WorldWideScience

Sample records for integrated manner specific

  1. Nucleoside analogues are activated by bacterial deoxyribonucleoside kinases in a species-specific manner

    DEFF Research Database (Denmark)

    Sandrini, Michael; Clausen, Anders; On, Stephen L. W.

    2007-01-01

    To investigate the bactericidal activity of antiviral and anticancer nucleoside analogues against a variety of pathogenic bacteria and characterize the activating enzymes, deoxyribonucleoside kinases (dNKs). Several FDA-approved nucleoside analogue drugs were screened for their potential bacteric......-specific manner. Therefore, nucleoside analogues have a potential to be employed as antibiotics in the fight against emerging multiresistant bacteria....

  2. Parental overprotection engenders dysfunctional attitudes about achievement and dependency in a gender-specific manner.

    Science.gov (United States)

    Otani, Koichi; Suzuki, Akihito; Matsumoto, Yoshihiko; Shibuya, Naoshi; Sadahiro, Ryoichi; Enokido, Masanori

    2013-12-24

    It has been suggested that dysfunctional attitudes, cognitive vulnerability to depression, have developmental origins. The present study examined the effects of parental rearing on dysfunctional attitudes in three areas of life with special attention to gender specificity. The subjects were 665 Japanese healthy volunteers. Dysfunctional attitudes were assessed by the 24-item Dysfunctional Attitude Scale, which has the Achievement, Dependency and Self-control subscales. Perceived parental rearing was assessed by the Parental Bonding Instrument, which has the Care and Protection subscales. Higher scores of the Achievement (β = 0.293, p overprotection engenders dysfunctional attitudes about achievement and dependency in a gender-specific manner.

  3. Maternal obesity programs increased leptin gene expression in rat male offspring via epigenetic modifications in a depot-specific manner

    Directory of Open Access Journals (Sweden)

    Simon Lecoutre

    2017-08-01

    Conclusions: Consistent with the DOHaD hypothesis, persistent epigenetic remodeling occurs at regulatory regions especially within intergenic sequences, linked to higher leptin gene expression in adult HF offspring in a depot-specific manner.

  4. IGFBP-4 regulates adult skeletal growth in a sex-specific manner.

    Science.gov (United States)

    Maridas, David E; DeMambro, Victoria E; Le, Phuong T; Nagano, Kenichi; Baron, Roland; Mohan, Subburaman; Rosen, Clifford J

    2017-04-01

    Insulin-like growth factor-1 (IGF-1) and its binding proteins are critical mediators of skeletal growth. Insulin-like growth factor-binding protein 4 (IGFBP-4) is highly expressed in osteoblasts and inhibits IGF-1 actions in vitro Yet, in vivo studies suggest that it could potentiate IGF-1 and IGF-2 actions. In this study, we hypothesized that IGFBP-4 might potentiate the actions of IGF-1 on the skeleton. To test this, we comprehensively studied 8- and 16-week-old Igfbp4 -/- mice. Both male and female adult Igfbp4 -/- mice had marked growth retardation with reductions in body weight, body and femur lengths, fat proportion and lean mass at 8 and 16 weeks. Marked reductions in aBMD and aBMC were observed in 16-week-old Igfbp4 -/- females, but not in males. Femoral trabecular BV/TV and thickness, cortical fraction and thickness in 16-week-old Igfbp4 -/- females were significantly reduced. However, surprisingly, males had significantly more trabeculae with higher connectivity density than controls. Concordantly, histomorphometry revealed higher bone resorption and lower bone formation in Igfbp4 -/- females. In contrast, Igfbp4 -/- males had lower mineralized surface/bone surface. Femoral expression of Sost and circulating levels of sclerostin were reduced but only in Igfbp4 -/- males. Bone marrow stromal cultures from mutants showed increased osteogenesis, whereas osteoclastogenesis was markedly increased in cells from Igfbp4 -/- females but decreased in males. In sum, our results indicate that loss of Igfbp4 affects mesenchymal stromal cell differentiation, regulates osteoclastogenesis and influences both skeletal development and adult bone maintenance. Thus, IGFBP-4 modulates the skeleton in a gender-specific manner, acting as both a cell autonomous and cell non-autonomous factor. © 2017 The authors.

  5. Behavioral stress alters corticolimbic microglia in a sex- and brain region-specific manner.

    Science.gov (United States)

    Bollinger, Justin L; Collins, Kaitlyn E; Patel, Rushi; Wellman, Cara L

    2017-01-01

    Women are more susceptible to numerous stress-linked psychological disorders (e.g., depression) characterized by dysfunction of corticolimbic brain regions critical for emotion regulation and cognitive function. Although sparsely investigated, a number of studies indicate sex differences in stress effects on neuronal structure, function, and behaviors associated with these regions. We recently demonstrated a basal sex difference in- and differential effects of stress on- microglial activation in medial prefrontal cortex (mPFC). The resident immune cells of the brain, microglia are implicated in synaptic and dendritic plasticity, and cognitive-behavioral function. Here, we examined the effects of acute (3h/day, 1 day) and chronic (3h/day, 10 days) restraint stress on microglial density and morphology, as well as immune factor expression in orbitofrontal cortex (OFC), basolateral amygdala (BLA), and dorsal hippocampus (DHC) in male and female rats. Microglia were visualized, classified based on their morphology, and stereologically counted. Microglia-associated transcripts (CD40, iNOS, Arg1, CX3CL1, CX3CR1, CD200, and CD200R) were assessed in brain punches from each region. Expression of genes linked with cellular stress, neuroimmune state, and neuron-microglia communication varied between unstressed male and female rats in a region-specific manner. In OFC, chronic stress upregulated a wider variety of immune factors in females than in males. Acute stress increased microglia-associated transcripts in BLA in males, whereas chronic stress altered immune factor expression in BLA more broadly in females. In DHC, chronic stress increased immune factor expression in males but not females. Moreover, acute and chronic stress differentially affected microglial morphological activation state in male and female rats across all brain regions investigated. In males, chronic stress altered microglial activation in a pattern consistent with microglial involvement in stress

  6. Behavioral stress alters corticolimbic microglia in a sex- and brain region-specific manner

    Science.gov (United States)

    Bollinger, Justin L.; Collins, Kaitlyn E.; Patel, Rushi

    2017-01-01

    Women are more susceptible to numerous stress-linked psychological disorders (e.g., depression) characterized by dysfunction of corticolimbic brain regions critical for emotion regulation and cognitive function. Although sparsely investigated, a number of studies indicate sex differences in stress effects on neuronal structure, function, and behaviors associated with these regions. We recently demonstrated a basal sex difference in- and differential effects of stress on- microglial activation in medial prefrontal cortex (mPFC). The resident immune cells of the brain, microglia are implicated in synaptic and dendritic plasticity, and cognitive-behavioral function. Here, we examined the effects of acute (3h/day, 1 day) and chronic (3h/day, 10 days) restraint stress on microglial density and morphology, as well as immune factor expression in orbitofrontal cortex (OFC), basolateral amygdala (BLA), and dorsal hippocampus (DHC) in male and female rats. Microglia were visualized, classified based on their morphology, and stereologically counted. Microglia-associated transcripts (CD40, iNOS, Arg1, CX3CL1, CX3CR1, CD200, and CD200R) were assessed in brain punches from each region. Expression of genes linked with cellular stress, neuroimmune state, and neuron-microglia communication varied between unstressed male and female rats in a region-specific manner. In OFC, chronic stress upregulated a wider variety of immune factors in females than in males. Acute stress increased microglia-associated transcripts in BLA in males, whereas chronic stress altered immune factor expression in BLA more broadly in females. In DHC, chronic stress increased immune factor expression in males but not females. Moreover, acute and chronic stress differentially affected microglial morphological activation state in male and female rats across all brain regions investigated. In males, chronic stress altered microglial activation in a pattern consistent with microglial involvement in stress

  7. Astrocytic connexin hemichannels are regulated by PKC phosphorylation in an isoform-specific manner

    DEFF Research Database (Denmark)

    MacAulay, N.; Alstrom, J. S.; Hansen, D. B.

    2017-01-01

    /activation of PKC and by mutational disruption of the proposed PKC-phosphorylation sites. Cx30 hemichannel activity, in contrast, was down-regulated by PKC activation, in a manner suggesting PKC-mediated channel closure. No single PKC consensus site could be assigned to this regulatory property by mutational...

  8. Laminar shear stress modulates endothelial luminal surface stiffness in a tissue-specific manner.

    Science.gov (United States)

    Merna, Nick; Wong, Andrew K; Barahona, Victor; Llanos, Pierre; Kunar, Balvir; Palikuqi, Brisa; Ginsberg, Michael; Rafii, Shahin; Rabbany, Sina Y

    2018-04-17

    Endothelial cells form vascular beds in all organs and are exposed to a range of mechanical forces that regulate cellular phenotype. We sought to determine the role of endothelial luminal surface stiffness in tissue-specific mechanotransduction of laminar shear stress in microvascular mouse cells and the role of arachidonic acid in mediating this response. Microvascular mouse endothelial cells were subjected to laminar shear stress at 4 dynes/cm 2 for 12 hours in parallel plate flow chambers that enabled real-time optical microscopy and atomic force microscopy measurements of cell stiffness. Lung endothelial cells aligned parallel to flow, while cardiac endothelial cells did not. This rapid alignment was accompanied by increased cell stiffness. The addition of arachidonic acid to cardiac endothelial cells increased alignment and stiffness in response to shear stress. Inhibition of arachidonic acid in lung endothelial cells and embryonic stem cell-derived endothelial cells prevented cellular alignment and decreased cell stiffness. Our findings suggest that increased endothelial luminal surface stiffness in microvascular cells may facilitate mechanotransduction and alignment in response to laminar shear stress. Furthermore, the arachidonic acid pathway may mediate this tissue-specific process. An improved understanding of this response will aid in the treatment of organ-specific vascular disease. © 2018 John Wiley & Sons Ltd.

  9. Variation in extracellular matrix genes is associated with weight regain after weight loss in a sex-specific manner

    DEFF Research Database (Denmark)

    Roumans, Nadia J T; Vink, Roel G; Gielen, Marij

    2015-01-01

    The extracellular matrix (ECM) of adipocytes is important for body weight regulation. Here, we investigated whether genetic variation in ECM-related genes is associated with weight regain among participants of the European DiOGenes study. Overweight and obese subjects (n = 469, 310 females, 159 m.......40-5.63). Concluding, variants of ECM genes are associated with weight regain after weight loss in a sex-specific manner....

  10. Aspartic protease activities of schistosomes cleave mammalian hemoglobins in a host-specific manner

    Directory of Open Access Journals (Sweden)

    Jeffrey W Koehler

    2007-02-01

    Full Text Available We examined the efficiency of digestion of hemoglobin from four mammalian species, human, cow, sheep, and horse by acidic extracts of mixed sex adults of Schistosoma japonicum and S. mansoni. Activity ascribable to aspartic protease(s from S. japonicum and S. mansoni cleaved human hemoglobin. In addition, aspartic protease activities from S. japonicum cleaved hemoglobin from bovine, sheep, and horse blood more efficiently than did the activity from extracts of S. mansoni. These findings support the hypothesis that substrate specificity of hemoglobin-degrading proteases employed by blood feeding helminth parasites influences parasite host species range; differences in amino acid sequences in key sites of the parasite proteases interact less or more efficiently with the hemoglobins of permissive or non-permissive hosts.

