream poly(A-segments. Although not integral parts of them, Alu-elements were found immediately upstream of all human and chimpanzee GA-sequences with an upstream poly(A-segment. The article hypothesizes that genome navigation uses these properties of GA-sequences in the following way. (1 Poly(A binding proteins interact with the upstream poly(A-segments and arrange adjacent GA-sequences side-by-side ('GA-ribbon', while folding the intervening DNA sequences between them into loops ('associated DNA-loops'. (2 Genome navigation uses the GA-ribbon as a search path for specific target genes that is up to 730-fold shorter than the full-length chromosome. (3 As to the specificity of the search, each molecule of a target protein is assumed to catalyze the formation of specific oligomers from a set of transcription factors that recognize tetra-GA-motifs. Their specific combinations of tetra-GA motifs are assumed to be present in the particular GA-sequence whose associated loop contains the gene for the target protein. As long as the target protein is abundant in the cell it produces sufficient numbers of such oligomers which bind to their specific GA-sequences and, thereby, inhibit locally the transcription of the target protein in the associated loop. However, if the amount of target protein drops below a certain threshold, the resultant reduction of specific oligomers leaves the corresponding GA-sequence 'denuded'. In response, the associated DNA-loop releases its nucleosomes and allows transcription of the target protein to proceed. (4 The Alu-transcripts may help control the general background of protein synthesis proportional to the number of transcriptionally active associated loops, especially in stressed cells. (5 The model offers a new mechanism of co-regulation of
Right psoas abscess following right flank trauma: a case report ...
African Journals Online (AJOL)
This is a case of 15 year old boy who presented with three weeks history of right flank pain, two weeks history of fever and five days history of inability to walk well. There was history of right flank trauma a week before the onset of right flank pain. He had earlier presented in two different hospitals before he was brought to our ...
The value of HASTE MR urography in the diagnosis of the chronic nephrogenic flank pain
International Nuclear Information System (INIS)
Werel, D.; Tarasow, E.; Dzienis, W.; Ustymowicz, A.; Orzechowska-Bobkiewicz, A.; Walecki, J.; Darewicz, B.
2004-01-01
To asses the usefulness of the projectional HASTE sequence in the diagnosis of chronic flank pain caused by obstructive uropathy in comparison with conventional urography. 28 patients with chronic flank pain and hydronephrosis on ultrasound underwent conventional urography and HASTE sequence of static MR urography. The methods were evaluated for image quality, presence, agree, level and cause of urinary tract dilatation. The image quality of the urinary tract on HASTE was good in 57.1% and satisfactory in 42.9%; in conventional urography - good in 28.6%, satisfactory in 42.8% and poor in 28.6%. HASTE demonstrated hydronephrosis and degree of hydronephrosis in all the cases and conventional urography in 25 (83.3%). HASTE identified correctly the site of obstruction in 29 cases (96.7%), and conventional urography in 21 cases (70%). The sensitivity of HASTE in diagnosis of the intrinsic and extrinsic causes of obstruction was 73.7% and 80%, accuracy 73.3% and that of conventional urography 68.4%, 40% and 56.7%, respectively. HASTE is a valuable method in the diagnostics of chronic obstructive uropathy. It allows to evaluate the degree of hydronephrosis, the level and in many cases the cause of obstruction. When the urinary tract is not visualized in conventional urography, static MR urography is especially useful. (author)
An integrated semiconductor device enabling non-optical genome sequencing.
Rothberg, Jonathan M; Hinz, Wolfgang; Rearick, Todd M; Schultz, Jonathan; Mileski, William; Davey, Mel; Leamon, John H; Johnson, Kim; Milgrew, Mark J; Edwards, Matthew; Hoon, Jeremy; Simons, Jan F; Marran, David; Myers, Jason W; Davidson, John F; Branting, Annika; Nobile, John R; Puc, Bernard P; Light, David; Clark, Travis A; Huber, Martin; Branciforte, Jeffrey T; Stoner, Isaac B; Cawley, Simon E; Lyons, Michael; Fu, Yutao; Homer, Nils; Sedova, Marina; Miao, Xin; Reed, Brian; Sabina, Jeffrey; Feierstein, Erika; Schorn, Michelle; Alanjary, Mohammad; Dimalanta, Eileen; Dressman, Devin; Kasinskas, Rachel; Sokolsky, Tanya; Fidanza, Jacqueline A; Namsaraev, Eugeni; McKernan, Kevin J; Williams, Alan; Roth, G Thomas; Bustillo, James
2011-07-20
The seminal importance of DNA sequencing to the life sciences, biotechnology and medicine has driven the search for more scalable and lower-cost solutions. Here we describe a DNA sequencing technology in which scalable, low-cost semiconductor manufacturing techniques are used to make an integrated circuit able to directly perform non-optical DNA sequencing of genomes. Sequence data are obtained by directly sensing the ions produced by template-directed DNA polymerase synthesis using all-natural nucleotides on this massively parallel semiconductor-sensing device or ion chip. The ion chip contains ion-sensitive, field-effect transistor-based sensors in perfect register with 1.2 million wells, which provide confinement and allow parallel, simultaneous detection of independent sequencing reactions. Use of the most widely used technology for constructing integrated circuits, the complementary metal-oxide semiconductor (CMOS) process, allows for low-cost, large-scale production and scaling of the device to higher densities and larger array sizes. We show the performance of the system by sequencing three bacterial genomes, its robustness and scalability by producing ion chips with up to 10 times as many sensors and sequencing a human genome.
Energy Technology Data Exchange (ETDEWEB)
Bejerman, Nicolás, E-mail: n.bejerman@uq.edu.au [Instituto de Patología Vegetal (IPAVE), Centro de Investigaciones Agropecuarias (CIAP), Instituto Nacional de Tecnología Agropecuaria INTA, Camino a 60 Cuadras k 5,5, Córdoba X5020ICA (Argentina); Queensland Alliance for Agriculture and Food Innovation, The University of Queensland, St Lucia, QLD 4072 (Australia); Giolitti, Fabián; Breuil, Soledad de; Trucco, Verónica; Nome, Claudia; Lenardon, Sergio [Instituto de Patología Vegetal (IPAVE), Centro de Investigaciones Agropecuarias (CIAP), Instituto Nacional de Tecnología Agropecuaria INTA, Camino a 60 Cuadras k 5,5, Córdoba X5020ICA (Argentina); Dietzgen, Ralf G. [Queensland Alliance for Agriculture and Food Innovation, The University of Queensland, St Lucia, QLD 4072 (Australia)
2015-09-15
Summary: We have determined the full-length 14,491-nucleotide genome sequence of a new plant rhabdovirus, alfalfa dwarf virus (ADV). Seven open reading frames (ORFs) were identified in the antigenomic orientation of the negative-sense, single-stranded viral RNA, in the order 3′-N-P-P3-M-G-P6-L-5′. The ORFs are separated by conserved intergenic regions and the genome coding region is flanked by complementary 3′ leader and 5′ trailer sequences. Phylogenetic analysis of the nucleoprotein amino acid sequence indicated that this alfalfa-infecting rhabdovirus is related to viruses in the genus Cytorhabdovirus. When transiently expressed as GFP fusions in Nicotiana benthamiana leaves, most ADV proteins accumulated in the cell periphery, but unexpectedly P protein was localized exclusively in the nucleus. ADV P protein was shown to have a homotypic, and heterotypic nuclear interactions with N, P3 and M proteins by bimolecular fluorescence complementation. ADV appears unique in that it combines properties of both cytoplasmic and nuclear plant rhabdoviruses. - Highlights: • The complete genome of alfalfa dwarf virus is obtained. • An integrated localization and interaction map for ADV is determined. • ADV has a genome sequence similarity and evolutionary links with cytorhabdoviruses. • ADV protein localization and interaction data show an association with the nucleus. • ADV combines properties of both cytoplasmic and nuclear plant rhabdoviruses.
International Nuclear Information System (INIS)
Bejerman, Nicolás; Giolitti, Fabián; Breuil, Soledad de; Trucco, Verónica; Nome, Claudia; Lenardon, Sergio; Dietzgen, Ralf G.
2015-01-01
Summary: We have determined the full-length 14,491-nucleotide genome sequence of a new plant rhabdovirus, alfalfa dwarf virus (ADV). Seven open reading frames (ORFs) were identified in the antigenomic orientation of the negative-sense, single-stranded viral RNA, in the order 3′-N-P-P3-M-G-P6-L-5′. The ORFs are separated by conserved intergenic regions and the genome coding region is flanked by complementary 3′ leader and 5′ trailer sequences. Phylogenetic analysis of the nucleoprotein amino acid sequence indicated that this alfalfa-infecting rhabdovirus is related to viruses in the genus Cytorhabdovirus. When transiently expressed as GFP fusions in Nicotiana benthamiana leaves, most ADV proteins accumulated in the cell periphery, but unexpectedly P protein was localized exclusively in the nucleus. ADV P protein was shown to have a homotypic, and heterotypic nuclear interactions with N, P3 and M proteins by bimolecular fluorescence complementation. ADV appears unique in that it combines properties of both cytoplasmic and nuclear plant rhabdoviruses. - Highlights: • The complete genome of alfalfa dwarf virus is obtained. • An integrated localization and interaction map for ADV is determined. • ADV has a genome sequence similarity and evolutionary links with cytorhabdoviruses. • ADV protein localization and interaction data show an association with the nucleus. • ADV combines properties of both cytoplasmic and nuclear plant rhabdoviruses
Boyd, D A; Mulvey, M R
2013-02-01
To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.
Unilateral flank ovariohysterectomy in guinea pigs (Cavia porcellus).
Rozanska, D; Rozanski, P; Orzelski, M; Chlebicka, N; Putowska, K
2016-11-01
To describe a simple, minimally invasive method of ovariohysterectomy via a unilateral flank approach in guinea pigs, for use in routine desexing of healthy female guinea pigs or treatment of ovarian cysts. The subjects of this retrospective study were 41 client-owned guinea pigs submitted for routine desexing or treatment of ovarian cysts. They included 16 healthy female guinea pigs aged 8-12 months (Group 1), and 15 females aged from 9 months to 3 years (Group 2), and 10 females aged from 3 to 7 years (Group 3) with different-sized ovarian cysts. Prior to surgery, the animals received clinical examination, blood testing (complete blood count and serum biochemistry profile) and examination of the abdomen using ultrasonography, to assess the condition of the reproductive tract and ensure the guinea pigs were fit for surgery. Ovariohysterectomy was performed via a unilateral flank incision made close to the erector spinae muscle starting approximately 1 cm caudal to the last rib. Both ovaries, uterine horns, and the uterine cervix were localised, ligated, and dissected through this unilateral retroperitoneal incision. Ovariohysterectomy was successfully completed via a single flank incision in 38/41 (93%) guinea pigs. Three guinea pigs with ovarian cysts from Group 3, which were >6 years old died during surgery due to circulatory and respiratory failure under anaesthesia. In the remaining 38 cases, surgery proceeded without complications. A further two guinea pigs from Group 3 were reluctant to move or eat for the first 3 days after surgery but recovered after provision of supportive care. All 38 animals fully recovered and wound healing was normal. This is the first report of ovariohysterectomy via a unilateral flank incision in guinea pigs. This approach is a simple, minimally invasive and safe alternative to the midline or bilateral flank approaches currently used for surgery of the reproductive tract in guinea pigs.
File list: InP.Emb.50.AllAg.Embryonic_flank [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available InP.Emb.50.AllAg.Embryonic_flank mm9 Input control Embryo Embryonic flank SRX804059... http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Emb.50.AllAg.Embryonic_flank.bed ...
Golden Ratio Versus Pi as Random Sequence Sources for Monte Carlo Integration
Sen, S. K.; Agarwal, Ravi P.; Shaykhian, Gholam Ali
2007-01-01
We discuss here the relative merits of these numbers as possible random sequence sources. The quality of these sequences is not judged directly based on the outcome of all known tests for the randomness of a sequence. Instead, it is determined implicitly by the accuracy of the Monte Carlo integration in a statistical sense. Since our main motive of using a random sequence is to solve real world problems, it is more desirable if we compare the quality of the sequences based on their performances for these problems in terms of quality/accuracy of the output. We also compare these sources against those generated by a popular pseudo-random generator, viz., the Matlab rand and the quasi-random generator ha/ton both in terms of error and time complexity. Our study demonstrates that consecutive blocks of digits of each of these numbers produce a good random sequence source. It is observed that randomly chosen blocks of digits do not have any remarkable advantage over consecutive blocks for the accuracy of the Monte Carlo integration. Also, it reveals that pi is a better source of a random sequence than theta when the accuracy of the integration is concerned.
Flanking Variation Influences Rates of Stutter in Simple Repeats
Directory of Open Access Journals (Sweden)
August E. Woerner
2017-11-01
Full Text Available It has been posited that the longest uninterrupted stretch (LUS of tandem repeats, as defined by the number of exactly matching repeating motif units, is a better predictor of rates of stutter than the parental allele length (PAL. While there are cases where this hypothesis is likely correct, such as the 9.3 allele in the TH01 locus, there can be situations where it may not apply as well. For example, the PAL may capture flanking indel variations while remaining insensitive to polymorphisms in the repeat, and these haplotypic changes may impact the stutter rate. To address this, rates of stutter were contrasted against the LUS as well as the PAL on different flanking haplotypic backgrounds. This study shows that rates of stutter can vary substantially depending on the flanking haplotype, and while there are cases where the LUS is a better predictor of stutter than the PAL, examples to the contrary are apparent in commonly assayed forensic markers. Further, flanking variation that is 7 bp from the repeat region can impact rates of stutter. These findings suggest that non-proximal effects, such as DNA secondary structure, may be impacting the rates of stutter in common forensic short tandem repeat markers.
Nanopore sequencing technology: a new route for the fast detection of unauthorized GMO.
Fraiture, Marie-Alice; Saltykova, Assia; Hoffman, Stefan; Winand, Raf; Deforce, Dieter; Vanneste, Kevin; De Keersmaecker, Sigrid C J; Roosens, Nancy H C
2018-05-21
In order to strengthen the current genetically modified organism (GMO) detection system for unauthorized GMO, we have recently developed a new workflow based on DNA walking to amplify unknown sequences surrounding a known DNA region. This DNA walking is performed on transgenic elements, commonly found in GMO, that were earlier detected by real-time PCR (qPCR) screening. Previously, we have demonstrated the ability of this approach to detect unauthorized GMO via the identification of unique transgene flanking regions and the unnatural associations of elements from the transgenic cassette. In the present study, we investigate the feasibility to integrate the described workflow with the MinION Next-Generation-Sequencing (NGS). The MinION sequencing platform can provide long read-lengths and deal with heterogenic DNA libraries, allowing for rapid and efficient delivery of sequences of interest. In addition, the ability of this NGS platform to characterize unauthorized and unknown GMO without any a priori knowledge has been assessed.
Jurka, Jerzy W.
1997-01-01
Enhanced homologous recombination is obtained by employing a consensus sequence which has been found to be associated with integration of repeat sequences, such as Alu and ID. The consensus sequence or sequence having a single transition mutation determines one site of a double break which allows for high efficiency of integration at the site. By introducing single or double stranded DNA having the consensus sequence flanking region joined to a sequence of interest, one can reproducibly direct integration of the sequence of interest at one or a limited number of sites. In this way, specific sites can be identified and homologous recombination achieved at the site by employing a second flanking sequence associated with a sequence proximal to the 3'-nick.
Construction of an integrated database to support genomic sequence analysis
Energy Technology Data Exchange (ETDEWEB)
Gilbert, W.; Overbeek, R.
1994-11-01
The central goal of this project is to develop an integrated database to support comparative analysis of genomes including DNA sequence data, protein sequence data, gene expression data and metabolism data. In developing the logic-based system GenoBase, a broader integration of available data was achieved due to assistance from collaborators. Current goals are to easily include new forms of data as they become available and to easily navigate through the ensemble of objects described within the database. This report comments on progress made in these areas.
Sequence homology at the breakpoint and clinical phenotype of mitochondrial DNA deletion syndromes.
Sadikovic, Bekim; Wang, Jing; El-Hattab, Ayman W; Landsverk, Megan; Douglas, Ganka; Brundage, Ellen K; Craigen, William J; Schmitt, Eric S; Wong, Lee-Jun C
2010-12-20
Mitochondrial DNA (mtDNA) deletions are a common cause of mitochondrial disorders. Large mtDNA deletions can lead to a broad spectrum of clinical features with different age of onset, ranging from mild mitochondrial myopathies (MM), progressive external ophthalmoplegia (PEO), and Kearns-Sayre syndrome (KSS), to severe Pearson syndrome. The aim of this study is to investigate the molecular signatures surrounding the deletion breakpoints and their association with the clinical phenotype and age at onset. MtDNA deletions in 67 patients were characterized using array comparative genomic hybridization (aCGH) followed by PCR-sequencing of the deletion junctions. Sequence homology including both perfect and imperfect short repeats flanking the deletion regions were analyzed and correlated with clinical features and patients' age group. In all age groups, there was a significant increase in sequence homology flanking the deletion compared to mtDNA background. The youngest patient group (deletion distribution in size and locations, with a significantly lower sequence homology flanking the deletion, and the highest percentage of deletion mutant heteroplasmy. The older age groups showed rather discrete pattern of deletions with 44% of all patients over 6 years old carrying the most common 5 kb mtDNA deletion, which was found mostly in muscle specimens (22/41). Only 15% (3/20) of the young patients (deletion, which is usually present in blood rather than muscle. This group of patients predominantly (16 out of 17) exhibit multisystem disorder and/or Pearson syndrome, while older patients had predominantly neuromuscular manifestations including KSS, PEO, and MM. In conclusion, sequence homology at the deletion flanking regions is a consistent feature of mtDNA deletions. Decreased levels of sequence homology and increased levels of deletion mutant heteroplasmy appear to correlate with earlier onset and more severe disease with multisystem involvement.
Multi-stage volcanic island flank collapses with coeval explosive caldera-forming eruptions
Hunt, James E.; Cassidy, Michael; Talling, Peter J.
2018-01-01
Volcanic flank collapses and explosive eruptions are among the largest and most destructive processes on Earth. Events at Mount St. Helens in May 1980 demonstrated how a relatively small (<5 km3) flank collapse on a terrestrial volcano could immediately precede a devastating eruption. The lateral collapse of volcanic island flanks, such as in the Canary Islands, can be far larger (>300 km3), but can also occur in complex multiple stages. Here, we show that multistage retrogressive lands...
Vartiainen, Johanna; Kesäniemi, Y Antero; Ukkola, Olavi
2006-10-01
Ghrelin is a 28-amino-acid peptide with several functions linked to energy metabolism. Low ghrelin plasma concentrations are associated with obesity, hypertension, and type 2 diabetes mellitus, whereas high concentrations reflect states of negative energy balance. Several studies addressing the hormonal and neural regulation of ghrelin gene expression have been carried out, but the role of genetic factors in the regulation of ghrelin plasma levels remains unclear. To elucidate the role of genetic factors in the regulation of ghrelin expression, we screened 1657 nucleotides of the ghrelin gene 5' flanking region (promoter and possible regulatory sites) for new sequential variations from patient samples with low (n = 50) and high (n = 50) fasting plasma total ghrelin concentrations (low- and high-ghrelin groups). Eleven single nucleotide polymorphisms (SNPs), 3 of which were rare variants (allelic frequency less than 1%) were found in our population. The genotype distribution patterns of the SNPs did not differ between the study groups, except for SNP-501A>C (P = .039). In addition, the SNP-01A>C was associated with body mass index (BMI) (P = .018). This variant was studied further in our large and well-defined Oulu Project Elucidating Risk for Atherosclerosis (OPERA) cohort (n = 1045) by the restriction fragment length polymorphism (RFLP) technique. No significant association of SNP-501A>C genotypes with fasting ghrelin plasma concentrations was found in the whole OPERA population. However, the association of this SNP with BMI and with waist circumference reached statistical significance in OPERA (P = .047 and .049, respectively), remaining of borderline significance for BMI after adjustments (P = .055). The results indicate that factors other than the 11 SNPs found in this study in the 5' flanking region of ghrelin gene are the main determinants of ghrelin plasma levels. However, SNP-501 A>C genotype distribution seems to be different in subjects having the highest
An Analysis of Delay-based and Integrator-based Sequence Detectors for Grid-Connected Converters
DEFF Research Database (Denmark)
Khazraj, Hesam; Silva, Filipe Miguel Faria da; Bak, Claus Leth
2017-01-01
-signal cancellation operators are the main members of the delay-based sequence detectors. The aim of this paper is to provide a theoretical and experimental comparative study between integrator and delay based sequence detectors. The theoretical analysis is conducted based on the small-signal modelling......Detecting and separating positive and negative sequence components of the grid voltage or current is of vital importance in the control of grid-connected power converters, HVDC systems, etc. To this end, several techniques have been proposed in recent years. These techniques can be broadly...... classified into two main classes: The integrator-based techniques and Delay-based techniques. The complex-coefficient filter-based technique, dual second-order generalized integrator-based method, multiple reference frame approach are the main members of the integrator-based sequence detector and the delay...
Sequence-dependent DNA deformability studied using molecular dynamics simulations.
Fujii, Satoshi; Kono, Hidetoshi; Takenaka, Shigeori; Go, Nobuhiro; Sarai, Akinori
2007-01-01
Proteins recognize specific DNA sequences not only through direct contact between amino acids and bases, but also indirectly based on the sequence-dependent conformation and deformability of the DNA (indirect readout). We used molecular dynamics simulations to analyze the sequence-dependent DNA conformations of all 136 possible tetrameric sequences sandwiched between CGCG sequences. The deformability of dimeric steps obtained by the simulations is consistent with that by the crystal structures. The simulation results further showed that the conformation and deformability of the tetramers can highly depend on the flanking base pairs. The conformations of xATx tetramers show the most rigidity and are not affected by the flanking base pairs and the xYRx show by contrast the greatest flexibility and change their conformations depending on the base pairs at both ends, suggesting tetramers with the same central dimer can show different deformabilities. These results suggest that analysis of dimeric steps alone may overlook some conformational features of DNA and provide insight into the mechanism of indirect readout during protein-DNA recognition. Moreover, the sequence dependence of DNA conformation and deformability may be used to estimate the contribution of indirect readout to the specificity of protein-DNA recognition as well as nucleosome positioning and large-scale behavior of nucleic acids.
Holland, M J; Holland, J P; Thill, G P; Jackson, K A
1981-02-10
Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5
International Nuclear Information System (INIS)
Kudo, Shinichi; Fukuda, Minoru
1989-01-01
Glycophorins A (GPA) and B (GPB) are two major sialoglycoproteins of the human erythrocyte membrane. Here the authors present a comparison of the genomic structures of GPA and GPB developed by analyzing DNA clones isolated from a K562 genomic library. Nucleotide sequences of exon-intron junctions and 5' and 3' flanking sequences revealed that the GPA and GPB genes consist of 7 and 5 exons, respectively, and both genes have >95% identical sequence from the 5' flanking region to the region ∼ 1 kilobase downstream from the exon encoding the transmembrane regions. In this homologous part of the genes, GPB lacks one exon due to a point mutation at the 5' splicing site of the third intron, which inactivates the 5' cleavage event of splicing and leads to ligation of the second to the fourth exon. Following these very homologous sequences, the genomic sequences for GPA and GPB diverge significantly and no homology can be detected in their 3' end sequences. The analysis of the Alu sequences and their flanking direct repeat sequences suggest that an ancestral genomic structure has been maintained in the GPA gene, whereas the GPB gene has arisen from the acquisition of 3' sequences different from those of the GPA gene by homologous recombination at the Alu repeats during or after gene duplication
International Nuclear Information System (INIS)
Klimov, Eugene; Vinokourova, Svetlana; Moisjak, Elena; Rakhmanaliev, Elian; Kobseva, Vera; Laimins, Laimonis; Kisseljov, Fjodor; Sulimova, Galina
2002-01-01
In cervical tumours the integration of human papilloma viruses (HPV) transcripts often results in the generation of transcripts that consist of hybrids of viral and cellular sequences. Mapping data using a variety of techniques has demonstrated that HPV integration occurred without obvious specificity into human genome. However, these techniques could not demonstrate whether integration resulted in the generation of transcripts encoding viral or viral-cellular sequences. The aim of this work was to map the integration sites of HPV DNA and to analyse the adjacent cellular sequences. Amplification of the INTs was done by the APOT technique. The APOT products were sequenced according to standard protocols. The analysis of the sequences was performed using BLASTN program and public databases. To localise the INTs PCR-based screening of GeneBridge4-RH-panel was used. Twelve cellular sequences adjacent to integrated HPV16 (INT markers) expressed in squamous cell cervical carcinomas were isolated. For 11 INT markers homologous human genomic sequences were readily identified and 9 of these showed significant homologies to known genes/ESTs. Using the known locations of homologous cDNAs and the RH-mapping techniques, mapping studies showed that the INTs are distributed among different human chromosomes for each tumour sample and are located in regions with the high levels of expression. Integration of HPV genomes occurs into the different human chromosomes but into regions that contain highly transcribed genes. One interpretation of these studies is that integration of HPV occurs into decondensed regions, which are more accessible for integration of foreign DNA
Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...
African Journals Online (AJOL)
The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...
Mitigation of Flanking Noise Transmission in Periodic Structures of Lightweight Elements
DEFF Research Database (Denmark)
Domadiya, Parthkumar Gandalal
through structural junctions and radiates into neighbouring rooms. To diminish the flanking transmission of sound, frames are usually designed with single or double studs or constructed with layers of foam or another viscoelastic material. This thesis is investigating the behaviour of flanking noise...... transmission in periodic structures of lightweight elements by employing various numerical, analytical and experimental methods. At first, three dimensional finite-element (FE) models of a Z-shaped lightweight panel structure based on various frame designs, inclusion of air and structural coupling between...... elements are considered for describing flanking noise transmission through panels. It is assumed that the ribs are fully fixed to the plates in case of various frame designs, and a parametric study is carried out on the centre panel with regard to various spacing between the ribs. Solid finite elements...
Flank tectonics of Martian volcanoes
International Nuclear Information System (INIS)
Thomas, P.J.; Squyres, S.W.; Carr, M.H.
1990-01-01
On the flanks of Olympus Mons is a series of terraces, concentrically distributed around the caldera. Their morphology and location suggest that they could be thrust faults caused by compressional failure of the cone. In an attempt to understand the mechanism of faulting and the possible influences of the interior structure of Olympus Mons, the authors have constructed a numerical model for elastic stresses within a Martian volcano. In the absence of internal pressurization, the middle slopes of the cone are subjected to compressional stress, appropriate to the formation of thrust faults. These stresses for Olympus Mons are ∼250 MPa. If a vacant magma chamber is contained within the cone, the region of maximum compressional stress is extended toward the base of the cone. If the magma chamber is pressurized, extensional stresses occur at the summit and on the upper slopes of the cone. For a filled but unpressurized magma chamber, the observed positions of the faults agree well with the calculated region of high compressional stress. Three other volcanoes on Mars, Ascraeus Mons, Arsia Mons, and Pavonis Mons, possess similar terraces. Extending the analysis to other Martian volcanoes, they find that only these three and Olympus Mons have flank stresses that exceed the compressional failure strength of basalt, lending support to the view that the terraces on all four are thrust faults
Directory of Open Access Journals (Sweden)
Nicholas Delihas
Full Text Available BACKGROUND: Plasmids of Borrelia species are dynamic structures that contain a large number of repetitive genes, gene fragments, and gene fusions. In addition, the transposable element IS605/200 family, as well as degenerate forms of this IS element, are prevalent. In Helicobacter pylori, flanking regions of the IS605 transposase gene contain sequences that fold into identical small stem loops. These function in transposition at the single-stranded DNA level. METHODOLOGY/PRINCIPAL FINDINGS: In work reported here, bioinformatics techniques were used to scan Borrelia plasmid genomes for IS605 transposable element specific stem loop sequences. Two variant stem loop motifs are found in the left and right flanking regions of the transposase gene. Both motifs appear to have dispersed in plasmid genomes and are found "free-standing" and phylogenetically conserved without the associated IS605 transposase gene or the adjacent flanking sequence. Importantly, IS605 specific stem loop sequences are also found at the 3' ends of lipoprotein genes (PFam12 and PFam60, however the left and right sequences appear to develop their own evolutionary patterns. The lipoprotein gene-linked left stem loop sequences maintain the IS605 stem loop motif in orthologs but only at the RNA level. These show mutations whereby variants fold into phylogenetically conserved RNA-type stem loops that contain the wobble non-Watson-Crick G-U base-pairing. The right flanking sequence is associated with the family lipoprotein-1 genes. A comparison of homologs shows that the IS605 stem loop motif rapidly dissipates, but a more elaborate secondary structure appears to develop in its place. CONCLUSIONS/SIGNIFICANCE: Stem loop sequences specific to the transposable element IS605 are present in plasmid regions devoid of a transposase gene and significantly, are found linked to lipoprotein genes in Borrelia plasmids. These sequences are evolutionarily conserved and/or structurally developed in
Yeh, Hsin-Chih; Jan, Hau-Chern; Wu, Wen-Jeng; Li, Ching-Chia; Li, Wei-Ming; Ke, Hung-Lung; Huang, Shu-Pin; Liu, Chia-Chu; Lee, Yung-Chin; Yang, Sheau-Fang; Liang, Peir-In; Huang, Chun-Nung
2015-01-01
To investigate the impact of preoperative hydronephrosis and flank pain on prognosis of patients with upper tract urothelial carcinoma. In total, 472 patients with upper tract urothelial carcinoma managed by radical nephroureterectomy were included from Kaohsiung Medical University Hospital Healthcare System. Clinicopathological data were collected retrospectively for analysis. The significance of hydronephrosis, especially when combined with flank pain, and other relevant factors on overall and cancer-specific survival were evaluated. Of the 472 patients, 292 (62%) had preoperative hydronephrosis and 121 (26%) presented with flank pain. Preoperative hydronephrosis was significantly associated with age, hematuria, flank pain, tumor location, and pathological tumor stage. Concurrent presence of hydronephrosis and flank pain was a significant predictor of non-organ-confined disease (multivariate-adjusted hazard ratio = 2.10, P = 0.025). Kaplan-Meier analysis showed significantly poorer overall and cancer-specific survival in patients with preoperative hydronephrosis (P = 0.005 and P = 0.026, respectively) and in patients with flank pain (P hydronephrosis and flank pain independently predicted adverse outcome (hazard ratio = 1.98, P = 0.016 for overall survival and hazard ratio = 1.87, P = 0.036 for and cancer-specific survival, respectively) in multivariate Cox proportional hazards models. In addition, concurrent presence of hydronephrosis and flank pain was also significantly predictive of worse survival in patient with high grade or muscle-invasive disease. Notably, there was no difference in survival between patients with hydronephrosis but devoid of flank pain and those without hydronephrosis. Concurrent preoperative presence of hydronephrosis and flank pain predicted non-organ-confined status of upper tract urothelial carcinoma. When accompanied with flank pain, hydronephrosis represented an independent predictor for worse outcome in patients with upper tract
Temporal integration windows for naturalistic visual sequences.
Directory of Open Access Journals (Sweden)
Scott L Fairhall
Full Text Available There is increasing evidence that the brain possesses mechanisms to integrate incoming sensory information as it unfolds over time-periods of 2-3 seconds. The ubiquity of this mechanism across modalities, tasks, perception and production has led to the proposal that it may underlie our experience of the subjective present. A critical test of this claim is that this phenomenon should be apparent in naturalistic visual experiences. We tested this using movie-clips as a surrogate for our day-to-day experience, temporally scrambling them to require (re- integration within and beyond the hypothesized 2-3 second interval. Two independent experiments demonstrate a step-wise increase in the difficulty to follow stimuli at the hypothesized 2-3 second scrambling condition. Moreover, only this difference could not be accounted for by low-level visual properties. This provides the first evidence that this 2-3 second integration window extends to complex, naturalistic visual sequences more consistent with our experience of the subjective present.
Matrix based method for synthesis of main intensified and integrated distillation sequences
International Nuclear Information System (INIS)
Khalili-Garakani, Amirhossein; Kasiri, Norollah; Ivakpour, Javad
2016-01-01
The objective of many studies in this area has involved access to a column-sequencing algorithm enabling designers and researchers alike to generate a wide range of sequences in a broad search space, and be as mathematically and as automated as possible for programing purposes and with good generality. In the present work an algorithm previously developed by the authors, called the matrix method, has been developed much further. The new version of the algorithm includes thermally coupled, thermodynamically equivalent, intensified, simultaneous heat and mass integrated and divided-wall column sequences which are of gross application and provide vast saving potential both on capital investment, operating costs and energy usage in industrial applications. To demonstrate the much wider searchable space now accessible, a three component separation has been thoroughly examined as a case study, always resulting in an integrated sequence being proposed as the optimum.
ISRNA: an integrative online toolkit for short reads from high-throughput sequencing data.
Luo, Guan-Zheng; Yang, Wei; Ma, Ying-Ke; Wang, Xiu-Jie
2014-02-01
Integrative Short Reads NAvigator (ISRNA) is an online toolkit for analyzing high-throughput small RNA sequencing data. Besides the high-speed genome mapping function, ISRNA provides statistics for genomic location, length distribution and nucleotide composition bias analysis of sequence reads. Number of reads mapped to known microRNAs and other classes of short non-coding RNAs, coverage of short reads on genes, expression abundance of sequence reads as well as some other analysis functions are also supported. The versatile search functions enable users to select sequence reads according to their sub-sequences, expression abundance, genomic location, relationship to genes, etc. A specialized genome browser is integrated to visualize the genomic distribution of short reads. ISRNA also supports management and comparison among multiple datasets. ISRNA is implemented in Java/C++/Perl/MySQL and can be freely accessed at http://omicslab.genetics.ac.cn/ISRNA/.
2012-01-01
Background The detection of conserved residue clusters on a protein structure is one of the effective strategies for the prediction of functional protein regions. Various methods, such as Evolutionary Trace, have been developed based on this strategy. In such approaches, the conserved residues are identified through comparisons of homologous amino acid sequences. Therefore, the selection of homologous sequences is a critical step. It is empirically known that a certain degree of sequence divergence in the set of homologous sequences is required for the identification of conserved residues. However, the development of a method to select homologous sequences appropriate for the identification of conserved residues has not been sufficiently addressed. An objective and general method to select appropriate homologous sequences is desired for the efficient prediction of functional regions. Results We have developed a novel index to select the sequences appropriate for the identification of conserved residues, and implemented the index within our method to predict the functional regions of a protein. The implementation of the index improved the performance of the functional region prediction. The index represents the degree of conserved residue clustering on the tertiary structure of the protein. For this purpose, the structure and sequence information were integrated within the index by the application of spatial statistics. Spatial statistics is a field of statistics in which not only the attributes but also the geometrical coordinates of the data are considered simultaneously. Higher degrees of clustering generate larger index scores. We adopted the set of homologous sequences with the highest index score, under the assumption that the best prediction accuracy is obtained when the degree of clustering is the maximum. The set of sequences selected by the index led to higher functional region prediction performance than the sets of sequences selected by other sequence
DISQUIETUDE ON THE EASTERN FLANK: AWAITING ALLIANCE RESPONSE
Directory of Open Access Journals (Sweden)
Octavian Manea
2010-03-01
Full Text Available The absence of significant and tangible military defensive infrastructure on the Eastern flank generated over time a breach of credibility in the security guarantee provided by NATO under its Article 5 commitment. The main argument of the countries in the New Europe now is that, in order to be credible enough, and not just a paper guarantee, a collective defence commitment must be backed by “boots on the ground” and by military tangible logistics.While assuming this perspective, the present article looks at some of the alarm signals coming from the countries on NATO’s Eastern flank, trying to explain the feeling of insecurity perceived by the states in the region as well as the options available to the Euro-Atlantic community in order to engage in a much-needed process of strategic reassurance.
Economic method for helical gear flank surface characterisation
Koulin, G.; Reavie, T.; Frazer, R. C.; Shaw, B. A.
2018-03-01
Typically the quality of a gear pair is assessed based on simplified geometric tolerances which do not always correlate with functional performance. In order to identify and quantify functional performance based parameters, further development of the gear measurement approach is required. Methodology for interpolation of the full active helical gear flank surface, from sparse line measurements, is presented. The method seeks to identify the minimum number of line measurements required to sufficiently characterise an active gear flank. In the form ground gear example presented, a single helix and three profile line measurements was considered to be acceptable. The resulting surfaces can be used to simulate the meshing engagement of a gear pair and therefore provide insight into functional performance based parameters. Therefore the assessment of the quality can be based on the predicted performance in the context of an application.
Relaxation of the south flank after the 7.2-magnitude Kalapana earthquake, Kilauea Volcano, Hawaii
Dvorak, John J.; Klein, Fred W.; Swanson, Donald A.
1994-01-01
An M = 7.2 earthquake on 29 November 1975 caused the south flank of Kilauea Volcano, Hawaii, to move seaward several meters: a catastrophic release of compression of the south flank caused by earlier injections of magma into the adjacent segment of a rift zone. The focal mechanisms of the mainshock, the largest foreshock, and the largest aftershock suggest seaward movement of the upper block. The rate of aftershocks decreased in a familiar hyperbolic decay, reaching the pre-1975 rate of seismicity by the mid-1980s. Repeated rift-zone intrusions and eruptions after 1975, which occurred within 25 km of the summit area, compressed the adjacent portion of the south flank, apparently masking continued seaward displacement of the south flank. This is evident along a trilateration line that continued to extend, suggesting seaward displacement, immediately after the M = 7.2 earthquake, but then was compressed during a series of intrusions and eruptions that began in September 1977. Farther to the east, trilateration measurements show that the portion of the south flank above the aftershock zone, but beyond the area of compression caused by the rift-zone intrusions and eruptions, continued to move seaward at a decreasing rate until the mid-1980s, mimicking the decay in aftershock rate. Along the same portion of the south flank, the pattern of vertical surface displacements can be explained by continued seaward movement of the south flank and development of two eruptive fissures along the east rift zone, each of which extended from a depth of ∼3 km to the surface. The aftershock rate and continued seaward movement of the south flank are reminiscent of crustal response to other large earthquakes, such as the 1966 M = 6 Parkfield earthquake and the 1983 M = 6.5 Coalinga earthquake.
Pegasys: software for executing and integrating analyses of biological sequences
Directory of Open Access Journals (Sweden)
Lett Drew
2004-04-01
Full Text Available Abstract Background We present Pegasys – a flexible, modular and customizable software system that facilitates the execution and data integration from heterogeneous biological sequence analysis tools. Results The Pegasys system includes numerous tools for pair-wise and multiple sequence alignment, ab initio gene prediction, RNA gene detection, masking repetitive sequences in genomic DNA as well as filters for database formatting and processing raw output from various analysis tools. We introduce a novel data structure for creating workflows of sequence analyses and a unified data model to store its results. The software allows users to dynamically create analysis workflows at run-time by manipulating a graphical user interface. All non-serial dependent analyses are executed in parallel on a compute cluster for efficiency of data generation. The uniform data model and backend relational database management system of Pegasys allow for results of heterogeneous programs included in the workflow to be integrated and exported into General Feature Format for further analyses in GFF-dependent tools, or GAME XML for import into the Apollo genome editor. The modularity of the design allows for new tools to be added to the system with little programmer overhead. The database application programming interface allows programmatic access to the data stored in the backend through SQL queries. Conclusions The Pegasys system enables biologists and bioinformaticians to create and manage sequence analysis workflows. The software is released under the Open Source GNU General Public License. All source code and documentation is available for download at http://bioinformatics.ubc.ca/pegasys/.
Effect of the bases flanking an abasic site on the recognition of nucleobase by amiloride.
Rajendran, Arivazhagan; Zhao, Chunxia; Rajendar, Burki; Thiagarajan, Viruthachalam; Sato, Yusuke; Nishizawa, Seiichi; Teramae, Norio
2010-06-01
We explain here the various non-covalent interactions which are responsible for the different binding modes of a small ligand with DNA. The combination of experimental and theoretical methods was used. The interaction of amiloride with thymine was found to depend on the bases flanking the AP site and different binding modes were observed for different flanking bases. Molecular modeling, absorption studies and binding constant measurements support for the different binding patterns. The flanking base dependent recognition of AP site phosphates was investigated by (31)P NMR experiments. The thermodynamics of the ligand-nucleotide interaction was demonstrated by isothermal titration calorimetry. The emission behavior of amiloride was found to depend on the bases flanking the AP site. Amiloride photophysics in the context of AP-site containing DNA is investigated by time-dependent density functional theory. Flanking bases affect the ground and excited electronic states of amiloride when binding to AP site, which causes flanking base-dependent fluorescence signaling. The various noncovalent interactions have been well characterized for the determination of nucleic acid structure and dynamics, and protein-DNA interactions. However, these are not clear for the DNA-small molecule interactions and we believe that our studies will bring a new insight into such phenomena. Copyright 2010 Elsevier B.V. All rights reserved.
CDinFusion--submission-ready, on-line integration of sequence and contextual data.
Hankeln, Wolfgang; Wendel, Norma Johanna; Gerken, Jan; Waldmann, Jost; Buttigieg, Pier Luigi; Kostadinov, Ivaylo; Kottmann, Renzo; Yilmaz, Pelin; Glöckner, Frank Oliver
2011-01-01
State of the art (DNA) sequencing methods applied in "Omics" studies grant insight into the 'blueprints' of organisms from all domains of life. Sequencing is carried out around the globe and the data is submitted to the public repositories of the International Nucleotide Sequence Database Collaboration. However, the context in which these studies are conducted often gets lost, because experimental data, as well as information about the environment are rarely submitted along with the sequence data. If these contextual or metadata are missing, key opportunities of comparison and analysis across studies and habitats are hampered or even impossible. To address this problem, the Genomic Standards Consortium (GSC) promotes checklists and standards to better describe our sequence data collection and to promote the capturing, exchange and integration of sequence data with contextual data. In a recent community effort the GSC has developed a series of recommendations for contextual data that should be submitted along with sequence data. To support the scientific community to significantly enhance the quality and quantity of contextual data in the public sequence data repositories, specialized software tools are needed. In this work we present CDinFusion, a web-based tool to integrate contextual and sequence data in (Multi)FASTA format prior to submission. The tool is open source and available under the Lesser GNU Public License 3. A public installation is hosted and maintained at the Max Planck Institute for Marine Microbiology at http://www.megx.net/cdinfusion. The tool may also be installed locally using the open source code available at http://code.google.com/p/cdinfusion.
Insulin increases transcription of rat gene 33 through cis-acting elements in 5[prime]-flanking DNA
Energy Technology Data Exchange (ETDEWEB)
Cadilla, C.; Isham, K.R.; Lee, K.L.; Ch' ang, L.Y.; Kenney, F.T. (Oak Ridge National Lab., TN (United States)); Johnson, A.C. (National Cancer Institute, Bethesda, MD (United States). Lab. of Molecular Biology)
1992-01-01
Gene 33 is a multihormonally-regulated rat gene whose transcription is rapidly and markedly enhanced by insulin in liver and cultured hepatoma cells. To examine the mechanism by which insulin regulates transcription, the authors have constructed chimeric plasmids in which expression of the bacterial cat gene, encoding chloramphenicol acetyltransferase (CAT), is governed by gene 33 promoter elements and contiguous sequence in DNA flanking the transcription start point (tsp). When transfected into H4IIE hepatoma cells, these constructs gave rise to stably transformed cell lines producing the bacterial CAT enzyme. This expression was increased by insulin treatment in a fashion resembling the effect of this hormone on transcription of the native gene. In vitro transcription assays in nuclear extracts also revealed increased transcription of the chimeric plasmids when the extracts were prepared from insulin-treated rat hepatoma cells. The results demonstrate that induction by insulin is mediated by cis-acting nucleotide sequences located between bp [minus]480 to +27 relative to the tsp.
Flank solar wind interaction. Annual report, June 1991-July 1992
International Nuclear Information System (INIS)
Moses, S.L.; Greenstadt, E.W.
1992-08-01
This report summarizes the results of the first 12 months of our program to study the interaction of the Earth's magnetosphere with the solar wind on the far flanks of the bow shock. This study employs data from the ISEE-3 spacecraft during its traversals of the Earth's magnetotail and correlative data from spacecraft monitoring the solar wind upstream. Our main effort to date has involved assembling data sets and developing new plotting programs. Two talks were given at the Spring Meeting of the American Geophysical Union describing our initial results from analyzing data from the far flank foreshock and magnetosheath. The following sections summarize our results
CDinFusion--submission-ready, on-line integration of sequence and contextual data.
Directory of Open Access Journals (Sweden)
Wolfgang Hankeln
Full Text Available State of the art (DNA sequencing methods applied in "Omics" studies grant insight into the 'blueprints' of organisms from all domains of life. Sequencing is carried out around the globe and the data is submitted to the public repositories of the International Nucleotide Sequence Database Collaboration. However, the context in which these studies are conducted often gets lost, because experimental data, as well as information about the environment are rarely submitted along with the sequence data. If these contextual or metadata are missing, key opportunities of comparison and analysis across studies and habitats are hampered or even impossible. To address this problem, the Genomic Standards Consortium (GSC promotes checklists and standards to better describe our sequence data collection and to promote the capturing, exchange and integration of sequence data with contextual data. In a recent community effort the GSC has developed a series of recommendations for contextual data that should be submitted along with sequence data. To support the scientific community to significantly enhance the quality and quantity of contextual data in the public sequence data repositories, specialized software tools are needed. In this work we present CDinFusion, a web-based tool to integrate contextual and sequence data in (MultiFASTA format prior to submission. The tool is open source and available under the Lesser GNU Public License 3. A public installation is hosted and maintained at the Max Planck Institute for Marine Microbiology at http://www.megx.net/cdinfusion. The tool may also be installed locally using the open source code available at http://code.google.com/p/cdinfusion.
Wear evaluation of flank in burins of high speed steel modified with titanium ions
E Caballero, J.; V-Niño, E. D.
2017-12-01
This report shows the results obtained researching the flank wearing resistance performed by the high-speed steel (HSS) burins without any surface treatment (reference substrate) and others with surface treatment based on Titanium ions. The flank wearing was carried out by means of an industrial process by chip removal with repetitive tests of dry finished turning of AISI/SAE 1045 steel bars. The useful service life of the burins was evaluated according to ISO 3685:1993, and it was found that the burins treated with Titanium ions showed an increase in the flank wearing resistance with respect to the ones used as reference.
Tools for integrated sequence-structure analysis with UCSF Chimera
Directory of Open Access Journals (Sweden)
Huang Conrad C
2006-07-01
Full Text Available Abstract Background Comparing related structures and viewing the structures in the context of sequence alignments are important tasks in protein structure-function research. While many programs exist for individual aspects of such work, there is a need for interactive visualization tools that: (a provide a deep integration of sequence and structure, far beyond mapping where a sequence region falls in the structure and vice versa; (b facilitate changing data of one type based on the other (for example, using only sequence-conserved residues to match structures, or adjusting a sequence alignment based on spatial fit; (c can be used with a researcher's own data, including arbitrary sequence alignments and annotations, closely or distantly related sets of proteins, etc.; and (d interoperate with each other and with a full complement of molecular graphics features. We describe enhancements to UCSF Chimera to achieve these goals. Results The molecular graphics program UCSF Chimera includes a suite of tools for interactive analyses of sequences and structures. Structures automatically associate with sequences in imported alignments, allowing many kinds of crosstalk. A novel method is provided to superimpose structures in the absence of a pre-existing sequence alignment. The method uses both sequence and secondary structure, and can match even structures with very low sequence identity. Another tool constructs structure-based sequence alignments from superpositions of two or more proteins. Chimera is designed to be extensible, and mechanisms for incorporating user-specific data without Chimera code development are also provided. Conclusion The tools described here apply to many problems involving comparison and analysis of protein structures and their sequences. Chimera includes complete documentation and is intended for use by a wide range of scientists, not just those in the computational disciplines. UCSF Chimera is free for non-commercial use and is
An integrative variant analysis suite for whole exome next-generation sequencing data
Directory of Open Access Journals (Sweden)
Challis Danny
2012-01-01
Full Text Available Abstract Background Whole exome capture sequencing allows researchers to cost-effectively sequence the coding regions of the genome. Although the exome capture sequencing methods have become routine and well established, there is currently a lack of tools specialized for variant calling in this type of data. Results Using statistical models trained on validated whole-exome capture sequencing data, the Atlas2 Suite is an integrative variant analysis pipeline optimized for variant discovery on all three of the widely used next generation sequencing platforms (SOLiD, Illumina, and Roche 454. The suite employs logistic regression models in conjunction with user-adjustable cutoffs to accurately separate true SNPs and INDELs from sequencing and mapping errors with high sensitivity (96.7%. Conclusion We have implemented the Atlas2 Suite and applied it to 92 whole exome samples from the 1000 Genomes Project. The Atlas2 Suite is available for download at http://sourceforge.net/projects/atlas2/. In addition to a command line version, the suite has been integrated into the Genboree Workbench, allowing biomedical scientists with minimal informatics expertise to remotely call, view, and further analyze variants through a simple web interface. The existing genomic databases displayed via the Genboree browser also streamline the process from variant discovery to functional genomics analysis, resulting in an off-the-shelf toolkit for the broader community.
Directory of Open Access Journals (Sweden)
Jean-Paul eBaquiran
2016-03-01
Full Text Available To examine microbe-mineral interactions in subsurface oceanic crust, we evaluated microbial colonization on crustal minerals that were incubated in borehole fluids for one year at the seafloor wellhead of a crustal borehole observatory (IODP Hole U1301A, Juan de Fuca Ridge flank as compared to an experiment that was not exposed to subsurface crustal fluids (at nearby IODP Hole U1301B. In comparison to previous studies at these same sites, this approach allowed assessment of the effects of temperature, fluid chemistry, and/or mineralogy on colonization patterns of different mineral substrates, and an opportunity to verify the approach of deploying colonization experiments at an observatory wellhead at the seafloor instead of within the borehole. The Hole U1301B deployment did not have biofilm growth, based on microscopy and DNA extraction, thereby confirming the integrity of the colonization design against bottom seawater intrusion. In contrast, the Hole U1301A deployment supported biofilms dominated by Epsilonproteobacteria (43.5% of 370 16S rRNA gene clone sequences and Gammaproteobacteria (29.3%. Sequence analysis revealed overlap in microbial communities between different minerals incubated at the Hole U1301A wellhead, indicating that mineralogy did not separate biofilm structure within the one-year colonization experiment. Differences in the Hole U1301A wellhead biofilm community composition relative to previous studies from within the borehole using similar mineral substrates suggest that temperature and the diffusion of dissolved oxygen through plastic components influenced the mineral colonization experiments positioned at the wellhead. This highlights the capacity of low abundance crustal fluid taxa to rapidly establish communities on diverse mineral substrates under changing environmental conditions such as from temperature and oxygen.
Method for Friction Force Estimation on the Flank of Cutting Tools
Directory of Open Access Journals (Sweden)
Luis Huerta
2017-01-01
Full Text Available Friction forces are present in any machining process. These forces could play an important role in the dynamics of the system. In the cutting process, friction is mainly present in the rake face and the flank of the tool. Although the one that acts on the rake face has a major influence, the other one can become also important and could take part in the stability of the system. In this work, experimental identification of the friction on the flank is presented. The experimental determination was carried out by machining aluminum samples in a CNC lathe. As a result, two friction functions were obtained as a function of the cutting speed and the relative motion of the contact elements. Experiments using a worn and a new insert were carried out. Force and acceleration were recorded simultaneously and, from these results, different friction levels were observed depending on the cutting parameters, such as cutting speed, feed rate, and tool condition. Finally, a friction model for the flank friction is presented.
Weathers, T. S.; Fisher, A. T.; Winslow, D. M.; Stauffer, P. H.; Gable, C. W.
2017-12-01
The flanks of mid-ocean ridges experience coupled flows of fluid, heat, and solutes that are critical for a wide range of global processes, including the cycling of carbon and nutrients, which supports a vast crustal biosphere. Only a few ridge-flank sites have been studied in detail; hydrogeologic conditions and processes in the volcanic crust are best understood on the eastern flank of the Juan de Fuca Ridge. This area has been extensively explored with decades of drilling, submersible, observatory, and survey expeditions and experiments, including the first hole-to-hole tracer injection experiment in the ocean crust. This study describes the development of reactive transport simulations for this ridge-flank setting using three-dimensional coupled (thermal-hydrological) models of crustal-scale circulation, beginning with the exploration of tracer transport. The prevailing flow direction is roughly south to north as a result of outcrop-to-outcrop flow, with a bulk flow rate in the range of meters/year. However, tracer was detected 500 m south ("upstream") from the injection borehole during the first year following injection. This may be explained by local mixing and/or formation fluid discharge from the southern borehole during and after injection. The constraints and parameters required to fit the observed tracer behavior can be used as a basis for modeling reactive transport processes such as nutrient delivery or microbial community evolution as a function of fluid flow. For example, the sulfate concentration in fluid samples from Baby Bare outcrop ( 8 km south of the tracer transport experiment) was 17.8 mmol/kg, whereas at Mama Bare outcrop ( 8 km to north of the tracer transport experiment) the sulfate concentration was 16.3 mmol/mg. By integrating laboratory-derived sulfate reduction rates from microbial samples originating from Juan de Fuca borehole observatories into reactive transport models, we can explore the range of microbial activity that supports
The hamster flank organ model: Is it relevant to man
International Nuclear Information System (INIS)
Franz, T.J.; Lehman, P.A.; Pochi, P.; Odland, G.F.; Olerud, J.
1989-01-01
The critical role that androgens play in the etiology of acne has led to a search for topically active antiandrogens and the frequent use of the flank organ of the golden Syrian hamster as an animal model. 17-alpha-propyltestosterone (17-PT) has been identified as having potent antiandrogenic activity in the hamster model, and this report describes its clinical evaluation. Two double-blind placebo controlled studies comparing 4% 17-PT in 80% alcohol versus vehicle alone were conducted. One study examined 17-PT sebosuppressive activity in 20 subjects. The second study examined its efficacy in 44 subjects having mild to moderate acne. A third study measured in vitro percutaneous absorption of 17-PT through hamster flank and monkey skin, and human face skin in-vivo, using radioactive drug. 17-PT was found to be ineffective in reducing either the sebum excretion rate or the number of inflammatory acne lesions. Failure of 17-PT to show clinical activity was not a result of poor percutaneous absorption. Total absorption in man was 7.7% of the dose and only 1.0% in the hamster. The sebaceous gland of hamster flank organ is apparently more sensitive to antiandrogens than the human sebaceous gland
Belyi, Vladimir A; Levine, Arnold J; Skalka, Anna Marie
2010-07-29
Vertebrate genomes contain numerous copies of retroviral sequences, acquired over the course of evolution. Until recently they were thought to be the only type of RNA viruses to be so represented, because integration of a DNA copy of their genome is required for their replication. In this study, an extensive sequence comparison was conducted in which 5,666 viral genes from all known non-retroviral families with single-stranded RNA genomes were matched against the germline genomes of 48 vertebrate species, to determine if such viruses could also contribute to the vertebrate genetic heritage. In 19 of the tested vertebrate species, we discovered as many as 80 high-confidence examples of genomic DNA sequences that appear to be derived, as long ago as 40 million years, from ancestral members of 4 currently circulating virus families with single strand RNA genomes. Surprisingly, almost all of the sequences are related to only two families in the Order Mononegavirales: the Bornaviruses and the Filoviruses, which cause lethal neurological disease and hemorrhagic fevers, respectively. Based on signature landmarks some, and perhaps all, of the endogenous virus-like DNA sequences appear to be LINE element-facilitated integrations derived from viral mRNAs. The integrations represent genes that encode viral nucleocapsid, RNA-dependent-RNA-polymerase, matrix and, possibly, glycoproteins. Integrations are generally limited to one or very few copies of a related viral gene per species, suggesting that once the initial germline integration was obtained (or selected), later integrations failed or provided little advantage to the host. The conservation of relatively long open reading frames for several of the endogenous sequences, the virus-like protein regions represented, and a potential correlation between their presence and a species' resistance to the diseases caused by these pathogens, are consistent with the notion that their products provide some important biological
Directory of Open Access Journals (Sweden)
Vladimir A Belyi
2010-07-01
Full Text Available Vertebrate genomes contain numerous copies of retroviral sequences, acquired over the course of evolution. Until recently they were thought to be the only type of RNA viruses to be so represented, because integration of a DNA copy of their genome is required for their replication. In this study, an extensive sequence comparison was conducted in which 5,666 viral genes from all known non-retroviral families with single-stranded RNA genomes were matched against the germline genomes of 48 vertebrate species, to determine if such viruses could also contribute to the vertebrate genetic heritage. In 19 of the tested vertebrate species, we discovered as many as 80 high-confidence examples of genomic DNA sequences that appear to be derived, as long ago as 40 million years, from ancestral members of 4 currently circulating virus families with single strand RNA genomes. Surprisingly, almost all of the sequences are related to only two families in the Order Mononegavirales: the Bornaviruses and the Filoviruses, which cause lethal neurological disease and hemorrhagic fevers, respectively. Based on signature landmarks some, and perhaps all, of the endogenous virus-like DNA sequences appear to be LINE element-facilitated integrations derived from viral mRNAs. The integrations represent genes that encode viral nucleocapsid, RNA-dependent-RNA-polymerase, matrix and, possibly, glycoproteins. Integrations are generally limited to one or very few copies of a related viral gene per species, suggesting that once the initial germline integration was obtained (or selected, later integrations failed or provided little advantage to the host. The conservation of relatively long open reading frames for several of the endogenous sequences, the virus-like protein regions represented, and a potential correlation between their presence and a species' resistance to the diseases caused by these pathogens, are consistent with the notion that their products provide some important
Perspectives of Integrative Cancer Genomics in Next Generation Sequencing Era
Directory of Open Access Journals (Sweden)
So Mee Kwon
2012-06-01
Full Text Available The explosive development of genomics technologies including microarrays and next generation sequencing (NGS has provided comprehensive maps of cancer genomes, including the expression of mRNAs and microRNAs, DNA copy numbers, sequence variations, and epigenetic changes. These genome-wide profiles of the genetic aberrations could reveal the candidates for diagnostic and/or prognostic biomarkers as well as mechanistic insights into tumor development and progression. Recent efforts to establish the huge cancer genome compendium and integrative omics analyses, so-called "integromics", have extended our understanding on the cancer genome, showing its daunting complexity and heterogeneity. However, the challenges of the structured integration, sharing, and interpretation of the big omics data still remain to be resolved. Here, we review several issues raised in cancer omics data analysis, including NGS, focusing particularly on the study design and analysis strategies. This might be helpful to understand the current trends and strategies of the rapidly evolving cancer genomics research.
Cloning and sequence of the human adrenodoxin reductase gene
International Nuclear Information System (INIS)
Lin, Dong; Shi, Y.; Miller, W.L.
1990-01-01
Adrenodoxin reductase is a flavoprotein mediating electron transport to all mitochondrial forms of cytochrome P450. The authors cloned the human adrenodoxin reductase gene and characterized it by restriction endonuclease mapping and DNA sequencing. The entire gene is approximately 12 kilobases long and consists of 12 exons. The first exon encodes the first 26 of the 32 amino acids of the signal peptide, and the second exon encodes the remainder of signal peptide and the apparent FAD binding site. The remaining 10 exons are clustered in a region of only 4.3 kilobases, separated from the first two exons by a large intron of about 5.6 kilobases. Two forms of human adrenodoxin reductase mRNA, differing by the presence or absence of 18 bases in the middle of the sequence, arise from alternate splicing at the 5' end of exon 7. This alternately spliced region is directly adjacent to the NADPH binding site, which is entirely contained in exon 6. The immediate 5' flanking region lacks TATA and CAAT boxes; however, this region is rich in G+C and contains six copies of the sequence GGGCGGG, resembling promoter sequences of housekeeping genes. RNase protection experiments show that transcription is initiated from multiple sites in the 5' flanking region, located about 21-91 base pairs upstream from the AUG translational initiation codon
Optimization of turning process through the analytic flank wear modelling
Del Prete, A.; Franchi, R.; De Lorenzis, D.
2018-05-01
In the present work, the approach used for the optimization of the process capabilities for Oil&Gas components machining will be described. These components are machined by turning of stainless steel castings workpieces. For this purpose, a proper Design Of Experiments (DOE) plan has been designed and executed: as output of the experimentation, data about tool wear have been collected. The DOE has been designed starting from the cutting speed and feed values recommended by the tools manufacturer; the depth of cut parameter has been maintained as a constant. Wear data has been obtained by means the observation of the tool flank wear under an optical microscope: the data acquisition has been carried out at regular intervals of working times. Through a statistical data and regression analysis, analytical models of the flank wear and the tool life have been obtained. The optimization approach used is a multi-objective optimization, which minimizes the production time and the number of cutting tools used, under the constraint on a defined flank wear level. The technique used to solve the optimization problem is a Multi Objective Particle Swarm Optimization (MOPS). The optimization results, validated by the execution of a further experimental campaign, highlighted the reliability of the work and confirmed the usability of the optimized process parameters and the potential benefit for the company.