  11. Oxytocin Reduces Cocaine Cued Fos Activation in a Regionally Specific Manner

    Science.gov (United States)

    Leong, Kah-Chung; Freeman, Linnea R; Berini, Carole R; Ghee, Shannon M; See, Ronald E

    2017-01-01

    Abstract Background Oxytocin may be a possible treatment for multiple neuropsychiatric disorders, including cocaine addiction. Little is known about the site-specific effects of oxytocin on various drug addiction-related brain regions. Furthermore, sexually dimorphic effects of oxytocin on neural function in the addiction circuit have not been established. Here, we studied Fos expression following cocaine-cued reinstatement in both male and female rats. Methods Male and female rats underwent self-administration, extinction, and reinstatement tests. On test days, rats were given oxytocin or vehicle, and lever pressing was measured in response to conditioned cocaine cues. Rats were perfused and Fos staining measured in the central amygdala, medial prefrontal cortex, nucleus accumbens core, and subthalamic nucleus. Fos/oxytocin double labeling occurred in the paraventricular nucleus of the hypothalamus. Results Rats reinstated to cocaine cues relative to extinction responding and oxytocin reduced cocaine seeking. Oxytocin combined with contingent cue presentations increased Fos+ oxytocin cell bodies within the paraventricular nucleus of the hypothalamus relative to vehicle. Fos expression robustly increased in the central amygdala following oxytocin administration. Oxytocin reversed cue-induced Fos expression in the medial prefrontal cortex, nucleus accumbens core, and subthalamic nucleus. Central oxytocin infusion also attenuated reinstated cocaine seeking. Conclusions Oxytocin decreased reinstated cocaine seeking, increased Fos activation in the paraventricular nucleus of the hypothalamus and central amygdala, but normalized cue-induced Fos activation in the medial prefrontal cortex, nucleus accumbens core, and subthalamic nucleus, thereby demonstrating regionally specific activation patterns. No sex differences were seen for the effects of oxytocin on cocaine seeking and Fos activation, indicating that oxytocin acts on similar central neural circuits critical to

  12. Competitive interactions are mediated in a sex-specific manner by arbuscular mycorrhiza in Antennaria dioica.

    Science.gov (United States)

    Varga, S; Vega-Frutis, R; Kytöviita, M-M

    2017-03-01

    Plants usually interact with other plants, and the outcome of such interaction ranges from facilitation to competition depending on the identity of the plants, including their sexual expression. Arbuscular mycorrhizal (AM) fungi have been shown to modify competitive interactions in plants. However, few studies have evaluated how AM fungi influence plant intraspecific and interspecific interactions in dioecious species. The competitive abilities of female and male plants of Antennaria dioica were examined in a greenhouse experiment. Females and males were grown in the following competitive settings: (i) without competition, (ii) with intrasexual competition, (iii) with intersexual competition, and (iv) with interspecific competition by Hieracium pilosella - a plant with similar characteristics to A. dioica. Half of the pots were grown with Claroideoglomus claroideum, an AM fungus isolated from the same habitat as the plant material. We evaluated plant survival, growth, flowering phenology, and production of AM fungal structures. Plant survival was unaffected by competition or AM fungi. Competition and the presence of AM fungi reduced plant biomass. However, the sexes responded differently to the interaction between fungal and competition treatments. Both intra- and interspecific competition results were sex-specific, and in general, female performance was reduced by AM colonization. Plant competition or sex did not affect the intraradical structures, extraradical hyphae, or spore production of the AM fungus. These findings suggest that plant sexual differences affect fundamental processes such as competitive ability and symbiotic relationships with AM fungi. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.

  13. Anti-aging drugs reduce hypothalamic inflammation in a sex-specific manner.

    Science.gov (United States)

    Sadagurski, Marianna; Cady, Gillian; Miller, Richard A

    2017-08-01

    Aging leads to hypothalamic inflammation, but does so more slowly in mice whose lifespan has been extended by mutations that affect GH/IGF-1 signals. Early-life exposure to GH by injection, or to nutrient restriction in the first 3 weeks of life, also modulate both lifespan and the pace of hypothalamic inflammation. Three drugs extend lifespan of UM-HET3 mice in a sex-specific way: acarbose (ACA), 17-α-estradiol (17αE2), and nordihydroguaiaretic acid (NDGA), with more dramatic longevity increases in males in each case. In this study, we examined the effect of these anti-aging drugs on neuro-inflammation in hypothalamus and hippocampus. We found that age-associated hypothalamic inflammation is reduced in males but not in females at 12 months of age by ACA and 17αE2 and at 22 months of age in NDGA-treated mice. The three drugs blocked indices of hypothalamic reactive gliosis associated with aging, such as Iba-1-positive microglia and GFAP-positive astrocytes, as well as age-associated overproduction of TNF-α. This effect was not observed in drug-treated female mice or in the hippocampus of the drug-treated animals. On the other hand, caloric restriction (CR; an intervention that extends the lifespan in both sexes) significantly reduced hypothalamic microglia and TNF-α in both sexes at 12 months of age. Together, these results suggest that the extent of drug-induced changes in hypothalamic inflammatory processes is sexually dimorphic in a pattern that parallels the effects of these agents on mouse longevity and that mimics the changes seen, in both sexes, of long-lived nutrient restricted or mutant mice. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  14. Serum IGF-1 affects skeletal acquisition in a temporal and compartment-specific manner.

    Directory of Open Access Journals (Sweden)

    Hayden-William Courtland

    2011-03-01

    Full Text Available Insulin-like growth factor-1 (IGF-1 plays a critical role in the development of the growing skeleton by establishing both longitudinal and transverse bone accrual. IGF-1 has also been implicated in the maintenance of bone mass during late adulthood and aging, as decreases in serum IGF-1 levels appear to correlate with decreases in bone mineral density (BMD. Although informative, mouse models to date have been unable to separate the temporal effects of IGF-1 depletion on skeletal development. To address this problem, we performed a skeletal characterization of the inducible LID mouse (iLID, in which serum IGF-1 levels are depleted at selected ages. We found that depletion of serum IGF-1 in male iLID mice prior to adulthood (4 weeks decreased trabecular bone architecture and significantly reduced transverse cortical bone properties (Ct.Ar, Ct.Th by 16 weeks (adulthood. Likewise, depletion of serum IGF-1 in iLID males at 8 weeks of age, resulted in significantly reduced transverse cortical bone properties (Ct.Ar, Ct.Th by 32 weeks (late adulthood, but had no effect on trabecular bone architecture. In contrast, depletion of serum IGF-1 after peak bone acquisition (at 16 weeks resulted in enhancement of trabecular bone architecture, but no significant changes in cortical bone properties by 32 weeks as compared to controls. These results indicate that while serum IGF-1 is essential for bone accrual during the postnatal growth phase, depletion of IGF-1 after peak bone acquisition (16 weeks is compartment-specific and does not have a detrimental effect on cortical bone mass in the older adult mouse.

  15. Self-Regulatory Capacities Are Depleted in a Domain-Specific Manner.

    Science.gov (United States)

    Zhang, Rui; Stock, Ann-Kathrin; Rzepus, Anneka; Beste, Christian

    2017-01-01

    Performing an act of self-regulation such as making decisions has been suggested to deplete a common limited resource, which impairs all subsequent self-regulatory actions (ego depletion theory). It has however remained unclear whether self-referred decisions truly impair behavioral control even in seemingly unrelated cognitive domains, and which neurophysiological mechanisms are affected by these potential depletion effects. In the current study, we therefore used an inter-individual design to compare two kinds of depletion, namely a self-referred choice-based depletion and a categorization-based switching depletion, to a non-depleted control group. We used a backward inhibition (BI) paradigm to assess the effects of depletion on task switching and associated inhibition processes. It was combined with EEG and source localization techniques to assess both behavioral and neurophysiological depletion effects. The results challenge the ego depletion theory in its current form: Opposing the theory's prediction of a general limited resource, which should have yielded comparable effects in both depletion groups, or maybe even a larger depletion in the self-referred choice group, there were stronger performance impairments following a task domain-specific depletion (i.e., the switching-based depletion) than following a depletion based on self-referred choices. This suggests at least partly separate and independent resources for various cognitive control processes rather than just one joint resource for all self-regulation activities. The implications are crucial to consider for people making frequent far-reaching decisions e.g., in law or economy.

  16. Specific immunotherapy modifies allergen-specific CD4+ T cell responses in an epitope-dependent manner

    Science.gov (United States)

    Wambre, Erik; DeLong, Jonathan H.; James, Eddie A.; Torres-Chinn, Nadia; Pfützner, Wolfgang; Möbs, Christian; Durham, Stephen R.; Till, Stephen J.; Robinson, David; Kwok, William W.

    2014-01-01

    Background Understanding the mechanisms by which the immune system induces and controls allergic inflammation at the T cell epitope level is critical for the design of new allergy vaccine strategies. Objective To characterize allergen-specific T cell responses linked with allergy or peripheral tolerance and to determine how CD4+ T cell responses to individual allergen-derived epitopes change over allergen-specific immunotherapy (ASIT). Methods Timothy grass pollen (TGP) allergy was used as a model for studying grass pollen allergies. The breadth, magnitude, epitope hierarchy and phenotype of the DR04:01-restricted TGP-specific T cell responses in ten grass pollen allergic, five non-atopic and six allergy vaccine-treated individuals was determined using an ex vivo pMHCII-tetramer approach. Results CD4+ T cells in allergic individuals are directed to a broad range of TGP epitopes characterized by defined immunodominance hierarchy patterns and with distinct functional profiles that depend on the epitope recognized. Epitopes that are restricted specifically to either TH2 or TH1/TR1 responses were identified. ASIT was associated with preferential deletion of allergen-specific TH2 cells and without significant change in frequency of TH1/TR1 cells. Conclusions Preferential allergen-specific TH2-cells deletion after repeated high doses antigen stimulation can be another independent mechanism to restore tolerance to allergen during immunotherapy. PMID:24373351

  17. O-GlcNAcylation modulates PKA-CREB signaling in a manner specific to PKA catalytic subunit isoforms.

    Science.gov (United States)

    Jin, Nana; Ma, Denglei; Gu, Jianlan; Shi, Jianhua; Xu, Xiaotao; Iqbal, Khalid; Gong, Cheng-Xin; Liu, Fei; Chu, Dandan

    2018-02-26

    O-GlcNAcylation is a post-translational modification of proteins. Protein kinase A (PKA)-cAMP response element binding protein (CREB) signaling plays critical roles in multiple biological processes. Isoforms α and β of PKA catalytic subunit (PKAc) and CREB are modified by O-GlcNAcylation. In the present study, we determined the role of O-GlcNAcylation in PKAc isoform-specific CREB signaling. We found that up-regulation of O-GlcNAcylation enhanced CREB phosphorylation, but suppressed CREB expression in exogenous PKAc isoform-unspecific manner. PKAc isoforms affected exogenous expression of OGT or OGA and protein O-GlcNAcylation differently. Up-regulation of O-GlcNAcylation did not significantly affect net PKAcα-CREB signaling, but enhanced PKAcβ-CREB signaling. The role of O-GlcNAcylation in PKA-CREB signaling was desensitized by insulin treatment. This study suggests a role of O-GlcNAcylation in PKA-CREB signaling by affecting phosphorylation of CREB in a PKAc isoform-specific manner. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. ESTIMATION OF PROCESSES REALIZATION RISK AS A MANNER OF SAFETY MANAGEMENT IN THE INTEGRATED SYSTEMS

    Directory of Open Access Journals (Sweden)

    Tatiana Karkoszka

    2011-12-01

    Full Text Available Realization of quality, environmental and occupational health and safety policy using the proposed model of processes' integrated risk estimation leads to the improvement of the analyzed productive processes by the preventive and corrective actions, and in consequence - to their optimization from the point of view of products' quality and in the aspect of quality of environmental influence and occupational health and safety.

  19. ESTIMATION OF PROCESSES REALIZATION RISK AS A MANNER OF SAFETY MANAGEMENT IN THE INTEGRATED SYSTEMS

    Directory of Open Access Journals (Sweden)

    Tatiana Karkoszka

    2011-06-01

    Full Text Available Realization of quality, environmental and occupational health and safety policy using the proposed model of processes' integrated risk estimation leads to the improvement of the analyzed productive processes by the preventive and corrective actions, and in consequence - to their optimization from the point of view of products' quality and in the aspect of quality of environmental influence and occupational health and safety.

  20. Adiponectin receptor 2 is regulated by nutritional status, leptin and pregnancy in a tissue-specific manner.

    Science.gov (United States)

    González, Carmen Ruth; Caminos, Jorge Eduardo; Gallego, Rosalía; Tovar, Sulay; Vázquez, María Jesús; Garcés, María Fernanda; Lopez, Miguel; García-Caballero, Tomás; Tena-Sempere, Manuel; Nogueiras, Rubén; Diéguez, Carlos

    2010-01-12

    The aim of the present work was to study the regulation of circulating adiponectin levels and the expression of adiponectin receptor 2 (Adipo-R2) in several rat tissues in relation to fasting, leptin challenge, pregnancy, and chronic undernutrition. Using real-time PCR, we found Adipo-R2 mRNA expression in the liver, stomach, white and brown adipose tissues (WAT and BAT) of adult rats. Immunohistochemical studies confirmed protein expression in the same tissues. Adipo-R2 mRNA levels were decreased in liver after fasting, with no changes in the other tissues. Leptin decreased Adipo-R2 expression in liver and stomach, but increased its expression in WAT and BAT. Chronic caloric restriction in normal rats increased Adipo-R2 gene expression in stomach, while it decreased hepatic Adipo-R2 levels in pregnant rats. Using radioimmunoassay, we found that plasma adiponectin levels were diminished by fasting and leptin. Conversely, circulating adiponectin was increased in food-restricted rats, whereas its levels decreased in food-restricted pregnant rats by the end of gestation. In conclusion our findings provide the first evidence that (a) Adipo-R2 mRNA is regulated in a tissue-specific manner by fasting, but leptin is not responsible for those changes; (b) chronic caloric restriction in normal and pregnant rats also regulate Adipo-R2 mRNA in a tissue-specific manner; and (c) Adipo-R2 mRNA does not show a clear correlation with plasma adiponectin levels.

  1. Integrated flight/propulsion control - Subsystem specifications for performance

    Science.gov (United States)

    Neighbors, W. K.; Rock, Stephen M.

    1993-01-01

    A procedure is presented for calculating multiple subsystem specifications given a number of performance requirements on the integrated system. This procedure applies to problems where the control design must be performed in a partitioned manner. It is based on a structured singular value analysis, and generates specifications as magnitude bounds on subsystem uncertainties. The performance requirements should be provided in the form of bounds on transfer functions of the integrated system. This form allows the expression of model following, command tracking, and disturbance rejection requirements. The procedure is demonstrated on a STOVL aircraft design.

  2. Transgenic over-expression of YY1 induces pathologic cardiac hypertrophy in a sex-specific manner

    Science.gov (United States)

    Stauffer, Brian L.; Dockstader, Karen; Russell, Gloria; Hijmans, Jamie; Walker, Lisa; Cecil, Mackenzie; Demos-Davies, Kimberly; Medway, Allen; McKinsey, Timothy A.; Sucharov, Carmen C.

    2015-01-01

    YY1 can activate or repress transcription of various genes. In cardiac myocytes in culture YY1 has been shown to regulate expression of several genes involved in myocyte pathology. YY1 can also acutely protect the heart against detrimental changes in gene expression. In this study we show that cardiac over-expression of YY1 induces pathologic cardiac hypertrophy in male mice, measured by changes in gene expression and lower ejection fraction/fractional shortening. In contrast, female animals are protected against pathologic gene expression changes and cardiac dysfunction. Furthermore, we show that YY1 regulates, in a sex-specific manner, the expression of mammalian enable (Mena), a factor that regulates cytoskeletal actin dynamics and whose expression is increased in several models of cardiac pathology, and that Mena expression in humans with heart failure is sex-dependent. Finally, we show that sex differences in YY1 expression are also observed in human heart failure. In summary, this is the first work to show that YY1 has a sex-specific effect in the regulation of cardiac pathology. PMID:25935483

  3. Common inversion polymorphism at 17q21.31 affects expression of multiple genes in tissue-specific manner.

    Science.gov (United States)

    de Jong, Simone; Chepelev, Iouri; Janson, Esther; Strengman, Eric; van den Berg, Leonard H; Veldink, Jan H; Ophoff, Roel A

    2012-09-06

    Chromosome 17q21.31 contains a common inversion polymorphism of approximately 900 kb in populations with European ancestry. Two divergent MAPT haplotypes, H1 and H2 are described with distinct linkage disequilibrium patterns across the region reflecting the inversion status at this locus. The MAPT H1 haplotype has been associated with progressive supranuclear palsy, corticobasal degeneration, Parkinson's disease and Alzheimer's disease, while the H2 is linked to recurrent deletion events associated with the 17q21.31 microdeletion syndrome, a disease characterized by developmental delay and learning disability. In this study, we investigate the effect of the inversion on the expression of genes in the 17q21.31 region. We find the expression of several genes in and at the borders of the inversion to be affected; specific either to whole blood or different regions of the human brain. The H1 haplotype was found to be associated with an increased expression of LRRC37A4, PLEKH1M and MAPT. In contrast, a decreased expression of MGC57346, LRRC37A and CRHR1 was associated with H1. Studies thus far have focused on the expression of MAPT in the inversion region. However, our results show that the inversion status affects expression of other genes in the 17q21.31 region as well. Given the link between the inversion status and different neurological diseases, these genes may also be involved in disease pathology, possibly in a tissue-specific manner.

  4. An Aphid Effector Targets Trafficking Protein VPS52 in a Host-Specific Manner to Promote Virulence1[OPEN

    Science.gov (United States)

    2017-01-01

    Plant- and animal-feeding insects secrete saliva inside their hosts, containing effectors, which may promote nutrient release and suppress immunity. Although for plant pathogenic microbes it is well established that effectors target host proteins to modulate host cell processes and promote disease, the host cell targets of herbivorous insects remain elusive. Here, we show that the existing plant pathogenic microbe effector paradigm can be extended to herbivorous insects in that effector-target interactions inside host cells modify critical host processes to promote plant susceptibility. We showed that the effector Mp1 from Myzus persicae associates with the host Vacuolar Protein Sorting Associated Protein52 (VPS52). Using natural variants, we provide a strong link between effector virulence activity and association with VPS52, and show that the association is highly specific to M. persicae-host interactions. Also, coexpression of Mp1, but not Mp1-like variants, specifically with host VPS52s resulted in effector relocalization to vesicle-like structures that associate with prevacuolar compartments. We show that high VPS52 levels negatively impact virulence, and that aphids are able to reduce VPS52 levels during infestation, indicating that VPS52 is an important virulence target. Our work is an important step forward in understanding, at the molecular level, how a major agricultural pest promotes susceptibility during infestation of crop plants. We give evidence that an herbivorous insect employs effectors that interact with host proteins as part of an effective virulence strategy, and that these effectors likely function in a species-specific manner. PMID:28100451

  5. An Aphid Effector Targets Trafficking Protein VPS52 in a Host-Specific Manner to Promote Virulence.

    Science.gov (United States)

    Rodriguez, Patricia A; Escudero-Martinez, Carmen; Bos, Jorunn I B

    2017-03-01

    Plant- and animal-feeding insects secrete saliva inside their hosts, containing effectors, which may promote nutrient release and suppress immunity. Although for plant pathogenic microbes it is well established that effectors target host proteins to modulate host cell processes and promote disease, the host cell targets of herbivorous insects remain elusive. Here, we show that the existing plant pathogenic microbe effector paradigm can be extended to herbivorous insects in that effector-target interactions inside host cells modify critical host processes to promote plant susceptibility. We showed that the effector Mp1 from Myzus persicae associates with the host Vacuolar Protein Sorting Associated Protein52 (VPS52). Using natural variants, we provide a strong link between effector virulence activity and association with VPS52, and show that the association is highly specific to M persicae -host interactions. Also, coexpression of Mp1, but not Mp1-like variants, specifically with host VPS52s resulted in effector relocalization to vesicle-like structures that associate with prevacuolar compartments. We show that high VPS52 levels negatively impact virulence, and that aphids are able to reduce VPS52 levels during infestation, indicating that VPS52 is an important virulence target. Our work is an important step forward in understanding, at the molecular level, how a major agricultural pest promotes susceptibility during infestation of crop plants. We give evidence that an herbivorous insect employs effectors that interact with host proteins as part of an effective virulence strategy, and that these effectors likely function in a species-specific manner. © 2017 American Society of Plant Biologists. All Rights Reserved.

  6. Rhizoctonia solani and Bacterial Inoculants Stimulate Root Exudation of Antifungal Compounds in Lettuce in a Soil-Type Specific Manner

    Directory of Open Access Journals (Sweden)

    Saskia Windisch

    2017-06-01

    Full Text Available Previous studies conducted on a unique field site comprising three contrasting soils (diluvial sand DS, alluvial loam AL, loess loam LL under identical cropping history, demonstrated soil type-dependent differences in biocontrol efficiency against Rhizoctonia solani-induced bottom rot disease in lettuce by two bacterial inoculants (Pseudomonas jessenii RU47 and Serratia plymuthica 3Re-4-18. Disease severity declined in the order DS > AL > LL. These differences were confirmed under controlled conditions, using the same soils in minirhizotron experiments. Gas chromatography-mass spectrometry (GC-MS profiling of rhizosphere soil solutions revealed benzoic and lauric acids as antifungal compounds; previously identified in root exudates of lettuce. Pathogen inoculation and pre-inoculation with bacterial inoculants significantly increased the release of antifungal root exudates in a soil type-specific manner; with the highest absolute levels detected on the least-affected LL soil. Soil type-dependent differences were also recorded for the biocontrol effects of the two bacterial inoculants; showing the highest efficiency after double-inoculation on the AL soil. However, this was associated with a reduction of shoot growth and root hair development and a limited micronutrient status of the host plants. Obviously, disease severity and the expression of biocontrol effects are influenced by soil properties with potential impact on reproducibility of practical applications.

  7. Maternal exposure to environmental enrichment before and during gestation influences behaviour of rat offspring in a sex-specific manner.

    Science.gov (United States)

    Zuena, Anna Rita; Zinni, Manuela; Giuli, Chiara; Cinque, Carlo; Alemà, Giovanni Sebastiano; Giuliani, Alessandro; Catalani, Assia; Casolini, Paola; Cozzolino, Roberto

    2016-09-01

    The beneficial effects of Environmental Enrichment (EE) applied immediately after weaning or even in adulthood have been widely demonstrated. Less is known about the possible changes in behaviour and brain development of the progeny following the exposure of dams to EE. In order to further investigate this matter, female rats were reared in EE for 12weeks, from weaning until delivery. After having confirmed the presence of relevant behavioural effects of EE, both control and EE females underwent mating. Maternal behaviour was observed and male and female offspring were then administered a battery of behavioural test at different ages. EE mothers showed a decreased frequency of total nursing and, during the first 2days of lactation, an increase in licking/grooming behaviour. Maternal exposure to EE affected offspring behaviour in a sex-specific manner: social play behaviour and anxiety-like behaviour were increased in males but not in females and learning ability was improved only in females. As a general trend, maternal EE had a marked influence on motility in male and female offspring in both locomotor activity and swimming speed. Overall, this study highlights the importance of environmental stimulation, not only in the animals directly experiencing EE, but for their progeny too, opening the way to new hypothesis on the heritability mechanisms of behavioural traits. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Ketogenic diets improve behaviors associated with autism spectrum disorder in a sex-specific manner in the EL mouse.

    Science.gov (United States)

    Ruskin, David N; Fortin, Jessica A; Bisnauth, Subrina N; Masino, Susan A

    2017-01-01

    The core symptoms of autism spectrum disorder are poorly treated with current medications. Symptoms of autism spectrum disorder are frequently comorbid with a diagnosis of epilepsy and vice versa. Medically-supervised ketogenic diets are remarkably effective nonpharmacological treatments for epilepsy, even in drug-refractory cases. There is accumulating evidence that supports the efficacy of ketogenic diets in treating the core symptoms of autism spectrum disorders in animal models as well as limited reports of benefits in patients. This study tests the behavioral effects of ketogenic diet feeding in the EL mouse, a model with behavioral characteristics of autism spectrum disorder and comorbid epilepsy. Male and female EL mice were fed control diet or one of two ketogenic diet formulas ad libitum starting at 5weeks of age. Beginning at 8weeks of age, diet protocols continued and performance of each group on tests of sociability and repetitive behavior was assessed. A ketogenic diet improved behavioral characteristics of autism spectrum disorder in a sex- and test-specific manner; ketogenic diet never worsened relevant behaviors. Ketogenic diet feeding improved multiple measures of sociability and reduced repetitive behavior in female mice, with limited effects in males. Additional experiments in female mice showed that a less strict, more clinically-relevant diet formula was equally effective in improving sociability and reducing repetitive behavior. Taken together these results add to the growing number of studies suggesting that ketogenic and related diets may provide significant relief from the core symptoms of autism spectrum disorder, and suggest that in some cases there may be increased efficacy in females. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Knockdown of the fat mass and obesity gene disrupts cellular energy balance in a cell-type specific manner.