Calvari, S.; Branca, S.; Corsaro, R.A.; De Beni, E.; Miraglia, L.; Norini, G.; Wijbrans, J.R.; Boschi, E.
2011-01-01
A multidisciplinary geological and compositional investigation allowed us to reconstruct the occurrence of flank eruptions on the lower NE flank of Stromboli volcano since 15 ka. The oldest flank eruption recognised is Roisa, which occurred at ~15 ka during the Vancori period, and has transitional
Chuzhanova, Nadia; Abeysinghe, Shaun S; Krawczak, Michael; Cooper, David N
2003-09-01
Translocations and gross deletions are responsible for a significant proportion of both cancer and inherited disease. Although such gene rearrangements are nonuniformly distributed in the human genome, the underlying mutational mechanisms remain unclear. We have studied the potential involvement of various types of repetitive sequence elements in the formation of secondary structure intermediates between the single-stranded DNA ends that recombine during rearrangements. Complexity analysis was used to assess the potential of these ends to form secondary structures, the maximum decrease in complexity consequent to a gross rearrangement being used as an indicator of the type of repeat and the specific DNA ends involved. A total of 175 pairs of deletion/translocation breakpoint junction sequences available from the Gross Rearrangement Breakpoint Database [GRaBD; www.uwcm.ac.uk/uwcm/mg/grabd/grabd.html] were analyzed. Potential secondary structure was noted between the 5' flanking sequence of the first breakpoint and the 3' flanking sequence of the second breakpoint in 49% of rearrangements and between the 5' flanking sequence of the second breakpoint and the 3' flanking sequence of the first breakpoint in 36% of rearrangements. Inverted repeats, inversions of inverted repeats, and symmetric elements were found in association with gross rearrangements at approximately the same frequency. However, inverted repeats and inversions of inverted repeats accounted for the vast majority (83%) of deletions plus small insertions, symmetric elements for one-half of all antigen receptor-mediated translocations, while direct repeats appear only to be involved in mediating simple deletions. These findings extend our understanding of illegitimate recombination by highlighting the importance of secondary structure formation between single-stranded DNA ends at breakpoint junctions. Copyright 2003 Wiley-Liss, Inc.
Hazza, Muataz Hazza F. Al; Adesta, Erry Y. T.; Riza, Muhammad
2013-12-01
High speed milling has many advantages such as higher removal rate and high productivity. However, higher cutting speed increase the flank wear rate and thus reducing the cutting tool life. Therefore estimating and predicting the flank wear length in early stages reduces the risk of unaccepted tooling cost. This research presents a neural network model for predicting and simulating the flank wear in the CNC end milling process. A set of sparse experimental data for finish end milling on AISI H13 at hardness of 48 HRC have been conducted to measure the flank wear length. Then the measured data have been used to train the developed neural network model. Artificial neural network (ANN) was applied to predict the flank wear length. The neural network contains twenty hidden layer with feed forward back propagation hierarchical. The neural network has been designed with MATLAB Neural Network Toolbox. The results show a high correlation between the predicted and the observed flank wear which indicates the validity of the models.
International Nuclear Information System (INIS)
Al Hazza, Muataz Hazza F; Adesta, Erry Y T; Riza, Muhammad
2013-01-01
High speed milling has many advantages such as higher removal rate and high productivity. However, higher cutting speed increase the flank wear rate and thus reducing the cutting tool life. Therefore estimating and predicting the flank wear length in early stages reduces the risk of unaccepted tooling cost. This research presents a neural network model for predicting and simulating the flank wear in the CNC end milling process. A set of sparse experimental data for finish end milling on AISI H13 at hardness of 48 HRC have been conducted to measure the flank wear length. Then the measured data have been used to train the developed neural network model. Artificial neural network (ANN) was applied to predict the flank wear length. The neural network contains twenty hidden layer with feed forward back propagation hierarchical. The neural network has been designed with MATLAB Neural Network Toolbox. The results show a high correlation between the predicted and the observed flank wear which indicates the validity of the models
Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T
2000-01-01
The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821
Plasma Transport at the Magnetospheric Flank Boundary. Final report
International Nuclear Information System (INIS)
Otto, Antonius
2012-01-01
Progress is highlighted in these areas: 1. Model of magnetic reconnection induced by three-dimensional Kelvin Helmholtz (KH) modes at the magnetospheric flank boundary; 2. Quantitative evaluation of mass transport from the magnetosheath onto closed geomagnetic field for northward IMF; 3. Comparison of mass transfer by cusp reconnection and Flank Kelvin Helmholtz modes; 4. Entropy constraint and plasma transport in the magnetotail - a new mechanism for current sheet thinning; 5. Test particle model for mass transport onto closed geomagnetic field for northward IMF; 6. Influence of density asymmetry and magnetic shear on (a) the linear and nonlinear growth of 3D Kelvin Helmholtz (KH) modes, and (b) three-dimensional KH mediated mass transport; 7. Examination of entropy and plasma transport in the magnetotail; 8. Entropy change and plasma transport by KH mediated reconnection - mixing and heating of plasma; 9. Entropy and plasma transport in the magnetotail - tail reconnection; and, 10. Wave coupling at the magnetospheric boundary and generation of kinetic Alfven waves
Force Modelling in Orthogonal Cutting Considering Flank Wear Effect
Rathod, Kanti Bhikhubhai; Lalwani, Devdas I.
2017-05-01
In the present work, an attempt has been made to provide a predictive cutting force model during orthogonal cutting by combining two different force models, that is, a force model for a perfectly sharp tool plus considering the effect of edge radius and a force model for a worn tool. The first force model is for a perfectly sharp tool that is based on Oxley's predictive machining theory for orthogonal cutting as the Oxley's model is for perfectly sharp tool, the effect of cutting edge radius (hone radius) is added and improve model is presented. The second force model is based on worn tool (flank wear) that was proposed by Waldorf. Further, the developed combined force model is also used to predict flank wear width using inverse approach. The performance of the developed combined total force model is compared with the previously published results for AISI 1045 and AISI 4142 materials and found reasonably good agreement.
Farr, Alex; Ott, Johannes; Kueronya, Verena; Margreiter, Markus; Javadli, Elchin; Einig, Sabrina; Husslein, Peter W; Bancher-Todesca, Dagmar
2017-10-01
Maternal hydronephrosis may cause flank pain during pregnancy. We aimed to investigate the association between maternal hydronephrosis and flank pain intensity. From 2014 to 2015, all consecutive women with singleton pregnancies, who presented at our tertiary center due to acute flank pain, were prospectively evaluated by renal ultrasonography and pain questionnaires. A visual analogue scale was used to assess pain intensity. The study had 90% power to detect a significant correlation between hydronephrosis and flank pain (Spearman's test). A total of 51 consecutive women with left-sided (13.7%), right-sided (64.7%) or bilateral (21.6%) pain were enrolled. The mean gestational age of these women, who presented due to their pain, was 27.5 ± 6.8 weeks at the time of consultation. The mean VAS score was 7.6 ± 2.2. In 43/51 (84.3%) women, hydronephrosis was found on renal sonograms. No correlation was found between the grade of hydronephrosis and pain intensity (p = 0.466; r= -0.28). Women delivered at a mean gestational age of 38.1 ± 2.4 weeks and their infants had a mean birthweight of 3138 ± 677 g. Hydronephrosis is a common finding among pregnant women with acute flank pain. The grade of hydronephrosis does not affect pain intensity. This study suggests normal pregnancy outcomes in these women.
Short sequence motifs, overrepresented in mammalian conservednon-coding sequences
Energy Technology Data Exchange (ETDEWEB)
Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna
2007-02-21
Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by
Hazard Potential of Volcanic Flank Collapses Raised by New Megatsunami Evidence
Ramalho, R. S.; Winckler, G.; Madeira, J.; Helffrich, G. R.; Hipólito, A.; Quartau, R.; Adena, K.; Schaefer, J. M.
2015-12-01
Large-scale gravitational flank collapses of steep volcanic islands are hypothetically capable of triggering megatsunamis with highly catastrophic effects. Yet evidence for the existence and impact of collapsed-triggered megatsunamis and their run-up heights remains scarce and/or is highly contentious. Therefore a considerable debate still exists over the potential magnitude of collapse-triggered tsunamis and their inherent hazard. In particular, doubts still remain whether or not large-scale flank failures typically generate enough volume flux to result in megatsunamis, or alternatively operate by slow-moving or multiple smaller episodic failures with much lower tsunamigenic potential. Here we show that one of the tallest and most active oceanic volcanoes on Earth - Fogo, in the Cape Verde Islands - collapsed catastrophically and triggered a megatsunami with devastating near-field effects ~73,000 years ago. Our deductions are based on the recent discovery and cosmogenic 3He dating of tsunamigenic deposits - comprising fields of stranded megaclasts, chaotic conglomerates, and sand sheets - found on the adjacent Santiago Island, which attest to the impact of this megatsunami and document wave run-up heights exceeding 270 m. The evidence reported here implies that Fogo's flank failure involved at least one sudden and voluminous event that resulted in a megatsunami, in contrast to what has been suggested before. Our work thus provides another line of evidence that large-scale flank failures at steep volcanic islands may indeed happen catastrophically and are capable of triggering tsunamis of enormous height and energy. This new line of evidence therefore reinforces the hazard potential of volcanic island collapses and stands as a warning that such hazard should not be underestimated, particularly in areas where volcanic island edifices are close to other islands or to highly populated continental margins.
Kardinal, C; Selmayr, M; Mocikat, R
1996-11-01
Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation.
Music and language perception: expectations, structural integration, and cognitive sequencing.
Tillmann, Barbara
2012-10-01
Music can be described as sequences of events that are structured in pitch and time. Studying music processing provides insight into how complex event sequences are learned, perceived, and represented by the brain. Given the temporal nature of sound, expectations, structural integration, and cognitive sequencing are central in music perception (i.e., which sounds are most likely to come next and at what moment should they occur?). This paper focuses on similarities in music and language cognition research, showing that music cognition research provides insight into the understanding of not only music processing but also language processing and the processing of other structured stimuli. The hypothesis of shared resources between music and language processing and of domain-general dynamic attention has motivated the development of research to test music as a means to stimulate sensory, cognitive, and motor processes. Copyright © 2012 Cognitive Science Society, Inc.
Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E
2013-06-24
Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable
Redmond, Catherine J.; Dooley, Katharine E.; Fu, Haiqing; Gillison, Maura L.; Akagi, Keiko; Symer, David E.; Aladjem, Mirit I.
2018-01-01
Integration of human papillomavirus (HPV) genomes into cellular chromatin is common in HPV-associated cancers. Integration is random, and each site is unique depending on how and where the virus integrates. We recently showed that tandemly integrated HPV16 could result in the formation of a super-enhancer-like element that drives transcription of the viral oncogenes. Here, we characterize the chromatin landscape and genomic architecture of this integration locus to elucidate the mechanisms that promoted de novo super-enhancer formation. Using next-generation sequencing and molecular combing/fiber-FISH, we show that ~26 copies of HPV16 are integrated into an intergenic region of chromosome 2p23.2, interspersed with 25 kb of amplified, flanking cellular DNA. This interspersed, co-amplified viral-host pattern is frequent in HPV-associated cancers and here we designate it as Type III integration. An abundant viral-cellular fusion transcript encoding the viral E6/E7 oncogenes is expressed from the integration locus and the chromatin encompassing both the viral enhancer and a region in the adjacent amplified cellular sequences is strongly enriched in the super-enhancer markers H3K27ac and Brd4. Notably, the peak in the amplified cellular sequence corresponds to an epithelial-cell-type specific enhancer. Thus, HPV16 integration generated a super-enhancer-like element composed of tandem interspersed copies of the viral upstream regulatory region and a cellular enhancer, to drive high levels of oncogene expression. PMID:29364907
Microsatellite, or simple sequence repeat (SSR) markers, are valuable as co-dominant genetic markers with a variety of applications such as DNA fingerprinting, linkage mapping, and population structure analysis. However, primer pairs designed from the regions that flank SSRs often generate fragment...
DEFF Research Database (Denmark)
Roch, F A; Hobi, R; Berchtold, M W
1997-01-01
respectively, can markedly affect the frequency of V(D)J recombination. We report that the entire Emu, the Emu core as well as its flanking 5' and 3' matrix associated regions (5' and 3' MARs) upregulate V(D)J recombination while the downstream section of the 3' MAR of Emu does not. Also, prokaryotic sequences...
Khalil, Mohamed I; Sommer, Marvin H; Hay, John; Ruyechan, William T; Arvin, Ann M
2015-07-01
The VZV genome has two origins of DNA replication (oriS), each of which consists of an AT-rich sequence and three origin binding protein (OBP) sites called Box A, C and B. In these experiments, the mutation in the core sequence CGC of the Box A and C not only inhibited DNA replication but also inhibited both ORF62 and ORF63 expression in reporter gene assays. In contrast the Box B mutation did not influence DNA replication or flanking gene transcription. These results suggest that efficient DNA replication enhances ORF62 and ORF63 transcription. Recombinant viruses carrying these mutations in both sites and one with a deletion of the whole oriS were constructed. Surprisingly, the recombinant virus lacking both copies of oriS retained the capacity to replicate in melanoma and HELF cells suggesting that VZV has another origin of DNA replication. Copyright © 2015 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Lucky, A.W.; Eisenfeld, A.J.; Visintin, I.
1985-01-01
In the hamster flank organ, the growth of hair and growth of sebaceous glands are androgen-dependent functions. Although dihydrotestosterone (DHT) is known to be a potent stimulator of flank organ growth, there is no information about localization of DHT receptor sites in this organ. The purpose of this study was to use steroid autoradiography to localize DHT receptors in the hamster flank organ. Because steroid hormones are functional when translocated to nuclear receptors, nuclear localization by autoradiography defines receptor sites. In order to be able to visualize autoradiographic grains from radiolabeled androgens around hair follicles, albino hamsters were studied to avoid confusion between the grains and pigment granules which are abundant in the more common Golden Syrian hamster. Mature male hamsters castrated 24 hours earlier were given tritium-labeled dihydrotestosterone ( [ 3 H]DHT). Using the technique of thaw-mount steroid autoradiography, 4-micron unfixed frozen sections were mounted in the dark onto emulsion-coated glass slides and allowed to develop for 4-6 months. [ 3 H]DHT was found to be concentrated over sebocyte nuclei. The label was present peripherally as well as in differentiating sebocytes. There was no nuclear localization of [ 3 H]DHT in animals pretreated with excessive quantities of unlabeled DHT. Steroid metabolites of [ 3 H] DHT were assessed by thin-layer chromatography in paired tissue samples. Most of the label remained with DHT. Uptake was inhibited in the flank organ of hamsters pretreated with unlabeled DHT
McAllister, Robert G; Liu, Jiahui; Woods, Matthew W; Tom, Sean K; Rupar, C Anthony; Barr, Stephen D
2014-01-01
The blood–brain barrier controls the passage of molecules from the blood into the central nervous system (CNS) and is a major challenge for treatment of neurological diseases. Metachromatic leukodystrophy is a neurodegenerative lysosomal storage disease caused by loss of arylsulfatase A (ARSA) activity. Gene therapy via intraventricular injection of a lentiviral vector is a potential approach to rapidly and permanently deliver therapeutic levels of ARSA to the CNS. We present the distribution of integration sites of a lentiviral vector encoding human ARSA (LV-ARSA) in murine brain choroid plexus and ependymal cells, administered via a single intracranial injection into the CNS. LV-ARSA did not exhibit a strong preference for integration in or near actively transcribed genes, but exhibited a strong preference for integration in or near satellite DNA. We identified several genomic hotspots for LV-ARSA integration and identified a consensus target site sequence characterized by two G-quadruplex-forming motifs flanking the integration site. In addition, our analysis identified several other non-B DNA motifs as new factors that potentially influence lentivirus integration, including human immunodeficiency virus type-1 in human cells. Together, our data demonstrate a clinically favorable integration site profile in the murine brain and identify non-B DNA as a potential new host factor that influences lentiviral integration in murine and human cells. PMID:25158091
Radon measurements in the SE and NE flank of Mt. Etna (Italy)
International Nuclear Information System (INIS)
La Delfa, S.; Imme, G.; Lo Nigro, S.; Morelli, D.; Patane, G.; Vizzini, F.
2007-01-01
Soil Radon has been monitored at two fixed sites located in the northeastern and southeastern flank of Mt. Etna. In this study we report the comparison between in-soil Radon concentration trend recorded in the SE flank and that one recorded in the NE one, where an in-soil Radon detection system is operating since 2001. The aim of this work was to implement the investigation area finding a suitable radon detection site, in the south-east flank of Mt. Etna, in order to better understand possible links between Radon anomalies and volcano dynamic. Radon data collected in NE and SE sites were compared with the volcanic tremor, frequency of occurrence of earthquakes and seismic strain-release recorded at a fixed 3D digital seismic station placed in the NE site. Same general in-soil Radon trends and anomalies were found in both sites. These results have confirmed the suitability of the chosen southeastern site for the in-soil Radon monitoring at Mt. Etna. The comparison of the recorded Radon concentration anomalies with seismicity and volcanic tremor trends, has also verified a possible link with the volcanic activity, as observed in our previous published studies
Multi-stage volcanic island flank collapses with coeval explosive caldera-forming eruptions.
Hunt, James E; Cassidy, Michael; Talling, Peter J
2018-01-18
Volcanic flank collapses and explosive eruptions are among the largest and most destructive processes on Earth. Events at Mount St. Helens in May 1980 demonstrated how a relatively small (300 km 3 ), but can also occur in complex multiple stages. Here, we show that multistage retrogressive landslides on Tenerife triggered explosive caldera-forming eruptions, including the Diego Hernandez, Guajara and Ucanca caldera eruptions. Geochemical analyses were performed on volcanic glasses recovered from marine sedimentary deposits, called turbidites, associated with each individual stage of each multistage landslide. These analyses indicate only the lattermost stages of subaerial flank failure contain materials originating from respective coeval explosive eruption, suggesting that initial more voluminous submarine stages of multi-stage flank collapse induce these aforementioned explosive eruption. Furthermore, there are extended time lags identified between the individual stages of multi-stage collapse, and thus an extended time lag between the initial submarine stages of failure and the onset of subsequent explosive eruption. This time lag succeeding landslide-generated static decompression has implications for the response of magmatic systems to un-roofing and poses a significant implication for ocean island volcanism and civil emergency planning.
Połowniak, Piotr; Sobolak, Mariusz
2017-12-01
In this article, a mathematical description of tooth flank surface of the globoidal worm and worm wheel generated by the hourglass worm hob with straight tooth axial profile is presented. The kinematic system of globoidal worm gear is shown. The equation of globoid helix and tooth axial profile of worm is derived to determine worm tooth surface. Based on the equation of meshing the contact lines are obtained. The mathematical description of globoidal worm wheel tooth flank is performed on the basis of contact lines and generating the tooth side by the extreme cutting edge of worm hob. The presented mathematical model of tooth flank of TA worm and worm wheel can be used e.g. to analyse the contact pattern of the gear.
Lopez, Genghis H; Turner, Robyn M; McGowan, Eunike C; Schoeman, Elizna M; Scott, Stacy A; O'Brien, Helen; Millard, Glenda M; Roulis, Eileen V; Allen, Amanda J; Liew, Yew-Wah; Flower, Robert L; Hyland, Catherine A
2018-03-01
The RhD blood group antigen is extremely polymorphic and the DEL phenotype represents one such class of polymorphisms. The DEL phenotype prevalent in East Asian populations arises from a synonymous substitution defined as RHD*1227A. However, initially, based on genomic and cDNA studies, the genetic basis for a DEL phenotype in Taiwan was attributed to a deletion of RHD Exon 9 that was never verified at the genomic level by any other independent group. Here we investigate the genetic basis for a Caucasian donor with a DEL partial D phenotype and compare the genomic findings to those initial molecular studies. The 3'-region of the RHD gene was amplified by long-range polymerase chain reaction (PCR) for massively parallel sequencing. Primers were designed to encompass a deletion, flanking Exon 9, by standard PCR for Sanger sequencing. Targeted sequencing of exons and flanking introns was also performed. Genomic DNA exhibited a 1012-bp deletion spanning from Intron 8, across Exon 9 into Intron 9. The deletion breakpoints occurred between two 25-bp repeat motifs flanking Exon 9 such that one repeat sequence remained. Deletion mutations bordered by repeat sequences are a hallmark of slipped-strand mispairing (SSM) event. We propose this genetic mechanism generated the germline deletion in the Caucasian donor. Extensive studies show that the RHD*1227A is the most prevalent DEL allele in East Asian populations and may have confounded the initial molecular studies. Review of the literature revealed that the SSM model explains some of the extreme polymorphisms observed in the clinically significant RhD blood group antigen. © 2017 AABB.
Liang, Chanjuan; van Dijk, Jeroen P; Scholtens, Ingrid M J; Staats, Martijn; Prins, Theo W; Voorhuijzen, Marleen M; da Silva, Andrea M; Arisi, Ana Carolina Maisonnave; den Dunnen, Johan T; Kok, Esther J
2014-04-01
The growing number of biotech crops with novel genetic elements increasingly complicates the detection of genetically modified organisms (GMOs) in food and feed samples using conventional screening methods. Unauthorized GMOs (UGMOs) in food and feed are currently identified through combining GMO element screening with sequencing the DNA flanking these elements. In this study, a specific and sensitive qPCR assay was developed for vip3A element detection based on the vip3Aa20 coding sequences of the recently marketed MIR162 maize and COT102 cotton. Furthermore, SiteFinding-PCR in combination with Sanger, Illumina or Pacific BioSciences (PacBio) sequencing was performed targeting the flanking DNA of the vip3Aa20 element in MIR162. De novo assembly and Basic Local Alignment Search Tool searches were used to mimic UGMO identification. PacBio data resulted in relatively long contigs in the upstream (1,326 nucleotides (nt); 95 % identity) and downstream (1,135 nt; 92 % identity) regions, whereas Illumina data resulted in two smaller contigs of 858 and 1,038 nt with higher sequence identity (>99 % identity). Both approaches outperformed Sanger sequencing, underlining the potential for next-generation sequencing in UGMO identification.
Single nucleotide polymorphisms in the 5'-flanking region of the ...
African Journals Online (AJOL)
Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...
Le Corvec, Nicolas
2014-07-01
Mount Etna volcano is subject to transient magmatic intrusions and flank movement. The east flank of the edifice, in particular, is moving eastward and is dissected by the Timpe Fault System. The relationship of this eastward motion with intrusions and tectonic fault motion, however, remains poorly constrained. Here we explore this relationship by using analogue experiments that are designed to simulate magmatic rift intrusion, flank movement, and fault activity before, during, and after a magmatic intrusion episode. Using particle image velocimetry allows for a precise temporal and spatial analysis of the development and activity of fault systems. The results show that the occurrence of rift intrusion episodes has a direct effect on fault activity. In such a situation, fault activity may occur or may be hindered, depending on the interplay of fault displacement and flank acceleration in response to dike intrusion. Our results demonstrate that a complex interplay may exist between an active tectonic fault system and magmatically induced flank instability. Episodes of magmatic intrusion change the intensity pattern of horizontal flank displacements and may hinder or activate associated faults. We further compare our results with the GPS data of the Mount Etna 2001 eruption and intrusion. We find that syneruptive displacement rates at the Timpe Fault System have differed from the preeruptive or posteruptive periods, which shows a good agreement of both the experimental and the GPS data. Therefore, understanding the flank instability and flank stability at Mount Etna requires consideration of both tectonic and magmatic forcing. Key Points Analyzing Mount Etna east flank dynamics during the 2001 eruption Good correlation between analogue models and GPS data Understanding the different behavior of faulting before/during/after an eruption © 2014. American Geophysical Union. All Rights Reserved.
Le Corvec, Nicolas; Walter, Thomas R.; Ruch, Joel; Bonforte, Alessandro; Puglisi, Giuseppe
2014-01-01
Mount Etna volcano is subject to transient magmatic intrusions and flank movement. The east flank of the edifice, in particular, is moving eastward and is dissected by the Timpe Fault System. The relationship of this eastward motion with intrusions and tectonic fault motion, however, remains poorly constrained. Here we explore this relationship by using analogue experiments that are designed to simulate magmatic rift intrusion, flank movement, and fault activity before, during, and after a magmatic intrusion episode. Using particle image velocimetry allows for a precise temporal and spatial analysis of the development and activity of fault systems. The results show that the occurrence of rift intrusion episodes has a direct effect on fault activity. In such a situation, fault activity may occur or may be hindered, depending on the interplay of fault displacement and flank acceleration in response to dike intrusion. Our results demonstrate that a complex interplay may exist between an active tectonic fault system and magmatically induced flank instability. Episodes of magmatic intrusion change the intensity pattern of horizontal flank displacements and may hinder or activate associated faults. We further compare our results with the GPS data of the Mount Etna 2001 eruption and intrusion. We find that syneruptive displacement rates at the Timpe Fault System have differed from the preeruptive or posteruptive periods, which shows a good agreement of both the experimental and the GPS data. Therefore, understanding the flank instability and flank stability at Mount Etna requires consideration of both tectonic and magmatic forcing. Key Points Analyzing Mount Etna east flank dynamics during the 2001 eruption Good correlation between analogue models and GPS data Understanding the different behavior of faulting before/during/after an eruption © 2014. American Geophysical Union. All Rights Reserved.
Sabin, Andrew; Blake, Kelly; Lazaro, Mike; Blankenship, Douglas; Kennedy, Mack; McCullough, Jess; DeOreo, S.B.; Hickman, Stephen H.; Glen, Jonathan; Kaven, Joern; Williams, Colin F.; Phelps, Geoffrey; Faulds, James E.; Hinz, Nicholas H.; Calvin, Wendy M.; Siler, Drew; Robertson-Tait, Ann
2017-01-01
The proposed West Flank FORGE site is within the China Lake Naval Air Weapons Station (NAWS), China Lake, CA. The West Flank is west of the Coso geothermal field, an area of China Lake NAWS dominated by the Quaternary Coso volcanic field largely comprised of rhyolite domes and their volcaniclastic and epiclastic horizons. The largest dome flow complex, Sugarloaf Mountain, marks the northwestern margin of the geothermal field. The West Flank is situated due west of Sugarloaf. The geologic setting of the West Flank was determined from one deep well (83-11) drilled as a potential production hole in 2009. The bottom-hole temperature (BHT) of well 83-11 approaches 600 oF (315˚C), but flow tests demonstrate very low, non-commercial permeabilities. With the exception of the upper 600 feet of volcaniclastic alluvium, well 83-11 is completed in granitic basement. The West Flank possesses the primary attributes of a FORGE site: non-commercial permeability (geothermal fieldThe Coso Mountains host the Coso volcanic field and are within a right-releasing stepover between the dextral Airport Lake (ALF) and Little Lake fault zones (LLFZ) and the Wild Horse Mesa and Owens Valley faults. Two distinct fault populations have been identified at Coso: WNW-trending and antithetical, NE-trending strike-slip faults and N- to NNE-trending normal faults. These faults are both high permeability drilling targets at depth within the main (productive) geothermal field and they locally segment the field into distinct hydrothermal regimes. The West Flank may be segmented from the rest of the field by one such northerly trending fault. The overall minimum principal stress orientation in the main geothermal field varies from 103˚ to 108˚; however, the minimum horizontal principal stress in 83-11 is rotated to 081˚.
Directory of Open Access Journals (Sweden)
Geoffrey R Bennett
Full Text Available Host base excision repair (BER proteins that repair oxidative damage enhance HIV infection. These proteins include the oxidative DNA damage glycosylases 8-oxo-guanine DNA glycosylase (OGG1 and mutY homolog (MYH as well as DNA polymerase beta (Polβ. While deletion of oxidative BER genes leads to decreased HIV infection and integration efficiency, the mechanism remains unknown. One hypothesis is that BER proteins repair the DNA gapped integration intermediate. An alternative hypothesis considers that the most common oxidative DNA base damages occur on guanines. The subtle consensus sequence preference at HIV integration sites includes multiple G:C base pairs surrounding the points of joining. These observations suggest a role for oxidative BER during integration targeting at the nucleotide level. We examined the hypothesis that BER repairs a gapped integration intermediate by measuring HIV infection efficiency in Polβ null cell lines complemented with active site point mutants of Polβ. A DNA synthesis defective mutant, but not a 5'dRP lyase mutant, rescued HIV infection efficiency to wild type levels; this suggested Polβ DNA synthesis activity is not necessary while 5'dRP lyase activity is required for efficient HIV infection. An alternate hypothesis that BER events in the host genome influence HIV integration site selection was examined by sequencing integration sites in OGG1 and MYH null cells. In the absence of these 8-oxo-guanine specific glycosylases the chromatin elements of HIV integration site selection remain the same as in wild type cells. However, the HIV integration site sequence preference at G:C base pairs is altered at several positions in OGG1 and MYH null cells. Inefficient HIV infection in the absence of oxidative BER proteins does not appear related to repair of the gapped integration intermediate; instead oxidative damage repair may participate in HIV integration site preference at the sequence level.
Hussing, C; Bytyci, R; Huber, C; Morling, N; Børsting, C
2018-05-24
Some STR loci have internal sequence variations, which are not revealed by the standard STR typing methods used in forensic genetics (PCR and fragment length analysis by capillary electrophoresis (CE)). Typing of STRs with next-generation sequencing (NGS) uncovers the sequence variation in the repeat region and in the flanking regions. In this study, 363 Danish individuals were typed for 56 STRs (26 autosomal STRs, 24 Y-STRs, and 6 X-STRs) using the ForenSeq™ DNA Signature Prep Kit to establish a Danish STR sequence database. Increased allelic diversity was observed in 34 STRs by the PCR-NGS assay. The largest increases were found in DYS389II and D12S391, where the numbers of sequenced alleles were around four times larger than the numbers of alleles determined by repeat length alone. Thirteen SNPs and one InDel were identified in the flanking regions of 12 STRs. Furthermore, 36 single positions and five longer stretches in the STR flanking regions were found to have dubious genotyping quality. The combined match probability of the 26 autosomal STRs was 10,000 times larger using the PCR-NGS assay than by using PCR-CE. The typical paternity indices for trios and duos were 500 and 100 times larger, respectively, than those obtained with PCR-CE. The assay also amplified 94 SNPs selected for human identification. Eleven of these loci were not in Hardy-Weinberg equilibrium in the Danish population, most likely because the minimum threshold for allele calling (30 reads) in the ForenSeq™ Universal Analysis Software was too low and frequent allele dropouts were not detected.
Complete motif analysis of sequence requirements for translation initiation at non-AUG start codons.
Diaz de Arce, Alexander J; Noderer, William L; Wang, Clifford L
2018-01-25
The initiation of mRNA translation from start codons other than AUG was previously believed to be rare and of relatively low impact. More recently, evidence has suggested that as much as half of all translation initiation utilizes non-AUG start codons, codons that deviate from AUG by a single base. Furthermore, non-AUG start codons have been shown to be involved in regulation of expression and disease etiology. Yet the ability to gauge expression based on the sequence of a translation initiation site (start codon and its flanking bases) has been limited. Here we have performed a comprehensive analysis of translation initiation sites that utilize non-AUG start codons. By combining genetic-reporter, cell-sorting, and high-throughput sequencing technologies, we have analyzed the expression associated with all possible variants of the -4 to +4 positions of non-AUG translation initiation site motifs. This complete motif analysis revealed that 1) with the right sequence context, certain non-AUG start codons can generate expression comparable to that of AUG start codons, 2) sequence context affects each non-AUG start codon differently, and 3) initiation at non-AUG start codons is highly sensitive to changes in the flanking sequences. Complete motif analysis has the potential to be a key tool for experimental and diagnostic genomics. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Ying-Juan LIU, Da-Wei WANG, Lixing SUN, Jin-Hua ZHANG, Jian-Xu ZHANG
2010-12-01
Full Text Available Behavioral studies have shown that flank glands are involved in chemical communication in golden hamsters Mesocricetus auratus but little chemical analysis has been conducted on volatiles arising from these glands. Using gas chromatography-mass spectrometry, we detected compounds from the flank glands of males, only eight of which were also produced in females. Based on these chemical data we performed a number of further experiments. By manipulating light we found that males exposed to short-photoperiods developed smaller flank glands than those exposed to long-photoperiods. Six flank gland volatiles reduced in relative abundance, which possibly coded for reproductive status of males of this seasonally breeding hamster species. Through dyadic encounters, we were able to induce the formation of dominant-subordinate relationships and show that two glandular compounds became high in relative abundance and may function as dominance pheromones. Castration eliminated all male-specific compounds resulting from flank glands, but bilateral ovariectomies only affected one compound in females. Once these ovariectomized females were treated with testosterone, their glandular compounds resembled those of males, suggesting these compounds are under the main control of androgen. Two female putative pheromones, tetradecanoic acid and hexadecanoic acid, were used in binary choice tests and were both found to attract males over females. Applying a solution of these pheromone compounds to adult males also suppressed their agonistic behavior [Current Zoology 56 (6: 800–812, 2010].
The role of viscous magma mush spreading in volcanic flank motion at Kīlauea Volcano, Hawai'i
Plattner, C.; Amelung, F.; Baker, S.; Govers, R.; Poland, M.
2013-01-01
Multiple mechanisms have been suggested to explain seaward motion of the south flank of Kīlauea Volcano, Hawai'i. The consistency of flank motion during both waxing and waning magmatic activity at Kīlauea suggests that a continuously acting force, like gravity body force, plays a substantial role.
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
Successful flank appraisal with a horizontal well: a Niger Delta example
Energy Technology Data Exchange (ETDEWEB)
Ohanele, C.; Emelumadu, U.
1998-12-31
Case study of a horizontal well successfully drilled in 1994 by Shell Oil in the Niger Delta is described. The well was drilled with the objectives of improving drainage of the major D3.1 reservoir and appraising the poorly defined eastern flank for structure and fluid content of the overlying D3.0 sand. The well was optimized by 3D reservoir and hydrocarbon modeling of these reservoirs. Combining the development and appraisal objectives in one horizontal well proved to be the optimal solution, both from a cost as well as a production consideration. The well proved up over 50 MMstb of additional reserves. The structural flank proved to be significantly shallower than previously mapped and had a positive effect not only on the D3.0 reserves, but also on the the D3.1. 6 figs.
Evidence for magnocellular involvement in the identification of flanked letters
Omtzigt, D.; Hendriks, A.W.C.J.; Kolk, H.H.J.
2002-01-01
Little is known about the role of the magno system in reading. One important hypothesis is that this system is involved in the allocation of attention. We reasoned that the presentation of a single letter automatically draws attention to this letter, whereas in the case of a flanked letter, an
Graph-based sequence annotation using a data integration approach.
Pesch, Robert; Lysenko, Artem; Hindle, Matthew; Hassani-Pak, Keywan; Thiele, Ralf; Rawlings, Christopher; Köhler, Jacob; Taubert, Jan
2008-08-25
The automated annotation of data from high throughput sequencing and genomics experiments is a significant challenge for bioinformatics. Most current approaches rely on sequential pipelines of gene finding and gene function prediction methods that annotate a gene with information from different reference data sources. Each function prediction method contributes evidence supporting a functional assignment. Such approaches generally ignore the links between the information in the reference datasets. These links, however, are valuable for assessing the plausibility of a function assignment and can be used to evaluate the confidence in a prediction. We are working towards a novel annotation system that uses the network of information supporting the function assignment to enrich the annotation process for use by expert curators and predicting the function of previously unannotated genes. In this paper we describe our success in the first stages of this development. We present the data integration steps that are needed to create the core database of integrated reference databases (UniProt, PFAM, PDB, GO and the pathway database Ara-Cyc) which has been established in the ONDEX data integration system. We also present a comparison between different methods for integration of GO terms as part of the function assignment pipeline and discuss the consequences of this analysis for improving the accuracy of gene function annotation. The methods and algorithms presented in this publication are an integral part of the ONDEX system which is freely available from http://ondex.sf.net/.
Directory of Open Access Journals (Sweden)
Messenger Tara
2001-08-01
Full Text Available Abstract Background Alterations in arginine vasopressin regulation and secretion have been proposed as one possible biochemical abnormality in patients with obsessive-compulsive disorder. In golden hamsters, arginine vasopressin microinjections into the anterior hypothalamus trigger robust grooming and flank marking, a stereotyped scent marking behaviors. The intensity and repetition of the behaviors induced by arginine vasopressin is somewhat reminiscent of Obsessive Compulsive Disorder in humans. The present experiments were carried out to test whether pharmacological agents used to alleviate obsessive compulsive disorder could inhibit arginine vasopressin-induced flank marking and grooming. Results Male golden hamsters were treated daily for two weeks with either vehicle, fluoxetine, clomipramine, or desipramine (an ineffective drug, before being tested for arginine vasopressin-induced flank marking and grooming. Flank marking was significantly inhibited in animals treated with fluoxetine or clomipramine but unaffected by treatment with desipramine. Grooming behavior was not affected by any treatment. Conclusion These data suggest that arginine vasopressin-induced flank marking may serve as an animal model for screening drugs used in the control of Obsessive Compulsive Disorder.
Molecular design of sequence specific DNA alkylating agents.
Minoshima, Masafumi; Bando, Toshikazu; Shinohara, Ken-ichi; Sugiyama, Hiroshi
2009-01-01
Sequence-specific DNA alkylating agents have great interest for novel approach to cancer chemotherapy. We designed the conjugates between pyrrole (Py)-imidazole (Im) polyamides and DNA alkylating chlorambucil moiety possessing at different positions. The sequence-specific DNA alkylation by conjugates was investigated by using high-resolution denaturing polyacrylamide gel electrophoresis (PAGE). The results showed that polyamide chlorambucil conjugates alkylate DNA at flanking adenines in recognition sequences of Py-Im polyamides, however, the reactivities and alkylation sites were influenced by the positions of conjugation. In addition, we synthesized conjugate between Py-Im polyamide and another alkylating agent, 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI). DNA alkylation reactivies by both alkylating polyamides were almost comparable. In contrast, cytotoxicities against cell lines differed greatly. These comparative studies would promote development of appropriate sequence-specific DNA alkylating polyamides against specific cancer cells.
International Nuclear Information System (INIS)
Riley, L.K.; Morrow, J.K.; Danton, M.J.; Coleman, M.S.
1988-01-01
Human terminal deoxyribonucleotidyltransferase cDNA contains an open reading frame of 1530 base pairs (bp) corresponding to a protein containing 510 amino acids. The encoded protein is a template-independent DNA polymerase found only in a restricted population of normal and malignant prelymphocytes. To begin to investigate the genetic elements responsible for the tissue-specific expression of terminal deoxyribonucleotidyltransferase, genomic clones, containing the entire human gene were isolated and characterized. Initially, cDNA clones were isolated from a library generated from the human lymphoblastoid cell line, MOLT-4R. A cDNA clone containing the entire coding region of the protein was used to isolate a series of overlapping clones from two human genomic libraries. The gene comprises 11 exons and 10 introns and spans 49.4 kilobases. The 5' flanking region (709 bp) including exon 1 was sequenced. Several putative transcription initiation sites were mapped. Within 500 nucleotides of the translation start site, a series of promoter elements was detected. TATA and CAAT sequences, respectively, were found to start at nucleotides -185 and -204, -328 and -370, and -465 and -505. Start sites were found for a cyclic AMP-dependent promoter analog at nucleotide -121, an eight-base sequence corresponding to the IgG promoter enhancer (cd) at nucleotide -455, and an analog of the IgG promoter (pd) at nucleotide -159. These findings suggest that transcripts coding for terminal deoxyribonucleotidyltransferase may be variable in length and that transcription may be influenced by a variety of genetic elements
Imaging modalities and therapy options in patients with acute flank pain
International Nuclear Information System (INIS)
Grosse, A.; Grosse, C.
2014-01-01
The objective of this article is the description of imaging techniques for the evaluation of patients with acute flank pain and suspicion of urolithiasis and the impact of these techniques in the therapy management of patients with calculi. (orig.) [de
Stability analysis of Western flank of Cumbre Vieja volcano (La Palma) using numerical modelling
Bru, Guadalupe; Gonzalez, Pablo J.; Fernandez-Merodo, Jose A.; Fernandez, Jose
2016-04-01
La Palma volcanic island is one of the youngest of the Canary archipelago, being a composite volcano formed by three overlapping volcanic centers. There are clear onshore and offshore evidences of past giant landslides that have occurred during its evolution. Currently, the active Cumbre Vieja volcano is in an early development state (Carracedo et al., 2001). The study of flank instability processes aim to assess, among other hazards, catastrophic collapse and potential tsunami generation. Early studies of the potential instability of Cumbre Vieja volcano western flank have focused on the use of sparse geodetic networks (Moss et al. 1999), surface geological mapping techniques (Day et al. 1999) and offshore bathymetry (Urgeles et al. 1999). Recently, a dense GNSS network and satellite radar interferometry results indicate ground motion consistent with deep-seated creeping processes (Prieto et al. 2009, Gonzalez et al. 2010). In this work, we present a geomechanical advanced numerical model that captures the ongoing deformation processes at Cumbre Vieja. We choose the Finite Elements Method (FEM) which is based in continuum mechanics and is the most used for geotechnical applications. FEM has the ability of using arbitrary geometry, heterogeneities, irregular boundaries and different constitutive models representative of the geotechnical units involved. Our main contribution is the introduction of an inverse approach to constrain the geomechanical parameters using satellite radar interferometry displacements. This is the first application of such approach on a large volcano flank study. We suggest that the use of surface displacements and inverse methods to rigorously constrain the geomechanical model parameter space is a powerful tool to understand volcano flank instability. A particular important result of the studied case is the estimation of displaced rock volume, which is a parameter of critical importance for simulations of Cumbre Vieja tsunamigenic hazard
Trubitsyna, Maryia; Michlewski, Gracjan; Finnegan, David J; Elfick, Alistair; Rosser, Susan J; Richardson, Julia M; French, Christopher E
2017-06-02
Delivery of DNA to cells and its subsequent integration into the host genome is a fundamental task in molecular biology, biotechnology and gene therapy. Here we describe an IP-free one-step method that enables stable genome integration into either prokaryotic or eukaryotic cells. A synthetic mariner transposon is generated by flanking a DNA sequence with short inverted repeats. When purified recombinant Mos1 or Mboumar-9 transposase is co-transfected with transposon-containing plasmid DNA, it penetrates prokaryotic or eukaryotic cells and integrates the target DNA into the genome. In vivo integrations by purified transposase can be achieved by electroporation, chemical transfection or Lipofection of the transposase:DNA mixture, in contrast to other published transposon-based protocols which require electroporation or microinjection. As in other transposome systems, no helper plasmids are required since transposases are not expressed inside the host cells, thus leading to generation of stable cell lines. Since it does not require electroporation or microinjection, this tool has the potential to be applied for automated high-throughput creation of libraries of random integrants for purposes including gene knock-out libraries, screening for optimal integration positions or safe genome locations in different organisms, selection of the highest production of valuable compounds for biotechnology, and sequencing. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Graph-based sequence annotation using a data integration approach
Directory of Open Access Journals (Sweden)
Pesch Robert
2008-06-01
Full Text Available The automated annotation of data from high throughput sequencing and genomics experiments is a significant challenge for bioinformatics. Most current approaches rely on sequential pipelines of gene finding and gene function prediction methods that annotate a gene with information from different reference data sources. Each function prediction method contributes evidence supporting a functional assignment. Such approaches generally ignore the links between the information in the reference datasets. These links, however, are valuable for assessing the plausibility of a function assignment and can be used to evaluate the confidence in a prediction. We are working towards a novel annotation system that uses the network of information supporting the function assignment to enrich the annotation process for use by expert curators and predicting the function of previously unannotated genes. In this paper we describe our success in the first stages of this development. We present the data integration steps that are needed to create the core database of integrated reference databases (UniProt, PFAM, PDB, GO and the pathway database Ara- Cyc which has been established in the ONDEX data integration system. We also present a comparison between different methods for integration of GO terms as part of the function assignment pipeline and discuss the consequences of this analysis for improving the accuracy of gene function annotation.
Genetic counselors' views and experiences with the clinical integration of genome sequencing.
Machini, Kalotina; Douglas, Jessica; Braxton, Alicia; Tsipis, Judith; Kramer, Kate
2014-08-01
In recent years, new sequencing technologies known as next generation sequencing (NGS) have provided scientists the ability to rapidly sequence all known coding as well as non-coding sequences in the human genome. As the two emerging approaches, whole exome (WES) and whole genome (WGS) sequencing, have started to be integrated in the clinical arena, we sought to survey health care professionals who are likely to be involved in the implementation process now and/or in the future (e.g., genetic counselors, geneticists and nurse practitioners). Two hundred twenty-one genetic counselors- one third of whom currently offer WES/WGS-participated in an anonymous online survey. The aims of the survey were first, to identify barriers to the implementation of WES/WGS, as perceived by survey participants; second, to provide the first systematic report of current practices regarding the integration of WES/WGS in clinic and/or research across the US and Canada and to illuminate the roles and challenges of genetic counselors participating in this process; and third to evaluate the impact of WES/WGS on patient care. Our results showed that genetic counseling practices with respect to WES/WGS are consistent with the criteria set forth in the ACMG 2012 policy statement, which highlights indications for testing, reporting, and pre/post test considerations. Our respondents described challenges related to offering WES/WGS, which included billing issues, the duration and content of the consent process, result interpretation and disclosure of incidental findings and variants of unknown significance. In addition, respondents indicated that specialty area (i.e., prenatal and cancer), lack of clinical utility of WES/WGS and concerns about interpretation of test results were factors that prevented them from offering this technology to patients. Finally, study participants identified the aspects of their professional training which have been most beneficial in aiding with the integration of
Reverse time migration of prism waves for salt flank delineation
Dai, Wei; Schuster, Gerard T.
2013-01-01
In this paper, we present a new reverse time migration method for imaging salt flanks with prism wave reflections. It consists of four steps: (1) migrating the seismic data with conventional RTM to give the RTM image; (2) using the RTM image as a reflectivity model to simulate source-side reflections with the Born approximation; (3) zero-lag correlation of the source-side reflection wavefields and receiver-side wavefields to produce the prism wave migration image; and (4) repeating steps 2 and 3 for the receiver-side reflections. An advantage of this method is that there is no need to pick the horizontal reflectors prior to migration of the prism waves. It also separately images the vertical structures at a different step to reduce crosstalk interference. The disadvantage of prism wave migration algorithm is that its computational cost is twice that of conventional RTM. The empirical results with a salt model suggest that prism wave migration can be an effective method for salt flank delineation in the absence of diving waves.
Reverse time migration of prism waves for salt flank delineation
Dai, Wei
2013-09-22
In this paper, we present a new reverse time migration method for imaging salt flanks with prism wave reflections. It consists of four steps: (1) migrating the seismic data with conventional RTM to give the RTM image; (2) using the RTM image as a reflectivity model to simulate source-side reflections with the Born approximation; (3) zero-lag correlation of the source-side reflection wavefields and receiver-side wavefields to produce the prism wave migration image; and (4) repeating steps 2 and 3 for the receiver-side reflections. An advantage of this method is that there is no need to pick the horizontal reflectors prior to migration of the prism waves. It also separately images the vertical structures at a different step to reduce crosstalk interference. The disadvantage of prism wave migration algorithm is that its computational cost is twice that of conventional RTM. The empirical results with a salt model suggest that prism wave migration can be an effective method for salt flank delineation in the absence of diving waves.
Forests of the tropical eastern Andean flank during the middle Pleistocene
Cárdenas, M.L.; Gosling, W.D.; Pennington, R.T.; Poole, I.; Sherlock, S.C.; Mothes, P.
2014-01-01
Inter-bedded volcanic and organic sediments from Erazo (Ecuador) indicate the presence of four different forest assemblages on the eastern Andean flank during the middle Pleistocene. Radiometric dates (40Ar-39Ar) obtained from the volcanic ash indicate that deposition occurred between 620,000 and
Arce, José Luis; Macías, Rodolfo; García Palomo, Armando; Capra, Lucia; Macías, José Luis; Layer, Paul; Rueda, Hernando
2008-11-01
Zempoala is an extinct Pleistocene (˜ 0.7-0.8 Ma) stratovolcano that together with La Corona volcano (˜ 0.9 Ma) forms the southern end of the Sierra de las Cruces volcanic range, Central Mexico. The volcano consists of andesitic and dacitic lava flows and domes, as well as pyroclastic and epiclastic sequences, and has had a complex history with several flank collapses. One of these collapses occurred during the late Pleistocene on the S-SE flank of the volcano and produced the Zempoala debris avalanche deposit. This collapse could have been triggered by the reactivation of two normal fault systems (E-W and NE-SW), although magmatic activity cannot be absolutely excluded. The debris avalanche traveled 60 km to the south, covers an area of 600 km 2 and has a total volume of 6 km 3, with a calculated Heim coefficient (H/L) of 0.03. Based on the textural characteristics of the deposit we recognized three zones: proximal, axial, and lateral distal zone. The proximal zone consists of debris avalanche blocks that develop a hummocky topography; the axial zone corresponds with the main debris avalanche deposit made of large clasts set in a sandy matrix, which transformed to a debris flow in the lateral distal portion. The deposit is heterolithologic in composition, with dacitic and andesitic fragments from the old edifice that decrease in volume as bulking of exotic clasts from the substratum increase. Several cities (Cuernavaca, Jojutla de Juárez, Alpuyeca) with associated industrial, agricultural, and tourism activities have been built on the deposit, which pose in evidence the possible impact in case of a new event with such characteristics, since the area is still tectonically active.
NATO’s Northeastern Flank: Emerging Opportunities for Engagement
2017-01-01
escalation concerns. Engagement should also stress the importance of Polish support for and capabilities toward addressing NATO’s southern flank...in their response to the Ukraine crisis.8 Some countries are either cowed by the Russian threat or genuinely less concerned about it than might be...no small part due to Hungary’s dependence on Russian gas exports, which heat the homes of most Hungarians. It is also, however, due to political
Focused seismicity triggered by flank instability on Kīlauea's Southwest Rift Zone
Judson, Josiah; Thelen, Weston A.; Greenfield, Tim; White, Robert S.
2018-03-01
Swarms of earthquakes at the head of the Southwest Rift Zone on Kīlauea Volcano, Hawai´i, reveal an interaction of normal and strike-slip faulting associated with movement of Kīlauea's south flank. A relocated subset of earthquakes between January 2012 and August 2014 are highly focused in space and time at depths that are coincident with the south caldera magma reservoir beneath the southern margin of Kīlauea Caldera. Newly calculated focal mechanisms are dominantly dextral shear with a north-south preferred fault orientation. Two earthquakes within this focused area of seismicity have normal faulting mechanisms, indicating two mechanisms of failure in very close proximity (10's of meters to 100 m). We suggest a model where opening along the Southwest Rift Zone caused by seaward motion of the south flank permits injection of magma and subsequent freezing of a plug, which then fails in a right-lateral strike-slip sense, consistent with the direction of movement of the south flank. The seismicity is concentrated in an area where a constriction occurs between a normal fault and the deeper magma transport system into the Southwest Rift Zone. Although in many ways the Southwest Rift Zone appears analogous to the more active East Rift Zone, the localization of the largest seismicity (>M2.5) within the swarms to a small volume necessitates a different model than has been proposed to explain the lineament outlined by earthquakes along the East Rift Zone.
Magnocellular involvement in flanked-letter identification relates to the allocation of attention
Omtzigt, D.; Hendriks, A.W.C.J.
2004-01-01
To verify the hypothesis that the magnocellular system is important to flanked-letter identification [Neuropsychologia 40 (2002) 1881] because it subserves attention allocation, we conducted three letter-naming experiments in which we manipulated magnocellular involvement (colour vs. luminance
BioVLAB-MMIA-NGS: microRNA-mRNA integrated analysis using high-throughput sequencing data.
Chae, Heejoon; Rhee, Sungmin; Nephew, Kenneth P; Kim, Sun
2015-01-15
It is now well established that microRNAs (miRNAs) play a critical role in regulating gene expression in a sequence-specific manner, and genome-wide efforts are underway to predict known and novel miRNA targets. However, the integrated miRNA-mRNA analysis remains a major computational challenge, requiring powerful informatics systems and bioinformatics expertise. The objective of this study was to modify our widely recognized Web server for the integrated mRNA-miRNA analysis (MMIA) and its subsequent deployment on the Amazon cloud (BioVLAB-MMIA) to be compatible with high-throughput platforms, including next-generation sequencing (NGS) data (e.g. RNA-seq). We developed a new version called the BioVLAB-MMIA-NGS, deployed on both Amazon cloud and on a high-performance publicly available server called MAHA. By using NGS data and integrating various bioinformatics tools and databases, BioVLAB-MMIA-NGS offers several advantages. First, sequencing data is more accurate than array-based methods for determining miRNA expression levels. Second, potential novel miRNAs can be detected by using various computational methods for characterizing miRNAs. Third, because miRNA-mediated gene regulation is due to hybridization of an miRNA to its target mRNA, sequencing data can be used to identify many-to-many relationship between miRNAs and target genes with high accuracy. http://epigenomics.snu.ac.kr/biovlab_mmia_ngs/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Bourras, Salim; Meyer, Michel; Grandaubert, Jonathan; Lapalu, Nicolas; Fudal, Isabelle; Linglin, Juliette; Ollivier, Benedicte; Blaise, Françoise; Balesdent, Marie-Hélène; Rouxel, Thierry
2012-08-01
The ever-increasing generation of sequence data is accompanied by unsatisfactory functional annotation, and complex genomes, such as those of plants and filamentous fungi, show a large number of genes with no predicted or known function. For functional annotation of unknown or hypothetical genes, the production of collections of mutants using Agrobacterium tumefaciens-mediated transformation (ATMT) associated with genotyping and phenotyping has gained wide acceptance. ATMT is also widely used to identify pathogenicity determinants in pathogenic fungi. A systematic analysis of T-DNA borders was performed in an ATMT-mutagenized collection of the phytopathogenic fungus Leptosphaeria maculans to evaluate the features of T-DNA integration in its particular transposable element-rich compartmentalized genome. A total of 318 T-DNA tags were recovered and analyzed for biases in chromosome and genic compartments, existence of CG/AT skews at the insertion site, and occurrence of microhomologies between the T-DNA left border (LB) and the target sequence. Functional annotation of targeted genes was done using the Gene Ontology annotation. The T-DNA integration mainly targeted gene-rich, transcriptionally active regions, and it favored biological processes consistent with the physiological status of a germinating spore. T-DNA integration was strongly biased toward regulatory regions, and mainly promoters. Consistent with the T-DNA intranuclear-targeting model, the density of T-DNA insertion correlated with CG skew near the transcription initiation site. The existence of microhomologies between promoter sequences and the T-DNA LB flanking sequence was also consistent with T-DNA integration to host DNA mediated by homologous recombination based on the microhomology-mediated end-joining pathway.
Biophysical properties of regions flanking the bHLH-Zip motif in the p22 Max protein
International Nuclear Information System (INIS)
Pursglove, Sharon E.; Fladvad, Malin; Bellanda, Massimo; Moshref, Ahmad; Henriksson, Marie; Carey, Jannette; Sunnerhagen, Maria
2004-01-01
The Max protein is the central dimerization partner in the Myc-Max-Mad network of transcriptional regulators, and a founding structural member of the family of basic-helix-loop-helix (bHLH)-leucine zipper (Zip) proteins. Biologically important regions flanking its bHLH-Zip motif have been disordered or absent in crystal structures. The present study shows that these regions are resistant to proteolysis in both the presence and absence of DNA, and that Max dimers containing both flanking regions have significantly higher helix content as measured by circular dichroism than that predicted from the crystal structures. Nuclear magnetic resonance measurements in the absence of DNA also support the inferred structural order. Deletion of both flanking regions is required to achieve maximal DNA affinity as measured by EMSA. Thus, the previously observed functionalities of these Max regions in DNA binding, phosphorylation, and apoptosis are suggested to be linked to structural properties
Stress-induced rearrangement of Fusarium retrotransposon sequences.
Anaya, N; Roncero, M I
1996-11-27
Rearrangement of fusarium oxysporum retrotransposon skippy was induced by growth in the presence of potassium chlorate. Three fungal strains, one sensitive to chlorate (Co60) and two resistant to chlorate and deficient for nitrate reductase (Co65 and Co94), were studied by Southern analysis of their genomic DNA. Polymorphism was detected in their hybridization banding pattern, relative to the wild type grown in the absence of chlorate, using various enzymes with or without restriction sites within the retrotransposon. Results were consistent with the assumption that three different events had occurred in strain Co60: genomic amplification of skippy yielding tandem arrays of the element, generation of new skippy sequences, and deletion of skippy sequences. Amplification of Co60 genomic DNA using the polymerase chain reaction and divergent primers derived from the retrotransposon generated a new band, corresponding to one long terminal repeat plus flanking sequences, that was not present in the wild-type strain. Molecular analysis of nitrate reductase-deficient mutants showed that generation and deletion of skippy sequences, but not genomic amplification in tandem repeats, had occurred in their genomes.
Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya
2011-01-01
To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533
Kosinski, Jan; Barbato, Alessandro; Tramontano, Anna
2013-01-01
SUMMARY: MODexplorer is an integrated tool aimed at exploring the sequence, structural and functional diversity in protein families useful in homology modeling and in analyzing protein families in general. It takes as input either the sequence or the structure of a protein and provides alignments with its homologs along with a variety of structural and functional annotations through an interactive interface. The annotations include sequence conservation, similarity scores, ligand-, DNA- and RNA-binding sites, secondary structure, disorder, crystallographic structure resolution and quality scores of models implied by the alignments to the homologs of known structure. MODexplorer can be used to analyze sequence and structural conservation among the structures of similar proteins, to find structures of homologs solved in different conformational state or with different ligands and to transfer functional annotations. Furthermore, if the structure of the query is not known, MODexplorer can be used to select the modeling templates taking all this information into account and to build a comparative model. AVAILABILITY AND IMPLEMENTATION: Freely available on the web at http://modorama.biocomputing.it/modexplorer. Website implemented in HTML and JavaScript with all major browsers supported. SUPPLEMENTARY INFORMATION: Supplementary data are available at Bioinformatics online.
Kosinski, Jan
2013-02-08
SUMMARY: MODexplorer is an integrated tool aimed at exploring the sequence, structural and functional diversity in protein families useful in homology modeling and in analyzing protein families in general. It takes as input either the sequence or the structure of a protein and provides alignments with its homologs along with a variety of structural and functional annotations through an interactive interface. The annotations include sequence conservation, similarity scores, ligand-, DNA- and RNA-binding sites, secondary structure, disorder, crystallographic structure resolution and quality scores of models implied by the alignments to the homologs of known structure. MODexplorer can be used to analyze sequence and structural conservation among the structures of similar proteins, to find structures of homologs solved in different conformational state or with different ligands and to transfer functional annotations. Furthermore, if the structure of the query is not known, MODexplorer can be used to select the modeling templates taking all this information into account and to build a comparative model. AVAILABILITY AND IMPLEMENTATION: Freely available on the web at http://modorama.biocomputing.it/modexplorer. Website implemented in HTML and JavaScript with all major browsers supported. SUPPLEMENTARY INFORMATION: Supplementary data are available at Bioinformatics online.
Flank wear analysing of high speed end milling for hardened steel D2 using Taguchi Method
Hazza Faizi Al-Hazza, Muataz; Ibrahim, Nur Asmawiyah bt; Adesta, Erry T. Y.; Khan, Ahsan Ali; Abdullah Sidek, Atiah Bt.
2017-03-01
One of the main challenges for any manufacturer is how to decrease the machining cost without affecting the final quality of the product. One of the new advanced machining processes in industry is the high speed hard end milling process that merges three advanced machining processes: high speed milling, hard milling and dry milling. However, one of the most important challenges in this process is to control the flank wear rate. Therefore a analyzing the flank wear rate during machining should be investigated in order to determine the best cutting levels that will not affect the final quality of the product. In this research Taguchi method has been used to investigate the effect of cutting speed, feed rate and depth of cut and determine the best level s to minimize the flank wear rate up to total length of 0.3mm based on the ISO standard to maintain the finishing requirements.