    Directory of Open Access Journals (Sweden)

    Ryan T Pitman

    Full Text Available Recent studies suggest that FTO variants strongly correlate with obesity and mainly influence energy intake with little effect on the basal metabolic rate. We suggest that FTO influences eating behavior by modulating intracellular energy levels and downstream signaling mechanisms which control energy intake and metabolism. Since FTO plays a particularly important role in adipocytes and in hypothalamic neurons, SH-SY5Y neuronal cells and 3T3-L1 adipocytes were used to understand how siRNA mediated knockdown of FTO expression alters cellular energy homeostasis. Cellular energy status was evaluated by measuring ATP levels using a luminescence assay and uptake of fluorescent glucose. FTO siRNA in SH-SY5Y cells mediated mRNA knockdown (-82%, increased ATP concentrations by up to 46% (P = 0.013 compared to controls, and decreased phosphorylation of AMPk and Akt in SH-SY5Y by -52% and -46% respectively as seen by immunoblotting. In contrast, FTO siRNA in 3T3-L1 cells decreased ATP concentration by -93% (p<0.0005, and increased AMPk and Akt phosphorylation by 204% and 70%, respectively suggesting that FTO mediates control of energy levels in a cell-type specific manner. Furthermore, glucose uptake was decreased in both SH-SY5Y (-51% p = 0.015 and 3T3-L1 cells (-30%, p = 0.0002. We also show that FTO knockdown decreases NPY mRNA expression in SH-SY5Y cells (-21% through upregulation of pSTAT3 (118%. These results provide important evidence that FTO-variant linked obesity may be associated with altered metabolic functions through activation of downstream metabolic mediators including AMPk.

  10. Synaptic dysbindin-1 reductions in schizophrenia occur in an isoform-specific manner indicating their subsynaptic location.

    Directory of Open Access Journals (Sweden)

    Konrad Talbot

    Full Text Available BACKGROUND: An increasing number of studies report associations between variation in DTNBP1, a top candidate gene in schizophrenia, and both the clinical symptoms of the disorder and its cognitive deficits. DTNBP1 encodes dysbindin-1, reduced levels of which have been found in synaptic fields of schizophrenia cases. This study determined whether such synaptic reductions are isoform-specific. METHODOLOGY/PRINCIPAL FINDINGS: Using Western blotting of tissue fractions, we first determined the synaptic localization of the three major dysbindin-1 isoforms (A, B, and C. All three were concentrated in synaptosomes of multiple brain areas, including auditory association cortices in the posterior half of the superior temporal gyrus (pSTG and the hippocampal formation (HF. Tests on the subsynaptic tissue fractions revealed that each isoform is predominantly, if not exclusively, associated with synaptic vesicles (dysbindin-1B or with postsynaptic densities (dysbindin-1A and -1C. Using Western blotting on pSTG (n = 15 and HF (n = 15 synaptosomal fractions from schizophrenia cases and their matched controls, we discovered that synaptic dysbindin-1 is reduced in an isoform-specific manner in schizophrenia without changes in levels of synaptophysin or PSD-95. In pSTG, about 92% of the schizophrenia cases displayed synaptic dysbindin-1A reductions averaging 48% (p = 0.0007 without alterations in other dysbindin-1 isoforms. In the HF, by contrast, schizophrenia cases displayed normal levels of synaptic dysbindin-1A, but 67% showed synaptic reductions in dysbindin-1B averaging 33% (p = 0.0256, while 80% showed synaptic reductions in dysbindin-1C averaging 35% (p = 0.0171. CONCLUSIONS/SIGNIFICANCE: Given the distinctive subsynaptic localization of dysbindin-1A, -1B, and -1C across brain regions, the observed pSTG reductions in dysbindin-1A are postsynaptic and may promote dendritic spine loss with consequent disruption of auditory information

  11. Cardiac myosin binding protein C phosphorylation affects cross-bridge cycle's elementary steps in a site-specific manner.

    Directory of Open Access Journals (Sweden)

    Li Wang

    Full Text Available Based on our recent finding that cardiac myosin binding protein C (cMyBP-C phosphorylation affects muscle contractility in a site-specific manner, we further studied the force per cross-bridge and the kinetic constants of the elementary steps in the six-state cross-bridge model in cMyBP-C mutated transgenic mice for better understanding of the influence of cMyBP-C phosphorylation on contractile functions. Papillary muscle fibres were dissected from cMyBP-C mutated mice of ADA (Ala273-Asp282-Ala302, DAD (Asp273-Ala282-Asp302, SAS (Ser273-Ala282-Ser302, and t/t (cMyBP-C null genotypes, and the results were compared to transgenic mice expressing wide-type (WT cMyBP-C. Sinusoidal analyses were performed with serial concentrations of ATP, phosphate (Pi, and ADP. Both t/t and DAD mutants significantly reduced active tension, force per cross-bridge, apparent rate constant (2πc, and the rate constant of cross-bridge detachment. In contrast to the weakened ATP binding and enhanced Pi and ADP release steps in t/t mice, DAD mice showed a decreased ADP release without affecting the ATP binding and the Pi release. ADA showed decreased ADP release, and slightly increased ATP binding and cross-bridge detachment steps, whereas SAS diminished the ATP binding step and accelerated the ADP release step. t/t has the broadest effects with changes in most elementary steps of the cross-bridge cycle, DAD mimics t/t to a large extent, and ADA and SAS predominantly affect the nucleotide binding steps. We conclude that the reduced tension production in DAD and t/t is the result of reduced force per cross-bridge, instead of the less number of strongly attached cross-bridges. We further conclude that cMyBP-C is an allosteric activator of myosin to increase cross-bridge force, and its phosphorylation status modulates the force, which is regulated by variety of protein kinases.

  12. Iron-Restricted Diet Affects Brain Ferritin Levels, Dopamine Metabolism and Cellular Prion Protein in a Region-Specific Manner

    Directory of Open Access Journals (Sweden)

    Jessica M. V. Pino

    2017-05-01

    disorders. Our findings show that nutritional iron deficiency produces these molecular alterations in a region-specific manner and provide new insight into the variety of molecular pathways that can lead to distinct neurological symptoms upon iron deficiency. Thus, adequate iron supplementation is essential for brain health and prevention of neurological diseases.

  13. Both the cutaneous sensation and phosphene perception are modulated in a frequency-specific manner during transcranial alternating current stimulation.

    Science.gov (United States)

    Turi, Zs; Ambrus, G G; Janacsek, K; Emmert, K; Hahn, L; Paulus, W; Antal, A

    2013-01-01

    Transcranial alternating current stimulation (tACS) is a non-invasive stimulation technique for shaping neuroplastic processes and possibly entraining ongoing neural oscillations in humans. Despite the growing number of studies using tACS, we know little about the procedural sensations caused by stimulation. In order to fill this gap, we explored the cutaneous sensation and phosphene perception during tACS. Twenty healthy participants took part in a randomized, single-blinded, sham-controlled study, where volunteers received short duration stimulation at 1.0 mA intensity between 2 to 250 Hz using the standard left motor cortex-contralateral supraorbital montage. We recorded the perception onset latency and the strength of the sensations assessed by visual rating scale as dependent variables. We found that tACS evoked both cutaneous sensation and phosphene perception in a frequency-dependent manner. Our results show that the most perceptible procedural sensations were induced in the beta and gamma frequency range, especially at 20 Hz, whereas minimal procedural sensations were indicated in the ripple range (140 and 250 Hz). We believe that our results provide a relevant insight into the procedural sensations caused by oscillatory currents, and will offer a basis for developing more sophisticated stimulation protocols and study designs for future investigations.

  14. RD53A Integrated Circuit Specifications

    OpenAIRE

    Garcia-Sciveres, Mauricio

    2015-01-01

    Specifications for the RD53 collaboration’s first engineering wafer run of an integrated circuit (IC) for hybrid pixel detector readout, called RD53A. RD53A is intended to demonstrate in a large format IC the suitability of the technology (including radiation tolerance), the stable low threshold operation, and the high hit and trigger rate capabilities, required for HL-LHC upgrades of ATLAS and CMS. The wafer scale production will permit the experiments to prototype bump bonding assembly with...

  15. Immortalisation with hTERT Impacts on Sulphated Glycosaminoglycan Secretion and Immunophenotype in a Variable and Cell Specific Manner.

    Directory of Open Access Journals (Sweden)

    Tina P Dale

    differentiation potential, was affected in a variable manner. As such, these cells are not a direct substitute for primary cells in cartilage regeneration research.

  16. Splenic B cells and antigen-specific B cells process anti-Ig in a similar manner

    International Nuclear Information System (INIS)

    Myers, C.D.; Vitetta, E.S.

    1989-01-01

    B lymphocytes can process and present antigen to T cells. However, the fate of native antigen after its binding to specific B cells, i.e., the intracellular events involved in the processing and recycling of the antigenic fragments to the cell surface for antigen presentation, are not well understood. In the present study, we demonstrate that murine B cells degrade anti-Ig molecules bound to their surface and release acid soluble fragments into the supernatant. We also demonstrate that the kinetics of this process are identical for anti-mu, anti-delta, and anti-light chain antibodies, indicating that both surface IgM and surface IgD are equally effective in binding antigen and directing its processing. We also describe the effects of azide, chloroquine, and irradiation on this process. To extend these studies to the processing of specifically bound antigen, we demonstrate that highly purified trinitrophenyl antigen-binding cells degrade anti-Ig molecules with the same kinetics as unpurified splenic B cells. Thus, this purified population provides a suitable model system for the analysis of antigen degradation by antigen-specific cells

  17. vasa is expressed in somatic cells of the embryonic gonad in a sex-specific manner in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Andrew D. Renault

    2012-08-01

    Vasa is a DEAD box helicase expressed in the Drosophila germline at all stages of development. vasa homologs are found widely in animals and vasa has become the gene of choice in identifying germ cells. I now show that Drosophila vasa expression is not restricted to the germline but is also expressed in a somatic lineage, the embryonic somatic gonadal precursor cells. This expression is sexually dimorphic, being maintained specifically in males, and is regulated post-transcriptionally. Although somatic Vasa expression is not required for gonad coalescence, these data support the notion that Vasa is not solely a germline factor.

  18. vasa is expressed in somatic cells of the embryonic gonad in a sex-specific manner in Drosophila melanogaster.

    Science.gov (United States)

    Renault, Andrew D

    2012-10-15

    Vasa is a DEAD box helicase expressed in the Drosophila germline at all stages of development. vasa homologs are found widely in animals and vasa has become the gene of choice in identifying germ cells. I now show that Drosophila vasa expression is not restricted to the germline but is also expressed in a somatic lineage, the embryonic somatic gonadal precursor cells. This expression is sexually dimorphic, being maintained specifically in males, and is regulated post-transcriptionally. Although somatic Vasa expression is not required for gonad coalescence, these data support the notion that Vasa is not solely a germline factor.

  19. Antenatal glucocorticoid treatment alters Na+ uptake in renal proximal tubule cells from adult offspring in a sex-specific manner

    OpenAIRE

    Su, Yixin; Bi, Jianli; Pulgar, Victor M.; Figueroa, Jorge; Chappell, Mark; Rose, James C.

    2015-01-01

    We have shown a sex-specific effect of fetal programming on Na+ excretion in adult sheep. The site of this effect in the kidney is unknown. Therefore, we tested the hypothesis that renal proximal tubule cells (RPTCs) from adult male sheep exposed to betamethasone (Beta) before birth have greater Na+ uptake than do RPTCs from vehicle-exposed male sheep and that RPTCs from female sheep similarly exposed are not influenced by antenatal Beta. In isolated RPTCs from 1- to 1.5-yr-old male and femal...

  20. Low frequency vibrations induce malformations in two aquatic species in a frequency-, waveform-, and direction-specific manner.

    Directory of Open Access Journals (Sweden)

    Laura N Vandenberg

    Full Text Available Environmental toxicants such as industrial wastes, air particulates from machinery and transportation vehicles, and pesticide run-offs, as well as many chemicals, have been widely studied for their effects on human and wildlife populations. Yet other potentially harmful environmental pollutants such as electromagnetic pulses, noise and vibrations have remained incompletely understood. Because developing embryos undergo complex morphological changes that can be affected detrimentally by alterations in physical forces, they may be particularly susceptible to exposure to these types of pollutants. We investigated the effects of low frequency vibrations on early embryonic development of two aquatic species, Xenopus laevis (frogs and Danio rerio (zebrafish, specifically focusing on the effects of varying frequencies, waveforms, and applied direction. We observed treatment-specific effects on the incidence of neural tube defects, left-right patterning defects and abnormal tail morphogenesis in Xenopus tadpoles. Additionally, we found that low frequency vibrations altered left-right patterning and tail morphogenesis, but did not induce neural tube defects, in zebrafish. The results of this study support the conclusion that low frequency vibrations are toxic to aquatic vertebrates, with detrimental effects observed in two important model species with very different embryonic architectures.

  1. CYLD, a deubiquitinase specific for lysine63-linked polyubiquitins, accumulates at the postsynaptic density in an activity-dependent manner

    International Nuclear Information System (INIS)

    Dosemeci, Ayse; Thein, Soe; Yang, Yijung; Reese, Thomas S.; Tao-Cheng, Jung-Hwa

    2013-01-01

    Highlights: ► CYLD is a deubiquitinase specific for lysine63-linked polyubiquitins. ► Presence of CYLD in PSDs is established by biochemistry and immunoEM. ► CYLD accumulates on PSDs upon depolarization of neurons. ► Accumulation of CYLD at PSDs may regulate trafficking/degradation of synaptic proteins. -- Abstract: Polyubiquitin chains on proteins flag them for distinct fates depending on the type of polyubiquitin linkage. While lysine48-linked polyubiquitination directs proteins to proteasomal degradation, lysine63-linked polyubiquitination promotes different protein trafficking and is involved in autophagy. Here we show that postsynaptic density (PSD) fractions from adult rat brain contain deubiquitinase activity that targets both lysine48 and lysine63-linked polyubiquitins. Comparison of PSD fractions with parent subcellular fractions by Western immunoblotting reveals that CYLD, a deubiquitinase specific for lysine63-linked polyubiquitins, is highly enriched in the PSD fraction. Electron microscopic examination of hippocampal neurons in culture under basal conditions shows immunogold label for CYLD at the PSD complex in approximately one in four synapses. Following depolarization by exposure to high K+, the proportion of CYLD-labeled PSDs as well as the labeling intensity of CYLD at the PSD increased by more than eighty percent, indicating that neuronal activity promotes accumulation of CYLD at the PSD. An increase in postsynaptic CYLD following activity would promote removal of lysine63-polyubiquitins from PSD proteins and thus could regulate their trafficking and prevent their autophagic degradation.

  2. CYLD, a deubiquitinase specific for lysine63-linked polyubiquitins, accumulates at the postsynaptic density in an activity-dependent manner

    Energy Technology Data Exchange (ETDEWEB)

    Dosemeci, Ayse, E-mail: dosemeca@mail.nih.gov [Laboratory of Neurobiology, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD 20892 (United States); Thein, Soe; Yang, Yijung; Reese, Thomas S. [Laboratory of Neurobiology, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD 20892 (United States); Tao-Cheng, Jung-Hwa [EM Facility, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD 20892 (United States)

    2013-01-04

    Highlights: Black-Right-Pointing-Pointer CYLD is a deubiquitinase specific for lysine63-linked polyubiquitins. Black-Right-Pointing-Pointer Presence of CYLD in PSDs is established by biochemistry and immunoEM. Black-Right-Pointing-Pointer CYLD accumulates on PSDs upon depolarization of neurons. Black-Right-Pointing-Pointer Accumulation of CYLD at PSDs may regulate trafficking/degradation of synaptic proteins. -- Abstract: Polyubiquitin chains on proteins flag them for distinct fates depending on the type of polyubiquitin linkage. While lysine48-linked polyubiquitination directs proteins to proteasomal degradation, lysine63-linked polyubiquitination promotes different protein trafficking and is involved in autophagy. Here we show that postsynaptic density (PSD) fractions from adult rat brain contain deubiquitinase activity that targets both lysine48 and lysine63-linked polyubiquitins. Comparison of PSD fractions with parent subcellular fractions by Western immunoblotting reveals that CYLD, a deubiquitinase specific for lysine63-linked polyubiquitins, is highly enriched in the PSD fraction. Electron microscopic examination of hippocampal neurons in culture under basal conditions shows immunogold label for CYLD at the PSD complex in approximately one in four synapses. Following depolarization by exposure to high K+, the proportion of CYLD-labeled PSDs as well as the labeling intensity of CYLD at the PSD increased by more than eighty percent, indicating that neuronal activity promotes accumulation of CYLD at the PSD. An increase in postsynaptic CYLD following activity would promote removal of lysine63-polyubiquitins from PSD proteins and thus could regulate their trafficking and prevent their autophagic degradation.

  3. Specific nuclear localizing sequence directs two myosin isoforms to the cell nucleus in calmodulin-sensitive manner.

    Science.gov (United States)

    Dzijak, Rastislav; Yildirim, Sukriye; Kahle, Michal; Novák, Petr; Hnilicová, Jarmila; Venit, Tomáš; Hozák, Pavel

    2012-01-01

    Nuclear myosin I (NM1) was the first molecular motor identified in the cell nucleus. Together with nuclear actin, they participate in crucial nuclear events such as transcription, chromatin movements, and chromatin remodeling. NM1 is an isoform of myosin 1c (Myo1c) that was identified earlier and is known to act in the cytoplasm. NM1 differs from the "cytoplasmic" myosin 1c only by additional 16 amino acids at the N-terminus of the molecule. This amino acid stretch was therefore suggested to direct NM1 into the nucleus. We investigated the mechanism of nuclear import of NM1 in detail. Using over-expressed GFP chimeras encoding for truncated NM1 mutants, we identified a specific sequence that is necessary for its import to the nucleus. This novel nuclear localization sequence is placed within calmodulin-binding motif of NM1, thus it is present also in the Myo1c. We confirmed the presence of both isoforms in the nucleus by transfection of tagged NM1 and Myo1c constructs into cultured cells, and also by showing the presence of the endogenous Myo1c in purified nuclei of cells derived from knock-out mice lacking NM1. Using pull-down and co-immunoprecipitation assays we identified importin beta, importin 5 and importin 7 as nuclear transport receptors that bind NM1. Since the NLS sequence of NM1 lies within the region that also binds calmodulin we tested the influence of calmodulin on the localization of NM1. The presence of elevated levels of calmodulin interfered with nuclear localization of tagged NM1. We have shown that the novel specific NLS brings to the cell nucleus not only the "nuclear" isoform of myosin I (NM1 protein) but also its "cytoplasmic" isoform (Myo1c protein). This opens a new field for exploring functions of this molecular motor in nuclear processes, and for exploring the signals between cytoplasm and the nucleus.

  4. Brain aromatase and circulating corticosterone are rapidly regulated by combined acute stress and sexual interaction in a sex specific manner

    Science.gov (United States)

    Dickens, M.J.; Balthazart, J.; Cornil, C. A.

    2012-01-01

    Neural production of 17β-oestradiol via aromatisation of testosterone may play a critical role in rapid, non-genomic regulation of physiological and behavioural processes. In brain nuclei implicated in the control of sexual behaviour, sexual or stressfull stimuli induce respectively a rapid inhibition or increase in preoptic aromatase activity (AA). Here, we tested quail that were either non-stressed or acutely stressed (15 min restraint) immediately prior to sexual interaction (5 min) with stressed or non-stressed partners. We measured nuclei-specific AA changes, corresponding behavioural output, fertilisation rates and corticosterone (CORT) concentrations. In males, sexual interaction rapidly reversed stress-induced increases of AA in the medial preoptic nucleus (POM). This time scale (behaviour suggesting that the input from the sexual stimuli on POM AA may actively preserve sexual behaviour despite stress exposure. We also found distinct sex differences in contextual physiological responses: while males did not show any effect of partner status, females responded to both their stress exposure and the male partner’s stress exposure at the level of circulating CORT and AA. In addition, fertilisation rates and female CORT correlated with the male partner’s exhibition of sexually aggressive behaviour suggesting that female perception of the male can affect their physiology as much as direct stress. Overall, male reproduction appears relatively simple – sexual stimuli, irrespective of stress, drives major neural changes including rapid reversal of stress-induced changes of AA. In contrast, female reproduction appears more nuanced and context specific, with subjects responding physiologically and behaviourally to stress, the male partner’s stress exposure, and female-directed male behaviour. PMID:22612582

  5. Fruit metabolite networks in engineered and non-engineered tomato genotypes reveal fluidity in a hormone and agroecosystem specific manner.

    Science.gov (United States)

    Fatima, Tahira; Sobolev, Anatoly P; Teasdale, John R; Kramer, Matthew; Bunce, Jim; Handa, Avtar K; Mattoo, Autar K

    Metabolomics provides a view of endogenous metabolic patterns not only during plant growth, development and senescence but also in response to genetic events, environment and disease. The effects of the field environment on plant hormone-specific metabolite profiles are largely unknown. Few studies have analyzed useful phenotypes generated by introducing single or multiple gene events alongside the non-engineered wild type control at field scale to determine the robustness of the genetic trait and its modulation in the metabolome as a function of specific agroecosystem environments. We evaluated the influence of genetic background (high polyamine lines; low methyl jasmonate line; low ethylene line; and isogenic genotypes carrying double transgenic events) and environments (hairy vetch, rye, plastic black mulch and bare soil mulching systems) on the metabolomic profile of isogenic reverse genetic mutations and selected mulch based cropping systems in tomato fruit. Net photosynthesis and fruit yield were also determined. NMR spectroscopy was used for quantifying metabolites that are central to primary metabolism. We analyzed both the first moment (means) of metabolic response to genotypes and agroecosystems by traditional univariate/multivariate methods, and the second moment (covariances) of responses by creating networks that depicted changes in correlations of paired metabolites. This particular approach is novel and was necessary because our experimental material yielded highly variable metabolic responses that could not be easily understood using the traditional analytical approaches for first moment statistics. High endogenous spermidine and spermine content exhibited strong effects on amino acids, Krebs cycle intermediates and energy molecules (ADP + ATP) in ripening fruits of plants grown under different agroecosystem environments. The metabolic response to high polyamine genotypes was similar to the response to hairy vetch cover crop mulch; supported by

  6. Counterbalancing angiogenic regulatory factors control the rate of cancer progression and survival in a stage-specific manner.

    Science.gov (United States)

    Xie, Liang; Duncan, Michael B; Pahler, Jessica; Sugimoto, Hikaru; Martino, Margot; Lively, Julie; Mundel, Thomas; Soubasakos, Mary; Rubin, Kristofer; Takeda, Takaaki; Inoue, Masahiro; Lawler, Jack; Hynes, Richard O; Hanahan, Douglas; Kalluri, Raghu

    2011-06-14

    Whereas the roles of proangiogenic factors in carcinogenesis are well established, those of endogenous angiogenesis inhibitors (EAIs) remain to be fully elaborated. We investigated the roles of three EAIs during de novo tumorigenesis to further test the angiogenic balance hypothesis, which suggests that blood vessel development in the tumor microenvironment can be governed by a net loss of negative regulators of angiogenesis in addition to the well-established principle of up-regulated angiogenesis inducers. In a mouse model of pancreatic neuroendocrine cancer, administration of endostatin, thrombospondin-1, and tumstatin peptides, as well as deletion of their genes, reveal neoplastic stage-specific effects on angiogenesis, tumor progression, and survival, correlating with endothelial expression of their receptors. Deletion of tumstatin and thrombospondin-1 in mice lacking the p53 tumor suppressor gene leads to increased incidence and reduced latency of angiogenic lymphomas associated with diminished overall survival. The results demonstrate that EAIs are part of a balance mechanism regulating tumor angiogenesis, serving as intrinsic microenvironmental barriers to tumorigenesis.

  7. Electrotonic Coupling in the Pituitary Supports the Hypothalamic-Pituitary-Gonadal Axis in a Sex Specific Manner

    Directory of Open Access Journals (Sweden)

    Christina Göngrich

    2016-08-01

    Full Text Available Gap junctions are present in many cell types throughout the animal kingdom and allow fast intercellular electrical and chemical communication between neighboring cells. Connexin-36 (Cx36, the major neuronal gap junction protein, synchronizes cellular activity in the brain, but also in other organs. Here we identify a sex-specific role for Cx36 within the hypothalamic-pituitary-gonadal (HPG axis at the level of the anterior pituitary gland (AP. We show that Cx36 is expressed in gonadotropes of the AP sustaining their synchronous activity. Cx36 ablation affects the entire downstream HPG axis in females, but not in males. We demonstrate that Cx36-mediated coupling between gonadotropes in the AP supports gonadotropin-releasing hormone-induced secretion of luteinizing hormone. Furthermore, we provide evidence for negative feedback regulation of Cx36 expression in the AP by estradiol. We thus conclude that hormonally-controlled plasticity of gap junction communication at the level of the AP constitutes an additional mechanism affecting female reproduction.

  8. Plasma protein corona modulates the vascular wall interaction of drug carriers in a material and donor specific manner.