Binning sequences using very sparse labels within a metagenome
Directory of Open Access Journals (Sweden)
Halgamuge Saman K
2008-04-01
Full Text Available Abstract Background In metagenomic studies, a process called binning is necessary to assign contigs that belong to multiple species to their respective phylogenetic groups. Most of the current methods of binning, such as BLAST, k-mer and PhyloPythia, involve assigning sequence fragments by comparing sequence similarity or sequence composition with already-sequenced genomes that are still far from comprehensive. We propose a semi-supervised seeding method for binning that does not depend on knowledge of completed genomes. Instead, it extracts the flanking sequences of highly conserved 16S rRNA from the metagenome and uses them as seeds (labels to assign other reads based on their compositional similarity. Results The proposed seeding method is implemented on an unsupervised Growing Self-Organising Map (GSOM, and called Seeded GSOM (S-GSOM. We compared it with four well-known semi-supervised learning methods in a preliminary test, separating random-length prokaryotic sequence fragments sampled from the NCBI genome database. We identified the flanking sequences of the highly conserved 16S rRNA as suitable seeds that could be used to group the sequence fragments according to their species. S-GSOM showed superior performance compared to the semi-supervised methods tested. Additionally, S-GSOM may also be used to visually identify some species that do not have seeds. The proposed method was then applied to simulated metagenomic datasets using two different confidence threshold settings and compared with PhyloPythia, k-mer and BLAST. At the reference taxonomic level Order, S-GSOM outperformed all k-mer and BLAST results and showed comparable results with PhyloPythia for each of the corresponding confidence settings, where S-GSOM performed better than PhyloPythia in the ≥ 10 reads datasets and comparable in the ≥ 8 kb benchmark tests. Conclusion In the task of binning using semi-supervised learning methods, results indicate S-GSOM to be the best of
Sequence-indexed mutations in maize using the UniformMu transposon-tagging population
Directory of Open Access Journals (Sweden)
Baier John
2007-05-01
Full Text Available Abstract Background Gene knockouts are a critical resource for functional genomics. In Arabidopsis, comprehensive knockout collections were generated by amplifying and sequencing genomic DNA flanking insertion mutants. These Flanking Sequence Tags (FSTs map each mutant to a specific locus within the genome. In maize, FSTs have been generated using DNA transposons. Transposable elements can generate unstable insertions that are difficult to analyze for simple knockout phenotypes. Transposons can also generate somatic insertions that fail to segregate in subsequent generations. Results Transposon insertion sites from 106 UniformMu FSTs were tested for inheritance by locus-specific PCR. We confirmed 89% of the FSTs to be germinal transposon insertions. We found no evidence for somatic insertions within the 11% of insertion sites that were not confirmed. Instead, this subset of insertion sites had errors in locus-specific primer design due to incomplete or low-quality genomic sequences. The locus-specific PCR assays identified a knockout of a 6-phosphogluconate dehydrogenase gene that co-segregates with a seed mutant phenotype. The mutant phenotype linked to this knockout generates novel hypotheses about the role for the plastid-localized oxidative pentose phosphate pathway during grain-fill. Conclusion We show that FSTs from the UniformMu population identify stable, germinal insertion sites in maize. Moreover, we show that these sequence-indexed mutations can be readily used for reverse genetic analysis. We conclude from these data that the current collection of 1,882 non-redundant insertion sites from UniformMu provide a genome-wide resource for reverse genetics.
PIMS sequencing extension: a laboratory information management system for DNA sequencing facilities
Directory of Open Access Journals (Sweden)
Baldwin Stephen A
2011-03-01
Full Text Available Abstract Background Facilities that provide a service for DNA sequencing typically support large numbers of users and experiment types. The cost of services is often reduced by the use of liquid handling robots but the efficiency of such facilities is hampered because the software for such robots does not usually integrate well with the systems that run the sequencing machines. Accordingly, there is a need for software systems capable of integrating different robotic systems and managing sample information for DNA sequencing services. In this paper, we describe an extension to the Protein Information Management System (PIMS that is designed for DNA sequencing facilities. The new version of PIMS has a user-friendly web interface and integrates all aspects of the sequencing process, including sample submission, handling and tracking, together with capture and management of the data. Results The PIMS sequencing extension has been in production since July 2009 at the University of Leeds DNA Sequencing Facility. It has completely replaced manual data handling and simplified the tasks of data management and user communication. Samples from 45 groups have been processed with an average throughput of 10000 samples per month. The current version of the PIMS sequencing extension works with Applied Biosystems 3130XL 96-well plate sequencer and MWG 4204 or Aviso Theonyx liquid handling robots, but is readily adaptable for use with other combinations of robots. Conclusions PIMS has been extended to provide a user-friendly and integrated data management solution for DNA sequencing facilities that is accessed through a normal web browser and allows simultaneous access by multiple users as well as facility managers. The system integrates sequencing and liquid handling robots, manages the data flow, and provides remote access to the sequencing results. The software is freely available, for academic users, from http://www.pims-lims.org/.
PIMS sequencing extension: a laboratory information management system for DNA sequencing facilities.
Troshin, Peter V; Postis, Vincent Lg; Ashworth, Denise; Baldwin, Stephen A; McPherson, Michael J; Barton, Geoffrey J
2011-03-07
Facilities that provide a service for DNA sequencing typically support large numbers of users and experiment types. The cost of services is often reduced by the use of liquid handling robots but the efficiency of such facilities is hampered because the software for such robots does not usually integrate well with the systems that run the sequencing machines. Accordingly, there is a need for software systems capable of integrating different robotic systems and managing sample information for DNA sequencing services. In this paper, we describe an extension to the Protein Information Management System (PIMS) that is designed for DNA sequencing facilities. The new version of PIMS has a user-friendly web interface and integrates all aspects of the sequencing process, including sample submission, handling and tracking, together with capture and management of the data. The PIMS sequencing extension has been in production since July 2009 at the University of Leeds DNA Sequencing Facility. It has completely replaced manual data handling and simplified the tasks of data management and user communication. Samples from 45 groups have been processed with an average throughput of 10000 samples per month. The current version of the PIMS sequencing extension works with Applied Biosystems 3130XL 96-well plate sequencer and MWG 4204 or Aviso Theonyx liquid handling robots, but is readily adaptable for use with other combinations of robots. PIMS has been extended to provide a user-friendly and integrated data management solution for DNA sequencing facilities that is accessed through a normal web browser and allows simultaneous access by multiple users as well as facility managers. The system integrates sequencing and liquid handling robots, manages the data flow, and provides remote access to the sequencing results. The software is freely available, for academic users, from http://www.pims-lims.org/.
International Nuclear Information System (INIS)
Takada, Shinako; Koike, Katsuro
1990-01-01
To investigate the expression and transactivation function of the X gene in integrated hepatitis B virus (HBV) DNA from chronic hepatitis tissues, a series of transfectants containing cloned integrated HBV DNAs was made and analyzed for X mRNA expression and trans-activation activity by using a chloramphenicol acetyltransferase assay. Most of the integrated HBV DNAs expressed X mRNA and encoded a product with trans-activation activity in spite of the loss of the 3' end region of the X gene due to integration. From cDNA cloning and sequence analysis of X mRNA transcribed from native or integrated HBV DNA, the X protein was found to be translated from the X open reading frame without splicing. For integrated HBV DNA, transcription was extended to a cellular flanking DNA and an X gene-cell fusion transcript was terminated by using a cellular poly(A) signal. The amino acid sequence deduced from an X-cell fusion transcript indicated truncation of the carboxyl-terminal five amino acids, but the upstream region of seven amino acids conserved among hepadnaviruses was retained in the integrated HBV DNA, suggesting that this conserved region is essential for the transactivation function of the X protein. These findings support the following explanation for hepatocarcinogenesis by HBV DNA integration: the expression of a cellular oncogene(s) is transactivated at the time of chronic infection by the increasing amounts of the integrated HBV gene product(s), such as the X-cell fusion product
Energy Technology Data Exchange (ETDEWEB)
Kyllo, J.H.; Collins, M.M.; Vetter, K.L. [Univ. of Iowa College of Medicine, Iowa City, IA (United States)] [and others
1996-03-29
Genetic screening techniques using simple sequence repeat polymorphisms were applied to investigate the molecular nature of congenital isolated adrenocorticotropic hormone (ACTH) deficiency. We hypothesize that this rare cause of hypocortisolism shared by a brother and sister with two unaffected sibs and unaffected parents is inherited as an autosomal recessive single gene mutation. Genes involved in the hypothalamic-pituitary axis controlling cortisol sufficiency were investigated for a causal role in this disorder. Southern blotting showed no detectable mutations of the gene encoding pro-opiomelanocortin (POMC), the ACTH precursor. Other candidate genes subsequently considered were those encoding neuroendocrine convertase-1, and neuroendocrine convertase-2 (NEC-1, NEC-2), and corticotropin releasing hormone (CRH). Tests for linkage were performed using polymorphic di- and tetranucleotide simple sequence repeat markers flanking the reported map locations for POMC, NEC-1, NEC-2, and CRH. The chromosomal haplotypes determined by the markers flanking the loci for POMC, NEC-1, and NEC-2 were not compatible with linkage. However, 22 individual markers defining the chromosomal haplotypes flanking CRH were compatible with linkage of the disorder to the immediate area of this gene of chromosome 8. Based on these data, we hypothesize that the ACTH deficiency in this family is due to an abnormality of CRH gene structure or expression. These results illustrate the useful application of high density genetic maps constructed with simple sequence repeat markers for inclusion/exclusion studies of candidate genes in even very small nuclear families segregating for unusual phenotypes. 25 refs., 5 figs., 2 tabs.
Ehrhardt, C. J.; Haymon, R.; Holden, P.; Lamontagne, M.
2003-12-01
Although heat flow studies suggest that ~70% of the hydrothermal heat loss in the oceans occurs in the abyssal hill terrain on the flanks of mid-ocean ridges, very few off-axis hydrothermal sites have been discovered. In May 2002, sedimentary blowout structures of probable hydrothermal origin were discovered along East Pacific Rise at 9° 27'N on an off-axis abyssal hill bounded by a fault scarp covered with orange-brown microbial flocculations. Recovered samples of these flocculations have presented an opportunity to study the unknown nature and role of thermophilic and hyperthermophilic microbial communities on the ridge flanks. Furthermore, the archaeal communities that we have identified in the samples are useful "microbial tracers" which can be used to locate off-axis areas of moderate-to-high temperature fluid flow (>50° C). In this study, we used molecular techniques to isolate, amplify, and sequence community archaeal RNA sequences from fault scarp flocculations collected with a slurp pump system mounted in the Alvin basket. Molecular phylogenies based on 16S rRNA were constructed. Phylogenetic relationships of isolated clones were used to infer temperature preferences of archaeal communities. We identified 12 clones that clustered within thermophilic or hyperthermophilic clades within Archaea suggesting that moderately high temperature fluid (>50° C) exited the seafloor along this abyssal hill fault scarp. Our studies also suggest that these communities mediate the formation of Fe-sulfide mineral phases. Analysis of the samples with an Environmental Scanning Electron Microscope (ESEM) and X-ray energy dispersive analysis (EDS) revealed unique iron sulfide mineral phases with anomalously low Fe/S ratios in direct association with microbial communities.
3D FEM Simulation of Flank Wear in Turning
Attanasio, Aldo; Ceretti, Elisabetta; Giardini, Claudio
2011-05-01
This work deals with tool wear simulation. Studying the influence of tool wear on tool life, tool substitution policy and influence on final part quality, surface integrity, cutting forces and power consumption it is important to reduce the global process costs. Adhesion, abrasion, erosion, diffusion, corrosion and fracture are some of the phenomena responsible of the tool wear depending on the selected cutting parameters: cutting velocity, feed rate, depth of cut, …. In some cases these wear mechanisms are described by analytical models as a function of process variables (temperature, pressure and sliding velocity along the cutting surface). These analytical models are suitable to be implemented in FEM codes and they can be utilized to simulate the tool wear. In the present paper a commercial 3D FEM software has been customized to simulate the tool wear during turning operations when cutting AISI 1045 carbon steel with uncoated tungsten carbide tip. The FEM software was improved by means of a suitable subroutine able to modify the tool geometry on the basis of the estimated tool wear as the simulation goes on. Since for the considered couple of tool-workpiece material the main phenomena generating wear are the abrasive and the diffusive ones, the tool wear model implemented into the subroutine was obtained as combination between the Usui's and the Takeyama and Murata's models. A comparison between experimental and simulated flank tool wear curves is reported demonstrating that it is possible to simulate the tool wear development.
Liang, Chun; Wang, Gang; Liu, Lin; Ji, Guoli; Fang, Lin; Liu, Yuansheng; Carter, Kikia; Webb, Jason S; Dean, Jeffrey F D
2007-05-29
With the advent of low-cost, high-throughput sequencing, the amount of public domain Expressed Sequence Tag (EST) sequence data available for both model and non-model organism is growing exponentially. While these data are widely used for characterizing various genomes, they also present a serious challenge for data quality control and validation due to their inherent deficiencies, particularly for species without genome sequences. ConiferEST is an integrated system for data reprocessing, visualization and mining of conifer ESTs. In its current release, Build 1.0, it houses 172,229 loblolly pine EST sequence reads, which were obtained from reprocessing raw DNA sequencer traces using our software--WebTraceMiner. The trace files were downloaded from NCBI Trace Archive. ConiferEST provides biologists unique, easy-to-use data visualization and mining tools for a variety of putative sequence features including cloning vector segments, adapter sequences, restriction endonuclease recognition sites, polyA and polyT runs, and their corresponding Phred quality values. Based on these putative features, verified sequence features such as 3' and/or 5' termini of cDNA inserts in either sense or non-sense strand have been identified in-silico. Interestingly, only 30.03% of the designated 3' ESTs were found to have an authenticated 5' terminus in the non-sense strand (i.e., polyT tails), while fewer than 5.34% of the designated 5' ESTs had a verified 5' terminus in the sense strand. Such previously ignored features provide valuable insight for data quality control and validation of error-prone ESTs, as well as the ability to identify novel functional motifs embedded in large EST datasets. We found that "double-termini adapters" were effective indicators of potential EST chimeras. For all sequences with in-silico verified termini/terminus, we used InterProScan to assign protein domain signatures, results of which are available for in-depth exploration using our biologist
Directory of Open Access Journals (Sweden)
Carter Kikia
2007-05-01
Full Text Available Abstract Background With the advent of low-cost, high-throughput sequencing, the amount of public domain Expressed Sequence Tag (EST sequence data available for both model and non-model organism is growing exponentially. While these data are widely used for characterizing various genomes, they also present a serious challenge for data quality control and validation due to their inherent deficiencies, particularly for species without genome sequences. Description ConiferEST is an integrated system for data reprocessing, visualization and mining of conifer ESTs. In its current release, Build 1.0, it houses 172,229 loblolly pine EST sequence reads, which were obtained from reprocessing raw DNA sequencer traces using our software – WebTraceMiner. The trace files were downloaded from NCBI Trace Archive. ConiferEST provides biologists unique, easy-to-use data visualization and mining tools for a variety of putative sequence features including cloning vector segments, adapter sequences, restriction endonuclease recognition sites, polyA and polyT runs, and their corresponding Phred quality values. Based on these putative features, verified sequence features such as 3' and/or 5' termini of cDNA inserts in either sense or non-sense strand have been identified in-silico. Interestingly, only 30.03% of the designated 3' ESTs were found to have an authenticated 5' terminus in the non-sense strand (i.e., polyT tails, while fewer than 5.34% of the designated 5' ESTs had a verified 5' terminus in the sense strand. Such previously ignored features provide valuable insight for data quality control and validation of error-prone ESTs, as well as the ability to identify novel functional motifs embedded in large EST datasets. We found that "double-termini adapters" were effective indicators of potential EST chimeras. For all sequences with in-silico verified termini/terminus, we used InterProScan to assign protein domain signatures, results of which are available
2012-01-01
Background The complete sequences of chloroplast genomes provide wealthy information regarding the evolutionary history of species. With the advance of next-generation sequencing technology, the number of completely sequenced chloroplast genomes is expected to increase exponentially, powerful computational tools annotating the genome sequences are in urgent need. Results We have developed a web server CPGAVAS. The server accepts a complete chloroplast genome sequence as input. First, it predicts protein-coding and rRNA genes based on the identification and mapping of the most similar, full-length protein, cDNA and rRNA sequences by integrating results from Blastx, Blastn, protein2genome and est2genome programs. Second, tRNA genes and inverted repeats (IR) are identified using tRNAscan, ARAGORN and vmatch respectively. Third, it calculates the summary statistics for the annotated genome. Fourth, it generates a circular map ready for publication. Fifth, it can create a Sequin file for GenBank submission. Last, it allows the extractions of protein and mRNA sequences for given list of genes and species. The annotation results in GFF3 format can be edited using any compatible annotation editing tools. The edited annotations can then be uploaded to CPGAVAS for update and re-analyses repeatedly. Using known chloroplast genome sequences as test set, we show that CPGAVAS performs comparably to another application DOGMA, while having several superior functionalities. Conclusions CPGAVAS allows the semi-automatic and complete annotation of a chloroplast genome sequence, and the visualization, editing and analysis of the annotation results. It will become an indispensible tool for researchers studying chloroplast genomes. The software is freely accessible from http://www.herbalgenomics.org/cpgavas. PMID:23256920
Directory of Open Access Journals (Sweden)
Liu Chang
2012-12-01
Full Text Available Abstract Background The complete sequences of chloroplast genomes provide wealthy information regarding the evolutionary history of species. With the advance of next-generation sequencing technology, the number of completely sequenced chloroplast genomes is expected to increase exponentially, powerful computational tools annotating the genome sequences are in urgent need. Results We have developed a web server CPGAVAS. The server accepts a complete chloroplast genome sequence as input. First, it predicts protein-coding and rRNA genes based on the identification and mapping of the most similar, full-length protein, cDNA and rRNA sequences by integrating results from Blastx, Blastn, protein2genome and est2genome programs. Second, tRNA genes and inverted repeats (IR are identified using tRNAscan, ARAGORN and vmatch respectively. Third, it calculates the summary statistics for the annotated genome. Fourth, it generates a circular map ready for publication. Fifth, it can create a Sequin file for GenBank submission. Last, it allows the extractions of protein and mRNA sequences for given list of genes and species. The annotation results in GFF3 format can be edited using any compatible annotation editing tools. The edited annotations can then be uploaded to CPGAVAS for update and re-analyses repeatedly. Using known chloroplast genome sequences as test set, we show that CPGAVAS performs comparably to another application DOGMA, while having several superior functionalities. Conclusions CPGAVAS allows the semi-automatic and complete annotation of a chloroplast genome sequence, and the visualization, editing and analysis of the annotation results. It will become an indispensible tool for researchers studying chloroplast genomes. The software is freely accessible from http://www.herbalgenomics.org/cpgavas.
Persistence Probabilities of Two-Sided (Integrated) Sums of Correlated Stationary Gaussian Sequences
Aurzada, Frank; Buck, Micha
2018-02-01
We study the persistence probability for some two-sided, discrete-time Gaussian sequences that are discrete-time analogues of fractional Brownian motion and integrated fractional Brownian motion, respectively. Our results extend the corresponding ones in continuous time in Molchan (Commun Math Phys 205(1):97-111, 1999) and Molchan (J Stat Phys 167(6):1546-1554, 2017) to a wide class of discrete-time processes.
Pancreatic Tail Cancer with Sole Manifestation of Left Flank Pain: A Very Rare Presentation
Directory of Open Access Journals (Sweden)
Hsing-Lin Lin
2008-06-01
Full Text Available Pancreatic cancer is sometimes called a “silent disease” because it often causes no symptoms in the early stage. The symptoms can be quite vague and various depending on the location of cancer in the pancreas. The anatomic site distribution is 78% in the head of the pancreas, 11% in the body, and 11% in the tail. Pancreatic cancer is rarely detected in the early stage, and it is very uncommon to diagnose pancreatic tail cancer during an emergency department visit. The manifestation of pancreatic tail cancer as left flank pain is very rare and has seldom been identified in the literature. We present a case of pancreatic tail cancer with the sole manifestation of dull left flank pain. Having negative findings on an ultrasound study initially, this female patient was misdiagnosed as having possible acute gastritis, urolithiasis or muscle strain after she received gastroendoscopy and colonofiberscopy. Her symptoms persisted for several months and she visited our emergency department due to an acute exacerbation of a persistent dull pain in the left flank area. Radiographic evaluation with computed tomography was performed, and pancreatic tail tumor with multiple metastases was found unexpectedly. We review the literature and discuss this rare presentation of pancreatic tail cancer.
An unusual manifestation of acute appendicitis with left flank pain
Directory of Open Access Journals (Sweden)
Roland Talanow, MD, PhD
2008-08-01
Full Text Available The author presents a case with an unusual presentation of early appendicitis. The patient presented initially with left sided flank pain. Workup for nephrolithiasis, including non-contrast CT of the abdomen and pelvis was negative for renal stones or hydronephrosis. After discharge, the patient presented one week later in the ED with right lower quadrant pain. Contrast enhanced CT of the abdomen revealed perforated appendicitis.
International Nuclear Information System (INIS)
Agrawal, Vikash; Shahjad; Bhardwaj, Dinesh; Bhargav, Ranoo; Sharma, Gauri Datt; Bhardwaj, Ramil Kumar; Patra, Asit; Chand, Suresh
2016-01-01
Highlights: • Biselenophene-flanked 3,4-ethylenedioxythiophene polymer films were obtained by electrochemical polymerization. • Supporting electrolyte has significant effect on the doping level, whereas electropolymerized solvent has a major effect on morphology of the polymer films. • Optoelectronic properties and morphology of the electropolymerized films were studied. • Density functional theory (DFT) calculation has been made for optoelectronic properties. - Abstract: Biselenophene-flanked 3,4-ethylenedioxythiophene (EDOT) based polymer films were obtained by electrochemical polymerization. The effects of polymerization conditions such as supporting electrolytes and solvents on doping level, optical property and morphology of the polymer films were systematically studied. Interestingly, we found that polymer prepared by using different supporting electrolytes (TBAPF 6 , TBABF 4 and TBAClO 4 ) has significant effects on the doping level of the polymer films, whereas electropolymerized solvents (acetonitrile and dichloromethane) has no such effects on doping level. The polymer films show reversible dedoping and doping behavior upon treatment with hydrazine hydrate and iodine respectively. Biselenophene-flanked EDOT polymer shows a band gap of about 1.6 eV which is comparable to poly(3,4- ethylenedioxythiophene) (PEDOT) and parent polyselenophene, whereas fine-tuning of HOMO and LUMO energy levels has been found. In contrast, we observed that electropolymerized solvent has a major effect on morphology of the polymer films, while supporting electrolyte has very minor effects on the morphology. The surface morphologies of the polymer films were characterized by scanning electron microscope (SEM) and atomic force microscope (AFM) techniques. We also present an efficient synthesis of bisthiophene-flanked bridged EDOT (ETTE), and biselenophene-flanked bridged EDOT (ESeSeE), and their electrochemical polymerization, characterizations and throughout comparison
Mia, Mozammel; Al Bashir, Mahmood; Dhar, Nikhil Ranjan
2016-10-01
Hard turning is increasingly employed in machining, lately, to replace time-consuming conventional turning followed by grinding process. An excessive amount of tool wear in hard turning is one of the main hurdles to be overcome. Many researchers have developed tool wear model, but most of them developed it for a particular work-tool-environment combination. No aggregate model is developed that can be used to predict the amount of principal flank wear for specific machining time. An empirical model of principal flank wear (VB) has been developed for the different hardness of workpiece (HRC40, HRC48 and HRC56) while turning by coated carbide insert with different configurations (SNMM and SNMG) under both dry and high pressure coolant conditions. Unlike other developed model, this model includes the use of dummy variables along with the base empirical equation to entail the effect of any changes in the input conditions on the response. The base empirical equation for principal flank wear is formulated adopting the Exponential Associate Function using the experimental results. The coefficient of dummy variable reflects the shifting of the response from one set of machining condition to another set of machining condition which is determined by simple linear regression. The independent cutting parameters (speed, rate, depth of cut) are kept constant while formulating and analyzing this model. The developed model is validated with different sets of machining responses in turning hardened medium carbon steel by coated carbide inserts. For any particular set, the model can be used to predict the amount of principal flank wear for specific machining time. Since the predicted results exhibit good resemblance with experimental data and the average percentage error is <10 %, this model can be used to predict the principal flank wear for stated conditions.
Directory of Open Access Journals (Sweden)
Alexander B. Opoku-Acheampong
2016-01-01
Full Text Available Saw palmetto supplements (SPS are commonly consumed by men with prostate cancer. We investigated whether SPS fatty acids and phytosterols concentrations determine their growth-inhibitory action in androgen-sensitive LNCaP cells and hamster flank organs. High long-chain fatty acids-low phytosterols (HLLP SPS ≥ 750 nM with testosterone significantly increased and ≥500 nM with dihydrotestosterone significantly decreased LNCaP cell number. High long-chain fatty acids-high phytosterols (HLHP SPS ≥ 500 nM with dihydrotestosterone and high medium-chain fatty acids-low phytosterols (HMLP SPS ≥ 750 nM or with androgens significantly decreased LNCaP cell number (n=3; p<0.05. Five- to six-week-old, castrated male Syrian hamsters were randomized to control (n=4, HLLP, HLHP, and HMLP SPS (n=6 groups. Testosterone or dihydrotestosterone was applied topically daily for 21 days to the right flank organ; the left flank organ was treated with ethanol and served as the control. Thirty minutes later, SPS or ethanol was applied to each flank organ in treatment and control groups, respectively. SPS treatments caused a notable but nonsignificant reduction in the difference between left and right flank organ growth in testosterone-treated SPS groups compared to the control. The same level of inhibition was not seen in dihydrotestosterone-treated SPS groups (p<0.05. Results may suggest that SPS inhibit 5α-reductase thereby preventing hamster flank organ growth.
Opoku-Acheampong, Alexander B; Penugonda, Kavitha; Lindshield, Brian L
2016-01-01
Saw palmetto supplements (SPS) are commonly consumed by men with prostate cancer. We investigated whether SPS fatty acids and phytosterols concentrations determine their growth-inhibitory action in androgen-sensitive LNCaP cells and hamster flank organs. High long-chain fatty acids-low phytosterols (HLLP) SPS ≥ 750 nM with testosterone significantly increased and ≥500 nM with dihydrotestosterone significantly decreased LNCaP cell number. High long-chain fatty acids-high phytosterols (HLHP) SPS ≥ 500 nM with dihydrotestosterone and high medium-chain fatty acids-low phytosterols (HMLP) SPS ≥ 750 nM or with androgens significantly decreased LNCaP cell number (n = 3; p < 0.05). Five- to six-week-old, castrated male Syrian hamsters were randomized to control (n = 4), HLLP, HLHP, and HMLP SPS (n = 6) groups. Testosterone or dihydrotestosterone was applied topically daily for 21 days to the right flank organ; the left flank organ was treated with ethanol and served as the control. Thirty minutes later, SPS or ethanol was applied to each flank organ in treatment and control groups, respectively. SPS treatments caused a notable but nonsignificant reduction in the difference between left and right flank organ growth in testosterone-treated SPS groups compared to the control. The same level of inhibition was not seen in dihydrotestosterone-treated SPS groups (p < 0.05). Results may suggest that SPS inhibit 5α-reductase thereby preventing hamster flank organ growth.
Lawal, S. A.; Choudhury, I. A.; Nukman, Y.
2015-01-01
The understanding of cutting fluids performance in turning process is very important in order to improve the efficiency of the process. This efficiency can be determined based on certain process parameters such as flank wear, cutting forces developed, temperature developed at the tool chip interface, surface roughness on the work piece, etc. In this study, the objective is to determine the influence of cutting fluids on flank wear during turning of AISI 4340 with coated carbide inserts. The performances of three types of cutting fluids were compared using Taguchi experimental method. The results show that palm kernel oil based cutting fluids performed better than the other two cutting fluids in reducing flank wear. Mathematical models for cutting parameters such as cutting speed, feed rate, depth of cut and cutting fluids were obtained from regression analysis using MINITAB 14 software to predict flank wear. Experiments were conducted based on the optimized values to validate the regression equations for flank wear and 5.82 % error was obtained. The optimal cutting parameters for the flank wear using S/N ratio were 160 m/min of cutting speed (level 1), 0.18 mm/rev of feed (level 1), 1.75 mm of depth of cut (level 2) and 2.97 mm2/s palm kernel oil based cutting fluid (level 3). ANOVA shows cutting speed of 85.36 %; and feed rate 4.81 %) as significant factors.
Zhang, Jianwei; Kudrna, Dave; Mu, Ting; Li, Weiming; Copetti, Dario; Yu, Yeisoo; Goicoechea, Jose Luis; Lei, Yang; Wing, Rod A
2016-10-15
Next generation sequencing technologies have revolutionized our ability to rapidly and affordably generate vast quantities of sequence data. Once generated, raw sequences are assembled into contigs or scaffolds. However, these assemblies are mostly fragmented and inaccurate at the whole genome scale, largely due to the inability to integrate additional informative datasets (e.g. physical, optical and genetic maps). To address this problem, we developed a semi-automated software tool-Genome Puzzle Master (GPM)-that enables the integration of additional genomic signposts to edit and build 'new-gen-assemblies' that result in high-quality 'annotation-ready' pseudomolecules. With GPM, loaded datasets can be connected to each other via their logical relationships which accomplishes tasks to 'group,' 'merge,' 'order and orient' sequences in a draft assembly. Manual editing can also be performed with a user-friendly graphical interface. Final pseudomolecules reflect a user's total data package and are available for long-term project management. GPM is a web-based pipeline and an important part of a Laboratory Information Management System (LIMS) which can be easily deployed on local servers for any genome research laboratory. The GPM (with LIMS) package is available at https://github.com/Jianwei-Zhang/LIMS CONTACTS: jzhang@mail.hzau.edu.cn or rwing@mail.arizona.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.
Raynard, Steven J; Baker, Mark D
2004-01-01
In mammalian cells, little is known about the nature of recombination-prone regions of the genome. Previously, we reported that the immunoglobulin heavy chain (IgH) mu locus behaved as a hotspot for mitotic, intrachromosomal gene conversion (GC) between repeated mu constant (Cmu) regions in mouse hybridoma cells. To investigate whether elements within the mu gene regulatory region were required for hotspot activity, gene targeting was used to delete a 9.1 kb segment encompassing the mu gene promoter (Pmu), enhancer (Emu) and switch region (Smu) from the locus. In these cell lines, GC between the Cmu repeats was significantly reduced, indicating that this 'recombination-enhancing sequence' (RES) is necessary for GC hotspot activity at the IgH locus. Importantly, the RES fragment stimulated GC when appended to the same Cmu repeats integrated at ectopic genomic sites. We also show that deletion of Emu and flanking matrix attachment regions (MARs) from the RES abolishes GC hotspot activity at the IgH locus. However, no stimulation of ectopic GC was observed with the Emu/MARs fragment alone. Finally, we provide evidence that no correlation exists between the level of transcription and GC promoted by the RES. We suggest a model whereby Emu/MARS enhances mitotic GC at the endogenous IgH mu locus by effecting chromatin modifications in adjacent DNA.
Díez-Villaseñor, César; Guzmán, Noemí M; Almendros, Cristóbal; García-Martínez, Jesús; Mojica, Francisco J M
2013-05-01
Prokaryotes immunize themselves against transmissible genetic elements by the integration (acquisition) in clustered regularly interspaced short palindromic repeats (CRISPR) loci of spacers homologous to invader nucleic acids, defined as protospacers. Following acquisition, mono-spacer CRISPR RNAs (termed crRNAs) guide CRISPR-associated (Cas) proteins to degrade (interference) protospacers flanked by an adjacent motif in extrachomosomal DNA. During acquisition, selection of spacer-precursors adjoining the protospacer motif and proper orientation of the integrated fragment with respect to the leader (sequence leading transcription of the flanking CRISPR array) grant efficient interference by at least some CRISPR-Cas systems. This adaptive stage of the CRISPR action is poorly characterized, mainly due to the lack of appropriate genetic strategies to address its study and, at least in Escherichia coli, the need of Cas overproduction for insertion detection. In this work, we describe the development and application in Escherichia coli strains of an interference-independent assay based on engineered selectable CRISPR-spacer integration reporter plasmids. By using this tool without the constraint of interference or cas overexpression, we confirmed fundamental aspects of this process such as the critical requirement of Cas1 and Cas2 and the identity of the CTT protospacer motif for the E. coli K12 system. In addition, we defined the CWT motif for a non-K12 CRISPR-Cas variant, and obtained data supporting the implication of the leader in spacer orientation, the preferred acquisition from plasmids harboring cas genes and the occurrence of a sequential cleavage at the insertion site by a ruler mechanism.
Díez-Villaseñor, César; Guzmán, Noemí M.; Almendros, Cristóbal; García-Martínez, Jesús; Mojica, Francisco J.M.
2013-01-01
Prokaryotes immunize themselves against transmissible genetic elements by the integration (acquisition) in clustered regularly interspaced short palindromic repeats (CRISPR) loci of spacers homologous to invader nucleic acids, defined as protospacers. Following acquisition, mono-spacer CRISPR RNAs (termed crRNAs) guide CRISPR-associated (Cas) proteins to degrade (interference) protospacers flanked by an adjacent motif in extrachomosomal DNA. During acquisition, selection of spacer-precursors adjoining the protospacer motif and proper orientation of the integrated fragment with respect to the leader (sequence leading transcription of the flanking CRISPR array) grant efficient interference by at least some CRISPR-Cas systems. This adaptive stage of the CRISPR action is poorly characterized, mainly due to the lack of appropriate genetic strategies to address its study and, at least in Escherichia coli, the need of Cas overproduction for insertion detection. In this work, we describe the development and application in Escherichia coli strains of an interference-independent assay based on engineered selectable CRISPR-spacer integration reporter plasmids. By using this tool without the constraint of interference or cas overexpression, we confirmed fundamental aspects of this process such as the critical requirement of Cas1 and Cas2 and the identity of the CTT protospacer motif for the E. coli K12 system. In addition, we defined the CWT motif for a non-K12 CRISPR-Cas variant, and obtained data supporting the implication of the leader in spacer orientation, the preferred acquisition from plasmids harboring cas genes and the occurrence of a sequential cleavage at the insertion site by a ruler mechanism. PMID:23445770
Cormas, Peter C.
2016-01-01
Preservice teachers (N = 27) in two sections of a sequenced, methodological and process integrated mathematics/science course solved a levers problem with three similar learning processes and a problem-solving approach, and identified a problem-solving approach through one different learning process. Similar learning processes used included:…
Wheat, C. Geoffrey; Jannasch, Hans W.; Fisher, Andrew T.; Becker, Keir; Sharkey, Jessica; Hulme, Samuel
2010-07-01
Integrated Ocean Drilling Program (IODP) Hole 1301A was drilled, cased, and instrumented with a long-term, subseafloor observatory (CORK) on the eastern flank of the Juan de Fuca Ridge in summer 2004. This borehole is located 1 km south of ODP Hole 1026B and 5 km north of Baby Bare outcrop. Hole 1301A penetrates 262 m of sediment and 108 m of the uppermost 3.5 Ma basaltic basement in an area of warm (64°C) hydrothermal circulation. The borehole was instrumented, and those instruments were recovered 4 years later. Here we report chemical data from two continuous fluid samplers (OsmoSamplers) and temperature recording tools that monitored changes in the state of borehole (formation) fluids. These changes document the effects of drilling, fluid overpressure and flow, seawater-basalt interactions, and microbial metababolic activity. Initially, bottom seawater flowed into the borehole through a leak between concentric CORK casing strings. Eventually, the direction of flow reversed, and warm, altered formation fluid flowed into the borehole and discharged at the seafloor. This reversal occurred during 1 week in September 2007, 3 years after drilling operations ceased. The composition of the formation fluid around Hole 1301A generally lies within bounds defined by springs on Baby Bare outcrop (to the south) and fluids that discharged from Hole 1026B (to the north); deviations likely result from reactions with drilling products. Simple conservative mixing of two end-member fluids reveals reactions occurring within the crust, including nitrate reduction presumably by denitrifying microbes. The observed changes in borehole fluid composition provide the foundation for a conceptual model of chemical and microbial change during recharge of a warm ridge-flank hydrothermal system. This model can be tested through future scientific ocean drilling experiments.
Energy Technology Data Exchange (ETDEWEB)
Das, Sudhansu Ranjan; Kuma, Amaresh [National Institute of Technology, Jamshedpur (India); Dhupal, Debabrata [Veer Surendra Sai University of Technology, Burla (India)
2015-10-15
This experimental investigation deals with dry hard turning of AISI 4140 steel using PVD-TiN coated Al{sub 2}O{sub 3}+TiCN mixed ceramic inserts. The combined effect of cutting parameters (cutting speed, feed and depth of cut) on performance characteristics such as surface roughness and flank wear is explored by Full factorial design (FFD) and analysis of variance (ANOVA). The results show that feed is the principal cutting parameter influencing surface roughness, followed by cutting speed. However, flank wear is affected by the cutting speed and interaction of feed-depth of cut, although depth of cut has not been found statistically significant, but flank wear is an increasing function of depth of cut. Observations are made on the machined surface, and worn tool by Scanning electron microscope (SEM) to establish the process. Abrasion was the major wear mechanism found during hard turning within the studied range. The effect of tool wear on surface roughness was also studied. The experimental data were analyzed to predict the optimal range of surface roughness and flank wear. Based on Response surface methodology (RSM), mathematical models were developed for surface roughness (Ra) and flank wear (VB) with 95% confidence level. Finally, under optimum cutting conditions (obtained by response optimization technique), tool life was evaluated to perform cost analysis for justifying the economic viability of coated ceramic inserts in hard turning. The estimated machining cost per part for TiN coated ceramic was found to be lower (Rs. 12.31) because of higher tool life (51 min), which results in the reduction of downtime and increase in savings.
International Nuclear Information System (INIS)
Das, Sudhansu Ranjan; Kuma, Amaresh; Dhupal, Debabrata
2015-01-01
This experimental investigation deals with dry hard turning of AISI 4140 steel using PVD-TiN coated Al_2O_3+TiCN mixed ceramic inserts. The combined effect of cutting parameters (cutting speed, feed and depth of cut) on performance characteristics such as surface roughness and flank wear is explored by Full factorial design (FFD) and analysis of variance (ANOVA). The results show that feed is the principal cutting parameter influencing surface roughness, followed by cutting speed. However, flank wear is affected by the cutting speed and interaction of feed-depth of cut, although depth of cut has not been found statistically significant, but flank wear is an increasing function of depth of cut. Observations are made on the machined surface, and worn tool by Scanning electron microscope (SEM) to establish the process. Abrasion was the major wear mechanism found during hard turning within the studied range. The effect of tool wear on surface roughness was also studied. The experimental data were analyzed to predict the optimal range of surface roughness and flank wear. Based on Response surface methodology (RSM), mathematical models were developed for surface roughness (Ra) and flank wear (VB) with 95% confidence level. Finally, under optimum cutting conditions (obtained by response optimization technique), tool life was evaluated to perform cost analysis for justifying the economic viability of coated ceramic inserts in hard turning. The estimated machining cost per part for TiN coated ceramic was found to be lower (Rs. 12.31) because of higher tool life (51 min), which results in the reduction of downtime and increase in savings.
Directory of Open Access Journals (Sweden)
Jiang Du
2009-07-01
Full Text Available The goal of human genome re-sequencing is obtaining an accurate assembly of an individual's genome. Recently, there has been great excitement in the development of many technologies for this (e.g. medium and short read sequencing from companies such as 454 and SOLiD, and high-density oligo-arrays from Affymetrix and NimbelGen, with even more expected to appear. The costs and sensitivities of these technologies differ considerably from each other. As an important goal of personal genomics is to reduce the cost of re-sequencing to an affordable point, it is worthwhile to consider optimally integrating technologies. Here, we build a simulation toolbox that will help us optimally combine different technologies for genome re-sequencing, especially in reconstructing large structural variants (SVs. SV reconstruction is considered the most challenging step in human genome re-sequencing. (It is sometimes even harder than de novo assembly of small genomes because of the duplications and repetitive sequences in the human genome. To this end, we formulate canonical problems that are representative of issues in reconstruction and are of small enough scale to be computationally tractable and simulatable. Using semi-realistic simulations, we show how we can combine different technologies to optimally solve the assembly at low cost. With mapability maps, our simulations efficiently handle the inhomogeneous repeat-containing structure of the human genome and the computational complexity of practical assembly algorithms. They quantitatively show how combining different read lengths is more cost-effective than using one length, how an optimal mixed sequencing strategy for reconstructing large novel SVs usually also gives accurate detection of SNPs/indels, how paired-end reads can improve reconstruction efficiency, and how adding in arrays is more efficient than just sequencing for disentangling some complex SVs. Our strategy should facilitate the sequencing of
Lou, Tzu-Fang; Weidmann, Chase A; Killingsworth, Jordan; Tanaka Hall, Traci M; Goldstrohm, Aaron C; Campbell, Zachary T
2017-04-15
RNA-binding proteins (RBPs) collaborate to control virtually every aspect of RNA function. Tremendous progress has been made in the area of global assessment of RBP specificity using next-generation sequencing approaches both in vivo and in vitro. Understanding how protein-protein interactions enable precise combinatorial regulation of RNA remains a significant problem. Addressing this challenge requires tools that can quantitatively determine the specificities of both individual proteins and multimeric complexes in an unbiased and comprehensive way. One approach utilizes in vitro selection, high-throughput sequencing, and sequence-specificity landscapes (SEQRS). We outline a SEQRS experiment focused on obtaining the specificity of a multi-protein complex between Drosophila RBPs Pumilio (Pum) and Nanos (Nos). We discuss the necessary controls in this type of experiment and examine how the resulting data can be complemented with structural and cell-based reporter assays. Additionally, SEQRS data can be integrated with functional genomics data to uncover biological function. Finally, we propose extensions of the technique that will enhance our understanding of multi-protein regulatory complexes assembled onto RNA. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Madajewski Marek
2017-01-01
Full Text Available This paper presents analysis of flank wear influence on forces in orthogonal turning of 42CrMo4 steel and evaluates capacity of finite element model to provide such force values. Data about magnitude of feed and cutting force were obtained from measurements with force tensiometer in experimental test as well as from finite element analysis of chip formation process in ABAQUS/Explicit software. For studies an insert with complex rake face was selected and flank wear was simulated by grinding operation on its flank face. The aim of grinding inset surface was to obtain even flat wear along cutting edge, which after the measurement could be modeled with CAD program and applied in FE analysis for selected range of wear width. By comparing both sets of force values as function of flank wear in given cutting conditions FEA model was validated and it was established that it can be applied to analyze other physical aspects of machining. Force analysis found that progression of wear causes increase in cutting force magnitude and steep boost to feed force magnitude. Analysis of Fc/Ff force ratio revealed that flank wear has significant impact on resultant force in orthogonal cutting and magnitude of this force components in cutting and feed direction. Surge in force values can result in transfer of substantial loads to machine-tool interface.
Madajewski, Marek; Nowakowski, Zbigniew
2017-01-01
This paper presents analysis of flank wear influence on forces in orthogonal turning of 42CrMo4 steel and evaluates capacity of finite element model to provide such force values. Data about magnitude of feed and cutting force were obtained from measurements with force tensiometer in experimental test as well as from finite element analysis of chip formation process in ABAQUS/Explicit software. For studies an insert with complex rake face was selected and flank wear was simulated by grinding operation on its flank face. The aim of grinding inset surface was to obtain even flat wear along cutting edge, which after the measurement could be modeled with CAD program and applied in FE analysis for selected range of wear width. By comparing both sets of force values as function of flank wear in given cutting conditions FEA model was validated and it was established that it can be applied to analyze other physical aspects of machining. Force analysis found that progression of wear causes increase in cutting force magnitude and steep boost to feed force magnitude. Analysis of Fc/Ff force ratio revealed that flank wear has significant impact on resultant force in orthogonal cutting and magnitude of this force components in cutting and feed direction. Surge in force values can result in transfer of substantial loads to machine-tool interface.
Survey of methods for integrated sequence analysis with emphasis on man-machine interaction
Energy Technology Data Exchange (ETDEWEB)
Kahlbom, U; Holmgren, P [RELCON, Stockholm (Sweden)
1995-05-01
This report presents a literature study concerning recently developed monotonic methodologies in the human reliability area. The work was performed by RELCON AB on commission by NKS/RAK-1, subproject 3. The topic of subproject 3 is `Integrated Sequence Analysis with Emphasis on Man-Machine Interaction`. The purpose with the study was to compile recently developed methodologies and to propose some of these methodologies for use in the sequence analysis task. The report describes mainly non-dynamic (monotonic) methodologies. One exception is HITLINE, which is a semi-dynamic method. Reference provides a summary of approaches to dynamic analysis of man-machine-interaction, and explains the differences between monotonic and dynamic methodologies. (au) 21 refs.
Survey of methods for integrated sequence analysis with emphasis on man-machine interaction
International Nuclear Information System (INIS)
Kahlbom, U.; Holmgren, P.
1995-05-01
This report presents a literature study concerning recently developed monotonic methodologies in the human reliability area. The work was performed by RELCON AB on commission by NKS/RAK-1, subproject 3. The topic of subproject 3 is 'Integrated Sequence Analysis with Emphasis on Man-Machine Interaction'. The purpose with the study was to compile recently developed methodologies and to propose some of these methodologies for use in the sequence analysis task. The report describes mainly non-dynamic (monotonic) methodologies. One exception is HITLINE, which is a semi-dynamic method. Reference provides a summary of approaches to dynamic analysis of man-machine-interaction, and explains the differences between monotonic and dynamic methodologies. (au) 21 refs
Sanford, Ward E.; Pearson, S.C.P.; Kiyosugi, K.; Lehto, H.L.; Saballos, J.A.; Connor, C.B.
2012-01-01
We investigate geologic controls on circulation in the shallow hydrothermal system of Masaya volcano, Nicaragua, and their relationship to surface diffuse degassing. On a local scale (~250 m), relatively impermeable normal faults dipping at ~60° control the flowpath of water vapor and other gases in the vadose zone. These shallow normal faults are identified by modeling of a NE-SW trending magnetic anomaly of up to 2300 nT that corresponds to a topographic offset. Elevated SP and CO2 to the NW of the faults and an absence of CO2 to the SE suggest that these faults are barriers to flow. TOUGH2 numerical models of fluid circulation show enhanced flow through the footwalls of the faults, and corresponding increased mass flow and temperature at the surface (diffuse degassing zones). On a larger scale, TOUGH2 modeling suggests that groundwater convection may be occurring in a 3-4 km radial fracture zone transecting the entire flank of the volcano. Hot water rising uniformly into the base of the model at 1 x 10-5 kg/m2s results in convection that focuses heat and fluid and can explain the three distinct diffuse degassing zones distributed along the fracture. Our data and models suggest that the unusually active surface degassing zones at Masaya volcano can result purely from uniform heat and fluid flux at depth that is complicated by groundwater convection and permeability variations in the upper few km. Therefore isolating the effects of subsurface geology is vital when trying to interpret diffuse degassing in light of volcanic activity.
Directory of Open Access Journals (Sweden)
Liang Rubing
2010-08-01
Full Text Available Abstract Background The lambda Red recombination system has been used to inactivate chromosomal genes in various bacteria and fungi. The procedure consists of electroporating a polymerase chain reaction (PCR fragment containing antibiotic cassette flanked by homology regions to the target locus into a strain that can express the lambda Red proteins (Gam, Bet, Exo. Results Here a scarless gene modification strategy based on the Red recombination system has been developed to modify Pseudomonas genome DNA via sequential deletion of multiple targets. This process was mediated by plasmid pRKaraRed encoding the Red proteins regulated by PBAD promoter, which was functional in P. aeruginosa as well as in other bacteria. First the target gene was substituted for the sacB-bla cassette flanked by short homology regions (50 bp, and then this marker gene cassette could be replaced by the PCR fragment flanking itself, generating target-deleted genome without any remnants and no change happened to the surrounding region. Twenty genes involved in the synthesis and regulation pathways of the phenazine derivate, pyocyanin, were modified, including one single-point mutation and deletion of two large operons. The recombination efficiencies ranged from 88% to 98%. Multiple-gene modification was also achieved, generating a triple-gene deletion strain PCA (PAO1, ΔphzHΔphzMΔphzS, which could produce another phenazine derivate, phenazine-1-carboxylic acid (PCA, efficiently and exclusively. Conclusions This lambda Red-based technique can be used to generate scarless and sequential gene modification mutants of P. aeruginosa efficiently, using one-step PCR product flanked by short homology regions. Single-point mutation, scarless deletion of genes can be achieved easily in less than three days. This method may give a new way to construct genetically modified P. aeruginosa strains more efficiently and advance the regulatory network study of this organism.
Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S
1992-09-05
We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or
DEFF Research Database (Denmark)
Wernersson, Rasmus
2006-01-01
of alternative start codons. ( ii) Integration of sequences feature annotation - in particular, native support for working with files containing intron/ exon structure annotation. The software is available for both download and online use at http://www.cbs.dtu.dk/services/VirtualRibosome/....
Kunrat, S. L.; Schwandner, F. M.
2013-12-01
Gede Volcano (West Java) is part of an andesitic stratovolcano complex consisting of Pangrango in the north-west and Gede in the south-east. The last recorded eruptive activity was a phreatic subvolcanian ash eruption in 1957. Current activity is characterized by episodic swarms at 2-4 km depth, and low-temperature (~160°C) crater degassing in two distinct summit crater fumarolic areas. Hot springs occur in the saddle between the Gede and Pangrango edifice, as well as on the NE flank base. The most recent eruptive events produced pyroclastic material, their flow deposits concentrate toward the NE. A collaborative effort between the Center for Volcanology and Geological Hazard Mitigation (CVGHM), Geological Agency and the Earth Observatory of Singapore (EOS) is since 2010 aimed at upgrading the geophysical and geochemical monitoring network at Gede Volcano. To support the monitoring instrumentation upgrades under way, surveys of soil CO2 degassing have been performed on the flanks of Gede, in circular and radial traverses.The goal was to establish a spatial distribution of flank CO2 fluxes, and to allow smart siting for continuous gas monitoring stations. Crater fluxes were not surveyed, as its low-temperature hydrothermal system is likely prone to large hydraulic changes in this tropical environment, resulting in variable permeability effects that might mask signals from deeper reservoir or conduit degassing. The high precipitation intensity in the mountains of tropical Java pose challenges to this method, since soil gas permeability is largely controlled by soil moisture content. Simultaneous soil moisture measurements were undertaken. The soil CO2 surveys were carried out using a LI-8100A campaign flux chamber instrument (LICOR Biosciences, Lincoln, Nebraska). This instrument has a very precise and highly stable sensor and an atmospheric pressure equilibrator, making it highly sensitive to low fluxes. It is the far superior choice for higher precision low
Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R
2005-09-01
We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.
Compartmentalization of the Coso East Flank geothermal field imaged by 3-D full-tensor MT inversion
Lindsey, Nathaniel J.; Kaven, Joern; Davatzes, Nicholas C.; Newman, Gregory A.
2017-01-01
Previous magnetotelluric (MT) studies of the high-temperature Coso geothermal system in California identified a subvertical feature of low resistivity (2–5 Ohm m) and appreciable lateral extent (>1 km) in the producing zone of the East Flank field. However, these models could not reproduce gross 3-D effects in the recorded data. We perform 3-D full-tensor inversion and retrieve a resistivity model that out-performs previous 2-D and 3-D off-diagonal models in terms of its fit to the complete 3-D MT data set as well as the degree of modelling bias. Inclusion of secondary Zxx and Zyy data components leads to a robust east-dip (60†) to the previously identified conductive East Flank reservoir feature, which correlates strongly with recently mapped surface faults, downhole well temperatures, 3-D seismic reflection data, and local microseismicity. We perform synthetic forward modelling to test the best-fit dip of this conductor using the response at a nearby MT station. We interpret the dipping conductor as a fractured and fluidized compartment, which is structurally controlled by an unmapped blind East Flank fault zone.
Association of the polymorphism in the 5' flanking region of the ovine ...
African Journals Online (AJOL)
The insulin-like growth factor 1 (IGF-I) gene has been described in several studies as a candidate gene for growth traits in farm animals. The present preliminary study attempts to establish associations between growth traits and genetic polymorphisms at the 5' flanking region s IGF-I in the Baluchi sheep. The DNA of 102 ...
Fortescue field, Gippsland basin: Flank potential realized
Energy Technology Data Exchange (ETDEWEB)
Hendrich, J.H.; Schwebel, D.A.; Palmer, I.D. (Esso Asustralia Ltd., Sydney, New South Wales (Australia))
1990-09-01
Fortescue field was the last major oil field to be discovered in the offshore Gippsland basin, southeastern Australia. The discovery well, 1 West Halibut, was drilled in 1978 on the basis of a 1-km seismic grid as a follow up to the dry 1 Fortescue wildcat. Data from this well were interpreted to indicate that there was a high probability of a stratigraphic trap occurring on the western flank of the giant Halibut-Cobia structure. The 2, 3, and 4 Fortescue wells were drilled by early 1979 to determine the limits of the field, delineate the stratigraphy, and define the hydrocarbon contacts. Cobia A had the dual purpose of developing the Cobia field and the southern extent of the Fortescue reservoirs that were inaccessible to the Fortescue A plat-form. At the conclusion of development drilling in early 1986, eight Cobia A wells and 20 Fortescue A wells were capable of producing from Fortescue reservoirs. The Fortescue reservoirs are Eocene sandstones that were deposited in coastal plain, upper shoreface, and lower shoreface environments. Integration of well log correlations, stratigraphic interpretations, reservoir pressure data, and seismic data indicates that these Fortescue reservoirs are stratigraphically younger than, and are hydraulically separated from, the underlying Halibut-Cobia fields. Pressure data acquired during development drilling and while monitoring subsequent production performance have conclusively demonstrated that there are at least three separate hydraulic systems active within the Fortescue field. Fortescue field dimensions are approximately 11 km x 4 km with a maximum relief of 100 m above the original oil-water contact. Reserves are estimated at 280,000 STB, based on original oil in place estimates of 415,000 STB and recovery factors in the 65-70% range. Production rate peaked in 1984 at 100 K BOPD from the combined development facilities and was sustained until late 1986. More than two-thirds of the reserves have been produced to date.
Amyloidosis of the renal pelvis presenting as flank pain
Directory of Open Access Journals (Sweden)
Rachel Shikhman, D.O.
2018-02-01
Full Text Available Amyloidosis is a rare disease defined by accumulation of extracellular amyloid systemically or within a specific organ. Localized amyloidosis of the genitourinary system is extremely rare, with the predominate location being the bladder. The imaging findings are often nonspecific and mimic urothelial carcinoma. We present a 49-year-old woman with a chief complaint of flank pain. A filling defect was discovered on radiological imaging. The defect was subsequently biopsied and proven to be a primary amyloidosis of the renal pelvis. We then review the radiological findings of amyloidosis of the genitourinary system.
Directory of Open Access Journals (Sweden)
Ashok Kumar Sahoo
2013-10-01
Full Text Available The paper presents the development of flank wear model in turning hardened EN 24 steel with PVD TiN coated mixed ceramic insert under dry environment. The paper also investigates the effect of process parameter on flank wear (VBc. The experiments have been conducted using three level full factorial design techniques. The machinability model has been developed in terms of cutting speed (v, feed (f and machining time (t as input variable using response surface methodology. The adequacy of model has been checked using correlation coefficients. As the determination coefficient, R2 (98% is higher for the model developed; the better is the response model fits the actual data. In addition, residuals of the normal probability plot lie reasonably close to a straight line showing that the terms mentioned in the model are statistically significant. The predicted flank wear has been found to lie close to the experimental value. This indicates that the developed model can be effectively used to predict the flank wear in the hard turning. Abrasion and diffusion has been found to be the dominant wear mechanism in machining hardened steel from SEM micrographs at highest parametric range. Machining time has been found to be the most significant parameter on flank wear followed by cutting speed and feed as observed from main effect plot and ANOVA study.
Frank, Daniel N
2008-10-07
Advances in automated DNA sequencing technology have accelerated the generation of metagenomic DNA sequences, especially environmental ribosomal RNA gene (rDNA) sequences. As the scale of rDNA-based studies of microbial ecology has expanded, need has arisen for software that is capable of managing, annotating, and analyzing the plethora of diverse data accumulated in these projects. XplorSeq is a software package that facilitates the compilation, management and phylogenetic analysis of DNA sequences. XplorSeq was developed for, but is not limited to, high-throughput analysis of environmental rRNA gene sequences. XplorSeq integrates and extends several commonly used UNIX-based analysis tools by use of a Macintosh OS-X-based graphical user interface (GUI). Through this GUI, users may perform basic sequence import and assembly steps (base-calling, vector/primer trimming, contig assembly), perform BLAST (Basic Local Alignment and Search Tool; 123) searches of NCBI and local databases, create multiple sequence alignments, build phylogenetic trees, assemble Operational Taxonomic Units, estimate biodiversity indices, and summarize data in a variety of formats. Furthermore, sequences may be annotated with user-specified meta-data, which then can be used to sort data and organize analyses and reports. A document-based architecture permits parallel analysis of sequence data from multiple clones or amplicons, with sequences and other data stored in a single file. XplorSeq should benefit researchers who are engaged in analyses of environmental sequence data, especially those with little experience using bioinformatics software. Although XplorSeq was developed for management of rDNA sequence data, it can be applied to most any sequencing project. The application is available free of charge for non-commercial use at http://vent.colorado.edu/phyloware.
Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas
2009-06-01
The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.
Effect of 5'-flanking sequence deletions on expression of the human insulin gene in transgenic mice
DEFF Research Database (Denmark)
Fromont-Racine, M; Bucchini, D; Madsen, O
1990-01-01
Expression of the human insulin gene was examined in transgenic mouse lines carrying the gene with various lengths of DNA sequences 5' to the transcription start site (+1). Expression of the transgene was demonstrated by 1) the presence of human C-peptide in urine, 2) the presence of specific...... of the transgene was observed in cell types other than beta-islet cells....
Kempter, K.A.; Rowe, G.L.
2000-01-01
The Active Crater at Rincon de la Vieja volcano, Costa Rica, reaches an elevation of 1750 m and contains a warm, hyper-acidic crater lake that probably formed soon after the eruption of the Rio Blanco tephra deposit approximately 3500 years before present. The Active Crater is buttressed by volcanic ridges and older craters on all sides except the north, which dips steeply toward the Caribbean coastal plains. Acidic, above-ambient-temperature streams are found along the Active Crater's north flank at elevations between 800 and 1000 m. A geochemical survey of thermal and non-thermal waters at Rincon de la Vieja was done in 1989 to determine whether hyper-acidic fluids are leaking from the Active Crater through the north flank, affecting the composition of north-flank streams. Results of the water-chemistry survey reveal that three distinct thermal waters are found on the flanks of Rincon de la Vieja volcano: acid chloride-sulfate (ACS), acid sulfate (AS), and neutral chloride (NC) waters. The most extreme ACS water was collected from the crater lake that fills the Active Crater. Chemical analyses of the lake water reveal a hyper-acidic (pH ~ 0) chloride-sulfate brine with elevated concentrations of calcium, magnesium, aluminum, iron, manganese, copper, zinc, fluorine, and boron. The composition of the brine reflects the combined effects of magmatic degassing from a shallow magma body beneath the Active Crater, dissolution of andesitic volcanic rock, and evaporative concentration of dissolved constituents at above-ambient temperatures. Similar cation and anion enrichments are found in the above-ambient-temperature streams draining the north flank of the Active Crater. The pH of north-flank thermal waters range from 3.6 to 4.1 and chloride:sulfate ratios (1.2-1.4) that are a factor of two greater than that of the lake brine (0.60). The waters have an ACS composition that is quite different from the AS and NC thermal waters that occur along the southern flank of Rincon
Ravi, Keerthi Sravan; Potdar, Sneha; Poojar, Pavan; Reddy, Ashok Kumar; Kroboth, Stefan; Nielsen, Jon-Fredrik; Zaitsev, Maxim; Venkatesan, Ramesh; Geethanath, Sairam
2018-03-11
To provide a single open-source platform for comprehensive MR algorithm development inclusive of simulations, pulse sequence design and deployment, reconstruction, and image analysis. We integrated the "Pulseq" platform for vendor-independent pulse programming with Graphical Programming Interface (GPI), a scientific development environment based on Python. Our integrated platform, Pulseq-GPI, permits sequences to be defined visually and exported to the Pulseq file format for execution on an MR scanner. For comparison, Pulseq files using either MATLAB only ("MATLAB-Pulseq") or Python only ("Python-Pulseq") were generated. We demonstrated three fundamental sequences on a 1.5 T scanner. Execution times of the three variants of implementation were compared on two operating systems. In vitro phantom images indicate equivalence with the vendor supplied implementations and MATLAB-Pulseq. The examples demonstrated in this work illustrate the unifying capability of Pulseq-GPI. The execution times of all the three implementations were fast (a few seconds). The software is capable of user-interface based development and/or command line programming. The tool demonstrated here, Pulseq-GPI, integrates the open-source simulation, reconstruction and analysis capabilities of GPI Lab with the pulse sequence design and deployment features of Pulseq. Current and future work includes providing an ISMRMRD interface and incorporating Specific Absorption Ratio and Peripheral Nerve Stimulation computations. Copyright © 2018 Elsevier Inc. All rights reserved.
Southward flow on the western flank of the Florida Current
Soloviev, Alexander V.; Hirons, Amy; Maingot, Christopher; Dean, Cayla W.; Dodge, Richard E.; Yankovsky, Alexander E.; Wood, Jon; Weisberg, Robert H.; Luther, Mark E.; McCreary, Julian P.
2017-07-01
A suite of long-term in situ measurements in the Straits of Florida, including the ADCP bottom moorings at an 11-m isobath and 244-m isobath (Miami Terrace) and several ADCP ship transects, have revealed a remarkable feature of the ocean circulation - southward flow on the western, coastal flank of the Florida Current. We have observed three forms of the southward flow - a seasonally varying coastal countercurrent, an undercurrent jet attached to the Florida shelf, and an intermittent undercurrent on the Miami Terrace. According to a 13-year monthly climatology obtained from the near-shore mooring, the coastal countercurrent is a persistent feature from October through January. The southward flow in the form of an undercurrent jet attached to the continental slope was observed during five ship transects from April through September but was not observed during three transects in February, March, and November. This undercurrent jet is well mixed due to strong shear at its top associated with the northward direction of the surface flow (Florida Current) and friction at the bottom. At the same time, no statistically significant seasonal cycle has been observed in the undercurrent flow on the Miami Terrace. Theoretical considerations suggest that several processes could drive the southward current, including interaction between the Florida Current and the shelf, as well as forcing that is independent of the Florida Current. The exact nature of the southward flow on the western flank of the Florida Current is, however, unknown.
Sequencing analysis reveals a unique gene organization in the gyrB region of Mycoplasma hominis
DEFF Research Database (Denmark)
Ladefoged, Søren; Christiansen, Gunna
1994-01-01
of which showed similarity to that which encodes the LicA protein of Haemophilus influenzae. The organization of the genes in the region showed no resemblance to that in the corresponding regions of other bacteria sequenced so far. The gyrA gene was mapped 35 kb downstream from the gyrB gene.......The homolog of the gyrB gene, which has been reported to be present in the vicinity of the initiation site of replication in bacteria, was mapped on the Mycoplasma hominis genome, and the region was subsequently sequenced. Five open reading frames were identified flanking the gyrB gene, one...
Unenhanced helical CT in the investigation of acute flank pain
International Nuclear Information System (INIS)
Colistro, Robert; Torreggiani, William C.; Lyburn, Iain D.; Harris, Alison C.; Al-Nakshabandi, Nizar A.; Nicolaou, Savvas; Munk, Peter L.
2002-01-01
Unenhanced helical CT has emerged as the imaging technique of choice for the investigation of patients presenting with acute flank pain and suspected nephroureteric stone disease. There are several signs identifiable on unenhanced CT that support a diagnosis of stone disease. However, there are many pitfalls, that may confound a correct diagnosis. Some of the common pitfalls, together with methods to avoid such occurrences, will be discussed. A review of some of the common alternative diagnoses that may mimic the symptoms of nephroureteric stone disease is illustrated. Colistro, R. et al (2002)
Naparstek, Sharon; Safadi, Ziad; Lichtenstein-Vidne, Limor; Henik, Avishai
2015-01-01
The current research examined whether peripherally presented numerical information can affect the speed of number processing. In 2 experiments, participants were presented with a target matrix flanked by a distractor matrix and were asked to perform a comparative judgment (i.e., decide whether the target was larger or smaller than the reference…
Directory of Open Access Journals (Sweden)
Kishima Yuji
2004-10-01
Full Text Available Abstract Background Plant genomes contain various kinds of repetitive sequences such as transposable elements, microsatellites, tandem repeats and virus-like sequences. Most of them, with the exception of virus-like sequences, do not allow us to trace their origins nor to follow the process of their integration into the host genome. Recent discoveries of virus-like sequences in plant genomes led us to set the objective of elucidating the origin of the repetitive sequences. Endogenous rice tungro bacilliform virus (RTBV-like sequences (ERTBVs have been found throughout the rice genome. Here, we reconstructed putative virus structures from RTBV-like sequences in the rice genome and characterized to understand evolutionary implication, integration manner and involvements of endogenous virus segments in the corresponding disease response. Results We have collected ERTBVs from the rice genomes. They contain rearranged structures and no intact ORFs. The identified ERTBV segments were shown to be phylogenetically divided into three clusters. For each phylogenetic cluster, we were able to make a consensus alignment for a circular virus-like structure carrying two complete ORFs. Comparisons of DNA and amino acid sequences suggested the closely relationship between ERTBV and RTBV. The Oryza AA-genome species vary in the ERTBV copy number. The species carrying low-copy-number of ERTBV segments have been reported to be extremely susceptible to RTBV. The DNA methylation state of the ERTBV sequences was correlated with their copy number in the genome. Conclusions These ERTBV segments are unlikely to have functional potential as a virus. However, these sequences facilitate to establish putative virus that provided information underlying virus integration and evolutionary relationship with existing virus. Comparison of ERTBV among the Oryza AA-genome species allowed us to speculate a possible role of endogenous virus segments against its related disease.
DEFF Research Database (Denmark)
Larsen, Jesper; Kuhnert, Peter; Frey, Joachim
2007-01-01
subclades, thus reaffirming the hypothesis of vertical inheritance of the leukotoxin operon. The presence of individual 5' flanking regions in M. haemolytica + M. glucosida and M. granulomatis reflects later genome rearrangements within each subclade. The evolution of the novel 5' flanking region in M...
Analysis of simple sequence repeats in rice bean (Vigna umbellata using an SSR-enriched library
Directory of Open Access Journals (Sweden)
Lixia Wang
2016-02-01
Full Text Available Rice bean (Vigna umbellata Thunb., a warm-season annual legume, is grown in Asia mainly for dried grain or fodder and plays an important role in human and animal nutrition because the grains are rich in protein and some essential fatty acids and minerals. With the aim of expediting the genetic improvement of rice bean, we initiated a project to develop genomic resources and tools for molecular breeding in this little-known but important crop. Here we report the construction of an SSR-enriched genomic library from DNA extracted from pooled young leaf tissues of 22 rice bean genotypes and developing SSR markers. In 433,562 reads generated by a Roche 454 GS-FLX sequencer, we identified 261,458 SSRs, of which 48.8% were of compound form. Dinucleotide repeats were predominant with an absolute proportion of 81.6%, followed by trinucleotides (17.8%. Other types together accounted for 0.6%. The motif AC/GT accounted for 77.7% of the total, followed by AAG/CTT (14.3%, and all others accounted for 12.0%. Among the flanking sequences, 2928 matched putative genes or gene models in the protein database of Arabidopsis thaliana, corresponding with 608 non-redundant Gene Ontology terms. Of these sequences, 11.2% were involved in cellular components, 24.2% were involved molecular functions, and 64.6% were associated with biological processes. Based on homolog analysis, 1595 flanking sequences were similar to mung bean and 500 to common bean genomic sequences. Comparative mapping was conducted using 350 sequences homologous to both mung bean and common bean sequences. Finally, a set of primer pairs were designed, and a validation test showed that 58 of 220 new primers can be used in rice bean and 53 can be transferred to mung bean. However, only 11 were polymorphic when tested on 32 rice bean varieties. We propose that this study lays the groundwork for developing novel SSR markers and will enhance the mapping of qualitative and quantitative traits and marker
Kass, David H; Janoušek, Václav; Wang, Liuyang; Tucker, Priscilla K
2014-06-01
Reproductive barriers exist between the house mouse subspecies, Mus musculus musculus and M. m. domesticus, members of the Mus musculus species complex, primarily as a result of hybrid male infertility, and a hybrid zone exists where their ranges intersect in Europe. Using single nucleotide polymorphisms (SNPs) diagnostic for the two taxa, the extent of introgression across the genome was previously compared in these hybrid populations. Sixty-nine of 1316 autosomal SNPs exhibited reduced introgression in two hybrid zone transects suggesting maladaptive interactions among certain loci. One of these markers is within a region on chromosome 11 that, in other studies, has been associated with hybrid male sterility of these subspecies. We assessed sequence variation in a 20 Mb region on chromosome 11 flanking this marker, and observed its inclusion within a roughly 150 kb stretch of DNA showing elevated sequence differentiation between the two subspecies. Four genes are associated with this genomic subregion, with two entirely encompassed. One of the two genes, the uncharacterized 1700093K21Rik gene, displays distinguishing features consistent with a potential role in reproductive isolation between these subspecies. Along with its expression specifically within spermatogenic cells, we present various sequence analyses that demonstrate a high rate of molecular evolution of this gene, as well as identify a subspecies amino acid variant resulting in a structural difference. Taken together, the data suggest a role for this gene in reproductive isolation.
Han, Yuepeng; Chagné, David; Gasic, Ksenija; Rikkerink, Erik H A; Beever, Jonathan E; Gardiner, Susan E; Korban, Schuyler S
2009-03-01
A genome-wide BAC physical map of the apple, Malus x domestica Borkh., has been recently developed. Here, we report on integrating the physical and genetic maps of the apple using a SNP-based approach in conjunction with bin mapping. Briefly, BAC clones located at ends of BAC contigs were selected, and sequenced at both ends. The BAC end sequences (BESs) were used to identify candidate SNPs. Subsequently, these candidate SNPs were genetically mapped using a bin mapping strategy for the purpose of mapping the physical onto the genetic map. Using this approach, 52 (23%) out of 228 BESs tested were successfully exploited to develop SNPs. These SNPs anchored 51 contigs, spanning approximately 37 Mb in cumulative physical length, onto 14 linkage groups. The reliability of the integration of the physical and genetic maps using this SNP-based strategy is described, and the results confirm the feasibility of this approach to construct an integrated physical and genetic maps for apple.
Odedeyi, P. B.; Abou-El-Hossein, K.; Liman, M.
2017-05-01
Stainless steel 316 is a difficult-to-machine iron-based alloys that contain minimum of about 12% of chromium commonly used in marine and aerospace industry. This paper presents an experimental study of the tool wear propagation variations in the end milling of stainless steel 316 with coated carbide inserts. The milling tests were conducted at three different cutting speeds while feed rate and depth of cut were at (0.02, 0.06 and 01) mm/rev and (1, 2 and 3) mm, respectively. The cutting tool used was TiAlN-PVD-multi-layered coated carbides. The effects of cutting speed, cutting tool coating top layer and workpiece material were investigated on the tool life. The results showed that cutting speed significantly affected the machined flank wears values. With increasing cutting speed, the flank wear values decreased. The experimental results showed that significant flank wear was the major and predominant failure mode affecting the tool life.
Sediment transport along the Cap de Creus Canyon flank during a mild, wet winter
Directory of Open Access Journals (Sweden)
J. Martín
2013-05-01
Full Text Available Cap de Creus Canyon (CCC is known as a preferential conduit for particulate matter leaving the Gulf of Lion continental shelf towards the slope and the basin, particularly in winter when storms and dense shelf water cascading coalesce to enhance the seaward export of shelf waters. During the CASCADE (CAscading, Storm, Convection, Advection and Downwelling Events cruise in March 2011, deployments of recording instruments within the canyon and vertical profiling of the water column properties were conducted to study with high spatial-temporal resolution the impact of such processes on particulate matter fluxes. In the context of the mild and wet 2010–2011 winter, no remarkable dense shelf water formation was observed. On the other hand, the experimental setup allowed for the study of the impact of E-SE storms on the hydrographical structure and the particulate matter fluxes in the CCC. The most remarkable feature in terms of sediment transport was a period of dominant E-SE winds from 12 to 16 March, including two moderate storms (maximum significant wave heights = 4.1–4.6 m. During this period, a plume of freshened, relatively cold and turbid water flowed at high speeds along the southern flank of the CCC in an approximate depth range of 150–350 m. The density of this water mass was lighter than the ambient water in the canyon, indicating that it did not cascade off-shelf and that it merely downwelled into the canyon forced by the strong cyclonic circulation induced over the shelf during the storms and by the subsequent accumulation of seawater along the coast. Suspended sediment load in this turbid intrusion recorded along the southern canyon flank oscillated between 10 and 50 mg L−1, and maximum currents speeds reached values up to 90 cm s−1. A rough estimation of 105 tons of sediment was transported through the canyon along its southern wall during a 3-day-long period of storm-induced downwelling. Following the veering of the wind
Directed PCR-free engineering of highly repetitive DNA sequences
Directory of Open Access Journals (Sweden)
Preissler Steffen
2011-09-01
Full Text Available Abstract Background Highly repetitive nucleotide sequences are commonly found in nature e.g. in telomeres, microsatellite DNA, polyadenine (poly(A tails of eukaryotic messenger RNA as well as in several inherited human disorders linked to trinucleotide repeat expansions in the genome. Therefore, studying repetitive sequences is of biological, biotechnological and medical relevance. However, cloning of such repetitive DNA sequences is challenging because specific PCR-based amplification is hampered by the lack of unique primer binding sites resulting in unspecific products. Results For the PCR-free generation of repetitive DNA sequences we used antiparallel oligonucleotides flanked by restriction sites of Type IIS endonucleases. The arrangement of recognition sites allowed for stepwise and seamless elongation of repetitive sequences. This facilitated the assembly of repetitive DNA segments and open reading frames encoding polypeptides with periodic amino acid sequences of any desired length. By this strategy we cloned a series of polyglutamine encoding sequences as well as highly repetitive polyadenine tracts. Such repetitive sequences can be used for diverse biotechnological applications. As an example, the polyglutamine sequences were expressed as His6-SUMO fusion proteins in Escherichia coli cells to study their aggregation behavior in vitro. The His6-SUMO moiety enabled affinity purification of the polyglutamine proteins, increased their solubility, and allowed controlled induction of the aggregation process. We successfully purified the fusions proteins and provide an example for their applicability in filter retardation assays. Conclusion Our seamless cloning strategy is PCR-free and allows the directed and efficient generation of highly repetitive DNA sequences of defined lengths by simple standard cloning procedures.
International Nuclear Information System (INIS)
Breslow, Norman E.; Beckwith, J. Bruce; Haase, Gerald M.; Kalapurakal, John A.; Ritchey, Michael L.; Shamberger, Robert C.; Thomas, Patrick; D'Angio, Giulio J.; Green, Daniel M.
2006-01-01
Purpose: To determine whether radiation therapy (RT) of patients with Wilms tumor of favorable histology prevented flank recurrence and thereby improved the survival outcomes. Methods and Materials: Recurrence and mortality risks were compared among groups of patients with Stage I-IV/favorable histology Wilms tumor enrolled in the third (n = 1,640) and fourth (n = 2,066) National Wilms Tumor Study Group studies. Results: Proportions of patients with flank recurrence were 0 of 513 = 0.0% for 20 Gy, 12 of 805 = 1.5% for 10 Gy, and 44 of 2,388 = 1.8% for no flank RT (p trend 0.001 adjusted for stage and doxorubicin); for intra-abdominal (including flank) recurrence they were 5 of 513 = 1.0%, 30 of 805 = 3.7%, and 58 of 2,388 = 2.4%, respectively (p trend = 0.02 adjusted). Survival percentages at 8 years after intra-abdominal recurrence were 0 of 5 = 0% for 20 Gy, 10 of 30 = 33% for 10 Gy, and 34 of 58 = 56% for no RT (p trend = 0.0001). NWTS-4 discontinued use of 20 Gy RT, and the 8-year flank recurrence risk increased to 2.1% from 1.0% on NWTS-3 (p = 0.013). However, event-free survival was unaltered (88% vs. 86%, p = 0.39), and overall survival was better (93.8% vs. 90.8%, p = 0.036) on NWTS-4. Conclusions: Partly because of lower postrecurrence mortality among nonirradiated patients, prevention of flank recurrence by RT did not improve survival. It is important to evaluate entire treatment policies with regard to long-term outcomes
Aswad, Amr; Katzourakis, Aris
2014-01-01
Herpesviridae is a diverse family of large and complex pathogens whose genomes are extremely difficult to sequence. This is particularly true for clinical samples, and if the virus, host, or both genomes are being sequenced for the first time. Although herpesviruses are known to occasionally integrate in host genomes, and can also be inherited in a Mendelian fashion, they are notably absent from the genomic fossil record comprised of endogenous viral elements (EVEs). Here, we combine paleovirological and metagenomic approaches to both explore the constituent viral diversity of mammalian genomes and search for endogenous herpesviruses. We describe the first endogenous herpesvirus from the genome of the Philippine tarsier, belonging to the Roseolovirus genus, and characterize its highly defective genome that is integrated and flanked by unambiguous host DNA. From a draft assembly of the aye-aye genome, we use bioinformatic tools to reveal over 100,000 bp of a novel rhadinovirus that is the first lemur gammaherpesvirus, closely related to Kaposi's sarcoma-associated virus. We also identify 58 genes of Pan paniscus lymphocryptovirus 1, the bonobo equivalent of human Epstein-Barr virus. For each of the viruses, we postulate gene function via comparative analysis to known viral relatives. Most notably, the evidence from gene content and phylogenetics suggests that the aye-aye sequences represent the most basal known rhadinovirus, and indicates that tumorigenic herpesviruses have been infecting primates since their emergence in the late Cretaceous. Overall, these data show that a genomic fossil record of herpesviruses exists despite their extremely large genomes, and expands the known diversity of Herpesviridae, which will aid the characterization of pathogenesis. Our analytical approach illustrates the benefit of intersecting evolutionary approaches with metagenomics, genetics and paleovirology. PMID:24945689
Sequencing genes in silico using single nucleotide polymorphisms
Directory of Open Access Journals (Sweden)
Zhang Xinyi
2012-01-01
Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate
Complete nucleotide sequences of avian metapneumovirus subtype B genome.
Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro
2010-12-01
Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.
Kijas, J M; Fowler, J C; Thomas, M R
1995-04-01
Microsatellites, also called sequence tagged microsatellite sites (STMSs), have become important markers for genome analysis but are currently little studied in plants. To assess the value of STMSs for analysis within the Citrus plant species, two example STMSs were isolated from an intergeneric cross between rangpur lime (Citrus x limonia Osbeck) and trifoliate orange (Poncirus trifoliata (L.) Raf.). Unique flanking primers were constructed for polymerase chain reaction amplification both within the test cross and across a broad range of citrus and related species. Both loci showed length variation between test cross parents with alleles segregating in a Mendelian fashion to progeny. Amplification across species showed the STMS flanking primers to be conserved in every genome tested. The traits of polymorphism, inheritance, and conservation across species mean that STMS markers are ideal for genome mapping within Citrus, which contains high levels of genetic variability.
Sequence of a New World primate insulin having low biological potency and immunoreactivity
Energy Technology Data Exchange (ETDEWEB)
Seino, S.; Steiner, D.F.; Bell, G.I.
1987-11-01
The organization of the insulin gene of the owl or night monkey (Aotus trivirgatus), a New World primate, is similar to that of the human gene. The sequences of these two genes and flanking regions possess 84.3% homology. An unusual feature of the owl monkey gene is the partial duplication and insertion of a portion of the A-chain coding sequence into the 3' untranslated region. The insulin gene of this primate also lacks a region of tandem repeats that is present in the 5' flanking region of the human and chimpanzee genes. Owl monkey preproinsulin has 85.5% identity with the human insulin precursor and is the most divergent of the primate insulins/preproinsulins yet described. The differences between owl monkey and human preproinsulin include three substitutions in the signal peptide, two in the B chain, seven in the C peptide, and three in the A chain. One of these replacements is the conservative substitution of valine for isoleucine a position A2, an invariant site in all other vertebrate insulins and insulin-like growth factors. The substitutions in owl monkey insulin at B9, B27, A2, A4, and A17 alter its structure so that it has only 20% of the receptor-binding activity and 1% of the affinity with guinea pig anti-porcine insulin antibodies as compared to human insulin.
Sequence of a New World primate insulin having low biological potency and immunoreactivity
International Nuclear Information System (INIS)
Seino, S.; Steiner, D.F.; Bell, G.I.
1987-01-01
The organization of the insulin gene of the owl or night monkey (Aotus trivirgatus), a New World primate, is similar to that of the human gene. The sequences of these two genes and flanking regions possess 84.3% homology. An unusual feature of the owl monkey gene is the partial duplication and insertion of a portion of the A-chain coding sequence into the 3' untranslated region. The insulin gene of this primate also lacks a region of tandem repeats that is present in the 5' flanking region of the human and chimpanzee genes. Owl monkey preproinsulin has 85.5% identity with the human insulin precursor and is the most divergent of the primate insulins/preproinsulins yet described. The differences between owl monkey and human preproinsulin include three substitutions in the signal peptide, two in the B chain, seven in the C peptide, and three in the A chain. One of these replacements is the conservative substitution of valine for isoleucine a position A2, an invariant site in all other vertebrate insulins and insulin-like growth factors. The substitutions in owl monkey insulin at B9, B27, A2, A4, and A17 alter its structure so that it has only 20% of the receptor-binding activity and 1% of the affinity with guinea pig anti-porcine insulin antibodies as compared to human insulin
Vaandrager, J W; Schuuring, E; Raap, T; Philippo, K; Kleiverda, K; Kluin, P
Rearrangement of the BCL2 gene is an important parameter for the differential diagnosis of non-Hodgkin lymphomas. Although a relatively large proportion of breakpoints is clustered, many are missed by standard PCR. A FISH assay is therefore desired. Up to now, a lack of probes flanking the BCL2 gene
Directory of Open Access Journals (Sweden)
Syahrul Azwan Sundi
2017-01-01
Full Text Available This paper is a study on full flute (extra-long tool and ground shank end mill wear analysis by utilizing five-axis CNC to implement flank milling strategy on curved shape part. Five-axis machining eases the user to implement variations of strategy such as flank milling. Flank milling is different from point milling. Point milling cuts materials by using the tip of the tool whereas the flank milling uses the cutting tool body to cut material. The type of cutting tool used was end mill 10 mm diameter with High Speed Steel (HSS material. One factor at a time was utilized to analyze the overall data. Feed rate and spindle speed were the two main factors that been set up equally for both full flute and ground shank end mill. At the end of this research, the qualitative analysis based on tool wear between full flute and ground shank end mill is observed. Generally, both types of cutting tools showed almost the same failure indication such as broken edge or chipped off edge, formation of pinned hole on the surface and serration formation or built-up edge (BUE on the primary flute. However, the results obtained from the enlarged images which were captured by Optical Microscope indicated that, the ground shank end mill is better than the full flute end mill.
Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Madura, K.; Prakash, S.
1986-01-01
The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes
National Research Council Canada - National Science Library
Werner, Sandra
1999-01-01
The thesis investigates the circulation at a 75-meter deep study site on the southern flank of Georges Bank, a shallow submarine bank located between the deeper Gulf of Maine and the continental slope...
Le Gal, V.; Lucazeau, F.; Cannat, M.; Poort, J.; Monnin, C.; Battani, A.; Fontaine, F.; Goutorbe, B.; Rolandone, F.; Poitou, C.; Blanc-Valleron, M.-M.; Piedade, A.; Hipólito, A.
2018-01-01
Hydrothermal circulation affects heat and mass transfers in the oceanic lithosphere, not only at the ridge axis but also on their flanks, where the magnitude of this process has been related to sediment blanket and seamounts density. This was documented in several areas of the Pacific Ocean by heat flow measurements and pore water analysis. However, as the morphology of Atlantic and Indian ridge flanks is generally rougher than in the Pacific, these regions of slow and ultra-slow accretion may be affected by hydrothermal processes of different regimes. We carried out a survey of two regions on the eastern and western flanks of the Mid-Atlantic Ridge between Oceanographer and Hayes fracture zones. Two hundred and eight new heat flow measurements were obtained along six seismic profiles, on 5 to 14 Ma old seafloor. Thirty sediment cores (from which porewaters have been extracted) have been collected with a Kullenberg corer equipped with thermistors thus allowing simultaneous heat flow measurement. Most heat flow values are lower than those predicted by purely conductive cooling models, with some local variations and exceptions: heat flow values on the eastern flank of the study area are more variable than on the western flank, where they tend to increase westward as the sedimentary cover in the basins becomes thicker and more continuous. Heat flow is also higher, on average, on the northern sides of both the western and eastern field regions and includes values close to conductive predictions near the Oceanographer Fracture Zone. All the sediment porewaters have a chemical composition similar to that of bottom seawater (no anomaly linked to fluid circulation has been detected). Heat flow values and pore fluid compositions are consistent with fluid circulation in volcanic rocks below the sediment. The short distances between seamounts and short fluid pathways explain that fluids flowing in the basaltic aquifer below the sediment have remained cool and unaltered
SIFTS: Structure Integration with Function, Taxonomy and Sequences resource
Velankar, Sameer; Dana, José M.; Jacobsen, Julius; van Ginkel, Glen; Gane, Paul J.; Luo, Jie; Oldfield, Thomas J.; O’Donovan, Claire; Martin, Maria-Jesus; Kleywegt, Gerard J.
2013-01-01
The Structure Integration with Function, Taxonomy and Sequences resource (SIFTS; http://pdbe.org/sifts) is a close collaboration between the Protein Data Bank in Europe (PDBe) and UniProt. The two teams have developed a semi-automated process for maintaining up-to-date cross-reference information to UniProt entries, for all protein chains in the PDB entries present in the UniProt database. This process is carried out for every weekly PDB release and the information is stored in the SIFTS database. The SIFTS process includes cross-references to other biological resources such as Pfam, SCOP, CATH, GO, InterPro and the NCBI taxonomy database. The information is exported in XML format, one file for each PDB entry, and is made available by FTP. Many bioinformatics resources use SIFTS data to obtain cross-references between the PDB and other biological databases so as to provide their users with up-to-date information. PMID:23203869
Directory of Open Access Journals (Sweden)
James L. Crainey
2017-05-01
Full Text Available Research interest in Wolbachia is growing as new discoveries and technical advancements reveal the public health importance of both naturally occurring and artificial infections. Improved understanding of the Wolbachia bacteriophages (WOs WOcauB2 and WOcauB3 [belonging to a sub-group of four WOs encoding serine recombinases group 1 (sr1WOs], has enhanced the prospect of novel tools for the genetic manipulation of Wolbachia. The basic biology of sr1WOs, including host range and mode of genomic integration is, however, still poorly understood. Very few sr1WOs have been described, with two such elements putatively resulting from integrations at the same Wolbachia genome loci, about 2 kb downstream from the FtsZ cell-division gene. Here, we characterize the DNA sequence flanking the FtsZ gene of wDam, a genetically distinct line of Wolbachia isolated from the West African onchocerciasis vector Simulium squamosum E. Using Roche 454 shot-gun and Sanger sequencing, we have resolved >32 kb of WO prophage sequence into three contigs representing three distinct prophage elements. Spanning ≥36 distinct WO open reading frame gene sequences, these prophage elements correspond roughly to three different WO modules: a serine recombinase and replication module (sr1RRM, a head and base-plate module and a tail module. The sr1RRM module contains replication genes and a Holliday junction recombinase and is unique to the sr1 group WOs. In the extreme terminal of the tail module there is a SpvB protein homolog—believed to have insecticidal properties and proposed to have a role in how Wolbachia parasitize their insect hosts. We propose that these wDam prophage modules all derive from a single WO genome, which we have named here sr1WOdamA1. The best-match database sequence for all of our sr1WOdamA1-predicted gene sequences was annotated as of Wolbachia or Wolbachia phage sourced from an arthropod. Clear evidence of exchange between sr1WOdamA1 and other Wolbachia
Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain
2011-01-01
cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.
Lava-flow hazard on the SE flank of Mt. Etna (Southern Italy)
Crisci, G. M.; Iovine, G.; Di Gregorio, S.; Lupiano, V.
2008-11-01
A method for mapping lava-flow hazard on the SE flank of Mt. Etna (Sicily, Southern Italy) by applying the Cellular Automata model SCIARA -fv is described, together with employed techniques of calibration and validation through a parallel Genetic Algorithm. The study area is partly urbanised; it has repeatedly been affected by lava flows from flank eruptions in historical time, and shows evidence of a dominant SSE-trending fracture system. Moreover, a dormant deep-seated gravitational deformation, associated with a larger volcano-tectonic phenomenon, affects the whole south-eastern flank of the volcano. The Etnean 2001 Mt. Calcarazzi lava-flow event has been selected for model calibration, while validation has been performed by considering the 2002 Linguaglossa and the 1991-93 Valle del Bove events — suitable data for back analysis being available for these recent eruptions. Quantitative evaluation of the simulations, with respect to the real events, has been performed by means of a couple of fitness functions, which consider either the areas affected by the lava flows, or areas and eruption duration. Sensitivity analyses are in progress for thoroughly evaluating the role of parameters, topographic input data, and mesh geometry on model performance; though, preliminary results have already given encouraging responses on model robustness. In order to evaluate lava-flow hazard in the study area, a regular grid of n.340 possible vents, uniformly covering the study area and located at 500 m intervals, has been hypothesised. For each vent, a statistically-significant number of simulations has been planned, by adopting combinations of durations, lava volumes, and effusion-rate functions, selected by considering available volcanological data. Performed simulations have been stored in a GIS environment for successive analyses and map elaboration. Probabilities of activation, empirically based on past behaviour of the volcano, can be assigned to each vent of the grid, by
On the geochemistry of the Kyra eruption sequence of Nisyros volcano on Nisyros and Tilos, Greece
International Nuclear Information System (INIS)
Sterba, Johannes H.; Steinhauser, Georg; Bichler, Max
2011-01-01
The Kyra sequence is a volcanic eruption sequence originating from the eastern flank of Nisyros volcano, Greece. Its eruptions products can be found not only on Nisyros itself but also on the nearby non-volcanic island of Tilos. In an extensive sampling campaign, outcrops of the Kyra eruption products on Nisyros were sampled and corresponding samples on Tilos were taken. The clear stratigraphical relationship between the different units within in the individual outcrops, combined with the chemical information gained by the application of instrumental neutron activation analysis (INAA) to the samples, made a detailed chemo-stratigraphy of the complete eruption sequence possible. It can be shown that the sequence is separated into eight distinguishable eruptions. Furthermore, no eruption products of the caldera-forming eruptions from Nisyros (Lower- and Upper Caldera Pumice) or from Santorin were found on Tilos.
On the geochemistry of the Kyra eruption sequence of Nisyros volcano on Nisyros and Tilos, Greece
Energy Technology Data Exchange (ETDEWEB)
Sterba, Johannes H., E-mail: jsterba@ati.ac.at [Atominstitut der oesterreichischen Universitaeten, Vienna University of Technology (Austria); Steinhauser, Georg; Bichler, Max [Atominstitut der oesterreichischen Universitaeten, Vienna University of Technology (Austria)
2011-11-15
The Kyra sequence is a volcanic eruption sequence originating from the eastern flank of Nisyros volcano, Greece. Its eruptions products can be found not only on Nisyros itself but also on the nearby non-volcanic island of Tilos. In an extensive sampling campaign, outcrops of the Kyra eruption products on Nisyros were sampled and corresponding samples on Tilos were taken. The clear stratigraphical relationship between the different units within in the individual outcrops, combined with the chemical information gained by the application of instrumental neutron activation analysis (INAA) to the samples, made a detailed chemo-stratigraphy of the complete eruption sequence possible. It can be shown that the sequence is separated into eight distinguishable eruptions. Furthermore, no eruption products of the caldera-forming eruptions from Nisyros (Lower- and Upper Caldera Pumice) or from Santorin were found on Tilos.
Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa
Directory of Open Access Journals (Sweden)
Shahin Arwa
2012-11-01
Full Text Available Abstract Background Bulbous flowers such as lily and tulip (Liliaceae family are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Results Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups and among the three monocot species: lily, tulip, and rice (6,900 groups were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Conclusions
Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa.
Shahin, Arwa; van Kaauwen, Martijn; Esselink, Danny; Bargsten, Joachim W; van Tuyl, Jaap M; Visser, Richard G F; Arens, Paul
2012-11-20
Bulbous flowers such as lily and tulip (Liliaceae family) are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags) for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats) showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions) compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP) markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side) were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups) and among the three monocot species: lily, tulip, and rice (6,900 groups) were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Two transcriptome sets were built that are valuable
Cluster Observations of reconnection along the dusk flank of the magnetosphere
Escoubet, C.-Philippe; Grison, Benjamin; Berchem, Jean; Trattner, Karlheinz; Lavraud, Benoit; Pitout, Frederic; Soucek, Jan; Richard, Robert; Laakso, Harri; Masson, Arnaud; Dunlop, Malcolm; Dandouras, Iannis; Reme, Henri; Fazakerley, Andrew; Daly, Patrick
2015-04-01
Magnetic reconnection is generally accepted to be the main process that transfers particles and energy from the solar wind to the magnetosphere. The location of the reconnection site depends on the orientation of the interplanetary magnetic field (IMF) in the solar wind: on the dayside magnetosphere for an IMF southward, on the lobes for an IMF northward and on the flanks for an IMF in the East-West direction. Since most of observations of reconnection events have sampled a limited region of space simultaneously it is still not yet know if the reconnection line is extended over large regions of the magnetosphere or if is patchy and made of many reconnection lines. We report a Cluster crossing on 5 January 2002 near the exterior cusp on the southern dusk side where we observe multiple sources of reconnection/injections. The IMF was mainly azimuthal (IMF-By around -5 nT), the solar wind speed lower than usual around 280 km/s with the density of order 5 cm-3. The four Cluster spacecraft had an elongated configuration near the magnetopause. C4 was the first spacecraft to enter the cusp around 19:52:04 UT, followed by C2 at 19:52:35 UT, C1 at 19:54:24 UT and C3 at 20:13:15 UT. C4 and C1 observed two ion energy dispersions at 20:10 UT and 20:40 UT and C3 at 20:35 UT and 21:15 UT. Using the time of flight technique on the upgoing and downgoing ions, which leads to energy dispersions, we obtain distances of the ion sources between 14 and 20 RE from the spacecraft. The slope of the ion energy dispersions confirmed these distances. Using Tsyganenko model, we find that these sources are located on the dusk flank, past the terminator. The first injection by C3 is seen at approximately the same time as the 2nd injection on C1 but their sources at the magnetopause were separated by more than 7 RE. This would imply that two distinct sources were active at the same time on the dusk flank of the magnetosphere. In addition, a flow reversal was observed at the magnetopause on C4
Directory of Open Access Journals (Sweden)
Stéphanie Barthe
Full Text Available Simple sequence repeat (SSR markers are widely used tools for inferences about genetic diversity, phylogeography and spatial genetic structure. Their applications assume that variation among alleles is essentially caused by an expansion or contraction of the number of repeats and that, accessorily, mutations in the target sequences follow the stepwise mutation model (SMM. Generally speaking, PCR amplicon sizes are used as direct indicators of the number of SSR repeats composing an allele with the data analysis either ignoring the extent of allele size differences or assuming that there is a direct correlation between differences in amplicon size and evolutionary distance. However, without precisely knowing the kind and distribution of polymorphism within an allele (SSR and the associated flanking region (FR sequences, it is hard to say what kind of evolutionary message is conveyed by such a synthetic descriptor of polymorphism as DNA amplicon size. In this study, we sequenced several SSR alleles in multiple populations of three divergent tree genera and disentangled the types of polymorphisms contained in each portion of the DNA amplicon containing an SSR. The patterns of diversity provided by amplicon size variation, SSR variation itself, insertions/deletions (indels, and single nucleotide polymorphisms (SNPs observed in the FRs were compared. Amplicon size variation largely reflected SSR repeat number. The amount of variation was as large in FRs as in the SSR itself. The former contributed significantly to the phylogenetic information and sometimes was the main source of differentiation among individuals and populations contained by FR and SSR regions of SSR markers. The presence of mutations occurring at different rates within a marker's sequence offers the opportunity to analyse evolutionary events occurring on various timescales, but at the same time calls for caution in the interpretation of SSR marker data when the distribution of within
Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...
Metagenome sequencing and 98 microbial genomes from Juan de Fuca Ridge flank subsurface fluids
Jungbluth, Sean P.; Amend, Jan P.; Rappé, Michael S.
2017-03-01
The global deep subsurface biosphere is one of the largest reservoirs for microbial life on our planet. This study takes advantage of new sampling technologies and couples them with improvements to DNA sequencing and associated informatics tools to reconstruct the genomes of uncultivated Bacteria and Archaea from fluids collected deep within the Juan de Fuca Ridge subseafloor. Here, we generated two metagenomes from borehole observatories located 311 meters apart and, using binning tools, retrieved 98 genomes from metagenomes (GFMs). Of the GFMs, 31 were estimated to be >90% complete, while an additional 17 were >70% complete. Phylogenomic analysis revealed 53 bacterial and 45 archaeal GFMs, of which nearly all were distantly related to known cultivated isolates. In the GFMs, abundant Bacteria included Chloroflexi, Nitrospirae, Acetothermia (OP1), EM3, Aminicenantes (OP8), Gammaproteobacteria, and Deltaproteobacteria, while abundant Archaea included Archaeoglobi, Bathyarchaeota (MCG), and Marine Benthic Group E (MBG-E). These data are the first GFMs reconstructed from the deep basaltic subseafloor biosphere, and provide a dataset available for further interrogation.
Clonal spread of blaOXA-72-carrying Acinetobacter baumannii sequence type 512 in Taiwan.
Kuo, Han-Yueh; Hsu, Po-Jui; Chen, Jiann-Yuan; Liao, Po-Cheng; Lu, Chia-Wei; Chen, Chang-Hua; Liou, Ming-Li
2016-07-01
This is the first report to show an insidious outbreak of armA- and blaOXA-72-carrying Acinetobacter baumannii sequence type 512 (ST512) at a study hospital in northern Taiwan. Multilocus sequence typing revealed that this was a ST512 clone. All of the isolates with ST512 carried a novel 12,056-bp repGR2 in combination with a repGR12-type plasmid. This plasmid, designated pAB-ML, had one copy of the blaOXA-72 gene that was flanked by XerC/XerD-like sites and conferred resistance to carbapenems. Copyright © 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.
Clifford, Jacob; Adami, Christoph
2015-09-02
Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.
Soil radon monitoring in the NE flank of Mt. Etna (Sicily)
International Nuclear Information System (INIS)
Imme, G.; La Delfa, S.; Lo Nigro, S.; Morelli, D.; Patane, G.
2006-01-01
Soil radon has been monitored at a fixed location on the northeastern flank of Mt. Etna, a high-risk volcano in Sicily. The aim of this study was to evaluate the effects of the recent volcanic activity on soil radon concentration. Continuous radon measurements have been performed since July 2001. While comparison between the trend in in-soil radon concentration and the acquired meteorological series (temperature, humidity and pressure) appear to confirm a general seasonal correlation, nevertheless particular anomalies suggest a possible dependence of the radon concentration on volcanic dynamics
Thaitrong, Numrin; Kim, Hanyoup; Renzi, Ronald F; Bartsch, Michael S; Meagher, Robert J; Patel, Kamlesh D
2012-12-01
We have developed an automated quality control (QC) platform for next-generation sequencing (NGS) library characterization by integrating a droplet-based digital microfluidic (DMF) system with a capillary-based reagent delivery unit and a quantitative CE module. Using an in-plane capillary-DMF interface, a prepared sample droplet was actuated into position between the ground electrode and the inlet of the separation capillary to complete the circuit for an electrokinetic injection. Using a DNA ladder as an internal standard, the CE module with a compact LIF detector was capable of detecting dsDNA in the range of 5-100 pg/μL, suitable for the amount of DNA required by the Illumina Genome Analyzer sequencing platform. This DMF-CE platform consumes tenfold less sample volume than the current Agilent BioAnalyzer QC technique, preserving precious sample while providing necessary sensitivity and accuracy for optimal sequencing performance. The ability of this microfluidic system to validate NGS library preparation was demonstrated by examining the effects of limited-cycle PCR amplification on the size distribution and the yield of Illumina-compatible libraries, demonstrating that as few as ten cycles of PCR bias the size distribution of the library toward undesirable larger fragments. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
M. F. Ulum
2014-12-01
Full Text Available The aim of this study was to describe the sonographic appearance of abdominal wall at the left flank of laparotomy incision site in 11 mated Ettawah grade does. Brightness-mode ultrasound examination by using transducer with frequency of 5.0-6.0 MHz was conducted to grouping the does based on their pregnancy statuses. The incision site of the abdominal wall at left flank laparotomy was transcutaneous-scanned as long as 8 cm vertically. The sonographic appearance of the laparotomy wall thickness showed that in all groups of does were similar and not different statistically. The thickness of oblique external and oblique internal abdominal muscles increased in the pregnant does as compared to non-pregnant does (P<0.05.
Stevens, Servi J C; Blom, Eveline W; Siegelaer, Ingrid T J; Smeets, Eric E J G L
2015-04-01
We identified an identical and recurrent 9.4-Mbp deletion at chromosome bands 2p11.2-2p12, which occurred de novo in two unrelated patients. It is flanked at the distal and proximal breakpoints by two homologous segmental duplications consisting of low copy repeat (LCR) blocks in direct orientation, which have >99% sequence identity. Despite the fact that the deletion was almost 10 Mbp in size, the patients showed a relatively mild clinical phenotype, that is, mild-to-moderate intellectual disability, a happy disposition, speech delay and delayed motor development. Their phenotype matches with that of previously described patients. The 2p11.2-2p12 deletion includes the REEP1 gene that is associated with spastic paraplegia and phenotypic features related to this are apparent in most 2p11.2-2p12 deletion patients, but not in all. Other hemizygous genes that may contribute to the clinical phenotype include LRRTM1 and CTNNA2. We propose a recurrent but rare 2p11.2-2p12 deletion syndrome based on (1) the identical, non-random localisation of the de novo deletion breakpoints in two unrelated patients and a patient from literature, (2) the patients' phenotypic similarity and their phenotypic overlap with other 2p deletions and (3) the presence of highly identical LCR blocks flanking both breakpoints, consistent with a non-allelic homologous recombination (NAHR)-mediated rearrangement.
Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region
Energy Technology Data Exchange (ETDEWEB)
Miyamoto, M.M.; Slightom, J.L.; Goodman, M.
1987-10-16
Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee are more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.
International Nuclear Information System (INIS)
Kidd, R.B.; Searle, R.C.; Weaver, P.P.E.; Jacobs, C.L.; Huggett, Q.J.; Noel, M.J.; Schultheiss, P.J.
1983-01-01
The King's Trough Flank study area in the Northeast Atlantic Ocean was chosen in 1979 as a location at which to examine the suitability of pelagic carbonate sequences for sub-seabed disposal of high-level radioactive waste. This report summarises investigations up to the end of 1982; following visits by four research ships to the area during which geophysical data and sediment samples were collected. The region is a characteristically rugged portion of the deep ocean floor with hills and scarps 10 to 30 km apart and slopes around the hills ranging from 18 deg to 30 deg. Areas of relatively smooth seafloor occur, however, up to 35 km across, where slopes no greater than 2 deg are recorded. At this stage an apparent discrepancy between the geophysical and sediment core data leaves some uncertainty regarding the stability of the sediment cover and the likelihood of current erosion in these areas. The general suitability of the area is discussed by comparing our present geological and geophysical data with the set of 'desirable characteristics' for a sub-seabed disposal site first outlined in 1979. The difficulties involved in extrapolating findings from presently-sampled depths of up to 10 metres to depths envisaged for shallow waste disposal are emphasised. (author)
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
The exact localization of an insertion in the genome of transgenic plants obtained by Agrobacterium-mediated transformation is an integral part of most experiments aimed at studying these types of mutants. There are several methods for isolating unknown nucleotide sequences of genomic DNA which flank the borders of ...
2012-01-01
Background Cotton is the world’s most important natural textile fiber and a significant oilseed crop. Decoding cotton genomes will provide the ultimate reference and resource for research and utilization of the species. Integration of high-density genetic maps with genomic sequence information will largely accelerate the process of whole-genome assembly in cotton. Results In this paper, we update a high-density interspecific genetic linkage map of allotetraploid cultivated cotton. An additional 1,167 marker loci have been added to our previously published map of 2,247 loci. Three new marker types, InDel (insertion-deletion) and SNP (single nucleotide polymorphism) developed from gene information, and REMAP (retrotransposon-microsatellite amplified polymorphism), were used to increase map density. The updated map consists of 3,414 loci in 26 linkage groups covering 3,667.62 cM with an average inter-locus distance of 1.08 cM. Furthermore, genome-wide sequence analysis was finished using 3,324 informative sequence-based markers and publicly-available Gossypium DNA sequence information. A total of 413,113 EST and 195 BAC sequences were physically anchored and clustered by 3,324 sequence-based markers. Of these, 14,243 ESTs and 188 BACs from different species of Gossypium were clustered and specifically anchored to the high-density genetic map. A total of 2,748 candidate unigenes from 2,111 ESTs clusters and 63 BACs were mined for functional annotation and classification. The 337 ESTs/genes related to fiber quality traits were integrated with 132 previously reported cotton fiber quality quantitative trait loci, which demonstrated the important roles in fiber quality of these genes. Higher-level sequence conservation between different cotton species and between the A- and D-subgenomes in tetraploid cotton was found, indicating a common evolutionary origin for orthologous and paralogous loci in Gossypium. Conclusion This study will serve as a valuable genomic resource
International Nuclear Information System (INIS)
Nelson, Jerel; Castillo, Carlos; Huntsman, Julie; Lucek, Heather; Marks, Tim
2012-01-01
Document available in abstract form only. Full text of publication follows: Faced with the DOE Complex Transformation, NNSA was tasked with developing an integrated plan for the decommissioning of over 400 facilities and 300 environmental remediation units, as well as the many reconfiguration and modernization projects at the Oak Ridge National Laboratory (ORNL) and Y-12 Complex. Manual scheduling of remediation activities is time-consuming, labor intensive, and inherently introduces bias and unaccounted for aspects of the scheduler or organization in the process. Clearly a tool was needed to develop an objective, unbiased baseline optimized project sequence and schedule with a sound technical foundation for the Integrated Facility Disposition Project (IFDP). In generating an integrated disposition schedule, each project (including facilities, environmental sites, and remedial action units) was identified, characterized, then ranked relative to other projects. Risk matrices allowed for core project data to be extrapolated into probable contamination levels, relative risks to the public, and other technical and risk parameters to be used in the development of an overall ranking. These matrices ultimately generated a complete data set that were used in the Ranking and Sequencing Model (RSM), commonly referred to as the SUPER model, for its numerous abilities to support D and D planning, prioritization, and sequencing
Integrated DNA walking system to characterize a broad spectrum of GMOs in food/feed matrices.
Fraiture, Marie-Alice; Herman, Philippe; Lefèvre, Loic; Taverniers, Isabel; De Loose, Marc; Deforce, Dieter; Roosens, Nancy H
2015-08-14
In order to provide a system fully integrated with qPCR screening, usually used in GMO routine analysis, as well as being able to detect, characterize and identify a broad spectrum of GMOs in food/feed matrices, two bidirectional DNA walking methods targeting p35S or tNOS, the most common transgenic elements found in GM crops, were developed. These newly developed DNA walking methods are completing the previously implemented DNA walking method targeting the t35S pCAMBIA element. Food/feed matrices containing transgenic crops (Bt rice or MON863 maize) were analysed using the integrated DNA walking system. First, the newly developed DNA walking methods, anchored on the sequences used for the p35S or tNOS qPCR screening, were tested on Bt rice that contains these two transgenic elements. Second, the methods were assessed on a maize sample containing a low amount of the GM MON863 event, representing a more complex matrix in terms of genome size and sensitivity. Finally, to illustrate its applicability in GMO routine analysis by enforcement laboratories, the entire workflow of the integrated strategy, including qPCR screening to detect the potential presence of GMOs and the subsequent DNA walking methods to characterize and identify the detected GMOs, was applied on a GeMMA Scheme Proficiency Test matrix. Via the characterization of the transgene flanking region between the transgenic cassette and the plant genome as well as of a part of the transgenic cassette, the presence of GMOs was properly confirmed or infirmed in all tested samples. Due to their simple procedure and their short time-frame to get results, the developed DNA walking methods proposed here can be easily implemented in GMO routine analysis by the enforcement laboratories. In providing crucial information about the transgene flanking regions and/or the transgenic cassettes, this DNA walking strategy is a key molecular tool to prove the presence of GMOs in any given food/feed matrix.
Directory of Open Access Journals (Sweden)
Wu Yu-Ren
2016-01-01
Full Text Available In this paper, a novel longitudinal tooth flank crowning method is proposed by setting the crossed angle between the hob cutter and work gear as a linear function of hob’s traverse feed movement in the gear hobbing process. However, this method makes twisted tooth flanks on the hobbed work gear. Therefore, a variable pressure angle hob cutter is applied to obtain an anti-twist tooth flank of hobbed work gear. A computer simulation example is performed to verify the superiority of the proposed novel hobbing method by comparing topographies of the crowned work gear surfaces hobbed by a standard hob cutter and a variable pressure angle hob cutter.
Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi
2015-12-10
D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.
Kemény, Ferenc; Meier, Beat
2016-02-01
While sequence learning research models complex phenomena, previous studies have mostly focused on unimodal sequences. The goal of the current experiment is to put implicit sequence learning into a multimodal context: to test whether it can operate across different modalities. We used the Task Sequence Learning paradigm to test whether sequence learning varies across modalities, and whether participants are able to learn multimodal sequences. Our results show that implicit sequence learning is very similar regardless of the source modality. However, the presence of correlated task and response sequences was required for learning to take place. The experiment provides new evidence for implicit sequence learning of abstract conceptual representations. In general, the results suggest that correlated sequences are necessary for implicit sequence learning to occur. Moreover, they show that elements from different modalities can be automatically integrated into one unitary multimodal sequence. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Heiland Randy
2006-03-01
Full Text Available Abstract Background Understanding protein function from its structure is a challenging problem. Sequence based approaches for finding homology have broad use for annotation of both structure and function. 3D structural information of protein domains and their interactions provide a complementary view to structure function relationships to sequence information. We have developed a web site http://www.sblest.org/ and an API of web services that enables users to submit protein structures and identify statistically significant neighbors and the underlying structural environments that make that match using a suite of sequence and structure analysis tools. To do this, we have integrated S-BLEST, PSI-BLAST and HMMer based superfamily predictions to give a unique integrated view to prediction of SCOP superfamilies, EC number, and GO term, as well as identification of the protein structural environments that are associated with that prediction. Additionally, we have extended UCSF Chimera and PyMOL to support our web services, so that users can characterize their own proteins of interest. Results Users are able to submit their own queries or use a structure already in the PDB. Currently the databases that a user can query include the popular structural datasets ASTRAL 40 v1.69, ASTRAL 95 v1.69, CLUSTER50, CLUSTER70 and CLUSTER90 and PDBSELECT25. The results can be downloaded directly from the site and include function prediction, analysis of the most conserved environments and automated annotation of query proteins. These results reflect both the hits found with PSI-BLAST, HMMer and with S-BLEST. We have evaluated how well annotation transfer can be performed on SCOP ID's, Gene Ontology (GO ID's and EC Numbers. The method is very efficient and totally automated, generally taking around fifteen minutes for a 400 residue protein. Conclusion With structural genomics initiatives determining structures with little, if any, functional characterization
Pore Pressure Distribution and Flank Instability in Hydrothermally Altered Stratovolcanoes
Ball, J. L.; Taron, J.; Hurwitz, S.; Reid, M. E.
2015-12-01
Field and geophysical investigations of stratovolcanoes with long-lived hydrothermal systems commonly reveal that initially permeable regions (such as brecciated layers of pyroclastic material) can become both altered and water-bearing. Hydrothermal alteration in these regions, including clay formation, can turn them into low-permeability barriers to fluid flow, which could increase pore fluid pressures resulting in flank slope instability. We examined elevated pore pressure conditions using numerical models of hydrothermal flow in stratovolcanoes, informed by geophysical data about internal structures and deposits. Idealized radially symmetric meshes were developed based on cross-sectional profiles and alteration/permeability structures of Cascade Range stratovolcanoes. We used the OpenGeoSys model to simulate variably saturated conditions in volcanoes heated only by regional heat fluxes, as well as 650°C intrusions at two km depth below the surface. Meteoric recharge was estimated from precipitation rates in the Cascade Range. Preliminary results indicate zones of elevated pore pressures form: 1) where slopes are underlain by continuous low-permeability altered layers, or 2) when the edifice has an altered core with saturated, less permeable limbs. The first scenario might control shallow collapses on the slopes above the altered layers. The second could promote deeper flank collapses that are initially limited to the summit and upper slopes, but could progress to the core of an edifice. In both scenarios, pore pressures can be further elevated by shallow intrusions, or evolve over longer time scales under forcing from regional heat flux. Geometries without confining low-permeability layers do not show these pressure effects. Our initial scenarios use radially symmetric models, but we are also simulating hydrothermal flow under real 3D geometries with asymmetric subsurface structures (Mount Adams). Simulation results will be used to inform 3D slope
Cluster observations of surface waves on the dawn flank magnetopause
Directory of Open Access Journals (Sweden)
C. J. Owen
2004-03-01
Full Text Available On 14 June 2001 the four Cluster spacecraft recorded multiple encounters of the dawn-side flank magnetopause. The characteristics of the observed electron populations varied between a cold, dense magnetosheath population and warmer, more rarified boundary layer population on a quasi-periodic basis. The demarcation between these two populations can be readily identified by gradients in the scalar temperature of the electrons. An analysis of the differences in the observed timings of the boundary at each spacecraft indicates that these magnetopause crossings are consistent with a surface wave moving across the flank magnetopause. When compared to the orientation of the magnetopause expected from models, we find that the leading edges of these waves are approximately 45° steeper than the trailing edges, consistent with the Kelvin-Helmholtz (KH driving mechanism. A stability analysis of this interval suggests that the magnetopause is marginally stable to this mechanism during this event. Periods in which the analysis predicts that the magnetopause is unstable correspond to observations of greater wave steepening. Analysis of the pulses suggests that the waves have an average wavelength of approximately 3.4 RE and move at an average speed of ~65km s-1 in an anti-sunward and northward direction, despite the spacecraft location somewhat south of the GSE Z=0 plane. This wave propagation direction lies close to perpendicular to the average magnetic field direction in the external magnetosheath, suggesting that these waves may preferentially propagate in the direction that requires no bending of these external field lines
Key words. Magnetospheric physics (magnetospheric configuration and dynamics; MHD waves and unstabilities; solar wind-magnetosphere interactions
Sequence elements correlating with circulating viral load in genotype 1b hepatitis C virus infection
International Nuclear Information System (INIS)
Watanabe, Hideki; Nagayama, Kazuyoshi; Enomoto, Nobuyuki; Itakura, Jun; Tanabe, Yoko; Hamano, Kosei; Izumi, Namiki; Sato, Chifumi; Watanabe, Mamoru
2003-01-01
The correlation between hepatitis C virus (HCV) genomic sequences and circulating HCV RNA levels was assessed to investigate the genetic elements affecting viral load. The interferon sensitivity-determining region (ISDR) sequence and the serum viral load were strongly correlated in 226 patients examined. Analysis of the entire HCV genome from six patients (three with a high and the others with a low viral load) with similar ISDR sequences identified several candidate residues associated with viral load. The amino acid (aa) sequences of these candidate residues and flanking regions in 67 additional patients revealed that only the residue at aa 962 varied significantly between the HCV patients with low and high serum loads (P 0.042). At this position, alanine was observed more frequently in the patients with a high viral load. In conclusion, our results strongly suggest that serum HCV RNA loads are inversely correlated with amino acid substitutions in the ISDR, and aa 962 was identified as a possible second determinant of serum HCV RNA load
Singh, Swati; Gupta, Sanchita; Mani, Ashutosh; Chaturvedi, Anoop
2012-01-01
Humulus lupulus is commonly known as hops, a member of the family moraceae. Currently many projects are underway leading to the accumulation of voluminous genomic and expressed sequence tag sequences in public databases. The genetically characterized domains in these databases are limited due to non-availability of reliable molecular markers. The large data of EST sequences are available in hops. The simple sequence repeat markers extracted from EST data are used as molecular markers for genetic characterization, in the present study. 25,495 EST sequences were examined and assembled to get full-length sequences. Maximum frequency distribution was shown by mononucleotide SSR motifs i.e. 60.44% in contig and 62.16% in singleton where as minimum frequency are observed for hexanucleotide SSR in contig (0.09%) and pentanucleotide SSR in singletons (0.12%). Maximum trinucleotide motifs code for Glutamic acid (GAA) while AT/TA were the most frequent repeat of dinucleotide SSRs. Flanking primer pairs were designed in-silico for the SSR containing sequences. Functional categorization of SSRs containing sequences was done through gene ontology terms like biological process, cellular component and molecular function. PMID:22368382
Simulation of flanking transmission in super-light structures for airborne and impact sound
DEFF Research Database (Denmark)
Christensen, Jacob Ellehauge; Hertz, Kristian Dahl; Brunskog, Jonas
2012-01-01
. Previously the airborne and impact sound insulation has been measured for a super-light deck element in a laboratory. This paper presents a flanking transmission analysis based on the measured results and are carried out for the Super-light deck elements by means of the acoustical software Bastian...... to design buildings with super-light deck elements while achieving a good acoustical environment in the building, fulfilling various acoustical requirements from the building regulations....
Sang, Helen; Whitehouse, Harold L K
1983-01-01
Aberrant asci containing one or more wild-type spores were selected from crosses between pairs of alleles of the buff locus in the presence of closely linked flanking markers. Data were obtained relating to the site of aberrant segregation and the position of any associated crossover giving recombination of flanking markers. Aberrant segregation at a proximal site within the buff gene may be associated with a crossover proximal to the site of aberrant segregation or, with equal frequency, wit...
The HIVToolbox 2 web system integrates sequence, structure, function and mutation analysis.
Directory of Open Access Journals (Sweden)
David P Sargeant
Full Text Available There is enormous interest in studying HIV pathogenesis for improving the treatment of patients with HIV infection. HIV infection has become one of the best-studied systems for understanding how a virus can hijack a cell. To help facilitate discovery, we previously built HIVToolbox, a web system for visual data mining. The original HIVToolbox integrated information for HIV protein sequence, structure, functional sites, and sequence conservation. This web system has been used for almost 40,000 searches. We report improvements to HIVToolbox including new functions and workflows, data updates, and updates for ease of use. HIVToolbox2, is an improvement over HIVToolbox with new functions. HIVToolbox2 has new functionalities focused on HIV pathogenesis including drug-binding sites, drug-resistance mutations, and immune epitopes. The integrated, interactive view enables visual mining to generate hypotheses that are not readily revealed by other approaches. Most HIV proteins form multimers, and there are posttranslational modification and protein-protein interaction sites at many of these multimerization interfaces. Analysis of protease drug binding sites reveals an anatomy of drug resistance with different types of drug-resistance mutations regionally localized on the surface of protease. Some of these drug-resistance mutations have a high prevalence in specific HIV-1 M subtypes. Finally, consolidation of Tat functional sites reveals a hotspot region where there appear to be 30 interactions or posttranslational modifications. A cursory analysis with HIVToolbox2 has helped to identify several global patterns for HIV proteins. An initial analysis with this tool identifies homomultimerization of almost all HIV proteins, functional sites that overlap with multimerization sites, a global drug resistance anatomy for HIV protease, and specific distributions of some DRMs in specific HIV M subtypes. HIVToolbox2 is an open-access web application available at
Directory of Open Access Journals (Sweden)
S. Yu. Sokolov
2017-01-01
Full Text Available This article presents the first map showing the vertical amplitudes of modern disjunctive dislocations inNorthern Atlantic, based on the estimated phase shifts of reflected waves recorded by high-frequency seismic acoustic surveys. The amplitude distribution pattern is mosaic with alternating areas of compression and extension in the flanks of the Knipovich rift system. The modern structure of the Knipovich Ridge, including two strike-slip faults, represents a local rift in the pull-apart setting. The asymmetry of stresses and the presence of compression in the ridge flanks is evidenced by the distribution of the focal mechanisms of strong earthquakes related to reverse faults. In the southeastern Knipovich Ridge, tectonic activity is marked by the asymmetric pattern of the epicenters of small earthquakes.
Complete sequences of glucagon-like peptide-1 from human and pig small intestine
DEFF Research Database (Denmark)
Orskov, C; Bersani, M; Johnsen, A H
1989-01-01
intestine of the proglucagon precursor were determined by pairs of basic amino acid residues flanking the two peptides. Earlier studies have shown that synthetic glucagon-like peptide-1 (GLP-1) synthesized according to the proposed structure (proglucagon 71-108 or because residue 108 is Gly, 72-107 amide......) had no physiological effects, whereas a truncated from of GLP-1, corresponding to proglucagon 78-107 amide, strongly stimulated insulin secretion and depressed glucagon secretion. To determine the amino acid sequence of the naturally occurring peptide we isolated GLP-1 from human small intestine...
Directory of Open Access Journals (Sweden)
King Graham J
2010-10-01
Full Text Available Abstract Background The Multinational Brassica rapa Genome Sequencing Project (BrGSP has developed valuable genomic resources, including BAC libraries, BAC-end sequences, genetic and physical maps, and seed BAC sequences for Brassica rapa. An integrated linkage map between the amphidiploid B. napus and diploid B. rapa will facilitate the rapid transfer of these valuable resources from B. rapa to B. napus (Oilseed rape, Canola. Results In this study, we identified over 23,000 simple sequence repeats (SSRs from 536 sequenced BACs. 890 SSR markers (designated as BrGMS were developed and used for the construction of an integrated linkage map for the A genome in B. rapa and B. napus. Two hundred and nineteen BrGMS markers were integrated to an existing B. napus linkage map (BnaNZDH. Among these mapped BrGMS markers, 168 were only distributed on the A genome linkage groups (LGs, 18 distrubuted both on the A and C genome LGs, and 33 only distributed on the C genome LGs. Most of the A genome LGs in B. napus were collinear with the homoeologous LGs in B. rapa, although minor inversions or rearrangements occurred on A2 and A9. The mapping of these BAC-specific SSR markers enabled assignment of 161 sequenced B. rapa BACs, as well as the associated BAC contigs to the A genome LGs of B. napus. Conclusion The genetic mapping of SSR markers derived from sequenced BACs in B. rapa enabled direct links to be established between the B. napus linkage map and a B. rapa physical map, and thus the assignment of B. rapa BACs and the associated BAC contigs to the B. napus linkage map. This integrated genetic linkage map will facilitate exploitation of the B. rapa annotated genomic resources for gene tagging and map-based cloning in B. napus, and for comparative analysis of the A genome within Brassica species.