    Directory of Open Access Journals (Sweden)

    Daniel J Sobczynski

    Full Text Available The nanoscale plasma protein interaction with intravenously injected particulate carrier systems is known to modulate their organ distribution and clearance from the bloodstream. However, the role of this plasma protein interaction in prescribing the adhesion of carriers to the vascular wall remains relatively unknown. Here, we show that the adhesion of vascular-targeted poly(lactide-co-glycolic-acid (PLGA spheres to endothelial cells is significantly inhibited in human blood flow, with up to 90% reduction in adhesion observed relative to adhesion in simple buffer flow, depending on the particle size and the magnitude and pattern of blood flow. This reduced PLGA adhesion in blood flow is linked to the adsorption of certain high molecular weight plasma proteins on PLGA and is donor specific, where large reductions in particle adhesion in blood flow (>80% relative to buffer is seen with ∼60% of unique donor bloods while others exhibit moderate to no reductions. The depletion of high molecular weight immunoglobulins from plasma is shown to successfully restore PLGA vascular wall adhesion. The observed plasma protein effect on PLGA is likely due to material characteristics since the effect is not replicated with polystyrene or silica spheres. These particles effectively adhere to the endothelium at a higher level in blood over buffer flow. Overall, understanding how distinct plasma proteins modulate the vascular wall interaction of vascular-targeted carriers of different material characteristics would allow for the design of highly functional delivery vehicles for the treatment of many serious human diseases.

  9. Counterbalancing angiogenic regulatory factors control the rate of cancer progression and survival in a stage-specific manner

    Science.gov (United States)

    Xie, Liang; Duncan, Michael B.; Pahler, Jessica; Sugimoto, Hikaru; Martino, Margot; Lively, Julie; Mundel, Thomas; Soubasakos, Mary; Rubin, Kristofer; Takeda, Takaaki; Inoue, Masahiro; Lawler, Jack; Hynes, Richard O.; Hanahan, Douglas; Kalluri, Raghu

    2011-01-01

    Whereas the roles of proangiogenic factors in carcinogenesis are well established, those of endogenous angiogenesis inhibitors (EAIs) remain to be fully elaborated. We investigated the roles of three EAIs during de novo tumorigenesis to further test the angiogenic balance hypothesis, which suggests that blood vessel development in the tumor microenvironment can be governed by a net loss of negative regulators of angiogenesis in addition to the well-established principle of up-regulated angiogenesis inducers. In a mouse model of pancreatic neuroendocrine cancer, administration of endostatin, thrombospondin-1, and tumstatin peptides, as well as deletion of their genes, reveal neoplastic stage-specific effects on angiogenesis, tumor progression, and survival, correlating with endothelial expression of their receptors. Deletion of tumstatin and thrombospondin-1 in mice lacking the p53 tumor suppressor gene leads to increased incidence and reduced latency of angiogenic lymphomas associated with diminished overall survival. The results demonstrate that EAIs are part of a balance mechanism regulating tumor angiogenesis, serving as intrinsic microenvironmental barriers to tumorigenesis. PMID:21622854

  10. Dietary Quercetin Attenuates Adipose Tissue Expansion and Inflammation and Alters Adipocyte Morphology in a Tissue-Specific Manner

    Science.gov (United States)

    Forney, Laura A.; Lenard, Natalie R.; Stewart, Laura K.

    2018-01-01

    Chronic inflammation in adipose tissue may contribute to depot-specific adipose tissue expansion, leading to obesity and insulin resistance. Dietary supplementation with quercetin or botanical extracts containing quercetin attenuates high fat diet (HFD)-induced obesity and insulin resistance and decreases inflammation. Here, we determined the effects of quercetin and red onion extract (ROE) containing quercetin on subcutaneous (inguinal, IWAT) vs. visceral (epididymal, EWAT) white adipose tissue morphology and inflammation in mice fed low fat, high fat, high fat plus 50 μg/day quercetin or high fat plus ROE containing 50 μg/day quercetin equivalents for 9 weeks. Quercetin and ROE similarly ameliorated HFD-induced increases in adipocyte size and decreases in adipocyte number in IWAT and EWAT. Furthermore, quercetin and ROE induced alterations in adipocyte morphology in IWAT. Quercetin and ROE similarly decreased HFD-induced IWAT inflammation. However, quercetin and red onion differentially affected HFD-induced EWAT inflammation, with quercetin decreasing and REO increasing inflammatory marker gene expression. Quercetin and REO also differentially regulated circulating adipokine levels. These results show that quercetin or botanical extracts containing quercetin induce white adipose tissue remodeling which may occur through inflammatory-related mechanisms. PMID:29562620

  11. Dietary Quercetin Attenuates Adipose Tissue Expansion and Inflammation and Alters Adipocyte Morphology in a Tissue-Specific Manner

    Directory of Open Access Journals (Sweden)

    Laura A. Forney

    2018-03-01

    Full Text Available Chronic inflammation in adipose tissue may contribute to depot-specific adipose tissue expansion, leading to obesity and insulin resistance. Dietary supplementation with quercetin or botanical extracts containing quercetin attenuates high fat diet (HFD-induced obesity and insulin resistance and decreases inflammation. Here, we determined the effects of quercetin and red onion extract (ROE containing quercetin on subcutaneous (inguinal, IWAT vs. visceral (epididymal, EWAT white adipose tissue morphology and inflammation in mice fed low fat, high fat, high fat plus 50 μg/day quercetin or high fat plus ROE containing 50 μg/day quercetin equivalents for 9 weeks. Quercetin and ROE similarly ameliorated HFD-induced increases in adipocyte size and decreases in adipocyte number in IWAT and EWAT. Furthermore, quercetin and ROE induced alterations in adipocyte morphology in IWAT. Quercetin and ROE similarly decreased HFD-induced IWAT inflammation. However, quercetin and red onion differentially affected HFD-induced EWAT inflammation, with quercetin decreasing and REO increasing inflammatory marker gene expression. Quercetin and REO also differentially regulated circulating adipokine levels. These results show that quercetin or botanical extracts containing quercetin induce white adipose tissue remodeling which may occur through inflammatory-related mechanisms.

  12. Generation of Oxtr cDNA(HA)-Ires-Cre Mice for Gene Expression in an Oxytocin Receptor Specific Manner.

    Science.gov (United States)

    Hidema, Shizu; Fukuda, Tomokazu; Hiraoka, Yuichi; Mizukami, Hiroaki; Hayashi, Ryotaro; Otsuka, Ayano; Suzuki, Shingo; Miyazaki, Shinji; Nishimori, Katsuhiko

    2016-05-01

    The neurohypophysial hormone oxytocin (OXT) and its receptor (OXTR) have critical roles in the regulation of pro-social behaviors, including social recognition, pair bonding, parental behavior, and stress-related responses. Supporting this hypothesis, a portion of patients suffering from autism spectrum disorder have mutations, such as single nucleotide polymorphisms, or epigenetic modifications in their OXTR gene. We previously reported that OXTR-deficient mice exhibit pervasive social deficits, indicating the critical role of OXTR in social behaviors. In the present study, we generated Oxtr cDNA(HA)-Ires-Cre knock-in mice, expressing both OXTR and Cre recombinase under the control of the endogenous Oxtr promoter. Knock-in cassette of Oxtr cDNA(HA)-Ires-Cre consisted of Oxtr cDNA tagged with the hemagglutinin epitope at the 3' end (Oxtr cDNA(HA)), internal ribosomal entry site (Ires), and Cre. Cre was expressed in the uterus, mammary gland, kidney, and brain of Oxtr cDNA(HA)-Ires-Cre knock-in mice. Furthermore, the distribution of Cre in the brain was similar to that observed in Oxtr-Venus fluorescent protein expressing mice (Oxtr-Venus), another animal model previously generated by our group. Social behavior of Oxtr cDNA(HA)-Ires-Cre knock-in mice was similar to that of wild-type animals. We demonstrated that this construct is expressed in OXTR-expressing neurons specifically after an infection with the recombinant adeno-associated virus carrying the flip-excision switch vector. Using this system, we showed the transport of the wheat-germ agglutinin tracing molecule from the OXTR-expressing neurons to the innervated neurons in knock-in mice. This study might contribute to the monosynaptic analysis of neuronal circuits and to the optogenetic analysis of neurons expressing OXTR. © 2015 Wiley Periodicals, Inc.

  13. Simple ortho- and para-hydroquinones as compounds neuroprotective against oxidative stress in a manner associated with specific transcriptional activation

    International Nuclear Information System (INIS)

    Satoh, Takumi; Saitoh, Sachie; Hosaka, Manami; Kosaka, Kunio

    2009-01-01

    Electrophilic compounds protect neurons through the activation of the Keap1/Nrf2 pathway and the induction of phase-2 enzymes [T. Satoh, S.A. Lipton, Redox regulation of neuronal survival by electrophilic compounds, Trends Neurosci. 30 (2007) 38-45; T. Satoh, S. Okamoto, J. Cui, Y. Watanabe, K. Furuta, M. Suzuki, K. Tohyama, S.A. Lipton, Activation of the Keap1/Nrf2 pathway for neuroprotection by electrophilic phase II inducers. Proc. Natl. Acad. Sci. USA 103 (2006) 768-773]. Hydroquinone-type electrophilic compounds such as tert-butyl hydroquinone (TBHQ) and carnosic acid (CA) have attracted special attention, because the oxidative conversion of 'hydroquinone' to 'quinone' is essential for the transcriptional activation of the above-mentioned enzymes [T. Satoh, K. Kosaka, K. Itoh, A. Kobayashi, M. Yamamoto, Y. Shimojo, C. Kitajima, J. Cui, J. Kamins, S. Okamoto, T. Shirasawa, S.A. Lipton, Carnosic acid, a catechol-type electrophilic compound, protect neurons both in vitro and in vivo through activation of the Keap1/Nrf2 pathway via S-alkylation of specific cysteine, J. Neurochem. 104 (2008) 1161-1131; A.D. Kraft, D.A. Johnson, J.A. Johnson, Nuclear factor E2-related factor 2-dependent antioxidant response element activation by tert-butylhydroquinone and sulforaphane occurring preferentially in astrocytes conditions neurons against oxidative insult, J. Neurosci. 24 (2004) 1101-1112]. In the present study, we examined the relationship between electrophilicity and the protective effects afforded by electrophilic compounds. Electrophilicity was assessed in terms of the ability of a compound to bind to a cysteine on bovine serum albumin, by which we found that neuroprotective hydroquinones [TBHQ (para-) and CA (ortho-)] had distinctive patterns of cysteine binding compared with other electrophilic compounds. Further, we found that isomers of simple ortho- and para-hydroquinones such as 2-methylhydroquinone (para-) and 4-methyl-catechol (ortho-) [not in abstract] had

  14. RD53A Integrated Circuit Specifications

    CERN Document Server

    Garcia-Sciveres, Mauricio

    2015-01-01

    Specifications for the RD53 collaboration’s first engineering wafer run of an integrated circuit (IC) for hybrid pixel detector readout, called RD53A. RD53A is intended to demonstrate in a large format IC the suitability of the technology (including radiation tolerance), the stable low threshold operation, and the high hit and trigger rate capabilities, required for HL-LHC upgrades of ATLAS and CMS. The wafer scale production will permit the experiments to prototype bump bonding assembly with realistic sensors in this new technology and to measure the performance of hybrid assemblies. RD53A is not intended to be a final production IC for use in an experiment, and will contain design variations for testing purposes, making the pixel matrix non-uniform.

  15. Maternal di-(2-ethylhexyl) phthalate exposure during pregnancy causes fetal growth restriction in a stage-specific but gender-independent manner.

    Science.gov (United States)

    Shen, Ru; Zhao, Ling-Li; Yu, Zhen; Zhang, Cheng; Chen, Yuan-Hua; Wang, Hua; Zhang, Zhi-Hui; Xu, De-Xiang

    2017-01-01

    Di (2-ethylhexyl) phthalate (DEHP) is male developmental toxicant that impairs testis development with reduced anogenital distance. The present study aimed to investigate whether maternal DEHP exposure during pregnancy causes intrauterine growth restriction (IUGR) in a gender-specific manner and to identify the critical window of DEHP-induced fetal IUGR. Pregnant mice were administered with DEHP (0, 50 or 200mg/kg) by gavage. Fetal IUGR was observed not only in males but also in females when litters were exposed to DEHP on gestational day (GD)0-GD17. Interestingly, fetal weight and crown-rump length were reduced, markedly in dams with DEHP on GD13-GD17, slightly in dams with on GD7-GD12, but not in dams with on GD0-GD6. Further analysis showed that maternal DEHP exposure on GD7-GD12 inhibited cell proliferation, lowered placental weight, and reduced blood sinusoid area in placental labyrinth layer. These results suggest that maternal DEHP exposure induces IUGR in a stage-specific but gender-independent manner. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Regulation of AKT phosphorylation at Ser473 and Thr308 by endoplasmic reticulum stress modulates substrate specificity in a severity dependent manner.