Integration deficiencies associated with continuous limb movement sequences in Parkinson's disease.
Park, Jin-Hoon; Stelmach, George E
2009-11-01
The present study examined the extent to which Parkinson's disease (PD) influences integration of continuous limb movement sequences. Eight patients with idiopathic PD and 8 age-matched normal subjects were instructed to perform repetitive sequential aiming movements to specified targets under three-accuracy constraints: 1) low accuracy (W = 7 cm) - minimal accuracy constraint, 2) high accuracy (W = 0.64 cm) - maximum accuracy constraint, and 3) mixed accuracy constraint - one target of high accuracy and another target of low accuracy. The characteristic of sequential movements in the low accuracy condition was mostly cyclical, whereas in the high accuracy condition it was discrete in both groups. When the accuracy constraint was mixed, the sequential movements were executed by assembling discrete and cyclical movements in both groups, suggesting that for PD patients the capability to combine discrete and cyclical movements to meet a task requirement appears to be intact. However, such functional linkage was not as pronounced as was in normal subjects. Close examination of movement from the mixed accuracy condition revealed marked movement hesitations in the vicinity of the large target in PD patients, resulting in a bias toward discrete movement. These results suggest that PD patients may have deficits in ongoing planning and organizing processes during movement execution when the tasks require to assemble various accuracy requirements into more complex movement sequences.
Determining injuries from posterior and flank stab wounds using computed tomography tractography.
Bansal, Vishal; Reid, Chris M; Fortlage, Dale; Lee, Jeanne; Kobayashi, Leslie; Doucet, Jay; Coimbra, Raul
2014-04-01
Unlike anterior stab wounds (SW), in which local exploration may direct management, posterior SW can be challenging to evaluate. Traditional triple contrast computed tomography (CT) imaging is cumbersome and technician-dependent. The present study examines the role of CT tractography as a strategy to manage select patients with back and flank SW. Hemodynamically stable patients with back and flank SW were studied. After resuscitation, Betadine- or Visipaque®-soaked sterile sponges were inserted into each SW for the estimated depth of the wound. Patients underwent abdominal helical CT scanning, including intravenous contrast, as the sole abdominal imaging study. Images were reviewed by an attending radiologist and trauma surgeon. The tractogram was evaluated to determine SW trajectory and injury to intra- or retroperitoneal organs, vascular structures, the diaphragm, and the urinary tract. Complete patient demographics including operative management and injuries were collected. Forty-one patients underwent CT tractography. In 11 patients, tractography detected violation of the intra- or retroperitoneal cavity leading to operative exploration. Injuries detected included: the spleen (two), colon (one), colonic mesentery (one), kidney (kidney), diaphragm (kidney), pneumothorax (seven), hemothorax (two), iliac artery (one), and traumatic abdominal wall hernia (two). In all patients, none had negative CT findings that failed observation. In this series, CT tractography is a safe and effective imaging strategy to evaluate posterior torso SW. It is unknown whether CT tractography is superior to traditional imaging modalities. Other uses for CT tractography may include determining trajectory from missile wounds and tangential penetrating injuries.
Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H
2012-04-27
To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.
International Nuclear Information System (INIS)
Finver, S.N.; Nishikura, K.; Finger, L.R.; Haluska, F.G.; Finan, J.; Nowell, P.C.; Croce, C.M.
1988-01-01
The authors cloned the translocation-associated and homologous normal MYC alleles from SKW-3, a leukemia T-cell line with the t(8; 14)(q24; q11) translocation, and determined the sequence of the MYC oncogene first exon and flanking 5' putative regulatory regions. S1 nuclease protection experiments utilizing a MYC first exon probe demonstrated transcriptional deregulation of the MYC gene associated with the T-cell receptor α locus on the 8q + chromosome of SKW-3 cells. Nucleotide sequence analysis of the translocation-associated (8q +) MYC allele identified a single base substitution within the upstream flanking region; the homologous nontranslocated allele contained an additional substitution and a two-base deletion. None of the deletions or substitutions localized to putative 5' regulatory regions. The MYC first exon sequence was germ line in both alleles. These results demonstrate that alterations within the putative 5' MYC regulatory regions are not necessarily involved in MYC deregulation in T-cell leukemias, and they show that juxtaposition of the T-cell receptor α locus to a germ-line MYC oncogene results in MYC deregulation
Automatic fitting of conical envelopes to free-form surfaces for flank CNC machining
Bo P.; Bartoň M.; Pottmann H.
2017-01-01
We propose a new algorithm to detect patches of free-form surfaces that can be well approximated by envelopes of a rotational cone under a rigid body motion. These conical envelopes are a preferable choice from the manufacturing point of view as they are, by-definition, manufacturable by computer numerically controlled (CNC) machining using the efficient flank (peripheral) method with standard conical tools. Our geometric approach exploits multi-valued vector fields that consist of vectors in...
Airborne sound insulation evaluation and flanking path prediction of coupled room
Tassia, R. D.; Asmoro, W. A.; Arifianto, D.
2016-11-01
One of the parameters to review the acoustic comfort is based on the value of the insulation partition in the classroom. The insulation value can be expressed by the sound transmission loss which converted into a single value as weighted sound reduction index (Rw, DnTw) and also have an additional sound correction factor in low frequency (C, Ctr) .In this study, the measurements were performed in two positions at each point using BSWA microphone and dodecahedron speaker as the sound source. The results of field measurements indicate the acoustic insulation values (DnT w + C) is 19.6 dB. It is noted that the partition wall not according to the standard which the DnTw + C> 51 dB. Hence the partition wall need to be redesign to improve acoustic insulation in the classroom. The design used gypsum board, plasterboard, cement board, and PVC as the replacement material. Based on the results, all the material is simulated in accordance with established standards. Best insulation is cement board with the insulation value is 69dB, the thickness of 12.5 mm on each side and the absorber material is 50 mm. Many factors lead to increase the value of acoustic insulation, such as the thickness of the panel, the addition of absorber material, density, and Poisson's ratio of a material. The prediction of flanking path can be estimated from noise reduction values at each measurement point in the class room. Based on data obtained, there is no significant change in noise reduction from each point so that the pathway of flanking is not affect the sound transmission in the classroom.
Institute of Scientific and Technical Information of China (English)
无
2002-01-01
An integrated approach to generation of precedence relations and precedence graphs for assembly sequence planning is presented, which contains more assembly flexibility. The approach involves two stages. Based on the assembly model, the components in the assembly can be divided into partially constrained components and completely constrained components in the first stage, and then geometric precedence relation for every component is generated automatically. According to the result of the first stage, the second stage determines and constructs all precedence graphs. The algorithms of these two stages proposed are verified by two assembly examples.
Nucleotide sequence and taxonomy of Cycas necrotic stunt virus. Brief report.
Han, S S; Karasev, A V; Ieki, H; Iwanami, T
2002-11-01
Cycas necrotic stunt virus (CNSV) is the only well-characterized virus from gymnosperm. cDNA segments corresponding to the bipartite genome RNAs (RNA1, RNA2) were synthesized and sequenced. Each RNA encoded a single polyprotein, flanked by the 5' and 3' non-coding regions (NCR) and followed by a poly (A) tail. The putative polyproteins encoded by RNA1 and RNA2 had sets of motifs, which were characteristic of viruses in the genus Nepovirus. The polyproteins showed higher sequence identities to Artichoke Italian latent virus, Grapevine chrome mosaic virus and Tomato black ring virus, all of which belong to subgroup b of the genus Nepovirus, than to other nepoviruses. Phylogenetic analysis of RNA dependent RNA polymerase and coat protein also showed closer relationships with these viruses than other viruses. The data obtained supported the taxonomical status of CNSV as a definitive member of the genus Nepovirus, subgroup b.
Surface waves on the tailward flanks of the Earth's magnetopause
Seon, J.; Frank, L. A.; Lazarus, A. J.; Lepping, R. P.
1995-01-01
Forty-three examples of ISEE 1 tailward flank side magnetopause crossings are examined and directly compared with upstream solar wind parameters. The crossings are classified into two groups. In the first group, a few sudden magnetopause crossings are observed, whereas repeated magnetopause crossings and oscillatory motions, often with boundary layer signatures, are observed in the second group. These distinctive characteristics of the two groups are interpreted in terms of the surface waves due to the Kelvin-Helmholtz instability. It is found that low solar wind speed tends to favor characteristics of the first group, whereas high solar wind speed yields those of the second group. However, no evident correlations between the groups and the interplanetary magnetic field directions are found.
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Lipman, P.W.; Coombs, M.L.
2006-01-01
The North Kona slump is an elliptical region, about 20 by 60 km (1000-km2 area), of multiple, geometrically intricate benches and scarps, mostly at water depths of 2000–4500 m, on the west flank of Hualalai Volcano. Two dives up steep scarps in the slump area were made in September 2001, using the ROV Kaiko of the Japan Marine Science and Technology Center (JAMSTEC), as part of a collaborative Japan–USA project to improve understanding of the submarine flanks of Hawaiian volcanoes. Both dives, at water depths of 2700–4000 m, encountered pillow lavas draping the scarp-and-bench slopes. Intact to only slightly broken pillow lobes and cylinders that are downward elongate dominate on the steepest mid-sections of scarps, while more equant and spherical pillow shapes are common near the tops and bases of scarps and locally protrude through cover of muddy sediment on bench flats. Notably absent are subaerially erupted Hualalai lava flows, interbedded hyaloclastite pillow breccia, and/or coastal sandy sediment that might have accumulated downslope from an active coastline. The general structure of the North Kona flank is interpreted as an intricate assemblage of downdropped lenticular blocks, bounded by steeply dipping normal faults. The undisturbed pillow-lava drape indicates that slumping occurred during shield-stage tholeiitic volcanism. All analyzed samples of the pillow-lava drape are tholeiite, similar to published analyses from the submarine northwest rift zone of Hualālai. Relatively low sulfur (330–600 ppm) and water (0.18–0.47 wt.%) contents of glass rinds suggest that the eruptive sources were in shallow water, perhaps 500–1000-m depth. In contrast, saturation pressures calculated from carbon dioxide concentrations (100–190 ppm) indicate deeper equilibration, at or near sample sites at water depths of − 3900 to − 2800 m. Either vents close to the sample sites erupted mixtures of undegassed and degassed magmas, or volatiles were resorbed from
International Nuclear Information System (INIS)
Letang, Jean-Michel
1993-01-01
This PhD thesis deals with the detection of moving objects in monocular image sequences. The first section presents the inherent problems of motion analysis in real applications. We propose a method robust to perturbations frequently encountered during acquisition of outdoor scenes. It appears three main directions for investigations, all of them pointing out the importance of the temporal axis, which is a specific dimension for motion analysis. In the first part, the image sequence is considered as a set of temporal signals. The temporal multi-scale decomposition enables the characterization of various dynamical behaviors of the objects being in the scene at a given instant. A second module integrates motion information. This elementary trajectography of moving objects provides a temporal prediction map, giving a confidence level of motion presence. Interactions between both sets of data are expressed within a statistical regularization. Markov random field models supply a formal framework to convey a priori knowledge of the primitives to be evaluated. A calibration method with qualitative boxes is presented to estimate model parameters. Our approach requires only simple computations and leads to a rather fast algorithm, that we evaluate in the last section over various typical sequences. (author) [fr
Nucleotide sequence of a human tRNA gene heterocluster
International Nuclear Information System (INIS)
Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.
1986-01-01
Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues
Description of the PMAD DC test bed architecture and integration sequence
Beach, R. F.; Trash, L.; Fong, D.; Bolerjack, B.
1991-01-01
NASA-LEWIS is responsible for the development, fabrication, and assembly of the electric power system (EPS) for the Space Station Freedom (SSF). The SSF power system is radically different from previous spacecraft power systems in both the size and complexity of the system. Unlike past spacecraft power systems, the SSF EPS will grow and be maintained on orbit and must be flexible to meet challenging user power needs. The SSF power system is also unique in comparison with terrestrial power systems because it is dominated by power electronic converters which regulate and control the power. A description is provided of the Power Management and Distribution DC Testbed which was assembled to support the design and early evaluation of the SSF EPS. A description of the integration process used in the assembly sequence is also given along with a description of the support facility.
Loughlin, N.J.D.; Gosling, W.D.; Coe, A.L.; Gulliver, P.; Mothes, P.; Montoya, E.
2018-01-01
Understanding the impact of landscape-scale disturbance events during the last glacial period is vital in accurately reconstructing the ecosystem dynamics of montane environments. Here, a sedimentary succession from the tropical montane cloud forest of the eastern Andean flank of Ecuador provides
Zhao, Panpan; Zhong, Jiayong; Liu, Wanting; Zhao, Jing; Zhang, Gong
2017-12-01
Multiple search engines based on various models have been developed to search MS/MS spectra against a reference database, providing different results for the same data set. How to integrate these results efficiently with minimal compromise on false discoveries is an open question due to the lack of an independent, reliable, and highly sensitive standard. We took the advantage of the translating mRNA sequencing (RNC-seq) result as a standard to evaluate the integration strategies of the protein identifications from various search engines. We used seven mainstream search engines (Andromeda, Mascot, OMSSA, X!Tandem, pFind, InsPecT, and ProVerB) to search the same label-free MS data sets of human cell lines Hep3B, MHCCLM3, and MHCC97H from the Chinese C-HPP Consortium for Chromosomes 1, 8, and 20. As expected, the union of seven engines resulted in a boosted false identification, whereas the intersection of seven engines remarkably decreased the identification power. We found that identifications of at least two out of seven engines resulted in maximizing the protein identification power while minimizing the ratio of suspicious/translation-supported identifications (STR), as monitored by our STR index, based on RNC-Seq. Furthermore, this strategy also significantly improves the peptides coverage of the protein amino acid sequence. In summary, we demonstrated a simple strategy to significantly improve the performance for shotgun mass spectrometry by protein-level integrating multiple search engines, maximizing the utilization of the current MS spectra without additional experimental work.
Dutta, Tanima
This dissertation focuses on the link between seismic amplitudes and reservoir properties. Prediction of reservoir properties, such as sorting, sand/shale ratio, and cement-volume from seismic amplitudes improves by integrating knowledge from multiple disciplines. The key contribution of this dissertation is to improve the prediction of reservoir properties by integrating sequence stratigraphy and rock physics. Sequence stratigraphy has been successfully used for qualitative interpretation of seismic amplitudes to predict reservoir properties. Rock physics modeling allows quantitative interpretation of seismic amplitudes. However, often there is uncertainty about selecting geologically appropriate rock physics model and its input parameters, away from the wells. In the present dissertation, we exploit the predictive power of sequence stratigraphy to extract the spatial trends of sedimentological parameters that control seismic amplitudes. These spatial trends of sedimentological parameters can serve as valuable constraints in rock physics modeling, especially away from the wells. Consequently, rock physics modeling, integrated with the trends from sequence stratigraphy, become useful for interpreting observed seismic amplitudes away from the wells in terms of underlying sedimentological parameters. We illustrate this methodology using a comprehensive dataset from channelized turbidite systems, deposited in minibasin settings in the offshore Equatorial Guinea, West Africa. First, we present a practical recipe for using closed-form expressions of effective medium models to predict seismic velocities in unconsolidated sandstones. We use an effective medium model that combines perfectly rough and smooth grains (the extended Walton model), and use that model to derive coordination number, porosity, and pressure relations for P and S wave velocities from experimental data. Our recipe provides reasonable fits to other experimental and borehole data, and specifically
Anatomy of the blood supply [by the circumflexa ilium profunda artery] to the flank of the sheep
International Nuclear Information System (INIS)
Zoltie, N.; Hynd, P.I.; Kuchel, T.
1988-01-01
The anatomy of the circumflexa ilium profunda artery supplying the flank of the sheep was investigated in 25 sheep. Two constant branches were identified by dissection and angiography, and the cutaneous areas they supply identified. The arterial system was used successfully in 2 separate experiments
Groves, Ian J; Coleman, Nicholas
2018-05-01
Human papillomavirus (HPV) infection is associated with ∼5% of all human cancers, including a range of squamous cell carcinomas. Persistent infection by high-risk HPVs (HRHPVs) is associated with the integration of virus genomes (which are usually stably maintained as extrachromosomal episomes) into host chromosomes. Although HRHPV integration rates differ across human sites of infection, this process appears to be an important event in HPV-associated neoplastic progression, leading to deregulation of virus oncogene expression, host gene expression modulation, and further genomic instability. However, the mechanisms by which HRHPV integration occur and by which the subsequent gene expression changes take place are incompletely understood. The advent of next-generation sequencing (NGS) of both RNA and DNA has allowed powerful interrogation of the association of HRHPVs with human disease, including precise determination of the sites of integration and the genomic rearrangements at integration loci. In turn, these data have indicated that integration occurs through two main mechanisms: looping integration and direct insertion. Improved understanding of integration sites is allowing further investigation of the factors that provide a competitive advantage to some integrants during disease progression. Furthermore, advanced approaches to the generation of genome-wide samples have given novel insights into the three-dimensional interactions within the nucleus, which could act as another layer of epigenetic control of both virus and host transcription. It is hoped that further advances in NGS techniques and analysis will not only allow the examination of further unanswered questions regarding HPV infection, but also direct new approaches to treating HPV-associated human disease. Copyright © 2018 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2018 Pathological Society of Great Britain and Ireland. Published by John
BALSA: integrated secondary analysis for whole-genome and whole-exome sequencing, accelerated by GPU
Directory of Open Access Journals (Sweden)
Ruibang Luo
2014-06-01
Full Text Available This paper reports an integrated solution, called BALSA, for the secondary analysis of next generation sequencing data; it exploits the computational power of GPU and an intricate memory management to give a fast and accurate analysis. From raw reads to variants (including SNPs and Indels, BALSA, using just a single computing node with a commodity GPU board, takes 5.5 h to process 50-fold whole genome sequencing (∼750 million 100 bp paired-end reads, or just 25 min for 210-fold whole exome sequencing. BALSA’s speed is rooted at its parallel algorithms to effectively exploit a GPU to speed up processes like alignment, realignment and statistical testing. BALSA incorporates a 16-genotype model to support the calling of SNPs and Indels and achieves competitive variant calling accuracy and sensitivity when compared to the ensemble of six popular variant callers. BALSA also supports efficient identification of somatic SNVs and CNVs; experiments showed that BALSA recovers all the previously validated somatic SNVs and CNVs, and it is more sensitive for somatic Indel detection. BALSA outputs variants in VCF format. A pileup-like SNAPSHOT format, while maintaining the same fidelity as BAM in variant calling, enables efficient storage and indexing, and facilitates the App development of downstream analyses. BALSA is available at: http://sourceforge.net/p/balsa.
Luo, Ruibang; Wong, Yiu-Lun; Law, Wai-Chun; Lee, Lap-Kei; Cheung, Jeanno; Liu, Chi-Man; Lam, Tak-Wah
2014-01-01
This paper reports an integrated solution, called BALSA, for the secondary analysis of next generation sequencing data; it exploits the computational power of GPU and an intricate memory management to give a fast and accurate analysis. From raw reads to variants (including SNPs and Indels), BALSA, using just a single computing node with a commodity GPU board, takes 5.5 h to process 50-fold whole genome sequencing (∼750 million 100 bp paired-end reads), or just 25 min for 210-fold whole exome sequencing. BALSA's speed is rooted at its parallel algorithms to effectively exploit a GPU to speed up processes like alignment, realignment and statistical testing. BALSA incorporates a 16-genotype model to support the calling of SNPs and Indels and achieves competitive variant calling accuracy and sensitivity when compared to the ensemble of six popular variant callers. BALSA also supports efficient identification of somatic SNVs and CNVs; experiments showed that BALSA recovers all the previously validated somatic SNVs and CNVs, and it is more sensitive for somatic Indel detection. BALSA outputs variants in VCF format. A pileup-like SNAPSHOT format, while maintaining the same fidelity as BAM in variant calling, enables efficient storage and indexing, and facilitates the App development of downstream analyses. BALSA is available at: http://sourceforge.net/p/balsa.
Reinforcing Deterrence on NATO’s Eastern Flank: Wargaming the Defense of the Baltics
2016-01-01
SUMMARY ■ C O R P O R A T I O N Reinforcing Deterrence on NATO’s Eastern Flank Wargaming the Defense of the Baltics David A. Shlapak and Michael...and stability between Moscow and its Western neighbors and raised concerns about its larger intentions. From the perspective of the North Atlantic...After eastern Ukraine, the next most likely targets for an attempted Russian coercion are the Baltic Republics of Estonia, Latvia, and Lithuania
Directory of Open Access Journals (Sweden)
Lucy F Stead
Full Text Available Squamous cell carcinoma (SCC of the lung kills over 350,000 people annually worldwide, and is the main lung cancer histotype with no targeted treatments. High-coverage whole-genome sequencing of the other main subtypes, small-cell and adenocarcinoma, gave insights into carcinogenic mechanisms and disease etiology. The genomic complexity within the lung SCC subtype, as revealed by The Cancer Genome Atlas, means this subtype is likely to benefit from a more integrated approach in which the transcriptional consequences of somatic mutations are simultaneously inspected. Here we present such an approach: the integrated analysis of deep sequencing data from both the whole genome and whole transcriptome (coding and non-coding of LUDLU-1, a SCC lung cell line. Our results show that LUDLU-1 lacks the mutational signature that has been previously associated with tobacco exposure in other lung cancer subtypes, and suggests that DNA-repair efficiency is adversely affected; LUDLU-1 contains somatic mutations in TP53 and BRCA2, allelic imbalance in the expression of two cancer-associated BRCA1 germline polymorphisms and reduced transcription of a potentially endogenous PARP2 inhibitor. Functional assays were performed and compared with a control lung cancer cell line. LUDLU-1 did not exhibit radiosensitisation or an increase in sensitivity to PARP inhibitors. However, LUDLU-1 did exhibit small but significant differences with respect to cisplatin sensitivity. Our research shows how integrated analyses of high-throughput data can generate hypotheses to be tested in the lab.
Directory of Open Access Journals (Sweden)
Gao Zhihong
2010-07-01
Full Text Available Abstract Background Expressed Sequence Tag (EST has been a cost-effective tool in molecular biology and represents an abundant valuable resource for genome annotation, gene expression, and comparative genomics in plants. Results In this study, we constructed a cDNA library of Prunus mume flower and fruit, sequenced 10,123 clones of the library, and obtained 8,656 expressed sequence tag (EST sequences with high quality. The ESTs were assembled into 4,473 unigenes composed of 1,492 contigs and 2,981 singletons and that have been deposited in NCBI (accession IDs: GW868575 - GW873047, among which 1,294 unique ESTs were with known or putative functions. Furthermore, we found 1,233 putative simple sequence repeats (SSRs in the P. mume unigene dataset. We randomly tested 42 pairs of PCR primers flanking potential SSRs, and 14 pairs were identified as true-to-type SSR loci and could amplify polymorphic bands from 20 individual plants of P. mume. We further used the 14 EST-SSR primer pairs to test the transferability on peach and plum. The result showed that nearly 89% of the primer pairs produced target PCR bands in the two species. A high level of marker polymorphism was observed in the plum species (65% and low in the peach (46%, and the clustering analysis of the three species indicated that these SSR markers were useful in the evaluation of genetic relationships and diversity between and within the Prunus species. Conclusions We have constructed the first cDNA library of P. mume flower and fruit, and our data provide sets of molecular biology resources for P. mume and other Prunus species. These resources will be useful for further study such as genome annotation, new gene discovery, gene functional analysis, molecular breeding, evolution and comparative genomics between Prunus species.
Li, Ming; Wang, Rui; Xiang, Hua
2014-06-01
The prokaryotic immune system CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated genes) adapts to foreign invaders by acquiring their short deoxyribonucleic acid (DNA) fragments as spacers, which guide subsequent interference to foreign nucleic acids based on sequence matching. The adaptation mechanism avoiding acquiring 'self' DNA fragments is poorly understood. In Haloarcula hispanica, we previously showed that CRISPR adaptation requires being primed by a pre-existing spacer partially matching the invader DNA. Here, we further demonstrate that flanking a fully-matched target sequence, a functional PAM (protospacer adjacent motif) is still required to prime adaptation. Interestingly, interference utilizes only four PAM sequences, whereas adaptation-priming tolerates as many as 23 PAM sequences. This relaxed PAM selectivity explains how adaptation-priming maximizes its tolerance of PAM mutations (that escape interference) while avoiding mis-targeting the spacer DNA within CRISPR locus. We propose that the primed adaptation, which hitches and cooperates with the interference pathway, distinguishes target from non-target by CRISPR ribonucleic acid guidance and PAM recognition. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Tweedy, Joshua; Spyrou, Maria Alexandra; Pearson, Max; Lassner, Dirk; Kuhl, Uwe; Gompels, Ursula A
2016-01-15
Human herpesvirus-6A and B (HHV-6A, HHV-6B) have recently defined endogenous genomes, resulting from integration into the germline: chromosomally-integrated "CiHHV-6A/B". These affect approximately 1.0% of human populations, giving potential for virus gene expression in every cell. We previously showed that CiHHV-6A was more divergent than CiHHV-6B by examining four genes in 44 European CiHHV-6A/B cardiac/haematology patients. There was evidence for gene expression/reactivation, implying functional non-defective genomes. To further define the relationship between HHV-6A and CiHHV-6A we used next-generation sequencing to characterize genomes from three CiHHV-6A cardiac patients. Comparisons to known exogenous HHV-6A showed CiHHV-6A genomes formed a separate clade; including all 85 non-interrupted genes and necessary cis-acting signals for reactivation as infectious virus. Greater single nucleotide polymorphism (SNP) density was defined in 16 genes and the direct repeats (DR) terminal regions. Using these SNPs, deep sequencing analyses demonstrated superinfection with exogenous HHV-6A in two of the CiHHV-6A patients with recurrent cardiac disease. Characterisation of the integration sites in twelve patients identified the human chromosome 17p subtelomere as a prevalent site, which had specific repeat structures and phylogenetically related CiHHV-6A coding sequences indicating common ancestral origins. Overall CiHHV-6A genomes were similar, but distinct from known exogenous HHV-6A virus, and have the capacity to reactivate as emerging virus infections.
The sequence, structure and evolutionary features of HOTAIR in mammals
2011-01-01
Background An increasing number of long noncoding RNAs (lncRNAs) have been identified recently. Different from all the others that function in cis to regulate local gene expression, the newly identified HOTAIR is located between HoxC11 and HoxC12 in the human genome and regulates HoxD expression in multiple tissues. Like the well-characterised lncRNA Xist, HOTAIR binds to polycomb proteins to methylate histones at multiple HoxD loci, but unlike Xist, many details of its structure and function, as well as the trans regulation, remain unclear. Moreover, HOTAIR is involved in the aberrant regulation of gene expression in cancer. Results To identify conserved domains in HOTAIR and study the phylogenetic distribution of this lncRNA, we searched the genomes of 10 mammalian and 3 non-mammalian vertebrates for matches to its 6 exons and the two conserved domains within the 1800 bp exon6 using Infernal. There was just one high-scoring hit for each mammal, but many low-scoring hits were found in both mammals and non-mammalian vertebrates. These hits and their flanking genes in four placental mammals and platypus were examined to determine whether HOTAIR contained elements shared by other lncRNAs. Several of the hits were within unknown transcripts or ncRNAs, many were within introns of, or antisense to, protein-coding genes, and conservation of the flanking genes was observed only between human and chimpanzee. Phylogenetic analysis revealed discrete evolutionary dynamics for orthologous sequences of HOTAIR exons. Exon1 at the 5' end and a domain in exon6 near the 3' end, which contain domains that bind to multiple proteins, have evolved faster in primates than in other mammals. Structures were predicted for exon1, two domains of exon6 and the full HOTAIR sequence. The sequence and structure of two fragments, in exon1 and the domain B of exon6 respectively, were identified to robustly occur in predicted structures of exon1, domain B of exon6 and the full HOTAIR in mammals
Directory of Open Access Journals (Sweden)
Takashi Irie
2012-01-01
Full Text Available The M40 VSV recombinant was engineered to contain overlapping PTAP and PPxY L-domain motifs and flanking residues from the VP40 protein of Ebola virus. Replication of M40 in cell culture is virtually indistinguishable from that of control viruses. However, the presence of the Ebola PTAP motif in the M40 recombinant enabled this virus to interact with and recruit host Tsg101, which was packaged into M40 virions. In this brief report, we compared replication and the pathogenic profiles of M40 and the parental virus M51R in mice to determine whether the presence of the Ebola L-domains and flanking residues altered in vivo characteristics of the virus. Overall, the in vivo characteristics of M40 were similar to those of the parental M51R virus, indicating that the Ebola sequences did not alter pathogenesis of VSV in this small animal model of infection.
The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine
International Nuclear Information System (INIS)
Nuc, K.; Nuc, P.; Pawelkiewicz, J.
1993-01-01
We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs
Chen, Zhuo-Yu; Gan, Jian-Kang; Xiao, Xiong; Jiang, Li-Yan; Zhang, Xi-Quan; Luo, Qing-Bin
2013-09-01
Thermo stress induces heat shock proteins (HSPs) expression and HSP90 family is one of them that has been reported to involve in cellular protection against heat stress. But whether there is any association of genetic variation in the Hsp90β gene in chicken with thermo tolerance is still unknown. Direct sequencing was used to detect possible SNPs in Hsp90β gene 5' flanking region in 3 chicken breeds (n = 663). Six mutations, among which 2 SNPs were chosen and genotypes were analyzed with PCR-RFLP method, were found in Hsp90β gene in these 3 chicken breeds. Association analysis indicated that SNP of C.-141G>A in the 5' flanking region of the Hsp90β gene in chicken had some effect on thermo tolerance traits, which may be a potential molecular marker of thermo tolerance, and the genotype GG was the thermo tolerance genotype. Hsp90β gene mRNA expression in different tissues detected by quantitative real-time PCR assay were demonstrated to be tissue dependent, implying that different tissues have distinct sensibilities to thermo stress. Besides, it was shown time specific and varieties differences. The expression of Hsp90β mRNA in Lingshan chickens in some tissues including heart, liver, brain and spleen were significantly higher or lower than that of White Recessive Rock (WRR). In this study, we presume that these mutations could be used in marker assisted selection for anti-heat stress chickens in our breeding program, and WRR were vulnerable to tropical thermo stress whereas Lingshan chickens were well adapted.
Geomorphology of the north flank of the Uinta Mountains
Bradley, W.H.
1936-01-01
The Uinta Mountains, whose northern margin is almost coincident with the southern boundary of Wyoming, extend from the Wasatch Range eastward across the northern part of Utah into northwestern Colorado. They were carved out of a large, simple anticlinal fold of sedimentary rocks arched up into essentially their present attitude at the end of the Cretaceous period. The Uinta Mountain group (Uinta quartzite of previous reports) a series of brick-red to purplish-red quartzite and sandstone beds of pre-Cambrian age, aggregating more than 12,000 feet in thickness, makes up the central mass of the range. Flanking the quartzite core and sharing its anticlinal structure are beds of limestone, sandstone, and shale ranging in age from Upper or Middle Cambrian to Upper Cretaceous. These rocks, which have a total thickness of about 15,000 feet, have been eroded from the higher part of the range, so the upturned edges of the harder
Li, Miaoxin; Li, Jiang; Li, Mulin Jun; Pan, Zhicheng; Hsu, Jacob Shujui; Liu, Dajiang J; Zhan, Xiaowei; Wang, Junwen; Song, Youqiang; Sham, Pak Chung
2017-05-19
Whole genome sequencing (WGS) is a promising strategy to unravel variants or genes responsible for human diseases and traits. However, there is a lack of robust platforms for a comprehensive downstream analysis. In the present study, we first proposed three novel algorithms, sequence gap-filled gene feature annotation, bit-block encoded genotypes and sectional fast access to text lines to address three fundamental problems. The three algorithms then formed the infrastructure of a robust parallel computing framework, KGGSeq, for integrating downstream analysis functions for whole genome sequencing data. KGGSeq has been equipped with a comprehensive set of analysis functions for quality control, filtration, annotation, pathogenic prediction and statistical tests. In the tests with whole genome sequencing data from 1000 Genomes Project, KGGSeq annotated several thousand more reliable non-synonymous variants than other widely used tools (e.g. ANNOVAR and SNPEff). It took only around half an hour on a small server with 10 CPUs to access genotypes of ∼60 million variants of 2504 subjects, while a popular alternative tool required around one day. KGGSeq's bit-block genotype format used 1.5% or less space to flexibly represent phased or unphased genotypes with multiple alleles and achieved a speed of over 1000 times faster to calculate genotypic correlation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Spradling, A C; Stern, D M; Kiss, I; Roote, J; Laverty, T; Rubin, G M
1995-01-01
Biologists require genetic as well as molecular tools to decipher genomic information and ultimately to understand gene function. The Berkeley Drosophila Genome Project is addressing these needs with a massive gene disruption project that uses individual, genetically engineered P transposable elements to target open reading frames throughout the Drosophila genome. DNA flanking the insertions is sequenced, thereby placing an extensive series of genetic markers on the physical genomic map and a...
A-integrable martingale sequences and Walsh series
International Nuclear Information System (INIS)
Skvortsov, V A
2001-01-01
A sufficient condition for a Walsh series converging to an A-integrable function f to be the A-Fourier's series of f is stated in terms of uniform A-integrability of a martingale subsequence of partial sums of the Walsh series. Moreover, the existence is proved of a Walsh series that converges almost everywhere to an A-integrable function and is not the A-Fourier series of its sum
Portland Project Committee, OR.
This teacher's guide includes parts one and two of the four-part third year Portland Project, a three-year integrated secondary science curriculum sequence. The Harvard Project Physics textbook is used for reading assignments for part one. Assignments relate to waves, light, electricity, magnetic fields, Faraday and the electrical age,…
Energy Technology Data Exchange (ETDEWEB)
Lace, M. J.; Kambesis, P. N.; Mylroie, J. E.
2016-07-01
Isla de Mona, a small, uplifted carbonate plateau jutting out of the waters of the Mona Passage, is an incredibly fragile and densely karstic environment. Expedition work was conducted by the Isla de Mona Project in cooperation with the Departamento Recursos Naturales y Ambientales de Puerto Rico (DRNA), including contributions from many researchers and cavers volunteering from across the U.S and Puerto Rico in the course of 12 separate expeditions, spanning a 14 year period (1998 to 2013). Over 200 caves have been documented on the island to date, the majority of this inventory is composed of flank margin caves but also includes sea caves, pit caves and talus caves. The most extensive example of cave development on the island is Sistema Faro - a sprawling maze-like series of chambers formed within the eastern point of the island with over 40 cliffside entrances overlooking the Caribbean Sea. Detailed cartography and analysis of the geomorphology and development of the Sistema Faro has helped form a complex model of carbonate island cave development as a function of tectonic uplift, lithology, sea level changes, karst hydrogeology and cliff retreat. This communication examines the roles these controls have played in the genesis of the world's largest flank margin cave. (Author)
Retroviral DNA Integration Directed by HIV Integration Protein in Vitro
Bushman, Frederic D.; Fujiwara, Tamio; Craigie, Robert
1990-09-01
Efficient retroviral growth requires integration of a DNA copy of the viral RNA genome into a chromosome of the host. As a first step in analyzing the mechanism of integration of human immunodeficiency virus (HIV) DNA, a cell-free system was established that models the integration reaction. The in vitro system depends on the HIV integration (IN) protein, which was partially purified from insect cells engineered to express IN protein in large quantities. Integration was detected in a biological assay that scores the insertion of a linear DNA containing HIV terminal sequences into a λ DNA target. Some integration products generated in this assay contained five-base pair duplications of the target DNA at the recombination junctions, a characteristic of HIV integration in vivo; the remaining products contained aberrant junctional sequences that may have been produced in a variation of the normal reaction. These results indicate that HIV IN protein is the only viral protein required to insert model HIV DNA sequences into a target DNA in vitro.
International Nuclear Information System (INIS)
Caselmann, W.H.; Meyer, M.; Kekule, A.S.; Lauer, U.; Hofschneider, P.H.; Koshy, R.
1990-01-01
The X gene of wild-type hepatitis B virus or integrated DNA has recently been shown to stimulate transcription of a variety of enhancers and promoters. To further delineate the viral sequences responsible for trans-activation in hepatomas, the authors cloned the single hepatitis B virus insert from human hepatocellular carcinoma DNA M1. The plasmid pM1 contains 2004 base of hepatitis B virus DNA subtype adr, including truncated preS/S sequences and the enhancer element. The X promoter and 422 nucleotides of the X coding region are present. The entire preC/C gene is deleted. In transient cotransfection assays using Chang liver cells (CCL 13), pM1 DNA exerts a 6- to 10-fold trans-activating effect on the expression of the pSV2CAT reporter plasmid. The transactivation occurs by stimulation of transcription and is dependent on the simian virus 40 enhancer in the reporter plasmid. Deletion analysis of pM1 subclones reveals that the transactivator is encoded by preS/S and not by X sequences. A frameshift mutation within the preS2 open reading frame shows that this portion is indispensable for the trans-activating function. Initiation of transcription has been mapped to the S1 promoter. A comparable trans-activating effect is also observed with cloned wild-type hepatitis B virus sequences similarly truncated. These results show that a transcriptional trans-activator function not present in the intact gene is generated by 3' truncation of integrated hepatitis B virus DNA preS/S sequences
Nonparametric combinatorial sequence models.
Wauthier, Fabian L; Jordan, Michael I; Jojic, Nebojsa
2011-11-01
This work considers biological sequences that exhibit combinatorial structures in their composition: groups of positions of the aligned sequences are "linked" and covary as one unit across sequences. If multiple such groups exist, complex interactions can emerge between them. Sequences of this kind arise frequently in biology but methodologies for analyzing them are still being developed. This article presents a nonparametric prior on sequences which allows combinatorial structures to emerge and which induces a posterior distribution over factorized sequence representations. We carry out experiments on three biological sequence families which indicate that combinatorial structures are indeed present and that combinatorial sequence models can more succinctly describe them than simpler mixture models. We conclude with an application to MHC binding prediction which highlights the utility of the posterior distribution over sequence representations induced by the prior. By integrating out the posterior, our method compares favorably to leading binding predictors.
Single-cell sequencing to quantify genomic integrity in cancer
van den Bos, Hilda; Bakker, Bjorn; Spierings, Diana C J; Lansdorp, Peter M; Foijer, Floris
The use of single-cell DNA sequencing (sc-seq) techniques for the diagnosis, prognosis and treatment of cancer is a rapidly developing field. Sc-seq research is gaining momentum by decreased sequencing costs and continuous improvements in techniques. In this review, we provide an overview of recent
El-Bestawy, Ebtesam; El-Sokkary, Ibrahim; Hussein, Hany; Keela, Alaa Farouk Abu
2008-11-01
The main objective of the present study was to improve the quality of pulp and paper industrial wastewater of two local mills RAKTA and El-Ahlia, Alexandria, Egypt, and to bring their pollutant contents to safe discharge levels. Quality improvement was carried out using integrated chemical and biological treatment approaches after their optimization. Chemical treatment (alum, lime, and ferric chloride) was followed by oxidation using hydrogen peroxide and finally biological treatment using activated sludge (90 min for RAKTA and 60 min for El-Ahlia effluents). Chemical coagulation produced low-quality effluents, while pH adjustment during coagulation treatment did not enhance the quality of the effluents. Maximum removal of the tested pollutants was achieved using the integrated treatment and the pollutants recorded residual concentrations (RCs) of 34.67, 17.33, 0.13, and 0.43 mg/l and 15.0, 11.0, 0.0, and 0.13 mg/l for chemical oxygen demand (COD), biochemical oxygen demand (BOD5), tannin and lignin, and silica in RAKTA and El-Ahlia effluents, respectively, all of which were below their maximum permissible limits (MPLs) for the safe discharge into water courses. Specific oxygen uptake rate (SOUR) and sludge volume index (SVI) values reflect good conditions and healthy activated sludge. Based on the previous results, optimized conditions were applied as bench scale on the raw effluents of RAKTA and El-Ahlia via the batch chemical and the biological treatment sequences proposed. For RAKTA effluents, the sequence was as follows: (1) coagulation with 375 mg/l FeCl3, (2) oxidation with 50 mg/l hydrogen peroxide, and (3) biological treatment using activated sludge with 2,000 mg/l initial concentration and 90 min hydraulic retention time (HRT), while for El-Ahlia raw effluents, the sequence was (1) coagulation with 250 mg/l FeCl3, (2) oxidation with 45 mg/l hydrogen peroxide, and (3) biological treatment using activated sludge with 2,000 mg/l initial concentration and 60
Pilla, Giulia; McVicker, Gareth; Tang, Christoph M
2017-09-01
Acquisition of a single copy, large virulence plasmid, pINV, led to the emergence of Shigella spp. from Escherichia coli. The plasmid encodes a Type III secretion system (T3SS) on a 30 kb pathogenicity island (PAI), and is maintained in a bacterial population through a series of toxin:antitoxin (TA) systems which mediate post-segregational killing (PSK). The T3SS imposes a significant cost on the bacterium, and strains which have lost the plasmid and/or genes encoding the T3SS grow faster than wild-type strains in the laboratory, and fail to bind the indicator dye Congo Red (CR). Our aim was to define the molecular events in Shigella flexneri that cause loss of Type III secretion (T3S), and to examine whether TA systems exert positional effects on pINV. During growth at 37°C, we found that deletions of regions of the plasmid including the PAI lead to the emergence of CR-negative colonies; deletions occur through intra-molecular recombination events between insertion sequences (ISs) flanking the PAI. Furthermore, by repositioning MvpAT (which belongs to the VapBC family of TA systems) near the PAI, we demonstrate that the location of this TA system alters the rearrangements that lead to loss of T3S, indicating that MvpAT acts both globally (by reducing loss of pINV through PSK) as well as locally (by preventing loss of adjacent sequences). During growth at environmental temperatures, we show for the first time that pINV spontaneously integrates into different sites in the chromosome, and this is mediated by inter-molecular events involving IS1294. Integration leads to reduced PAI gene expression and impaired secretion through the T3SS, while excision of pINV from the chromosome restores T3SS function. Therefore, pINV integration provides a reversible mechanism for Shigella to circumvent the metabolic burden imposed by pINV. Intra- and inter-molecular events between ISs, which are abundant in Shigella spp., mediate plasticity of S. flexneri pINV.
Cost analysis of different protocols for imaging a patient with acute flank pain
International Nuclear Information System (INIS)
Grisi, G.; Stacul, F.; Cuttin, R.; Rimondini, A.; Meduri, S.; Dalla Palma, L.
2000-01-01
The aim of this study was to analyse the costs of different diagnostic approaches to patients with acute flank pain. Four different diagnostic approaches were considered: (a) spiral CT without contrast medium (CM); (b) plain film, ultrasonography (US) and intravenous urography (IVU) - the latter procedure is used in our department in cases still unsolved following the former investigations (28 % in our experience); (c) plain film, US and spiral CT without CM (as an alternative to IVU in 28 % of cases); and (d) IVU. The cost of each procedure in a university hospital was calculated, following analysis of the differential costs of each investigation (equipment, depreciation and maintenance costs, related materials and services, radiologists, radiographers, nurses) and their common costs (auxiliary personnel and indirect internal costs). Finally, we calculated the full cost of each procedure and applied it to the different diagnostic approaches. The full cost of each approach was: (a) spiral CT without CM = 74 Euro; (b) plain film, US and IVU (28 %) = 66.89 Euro; (c) plain film, US and spiral CT without CM (28 %) = 64.93 Euro; (d) IVU = 80.90 Euro. Intravenous urography alone or in unsolved cases is not to be considered because it provides higher costs and worse diagnostic results, whereas X-ray dose to patient is almost equal between IVU and spiral CT. Spiral CT integrated to plain film and US in unsolved cases could be preferred because of lower cost and dose to patient, though reaching a diagnostic conclusion may take longer than an immediate spiral CT. (orig.)
Computational identification of MoRFs in protein sequences.
Malhis, Nawar; Gsponer, Jörg
2015-06-01
Intrinsically disordered regions of proteins play an essential role in the regulation of various biological processes. Key to their regulatory function is the binding of molecular recognition features (MoRFs) to globular protein domains in a process known as a disorder-to-order transition. Predicting the location of MoRFs in protein sequences with high accuracy remains an important computational challenge. In this study, we introduce MoRFCHiBi, a new computational approach for fast and accurate prediction of MoRFs in protein sequences. MoRFCHiBi combines the outcomes of two support vector machine (SVM) models that take advantage of two different kernels with high noise tolerance. The first, SVMS, is designed to extract maximal information from the general contrast in amino acid compositions between MoRFs, their surrounding regions (Flanks), and the remainders of the sequences. The second, SVMT, is used to identify similarities between regions in a query sequence and MoRFs of the training set. We evaluated the performance of our predictor by comparing its results with those of two currently available MoRF predictors, MoRFpred and ANCHOR. Using three test sets that have previously been collected and used to evaluate MoRFpred and ANCHOR, we demonstrate that MoRFCHiBi outperforms the other predictors with respect to different evaluation metrics. In addition, MoRFCHiBi is downloadable and fast, which makes it useful as a component in other computational prediction tools. http://www.chibi.ubc.ca/morf/. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Tweedy, Joshua; Spyrou, Maria Alexandra; Pearson, Max; Lassner, Dirk; Kuhl, Uwe; Gompels, Ursula A.
2016-01-01
Human herpesvirus-6A and B (HHV-6A, HHV-6B) have recently defined endogenous genomes, resulting from integration into the germline: chromosomally-integrated “CiHHV-6A/B”. These affect approximately 1.0% of human populations, giving potential for virus gene expression in every cell. We previously showed that CiHHV-6A was more divergent than CiHHV-6B by examining four genes in 44 European CiHHV-6A/B cardiac/haematology patients. There was evidence for gene expression/reactivation, implying functional non-defective genomes. To further define the relationship between HHV-6A and CiHHV-6A we used next-generation sequencing to characterize genomes from three CiHHV-6A cardiac patients. Comparisons to known exogenous HHV-6A showed CiHHV-6A genomes formed a separate clade; including all 85 non-interrupted genes and necessary cis-acting signals for reactivation as infectious virus. Greater single nucleotide polymorphism (SNP) density was defined in 16 genes and the direct repeats (DR) terminal regions. Using these SNPs, deep sequencing analyses demonstrated superinfection with exogenous HHV-6A in two of the CiHHV-6A patients with recurrent cardiac disease. Characterisation of the integration sites in twelve patients identified the human chromosome 17p subtelomere as a prevalent site, which had specific repeat structures and phylogenetically related CiHHV-6A coding sequences indicating common ancestral origins. Overall CiHHV-6A genomes were similar, but distinct from known exogenous HHV-6A virus, and have the capacity to reactivate as emerging virus infections. PMID:26784220
Li, Huilin; Nguyen, Hong Hanh; Ogorzalek Loo, Rachel R.; Campuzano, Iain D. G.; Loo, Joseph A.
2018-02-01
Mass spectrometry (MS) has become a crucial technique for the analysis of protein complexes. Native MS has traditionally examined protein subunit arrangements, while proteomics MS has focused on sequence identification. These two techniques are usually performed separately without taking advantage of the synergies between them. Here we describe the development of an integrated native MS and top-down proteomics method using Fourier-transform ion cyclotron resonance (FTICR) to analyse macromolecular protein complexes in a single experiment. We address previous concerns of employing FTICR MS to measure large macromolecular complexes by demonstrating the detection of complexes up to 1.8 MDa, and we demonstrate the efficacy of this technique for direct acquirement of sequence to higher-order structural information with several large complexes. We then summarize the unique functionalities of different activation/dissociation techniques. The platform expands the ability of MS to integrate proteomics and structural biology to provide insights into protein structure, function and regulation.
Sistema Faro, Isla de Mona, Puerto Rico: speleogenesis of the worlds largest flank margin cave
International Nuclear Information System (INIS)
Lace, M. J.; Kambesis, P. N.; Mylroie, J. E.
2016-01-01
Isla de Mona, a small, uplifted carbonate plateau jutting out of the waters of the Mona Passage, is an incredibly fragile and densely karstic environment. Expedition work was conducted by the Isla de Mona Project in cooperation with the Departamento Recursos Naturales y Ambientales de Puerto Rico (DRNA), including contributions from many researchers and cavers volunteering from across the U.S and Puerto Rico in the course of 12 separate expeditions, spanning a 14 year period (1998 to 2013). Over 200 caves have been documented on the island to date, the majority of this inventory is composed of flank margin caves but also includes sea caves, pit caves and talus caves. The most extensive example of cave development on the island is Sistema Faro - a sprawling maze-like series of chambers formed within the eastern point of the island with over 40 cliffside entrances overlooking the Caribbean Sea. Detailed cartography and analysis of the geomorphology and development of the Sistema Faro has helped form a complex model of carbonate island cave development as a function of tectonic uplift, lithology, sea level changes, karst hydrogeology and cliff retreat. This communication examines the roles these controls have played in the genesis of the world's largest flank margin cave. (Author)
Long sequence correlation coprocessor
Gage, Douglas W.
1994-09-01
A long sequence correlation coprocessor (LSCC) accelerates the bitwise correlation of arbitrarily long digital sequences by calculating in parallel the correlation score for 16, for example, adjacent bit alignments between two binary sequences. The LSCC integrated circuit is incorporated into a computer system with memory storage buffers and a separate general purpose computer processor which serves as its controller. Each of the LSCC's set of sequential counters simultaneously tallies a separate correlation coefficient. During each LSCC clock cycle, computer enable logic associated with each counter compares one bit of a first sequence with one bit of a second sequence to increment the counter if the bits are the same. A shift register assures that the same bit of the first sequence is simultaneously compared to different bits of the second sequence to simultaneously calculate the correlation coefficient by the different counters to represent different alignments of the two sequences.
Wateren, F.M. van der; Dunai, T.J.; Balen, R.T. van; Klas, W.; Verbers, A.L.L.M.; Passchier, S.; Herpers, U.
1999-01-01
Separate regions within the Transantarctic Mountains, the uplifted flank of the West Antarctic rift system, appear to have distinct Neogene histories of glaciation and valley downcutting. Incision of deep glacial outlet valleys occurred at different times throughout central and northern Victoria
Influence of the cutting parameters on flank wear of coated inserts during turning of AISI 316L
Directory of Open Access Journals (Sweden)
Yusimit Zamora Hernández
2015-03-01
Full Text Available (Received: 2015/01/20 - Accepted: 2015/03/25The continuous improvement of manufacturing processes is critical to achieve optimum levels of productivity, quality and cut production of components and products. This research aims to determine the cutting tool flank wearing progression, during a high speed dry turning, for AISI 316L steel parts. Experimental data were acquired using two cutting feed levels, two material levels, three cutting speeds, and four principal cutting times. A scanning electron microscope (SEM was used to measure and analyze the wear of the cutting tools. Results were compared using analysis of variance and multiple regression for describing the relation between the variables used in the study. The analysis showed that the three layers coating insert did not exceed the end of life wearing criterion, while the one layer insert suffered a catastrophic wearing at the highest cutting speed. It was found that a relation exists between the experimental data and the predicted values for flank wear with a general average error of 4.1182%.
miRBase: integrating microRNA annotation and deep-sequencing data.
Kozomara, Ana; Griffiths-Jones, Sam
2011-01-01
miRBase is the primary online repository for all microRNA sequences and annotation. The current release (miRBase 16) contains over 15,000 microRNA gene loci in over 140 species, and over 17,000 distinct mature microRNA sequences. Deep-sequencing technologies have delivered a sharp rise in the rate of novel microRNA discovery. We have mapped reads from short RNA deep-sequencing experiments to microRNAs in miRBase and developed web interfaces to view these mappings. The user can view all read data associated with a given microRNA annotation, filter reads by experiment and count, and search for microRNAs by tissue- and stage-specific expression. These data can be used as a proxy for relative expression levels of microRNA sequences, provide detailed evidence for microRNA annotations and alternative isoforms of mature microRNAs, and allow us to revisit previous annotations. miRBase is available online at: http://www.mirbase.org/.
Arrieta-Aguirre, Inés; Menéndez-Manjón, Pilar; Cuétara, María Soledad; Fernández de Larrinoa, Iñigo; García-Ruiz, Juan Carlos; Moragues, María Dolores
2018-02-01
Saprochaete capitata , formerly known as Geotrichum capitatum , is an emerging fungal pathogen with low susceptibility to echinocandins. Here, we report the nucleotide sequence of the S. capitata hot spot 1 region of the FKS gene ( FKS HS1), which codifies for the catalytic subunit of β-1,3-d-glucan synthase, the target of echinocandins. For that purpose, we first designed degenerated oligonucleotide primers derived from conserved flanking regions of the FKS1 HS1 segment of 12 different fungal species. Interestingly, analysis of the translated FKS HS1 sequences of 12 isolates of S. capitata revealed that all of them exhibited the same F-to-L substitution in a position that is highly related to reduced echinocandin susceptibility. Copyright © 2018 American Society for Microbiology.
Harp, A. G.; Valentine, G. A.
2018-02-01
Mafic flank eruptions are common events that pose a serious hazard to the communities and infrastructure often encroaching on the slopes of stratovolcanoes. Flank vent locations are dictated by the propagation path of their feeder dikes. The dikes are commonly thought to propagate either laterally from the central conduit or vertically from a deeper source. However, these interpretations are often based on indirect measurements, such as surface deformation and seismicity at active systems, and several studies at eroded volcanoes indicate the propagation paths may be more complex. We investigated the Oligocene age Summer Coon volcano (Colorado, USA), where erosion has exposed over 700 basaltic-andesitic radial dikes, to constrain the propagation directions, geometries, and spatial distributions of mafic dikes within a stratovolcano. The mean fabric angle of aligned plagioclase crystals was measured in oriented samples from the margins of 77 dikes. Of the 41 dikes with statistically significant flow fabrics, 85% had fabric angles that were inclined—plunging both inward and outward relative to the center of the volcano. After comparing fabric angles to those reported in other studies, we infer that, while most of the dikes with outward-plunging fabrics descended toward the flanks from a source within the edifice and near its axis, dikes with inward-plunging fabrics ascended through the edifice and toward the flanks from a deeper source. A possible control for the inclination of ascending dikes was the ratio between magma overpressure and the normal stress in the host rock. While higher ratios led to high-angle propagation, lower ratios resulted in inclined emplacement. Dikes crop out in higher frequencies within a zone surrounding the volcano axis at 2500 m radial distance from the center and may be the result of ascending dikes, emplaced at similar propagation angles, intersecting the current level of exposure at common distances from the volcano axis. The process
Improvement of methods for large scale sequencing; application to human Xq28
Energy Technology Data Exchange (ETDEWEB)
Gibbs, R.A.; Andersson, B.; Wentland, M.A. [Baylor College of Medicine, Houston, TX (United States)] [and others
1994-09-01
Sequencing of a one-metabase region of Xq28, spanning the FRAXA and IDS loci has been undertaken in order to investigate the practicality of the shotgun approach for large scale sequencing and as a platform to develop improved methods. The efficiency of several steps in the shotgun sequencing strategy has been increased using PCR-based approaches. An improved method for preparation of M13 libraries has been developed. This protocol combines a previously described adaptor-based protocol with the uracil DNA glycosylase (UDG)-cloning procedure. The efficiency of this procedure has been found to be up to 100-fold higher than that of previously used protocols. In addition the novel protocol is more reliable and thus easy to establish in a laboratory. The method has also been adapted for the simultaneous shotgun sequencing of multiple short fragments by concentrating them before library construction is presented. This protocol is suitable for rapid characterization of cDNA clones. A library was constructed from 15 PCR-amplified and concentrated human cDNA inserts, and the insert sequences could easily be identified as separate contigs during the assembly process and the sequence coverage was even along each fragment. Using this strategy, the fine structures of the FraxA and IDS loci have been revealed and several EST homologies indicating novel expressed sequences have been identified. Use of PCR to close repetitive regions that are difficult to clone was tested by determination of the sequence of a cosmid mapping DXS455 in Xq28, containing a polymorphic VNTR. The region containing the VNTR was not represented in the shotgun library, but by designing PCR primers in the sequences flanking the gap and by cloning and sequencing the PCR product, the fine structure of the VNTR has been determined. It was found to be an AT-rich VNTR with a repeated 25-mer at the center.
International Nuclear Information System (INIS)
Chebloune, Y.; Pagnier, J.; Trabuchet, G.; Faure, C.; Verdier, G.; Labie, D.; Nigon, V.
1988-01-01
Haplotype analysis of the β-globin gene cluster shows two regions of DNA characterized by nonrandom association of restriction site polymorphisms. These regions are separated by a variable segment containing the repeated sequences (ATTTT) n and (AT) x T y , which might be involved in recombinational events. Studies of haplotypes linked to the sickle cell gene in Africa provide strong argument for three origins of the mutation: Benin, Senegal, and the Central African Republic. The structure of the variable segment in the three African populations was studied by S1 nuclease mapping of genomic DNA, which allows a comparison of several samples. A 1080-base-pair DNA segment was sequenced for one sample from each population. S1 nuclease mapping confirmed the homogeneity of each population with regard to both (ATTTT) n and (AT) x T y repeats. The authors found three additional structures for (AT) x T y correlating with the geographic origin of the patients. Ten other nucleotide positions, 5' and 3' to the (AT) x T y copies, were found to be variable when compared to homologous sequences from human and monkey DNAs. These results allow us to propose an evolutionary scheme for the polymorphisms in the 5' flanking region of the β-globin gene. The results strongly support the hypothesis of three origins for the sickle mutation in Africa
Sodium Ion Dynamics in the Magnetospheric Flanks of Mercury
Aizawa, Sae; Delcourt, Dominique; Terada, Naoki
2018-01-01
We investigate the transport of planetary ions in the magnetospheric flanks of Mercury. In situ measurements from the MErcury Surface, Space ENvironment, GEochemistry, and Ranging spacecraft show evidences of Kelvin-Helmholtz instability development in this region of space, due to the velocity shear between the downtail streaming flow of solar wind originating protons in the magnetosheath and the magnetospheric populations. Ions that originate from the planet exosphere and that gain access to this region of space may be transported across the magnetopause along meandering orbits. We examine this transport using single-particle trajectory calculations in model Magnetohydrodynamics simulations of the Kelvin-Helmholtz instability. We show that heavy ions of planetary origin such as Na+ may experience prominent nonadiabatic energization as they E × B drift across large-scale rolled up vortices. This energization is controlled by the characteristics of the electric field burst encountered along the particle path, the net energy change realized corresponding to the maximum E × B drift energy. This nonadiabatic energization also is responsible for prominent scattering of the particles toward the direction perpendicular to the magnetic field.
Distinct sources of particles near the cusp and the dusk flank of the magnetosphere
Escoubet, C. P.; Grison, B.; Berchem, J.; Trattner, K. J.; Lavraud, B.; Pitout, F.; Soucek, J.; Richard, R. L.; Laakso, H. E.; Masson, A.; Dunlop, M.; Dandouras, I. S.; Rème, H.; Fazakerley, A. N.; Daly, P. W.
2015-12-01
At the magnetopause, the location of the magnetic reconnection sites depends on the orientation of the interplanetary magnetic field (IMF) in the solar wind: on the dayside magnetosphere for an IMF southward, on the lobes for an IMF northward and on the flanks for an IMF in the East-West direction. Since most of observations of reconnection events have sampled a limited region of space simultaneously it is still not yet know if the reconnection line is extended over large regions of the magnetosphere or if is patchy and made of many reconnection lines. We report a Cluster crossing on 5 January 2002 near the exterior cusp on the southern dusk side where we observe multiple sources of reconnection/injections. The IMF was mainly azimuthal (IMF-By around -5 nT), the solar wind speed lower than usual around 280 km/s with the density of order 5 cm-3. The four Cluster spacecraft had an elongated configuration near the magnetopause. C4 was the first spacecraft to enter the cusp around 19:52:04 UT, followed by C2 at 19:52:35 UT, C1 at 19:54:24 UT and C3 at 20:13:15 UT. C4 and C1 observed two ion energy dispersions at 20:10 UT and 20:40 UT and C3 at 20:35 UT and 21:15 UT. Using the time of flight technique on the upgoing and downgoing ions, which leads to energy dispersions, we obtain distances of the ion sources between 14 and 20 RE from the spacecraft. The slope of the ion energy dispersions confirmed these distances. Using Tsyganenko model, we find that these sources are located on the dusk flank, past the terminator. The first injection by C3 is seen at approximately the same time as the 2nd injection on C1 but their sources at the magnetopause were separated by more than 7 RE. This would imply that two distinct sources were active at the same time on the dusk flank of the magnetosphere. In addition, a flow reversal was observed at the magnetopause on C4 which would be an indication that reconnection is also taking place near the exterior cusp quasi-simultaneously. A
Characterization of Bovine 5′-flanking Region during Differentiation of Mouse Embryonic Stem Cells
Directory of Open Access Journals (Sweden)
Hye-Jeong Jang
2015-12-01
Full Text Available Embryonic stem cells (ESCs have been used as a powerful tool for research including gene manipulated animal models and the study of developmental gene regulation. Among the critical regulatory factors that maintain the pluripotency and self-renewal of undifferentiated ESCs, NANOG plays a very important role. Nevertheless, because pluripotency maintaining factors and specific markers for livestock ESCs have not yet been probed, few studies of the NANOG gene from domestic animals including bovine have been reported. Therefore, we chose mouse ESCs in order to understand and compare NANOG expression between bovine, human, and mouse during ESCs differentiation. We cloned a 600 bp (−420/+181 bovine NANOG 5′-flanking region, and tagged it with humanized recombinant green fluorescent protein (hrGFP as a tracing reporter. Very high GFP expression for bovine NANOG promoter was observed in the mouse ESC line. GFP expression was monitored upon ESC differentiation and was gradually reduced along with differentiation toward neurons and adipocyte cells. Activity of bovine NANOG (−420/+181 promoter was compared with already known mouse and human NANOG promoters in mouse ESC and they were likely to show a similar pattern of regulation. In conclusion, bovine NANOG 5-flanking region functions in mouse ES cells and has characteristics similar to those of mouse and human. These results suggest that bovine gene function studied in mouse ES cells should be evaluated and extrapolated for application to characterization of bovine ES cells.
Energy Technology Data Exchange (ETDEWEB)
Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie; Weinberg, Marc S. [Antiviral Gene Therapy Research Unit, University of the Witwatersrand (South Africa); Arbuthnot, Patrick, E-mail: Patrick.Arbuthnot@wits.ac.za [Antiviral Gene Therapy Research Unit, University of the Witwatersrand (South Africa)
2009-11-20
RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR) shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.
International Nuclear Information System (INIS)
Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie; Weinberg, Marc S.; Arbuthnot, Patrick
2009-01-01
RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR) shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.
Heads or tails: L1 insertion-associated 5' homopolymeric sequences
Directory of Open Access Journals (Sweden)
Meyer Thomas J
2010-02-01
Full Text Available Abstract Background L1s are one of the most successful autonomous mobile elements in primate genomes. These elements comprise as much as 17% of primate genomes with the majority of insertions occurring via target primed reverse transcription (TPRT. Twin priming, a variant of TPRT, can result in unusual DNA sequence architecture. These insertions appear to be inverted, truncated L1s flanked by target site duplications. Results We report on loci with sequence architecture consistent with variants of the twin priming mechanism and introduce dual priming, a mechanism that could generate similar sequence characteristics. These insertions take the form of truncated L1s with hallmarks of classical TPRT insertions but having a poly(T simple repeat at the 5' end of the insertion. We identified loci using computational analyses of the human, chimpanzee, orangutan, rhesus macaque and marmoset genomes. Insertion site characteristics for all putative loci were experimentally verified. Conclusions The 39 loci that passed our computational and experimental screens probably represent inversion-deletion events which resulted in a 5' inverted poly(A tail. Based on our observations of these loci and their local sequence properties, we conclude that they most probably represent twin priming events with unusually short non-inverted portions. We postulate that dual priming could, theoretically, produce the same patterns. The resulting homopolymeric stretches associated with these insertion events may promote genomic instability and create potential target sites for future retrotransposition events.
Lenzmeier, B A; Giebler, H A; Nyborg, J K
1998-02-01
Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.
Haproff, P. J.; Yin, A.; Zuza, A. V.
2017-12-01
Investigations of continental collisions often focus on thrust belts oriented perpendicular to the plate-convergence direction and exclude belts that bound the flanks of a continental indenter despite being crucial to understanding the collisional process. Research of the Himalayan orogen, for example, has mostly centered on the east-trending thrust belt between the eastern and western syntaxes, resulting in inadequate examination of the north-trending Indo-Burma Ranges located along the eastern margin of India. To better understand the development of the entire Himalayan orogenic system, we conducted field mapping across the Northern Indo-Burma Range (NIBR), situated at the intersection of the eastern Himalaya and Indo-Burma Ranges. Our research shows that major lithologic units and thrust faults of the Himalaya extend to the NIBR, suggesting a shared geologic evolution. The structural framework of the NIBR consists of a southwest-directed thrust belt cored by a hinterland-dipping duplex, like the Himalaya. However, the Northern Indo-Burma orogen is distinct based on (1) the absence of the Tethyan Himalayan Sequence and southern Gangdese batholith, (2) the absence of the South Tibetan detachment, (3) crustal shortening greater than 80%, (4) an incredibly narrow orogen width of 7-33 km, (5) exposure of an ophiolitic mélange complex as a klippe, (6) and right-slip shear along the active range-bounding thrust fault. Furthermore, lithospheric deformation along the flank and northeast corner of India is characterized by right-slip transpression partitioned between the thrust belt and right-slip faults. Such a regime is interpreted to accommodate both contraction and clockwise rotation of Tibetan lithosphere around India, consistent with existing continuum deformation and rotation models.
Development and validation of an integrated DNA walking strategy to detect GMO expressing cry genes.
Fraiture, Marie-Alice; Vandamme, Julie; Herman, Philippe; Roosens, Nancy H C
2018-06-27
Recently, an integrated DNA walking strategy has been proposed to prove the presence of GMO via the characterisation of sequences of interest, including their transgene flanking regions and the unnatural associations of elements in their transgenic cassettes. To this end, the p35S, tNOS and t35S pCAMBIA elements have been selected as key targets, allowing the coverage of most of GMO, EU authorized or not. In the present study, a bidirectional DNA walking method anchored on the CryAb/c genes is proposed with the aim to cover additional GMO and additional sequences of interest. The performance of the proposed bidirectional DNA walking method anchored on the CryAb/c genes has been evaluated in a first time for its feasibility using several GM events possessing these CryAb/c genes. Afterwards, its sensitivity has been investigated through low concentrations of targets (as low as 20 HGE). In addition, to illustrate its applicability, the entire workflow has been tested on a sample mimicking food/feed matrices analysed in GMO routine analysis. Given the successful assessment of its performance, the present bidirectional DNA walking method anchored on the CryAb/c genes can easily be implemented in GMO routine analysis by the enforcement laboratories and allows completing the entire DNA walking strategy in targeting an additional transgenic element frequently found in GMO.
Energy Technology Data Exchange (ETDEWEB)
Itadera, K. (Kanagawa Hot Springs Research Institute, Kanagawa (Japan)); Shimano, Y. (Utsunomiya Bunsei Junior College, Tochigi (Japan))
1993-06-30
This paper describes the following matters on the springs at the mountain flank of Iwate volcano in Iwate Prefecture, with the Kanazawa spring as the main subject: The new and old Iwate volcanos have rock-bed flow deposits which resulted from mountain disintegration, distributed over their south, east and north flanks, and most of the spring water wells up in these areas; the south, east and north flanks have about 80 springs, about 30 springs, and about 10 springs, respectively; the number of springs and the water well-up scale show a trend of inverse proportion; the Kanazawa spring is a generic name of the several springs located on the north flank in the Kanazawa area; its main spring forms a spring pond with an area of about 100 m[sup 2] with a spring water temperature of about 11.5[degree]C, electric conductivity of 200 [mu] S/cm or higher, and a flow-out rate of 500 l/s or more; the Kanazawa spring is characterized by having as large total dissolved component amount as 170 mg/l or more and abundant amount of SO4[sup 2-] and Cl[sup -]; and the spring presents properties different from those in other springs. 10 refs., 5 figs., 1 tab.
Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene
International Nuclear Information System (INIS)
Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.
1987-01-01
DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus
International Nuclear Information System (INIS)
Moreno Chamorro, P.; Gallego Diaz, C.
2011-01-01
The main objective of this work is to show the current status of the implementation of integrated analysis of safety (ISA) methodology and its SCAIS associated tool (system of simulation codes for ISA) to the sequence analysis of total loss of feedwater in a PWR reactor model Westinghouse of three loops with large, dry containment.
Directory of Open Access Journals (Sweden)
Szabolcs Szelinger
Full Text Available In females, X chromosome inactivation (XCI is an epigenetic, gene dosage compensatory mechanism by inactivation of one copy of X in cells. Random XCI of one of the parental chromosomes results in an approximately equal proportion of cells expressing alleles from either the maternally or paternally inherited active X, and is defined by the XCI ratio. Skewed XCI ratio is suggestive of non-random inactivation, which can play an important role in X-linked genetic conditions. Current methods rely on indirect, semi-quantitative DNA methylation-based assay to estimate XCI ratio. Here we report a direct approach to estimate XCI ratio by integrated, family-trio based whole-exome and mRNA sequencing using phase-by-transmission of alleles coupled with allele-specific expression analysis. We applied this method to in silico data and to a clinical patient with mild cognitive impairment but no clear diagnosis or understanding molecular mechanism underlying the phenotype. Simulation showed that phased and unphased heterozygous allele expression can be used to estimate XCI ratio. Segregation analysis of the patient's exome uncovered a de novo, interstitial, 1.7 Mb deletion on Xp22.31 that originated on the paternally inherited X and previously been associated with heterogeneous, neurological phenotype. Phased, allelic expression data suggested an 83∶20 moderately skewed XCI that favored the expression of the maternally inherited, cytogenetically normal X and suggested that the deleterious affect of the de novo event on the paternal copy may be offset by skewed XCI that favors expression of the wild-type X. This study shows the utility of integrated sequencing approach in XCI ratio estimation.
Robustness of ancestral sequence reconstruction to phylogenetic uncertainty.
Hanson-Smith, Victor; Kolaczkowski, Bryan; Thornton, Joseph W
2010-09-01
Ancestral sequence reconstruction (ASR) is widely used to formulate and test hypotheses about the sequences, functions, and structures of ancient genes. Ancestral sequences are usually inferred from an alignment of extant sequences using a maximum likelihood (ML) phylogenetic algorithm, which calculates the most likely ancestral sequence assuming a probabilistic model of sequence evolution and a specific phylogeny--typically the tree with the ML. The true phylogeny is seldom known with certainty, however. ML methods ignore this uncertainty, whereas Bayesian methods incorporate it by integrating the likelihood of each ancestral state over a distribution of possible trees. It is not known whether Bayesian approaches to phylogenetic uncertainty improve the accuracy of inferred ancestral sequences. Here, we use simulation-based experiments under both simplified and empirically derived conditions to compare the accuracy of ASR carried out using ML and Bayesian approaches. We show that incorporating phylogenetic uncertainty by integrating over topologies very rarely changes the inferred ancestral state and does not improve the accuracy of the reconstructed ancestral sequence. Ancestral state reconstructions are robust to uncertainty about the underlying tree because the conditions that produce phylogenetic uncertainty also make the ancestral state identical across plausible trees; conversely, the conditions under which different phylogenies yield different inferred ancestral states produce little or no ambiguity about the true phylogeny. Our results suggest that ML can produce accurate ASRs, even in the face of phylogenetic uncertainty. Using Bayesian integration to incorporate this uncertainty is neither necessary nor beneficial.
Walker, Joseph F; Zanis, Michael J; Emery, Nancy C
2014-04-01
Complete chloroplast genome studies can help resolve relationships among large, complex plant lineages such as Asteraceae. We present the first whole plastome from the Madieae tribe and compare its sequence variation to other chloroplast genomes in Asteraceae. We used high throughput sequencing to obtain the Lasthenia burkei chloroplast genome. We compared sequence structure and rates of molecular evolution in the small single copy (SSC), large single copy (LSC), and inverted repeat (IR) regions to those for eight Asteraceae accessions and one Solanaceae accession. The chloroplast sequence of L. burkei is 150 746 bp and contains 81 unique protein coding genes and 4 coding ribosomal RNA sequences. We identified three major inversions in the L. burkei chloroplast, all of which have been found in other Asteraceae lineages, and a previously unreported inversion in Lactuca sativa. Regions flanking inversions contained tRNA sequences, but did not have particularly high G + C content. Substitution rates varied among the SSC, LSC, and IR regions, and rates of evolution within each region varied among species. Some observed differences in rates of molecular evolution may be explained by the relative proportion of coding to noncoding sequence within regions. Rates of molecular evolution vary substantially within and among chloroplast genomes, and major inversion events may be promoted by the presence of tRNAs. Collectively, these results provide insight into different mechanisms that may promote intramolecular recombination and the inversion of large genomic regions in the plastome.
Sequence specific inhibition of DNA restriction enzyme cleavage by PNA
DEFF Research Database (Denmark)
Nielsen, P.E.; Egholm, M.; Berg, R.H.
1993-01-01
Plasmids containing double-stranded 10-mer PNA (peptide nucleic acid chimera) targets proximally flanked by two restriction enzyme sites were challenged with the complementary PNA or PNAs having one or two mismatches, and the effect on the restriction enzyme cleavage of the flanking sites was ass...
Flanking region sequence information to refine microRNA target ...
Indian Academy of Sciences (India)
Prakash
(SVM)-based target prediction refinement approach has been introduced through .... are kernel-based statistical learning machines, where a discriminant ...... Cox T and Cuff J 2002 The Ensembl genome database project;. Nucleic Acids Res.
Prlic, Andreas; Kalro, Tara; Bhattacharya, Roshni; Christie, Cole; Burley, Stephen K; Rose, Peter W
2016-12-15
The Protein Data Bank (PDB) now contains more than 120,000 three-dimensional (3D) structures of biological macromolecules. To allow an interpretation of how PDB data relates to other publicly available annotations, we developed a novel data integration platform that maps 3D structural information across various datasets. This integration bridges from the human genome across protein sequence to 3D structure space. We developed novel software solutions for data management and visualization, while incorporating new libraries for web-based visualization using SVG graphics. The new views are available from http://www.rcsb.org and software is available from https://github.com/rcsb/. andreas.prlic@rcsb.orgSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.
Directory of Open Access Journals (Sweden)
R. Paris
2014-05-01
Full Text Available Tsunamis related to volcano flank collapse are typically a high-magnitude, low frequency hazard for which evaluation and mitigation are difficult to address. In this short communication, we present field evidences of a large tsunami along the southern coast of Mauritius Island ca. 4400 years ago. Tsunami deposits described include both marine conglomerates and coral boulders up to 90 m3 (> 100 tons. The most probable origin of the tsunami is a flank collapse of Piton de la Fournaise volcano, Réunion Island.
Cisgenic barley with improved phytase activity
DEFF Research Database (Denmark)
Holme, Inger; Dionisio, Giuseppe; Brinch-Pedersen, Henrik
2012-01-01
phytase gene (HvPAPhy_a) expressed during grain filling to evaluate the cisgenesis concept in barley. The marker gene elimination method was used to obtain marker-free plant lines. Here, the gene of interest and the selection gene are flanked by their own T-DNA borders to allow unlinked integration...... of the two genes. We analysed the transformants for co-transformation efficiency, increased phytase activities in the grain, integration of the kanamycin resistance gene of the vector-backbone and segregation between the HvPAPhy_a insert and the hygromycin resistance gene. The frequencies of the four......PAPhy_a insert for further analysis. Seeds from plants homozygous for the insert showed 2.6- and 2.8-fold increases in phytase activities and the activity levels were stable over the three generations analysed. In one of the selected lines, the flanking sequences from both the left and right T-DNA borders were...
Evolutionary growth process of highly conserved sequences in vertebrate genomes.
Ishibashi, Minaka; Noda, Akiko Ogura; Sakate, Ryuichi; Imanishi, Tadashi
2012-08-01
Genome sequence comparison between evolutionarily distant species revealed ultraconserved elements (UCEs) among mammals under strong purifying selection. Most of them were also conserved among vertebrates. Because they tend to be located in the flanking regions of developmental genes, they would have fundamental roles in creating vertebrate body plans. However, the evolutionary origin and selection mechanism of these UCEs remain unclear. Here we report that UCEs arose in primitive vertebrates, and gradually grew in vertebrate evolution. We searched for UCEs in two teleost fishes, Tetraodon nigroviridis and Oryzias latipes, and found 554 UCEs with 100% identity over 100 bps. Comparison of teleost and mammalian UCEs revealed 43 pairs of common, jawed-vertebrate UCEs (jUCE) with high sequence identities, ranging from 83.1% to 99.2%. Ten of them retain lower similarities to the Petromyzon marinus genome, and the substitution rates of four non-exonic jUCEs were reduced after the teleost-mammal divergence, suggesting that robust conservation had been acquired in the jawed vertebrate lineage. Our results indicate that prototypical UCEs originated before the divergence of jawed and jawless vertebrates and have been frozen as perfect conserved sequences in the jawed vertebrate lineage. In addition, our comparative sequence analyses of UCEs and neighboring regions resulted in a discovery of lineage-specific conserved sequences. They were added progressively to prototypical UCEs, suggesting step-wise acquisition of novel regulatory roles. Our results indicate that conserved non-coding elements (CNEs) consist of blocks with distinct evolutionary history, each having been frozen since different evolutionary era along the vertebrate lineage. Copyright © 2012 Elsevier B.V. All rights reserved.
Accurate typing of short tandem repeats from genome-wide sequencing data and its applications.
Fungtammasan, Arkarachai; Ananda, Guruprasad; Hile, Suzanne E; Su, Marcia Shu-Wei; Sun, Chen; Harris, Robert; Medvedev, Paul; Eckert, Kristin; Makova, Kateryna D
2015-05-01
Short tandem repeats (STRs) are implicated in dozens of human genetic diseases and contribute significantly to genome variation and instability. Yet profiling STRs from short-read sequencing data is challenging because of their high sequencing error rates. Here, we developed STR-FM, short tandem repeat profiling using flank-based mapping, a computational pipeline that can detect the full spectrum of STR alleles from short-read data, can adapt to emerging read-mapping algorithms, and can be applied to heterogeneous genetic samples (e.g., tumors, viruses, and genomes of organelles). We used STR-FM to study STR error rates and patterns in publicly available human and in-house generated ultradeep plasmid sequencing data sets. We discovered that STRs sequenced with a PCR-free protocol have up to ninefold fewer errors than those sequenced with a PCR-containing protocol. We constructed an error correction model for genotyping STRs that can distinguish heterozygous alleles containing STRs with consecutive repeat numbers. Applying our model and pipeline to Illumina sequencing data with 100-bp reads, we could confidently genotype several disease-related long trinucleotide STRs. Utilizing this pipeline, for the first time we determined the genome-wide STR germline mutation rate from a deeply sequenced human pedigree. Additionally, we built a tool that recommends minimal sequencing depth for accurate STR genotyping, depending on repeat length and sequencing read length. The required read depth increases with STR length and is lower for a PCR-free protocol. This suite of tools addresses the pressing challenges surrounding STR genotyping, and thus is of wide interest to researchers investigating disease-related STRs and STR evolution. © 2015 Fungtammasan et al.; Published by Cold Spring Harbor Laboratory Press.
Vlčková Kateřina
2014-01-01
The presentation focused on an so called integrated mixed method research design example on a basis of a Czech Science Foundation Project Nr. GAP407/12/0432 "Foreign Language Learning Strategies and Achievement: Analysis of Strategy Clusters and Sequences". All main integrated parts of the mixed methods research design were discussed: the aim, theoretical framework, research question, methods and validity threats. Prezentace se zaměřovala na tzv. integrovaný vícemetodový výzkumný design na...
OPAL: prediction of MoRF regions in intrinsically disordered protein sequences.
Sharma, Ronesh; Raicar, Gaurav; Tsunoda, Tatsuhiko; Patil, Ashwini; Sharma, Alok
2018-06-01
Intrinsically disordered proteins lack stable 3-dimensional structure and play a crucial role in performing various biological functions. Key to their biological function are the molecular recognition features (MoRFs) located within long disordered regions. Computationally identifying these MoRFs from disordered protein sequences is a challenging task. In this study, we present a new MoRF predictor, OPAL, to identify MoRFs in disordered protein sequences. OPAL utilizes two independent sources of information computed using different component predictors. The scores are processed and combined using common averaging method. The first score is computed using a component MoRF predictor which utilizes composition and sequence similarity of MoRF and non-MoRF regions to detect MoRFs. The second score is calculated using half-sphere exposure (HSE), solvent accessible surface area (ASA) and backbone angle information of the disordered protein sequence, using information from the amino acid properties of flanks surrounding the MoRFs to distinguish MoRF and non-MoRF residues. OPAL is evaluated using test sets that were previously used to evaluate MoRF predictors, MoRFpred, MoRFchibi and MoRFchibi-web. The results demonstrate that OPAL outperforms all the available MoRF predictors and is the most accurate predictor available for MoRF prediction. It is available at http://www.alok-ai-lab.com/tools/opal/. ashwini@hgc.jp or alok.sharma@griffith.edu.au. Supplementary data are available at Bioinformatics online.
Energy Technology Data Exchange (ETDEWEB)
Werner, C.; Goff, F. [Los Alamos National Lab., NM (United States); Janik, C.J. [Geological Survey, Menlo Park, CA (United States)] [and others
1997-06-01
Popocatepetl Volcano is potentially devastating to populations living in the greater Mexico City area. Systematic monitoring of fumarole gases and flanking thermal/mineral springs began in early 1994 after increased fumarolic and seismic activity were noticed in 1991. These investigations had two major objectives: (1) to determine if changes in magmatic conditions beneath Popocatepetl might be reflected by chemical changes in fumarolic discharges and (2) to determine if thermal/mineral spring waters in the vicinity of Popocatepetl are geochemically related to or influences by the magmatic system. This report summarizes results from these two discrete studies.
DNA pattern recognition using canonical correlation algorithm.
Sarkar, B K; Chakraborty, Chiranjib
2015-10-01
We performed canonical correlation analysis as an unsupervised statistical tool to describe related views of the same semantic object for identifying patterns. A pattern recognition technique based on canonical correlation analysis (CCA) was proposed for finding required genetic code in the DNA sequence. Two related but different objects were considered: one was a particular pattern, and other was test DNA sequence. CCA found correlations between two observations of the same semantic pattern and test sequence. It is concluded that the relationship possesses maximum value in the position where the pattern exists. As a case study, the potential of CCA was demonstrated on the sequence found from HIV-1 preferred integration sites. The subsequences on the left and right flanking from the integration site were considered as the two views, and statistically significant relationships were established between these two views to elucidate the viral preference as an important factor for the correlation.
DEFF Research Database (Denmark)
Rieneck, Klaus; Bak, Mads; Jønson, Lars
2013-01-01
, Illumina); several millions of PCR sequences were analyzed. RESULTS: The results demonstrated the feasibility of diagnosing the fetal KEL1 or KEL2 blood group from cell-free DNA purified from maternal plasma. CONCLUSION: This method requires only one primer pair, and the large amount of sequence...... information obtained allows well for statistical analysis of the data. This general approach can be integrated into current laboratory practice and has numerous applications. Besides DNA-based predictions of blood group phenotypes, platelet phenotypes, or sickle cell anemia, and the determination of zygosity...
Yang, Peng; Peng, Yongfei; Ye, Bin; Miao, Lixin
2017-09-01
This article explores the integrated optimization problem of location assignment and sequencing in multi-shuttle automated storage/retrieval systems under the modified 2n-command cycle pattern. The decision of storage and retrieval (S/R) location assignment and S/R request sequencing are jointly considered. An integer quadratic programming model is formulated to describe this integrated optimization problem. The optimal travel cycles for multi-shuttle S/R machines can be obtained to process S/R requests in the storage and retrieval request order lists by solving the model. The small-sized instances are optimally solved using CPLEX. For large-sized problems, two tabu search algorithms are proposed, in which the first come, first served and nearest neighbour are used to generate initial solutions. Various numerical experiments are conducted to examine the heuristics' performance and the sensitivity of algorithm parameters. Furthermore, the experimental results are analysed from the viewpoint of practical application, and a parameter list for applying the proposed heuristics is recommended under different real-life scenarios.
Cranial modularity and sequence heterochrony in mammals.
Goswami, Anjali
2007-01-01
Heterochrony, the temporal shifting of developmental events relative to each other, requires a degree of autonomy among those processes or structures. Modularity, the division of larger structures or processes into autonomous sets of internally integrated units, is often discussed in relation to the concept of heterochrony. However, the relationship between the developmental modules derived from studies of heterochrony and evolutionary modules, which should be of adaptive importance and relate to the genotype-phenotype map, has not been explicitly studied. I analyzed a series of sectioned and whole cleared-and-stained embryological and neonatal specimens, supplemented with published ontogenetic data, to test the hypothesis that bones within the same phenotypic modules, as determined by morphometric analysis, are developmentally integrated and will display coordinated heterochronic shifts across taxa. Modularity was analyzed in cranial bone ossification sequences of 12 therian mammals. A dataset of 12-18 developmental events was used to assess if modularity in developmental sequences corresponds to six phenotypic modules, derived from a recent morphometric analysis of cranial modularity in mammals. Kendall's tau was used to measure rank correlations, with randomization tests for significance. If modularity in developmental sequences corresponds to observed phenotypic modules, bones within a single phenotypic module should show integration of developmental timing, maintaining the same timing of ossification relative to each other, despite differences in overall ossification sequences across taxa. Analyses did not find any significant conservation of developmental timing within the six phenotypic modules, meaning that bones that are highly integrated in adult morphology are not significantly integrated in developmental timing.
Zhang, Tiejun; Yu, Long-Xi; Zheng, Ping; Li, Yajun; Rivera, Martha; Main, Dorrie; Greene, Stephanie L
2015-01-01
Drought resistance is an important breeding target for enhancing alfalfa productivity in arid and semi-arid regions. Identification of genes involved in drought tolerance will facilitate breeding for improving drought resistance and water use efficiency in alfalfa. Our objective was to use a diversity panel of alfalfa accessions comprised of 198 cultivars and landraces to identify genes involved in drought tolerance. The panel was selected from the USDA-ARS National Plant Germplasm System alfalfa collection and genotyped using genotyping by sequencing. A greenhouse procedure was used for phenotyping two important traits associated with drought tolerance: drought resistance index (DRI) and relative leaf water content (RWC). Marker-trait association identified nineteen and fifteen loci associated with DRI and RWC, respectively. Alignments of target sequences flanking to the resistance loci against the reference genome of M. truncatula revealed multiple chromosomal locations. Markers associated with DRI are located on all chromosomes while markers associated with RWC are located on chromosomes 1, 2, 3, 4, 5, 6 and 7. Co-localizations of significant markers between DRI and RWC were found on chromosomes 3, 5 and 7. Most loci associated with DRI in this work overlap with the reported QTLs associated with biomass under drought in alfalfa. Additional significant markers were targeted to several contigs with unknown chromosomal locations. BLAST search using their flanking sequences revealed homology to several annotated genes with functions in stress tolerance. With further validation, these markers may be used for marker-assisted breeding new alfalfa varieties with drought resistance and enhanced water use efficiency.
International Nuclear Information System (INIS)
Dillman, S.B.
1980-01-01
The Upper Devonian-Lower Mississippi black-shale sequence is an important source of natural gas in eastern Kentucky and with technological advances may be an important source of synthetic oil and uranium on the flanks of the Cincinnati arch. To enhance the understanding and development of these resources in the black-shale sequence, eight isopach maps, eight structure-contour maps and nine isopach maps of highly radioactive black shale were constructed. Structural features including the Rome trough, Rockcastle River uplift, Pine Mountain thrust fault, Kentucky River and Paint Creek fault zones and unnamed basinal areas in Greenup, Pike, and Knott counties were identified on the maps. Faults bounding the Rome trough and other structures were active intermittently throughout Late Devonian time. Other structures show only post-Devonian activity, whereas some show both Devonian and post-Devonian activity. Comparison of structure-contour and isopach maps allow the differentiation of syn- and post-sedimentray structural activity relative to the black-shale sequence. A north-south trending hinge line separates a broad platform area from an area of rapid eastward thickening into the Appalachian basin. Units 7 through 1 progressively onlap the Cincinnati arch; units 4 through 1 cover the arch
D20S16 is a complex interspersed repeated sequence: Genetic and physical analysis of the locus
Energy Technology Data Exchange (ETDEWEB)
Bowden, D.W.; Krawchuk, M.D.; Howard, T.D. [Wake Forest Univ., Winston-Salem, NC (United States)] [and others
1995-01-20
The genomic structure of the D20S16 locus has been evaluated using genetic and physical methods. D20S16, originally detected with the probe CRI-L1214, is a highly informative, complex restriction fragment length polymorphism consisting of two separate allelic systems. The allelic systems have the characteristics of conventional VNTR polymorphisms and are separated by recombination ({theta} = 0.02, Z{sub max} = 74.82), as demonstrated in family studies. Most of these recombination events are meiotic crossovers and are maternal in origin, but two, including deletion of the locus in a cell line from a CEPH family member, occur without evidence for exchange of flanking markers. DNA sequence analysis suggests that the basis of the polymorphism is variable numbers of a 98-bp sequence tandemly repeated with 87 to 90% sequence similarity between repeats. The 98-bp repeat is a dimer of 49 bp sequence with 45 to 98% identity between the elements. In addition, nonpolymorphic genomic sequences adjacent to the polymorphic 98-bp repeat tracts are also repeated but are not polymorphic, i.e., show no individual to individual variation. Restriction enzyme mapping of cosmids containing the CRI-L1214 sequence suggests that there are multiple interspersed repeats of the CRI-L1214 sequence on chromosome 20. The results of dual-color fluorescence in situ hybridization experiments with interphase nuclei are also consistent with multiple repeats of an interspersed sequence on chromosome 20. 23 refs., 6 figs.
Directory of Open Access Journals (Sweden)
Kuczmarski Thomas A
2006-10-01
Full Text Available Abstract Background MannDB was created to meet a need for rapid, comprehensive automated protein sequence analyses to support selection of proteins suitable as targets for driving the development of reagents for pathogen or protein toxin detection. Because a large number of open-source tools were needed, it was necessary to produce a software system to scale the computations for whole-proteome analysis. Thus, we built a fully automated system for executing software tools and for storage, integration, and display of automated protein sequence analysis and annotation data. Description MannDB is a relational database that organizes data resulting from fully automated, high-throughput protein-sequence analyses using open-source tools. Types of analyses provided include predictions of cleavage, chemical properties, classification, features, functional assignment, post-translational modifications, motifs, antigenicity, and secondary structure. Proteomes (lists of hypothetical and known proteins are downloaded and parsed from Genbank and then inserted into MannDB, and annotations from SwissProt are downloaded when identifiers are found in the Genbank entry or when identical sequences are identified. Currently 36 open-source tools are run against MannDB protein sequences either on local systems or by means of batch submission to external servers. In addition, BLAST against protein entries in MvirDB, our database of microbial virulence factors, is performed. A web client browser enables viewing of computational results and downloaded annotations, and a query tool enables structured and free-text search capabilities. When available, links to external databases, including MvirDB, are provided. MannDB contains whole-proteome analyses for at least one representative organism from each category of biological threat organism listed by APHIS, CDC, HHS, NIAID, USDA, USFDA, and WHO. Conclusion MannDB comprises a large number of genomes and comprehensive protein
Directory of Open Access Journals (Sweden)
Margaret Staton
Full Text Available Forest health issues are on the rise in the United States, resulting from introduction of alien pests and diseases, coupled with abiotic stresses related to climate change. Increasingly, forest scientists are finding genetic/genomic resources valuable in addressing forest health issues. For a set of ten ecologically and economically important native hardwood tree species representing a broad phylogenetic spectrum, we used low coverage whole genome sequencing from multiplex Illumina paired ends to economically profile their genomic content. For six species, the genome content was further analyzed by flow cytometry in order to determine the nuclear genome size. Sequencing yielded a depth of 0.8X to 7.5X, from which in silico analysis yielded preliminary estimates of gene and repetitive sequence content in the genome for each species. Thousands of genomic SSRs were identified, with a clear predisposition toward dinucleotide repeats and AT-rich repeat motifs. Flanking primers were designed for SSR loci for all ten species, ranging from 891 loci in sugar maple to 18,167 in redbay. In summary, we have demonstrated that useful preliminary genome information including repeat content, gene content and useful SSR markers can be obtained at low cost and time input from a single lane of Illumina multiplex sequence.
Directory of Open Access Journals (Sweden)
Yuichi Shiraishi
Full Text Available Recent studies applying high-throughput sequencing technologies have identified several recurrently mutated genes and pathways in multiple cancer genomes. However, transcriptional consequences from these genomic alterations in cancer genome remain unclear. In this study, we performed integrated and comparative analyses of whole genomes and transcriptomes of 22 hepatitis B virus (HBV-related hepatocellular carcinomas (HCCs and their matched controls. Comparison of whole genome sequence (WGS and RNA-Seq revealed much evidence that various types of genomic mutations triggered diverse transcriptional changes. Not only splice-site mutations, but also silent mutations in coding regions, deep intronic mutations and structural changes caused splicing aberrations. HBV integrations generated diverse patterns of virus-human fusion transcripts depending on affected gene, such as TERT, CDK15, FN1 and MLL4. Structural variations could drive over-expression of genes such as WNT ligands, with/without creating gene fusions. Furthermore, by taking account of genomic mutations causing transcriptional aberrations, we could improve the sensitivity of deleterious mutation detection in known cancer driver genes (TP53, AXIN1, ARID2, RPS6KA3, and identified recurrent disruptions in putative cancer driver genes such as HNF4A, CPS1, TSC1 and THRAP3 in HCCs. These findings indicate genomic alterations in cancer genome have diverse transcriptomic effects, and integrated analysis of WGS and RNA-Seq can facilitate the interpretation of a large number of genomic alterations detected in cancer genome.
National Oceanic and Atmospheric Administration, Department of Commerce — The project restored both structural and habitat functions of Bayou Dupont and flanking marshes. The project created and nourished marsh and restored a ridge on the...
Plasma wave profiles of Earth's bow shock at low Mach number: ISEE 3 observations on the far flank
International Nuclear Information System (INIS)
Greenstadt, E.W.; Coroniti, F.V.; Moses, S.L.; Smith, E.J.
1992-01-01
The Earth's bow shock is weak along its distant flanks where the projected component of solar wind velocity normal to the hyperboloidal surface is only a fraction of the total free stream velocity, severely reducing the local Mach number. The authors present a survey of selected crossings far downstream from the subsolar shock, delineating the overall plasma wave (pw) behavior of a selected set of nearly perpendicular crossings and another set of limited Mach number but broad geometry; they include their immediate upstream regions. The result is a generalizable pw signature, or signatures, of low Mach number shocks and some likely implications of those signatures for the weak shock's plasma physical processes on the flank. They find the data consistent with the presence of ion beam interactions producing noise ahead of the shock in the ion acoustic frequency range. One subcritical case was found whose pw noise was presumably related to a reflected ion population just as in stronger events. The presence or absence, and the amplitudes, of pw activity are explainable by the presence or absence of a population of upstream ions controlled by the component of interplanetary magnetic field normal to the solar wind flow
Rapid detection of SMARCB1 sequence variation using high resolution melting
Directory of Open Access Journals (Sweden)
Ashley David M
2009-12-01
Full Text Available Abstract Background Rhabdoid tumors are rare cancers of early childhood arising in the kidney, central nervous system and other organs. The majority are caused by somatic inactivating mutations or deletions affecting the tumor suppressor locus SMARCB1 [OMIM 601607]. Germ-line SMARCB1 inactivation has been reported in association with rhabdoid tumor, epitheloid sarcoma and familial schwannomatosis, underscoring the importance of accurate mutation screening to ascertain recurrence and transmission risks. We describe a rapid and sensitive diagnostic screening method, using high resolution melting (HRM, for detecting sequence variations in SMARCB1. Methods Amplicons, encompassing the nine coding exons of SMARCB1, flanking splice site sequences and the 5' and 3' UTR, were screened by both HRM and direct DNA sequencing to establish the reliability of HRM as a primary mutation screening tool. Reaction conditions were optimized with commercially available HRM mixes. Results The false negative rate for detecting sequence variants by HRM in our sample series was zero. Nine amplicons out of a total of 140 (6.4% showed variant melt profiles that were subsequently shown to be false positive. Overall nine distinct pathogenic SMARCB1 mutations were identified in a total of 19 possible rhabdoid tumors. Two tumors had two distinct mutations and two harbored SMARCB1 deletion. Other mutations were nonsense or frame-shifts. The detection sensitivity of the HRM screening method was influenced by both sequence context and specific nucleotide change and varied from 1: 4 to 1:1000 (variant to wild-type DNA. A novel method involving digital HRM, followed by re-sequencing, was used to confirm mutations in tumor specimens containing associated normal tissue. Conclusions This is the first report describing SMARCB1 mutation screening using HRM. HRM is a rapid, sensitive and inexpensive screening technology that is likely to be widely adopted in diagnostic laboratories to
Rapid detection of SMARCB1 sequence variation using high resolution melting
International Nuclear Information System (INIS)
Dagar, Vinod; Chow, Chung-Wo; Ashley, David M; Algar, Elizabeth M
2009-01-01
Rhabdoid tumors are rare cancers of early childhood arising in the kidney, central nervous system and other organs. The majority are caused by somatic inactivating mutations or deletions affecting the tumor suppressor locus SMARCB1 [OMIM 601607]. Germ-line SMARCB1 inactivation has been reported in association with rhabdoid tumor, epitheloid sarcoma and familial schwannomatosis, underscoring the importance of accurate mutation screening to ascertain recurrence and transmission risks. We describe a rapid and sensitive diagnostic screening method, using high resolution melting (HRM), for detecting sequence variations in SMARCB1. Amplicons, encompassing the nine coding exons of SMARCB1, flanking splice site sequences and the 5' and 3' UTR, were screened by both HRM and direct DNA sequencing to establish the reliability of HRM as a primary mutation screening tool. Reaction conditions were optimized with commercially available HRM mixes. The false negative rate for detecting sequence variants by HRM in our sample series was zero. Nine amplicons out of a total of 140 (6.4%) showed variant melt profiles that were subsequently shown to be false positive. Overall nine distinct pathogenic SMARCB1 mutations were identified in a total of 19 possible rhabdoid tumors. Two tumors had two distinct mutations and two harbored SMARCB1 deletion. Other mutations were nonsense or frame-shifts. The detection sensitivity of the HRM screening method was influenced by both sequence context and specific nucleotide change and varied from 1: 4 to 1:1000 (variant to wild-type DNA). A novel method involving digital HRM, followed by re-sequencing, was used to confirm mutations in tumor specimens containing associated normal tissue. This is the first report describing SMARCB1 mutation screening using HRM. HRM is a rapid, sensitive and inexpensive screening technology that is likely to be widely adopted in diagnostic laboratories to facilitate whole gene mutation screening
Noh, Ju Young; Patnaik, Bharat Bhusan; Tindwa, Hamisi; Seo, Gi Won; Kim, Dong Hyun; Patnaik, Hongray Howrelia; Jo, Yong Hun; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Han, Yeon Soo
2014-01-25
Apolipophorin III (apoLp-III) is a well-known hemolymph protein having a functional role in lipid transport and immune response of insects. We cloned full-length cDNA encoding putative apoLp-III from larvae of the coleopteran beetle, Tenebrio molitor (TmapoLp-III), by identification of clones corresponding to the partial sequence of TmapoLp-III, subsequently followed with full length sequencing by a clone-by-clone primer walking method. The complete cDNA consists of 890 nucleotides, including an ORF encoding 196 amino acid residues. Excluding a putative signal peptide of the first 20 amino acid residues, the 176-residue mature apoLp-III has a calculated molecular mass of 19,146Da. Genomic sequence analysis with respect to its cDNA showed that TmapoLp-III was organized into four exons interrupted by three introns. Several immune-related transcription factor binding sites were discovered in the putative 5'-flanking region. BLAST and phylogenetic analyses reveal that TmapoLp-III has high sequence identity (88%) with Tribolium castaneum apoLp-III but shares little sequence homologies (molitor. Copyright © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Juana M. Córdoba
2010-11-01
Full Text Available Microsatellite markers or simple sequence repeat (SSR loci are useful for diversity characterization and genetic–physical mapping. Different in silico microsatellite search methods have been developed for mining bacterial artificial chromosome (BAC end sequences for SSRs. The overall goal of this study was genome characterization based on SSRs in 89,017 BAC end sequences (BESs from the G19833 common bean ( L. library. Another objective was to identify new SSR taking into account three tandem motif identification programs (Automated Microsatellite Marker Development [AMMD], Tandem Repeats Finder [TRF], and SSRLocator [SSRL]. Among the microsatellite search engines, SSRL identified the highest number of SSRs; however, when primer design was attempted, the number dropped due to poor primer design regions. Automated Microsatellite Marker Development software identified many SSRs with valuable AT/TA or AG/TC motifs, while TRF found fewer SSRs and produced no primers. A subgroup of 323 AT-rich, di-, and trinucleotide SSRs were selected from the AMMD results and used in a parental survey with DOR364 and G19833, of which 75 could be mapped in the corresponding population; these represented 4052 BAC clones. Together with 92 previously mapped BES- and 114 non-BES-derived markers, a total of 280 SSRs were included in the polymerase chain reaction (PCR-based map, integrating a total of 8232 BAC clones in 162 contigs from the physical map.
Directory of Open Access Journals (Sweden)
Dimos Gaidatzis
2014-02-01
Full Text Available For the most part metazoan genomes are highly methylated and harbor only small regions with low or absent methylation. In contrast, partially methylated domains (PMDs, recently discovered in a variety of cell lines and tissues, do not fit this paradigm as they show partial methylation for large portions (20%-40% of the genome. While in PMDs methylation levels are reduced on average, we found that at single CpG resolution, they show extensive variability along the genome outside of CpG islands and DNase I hypersensitive sites (DHS. Methylation levels range from 0% to 100% in a roughly uniform fashion with only little similarity between neighboring CpGs. A comparison of various PMD-containing methylomes showed that these seemingly disordered states of methylation are strongly conserved across cell types for virtually every PMD. Comparative sequence analysis suggests that DNA sequence is a major determinant of these methylation states. This is further substantiated by a purely sequence based model which can predict 31% (R(2 of the variation in methylation. The model revealed CpG density as the main driving feature promoting methylation, opposite to what has been shown for CpG islands, followed by various dinucleotides immediately flanking the CpG and a minor contribution from sequence preferences reflecting nucleosome positioning. Taken together we provide a reinterpretation for the nucleotide-specific methylation levels observed in PMDs, demonstrate their conservation across tissues and suggest that they are mainly determined by specific DNA sequence features.
Levels of integration in cognitive control and sequence processing in the prefrontal cortex.
Bahlmann, Jörg; Korb, Franziska M; Gratton, Caterina; Friederici, Angela D
2012-01-01
Cognitive control is necessary to flexibly act in changing environments. Sequence processing is needed in language comprehension to build the syntactic structure in sentences. Functional imaging studies suggest that sequence processing engages the left ventrolateral prefrontal cortex (PFC). In contrast, cognitive control processes additionally recruit bilateral rostral lateral PFC regions. The present study aimed to investigate these two types of processes in one experimental paradigm. Sequence processing was manipulated using two different sequencing rules varying in complexity. Cognitive control was varied with different cue-sets that determined the choice of a sequencing rule. Univariate analyses revealed distinct PFC regions for the two types of processing (i.e. sequence processing: left ventrolateral PFC and cognitive control processing: bilateral dorsolateral and rostral PFC). Moreover, in a common brain network (including left lateral PFC and intraparietal sulcus) no interaction between sequence and cognitive control processing was observed. In contrast, a multivariate pattern analysis revealed an interaction of sequence and cognitive control processing, such that voxels in left lateral PFC and parietal cortex showed different tuning functions for tasks involving different sequencing and cognitive control demands. These results suggest that the difference between the process of rule selection (i.e. cognitive control) and the process of rule-based sequencing (i.e. sequence processing) find their neuronal underpinnings in distinct activation patterns in lateral PFC. Moreover, the combination of rule selection and rule sequencing can shape the response of neurons in lateral PFC and parietal cortex.
Islam, Mohammed A; Schweiger, Teresa A
2015-04-01
To develop an integrated approach of teaching medicinal chemistry, pharmacology, and pharmacotherapeutics and to evaluate students' perceptions of integration as they progress through the PharmD curriculum. Instructors from each discipline jointly mapped the course contents and sequenced the course delivery based on organ systems/disease states. Medicinal chemistry and pharmacology contents were integrated and aligned with respective pharmacotherapeutics contents to deliver throughout second and third year of the curriculum. In addition to classroom lectures, active learning strategies such as recitation, case studies, online-discussion boards, open book quizzes, and writing patient progress notes were incorporated to enhance student learning. Student learning was assessed by examination scores, patient progress notes, and writing assignments. The impact of course integration was evaluated by a Web-based survey. One hundred and sixty-nine students completed the survey. Students exhibited positive attitude toward the integrated approach of teaching medicinal chemistry, pharmacology, and therapeutics. The P3 and P4 students better appreciated the benefits of integration compared to P2 students (P < .05). Students perceived the course integration as an effective way of learning. This study supports course improvement and the viability of expanding the concept of integration to other courses in the curriculum. © The Author(s) 2014.
Sun, Xin; Zhang, Feng; Ding, Yinhuan; Davies, Thomas W; Li, Yu; Wu, Donghui
2017-08-15
Species delimitation remains a significant challenge when the diagnostic morphological characters are limited. Integrative taxonomy was applied to the genus Protaphorura (Collembola: Onychiuridae), which is one of most difficult soil animals to distinguish taxonomically. Three delimitation approaches (morphology, molecular markers and geography) were applied providing rigorous species validation criteria with an acceptably low error rate. Multiple molecular approaches, including distance- and evolutionary model-based methods, were used to determine species boundaries based on 144 standard barcode sequences. Twenty-two molecular putative species were consistently recovered across molecular and geographical analyses. Geographic criteria were was proved to be an efficient delimitation method for onychiurids. Further morphological examination, based on the combination of the number of pseudocelli, parapseudocelli and ventral mesothoracic chaetae, confirmed 18 taxa of 22 molecular units, with six of them described as new species. These characters were found to be of high taxonomical value. This study highlights the potential benefits of integrative taxonomy, particularly simultaneous use of molecular/geographical tools, as a powerful way of ascertaining the true diversity of the Onychiuridae. Our study also highlights that discovering new morphological characters remains central to achieving a full understanding of collembolan taxonomy.
Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin
2015-04-01
This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.
Flank pseudohernia following posterior rib fracture: a case report.
Butensky, Adam M; Gruss, Leah P; Gleit, Zachary L
2016-10-01
A pseudohernia is an abdominal wall bulge that may be mistaken for a hernia but that lacks the disruption of the abdominal wall that characterizes a hernia. Thus, the natural history and treatment of this condition differ from those of a hernia. This is the first report of a pseudohernia due to cough-associated rib fracture. A case of pseudohernia due to fractures of the 10 th and 11 th ribs in a 68-year-old white woman is presented. The patient suffered from a major coughing episode 1 year prior to her presentation, after which she noted a progressively enlarging bulge in her left flank. Computed tomography demonstrated a bulge in the abdominal wall containing bowel and spleen but with all muscle and fascial layers intact; in addition, lateral 10 th rib and posterior 11 th rib fractures were noted. As there was no defect in muscle or fascia, we diagnosed a pseudohernia, likely due to a denervation injury from the fractured ribs. Symptomatic treatment was recommended, including wearing a corset and referral to a pain management clinic. Symptomatic treatment is thought to be the mainstay of therapy for pseudohernias, as surgical intervention is unlikely to be of benefit.
Monolithic microwave integrated circuit with integral array antenna
International Nuclear Information System (INIS)
Stockton, R.J.; Munson, R.E.
1984-01-01
A monolithic microwave integrated circuit including an integral array antenna. The system includes radiating elements, feed network, phasing network, active and/or passive semiconductor devices, digital logic interface circuits and a microcomputer controller simultaneously incorporated on a single substrate by means of a controlled fabrication process sequence
[Norrie syndrome: identification of carriers by segregation analysis with flanking DNA markers].
Körner, J; Uhlhaas, S; Neugebauer, M; Gal, A
1989-01-01
Norrie disease is an X-linked recessive disorder. Affected males present with congenital blindness. Additionally, hearing loss and psychotic behavior may occur at any time. Since carriers are clinically healthy, they can only be identified by genetic means. Daughters of carriers or sisters of affected males have an à priori 50% risk of being carriers themselves. Close linkage has been found between the Norrie disease locus (NDP) and the DNA locus DXS7 mapped to Xp11.3. For genetic counselling, this linkage relationship allows carriers of the disease to be identified in informative families. We describe a large pedigree with Norrie disease. Segregation analysis was carried out with DXS7 and a second flanking marker, DXS255, both linked to NDP. In this way, three females at risk were identified who had a high probability of being carriers for Norrie disease.
Reeves, R H; O'Brien, S J
1984-01-01
RD-114 is a replication-competent, xenotropic retrovirus which is homologous to a family of moderately repetitive DNA sequences present at ca. 20 copies in the normal cellular genome of domestic cats. To examine the extent and character of genomic divergence of the RD-114 gene family as well as to assess their positional association within the cat genome, we have prepared a series of molecular clones of endogenous RD-114 DNA segments from a genomic library of cat cellular DNA. Their restriction endonuclease maps were compared with each other as well as to that of the prototype-inducible RD-114 which was molecularly cloned from a chronically infected human cell line. The endogenous sequences analyzed were similar to each other in that they were colinear with RD-114 proviral DNA, were bounded by long terminal redundancies, and conserved many restriction sites in the gag and pol regions. However, the env regions of many of the sequences examined were substantially deleted. Several of the endogenous RD-114 genomes contained a novel envelope sequence which was unrelated to the env gene of the prototype RD-114 env gene but which, like RD-114 and endogenous feline leukemia virus provirus, was found only in species of the genus Felis, and not in other closely related Felidae genera. The endogenous RD-114 sequences each had a distinct cellular flank which indicates that these sequences are not tandem but dispersed nonspecifically throughout the genome. Southern analysis of cat cellular DNA confirmed the conclusions about conserved restriction sites in endogenous sequences and indicated that a single locus may be responsible for the production of the major inducible form of RD-114. Images PMID:6090693
Directory of Open Access Journals (Sweden)
Peter Norberg
Full Text Available The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp and pMCBF6 (66 729 bp have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA and the vegetative replication origin (oriV. One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.
Yutin, Natalya; Bäckström, Disa; Ettema, Thijs J G; Krupovic, Mart; Koonin, Eugene V
2018-04-10
Analysis of metagenomic sequences has become the principal approach for the study of the diversity of viruses. Many recent, extensive metagenomic studies on several classes of viruses have dramatically expanded the visible part of the virosphere, showing that previously undetected viruses, or those that have been considered rare, actually are important components of the global virome. We investigated the provenance of viruses related to tail-less bacteriophages of the family Tectiviridae by searching genomic and metagenomics sequence databases for distant homologs of the tectivirus-like Double Jelly-Roll major capsid proteins (DJR MCP). These searches resulted in the identification of numerous genomes of virus-like elements that are similar in size to tectiviruses (10-15 kilobases) and have diverse gene compositions. By comparison of the gene repertoires, the DJR MCP-encoding genomes were classified into 6 distinct groups that can be predicted to differ in reproduction strategies and host ranges. Only the DJR MCP gene that is present by design is shared by all these genomes, and most also encode a predicted DNA-packaging ATPase; the rest of the genes are present only in subgroups of this unexpectedly diverse collection of DJR MCP-encoding genomes. Only a minority encode a DNA polymerase which is a hallmark of the family Tectiviridae and the putative family "Autolykiviridae". Notably, one of the identified putative DJR MCP viruses encodes a homolog of Cas1 endonuclease, the integrase involved in CRISPR-Cas adaptation and integration of transposon-like elements called casposons. This is the first detected occurrence of Cas1 in a virus. Many of the identified elements are individual contigs flanked by inverted or direct repeats and appear to represent complete, extrachromosomal viral genomes, whereas others are flanked by bacterial genes and thus can be considered as proviruses. These contigs come from metagenomes of widely different environments, some dominated by
Harp, A. G.; Valentine, G. A.
2018-06-01
In the article "Emplacement controls for the basaltic-andesitic radial dikes of Summer Coon volcano and implications for flank vents at stratovolcanoes", the vertical axis for Fig. 8 a was incorrectly labeled (i.e., the value for dikes per km2).
Generation and characterization of a stable red fluorescent ...
African Journals Online (AJOL)
An approximately 1.0 kb fragment amplified from 5'-flanking sequence of transgenes was identified in wild-type T. albonubes genome, and bears no homologous sequence in the GenBank database. In the 3'-flanking region, an approximately 1.2 kb fragment with unidentified source was amplified which has 99% homology ...
A new mathematical model of the surface degradation causing wear on the cutting tool`s flank land
Pаlmai, Z.
2011-01-01
Having reviewed the extensive literature on the wear of the cutting tool, we chose the theoretical description of flank wear as the subject matter of this paper. Based on the optical electron-optical and morphological studies of the physical characteristics of wear processes we came to the conclusion that the cutting distance need not only be taken into consideration in abrasive, adhesive processes but also in thermally activated diffusion, oxidation processes. Consequently, we propose the ap...
Ghosh, Jayadri Sekhar; Bhattacharya, Samik; Pal, Amita
2017-06-01
The unavailability of the reproductive structure and unpredictability of vegetative characters for the identification and phylogenetic study of bamboo prompted the application of molecular techniques for greater resolution and consensus. We first employed internal transcribed spacer (ITS1, 5.8S rRNA and ITS2) sequences to construct the phylogenetic tree of 21 tropical bamboo species. While the sequence alone could grossly reconstruct the traditional phylogeny amongst the 21-tropical species studied, some anomalies were encountered that prompted a further refinement of the phylogenetic analyses. Therefore, we integrated the secondary structure of the ITS sequences to derive individual sequence-structure matrix to gain more resolution on the phylogenetic reconstruction. The results showed that ITS sequence-structure is the reliable alternative to the conventional phenotypic method for the identification of bamboo species. The best-fit topology obtained by the sequence-structure based phylogeny over the sole sequence based one underscores closer clustering of all the studied Bambusa species (Sub-tribe Bambusinae), while Melocanna baccifera, which belongs to Sub-Tribe Melocanneae, disjointedly clustered as an out-group within the consensus phylogenetic tree. In this study, we demonstrated the dependability of the combined (ITS sequence+structure-based) approach over the only sequence-based analysis for phylogenetic relationship assessment of bamboo.
National Oceanic and Atmospheric Administration, Department of Commerce — The project restored both structural and habitat functions of Grand Liard Bayou and flanking marshes. The project created and nourished marsh and restored a ridge on...
Directory of Open Access Journals (Sweden)
Kojima Kenji K
2010-07-01
Full Text Available Abstract Background Long interspersed nuclear element-1 (LINE-1 or L1 is a dominant repetitive sequence in the human genome. Besides mediating its own retrotransposition, L1 can mobilize Alu and messenger RNA (mRNA in trans, and probably also SVA and non-coding RNA. The structures of L1 copies and trans-mobilized retrocopies are variable and can be classified into three categories: full-length; 5'-truncated; and 5'-inverted insertions. These structures may be generated by different 5' integration mechanisms. Results In this study, a method to correctly characterize insertions with short target site duplications (TSDs is developed and extranucleotides, TSDs and microhomologies (MHs at junctions were analysed for the three types of insertions. Only 5'-truncated L1 insertions were found to be associated with short TSDs. Both full-length and 5'-truncated retrotransposed sequences in trans, including Alu, SVA and mRNA retrocopies and also full-length and 5'-inverted L1, were not associated with short TSDs, indicating the difference of 5' attachment between retrotransposition in cis and retrotransposition in trans. Target sequence analysis suggested that short TSDs were generated in an L1 endonuclease-dependent manner. The MHs were longer for 5'-inverted L1 than for 5'-truncated L1, indicating less dependence on annealing in 5'-truncated L1 insertions. Conclusions The results suggest that insertions flanked by short TSDs occur more often coupled with the insertion of 5'-truncated L1 than with those of other types of insertions in vivo. The method used in this study can be used to characterize elements without any apparent boundary structures.
Cloning and sequencing of Staphylococcus aureus murC, a gene essential for cell wall biosynthesis.
Lowe, A M; Deresiewicz, R L
1999-01-01
Staphylococcus aureus is a major human pathogen that is increasingly resistant to clinically useful antimicrobial agents. While screening for S. aureus genes expressed during mammalian infection, we isolated murC. This gene encodes UDP-N-acetylmuramoyl-L-alanine synthetase, an enzyme essential for cell wall biosynthesis in a number of bacteria. S. aureus MurC has a predicted mass 49,182 Da and complements the temperature-sensitive murC mutation of E. coli ST222. Sequence data on the DNA flanking staphylococcal murC suggests that the local gene organization there parallels that found in B. subtilis, but differs from that found in gram-negative bacterial pathogens. MurC proteins represent promising targets for broad spectrum antimicrobial drug development.
Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin
2015-10-01
Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.
LOX: Inferring level of expression from diverse methods of census sequencing
Zhang, Zhang
2010-06-10
Summary: We present LOX (Level Of eXpression) that estimates the Level Of gene eXpression from high-throughput-expressed sequence datasets with multiple treatments or samples. Unlike most analyses, LOX incorporates a gene bias model that facilitates integration of diverse transcriptomic sequencing data that arises when transcriptomic data have been produced using diverse experimental methodologies. LOX integrates overall sequence count tallies normalized by total expressed sequence count to provide expression levels for each gene relative to all treatments as well as Bayesian credible intervals. © The Author 2010. Published by Oxford University Press. All rights reserved.
LOX: Inferring level of expression from diverse methods of census sequencing
Zhang, Zhang; Ló pez-Girá ldez, Francesc Francisco; Townsend, Jeffrey P.
2010-01-01
Summary: We present LOX (Level Of eXpression) that estimates the Level Of gene eXpression from high-throughput-expressed sequence datasets with multiple treatments or samples. Unlike most analyses, LOX incorporates a gene bias model that facilitates integration of diverse transcriptomic sequencing data that arises when transcriptomic data have been produced using diverse experimental methodologies. LOX integrates overall sequence count tallies normalized by total expressed sequence count to provide expression levels for each gene relative to all treatments as well as Bayesian credible intervals. © The Author 2010. Published by Oxford University Press. All rights reserved.
Investigation of the role of TCF4 rare sequence variants in schizophrenia.
Basmanav, F Buket; Forstner, Andreas J; Fier, Heide; Herms, Stefan; Meier, Sandra; Degenhardt, Franziska; Hoffmann, Per; Barth, Sandra; Fricker, Nadine; Strohmaier, Jana; Witt, Stephanie H; Ludwig, Michael; Schmael, Christine; Moebus, Susanne; Maier, Wolfgang; Mössner, Rainald; Rujescu, Dan; Rietschel, Marcella; Lange, Christoph; Nöthen, Markus M; Cichon, Sven
2015-07-01
Transcription factor 4 (TCF4) is one of the most robust of all reported schizophrenia risk loci and is supported by several genetic and functional lines of evidence. While numerous studies have implicated common genetic variation at TCF4 in schizophrenia risk, the role of rare, small-sized variants at this locus-such as single nucleotide variants and short indels which are below the resolution of chip-based arrays requires further exploration. The aim of the present study was to investigate the association between rare TCF4 sequence variants and schizophrenia. Exon-targeted resequencing was performed in 190 German schizophrenia patients. Six rare variants at the coding exons and flanking sequences of the TCF4 gene were identified, including two missense variants and one splice site variant. These six variants were then pooled with nine additional rare variants identified in 379 European participants of the 1000 Genomes Project, and all 15 variants were genotyped in an independent German sample (n = 1,808 patients; n = 2,261 controls). These data were then analyzed using six statistical methods developed for the association analysis of rare variants. No significant association (P power analyses suggest that further research into the possible involvement of rare TCF4 sequence variants in schizophrenia risk is warranted by the assessment of larger cohorts with higher statistical power to identify rare variant associations. © 2015 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Rodrigues NB
2002-01-01
Full Text Available In the last decade microsatellites have become one of the most useful genetic markers used in a large number of organisms due to their abundance and high level of polymorphism. Microsatellites have been used for individual identification, paternity tests, forensic studies and population genetics. Data on microsatellite abundance comes preferentially from microsatellite enriched libraries and DNA sequence databases. We have conducted a search in GenBank of more than 16,000 Schistosoma mansoni ESTs and 42,000 BAC sequences. In addition, we obtained 300 sequences from CA and AT microsatellite enriched genomic libraries. The sequences were searched for simple repeats using the RepeatMasker software. Of 16,022 ESTs, we detected 481 (3% sequences that contained 622 microsatellites (434 perfect, 164 imperfect and 24 compounds. Of the 481 ESTs, 194 were grouped in 63 clusters containing 2 to 15 ESTs per cluster. Polymorphisms were observed in 16 clusters. The 287 remaining ESTs were orphan sequences. Of the 42,017 BAC end sequences, 1,598 (3.8% contained microsatellites (2,335 perfect, 287 imperfect and 79 compounds. The 1,598 BAC end sequences 80 were grouped into 17 clusters containing 3 to 17 BAC end sequences per cluster. Microsatellites were present in 67 out of 300 sequences from microsatellite enriched libraries (55 perfect, 38 imperfect and 15 compounds. From all of the observed loci 55 were selected for having the longest perfect repeats and flanking regions that allowed the design of primers for PCR amplification. Additionally we describe two new polymorphic microsatellite loci.