    Directory of Open Access Journals (Sweden)

    Hong Wa Yung

    2011-03-01

    Full Text Available Endoplasmic reticulum (ER stress is a common factor in the pathophysiology of diverse human diseases that are characterised by contrasting cellular behaviours, from proliferation in cancer to apoptosis in neurodegenerative disorders. Coincidently, dysregulation of AKT/PKB activity, which is the central regulator of cell growth, proliferation and survival, is often associated with the same diseases. Here, we demonstrate that ER stress modulates AKT substrate specificity in a severity-dependent manner, as shown by phospho-specific antibodies against known AKT targets. ER stress also reduces both total and phosphorylated AKT in a severity-dependent manner, without affecting activity of the upstream kinase PDK1. Normalisation to total AKT revealed that under ER stress phosphorylation of Thr308 is suppressed while that of Ser473 is increased. ER stress induces GRP78, and siRNA-mediated knock-down of GRP78 enhances phosphorylation at Ser473 by 3.6 fold, but not at Thr308. Substrate specificity is again altered. An in-situ proximity ligation assay revealed a physical interaction between GRP78 and AKT at the plasma membrane of cells following induction of ER stress. Staining was weak in cells with normal nuclear morphology but stronger in those displaying rounded, condensed nuclei. Co-immunoprecipitation of GRP78 and P-AKT(Ser473 confirmed the immuno-complex consists of non-phosphorylated AKT (Ser473 and Thr308. The interaction is likely specific as AKT did not bind to all molecular chaperones, and GRP78 did not bind to p70 S6 kinase. These findings provide one mechanistic explanation for how ER stress contributes to human pathologies demonstrating contrasting cell fates via modulation of AKT signalling.

  17. Regulation of AKT Phosphorylation at Ser473 and Thr308 by Endoplasmic Reticulum Stress Modulates Substrate Specificity in a Severity Dependent Manner

    Science.gov (United States)

    Yung, Hong Wa

    2011-01-01

    Endoplasmic reticulum (ER) stress is a common factor in the pathophysiology of diverse human diseases that are characterised by contrasting cellular behaviours, from proliferation in cancer to apoptosis in neurodegenerative disorders. Coincidently, dysregulation of AKT/PKB activity, which is the central regulator of cell growth, proliferation and survival, is often associated with the same diseases. Here, we demonstrate that ER stress modulates AKT substrate specificity in a severity-dependent manner, as shown by phospho-specific antibodies against known AKT targets. ER stress also reduces both total and phosphorylated AKT in a severity-dependent manner, without affecting activity of the upstream kinase PDK1. Normalisation to total AKT revealed that under ER stress phosphorylation of Thr308 is suppressed while that of Ser473 is increased. ER stress induces GRP78, and siRNA-mediated knock-down of GRP78 enhances phosphorylation at Ser473 by 3.6 fold, but not at Thr308. Substrate specificity is again altered. An in-situ proximity ligation assay revealed a physical interaction between GRP78 and AKT at the plasma membrane of cells following induction of ER stress. Staining was weak in cells with normal nuclear morphology but stronger in those displaying rounded, condensed nuclei. Co-immunoprecipitation of GRP78 and P-AKT(Ser473) confirmed the immuno-complex consists of non-phosphorylated AKT (Ser473 and Thr308). The interaction is likely specific as AKT did not bind to all molecular chaperones, and GRP78 did not bind to p70 S6 kinase. These findings provide one mechanistic explanation for how ER stress contributes to human pathologies demonstrating contrasting cell fates via modulation of AKT signalling. PMID:21445305

  18. A CNN-Specific Integrated Processor

    Directory of Open Access Journals (Sweden)

    Suleyman Malki

    2009-01-01

    Full Text Available Integrated Processors (IP are algorithm-specific cores that either by programming or by configuration can be re-used within many microelectronic systems. This paper looks at Cellular Neural Networks (CNN to become realized as IP. First current digital implementations are reviewed, and the memoryprocessor bandwidth issues are analyzed. Then a generic view is taken on the structure of the network, and a new intra-communication protocol based on rotating wheels is proposed. It is shown that this provides for guaranteed high-performance with a minimal network interface. The resulting node is small and supports multi-level CNN designs, giving the system a 30-fold increase in capacity compared to classical designs. As it facilitates multiple operations on a single image, and single operations on multiple images, with minimal access to the external image memory, balancing the internal and external data transfer requirements optimizes the system operation. In conventional digital CNN designs, the treatment of boundary nodes requires additional logic to handle the CNN value propagation scheme. In the new architecture, only a slight modification of the existing cells is necessary to model the boundary effect. A typical prototype for visual pattern recognition will house 4096 CNN cells with a 2% overhead for making it an IP.

  19. Double-stranded RNA interferes in a sequence-specific manner with the infection of representative members of the two viroid families

    International Nuclear Information System (INIS)

    Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo; Gago, Selma

    2008-01-01

    Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one of the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery

  20. High Gestational Folic Acid Supplementation Alters Expression of Imprinted and Candidate Autism Susceptibility Genes in a sex-Specific Manner in Mouse Offspring.

    Science.gov (United States)

    Barua, Subit; Kuizon, Salomon; Brown, W Ted; Junaid, Mohammed A

    2016-02-01

    Maternal nutrients play critical roles in modulating epigenetic events and exert long-term influences on the progeny's health. Folic acid (FA) supplementation during pregnancy has decreased the incidence of neural tube defects in newborns, but the influence of high doses of maternal FA supplementation on infants' brain development is unclear. The present study was aimed at investigating the effects of a high dose of gestational FA on the expression of genes in the cerebral hemispheres (CHs) of 1-day-old pups. One week prior to mating and throughout the entire period of gestation, female C57BL/6J mice were fed a diet, containing FA at either 2 mg/kg (control diet (CD)) or 20 mg/kg (high maternal folic acid (HMFA)). At postnatal day 1, pups from different dams were sacrificed and CH tissues were collected. Quantitative RT-PCR and Western blot analysis confirmed sex-specific alterations in the expression of several genes that modulate various cellular functions (P < 0.05) in pups from the HMFA group. Genomic DNA methylation analysis showed no difference in the level of overall methylation in pups from the HMFA group. These findings demonstrate that HMFA supplementation alters offsprings' CH gene expression in a sex-specific manner. These changes may influence infants' brain development.

  1. CELF family RNA-binding protein UNC-75 regulates two sets of mutually exclusive exons of the unc-32 gene in neuron-specific manners in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Hidehito Kuroyanagi

    Full Text Available An enormous number of alternative pre-mRNA splicing patterns in multicellular organisms are coordinately defined by a limited number of regulatory proteins and cis elements. Mutually exclusive alternative splicing should be strictly regulated and is a challenging model for elucidating regulation mechanisms. Here we provide models of the regulation of two sets of mutually exclusive exons, 4a-4c and 7a-7b, of the Caenorhabditis elegans uncoordinated (unc-32 gene, encoding the a subunit of V0 complex of vacuolar-type H(+-ATPases. We visualize selection patterns of exon 4 and exon 7 in vivo by utilizing a trio and a pair of symmetric fluorescence splicing reporter minigenes, respectively, to demonstrate that they are regulated in tissue-specific manners. Genetic analyses reveal that RBFOX family RNA-binding proteins ASD-1 and FOX-1 and a UGCAUG stretch in intron 7b are involved in the neuron-specific selection of exon 7a. Through further forward genetic screening, we identify UNC-75, a neuron-specific CELF family RNA-binding protein of unknown function, as an essential regulator for the exon 7a selection. Electrophoretic mobility shift assays specify a short fragment in intron 7a as the recognition site for UNC-75 and demonstrate that UNC-75 specifically binds via its three RNA recognition motifs to the element including a UUGUUGUGUUGU stretch. The UUGUUGUGUUGU stretch in the reporter minigenes is actually required for the selection of exon 7a in the nervous system. We compare the amounts of partially spliced RNAs in the wild-type and unc-75 mutant backgrounds and raise a model for the mutually exclusive selection of unc-32 exon 7 by the RBFOX family and UNC-75. The neuron-specific selection of unc-32 exon 4b is also regulated by UNC-75 and the unc-75 mutation suppresses the Unc phenotype of the exon-4b-specific allele of unc-32 mutants. Taken together, UNC-75 is the neuron-specific splicing factor and regulates both sets of the mutually exclusive

  2. Intracellular high mobility group B1 protein (HMGB1) represses HIV-1 LTR-directed transcription in a promoter- and cell-specific manner

    International Nuclear Information System (INIS)

    Naghavi, Mojgan H.; Nowak, Piotr; Andersson, Jan; Soennerborg, Anders; Yang Huan; Tracey, Kevin J.; Vahlne, Anders

    2003-01-01

    We investigated whether the high mobility group B 1 (HMGB1), an abundant nuclear protein in all mammalian cells, affects HIV-1 transcription. Intracellular expression of human HMGB1 repressed HIV-1 gene expression in epithelial cells. This inhibitory effect of HMGB1 was caused by repression of long terminal repeat (LTR)-mediated transcription. Other viral promoters/enhancers, including simian virus 40 or cytomegalovirus, were not inhibited by HMGB1. In addition, HMGB1 inhibition of HIV-1 subtype C expression was dependent on the number of NFκB sites in the LTR region. The inhibitory effect of HMGB1 on viral gene expression observed in HeLa cells was confirmed by an upregulation of viral replication in the presence of antisense HMGB1 in monocytic cells. In contrast to what was found in HeLa cells and monocytic cells, endogenous HMGB1 expression did not affect HIV-1 replication in unstimulated Jurkat cells. Thus, intracellular HMGB1 affects HIV-1 LTR-directed transcription in a promoter- and cell-specific manner

  3. Localized sequence-specific release of a chemopreventive agent and an anticancer drug in a time-controllable manner to enhance therapeutic efficacy.

    Science.gov (United States)

    Pan, Wen-Yu; Lin, Kun-Ju; Huang, Chieh-Cheng; Chiang, Wei-Lun; Lin, Yu-Jung; Lin, Wei-Chih; Chuang, Er-Yuan; Chang, Yen; Sung, Hsing-Wen

    2016-09-01

    Combination chemotherapy with multiple drugs commonly requires several injections on various schedules, and the probability that the drug molecules reach the diseased tissues at the proper time and effective therapeutic concentrations is very low. This work elucidates an injectable co-delivery system that is based on cationic liposomes that are adsorbed on anionic hollow microspheres (Lipos-HMs) via electrostatic interaction, from which the localized sequence-specific release of a chemopreventive agent (1,25(OH)2D3) and an anticancer drug (doxorubicin; DOX) can be thermally driven in a time-controllable manner by an externally applied high-frequency magnetic field (HFMF). Lipos-HMs can greatly promote the accumulation of reactive oxygen species (ROS) in tumor cells by reducing their cytoplasmic expression of an antioxidant enzyme (superoxide dismutase) by 1,25(OH)2D3, increasing the susceptibility of cancer cells to the cytotoxic action of DOX. In nude mice that bear xenograft tumors, treatment with Lipos-HMs under exposure to HFMF effectively inhibits tumor growth and is the most effective therapeutic intervention among all the investigated. These empirical results demonstrate that the synergistic anticancer effects of sequential release of 1,25(OH)2D3 and DOX from the Lipos-HMs may have potential for maximizing DOX cytotoxicity, supporting more effective cancer treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Nbn and atm cooperate in a tissue and developmental stage-specific manner to prevent double strand breaks and apoptosis in developing brain and eye.

    Directory of Open Access Journals (Sweden)

    Paulo M G Rodrigues

    Full Text Available Nibrin (NBN or NBS1 and ATM are key factors for DNA Double Strand Break (DSB signaling and repair. Mutations in NBN or ATM result in Nijmegen Breakage Syndrome and Ataxia telangiectasia. These syndromes share common features such as radiosensitivity, neurological developmental defects and cancer predisposition. However, the functional synergy of Nbn and Atm in different tissues and developmental stages is not yet understood. Here, we show in vivo consequences of conditional inactivation of both genes in neural stem/progenitor cells using Nestin-Cre mice. Genetic inactivation of Atm in the central nervous system of Nbn-deficient mice led to reduced life span and increased DSBs, resulting in increased apoptosis during neural development. Surprisingly, the increase of DSBs and apoptosis was found only in few tissues including cerebellum, ganglionic eminences and lens. In sharp contrast, we showed that apoptosis associated with Nbn deletion was prevented by simultaneous inactivation of Atm in developing retina. Therefore, we propose that Nbn and Atm collaborate to prevent DSB accumulation and apoptosis during development in a tissue- and developmental stage-specific manner.