Miller, Danny E; Cook, Kevin R; Yeganeh Kazemi, Nazanin; Smith, Clarissa B; Cockrell, Alexandria J; Hawley, R Scott; Bergman, Casey M
2016-03-08
Multiply inverted balancer chromosomes that suppress exchange with their homologs are an essential part of the Drosophila melanogaster genetic toolkit. Despite their widespread use, the organization of balancer chromosomes has not been characterized at the molecular level, and the degree of sequence variation among copies of balancer chromosomes is unknown. To map inversion breakpoints and study potential diversity in descendants of a structurally identical balancer chromosome, we sequenced a panel of laboratory stocks containing the most widely used X chromosome balancer, First Multiple 7 (FM7). We mapped the locations of FM7 breakpoints to precise euchromatic coordinates and identified the flanking sequence of breakpoints in heterochromatic regions. Analysis of SNP variation revealed megabase-scale blocks of sequence divergence among currently used FM7 stocks. We present evidence that this divergence arose through rare double-crossover events that replaced a female-sterile allele of the singed gene (sn(X2)) on FM7c with a sequence from balanced chromosomes. We propose that although double-crossover events are rare in individual crosses, many FM7c chromosomes in the Bloomington Drosophila Stock Center have lost sn(X2) by this mechanism on a historical timescale. Finally, we characterize the original allele of the Bar gene (B(1)) that is carried on FM7, and validate the hypothesis that the origin and subsequent reversion of the B(1) duplication are mediated by unequal exchange. Our results reject a simple nonrecombining, clonal mode for the laboratory evolution of balancer chromosomes and have implications for how balancer chromosomes should be used in the design and interpretation of genetic experiments in Drosophila.
International Nuclear Information System (INIS)
Nelson, J.G.; Castillo, C.; Huntsman, J.; Killoy, S.; Lucek, H.; Marks, T.C.
2011-01-01
Faced with the Department of Energy (DOE) Complex Transformation, National Nuclear Security Administration (NNSA) was tasked with developing an integrated plan for the decommissioning of over 400 facilities and 300 environmental remediation units, as well as the many reconfiguration and modernization projects at the Oak Ridge National Laboratory (ORNL) and Y-12 Complex. Manual scheduling of remediation activities is time-consuming and inherently introduces bias of the scheduler or organization into the process. Clearly a well-defined process, quantitative risk-based tool was needed to develop an objective, unbiased baseline sequence and schedule with a sound technical foundation for the Integrated Facility Disposition Project (IFDP). Faced with limited available data, innovation was needed to extrapolate intelligent relative data for key risk parameters based on known data elements. The IFDP Supermodel was customized and expanded to provide this capability for conceptual planning of diverse project portfolios and multiple sites. (author)
Directory of Open Access Journals (Sweden)
Nataly de Jesús Huertas
2017-06-01
Full Text Available Peptides derived from LfcinB were designed and synthesized, and their antibacterial activity was tested against Escherichia coli ATCC 25922 and Staphylococcus aureus ATCC 25923. Specifically, a peptide library was constructed by systemically removing the flanking residues (N or C-terminal of Lfcin 17–31 (17FKCRRWQWRMKKLGA31, maintaining in all peptides the 20RRWQWR25 sequence that corresponds to the minimal antimicrobial motif. For this research, also included were (i a peptide containing an Ala instead of Cys ([Ala19]-LfcinB 17–31 and (ii polyvalent peptides containing the RRWQWR sequence and a non-natural amino acid (aminocaproic acid. We established that the lineal peptides LfcinB 17–25 and LfcinB 17–26 exhibited the greatest activity against E. coli ATCC 25922 and S. aureus ATCC 25923, respectively. On the other hand, polyvalent peptides, a dimer and a tetramer, exhibited the greatest antibacterial activity, indicating that multiple copies of the sequence increase the activity. Our results suggest that the dimeric and tetrameric sequence forms potentiate the antibacterial activity of lineal sequences that have exhibited moderate antibacterial activity.
International Nuclear Information System (INIS)
Wang, Li-Jen; Wong, Yon-Cheong; Ng, Chip-Jin; Chen, Jih-Chang; Chiu, Te-Fa
2004-01-01
The aim of this study was to assess the usefulness of combined direct and indirect signs on intravenous urography (IVU) and unenhanced helical computed tomography (UHCT) for the diagnosis of ureteral stones in emergency patients with acute flank pain. During an 8-month period, 82 emergency patients with acute flank pain undergoing IVU and UHCT with sufficient clinical follow-up formed the study group. The presence or absence of direct sign (visualization of ureteral stones) and indirect signs on IVU and UHCT was recorded. The diagnostic accuracy of each direct/indirect sign and their combination for the diagnosis of ureteral stones on IVU and UHCT were analyzed and compared. Of the 82 patients, 66 had ureteral stones, four had passed urinary stones prior to imaging and 12 had other diseases. The diagnostic accuracies of direct signs on IVU and UHCT for the diagnosis of ureteral stones were 79.3 and 98.8%, respectively, which was more accurate than that of any single indirect sign on IVU and UHCT. However, the diagnostic accuracy of ureteral stones by IVU increased to 90.2% when using diagnostic criteria requiring the presence of a direct sign or at least three indirect signs, and by UHCT, it increased to 100% when using diagnostic criteria requiring the presence of a direct sign with at least one indirect sign. Therefore, for emergency patients with acute flank pain, the use of the above combinations of direct/indirect signs is useful as the diagnostic criterion for ureteral stones. (orig.)
Norini, Gianluca; de Beni, Emanuela; Andronico, Daniele; Polacci, Margherita; Burton, Mike; Zucca, Francesco
2009-02-01
On 16 November 2006 a flank collapse affected the unstable eastern slope of the South-East Crater (SEC) of Mount Etna. The collapse occurred during one of the paroxysmal events with sustained strombolian activity that characterized the August-December 2006 eruption and was triggered by erosion of loose, hydrothermally altered material of the steep south-east sector of SEC from the outpour of lava. The collapse produced a debris avalanche that involved both lithic and juvenile material and resulted in a deposit emplaced on the eastern flank of the volcano up to 1.2 km away from the source. The total volume of the deposit was estimated to be in the order of 330,000-413,000 m3. The reconstruction of the collapse event was simulated using TITAN2D software designed to model granular avalanches and landslides. This approach can be used to estimate areas that may be affected by similar collapse events in the future. The area affected by the 16 November 2006 lateral collapse of SEC was a small portion of the Mount Etna summit area, but the fact that no one was killed or injured should be considered fortuitous. The summit and adjacent areas of the volcano, in fact, are usually visited by many tourists who are not prepared to face this type of danger. The 16 November 2006 collapse points to the need to be prepared for similar events through scientific investigation (analysis of flank instability, numerical simulation of flows) and development of specific civil protection plans.
On calculating the probability of a set of orthologous sequences
Directory of Open Access Journals (Sweden)
Junfeng Liu
2009-02-01
Full Text Available Junfeng Liu1,2, Liang Chen3, Hongyu Zhao4, Dirk F Moore1,2, Yong Lin1,2, Weichung Joe Shih1,21Biometrics Division, The Cancer, Institute of New Jersey, New Brunswick, NJ, USA; 2Department of Biostatistics, School of Public Health, University of Medicine and Dentistry of New Jersey, Piscataway, NJ, USA; 3Department of Biological Sciences, University of Southern California, Los Angeles, CA, USA; 4Department of Epidemiology and Public Health, Yale University School of Medicine, New Haven, CT, USAAbstract: Probabilistic DNA sequence models have been intensively applied to genome research. Within the evolutionary biology framework, this article investigates the feasibility for rigorously estimating the probability of a set of orthologous DNA sequences which evolve from a common progenitor. We propose Monte Carlo integration algorithms to sample the unknown ancestral and/or root sequences a posteriori conditional on a reference sequence and apply pairwise Needleman–Wunsch alignment between the sampled and nonreference species sequences to estimate the probability. We test our algorithms on both simulated and real sequences and compare calculated probabilities from Monte Carlo integration to those induced by single multiple alignment.Keywords: evolution, Jukes–Cantor model, Monte Carlo integration, Needleman–Wunsch alignment, orthologous
LPTAU, Quasi Random Sequence Generator
International Nuclear Information System (INIS)
Sobol, Ilya M.
1993-01-01
1 - Description of program or function: LPTAU generates quasi random sequences. These are uniformly distributed sets of L=M N points in the N-dimensional unit cube: I N =[0,1]x...x[0,1]. These sequences are used as nodes for multidimensional integration; as searching points in global optimization; as trial points in multi-criteria decision making; as quasi-random points for quasi Monte Carlo algorithms. 2 - Method of solution: Uses LP-TAU sequence generation (see references). 3 - Restrictions on the complexity of the problem: The number of points that can be generated is L 30 . The dimension of the space cannot exceed 51
Directory of Open Access Journals (Sweden)
Vinod Kumar Singh
2016-09-01
Full Text Available Genome-wide experimental studies in Saccharomyces cerevisiae reveal that autonomous replicating sequence (ARS requires an essential consensus sequence (ACS for replication activity. Computational studies identified thousands of ACS like patterns in the genome. However, only a few hundreds of these sites act as replicating sites and the rest are considered as dormant or evolving sites. In a bid to understand the sequence makeup of replication sites, a content and context-based analysis was performed on a set of replicating ACS sequences that binds to origin-recognition complex (ORC denoted as ORC-ACS and non-replicating ACS sequences (nrACS, that are not bound by ORC. In this study, DNA properties such as base composition, correlation, sequence dependent thermodynamic and DNA structural profiles, and their positions have been considered for characterizing ORC-ACS and nrACS. Analysis reveals that ORC-ACS depict marked differences in nucleotide composition and context features in its vicinity compared to nrACS. Interestingly, an A-rich motif was also discovered in ORC-ACS sequences within its nucleosome-free region. Profound changes in the conformational features, such as DNA helical twist, inclination angle and stacking energy between ORC-ACS and nrACS were observed. Distribution of ACS motifs in the non-coding segments points to the locations of ORC-ACS which are found far away from the adjacent gene start position compared to nrACS thereby enabling an accessible environment for ORC-proteins. Our attempt is novel in considering the contextual view of ACS and its flanking region along with nucleosome positioning in the S. cerevisiae genome and may be useful for any computational prediction scheme.
Lough, R. G.; Broughton, E. A.; Buckley, L. J.; Incze, L. S.; Pehrson Edwards, K.; Converse, R.; Aretxabaleta, A.; Werner, F. E.
2006-11-01
Cruises were conducted in spring 1999 to describe the interaction between tidal-front processes and the transport, retention, and growth of cod larvae and their prey during the seasonal transition to a stratified water-column along the southern flank of Georges Bank. All the physical and biological observations were integrated in coupled circulation-trophodynamic simulations. The three-dimensional circulation fields were modeled using data assimilation methods described in Aretxabaleta et al. [2005. Data assimilative hindcast on the Southern Flank of Georges Bank during May 1999: frontal circulation and implications. Continental Shelf Research 25, 849-874]. The individual-based model (IBM) of Lough et al. [2005. A general biophysical model of larval cod growth applied to populations on Georges Bank. Fisheries Oceanography 14, 241-262] was used to consider trophodynamic effects on the growth and survival of larval cod. Prey fields were specified for mixed and stratified water columns from field surveys and allowed to adjust in the circulation model. Encounter and ingestion rates of larvae were functions of prey concentration, larval search patterns, light, swimming speeds of predator and prey, and turbulence. Model outputs provide hourly depth-dependent estimates of growth rates, prey biomass ingested, and larval length and weight. Simulations were conducted along a 2-D transect across the tidal front, from mixed to stratified water columns, before and after a wind event. Pre-storm, observed larval cod growth rates, based on RNA-DNA analysis, were highest in the surface 20 m at the stratified and front stations. Post-storm, larval growth rates decreased 1-2% d -1 at the stratified and front stations, corresponding with a <1 °C decrease in temperature. At the mixed station, there was no apparent difference in growth rates with depth, either before or after the storm. Simulations indicate that maximum larval growth rates can occur at the tidal-mixing front due to the
Deep Sequencing of 71 Candidate Genes to Characterize Variation Associated with Alcohol Dependence.
Clark, Shaunna L; McClay, Joseph L; Adkins, Daniel E; Kumar, Gaurav; Aberg, Karolina A; Nerella, Srilaxmi; Xie, Linying; Collins, Ann L; Crowley, James J; Quackenbush, Corey R; Hilliard, Christopher E; Shabalin, Andrey A; Vrieze, Scott I; Peterson, Roseann E; Copeland, William E; Silberg, Judy L; McGue, Matt; Maes, Hermine; Iacono, William G; Sullivan, Patrick F; Costello, Elizabeth J; van den Oord, Edwin J
2017-04-01
Previous genomewide association studies (GWASs) have identified a number of putative risk loci for alcohol dependence (AD). However, only a few loci have replicated and these replicated variants only explain a small proportion of AD risk. Using an innovative approach, the goal of this study was to generate hypotheses about potentially causal variants for AD that can be explored further through functional studies. We employed targeted capture of 71 candidate loci and flanking regions followed by next-generation deep sequencing (mean coverage 78X) in 806 European Americans. Regions included in our targeted capture library were genes identified through published GWAS of alcohol, all human alcohol and aldehyde dehydrogenases, reward system genes including dopaminergic and opioid receptors, prioritized candidate genes based on previous associations, and genes involved in the absorption, distribution, metabolism, and excretion of drugs. We performed single-locus tests to determine if any single variant was associated with AD symptom count. Sets of variants that overlapped with biologically meaningful annotations were tested for association in aggregate. No single, common variant was significantly associated with AD in our study. We did, however, find evidence for association with several variant sets. Two variant sets were significant at the q-value <0.10 level: a genic enhancer for ADHFE1 (p = 1.47 × 10 -5 ; q = 0.019), an alcohol dehydrogenase, and ADORA1 (p = 5.29 × 10 -5 ; q = 0.035), an adenosine receptor that belongs to a G-protein-coupled receptor gene family. To our knowledge, this is the first sequencing study of AD to examine variants in entire genes, including flanking and regulatory regions. We found that in addition to protein coding variant sets, regulatory variant sets may play a role in AD. From these findings, we have generated initial functional hypotheses about how these sets may influence AD. Copyright © 2017 by the Research Society on
Purires and Picagres faults and its relationship with the 1990 Puriscal seismic sequence
International Nuclear Information System (INIS)
Montero, Walter; Rojas, Wilfredo
2014-01-01
The system of active faults in the region between the southern flank of the Montes del Aguacate and the northwest flank of the Talamanca mountain range was re-evaluated and defined in relation to the seismic activity that occurred between the end of March 1990 and the beginning of 1991. Aerial photographs of different scales of the Instituto Geografico Nacional de Costa Rica, aerial photographs of scale 1: 40000 of the TERRA project, of the Centro Nacional Geoambiental and infrared photos of scale 1: 40000 of the Mission CARTA 2003, of the Programa Nacional de Investigaciones Aerotransportadas y Sensores Remotos (PRIAS) were reviewed. Morphotectonic, structural and geological information related to the various faults was obtained with field work. A set of faults within the study area were determined with the neotectonic investigation. Several of these faults continue outside the zone both to the northwest within the Montes del Aguacate, and to the southeast to the NW foothills of the Cordillera de Talamanca. The superficial focus seismicity (<20 km), which occurred in the Puriscal area during 1990, was revised from previous studies, whose base information comes from the Red Sismologica Nacional (RSN, UCR-ICE). The relationship between the superficial seismic sequence and the defined faults was determined, allowing to conclude that the main seismic sources that originated the seismicity were the Purires and Picagres faults. A minor seismicity was related to the faults Jaris, Bajos de Jorco, Zapote and Junquillo [es
Directory of Open Access Journals (Sweden)
Carol Ying-Ying Szeto
2014-01-01
Full Text Available Nasopharyngeal carcinoma (NPC is a prevalent malignancy in Southeast Asia among the Chinese population. Aberrant regulation of transcripts has been implicated in many types of cancers including NPC. Herein, we characterized mRNA and miRNA transcriptomes by RNA sequencing (RNASeq of NPC model systems. Matched total mRNA and small RNA of undifferentiated Epstein–Barr virus (EBV-positive NPC xenograft X666 and its derived cell line C666, well-differentiated NPC cell line HK1, and the immortalized nasopharyngeal epithelial cell line NP460 were sequenced by Solexa technology. We found 2812 genes and 149 miRNAs (human and EBV to be differentially expressed in NP460, HK1, C666 and X666 with RNASeq; 533 miRNA–mRNA target pairs were inversely regulated in the three NPC cell lines compared to NP460. Integrated mRNA/miRNA expression profiling and pathway analysis show extracellular matrix organization, Beta-1 integrin cell surface interactions, and the PI3K/AKT, EGFR, ErbB, and Wnt pathways were potentially deregulated in NPC. Real-time quantitative PCR was performed on selected mRNA/miRNAs in order to validate their expression. Transcript sequence variants such as short insertions and deletions (INDEL, single nucleotide variant (SNV, and isomiRs were characterized in the NPC model systems. A novel TP53 transcript variant was identified in NP460, HK1, and C666. Detection of three previously reported novel EBV-encoded BART miRNAs and their isomiRs were also observed. Meta-analysis of a model system to a clinical system aids the choice of different cell lines in NPC studies. This comprehensive characterization of mRNA and miRNA transcriptomes in NPC cell lines and the xenograft provides insights on miRNA regulation of mRNA and valuable resources on transcript variation and regulation in NPC, which are potentially useful for mechanistic and preclinical studies.
Bonzano, L; Tacchino, A; Roccatagliata, L; Sormani, M P; Mancardi, G L; Bove, M
2011-07-15
Sequence learning can be investigated by serial reaction-time (SRT) paradigms. Explicit learning occurs when subjects have to recognize a test sequence and has been shown to activate the frontoparietal network in both contralateral and ipsilateral hemispheres. Thus, the left and right superior longitudinal fasciculi (SLF), connecting the intra-hemispheric frontoparietal circuits, could have a role in explicit unimanual visuomotor learning. Also, as both hemispheres are involved, we could hypothesize that the corpus callosum (CC) has a role in this process. Pathological damage in both SLF and CC has been detected in patients with Multiple Sclerosis (PwMS), and microstructural alterations can be quantified by Diffusion Tensor Imaging (DTI). In light of these findings, we inquired whether PwMS with minimal disability showed impairments in explicit visuomotor sequence learning and whether this could be due to loss of white matter integrity in these intra- and inter-hemispheric white matter pathways. Thus, we combined DTI analysis with a modified version of SRT task based on finger opposition movements in a group of PwMS with minimal disability. We found that the performance in explicit sequence learning was significantly reduced in these patients with respect to healthy subjects; the amount of sequence-specific learning was found to be more strongly correlated with fractional anisotropy (FA) in the CC (r=0.93) than in the left (r=0.28) and right SLF (r=0.27) (p for interaction=0.005 and 0.04 respectively). This finding suggests that an inter-hemispheric information exchange between the homologous areas is required to successfully accomplish the task and indirectly supports the role of the right (ipsilateral) hemisphere in explicit visuomotor learning. On the other hand, we found no significant correlation of the FA in the CC and in the SLFs with nonspecific learning (assessed when stimuli are randomly presented), supporting the hypothesis that inter
Barik, Sailen
2018-01-01
The two classical immunophilin families, found essentially in all living cells, are: cyclophilin (CYN) and FK506-binding protein (FKBP). We previously reported a novel class of immunophilins that are natural chimera of these two, which we named dual-family immunophilin (DFI). The DFIs were found in either of two conformations: CYN-linker-FKBP (CFBP) or FKBP-3TPR-CYN (FCBP). While the 3TPR domain can serve as a flexible linker between the FKBP and CYN modules in the FCBP-type DFI, the linker sequences in the CFBP-type DFIs are relatively short, diverse in sequence, and contain no discernible motif or signature. Here, I present several lines of computational evidence that, regardless of their primary structure, these CFBP linkers are intrinsically disordered. This report provides the first molecular foundation for the model that the CFBP linker acts as an unstructured, flexible loop, allowing the two flanking chaperone modules function independently while linked in cis , likely to assist in the folding of multisubunit client complexes.
Unenhanced helical computed tomography in the evaluation of acute flank pain
International Nuclear Information System (INIS)
Ahmad, N.A.; Ather, M.H.; Rees, J.
2003-01-01
The purpose of this study was to determine the value of unenhanced helical computed tomography (UHCT) in the diagnosis of acute flank pain at our institution. Two hundred and thirty-three consecutive UHCT examinations, performed for suspected renal/ureteral colic between July 2000 and August 2001 were reviewed, along with pertinent medical records. Ureteral calculi were identified in 148 (64%) examinations, evidence of recent passage of calculi was found in 10 (4%) and no calculi were found in 75 (32%). Thirty-two of the conservatively managed patients were excluded for inadequate follow-up. In the remaining 201 patients, sensitivity of UHCT in diagnosing calculi was 99% and specificity was 98%, while the positive predictive value was 99% and negative positive predictive value was 98%. Overall, an alternative or additional diagnosis was established in 28 (12%) patients. Upon diagnosis of ureterolithiasis on UHCT, none of the patients required additional imaging studies for confirmation. UHCT is a highly sensitive imaging modality for the detection of urinary tract calculi and obstruction. (author)
Sang, H; Whitehouse, H L
1983-02-01
Aberrant asci containing one or more wild-type spores were selected from crosses between pairs of alleles of the buff locus in the presence of closely linked flanking markers. Data were obtained relating to the site of aberrant segregation and the position of any associated crossover giving recombination of flanking markers. Aberrant segregation at a proximal site within the buff gene may be associated with a crossover proximal to the site of aberrant segregation or, with equal frequency, with a crossover distal to the site of the second mutant present in the cross. Similarly, segregation at a distal site may be associated with a crossover distal to the site or, with lower frequency, with a crossover proximal to the site of the proximal mutant present in the cross. Crossovers between the alleles were rare. This evidence for the relationship between hybrid DNA and crossing over is discussed in terms of current models for the mechanism of recombination.
Geologic map of the northeast flank of Mauna Loa volcano, Island of Hawai'i, Hawaii
Trusdell, Frank A.; Lockwood, John P.
2017-05-01
SummaryMauna Loa, the largest volcano on Earth, has erupted 33 times since written descriptions became available in 1832. Some eruptions were preceded by only brief seismic unrest, while others followed several months to a year of increased seismicity.The majority of the eruptions of Mauna Loa began in the summit area (>12,000-ft elevation; Lockwood and Lipman, 1987); yet the Northeast Rift Zone (NERZ) was the source of eight flank eruptions since 1843 (table 1). This zone extends from the 13,680-ft-high summit towards Hilo (population ~60,000), the second largest city in the State of Hawaii. Although most of the source vents are farther than 30 km away, the 1880 flow from one of the vents extends into Hilo, nearly reaching Hilo Bay. The city is built entirely on flows erupted from the NERZ, most older than that erupted in 1843.Once underway, Mauna Loa's eruptions can produce lava flows that reach the sea in less than 24 hours, severing roads and utilities in their path. For example, lava flows erupted from the Southwest Rift Zone (SWRZ) in 1950 advanced at an average rate of 9.3 km per hour, and all three lobes reached the ocean within approximately 24 hours (Finch and Macdonald, 1953). The flows near the eruptive vents must have traveled even faster.In terms of eruption frequency, pre-eruption warning, and rapid flow emplacement, Mauna Loa poses an enormous volcanic-hazard threat to the Island of Hawai‘i. By documenting past activity and by alerting the public and local government officials of our findings, we can anticipate the volcanic hazards and substantially mitigate the risks associated with an eruption of this massive edifice.From the geologic record, we can deduce several generalized facts about the geologic history of the NERZ. The middle to the uppermost section of the rift zone were more active in the past 4,000 years than the lower part, perhaps due to buttressing of the lower east rift zone by Mauna Kea and Kīlauea volcanoes. The historical flows
Yeruva, Dileep Kumar; Jukuri, Srinivas; Velvizhi, G; Naresh Kumar, A; Swamy, Y V; Venkata Mohan, S
2015-01-01
The present study evaluates the sequential integration of two advanced biological treatment methods viz., sequencing batch reactor (SBR) and bioelectrochemical treatment systems (BET) for the treatment of real-field petrochemical wastewater (PCW). Initially two SBR reactors were operated in aerobic (SBR(Ae)) and anoxic (SBR(Ax)) microenvironments with an organic loading rate (OLR) of 9.68 kg COD/m(3)-day. Relatively, SBR(Ax) showed higher substrate degradation (3.34 kg COD/m(3)-day) compared to SBR(Ae) (2.9 kg COD/m(3)-day). To further improve treatment efficiency, the effluents from SBR process were fed to BET reactors. BET(Ax) depicted higher SDR (1.92 kg COD/m(3)-day) with simultaneous power generation (17.12 mW/m(2)) followed by BET(Ae) (1.80 kg COD/m(3)-day; 14.25 mW/m(2)). Integrating both the processes documented significant improvement in COD removal efficiency due to the flexibility of combining multiple microenvironments sequentially. Results were supported with GC-MS and FTIR, which confirmed the increment in biodegradability of wastewater. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Patrik L Ståhl
Full Text Available Biomarker identification is of utmost importance for the development of novel diagnostics and therapeutics. Here we make use of a translational database selection strategy, utilizing data from the Human Protein Atlas (HPA on differentially expressed protein patterns in healthy and breast cancer tissues as a means to filter out potential biomarkers for underlying genetic causatives of the disease. DNA was isolated from ten breast cancer biopsies, and the protein coding and flanking non-coding genomic regions corresponding to the selected proteins were extracted in a multiplexed format from the samples using a single DNA sequence capture array. Deep sequencing revealed an even enrichment of the multiplexed samples and a great variation of genetic alterations in the tumors of the sampled individuals. Benefiting from the upstream filtering method, the final set of biomarker candidates could be completely verified through bidirectional Sanger sequencing, revealing a 40 percent false positive rate despite high read coverage. Of the variants encountered in translated regions, nine novel non-synonymous variations were identified and verified, two of which were present in more than one of the ten tumor samples.
Toward an Integrated BAC Library Resource for Genome Sequencing and Analysis; FINAL
International Nuclear Information System (INIS)
Simon, M. I.; Kim, U.-J.
2002-01-01
We developed a great deal of expertise in building large BAC libraries from a variety of DNA sources including humans, mice, corn, microorganisms, worms, and Arabidopsis. We greatly improved the technology for screening these libraries rapidly and for selecting appropriate BACs and mapping BACs to develop large overlapping contigs. We became involved in supplying BACs and BAC contigs to a variety of sequencing and mapping projects and we began to collaborate with Drs. Adams and Venter at TIGR and with Dr. Leroy Hood and his group at University of Washington to provide BACs for end sequencing and for mapping and sequencing of large fragments of chromosome 16. Together with Dr. Ian Dunham and his co-workers at the Sanger Center we completed the mapping and they completed the sequencing of the first human chromosome, chromosome 22. This was published in Nature in 1999 and our BAC contigs made a major contribution to this sequencing effort. Drs. Shizuya and Ding invented an automated highly accurate BAC mapping technique. We also developed long-term collaborations with Dr. Uli Weier at UCSF in the design of BAC probes for characterization of human tumors and specific chromosome deletions and breakpoints. Finally the contribution of our work to the human genome project has been recognized in the publication both by the international consortium and the NIH of a draft sequence of the human genome in Nature last year. Dr. Shizuya was acknowledged in the authorship of that landmark paper. Dr. Simon was also an author on the Venter/Adams Celera project sequencing the human genome that was published in Science last year
Accident sequence quantification with KIRAP
Energy Technology Data Exchange (ETDEWEB)
Kim, Tae Un; Han, Sang Hoon; Kim, Kil You; Yang, Jun Eon; Jeong, Won Dae; Chang, Seung Cheol; Sung, Tae Yong; Kang, Dae Il; Park, Jin Hee; Lee, Yoon Hwan; Hwang, Mi Jeong
1997-01-01
The tasks of probabilistic safety assessment(PSA) consists of the identification of initiating events, the construction of event tree for each initiating event, construction of fault trees for event tree logics, the analysis of reliability data and finally the accident sequence quantification. In the PSA, the accident sequence quantification is to calculate the core damage frequency, importance analysis and uncertainty analysis. Accident sequence quantification requires to understand the whole model of the PSA because it has to combine all event tree and fault tree models, and requires the excellent computer code because it takes long computation time. Advanced Research Group of Korea Atomic Energy Research Institute(KAERI) has developed PSA workstation KIRAP(Korea Integrated Reliability Analysis Code Package) for the PSA work. This report describes the procedures to perform accident sequence quantification, the method to use KIRAP`s cut set generator, and method to perform the accident sequence quantification with KIRAP. (author). 6 refs.
Accident sequence quantification with KIRAP
International Nuclear Information System (INIS)
Kim, Tae Un; Han, Sang Hoon; Kim, Kil You; Yang, Jun Eon; Jeong, Won Dae; Chang, Seung Cheol; Sung, Tae Yong; Kang, Dae Il; Park, Jin Hee; Lee, Yoon Hwan; Hwang, Mi Jeong.
1997-01-01
The tasks of probabilistic safety assessment(PSA) consists of the identification of initiating events, the construction of event tree for each initiating event, construction of fault trees for event tree logics, the analysis of reliability data and finally the accident sequence quantification. In the PSA, the accident sequence quantification is to calculate the core damage frequency, importance analysis and uncertainty analysis. Accident sequence quantification requires to understand the whole model of the PSA because it has to combine all event tree and fault tree models, and requires the excellent computer code because it takes long computation time. Advanced Research Group of Korea Atomic Energy Research Institute(KAERI) has developed PSA workstation KIRAP(Korea Integrated Reliability Analysis Code Package) for the PSA work. This report describes the procedures to perform accident sequence quantification, the method to use KIRAP's cut set generator, and method to perform the accident sequence quantification with KIRAP. (author). 6 refs
Energy Technology Data Exchange (ETDEWEB)
Grosse, A.; Grosse, C. [Universitaet Bern, Bern (Switzerland)
2014-07-15
The objective of this article is the description of imaging techniques for the evaluation of patients with acute flank pain and suspicion of urolithiasis and the impact of these techniques in the therapy management of patients with calculi. (orig.) [German] Ziel der Arbeit ist die Eroerterung der bildgebenden Verfahren zur Abklaerung von Patienten mit akutem Flankenschmerz und Verdacht auf Urolithiasis und die Rolle dieser Verfahren im Therapiemanagement von Steinpatienten. (orig.)
Ni, Zhenjie; Dong, Huanli; Wang, Hanlin; Ding, Shang; Zou, Ye; Zhao, Qiang; Zhen, Yonggang; Liu, Feng; Jiang, Lang; Hu, Wenping
2018-03-01
Herein, the design and synthesis of novel π-extended quinoline-flanked diketopyrrolopyrrole (DPP) [abbreviated as QDPP] motifs and corresponding copolymers named PQDPP-T and PQDPP-2FT for high performing n-type organic field-effect transistors (OFETs) in flexible organic thin film devices are reported. Serving as DPP-flankers in backbones, quinoline is found to effectively tune copolymer optoelectric properties. Compared with TDPP and pyridine-flanked DPP (PyDPP) analogs, widened bandgaps and strengthened electron deficiency are achieved. Moreover, both hole and electron mobility are improved two orders of magnitude compared to those of PyDPP analogs (PPyDPP-T and PPyDPP-2FT). Notably, featuring an all-acceptor-incorporated backbone, PQDPP-2FT exhibits electron mobility of 6.04 cm 2 V -1 s -1 , among the highest value in OFETs fabricated on flexible substrates to date. Moreover, due to the widened bandgap and strengthened electron deficiency of PQDPP, n-channel on/off ratio over 10 5 with suppressed hole transport is first realized in the ambipolar DPP-based copolymers. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Energy Technology Data Exchange (ETDEWEB)
McGinnis, R.E.; Spielman, R.S. [Univ. of Pennsylvania School of Medicine, Philadelphia, PA (United States)
1994-09-01
The 5{prime} flanking polymorphism (5{prime}FP), a hypervariable region at the 5{prime} end of the insulin gene, has {open_quotes}class 1{close_quotes} alleles (650-900 bp long) that are in positive linkage disequilibrium with insulin-dependent diabetes mellitus (IDDM). The authors report that precise sizing of the 5{prime}FP yields a bimodal frequency distribution of class 1 allele lengths. Class 1 alleles belonging to the lower component (650-750 bp) of the bimodal distribution were somewhat more highly associated with IDDM than were alleles from the upper component (760-900 bp), but the difference was not statistically significant. They also examined 5{prime}FP length variation in relation to allelic variation at nearby polymorphisms. At biallelic RFLPs on both sides of the 5{prime}FP, they found that one allele exhibits near-total association with the upper component of the 5FP class 1 distribution. Such associations represent a little-known but potentially wide-spread form of linkage disequilibrium. In this type of disequilibrium, a flanking allele has near-complete association with a single mode of VNTR alleles whose lengths represent consecutive numbers of tandem repeats (CNTR). Such extreme disequilibrium between a CNTR mode and flanking alleles may originate and persist because length mutations at some VNTR loci usually add or delete only one or two repeat units. 22 refs., 5 figs., 6 tabs.
Ayesh, Basim M
2017-01-01
Molecular markers are credible for the discrimination of genotypes and estimation of the extent of genetic diversity and relatedness in a set of genotypes. Inter-simple sequence repeat (ISSR) markers rapidly reveal high polymorphic fingerprints and have been used frequently to determine the genetic diversity among date palm cultivars. This chapter describes the application of ISSR markers for genotyping of date palm cultivars. The application involves extraction of genomic DNA from the target cultivars with reliable quality and quantity. Subsequently the extracted DNA serves as a template for amplification of genomic regions flanked by inverted simple sequence repeats using a single primer. The similarity of each pair of samples is measured by calculating the number of mono- and polymorphic bands revealed by gel electrophoresis. Matrices constructed for similarity and genetic distance are used to build a phylogenetic tree and cluster analysis, to determine the molecular relatedness of cultivars. The protocol describes 3 out of 9 tested primers consistently amplified 31 loci in 6 date palm cultivars, with 28 polymorphic loci.
A Boy with an LCR3/4-Flanked 10q22.3q23.2 Microdeletion and Uncommon Phenotypic Features
Petrova, E.; Neuner, C.; Haaf, T.; Schmid, M.; Wirbelauer, J.; Jurkutat, A.; Wermke, K.; Nanda, I.; Kunstmann, E.
2014-01-01
The recurrent 10q22.3q23.2 deletion with breakpoints within low copy repeats 3 and 4 is a rare genomic disorder, reported in only 13 patients to date. The phenotype is rather uncharacteristic, which makes a clinical diagnosis difficult. A phenotypic feature described in almost all patients is a delay in speech development, albeit systematic studies are still pending. In this study, we report on a boy with an LCR3/4-flanked 10q22.3q23.2 deletion exhibiting an age-appropriate language development evaluated by a standardized test at an age of 2 years and 3 months. The boy was born with a cleft palate – a feature not present in any of the patients described before. Previously reported cases are reviewed, and the role of the BMPR1A gene is discussed. The phenotype of patients with an LCR3/4-flanked 10q22.3q23.2 deletion can be rather variable, so counseling the families regarding the prognosis of an affected child should be done with caution. Long-term studies of affected children are needed to delineate the natural history of this rare disorder. PMID:24550761
Kanhayuwa, Lakkhana; Coutts, Robert H A
2016-01-01
Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.
Deviating T-DNA transfer from Agrobacterium tumefaciens to plants
DEFF Research Database (Denmark)
van der Graaff, Eric; den Dulk-Ras, A; Hooykaas, P J
1996-01-01
-region. On the basis of the structure of the transferred DNA we propose that in these lines T-DNA transfer started at the left-border repeat, continued through the vector part, passed the right border repeat, and ended only after reaching again this left-border repeat.......We analyzed 29 T-DNA inserts in transgenic Arabidopsis thaliana plants for the junction of the right border sequences and the flanking plant DNA. DNA sequencing showed that in most lines the right border sequences transferred had been preserved during integration, corroborating literature data....... Surprisingly, in four independent transgenic lines a complete right border repeat was present followed by binary vector sequences. Cloning of two of these T-DNA inserts by plasmid rescue showed that in these lines the transferred DNA consisted of the complete binary vector sequences in addition to the T...
A rhodanine flanked nonfullerene acceptor for solution-processed organic photovoltaics
Holliday, Sarah
2015-01-21
A novel small molecule, FBR, bearing 3-ethylrhodanine flanking groups was synthesized as a nonfullerene electron acceptor for solution-processed bulk heterojunction organic photovoltaics (OPV). A straightforward synthesis route was employed, offering the potential for large scale preparation of this material. Inverted OPV devices employing poly(3-hexylthiophene) (P3HT) as the donor polymer and FBR as the acceptor gave power conversion efficiencies (PCE) up to 4.1%. Transient and steady state optical spectroscopies indicated efficient, ultrafast charge generation and efficient photocurrent generation from both donor and acceptor. Ultrafast transient absorption spectroscopy was used to investigate polaron generation efficiency as well as recombination dynamics. It was determined that the P3HT:FBR blend is highly intermixed, leading to increased charge generation relative to comparative devices with P3HT:PC60BM, but also faster recombination due to a nonideal morphology in which, in contrast to P3HT:PC60BM devices, the acceptor does not aggregate enough to create appropriate percolation pathways that prevent fast nongeminate recombination. Despite this nonoptimal morphology the P3HT:FBR devices exhibit better performance than P3HT:PC60BM devices, used as control, demonstrating that this acceptor shows great promise for further optimization.
ASPECTS OF PERSONNEL INTEGRATION IN MULTINATIONAL ORGANIZATIONS
Craiovan, Petru Mihai; Cramariuc, Alexandra
2011-01-01
Organizational integration is the process which involves adaptation, accommodation, assimilation by which the employee compiles with the requests, the rules of the objective situations and of the collectivity. The new employee must adapt both professional and social in order to fulfill his tasks and to integrate in the new organizational culture. The integration strategies are: formal/informal, individual/group, sequenced/no sequenced, nonmobile/mobile, serials/disjunctives, investment/disinv...
Integration of point-of-care ultrasound during rapid sequence intubation in trauma resuscitation
Directory of Open Access Journals (Sweden)
Prakash Ranjan Mishra
2018-01-01
Full Text Available Introduction: Airway and breathing management play critical role in trauma resuscitation. Early identification of esophageal intubation and detection of fatal events is critical. Authors studied the utility of integration of point-of-care ultrasound (POCUS during different phases of rapid sequence intubation (RSI in trauma resuscitation. Methods: It was prospective, randomized single-centered study conducted at the Emergency Department of a level one trauma center. Patients were divided into ultrasonography (USG and clinical examination (CE arm. The objectives were to study the utility of POCUS in endotracheal tube placement and confirmations and identification of potentially fatal conditions as tracheal injury, midline vessels, paratracheal hematoma, vocal cord pathology, pneumothorax, and others during RSI. Patient >1 year of age were included. Time taken for procedure, number of incorrect intubations, and pathologies detected were noted. The data were collected in Microsoft Excel spread sheets and analyzed using Stata (version 11.2, Stata Corp, Texas, U. S. A software. Results: One hundred and six patients were recruited. The mean time for primary survey USG versus CE arm was (20 ± 10.01 vs. 18 ± 11.03 seconds. USG detected four pneumothorax, one tracheal injury, and one paratracheal hematoma. The mean procedure time USG versus CE arm was (37.3 ± 21.92 vs. 58 ± 32.04 seconds. Eight esophageal intubations were identified in USG arm by POCUS and two in CE arm by EtCO2 values. Conclusion: Integration of POCUS was useful in all three phases of RSI. It identified paratracheal hematoma, tracheal injury, and pneumothorax. It also identified esophageal intubation and confirmed main stem tracheal intubation in less time compared to five-point auscultation and capnography.
VoSeq: a voucher and DNA sequence web application.
Directory of Open Access Journals (Sweden)
Carlos Peña
Full Text Available There is an ever growing number of molecular phylogenetic studies published, due to, in part, the advent of new techniques that allow cheap and quick DNA sequencing. Hence, the demand for relational databases with which to manage and annotate the amassing DNA sequences, genes, voucher specimens and associated biological data is increasing. In addition, a user-friendly interface is necessary for easy integration and management of the data stored in the database back-end. Available databases allow management of a wide variety of biological data. However, most database systems are not specifically constructed with the aim of being an organizational tool for researchers working in phylogenetic inference. We here report a new software facilitating easy management of voucher and sequence data, consisting of a relational database as back-end for a graphic user interface accessed via a web browser. The application, VoSeq, includes tools for creating molecular datasets of DNA or amino acid sequences ready to be used in commonly used phylogenetic software such as RAxML, TNT, MrBayes and PAUP, as well as for creating tables ready for publishing. It also has inbuilt BLAST capabilities against all DNA sequences stored in VoSeq as well as sequences in NCBI GenBank. By using mash-ups and calls to web services, VoSeq allows easy integration with public services such as Yahoo! Maps, Flickr, Encyclopedia of Life (EOL and GBIF (by generating data-dumps that can be processed with GBIF's Integrated Publishing Toolkit.
BioWord: A sequence manipulation suite for Microsoft Word
Directory of Open Access Journals (Sweden)
Anzaldi Laura J
2012-06-01
Full Text Available Abstract Background The ability to manipulate, edit and process DNA and protein sequences has rapidly become a necessary skill for practicing biologists across a wide swath of disciplines. In spite of this, most everyday sequence manipulation tools are distributed across several programs and web servers, sometimes requiring installation and typically involving frequent switching between applications. To address this problem, here we have developed BioWord, a macro-enabled self-installing template for Microsoft Word documents that integrates an extensive suite of DNA and protein sequence manipulation tools. Results BioWord is distributed as a single macro-enabled template that self-installs with a single click. After installation, BioWord will open as a tab in the Office ribbon. Biologists can then easily manipulate DNA and protein sequences using a familiar interface and minimize the need to switch between applications. Beyond simple sequence manipulation, BioWord integrates functionality ranging from dyad search and consensus logos to motif discovery and pair-wise alignment. Written in Visual Basic for Applications (VBA as an open source, object-oriented project, BioWord allows users with varying programming experience to expand and customize the program to better meet their own needs. Conclusions BioWord integrates a powerful set of tools for biological sequence manipulation within a handy, user-friendly tab in a widely used word processing software package. The use of a simple scripting language and an object-oriented scheme facilitates customization by users and provides a very accessible educational platform for introducing students to basic bioinformatics algorithms.
BioWord: A sequence manipulation suite for Microsoft Word
2012-01-01
Background The ability to manipulate, edit and process DNA and protein sequences has rapidly become a necessary skill for practicing biologists across a wide swath of disciplines. In spite of this, most everyday sequence manipulation tools are distributed across several programs and web servers, sometimes requiring installation and typically involving frequent switching between applications. To address this problem, here we have developed BioWord, a macro-enabled self-installing template for Microsoft Word documents that integrates an extensive suite of DNA and protein sequence manipulation tools. Results BioWord is distributed as a single macro-enabled template that self-installs with a single click. After installation, BioWord will open as a tab in the Office ribbon. Biologists can then easily manipulate DNA and protein sequences using a familiar interface and minimize the need to switch between applications. Beyond simple sequence manipulation, BioWord integrates functionality ranging from dyad search and consensus logos to motif discovery and pair-wise alignment. Written in Visual Basic for Applications (VBA) as an open source, object-oriented project, BioWord allows users with varying programming experience to expand and customize the program to better meet their own needs. Conclusions BioWord integrates a powerful set of tools for biological sequence manipulation within a handy, user-friendly tab in a widely used word processing software package. The use of a simple scripting language and an object-oriented scheme facilitates customization by users and provides a very accessible educational platform for introducing students to basic bioinformatics algorithms. PMID:22676326
BioWord: a sequence manipulation suite for Microsoft Word.
Anzaldi, Laura J; Muñoz-Fernández, Daniel; Erill, Ivan
2012-06-07
The ability to manipulate, edit and process DNA and protein sequences has rapidly become a necessary skill for practicing biologists across a wide swath of disciplines. In spite of this, most everyday sequence manipulation tools are distributed across several programs and web servers, sometimes requiring installation and typically involving frequent switching between applications. To address this problem, here we have developed BioWord, a macro-enabled self-installing template for Microsoft Word documents that integrates an extensive suite of DNA and protein sequence manipulation tools. BioWord is distributed as a single macro-enabled template that self-installs with a single click. After installation, BioWord will open as a tab in the Office ribbon. Biologists can then easily manipulate DNA and protein sequences using a familiar interface and minimize the need to switch between applications. Beyond simple sequence manipulation, BioWord integrates functionality ranging from dyad search and consensus logos to motif discovery and pair-wise alignment. Written in Visual Basic for Applications (VBA) as an open source, object-oriented project, BioWord allows users with varying programming experience to expand and customize the program to better meet their own needs. BioWord integrates a powerful set of tools for biological sequence manipulation within a handy, user-friendly tab in a widely used word processing software package. The use of a simple scripting language and an object-oriented scheme facilitates customization by users and provides a very accessible educational platform for introducing students to basic bioinformatics algorithms.
Sequencing of bovine herpesvirus 4 v.test strain reveals important genome features
Directory of Open Access Journals (Sweden)
Gillet Laurent
2011-08-01
Full Text Available Abstract Background Bovine herpesvirus 4 (BoHV-4 is a useful model for the human pathogenic gammaherpesviruses Epstein-Barr virus and Kaposi's Sarcoma-associated Herpesvirus. Although genome manipulations of this virus have been greatly facilitated by the cloning of the BoHV-4 V.test strain as a Bacterial Artificial Chromosome (BAC, the lack of a complete genome sequence for this strain limits its experimental use. Methods In this study, we have determined the complete sequence of BoHV-4 V.test strain by a pyrosequencing approach. Results The long unique coding region (LUR consists of 108,241 bp encoding at least 79 open reading frames and is flanked by several polyrepetitive DNA units (prDNA. As previously suggested, we showed that the prDNA unit located at the left prDNA-LUR junction (prDNA-G differs from the other prDNA units (prDNA-inner. Namely, the prDNA-G unit lacks the conserved pac-2 cleavage and packaging signal in its right terminal region. Based on the mechanisms of cleavage and packaging of herpesvirus genomes, this feature implies that only genomes bearing left and right end prDNA units are encapsulated into virions. Conclusions In this study, we have determined the complete genome sequence of the BAC-cloned BoHV-4 V.test strain and identified genome organization features that could be important in other herpesviruses.
Hong, Mee Yeon; Lee, Eun Mee; Jo, Yong Hun; Park, Hae Chul; Kim, Seong Ryul; Hwang, Jae Sam; Jin, Byung Rae; Kang, Pil Don; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo
2008-04-30
The 15,360-bp long complete mitogenome of Caligula boisduvalii possesses a gene arrangement and content identical to other completely sequenced lepidopteran mitogenomes, but different from the common arrangement found in most insect order, as the result of the movement of tRNA(Met) to a position 5'-upstream of tRNA Ile. The 330-bp A+T-rich region is apparently capable of forming a stem-and-loop structure, which harbors the conserved flanking sequences at both ends. Dissimilar to what has been seen in other sequenced lepidopteran insects, the initiation codon for C. boisduvalii COI appears to be TTG, which is a rare, but apparently possible initiation codon. The ATP8, ATP6, ND4L, and ND6 genes, which neighbor another PCG at their 3' end, all harbored potential sequences for the formation of a hairpin structure. This is suggestive of the importance of such structures for the precise cleavage of the mRNA of mature PCGs. Phylogenetic analyses of available sequenced species of Bombycoidea, Pyraloidea, and Tortricidea supported the morphology-based current hypothesis that Bombycoidea and Pyraloidea are monophyletic (Obtectomera). As previously suggested, Bombycidae (Bombyx mori and B. mandarina) and Saturniidae (Antheraea pernyi and C. boisduvalii) formed a reciprocal monophyletic group.
Vassy, Jason L; Lautenbach, Denise M; McLaughlin, Heather M; Kong, Sek Won; Christensen, Kurt D; Krier, Joel; Kohane, Isaac S; Feuerman, Lindsay Z; Blumenthal-Barby, Jennifer; Roberts, J Scott; Lehmann, Lisa Soleymani; Ho, Carolyn Y; Ubel, Peter A; MacRae, Calum A; Seidman, Christine E; Murray, Michael F; McGuire, Amy L; Rehm, Heidi L; Green, Robert C
2014-03-20
Whole genome sequencing (WGS) is already being used in certain clinical and research settings, but its impact on patient well-being, health-care utilization, and clinical decision-making remains largely unstudied. It is also unknown how best to communicate sequencing results to physicians and patients to improve health. We describe the design of the MedSeq Project: the first randomized trials of WGS in clinical care. This pair of randomized controlled trials compares WGS to standard of care in two clinical contexts: (a) disease-specific genomic medicine in a cardiomyopathy clinic and (b) general genomic medicine in primary care. We are recruiting 8 to 12 cardiologists, 8 to 12 primary care physicians, and approximately 200 of their patients. Patient participants in both the cardiology and primary care trials are randomly assigned to receive a family history assessment with or without WGS. Our laboratory delivers a genome report to physician participants that balances the needs to enhance understandability of genomic information and to convey its complexity. We provide an educational curriculum for physician participants and offer them a hotline to genetics professionals for guidance in interpreting and managing their patients' genome reports. Using varied data sources, including surveys, semi-structured interviews, and review of clinical data, we measure the attitudes, behaviors and outcomes of physician and patient participants at multiple time points before and after the disclosure of these results. The impact of emerging sequencing technologies on patient care is unclear. We have designed a process of interpreting WGS results and delivering them to physicians in a way that anticipates how we envision genomic medicine will evolve in the near future. That is, our WGS report provides clinically relevant information while communicating the complexity and uncertainty of WGS results to physicians and, through physicians, to their patients. This project will not only
Gasc, Cyrielle; Peyretaillade, Eric; Peyret, Pierre
2016-06-02
The recent expansion of next-generation sequencing has significantly improved biological research. Nevertheless, deep exploration of genomes or metagenomic samples remains difficult because of the sequencing depth and the associated costs required. Therefore, different partitioning strategies have been developed to sequence informative subsets of studied genomes. Among these strategies, hybridization capture has proven to be an innovative and efficient tool for targeting and enriching specific biomarkers in complex DNA mixtures. It has been successfully applied in numerous areas of biology, such as exome resequencing for the identification of mutations underlying Mendelian or complex diseases and cancers, and its usefulness has been demonstrated in the agronomic field through the linking of genetic variants to agricultural phenotypic traits of interest. Moreover, hybridization capture has provided access to underexplored, but relevant fractions of genomes through its ability to enrich defined targets and their flanking regions. Finally, on the basis of restricted genomic information, this method has also allowed the expansion of knowledge of nonreference species and ancient genomes and provided a better understanding of metagenomic samples. In this review, we present the major advances and discoveries permitted by hybridization capture and highlight the potency of this approach in all areas of biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
International Nuclear Information System (INIS)
Hu, R.-M.; Yang, T.-C.; Yang, S.-H.; Tseng, Y.-H.
2005-01-01
Xanthomonas campestris pv. campestris (Xcc), a close relative to Pseudomonas aeruginosa, is the pathogen causing black rot in cruciferous plants. In P. aeruginosa, FleQ serves as a cognate activator of σ 54 in transcription from several σ 54 -dependent promoters of flagellar genes. These P. aeruginosa promoters have been analyzed for FleQ-binding sequences; however, no consensus was deduced. Xcc, although lacks fleSR, has a fleQ homologue residing among over 40 contiguously clustered flagellar genes. A fleQ mutant, Xc17fleQ, constructed by insertional mutation is deficient in FleQ protein, non-flagellated, and immobile. Transcriptional fusion assays on six putative σ 54 -dependent promoters of the flagellar genes, fliE, fliQ, fliL, flgG, flgB, and flhF, indicated that each of them is also FleQ dependent. Each of these promoters has a sequence with weak consensus to 5'-gaaacCCgccgCcgctTt-3', immediately upstream of the predicted σ 54 -binding site, with an imperfect inverted repeat containing a GC-rich center flanked by several A and T at 5'- and 3'-ends, respectively. Replacing this region in fliE promoter with a HindIII recognition sequence abolished the transcription, indicating that this region responds to transcription activation by FleQ
DNA watermarks in non-coding regulatory sequences
Directory of Open Access Journals (Sweden)
Pyka Martin
2009-07-01
Full Text Available Abstract Background DNA watermarks can be applied to identify the unauthorized use of genetically modified organisms. It has been shown that coding regions can be used to encrypt information into living organisms by using the DNA-Crypt algorithm. Yet, if the sequence of interest presents a non-coding DNA sequence, either the function of a resulting functional RNA molecule or a regulatory sequence, such as a promoter, could be affected. For our studies we used the small cytoplasmic RNA 1 in yeast and the lac promoter region of Escherichia coli. Findings The lac promoter was deactivated by the integrated watermark. In addition, the RNA molecules displayed altered configurations after introducing a watermark, but surprisingly were functionally intact, which has been verified by analyzing the growth characteristics of both wild type and watermarked scR1 transformed yeast cells. In a third approach we introduced a second overlapping watermark into the lac promoter, which did not affect the promoter activity. Conclusion Even though the watermarked RNA and one of the watermarked promoters did not show any significant differences compared to the wild type RNA and wild type promoter region, respectively, it cannot be generalized that other RNA molecules or regulatory sequences behave accordingly. Therefore, we do not recommend integrating watermark sequences into regulatory regions.
Bracke, M.B.M.; Ettema, K.
2014-01-01
Injurious behaviours in pigs may involve persistent or forceful biting in specific body parts and may result in wounds of the pigs’ tails, ears, flanks and legs. Such behaviours, which may lead to progressive tissue damage, are difficult to counteract. On a commercial farm 22 groups of pigs with
Bo P.; Bartoň M.; Plakhotnik D.; Pottmann H.
2016-01-01
We introduce a new method that approximates free-form surfaces by envelopes of one-parameter motions of surfaces of revolution. In the context of 5-axis computer numerically controlled (CNC) machining, we propose a flank machining methodology which is a preferable scallop-free scenario when the milling tool and the machined free-form surface meet tangentially along a smooth curve. We seek both an optimal shape of the milling tool as well as its optimal path in 3D space and propose an optimiza...
Directory of Open Access Journals (Sweden)
Michael R Lindberg
Full Text Available Single source and multiple donor (mixed samples of human mitochondrial DNA were analyzed and compared using the MinION and the MiSeq platforms. A generalized variant detection strategy was employed to provide a cursory framework for evaluating the reliability and accuracy of mitochondrial sequences produced by the MinION. The feasibility of long-read phasing was investigated to establish its efficacy in quantitatively distinguishing and deconvolving individuals in a mixture. Finally, a proof-of-concept was demonstrated by integrating both platforms in a hybrid assembly that leverages solely mixture data to accurately reconstruct full mitochondrial genomes.
Sequence finishing and mapping of Drosophila melanogasterheterochromatin
Energy Technology Data Exchange (ETDEWEB)
Hoskins, Roger A.; Carlson, Joseph W.; Kennedy, Cameron; Acevedo,David; Evans-Holm, Martha; Frise, Erwin; Wan, Kenneth H.; Park, Soo; Mendez-Lago, Maria; Rossi, Fabrizio; Villasante, Alfredo; Dimitri,Patrizio; Karpen, Gary H.; Celniker, Susan E.
2007-06-15
Genome sequences for most metazoans are incomplete due tothe presence of repeated DNA in the pericentromeric heterochromatin. Theheterochromatic regions of D. melanogaster contain 20 Mb of sequenceamenable to mapping, sequence assembly and finishing. Here we describethe generation of 15 Mb of finished or improved heterochromatic sequenceusing available clone resources and assembly and mapping methods. We alsoconstructed a BAC-based physical map that spans approximately 13 Mb ofthe pericentromeric heterochromatin, and a cytogenetic map that positionsapproximately 11 Mb of BAC contigs and sequence scaffolds in specificchromosomal locations. The integrated sequence assembly and maps greatlyimprove our understanding of the structure and composition of this poorlyunderstood fraction of a metazoan genome and provide a framework forfunctional analyses.
Simonyan, Vahan; Chumakov, Konstantin; Dingerdissen, Hayley; Faison, William; Goldweber, Scott; Golikov, Anton; Gulzar, Naila; Karagiannis, Konstantinos; Vinh Nguyen Lam, Phuc; Maudru, Thomas; Muravitskaja, Olesja; Osipova, Ekaterina; Pan, Yang; Pschenichnov, Alexey; Rostovtsev, Alexandre; Santana-Quintero, Luis; Smith, Krista; Thompson, Elaine E; Tkachenko, Valery; Torcivia-Rodriguez, John; Voskanian, Alin; Wan, Quan; Wang, Jing; Wu, Tsung-Jung; Wilson, Carolyn; Mazumder, Raja
2016-01-01
The High-performance Integrated Virtual Environment (HIVE) is a distributed storage and compute environment designed primarily to handle next-generation sequencing (NGS) data. This multicomponent cloud infrastructure provides secure web access for authorized users to deposit, retrieve, annotate and compute on NGS data, and to analyse the outcomes using web interface visual environments appropriately built in collaboration with research and regulatory scientists and other end users. Unlike many massively parallel computing environments, HIVE uses a cloud control server which virtualizes services, not processes. It is both very robust and flexible due to the abstraction layer introduced between computational requests and operating system processes. The novel paradigm of moving computations to the data, instead of moving data to computational nodes, has proven to be significantly less taxing for both hardware and network infrastructure.The honeycomb data model developed for HIVE integrates metadata into an object-oriented model. Its distinction from other object-oriented databases is in the additional implementation of a unified application program interface to search, view and manipulate data of all types. This model simplifies the introduction of new data types, thereby minimizing the need for database restructuring and streamlining the development of new integrated information systems. The honeycomb model employs a highly secure hierarchical access control and permission system, allowing determination of data access privileges in a finely granular manner without flooding the security subsystem with a multiplicity of rules. HIVE infrastructure will allow engineers and scientists to perform NGS analysis in a manner that is both efficient and secure. HIVE is actively supported in public and private domains, and project collaborations are welcomed. Database URL: https://hive.biochemistry.gwu.edu. © The Author(s) 2016. Published by Oxford University Press.
Azaïez, Hajer; Bédir, Mourad; Tanfous, Dorra; Soussi, Mohamed
2007-05-01
In central Tunisia, Lower Cretaceous deposits represent carbonate and sandstone reservoir series that correspond to proven oil fields. The main problems for hydrocarbon exploration of these levels are their basin tectonic configuration and their sequence distribution in addition to the source rock availability. The Central Atlas of Tunisia is characterized by deep seated faults directed northeast-southwest, northwest-southeast and north-south. These faults limit inherited tectonic blocks and show intruded Triassic salt domes. Lower Cretaceous series outcropping in the region along the anticline flanks present platform deposits. The seismic interpretation has followed the Exxon methodologies in the 26th A.A.P.G. Memoir. The defined Lower Cretaceous seismic units were calibrated with petroleum well data and tied to stratigraphic sequences established by outcrop studies. This allows the subsurface identification of subsiding zones and thus sequence deposit distribution. Seismic mapping of these units boundary shows a structuring from a platform to basin blocks zones and helps to understand the hydrocarbon reservoir systems-tract and horizon distribution around these domains.
Directory of Open Access Journals (Sweden)
Chen-Chi Wu
Full Text Available Despite the clinical utility of genetic diagnosis to address idiopathic sensorineural hearing impairment (SNHI, the current strategy for screening mutations via Sanger sequencing suffers from the limitation that only a limited number of DNA fragments associated with common deafness mutations can be genotyped. Consequently, a definitive genetic diagnosis cannot be achieved in many families with discernible family history. To investigate the diagnostic utility of massively parallel sequencing (MPS, we applied the MPS technique to 12 multiplex families with idiopathic SNHI in which common deafness mutations had previously been ruled out. NimbleGen sequence capture array was designed to target all protein coding sequences (CDSs and 100 bp of the flanking sequence of 80 common deafness genes. We performed MPS on the Illumina HiSeq2000, and applied BWA, SAMtools, Picard, GATK, Variant Tools, ANNOVAR, and IGV for bioinformatics analyses. Initial data filtering with allele frequencies (0.95 prioritized 5 indels (insertions/deletions and 36 missense variants in the 12 multiplex families. After further validation by Sanger sequencing, segregation pattern, and evolutionary conservation of amino acid residues, we identified 4 variants in 4 different genes, which might lead to SNHI in 4 families compatible with autosomal dominant inheritance. These included GJB2 p.R75Q, MYO7A p.T381M, KCNQ4 p.S680F, and MYH9 p.E1256K. Among them, KCNQ4 p.S680F and MYH9 p.E1256K were novel. In conclusion, MPS allows genetic diagnosis in multiplex families with idiopathic SNHI by detecting mutations in relatively uncommon deafness genes.
Theoretical information reuse and integration
Rubin, Stuart
2016-01-01
Information Reuse and Integration addresses the efficient extension and creation of knowledge through the exploitation of Kolmogorov complexity in the extraction and application of domain symmetry. Knowledge, which seems to be novel, can more often than not be recast as the image of a sequence of transformations, which yield symmetric knowledge. When the size of those transformations and/or the length of that sequence of transforms exceeds the size of the image, then that image is said to be novel or random. It may also be that the new knowledge is random in that no such sequence of transforms, which produces it exists, or is at least known. The nine chapters comprising this volume incorporate symmetry, reuse, and integration as overt operational procedures or as operations built into the formal representations of data and operators employed. Either way, the aforementioned theoretical underpinnings of information reuse and integration are supported.
Human Chromosome 7: DNA Sequence and Biology
Scherer, Stephen W.; Cheung, Joseph; MacDonald, Jeffrey R.; Osborne, Lucy R.; Nakabayashi, Kazuhiko; Herbrick, Jo-Anne; Carson, Andrew R.; Parker-Katiraee, Layla; Skaug, Jennifer; Khaja, Razi; Zhang, Junjun; Hudek, Alexander K.; Li, Martin; Haddad, May; Duggan, Gavin E.
2003-01-01
DNA sequence and annotation of the entire human chromosome 7, encompassing nearly 158 million nucleotides of DNA and 1917 gene structures, are presented. To generate a higher order description, additional structural features such as imprinted genes, fragile sites, and segmental duplications were integrated at the level of the DNA sequence with medical genetic data, including 440 chromosome rearrangement breakpoints associated with disease. This approach enabled the discovery of candidate gene...
Establishing a framework for comparative analysis of genome sequences
Energy Technology Data Exchange (ETDEWEB)
Bansal, A.K.
1995-06-01
This paper describes a framework and a high-level language toolkit for comparative analysis of genome sequence alignment The framework integrates the information derived from multiple sequence alignment and phylogenetic tree (hypothetical tree of evolution) to derive new properties about sequences. Multiple sequence alignments are treated as an abstract data type. Abstract operations have been described to manipulate a multiple sequence alignment and to derive mutation related information from a phylogenetic tree by superimposing parsimonious analysis. The framework has been applied on protein alignments to derive constrained columns (in a multiple sequence alignment) that exhibit evolutionary pressure to preserve a common property in a column despite mutation. A Prolog toolkit based on the framework has been implemented and demonstrated on alignments containing 3000 sequences and 3904 columns.
SMITH: a LIMS for handling next-generation sequencing workflows
Venco, Francesco; Vaskin, Yuriy; Ceol, Arnaud; Muller, Heiko
2014-01-01
Background Life-science laboratories make increasing use of Next Generation Sequencing (NGS) for studying bio-macromolecules and their interactions. Array-based methods for measuring gene expression or protein-DNA interactions are being replaced by RNA-Seq and ChIP-Seq. Sequencing is generally performed by specialized facilities that have to keep track of sequencing requests, trace samples, ensure quality and make data available according to predefined privileges. An integrated tool helps to ...
Hess, A.D.; Thoburn, C.; Chen, W.; Miura, Y.; Wall, E. van der
2001-01-01
The N-terminal flanking region of the invariant chain peptide termed CLIP appears to have superagonistic properties interacting with the T cell receptor and the MHC class II molecule at or near the binding site for the bacterial superantigen Staphylococcal enterotoxin B (SEB). The present studies
Gillard, D.; Wyss, M.; Okubo, P.
1996-01-01
Earthquake focal mechanisms of events occurring between 1972 and 1992 in the south flank of Kilauea volcano, Hawaii, are used to infer the state of stress and strain as a function of time and space. We have determined 870 fault plane solutions from P wave first motion polarities for events with magnitudes ML ??? 2.5 and depth ranging between 6 and 12 km. Faulting is characterized by a mixture of decollement, reverse, and normal faults. Most large earthquakes with magnitude M 7 rupture the decollement plane, since it is the only surface large enough to generate magnitude 7 or larger earthquakes. The percentage of reverse faulting events is high compared to the decollement and normal faulting mechanisms for the period 1972-1983. The percentage of decollement type focal mechanisms becomes dominant after 1983. This pattern of faulting activity suggests that pressure was building up within Kilauea's rift zone prior to the 1983 Puu'Oo eruption. Overall, a single stress orientation with the maximum compressive stress oriented SE perpendicular to the rift and dipping at 45?? is compatible with the coeval existence of decollement, reverse, and normal faults. However, in a crustal volume east of longitude 155??10'W, we find a change of the orientation of ??1 from nearly horizontal to plunging 45?? SE occurring in 1979. This stress rotation suggests magma movements within the aseismic part of Kilauea's east rift zone. The strain and stress orientations are coaxial in the south flank except within the volume where the stress rotation is observed. We observe a change in the relationship between stress and strain directions caused either by the shifting of seismic activity from reverse faults to decollements, while stress stays constant, or by a rotation of stress, while strain remains constant. Assuming that the model of a noncohesive Coulomb wedge is appropriate for Kilauea's south flank, we find that high pore pressures are prevalent along the decollement and within the wedge
Evidence for widespread convergent evolution around human microsatellites.
Directory of Open Access Journals (Sweden)
Edward J Vowles
2004-08-01
Full Text Available Microsatellites are a major component of the human genome, and their evolution has been much studied. However, the evolution of microsatellite flanking sequences has received less attention, with reports of both high and low mutation rates and of a tendency for microsatellites to cluster. From the human genome we generated a database of many thousands of (AC(n flanking sequences within which we searched for common characteristics. Sequences flanking microsatellites of similar length show remarkable levels of convergent evolution, indicating shared mutational biases. These biases extend 25-50 bases either side of the microsatellite and may therefore affect more than 30% of the entire genome. To explore the extent and absolute strength of these effects, we quantified the observed convergence. We also compared homologous human and chimpanzee loci to look for evidence of changes in mutation rate around microsatellites. Most models of DNA sequence evolution assume that mutations are independent and occur randomly. Allowances may be made for sites mutating at different rates and for general mutation biases such as the faster rate of transitions over transversions. Our analysis suggests that these models may be inadequate, in that proximity to even very short microsatellites may alter the rate and distribution of mutations that occur. The elevated local mutation rate combined with sequence convergence, both of which we find evidence for, also provide a possible resolution for the apparently contradictory inferences of mutation rates in microsatellite flanking sequences.
INTEGRATION OF SHIP HULL ASSEMBLY SEQUENCE PLANNING, SCHEDULING AND BUDGETING
Directory of Open Access Journals (Sweden)
Remigiusz Romuald Iwańkowicz
2015-02-01
Full Text Available The specificity of the yard work requires the particularly careful treatment of the issues of scheduling and budgeting in the production planning processes. The article presents the method of analysis of the assembly sequence taking into account the duration of individual activities and the demand for resources. A method of the critical path and resource budgeting were used. Modelling of the assembly was performed using the acyclic graphs. It has been shown that the assembly sequences can have very different feasible budget regions. The proposed model is applied to the assembly processes of large-scale welded structures, including the hulls of ships. The presented computational examples have a simulation character. They show the usefulness of the model and the possibility to use it in a variety of analyses.
Millard, T P; Ashton, G H S; Kondeatis, E; Vaughan, R W; Hughes, G R V; Khamashta, M A; Hawk, J L M; McGregor, J M; McGrath, J A
2002-02-01
The Ro 60 kDa protein (Ro60 or SSA2) is the major component of the Ro ribonucleoprotein (Ro RNP) complex, to which an immune response is a specific feature of several autoimmune diseases. The genomic organization and any sequence variation within the DNA encoding Ro60 are unknown. To characterize the Ro60 gene structure and to assess whether any sequence alterations might be associated with serum anti-Ro antibody in subacute cutaneous lupus erythematosus (SCLE), thus potentially providing new insight into disease pathogenesis. The cDNA sequence for Ro60 was obtained from the NCBI database and used for a BLAST search for a clone containing the entire genomic sequence. The intron-exon borders were confirmed by designing intronic primer pairs to flank each exon, which were then used to amplify genomic DNA for automated sequencing from 36 caucasian patients with SCLE (anti-Ro positive) and 49 with discoid LE (DLE, anti-Ro negative), in addition to 36 healthy caucasian controls. Heteroduplex analysis of polymerase chain reaction (PCR) products from patients and controls spanning all Ro60 exons (1-8) revealed a common bandshift in the PCR products spanning exon 7. Sequencing of the corresponding PCR products demonstrated an A > G substitution at nucleotide position 1318-7, within the consensus acceptor splice site of exon 7 (GenBank XM001901). The allele frequencies were major allele A (0.71) and minor allele G (0.29) in 72 control chromosomes, with no significant differences found between SCLE patients, DLE patients and controls. The genomic organization of the DNA encoding the Ro60 protein is described, including a common polymorphism within the consensus acceptor splice site of exon 7. Our delineation of a strategy for the genomic amplification of Ro60 forms a basis for further examination of the pathological functions of the Ro RNP in autoimmune disease.
[Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence
Ortega, Maya
2010-01-01
My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.
Soil gases and SAR measurements reveal hidden faults on the sliding flank of Mt. Etna (Italy)
Bonforte, Alessandro; Federico, Cinzia; Giammanco, Salvatore; Guglielmino, Francesco; Liuzzo, Marco; Neri, Marco
2013-02-01
From October 2008 to November 2009, soil CO2, radon and structural field surveys were performed on Mt. Etna, in order to acquire insights into active tectonic structures in a densely populated sector of the south-eastern flank of the volcano, which is involved in the flank dynamics, as highlighted by satellite data (InSAR). The studied area extends about 150 km2, in a sector of the volcano where InSAR results detected several lineaments that were not well-defined from previous geological surveys. In order to validate and better constrain these features with ground data evidences, soil CO2 and soil radon measurements were performed along transects roughly orthogonal to the newly detected faults, with measurement points spaced about 100 m. In each transect, the highest CO2 values were found very close to the lineaments evidenced by InSAR observations. Anomalous soil CO2 and radon values were also measured at old eruptive fractures. In some portions of the investigated area soil gas anomalies were rather broad over transects, probably suggesting a complex structural framework consisting of several parallel volcano-tectonic structures, instead of a single one. Soil gas measurements proved particularly useful in areas at higher altitude on Mt. Etna (i.e. above 900 m asl), where InSAR results are not very informative/are fairly limited, and allowed recognizing the prolongation of some tectonic lineaments towards the summit of the volcano. At a lower altitude on the volcanic edifice, soil gas anomalies define the active structures indicated by InSAR results prominently, down to almost the coastline and through the northern periphery of the city of Catania. Coupling InSAR with soil gas prospecting methods has thus proved to be a powerful tool in detecting hidden active structures that do not show significant field evidences.
International Nuclear Information System (INIS)
Hao, D.C.; Vautrin, S.; Berges, H.; Chen, S.L.
2015-01-01
Salvia is a representative genus of Lamiaceae, a eudicot family with significant species diversity and population adaptibility. One of the key goals of Salvia genomics research is to identify genes of adaptive significance. This information may help to improve the conservation of adaptive genetic variation and the management of medicinal plants to increase their health and productivity. Large-insert genomic libraries are a fundamental tool for achieving this purpose. We report herein the construction, characterization and screening of a gridded BAC library for Salvia officinalis (sage). The S. officinalis BAC library consists of 17,764 clones and the average insert size is 107 Kb, corresponding to 3 haploid genome equivalents. Seventeen positive clones (average insert size 115 Kb) containing five terpene synthase (TPS) genes were screened out by PCR and 12 of them were subject to Illumina HiSeq 2000 sequencing, which yielded 28,097,480 90-bp raw reads (2.53 Gb). Scaffolds containing sabinene synthase (Sab), a Sab homolog, TPS3 (kaurene synthase-like 2), copalyl diphosphate synthase 2 and one cytochrome P450 gene were retrieved via de novo assembly and annotation, which also have flanking noncoding sequences, including predicted promoters and repeat sequences. Among 2,638 repeat sequences, there are 330 amplifiable microsatellites. This BAC library provides a new resource for Lamiaceae genomic studies, including microsatellite marker development, physical mapping, comparative genomics and genome sequencing. Characterization of positive clones provided insights into the structure of the Salvia genome. These sequences will be used in the assembly of a future genome sequence for S. officinalis. (author)
Oggioni, M R; Claverys, J P
1999-10-01
A survey of all Streptococcus pneumoniae GenBank/EMBL DNA sequence entries and of the public domain sequence (representing more than 90% of the genome) of an S. pneumoniae type 4 strain allowed identification of 108 copies of a 107-bp-long highly repeated intergenic element called RUP (for repeat unit of pneumococcus). Several features of the element, revealed in this study, led to the proposal that RUP is an insertion sequence (IS)-derivative that could still be mobile. Among these features are: (1) a highly significant homology between the terminal inverted repeats (IRs) of RUPs and of IS630-Spn1, a new putative IS of S. pneumoniae; and (2) insertion at a TA dinucleotide, a characteristic target of several members of the IS630 family. Trans-mobilization of RUP is therefore proposed to be mediated by the transposase of IS630-Spn1. To account for the observation that RUPs are distributed among four subtypes which exhibit different degrees of sequence homogeneity, a scenario is invoked based on successive stages of RUP mobility and non-mobility, depending on whether an active transposase is present or absent. In the latter situation, an active transposase could be reintroduced into the species through natural transformation. Examination of sequences flanking RUP revealed a preferential association with ISs. It also provided evidence that RUPs promote sequence rearrangements, thereby contributing to genome flexibility. The possibility that RUP preferentially targets transforming DNA of foreign origin and subsequently favours disruption/rearrangement of exogenous sequences is discussed.
Energy Technology Data Exchange (ETDEWEB)
Komorowski, J C [IPGP, (Mexico); Siebe, C [Institut de Geofisica, UNAM (Mexico); Rodriguez, S [Institut de Geologia, UNAM (Mexico); Cortes, A; Navarro, C; Gavilanes, J C
1997-12-31
This short paper reports on new {sup 14}C datings of debris flow units from the Nevado de Colima and Fuego de Colima volcanoes in Mexico. These new datings in connection with a detailed stratigraphic study in the deep canyons around the volcanoes has revealed an exceptional recurrence of flank destabilizations of the Fuego de Colima during the last 45000 years. The cumulated volume of debris in the whole Colima massif is estimated to 60-100 km{sup 3}. The correlation between Landsat satellite pictures and the distribution and age of the debris flows shows that both volcanoes are made of several post-destabilization remaining structures, and that both volcanoes were active and simultaneously collapsed 18500 years ago. The numerous fluvial-lacustrine sequences intercalated between the successive flows indicate that the debris flow were partially sedimented under water and could have led to catastrophic tsunamis towards the Pacific coast. Implications of this work are important because a population of more than 200000 inhabitants is living in a zone covered by several debris flows. (J.S.).
Energy Technology Data Exchange (ETDEWEB)
Komorowski, J.C. [IPGP, (Mexico); Siebe, C. [Institut de Geofisica, UNAM (Mexico); Rodriguez, S. [Institut de Geologia, UNAM (Mexico); Cortes, A.; Navarro, C.; Gavilanes, J.C.
1996-12-31
This short paper reports on new {sup 14}C datings of debris flow units from the Nevado de Colima and Fuego de Colima volcanoes in Mexico. These new datings in connection with a detailed stratigraphic study in the deep canyons around the volcanoes has revealed an exceptional recurrence of flank destabilizations of the Fuego de Colima during the last 45000 years. The cumulated volume of debris in the whole Colima massif is estimated to 60-100 km{sup 3}. The correlation between Landsat satellite pictures and the distribution and age of the debris flows shows that both volcanoes are made of several post-destabilization remaining structures, and that both volcanoes were active and simultaneously collapsed 18500 years ago. The numerous fluvial-lacustrine sequences intercalated between the successive flows indicate that the debris flow were partially sedimented under water and could have led to catastrophic tsunamis towards the Pacific coast. Implications of this work are important because a population of more than 200000 inhabitants is living in a zone covered by several debris flows. (J.S.).
International Nuclear Information System (INIS)
Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.
1987-01-01
The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function
DEFF Research Database (Denmark)
Carattoli, Alessandra; Zankari, Ea; García-Fernández, Aurora
2014-01-01
In the work presented here, we designed and developed two easy-to-use Web tools for in silico detection and characterization of whole-genome sequence (WGS) and whole-plasmid sequence data from members of the family Enterobacteriaceae. These tools will facilitate bacterial typing based on draft...... genomes of multidrug-resistant Enterobacteriaceae species by the rapid detection of known plasmid types. Replicon sequences from 559 fully sequenced plasmids associated with the family Enterobacteriaceae in the NCBI nucleotide database were collected to build a consensus database for integration...... sequences identified in the 559 fully sequenced plasmids. For plasmid multilocus sequence typing (pMLST) analysis, a database that is updated weekly was generated from www.pubmlst.org and integrated into a Web tool called pMLST. Both databases were evaluated using draft genomes from a collection...
Cloning and analysis of the promoter region of the human fibronectin gene
International Nuclear Information System (INIS)
Dean, D.C.; Bowlus, C.L.; Bourgeois, S.
1987-01-01
Human fibronectin (FN) genomic clones were isolated by screening a human genomic library with a 75-base oligonucleotide. The sequence of the oligonucleotide corresponds to a region near the 5' end of the human FN cDNA clone pFH6 that contains the amino-terminal coding sequences but does not extend to the 5' end of the mRNA. The 5' end of the FN gene is found on a 3.7-kilobase-pair EcoRI fragment that contains about 2.7 kilobase pairs of flanking sequence. The first exon is 414 base pairs long, with a 5' untranslated region of 267 base pairs. As deduced on the basis of the position of the initiation codon, FN is synthesized with a 31-residue amino acid extension on the amion terminus that is not present in the mature polypeptide. This amino-terminal extension appears to contain both a signal peptide and a propeptide. The first 200 base pairs of 5'-flanking sequence is very G+C rich. Upstream of this the sequence becomes relatively A+T rich. The sequence ATATAA is found at -25 and the sequence CAAT is present at -150. The sequence GGGGCGGGGC at -102 exhibits homology to the binding site for the transcription factor SP1, and the sequence TGACGTCA at -173 exhibits homology to 5'-flanking sequences important for induction by cAMP
International Nuclear Information System (INIS)
Madu, Ikenna G.; Belouzard, Sandrine; Whittaker, Gary R.
2009-01-01
The S2 domain of the coronavirus spike (S) protein is known to be responsible for mediating membrane fusion. In addition to a well-recognized cleavage site at the S1-S2 boundary, a second proteolytic cleavage site has been identified in the severe acute respiratory syndrome coronavirus (SARS-CoV) S2 domain (R797). C-terminal to this S2 cleavage site is a conserved region flanked by cysteine residues C822 and C833. Here, we investigated the importance of this well conserved region for SARS-CoV S-mediated fusion activation. We show that the residues between C822-C833 are well conserved across all coronaviruses. Mutagenic analysis of SARS-CoV S, combined with cell-cell fusion and pseudotyped virion infectivity assays, showed a critical role for the core-conserved residues C822, D830, L831, and C833. Based on available predictive models, we propose that the conserved domain flanked by cysteines 822 and 833 forms a loop structure that interacts with components of the SARS-CoV S trimer to control the activation of membrane fusion.
Structure and regulated expression of bovine prolactin and bovine growth hormone genes
International Nuclear Information System (INIS)
Rottman, F.; Camper, S.; Goodwin, E.; Hampson, R.; Lyons, R.
1986-01-01
This paper presents a description of several studies which utilize the transfection of cloned chimeric genes in an attempt to analyze the regulatory signals found in the bPRL and bGH genes. Examination of 5' flanking region of PRL genes reveals a high degree of sequence homology between the bovine, human, and rat species. In order to assess the existence of possible regulatory sequences in a more direct manner, the authors transfected homologous and heterologous cells with chimeric gene constructs containing possible regulatory sequences derived from both the bPRL and bGH genes. An analysis is presented of the polyadenylation signal contained in the bGH 3' flanking sequence
Directory of Open Access Journals (Sweden)
Lakkhana Kanhayuwa
Full Text Available Novel families of short interspersed nuclear element (SINE sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.
Lamartina, S; Roscilli, G; Rinaudo, D; Delmastro, P; Toniatti, C
1998-09-01
Adeno-associated virus (AAV) integrates very efficiently into a specific site (AAVS1) of human chromosome 19. Two elements of the AAV genome are sufficient: the inverted terminal repeats (ITRs) and the Rep78 or Rep68 protein. The incorporation of the AAV integration machinery in nonviral delivery systems is of great interest for gene therapy. We demonstrate that purified recombinant Rep68 protein is functionally active when directly delivered into human cells by using the polycationic liposome Lipofectamine, promoting the rescue-replication of a codelivered ITR-flanked cassette in adenovirus-infected cells and its site-specific integration in noninfected cells. The sequencing of cloned virus-host DNA junctions confirmed that lipofected Rep68 protein triggers site-specific integration at the same sites in chromosome 19 already characterized in cells latently infected with AAV.
Directory of Open Access Journals (Sweden)
Wang Yong
2011-07-01
classifiers are quite effective in predicting hot spots based on sequence features. Hot spots cannot be fully predicted through simple analysis based on physicochemical characteristics, but there is reason to believe that integration of features and machine learning methods can remarkably improve the predictive performance for hot spots.
2011-01-01
effective in predicting hot spots based on sequence features. Hot spots cannot be fully predicted through simple analysis based on physicochemical characteristics, but there is reason to believe that integration of features and machine learning methods can remarkably improve the predictive performance for hot spots. PMID:21798070
Spielmann, A; Stutz, E
1983-10-25
The soybean chloroplast psb A gene (photosystem II thylakoid membrane protein of Mr 32 000, lysine-free) and the trn H gene (tRNAHisGUG), which both map in the large single copy region adjacent to one of the inverted repeat structures (IR1), have been sequenced including flanking regions. The psb A gene shows in its structural part 92% sequence homology with the corresponding genes of spinach and N. debneyi and contains also an open reading frame for 353 aminoacids. The aminoacid sequence of a potential primary translation product (calculated Mr, 38 904, no lysine) diverges from that of spinach and N. debneyi in only two positions in the C-terminal part. The trn H gene has the same polarity as the psb A gene and the coding region is located at the very end of the large single copy region. The deduced sequence of the soybean chloroplast tRNAHisGUG is identical with that of Zea mays chloroplasts. Both ends of the large single copy region were sequenced including a small segment of the adjacent IR1 and IR2.
SeqLib: a C ++ API for rapid BAM manipulation, sequence alignment and sequence assembly.
Wala, Jeremiah; Beroukhim, Rameen
2017-03-01
We present SeqLib, a C ++ API and command line tool that provides a rapid and user-friendly interface to BAM/SAM/CRAM files, global sequence alignment operations and sequence assembly. Four C libraries perform core operations in SeqLib: HTSlib for BAM access, BWA-MEM and BLAT for sequence alignment and Fermi for error correction and sequence assembly. Benchmarking indicates that SeqLib has lower CPU and memory requirements than leading C ++ sequence analysis APIs. We demonstrate an example of how minimal SeqLib code can extract, error-correct and assemble reads from a CRAM file and then align with BWA-MEM. SeqLib also provides additional capabilities, including chromosome-aware interval queries and read plotting. Command line tools are available for performing integrated error correction, micro-assemblies and alignment. SeqLib is available on Linux and OSX for the C ++98 standard and later at github.com/walaj/SeqLib. SeqLib is released under the Apache2 license. Additional capabilities for BLAT alignment are available under the BLAT license. jwala@broadinstitue.org ; rameen@broadinstitute.org. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart
2010-07-01
High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users.
Energy Technology Data Exchange (ETDEWEB)
Hernandez-Gonzalez, L. W.; Perez-Rodriguez, R.; Zambrano-Robledo, P.; Guerrero-Mata, M.; Dumitrescu, L.
2011-07-01
This work deals with the experimental study of the flank wear evolution of two coating carbide inserts and a cermet insert during the dry finishing turning of AISI 1045 steel with 400, 500 and 600 m/min cutting speeds. The results were analyzed using the variance analysis and lineal regression analysis in order to describe the relationship between the flank wear and machining time, obtaining the adjusted model equation. The investigation demonstrated a significant effect of cutting speed and machining time on the flank wear at high speed machining. The three coating layers insert showed the best performance while the two layers insert had the worst behaviour of the cutting tool wear at high cutting speeds. (Author) 19 refs.
Directory of Open Access Journals (Sweden)
Jumpei Saito
Full Text Available MicroRNA (miRNA are non-coding small RNA that regulate gene expression. MiR-328 is reported to influence breast cancer resistance protein (BCRP expression in cancer cells. As a large inter-individual difference in BCRP levels is observed in various human tissues, the contribution of miR-328 to these differences is of interest. We hypothesized that DNA methylation in the miR-328 promoter region is responsible for the difference in miR-328 levels, leading to inter-individual variability in BCRP levels in human placenta. The association between placental miR-328 and BCRP levels was analyzed, and then DNA methylation in the miR-328 5'-flanking region and regulatory mechanisms causing inter-individual differences in miR-328 and BCRP levels were examined. MiR-328 expression was significantly correlated with BCRP mRNA (Rs = -0.560, P < 0.01 and protein (Rs = -0.730, P < 0.01 levels. It was also up-regulated by the demethylating agent 5-aza-2'-deoxycytidine in BCRP-expressing cells. Luciferase assays with differentially methylated reporter constructs indicated that methylation in the miR-328 5'-flanking region including a predicted CpG island remarkably decreased transcriptional activity compared to that in unmethylated constructs. We selected CCAAT/enhancer binding protein α (C/EBPα, located within the predicted CpG island, by in silico analysis. To elucidate the role of C/EBPα in miR-328 expression, a chromatin immunoprecipitation assay, promoter deletion analysis, and electrophoretic mobility shift assay (EMSA were performed. C/EBPα-binding site-truncated constructs showed significantly decreased promoter activity, and EMSA indicated that the C/EBPα-binding sites were located in the CpG island. Finally, the methylation patterns of several CpG dinucleotides proximal to two C/EBPα-binding sites in the miR-328 5'-flanking region were correlated negatively with miR-328 levels, and positively with BCRP levels in human placental samples. These
International Nuclear Information System (INIS)
Price, E.R.; Zydowsky, L.D.; Jin, Mingjie; Baker, C.H.; McKeon, F.D.; Walsh, C.T.
1991-01-01
The authors report the cloning and characterization of a cDNA encoding a second human cyclosporin A-binding protein (hCyPB). Homology analyses reveal that hCyPB is a member of the cyclophilin B (CyPB) family, which includes yeast CyPB, Drosophila nina A, and rat cyclophilin-like protein. This family is distinguished from the cyclophilin A (CyPA) family by the presence of endoplasmic reticulum (ER)-directed signal sequences. hCyPB has a hydrophobic leader sequence not found in hCyPA, and its first 25 amino acids are removed upon expression in Escherichia coli. Moreover, they show that hCyPB is a peptidyl-prolyl cis-trans isomerase which can be inhibited by cyclosporin A. These observations suggest that other members of the CyPB family will have similar enzymatic properties. Sequence comparisons of the CyPB proteins show a central, 165-amino acid peptidyl-prolyl isomerase and cyclosprorin A-binding domain, flanked by variable N-terminal and C-terminal domains. These two variable regions may impart compartmental specificity and regulation to this family of cyclophilin proteins containing the conserved core domain. Northern blot analyses show that hCyPB mRNA is expressed in the Jurkat T-cell line, consistent with its possible target role in cyclosporin A-mediated immunosuppression
CisSERS: Customizable In Silico Sequence Evaluation for Restriction Sites.
Sharpe, Richard M; Koepke, Tyson; Harper, Artemus; Grimes, John; Galli, Marco; Satoh-Cruz, Mio; Kalyanaraman, Ananth; Evans, Katherine; Kramer, David; Dhingra, Amit
2016-01-01
High-throughput sequencing continues to produce an immense volume of information that is processed and assembled into mature sequence data. Data analysis tools are urgently needed that leverage the embedded DNA sequence polymorphisms and consequent changes to restriction sites or sequence motifs in a high-throughput manner to enable biological experimentation. CisSERS was developed as a standalone open source tool to analyze sequence datasets and provide biologists with individual or comparative genome organization information in terms of presence and frequency of patterns or motifs such as restriction enzymes. Predicted agarose gel visualization of the custom analyses results was also integrated to enhance the usefulness of the software. CisSERS offers several novel functionalities, such as handling of large and multiple datasets in parallel, multiple restriction enzyme site detection and custom motif detection features, which are seamlessly integrated with real time agarose gel visualization. Using a simple fasta-formatted file as input, CisSERS utilizes the REBASE enzyme database. Results from CisSERS enable the user to make decisions for designing genotyping by sequencing experiments, reduced representation sequencing, 3'UTR sequencing, and cleaved amplified polymorphic sequence (CAPS) molecular markers for large sample sets. CisSERS is a java based graphical user interface built around a perl backbone. Several of the applications of CisSERS including CAPS molecular marker development were successfully validated using wet-lab experimentation. Here, we present the tool CisSERS and results from in-silico and corresponding wet-lab analyses demonstrating that CisSERS is a technology platform solution that facilitates efficient data utilization in genomics and genetics studies.
The primary structures of two leghemoglobin genes from soybean
DEFF Research Database (Denmark)
Hyldig-Nielsen, J J; Jensen, E O; Paludan, K
1982-01-01
We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences which interrupt the two coding sequences in identical positions. The 5' and 3' flanking sequences in both genes contain conserved sequences similar...
De Oliveira, T; Miller, R; Tarin, M; Cassol, S
2003-01-01
Sequence databases encode a wealth of information needed to develop improved vaccination and treatment strategies for the control of HIV and other important pathogens. To facilitate effective utilization of these datasets, we developed a user-friendly GDE-based LINUX interface that reduces input/output file formatting. GDE was adapted to the Linux operating system, bioinformatics tools were integrated with microbe-specific databases, and up-to-date GDE menus were developed for several clinically important viral, bacterial and parasitic genomes. Each microbial interface was designed for local access and contains Genbank, BLAST-formatted and phylogenetic databases. GDE-Linux is available for research purposes by direct application to the corresponding author. Application-specific menus and support files can be downloaded from (http://www.bioafrica.net).
Integrated genetic analysis microsystems
International Nuclear Information System (INIS)
Lagally, Eric T; Mathies, Richard A
2004-01-01
With the completion of the Human Genome Project and the ongoing DNA sequencing of the genomes of other animals, bacteria, plants and others, a wealth of new information about the genetic composition of organisms has become available. However, as the demand for sequence information grows, so does the workload required both to generate this sequence and to use it for targeted genetic analysis. Microfabricated genetic analysis systems are well poised to assist in the collection and use of these data through increased analysis speed, lower analysis cost and higher parallelism leading to increased assay throughput. In addition, such integrated microsystems may point the way to targeted genetic experiments on single cells and in other areas that are otherwise very difficult. Concomitant with these advantages, such systems, when fully integrated, should be capable of forming portable systems for high-speed in situ analyses, enabling a new standard in disciplines such as clinical chemistry, forensics, biowarfare detection and epidemiology. This review will discuss the various technologies available for genetic analysis on the microscale, and efforts to integrate them to form fully functional robust analysis devices. (topical review)
Space shuttle operations integration plan
1975-01-01
The Operations Integration Plan is presented, which is to provide functional definition of the activities necessary to develop and integrate shuttle operating plans and facilities to support flight, flight control, and operations. It identifies the major tasks, the organizations responsible, their interrelationships, the sequence of activities and interfaces, and the resultant products related to operations integration.
Directory of Open Access Journals (Sweden)
Steven N Hart
Full Text Available BACKGROUND: Structural variation (SV represents a significant, yet poorly understood contribution to an individual's genetic makeup. Advanced next-generation sequencing technologies are widely used to discover such variations, but there is no single detection tool that is considered a community standard. In an attempt to fulfil this need, we developed an algorithm, SoftSearch, for discovering structural variant breakpoints in Illumina paired-end next-generation sequencing data. SoftSearch combines multiple strategies for detecting SV including split-read, discordant read-pair, and unmated pairs. Co-localized split-reads and discordant read pairs are used to refine the breakpoints. RESULTS: We developed and validated SoftSearch using real and synthetic datasets. SoftSearch's key features are 1 not requiring secondary (or exhaustive primary alignment, 2 portability into established sequencing workflows, and 3 is applicable to any DNA-sequencing experiment (e.g. whole genome, exome, custom capture, etc.. SoftSearch identifies breakpoints from a small number of soft-clipped bases from split reads and a few discordant read-pairs which on their own would not be sufficient to make an SV call. CONCLUSIONS: We show that SoftSearch can identify more true SVs by combining multiple sequence features. SoftSearch was able to call clinically relevant SVs in the BRCA2 gene not reported by other tools while offering significantly improved overall performance.
International Nuclear Information System (INIS)
Woodson, S.A.; Crothers, D.M.
1987-01-01
A series of bulge-containing and normal double-helical synthetic oligodeoxyribonucleotides, of sequence corresponding to a frame-shift mutational hot spot in the λ C/sub I/ gene, are compared by proton magnetic resonance spectroscopy at 500 MHz. The imino proton resonances are assigned by one-dimensional nuclear Overhauser effect spectroscopy. Nonselective T 1 inversion-recovery experiments are used to determine exchangeable proton lifetimes and to compare helix stability and dynamics of the three duplexes. An extra adenosine flanking the internal G-C base pairs has a strongly localized effect on helix stability, but the destabilizing effect of an extra cytidine in a C tract is delocalized over the entire G-C run. These data lead to the conclusion that the position of the bulge migrates along the run in the fast-exchange limit on the NMR time scale. Rapid migration of the bulge defect in homopolymeric sequences may help rationalize both frame-shift mutagenesis and translational frame shifting. The authors estimate that the unfavorable free energy of a localized bulge defect is 2.9-3.2 kcal/mol, in good agreement with earlier estimates for RNA helices
Probabilistic Dynamics for Integrated Analysis of Accident Sequences considering Uncertain Events
Directory of Open Access Journals (Sweden)
Robertas Alzbutas
2015-01-01
Full Text Available The analytical/deterministic modelling and simulation/probabilistic methods are used separately as a rule in order to analyse the physical processes and random or uncertain events. However, in the currently used probabilistic safety assessment this is an issue. The lack of treatment of dynamic interactions between the physical processes on one hand and random events on the other hand causes the limited assessment. In general, there are a lot of mathematical modelling theories, which can be used separately or integrated in order to extend possibilities of modelling and analysis. The Theory of Probabilistic Dynamics (TPD and its augmented version based on the concept of stimulus and delay are introduced for the dynamic reliability modelling and the simulation of accidents in hybrid (continuous-discrete systems considering uncertain events. An approach of non-Markovian simulation and uncertainty analysis is discussed in order to adapt the Stimulus-Driven TPD for practical applications. The developed approach and related methods are used as a basis for a test case simulation in view of various methods applications for severe accident scenario simulation and uncertainty analysis. For this and for wider analysis of accident sequences the initial test case specification is then extended and discussed. Finally, it is concluded that enhancing the modelling of stimulated dynamics with uncertainty and sensitivity analysis allows the detailed simulation of complex system characteristics and representation of their uncertainty. The developed approach of accident modelling and analysis can be efficiently used to estimate the reliability of hybrid systems and at the same time to analyze and possibly decrease the uncertainty of this estimate.
Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter
Directory of Open Access Journals (Sweden)
Wanying Li
2018-03-01
Full Text Available ZmbZIP25 (Zea mays bZIP (basic leucine zipper transcription factor 25 is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction. In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5′ RACE (rapid amplification of cDNA ends assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from −2083 to +367 and a 2600 bp sequence of ZmbZIP25 (from −2083 to +517, the transcription start site was denoted +1. Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5′-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5′-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5′-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5′-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from −1117 to −957 that were responsible for the specificity of the ZmbZIP25 5′-flanking sequence.
Identification of a Flavivirus Sequence in a Marine Arthropod.
Directory of Open Access Journals (Sweden)
Michael J Conway
Full Text Available Phylogenetic analysis has yet to uncover the early origins of flaviviruses. In this study, I mined a database of expressed sequence tags in order to discover novel flavivirus sequences. Flavivirus sequences were identified in a pool of mRNA extracted from the sea spider Endeis spinosa (Pycnogonida, Pantopoda. Reconstruction of the translated sequences and BLAST analysis matched the sequence to the flavivirus NS5 gene. Additional sequences corresponding to envelope and the NS5 MTase domain were also identified. Phylogenetic analysis of homologous NS5 sequences revealed that Endeis spinosa NS5 (ESNS5 is likely related to classical insect-specific flaviviruses. It is unclear if ESNS5 represents genetic material from an active viral infection or an integrated viral genome. These data raise the possibility that classical insect-specific flaviviruses and perhaps medically relevant flaviviruses, evolved from progenitors that infected marine arthropods.
Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.
2013-01-01
Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596
ggseqlogo: a versatile R package for drawing sequence logos.
Wagih, Omar
2017-11-15
Sequence logos have become a crucial visualization method for studying underlying sequence patterns in the genome. Despite this, there remains a scarcity of software packages that provide the versatility often required for such visualizations. ggseqlogo is an R package built on the ggplot2 package that aims to address this issue. ggseqlogo offers native illustration of publication-ready DNA, RNA and protein sequence logos in a highly customizable fashion with features including multi-logo plots, qualitative and quantitative colour schemes, annotation of logos and integration with other plots. The package is intuitive to use and seamlessly integrates into R analysis pipelines. ggseqlogo is released under the GNU licence and is freely available via CRAN-The Comprehensive R Archive Network https://cran.r-project.org/web/packages/ggseqlogo. A detailed tutorial can be found at https://omarwagih.github.io/ggseqlogo. wagih@ebi.ac.uk. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
An assembly sequence planning method based on composite algorithm
Directory of Open Access Journals (Sweden)
Enfu LIU
2016-02-01
Full Text Available To solve the combination explosion problem and the blind searching problem in assembly sequence planning of complex products, an assembly sequence planning method based on composite algorithm is proposed. In the composite algorithm, a sufficient number of feasible assembly sequences are generated using formalization reasoning algorithm as the initial population of genetic algorithm. Then fuzzy knowledge of assembly is integrated into the planning process of genetic algorithm and ant algorithm to get the accurate solution. At last, an example is conducted to verify the feasibility of composite algorithm.
Directory of Open Access Journals (Sweden)
Alessandro Bonforte
2013-05-01
Full Text Available Results of recent monitoring activities on potentially unstable areas of the NW volcano flank of La Fossa cone (Vulcano Island, Italy are shown here. They are obtained by integration of data by aerial photogrammetry, terrestrial laser scanning (TLS and GPS taken in the 1996–2011 time span. A comparison between multi-temporal models built from remote sensing data (photogrammetry and TLS highlights areas characterized by ~7–10 cm/y positive differences (i.e., elevation increase in the upper crown of the slope. The GPS measurements confirm these results. Areas characterized by negative differences, related to both mass collapses or small surface lowering, also exist. The higher differences, positive and negative, are always observed in zones affected by higher fumarolic activity. In the 2010–2012 time span, ground motions in the northern part of the crater rim, immediately above the upper part of observed area, are also observed. The results show different trends for both vertical and horizontal displacements of points distributed along the rim, with a magnitude of some centimeters, thus revealing a complex kinematics. A slope stability analysis shows that the safety factors estimated from these data do not indicate evidence of possible imminent failures. Nevertheless, new time series are needed to detect possible changes with the time of the stability conditions, and the monitoring has to go on.
CisSERS: Customizable In Silico Sequence Evaluation for Restriction Sites.
Directory of Open Access Journals (Sweden)
Richard M Sharpe
Full Text Available High-throughput sequencing continues to produce an immense volume of information that is processed and assembled into mature sequence data. Data analysis tools are urgently needed that leverage the embedded DNA sequence polymorphisms and consequent changes to restriction sites or sequence motifs in a high-throughput manner to enable biological experimentation. CisSERS was developed as a standalone open source tool to analyze sequence datasets and provide biologists with individual or comparative genome organization information in terms of presence and frequency of patterns or motifs such as restriction enzymes. Predicted agarose gel visualization of the custom analyses results was also integrated to enhance the usefulness of the software. CisSERS offers several novel functionalities, such as handling of large and multiple datasets in parallel, multiple restriction enzyme site detection and custom motif detection features, which are seamlessly integrated with real time agarose gel visualization. Using a simple fasta-formatted file as input, CisSERS utilizes the REBASE enzyme database. Results from CisSERS enable the user to make decisions for designing genotyping by sequencing experiments, reduced representation sequencing, 3'UTR sequencing, and cleaved amplified polymorphic sequence (CAPS molecular markers for large sample sets. CisSERS is a java based graphical user interface built around a perl backbone. Several of the applications of CisSERS including CAPS molecular marker development were successfully validated using wet-lab experimentation. Here, we present the tool CisSERS and results from in-silico and corresponding wet-lab analyses demonstrating that CisSERS is a technology platform solution that facilitates efficient data utilization in genomics and genetics studies.
E-MSD: an integrated data resource for bioinformatics.
Velankar, S; McNeil, P; Mittard-Runte, V; Suarez, A; Barrell, D; Apweiler, R; Henrick, K
2005-01-01
The Macromolecular Structure Database (MSD) group (http://www.ebi.ac.uk/msd/) continues to enhance the quality and consistency of macromolecular structure data in the worldwide Protein Data Bank (wwPDB) and to work towards the integration of various bioinformatics data resources. One of the major obstacles to the improved integration of structural databases such as MSD and sequence databases like UniProt is the absence of up to date and well-maintained mapping between corresponding entries. We have worked closely with the UniProt group at the EBI to clean up the taxonomy and sequence cross-reference information in the MSD and UniProt databases. This information is vital for the reliable integration of the sequence family databases such as Pfam and Interpro with the structure-oriented databases of SCOP and CATH. This information has been made available to the eFamily group (http://www.efamily.org.uk/) and now forms the basis of the regular interchange of information between the member databases (MSD, UniProt, Pfam, Interpro, SCOP and CATH). This exchange of annotation information has enriched the structural information in the MSD database with annotation from wider sequence-oriented resources. This work was carried out under the 'Structure Integration with Function, Taxonomy and Sequences (SIFTS)' initiative (http://www.ebi.ac.uk/msd-srv/docs/sifts) in the MSD group.
Ryb, U.; Matmon, A.; Erel, Y.; Haviv, I.; Benedetti, L. C.
2013-12-01
The Judea Range which is composed of a thick sequence of Cretaceous marine carbonate rises up to ~1000 m between the Mediterranean Sea and the Dead Sea basins. The western flank of the range faces predominant winds which deliver humidity from the Mediterranean and thus maintains a sub-humid Mediterranean climate (Mean Annual Precipitation (MAP) of 500-700 mm). Over the eastern, leeward side, rain-shadow orographic effect imposes a climatic gradient from Mediterranean near the water divide to hyper-arid near the Dead Sea rift escarpment (MAPMAP values, indicating that chemical weathering is the dominant process of erosion. Long-term denudation rates of interfluves reflect the climatic gradient between the two flanks of the Judea range; over the western, windward, flank of the Judea range, exposed bedrock denude at an average rate of 21×7 mm kyr-1, while over the leeward flank denudation rates drop dramatically, reaching 1-3 mm kyr-1 near the Dead Sea rift escarpment. As a rough measure to the erosion of the Judea Range since it began uplifting in Senonian time, we compare the present envelope-topography (T) of the range with the top-Turonian structural datum (S). We found that over the windward flank topography lay ~300 meters below the datum, while over the leeward flank topography generally follows the datum. Can this difference result from differential denudation, similar to the one observed over 10-1-105 year timescales? S-T values are well correlated with present MAP values, suggesting a positive answer. Assuming that the late Pleistocene denudation pattern calculated from 36Cl data was maintained, ~15 million years are required to form the observed 300 difference between the eastern and western flanks of the range. Indeed, previous studies suggest that by mid Miocene the Judea Range was uplifted to about ~500 m above sea level, while the Mediterranean was the immediate source for humidity in the region as of the early Miocene. The integrated data could
A functional analysis of the spacer of V(DJ recombination signal sequences.
Directory of Open Access Journals (Sweden)
Alfred Ian Lee
2003-10-01
Full Text Available During lymphocyte development, V(DJ recombination assembles antigen receptor genes from component V, D, and J gene segments. These gene segments are flanked by a recombination signal sequence (RSS, which serves as the binding site for the recombination machinery. The murine Jbeta2.6 gene segment is a recombinationally inactive pseudogene, but examination of its RSS reveals no obvious reason for its failure to recombine. Mutagenesis of the Jbeta2.6 RSS demonstrates that the sequences of the heptamer, nonamer, and spacer are all important. Strikingly, changes solely in the spacer sequence can result in dramatic differences in the level of recombination. The subsequent analysis of a library of more than 4,000 spacer variants revealed that spacer residues of particular functional importance are correlated with their degree of conservation. Biochemical assays indicate distinct cooperation between the spacer and heptamer/nonamer along each step of the reaction pathway. The results suggest that the spacer serves not only to ensure the appropriate distance between the heptamer and nonamer but also regulates RSS activity by providing additional RAG:RSS interaction surfaces. We conclude that while RSSs are defined by a "digital" requirement for absolutely conserved nucleotides, the quality of RSS function is determined in an "analog" manner by numerous complex interactions between the RAG proteins and the less-well conserved nucleotides in the heptamer, the nonamer, and, importantly, the spacer. Those modulatory effects are accurately predicted by a new computational algorithm for "RSS information content." The interplay between such binary and multiplicative modes of interactions provides a general model for analyzing protein-DNA interactions in various biological systems.
Guo, Jinchao; Yang, Litao; Liu, Xin; Guan, Xiaoyan; Jiang, Lingxi; Zhang, Dabing
2009-08-26
Genetically modified (GM) papaya (Carica papaya L.), Huanong No. 1, was approved for commercialization in Guangdong province, China in 2006, and the development of the Huanong No. 1 papaya detection method is necessary for implementing genetically modified organism (GMO) labeling regulations. In this study, we reported the characterization of the exogenous integration of GM Huanong No. 1 papaya by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. The results suggested that one intact copy of the initial construction was integrated in the papaya genome and which probably resulted in one deletion (38 bp in size) of the host genomic DNA. Also, one unintended insertion of a 92 bp truncated NptII fragment was observed at the 5' end of the exogenous insert. Furthermore, we revealed its 5' and 3' flanking sequences between the insert DNA and the papaya genomic DNA, and developed the event-specific qualitative and quantitative PCR assays for GM Huanong No. 1 papaya based on the 5' integration flanking sequence. The relative limit of detection (LOD) of the qualitative PCR assay was about 0.01% in 100 ng of total papaya genomic DNA, corresponding to about 25 copies of papaya haploid genome. In the quantitative PCR, the limits of detection and quantification (LOD and LOQ) were as low as 12.5 and 25 copies of papaya haploid genome, respectively. In practical sample quantification, the quantified biases between the test and true values of three samples ranged from 0.44% to 4.41%. Collectively, we proposed that all of these results are useful for the identification and quantification of Huanong No. 1 papaya and its derivates.
A microfluidic DNA library preparation platform for next-generation sequencing.
Kim, Hanyoup; Jebrail, Mais J; Sinha, Anupama; Bent, Zachary W; Solberg, Owen D; Williams, Kelly P; Langevin, Stanley A; Renzi, Ronald F; Van De Vreugde, James L; Meagher, Robert J; Schoeniger, Joseph S; Lane, Todd W; Branda, Steven S; Bartsch, Michael S; Patel, Kamlesh D
2013-01-01
Next-generation sequencing (NGS) is emerging as a powerful tool for elucidating genetic information for a wide range of applications. Unfortunately, the surging popularity of NGS has not yet been accompanied by an improvement in automated techniques for preparing formatted sequencing libraries. To address this challenge, we have developed a prototype microfluidic system for preparing sequencer-ready DNA libraries for analysis by Illumina sequencing. Our system combines droplet-based digital microfluidic (DMF) sample handling with peripheral modules to create a fully-integrated, sample-in library-out platform. In this report, we use our automated system to prepare NGS libraries from samples of human and bacterial genomic DNA. E. coli libraries prepared on-device from 5 ng of total DNA yielded excellent sequence coverage over the entire bacterial genome, with >99% alignment to the reference genome, even genome coverage, and good quality scores. Furthermore, we produced a de novo assembly on a previously unsequenced multi-drug resistant Klebsiella pneumoniae strain BAA-2146 (KpnNDM). The new method described here is fast, robust, scalable, and automated. Our device for library preparation will assist in the integration of NGS technology into a wide variety of laboratories, including small research laboratories and clinical laboratories.
A microfluidic DNA library preparation platform for next-generation sequencing.
Directory of Open Access Journals (Sweden)
Hanyoup Kim
Full Text Available Next-generation sequencing (NGS is emerging as a powerful tool for elucidating genetic information for a wide range of applications. Unfortunately, the surging popularity of NGS has not yet been accompanied by an improvement in automated techniques for preparing formatted sequencing libraries. To address this challenge, we have developed a prototype microfluidic system for preparing sequencer-ready DNA libraries for analysis by Illumina sequencing. Our system combines droplet-based digital microfluidic (DMF sample handling with peripheral modules to create a fully-integrated, sample-in library-out platform. In this report, we use our automated system to prepare NGS libraries from samples of human and bacterial genomic DNA. E. coli libraries prepared on-device from 5 ng of total DNA yielded excellent sequence coverage over the entire bacterial genome, with >99% alignment to the reference genome, even genome coverage, and good quality scores. Furthermore, we produced a de novo assembly on a previously unsequenced multi-drug resistant Klebsiella pneumoniae strain BAA-2146 (KpnNDM. The new method described here is fast, robust, scalable, and automated. Our device for library preparation will assist in the integration of NGS technology into a wide variety of laboratories, including small research laboratories and clinical laboratories.
Sequencing Information Management System (SIMS). Final report
Energy Technology Data Exchange (ETDEWEB)
Fields, C.
1996-02-15
A feasibility study to develop a requirements analysis and functional specification for a data management system for large-scale DNA sequencing laboratories resulted in a functional specification for a Sequencing Information Management System (SIMS). This document reports the results of this feasibility study, and includes a functional specification for a SIMS relational schema. The SIMS is an integrated information management system that supports data acquisition, management, analysis, and distribution for DNA sequencing laboratories. The SIMS provides ad hoc query access to information on the sequencing process and its results, and partially automates the transfer of data between laboratory instruments, analysis programs, technical personnel, and managers. The SIMS user interfaces are designed for use by laboratory technicians, laboratory managers, and scientists. The SIMS is designed to run in a heterogeneous, multiplatform environment in a client/server mode. The SIMS communicates with external computational and data resources via the internet.
Chen, Hung-Yang
2017-12-28
A novel fused heterocycle-flanked diketopyrrolopyrrole (DPP) monomer, thieno[2,3-b]pyridine diketopyrrolopyrrole (TPDPP), was designed and synthesized. When copolymerized with 3,4-difluorothiophene using Stille coupling polymerization, the new polymer pTPDPP-TF possesses a highly planar conjugated polymer backbone due to the fused thieno[2,3-b]pyridine flanking unit that effectively alleviates the steric hindrance with both the central DPP core and the 3,4-difluorothiophene repeat unit. This new polymer exhibits a high electron affinity (EA) of −4.1 eV and was successfully utilized as an n-type polymer semiconductor for applications in organic field-effect transistors (OFETs) and all polymer solar cells. A promising n-type charge carrier mobility of 0.1 cm2 V–1 s–1 was obtained in bottom-contact, top-gate OFETs, and a power conversion efficiency (PCE) of 2.72% with a high open-circuit voltage (VOC) of 1.04 V was achieved for all polymer solar cells using PTB7-Th as the polymer donor.
Chen, Hung-Yang; Nikolka, Mark; Wadsworth, Andrew; Yue, Wan; Onwubiko, Ada; Xiao, Mingfei; White, Andrew J. P.; Baran, Derya; Sirringhaus, Henning; McCulloch, Iain
2017-01-01
A novel fused heterocycle-flanked diketopyrrolopyrrole (DPP) monomer, thieno[2,3-b]pyridine diketopyrrolopyrrole (TPDPP), was designed and synthesized. When copolymerized with 3,4-difluorothiophene using Stille coupling polymerization, the new polymer pTPDPP-TF possesses a highly planar conjugated polymer backbone due to the fused thieno[2,3-b]pyridine flanking unit that effectively alleviates the steric hindrance with both the central DPP core and the 3,4-difluorothiophene repeat unit. This new polymer exhibits a high electron affinity (EA) of −4.1 eV and was successfully utilized as an n-type polymer semiconductor for applications in organic field-effect transistors (OFETs) and all polymer solar cells. A promising n-type charge carrier mobility of 0.1 cm2 V–1 s–1 was obtained in bottom-contact, top-gate OFETs, and a power conversion efficiency (PCE) of 2.72% with a high open-circuit voltage (VOC) of 1.04 V was achieved for all polymer solar cells using PTB7-Th as the polymer donor.
Identification of Laying-Related SNP Markers in Geese Using RAD Sequencing.
Directory of Open Access Journals (Sweden)
ShiGang Yu
Full Text Available Laying performance is an important economical trait of goose production. As laying performance is of low heritability, it is of significance to develop a marker-assisted selection (MAS strategy for this trait. Definition of sequence variation related to the target trait is a prerequisite of quantitating MAS, but little is presently known about the goose genome, which greatly hinders the identification of genetic markers for the laying traits of geese. Recently developed restriction site-associated DNA (RAD sequencing is a possible approach for discerning large-scale single nucleotide polymorphism (SNP and reducing the complexity of a genome without having reference genomic information available. In the present study, we developed a pooled RAD sequencing strategy for detecting geese laying-related SNP. Two DNA pools were constructed, each consisting of equal amounts of genomic DNA from 10 individuals with either high estimated breeding value (HEBV or low estimated breeding value (LEBV. A total of 139,013 SNP were obtained from 42,291,356 sequences, of which 18,771,943 were for LEBV and 23,519,413 were for HEBV cohorts. Fifty-five SNP which had different allelic frequencies in the two DNA pools were further validated by individual-based AS-PCR genotyping in the LEBV and HEBV cohorts. Ten out of 55 SNP exhibited distinct allele distributions in these two cohorts. These 10 SNP were further genotyped in a goose population of 492 geese to verify the association with egg numbers. The result showed that 8 of 10 SNP were associated with egg numbers. Additionally, liner regression analysis revealed that SNP Record-111407, 106975 and 112359 were involved in a multiplegene network affecting laying performance. We used IPCR to extend the unknown regions flanking the candidate RAD tags. The obtained sequences were subjected to BLAST to retrieve the orthologous genes in either ducks or chickens. Five novel genes were cloned for geese which harbored the
Directory of Open Access Journals (Sweden)
K. Nykyri
2006-10-01
Full Text Available On 3 July 2001, the four Cluster satellites traversed along the dawnside magnetospheric flank and observed large variations in all plasma parameters. The estimated magnetopause boundary normals were oscillating in the z-direction and the normal component of the magnetic field showed systematic 2–3 min bipolar variations for 1 h when the IMF had a small positive bz-component and a Parker-spiral orientation in the x,y-plane. Brief 33 s intervals with excellent deHoffman Teller frames were observed satisfying the Walén relation. Detailed comparisons with 2-D MHD simulations indicate that Cluster encountered rotational discontinuities generated by Kelvin-Helmholtz instability. We estimate a wave length of 6 RE and a wave vector with a significant z-component.
FOX, LYLE E.; GREEN, DAVID; YAN, ZIYING; ENGELHARDT, JOHN F.; WU, CHUN-FANG
2007-01-01
Here we report the development of a high-throughput screen to assess dominant mutation rates caused by P-element transposition within the Drosophila genome that is suitable for assessing the undesirable effects of integrating foreign regulatory sequences (viral cargo) into a host genome. Three different behavioral paradigms were used: sensitivity to mechanical stress, response to heat stress, and ability to fly. The results, from our screen of 35,000 flies, indicate that mutations caused by t...
Chaos game representation (CGR)-walk model for DNA sequences
International Nuclear Information System (INIS)
Jie, Gao; Zhen-Yuan, Xu
2009-01-01
Chaos game representation (CGR) is an iterative mapping technique that processes sequences of units, such as nucleotides in a DNA sequence or amino acids in a protein, in order to determine the coordinates of their positions in a continuous space. This distribution of positions has two features: one is unique, and the other is source sequence that can be recovered from the coordinates so that the distance between positions may serve as a measure of similarity between the corresponding sequences. A CGR-walk model is proposed based on CGR coordinates for the DNA sequences. The CGR coordinates are converted into a time series, and a long-memory ARFIMA (p, d, q) model, where ARFIMA stands for autoregressive fractionally integrated moving average, is introduced into the DNA sequence analysis. This model is applied to simulating real CGR-walk sequence data of ten genomic sequences. Remarkably long-range correlations are uncovered in the data, and the results from these models are reasonably fitted with those from the ARFIMA (p, d, q) model. (cross-disciplinary physics and related areas of science and technology)
Molecular beam epitaxy grown Ge/Si pin layer sequence for photonic devices
International Nuclear Information System (INIS)
Schulze, J.; Oehme, M.; Werner, J.
2012-01-01
A key challenge to obtain a convergence of classical Si-based microelectronics and optoelectronics is the manufacturing of photonic integrated circuits integrable into classical Si-based integrated circuits. This integration would be greatly enhanced if similar facilities and technologies could be used. Therefore one approach is the development of optoelectronic components and devices made from group-IV-based materials such as SiGe, Ge or Ge:Sn. In this paper the optoelectronic performances of a pin diode made from a Ge/Si heterostructure pin layer sequence grown by molecular beam epitaxy are discussed. After a detailed description of the layer sequence growth and the device manufacturing process it will be shown that – depending on the chosen operating point and device design – the diode serves as a broadband high speed photo detector, Franz–Keldysh effect modulator or light emitting diode.
Molecular beam epitaxy grown Ge/Si pin layer sequence for photonic devices
Energy Technology Data Exchange (ETDEWEB)
Schulze, J., E-mail: schulze@iht.uni-stuttgart.de; Oehme, M.; Werner, J.
2012-02-01
A key challenge to obtain a convergence of classical Si-based microelectronics and optoelectronics is the manufacturing of photonic integrated circuits integrable into classical Si-based integrated circuits. This integration would be greatly enhanced if similar facilities and technologies could be used. Therefore one approach is the development of optoelectronic components and devices made from group-IV-based materials such as SiGe, Ge or Ge:Sn. In this paper the optoelectronic performances of a pin diode made from a Ge/Si heterostructure pin layer sequence grown by molecular beam epitaxy are discussed. After a detailed description of the layer sequence growth and the device manufacturing process it will be shown that - depending on the chosen operating point and device design - the diode serves as a broadband high speed photo detector, Franz-Keldysh effect modulator or light emitting diode.
Ruhlman, Tracey; Lee, Seung-Bum; Jansen, Robert K; Hostetler, Jessica B; Tallon, Luke J; Town, Christopher D; Daniell, Henry
2006-08-31
results provide the best taxon sampling of complete chloroplast genomes and the strongest support yet for the sister relationship of Caryophyllales to the asterids. The availability of the complete plastid genome sequence should facilitate improved transformation efficiency and foreign gene expression in carrot through utilization of endogenous flanking sequences and regulatory elements.
Directory of Open Access Journals (Sweden)
Ruhlman Tracey
2006-08-01
Daucus with Panax in the euasterid II clade. These results provide the best taxon sampling of complete chloroplast genomes and the strongest support yet for the sister relationship of Caryophyllales to the asterids. The availability of the complete plastid genome sequence should facilitate improved transformation efficiency and foreign gene expression in carrot through utilization of endogenous flanking sequences and regulatory elements.
PhyloSim - Monte Carlo simulation of sequence evolution in the R statistical computing environment
Directory of Open Access Journals (Sweden)
Massingham Tim
2011-04-01
Full Text Available Abstract Background The Monte Carlo simulation of sequence evolution is routinely used to assess the performance of phylogenetic inference methods and sequence alignment algorithms. Progress in the field of molecular evolution fuels the need for more realistic and hence more complex simulations, adapted to particular situations, yet current software makes unreasonable assumptions such as homogeneous substitution dynamics or a uniform distribution of indels across the simulated sequences. This calls for an extensible simulation framework written in a high-level functional language, offering new functionality and making it easy to incorporate further complexity. Results PhyloSim is an extensible framework for the Monte Carlo simulation of sequence evolution, written in R, using the Gillespie algorithm to integrate the actions of many concurrent processes such as substitutions, insertions and deletions. Uniquely among sequence simulation tools, PhyloSim can simulate arbitrarily complex patterns of rate variation and multiple indel processes, and allows for the incorporation of selective constraints on indel events. User-defined complex patterns of mutation and selection can be easily integrated into simulations, allowing PhyloSim to be adapted to specific needs. Conclusions Close integration with R and the wide range of features implemented offer unmatched flexibility, making it possible to simulate sequence evolution under a wide range of realistic settings. We believe that PhyloSim will be useful to future studies involving simulated alignments.