  5. The adipokinetic hormone receptor modulates sexual behavior, pheromone perception and pheromone production in a sex-specific and starvation-dependent manner in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Sebastien eLebreton

    2016-01-01

    Full Text Available Food availability and nutritional status shape the reproductive activity of many animals. In rodents, hormones such as gonadotropin-releasing hormone (GnRH, restore energy homeostasis not only through regulating e.g. caloric intake and energy housekeeping, but also through modulating sex drive. We investigated whether the insect homologue of the GnRH receptor, the adipokinetic hormone receptor (AKHR modulates sexual behavior of the fruit fly Drosophila melanogaster depending on nutritional status. We found that AKHR regulates male, but not female sexual behavior in a starvation-dependent manner. Males lacking AKHR showed a severe decrease in their courtship activity when starved, as well as an increase in mating duration when fed. AKHR expression is particularly strong in the subesophageal zone (SEZ, Ito et al. 2014. We found axonal projections from AKHR-expressing neurons to higher brain centers including specific glomeruli in the antennal lobe. Among the glomeruli that received projections were those dedicated to detecting the male specific pheromone cis-vaccenyl acetate (cVA. Accordingly, responses to cVA were dependent on the nutritional status of flies. AKHR was also involved in the regulation of the production of cuticular pheromones, 7,11-heptacosadiene and 7-tricosene. This effect was observed only in females and depended on their feeding state. AKHR has therefore a dual role on both pheromone perception and production. For the first time our study shows an effect of AKHR on insect sexual behavior and physiology. Our results support the hypothesis of a conserved role of the GnRH/AKH pathway on a nutritional state-dependent regulation of reproduction in both vertebrates and invertebrates.

  6. Insulin, IGF-1, and GH Receptors Are Altered in an Adipose Tissue Depot-Specific Manner in Male Mice With Modified GH Action.

    Science.gov (United States)

    Hjortebjerg, Rikke; Berryman, Darlene E; Comisford, Ross; Frank, Stuart J; List, Edward O; Bjerre, Mette; Frystyk, Jan; Kopchick, John J

    2017-05-01

    Growth hormone (GH) is a determinant of glucose homeostasis and adipose tissue (AT) function. Using 7-month-old transgenic mice expressing the bovine growth hormone (bGH) gene and growth hormone receptor knockout (GHR-/-) mice, we examined whether changes in GH action affect glucose, insulin, and pyruvate tolerance and AT expression of proteins involved in the interrelated signaling pathways of GH, insulinlike growth factor 1 (IGF-1), and insulin. Furthermore, we searched for AT depot-specific differences in control mice. Glycated hemoglobin levels were reduced in bGH and GHR-/- mice, and bGH mice displayed impaired gluconeogenesis as judged by pyruvate tolerance testing. Serum IGF-1 was elevated by 90% in bGH mice, whereas IGF-1 and insulin were reduced by 97% and 61% in GHR-/- mice, respectively. Igf1 RNA was increased in subcutaneous, epididymal, retroperitoneal, and brown adipose tissue (BAT) depots in bGH mice (mean increase ± standard error of the mean in all five depots, 153% ± 27%) and decreased in all depots in GHR-/- mice (mean decrease, 62% ± 4%). IGF-1 receptor expression was decreased in all AT depots of bGH mice (mean decrease, 49% ± 6%) and increased in all AT depots of GHR-/- mice (mean increase, 94% ± 8%). Insulin receptor expression was reduced in retroperitoneal, mesenteric, and BAT depots in bGH mice (mean decrease in all depots, 56% ± 4%) and augmented in subcutaneous, retroperitoneal, mesenteric, and BAT depots in GHR-/- mice (mean increase: 51% ± 1%). Collectively, our findings indicate a role for GH in influencing hormone signaling in AT in a depot-dependent manner. Copyright © 2017 Endocrine Society.

  7. Unique morphological changes in plant pathogenic phytoplasma-infected petunia flowers are related to transcriptional regulation of floral homeotic genes in an organ-specific manner.

    Science.gov (United States)

    Himeno, Misako; Neriya, Yutaro; Minato, Nami; Miura, Chihiro; Sugawara, Kyoko; Ishii, Yoshiko; Yamaji, Yasuyuki; Kakizawa, Shigeyuki; Oshima, Kenro; Namba, Shigetou

    2011-09-01

    Abnormal flowers are often induced by infection of certain plant pathogens, e.g. phytoplasma, but the molecular mechanisms underlying these malformations have remained poorly understood. Here, we show that infection with OY-W phytoplasma (Candidatus Phytoplasma asteris, onion yellows phytoplasma strain, line OY-W) affects the expression of the floral homeotic genes of petunia plants in an organ-specific manner. Upon infection with OY-W phytoplasma, floral morphological changes, including conversion to leaf-like structures, were observed in sepals, petals and pistils, but not in stamens. As the expression levels of homeotic genes differ greatly between floral organs, we examined the expression levels of homeotic genes in each floral organ infected by OY-W phytoplasma, compared with healthy plants. The expression levels of several homeotic genes required for organ development, such as PFG, PhGLO1 and FBP7, were significantly downregulated by the phytoplasma infection in floral organs, except the stamens, suggesting that the unique morphological changes caused by the phytoplasma infection might result from the significant decrease in expression of some crucial homeotic genes. Moreover, the expression levels of TER, ALF and DOT genes, which are known to participate in floral meristem identity, were significantly downregulated in the phytoplasma-infected petunia meristems, implying that phytoplasma would affect an upstream signaling pathway of floral meristem identity. Our results suggest that phytoplasma infection may have complex effects on floral development, resulting in the unique phenotypes that were clearly distinct from the mutant flower phenotypes produced by the knock-out or the overexpression of certain homeotic genes. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  8. Transdifferentiated rat pancreatic progenitor cells (AR42J-B13/H) respond to phenobarbital in a rat hepatocyte-specific manner.

    Science.gov (United States)

    Osborne, M; Haltalli, M; Currie, R; Wright, J; Gooderham, N J

    2016-07-01

    Phenobarbital (PB) is known to produce species-specific effects in the rat and mouse, being carcinogenic in certain mouse strains, but only in rats if treated after a DNA damaging event. PB treatment in the rat and mouse also produces disparate effects on cell signalling and miRNA expression profiles. These responses are induced by short term and prolonged PB exposure, respectively, with the latter treatments being difficult to examine mechanistically in primary hepatocytes due to rapid loss of the original hepatic phenotype and limited sustainability in culture. Here we explore the rat hepatocyte-like B13/H cell line as a model for hepatic response to PB exposure in both short-term and longer duration treatments. We demonstrate that PB with Egf treatment in the B13/H cells resulted in a significant increase in Erk activation, as determined by the ratio of phospho-Erk to total Erk, compared to Egf alone. We also show that an extended treatment with PB in the B13/H cells produces a miRNA response similar to that seen in the rat in vivo, via the time-dependent induction of miR-182/96. Additionally, we confirm that B13/H cells respond to Car activators in a typical rat-specific manner. These data suggest that the B13/H cells produce temporal responses to PB that are comparable to those reported in short-term primary rat hepatocyte cultures and in the longer term are similar to those in the rat in vivo. Finally, we also show that Car-associated miR-122 expression is decreased by PB treatment in B13/H cells, a PB-induced response that is common to the rat, mouse and human. We conclude that the B13/H cell system produces a qualitative response comparable to the rat, which is different to the response in the mouse, and that this model could be a useful tool for exploring the functional consequences of PB-sensitive miRNA changes and resistance to PB-mediated tumours in the rat. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  9. The cell-free integration of a polytopic mitochondrial membrane protein into liposomes occurs cotranslationally and in a lipid-dependent manner.

    Directory of Open Access Journals (Sweden)

    Ashley R Long

    Full Text Available The ADP/ATP Carrier (AAC is the most abundant transporter of the mitochondrial inner membrane. The central role that this transporter plays in cellular energy production highlights the importance of understanding its structure, function, and the basis of its pathologies. As a means of preparing proteoliposomes for the study of membrane proteins, several groups have explored the use of cell-free translation systems to facilitate membrane protein integration directly into preformed unilamellar vesicles without the use of surfactants. Using AAC as a model, we report for the first time the detergent-free reconstitution of a mitochondrial inner membrane protein into liposomes using a wheat germ-based in vitro translation system. Using a host of independent approaches, we demonstrate the efficient integration of AAC into vesicles with an inner membrane-mimetic lipid composition and, more importantly, that the integrated AAC is functionally active in transport. By adding liposomes at different stages of the translation reaction, we show that this direct integration is obligatorily cotranslational, and by synthesizing stable ribosome-bound nascent chain intermediates, we show that the nascent AAC polypeptide interacts with lipid vesicles while ribosome-bound. Finally, we show that the presence of the phospholipid cardiolipin in the liposomes specifically enhances AAC translation rate as well as the efficiency of vesicle association and integration. In light of these results, the possible mechanisms of liposome-assisted membrane protein integration during cell-free translation are discussed with respect to the mode of integration and the role of specific lipids.

  10. METCAM/MUC18 promoted tumorigenesis of human breast cancer SK-BR-3 cells in a dosage-specific manner.

    Science.gov (United States)

    Huang, Chang-Yu; Wu, Guang-Jer

    2016-04-01

    Overexpression of METCAM/MUC18, an immunoglobulin-like cell-adhesion molecule, promotes tumorigenesis and progression of human breast cancer cells. We also observed an intriguing phenomenon that a high-expressing SK-BR-3 clone manifested a transient tumor suppression effect in vivo. The purpose of this study was to understand if this was caused by clonal variation, METCAM/MUC18-dosage effect, or the number of cells injected. Several G418-resistant clones of SK-BR-3, expressing different levels of METCAM/MUC18, were obtained for testing effects of human METCAM/MUC18 on in vitro motility, invasiveness, and anchorage-independent colony formation (in vitro tumorigenicity) and in vivo tumorigenesis in female Balb/C athymic nude mice. Tumor sections were made for histology and immunohistochemistry analyses, and tumor lysates for Western blot analysis to determine the effects of human METCAM/MUC18 expression on levels of various downstream effectors. METCAM/MUC18 promoted in vitro motility, invasiveness, and in vitro tumorigenicity of SK-BR-3 cells in a dosage-specific manner. Overexpression of METCAM/MUC18 could promote in vivo tumorigenesis of SK-BR-3 cells even when one tenth of the previously used cell number (5 × 10(5)) was injected and in vivo tumorigenesis of SK-BR-3 cells was directly proportional to the dosage of the protein. The previously observed transient tumor suppression effect from the same clone was no longer observed. The downstream effector, such as phospho-AKT/AKT ratio, was elevated in the tumors. Transient suppression observed previously in the clone was caused by injection of a high cell number (2 × 10(6)-5 × 10(6)). METCAM/MUC18 positively promotes tumorigenesis of SK-BR-3 cells by increasing the survival and proliferation pathway. Copyright © 2016. Published by Elsevier B.V.

  11. Electrophysiological evidence for speech-specific audiovisual integration

    NARCIS (Netherlands)

    Baart, M.; Stekelenburg, J.J.; Vroomen, J.

    2014-01-01

    Lip-read speech is integrated with heard speech at various neural levels. Here, we investigated the extent to which lip-read induced modulations of the auditory N1 and P2 (measured with EEG) are indicative of speech-specific audiovisual integration, and we explored to what extent the ERPs were

  12. Speech-specificity of two audiovisual integration effects

    DEFF Research Database (Denmark)

    Eskelund, Kasper; Tuomainen, Jyrki; Andersen, Tobias

    2010-01-01

    Seeing the talker’s articulatory mouth movements can influence the auditory speech percept both in speech identification and detection tasks. Here we show that these audiovisual integration effects also occur for sine wave speech (SWS), which is an impoverished speech signal that naïve observers...... often fail to perceive as speech. While audiovisual integration in the identification task only occurred when observers were informed of the speech-like nature of SWS, integration occurred in the detection task both for informed and naïve observers. This shows that both speech-specific and general...... mechanisms underlie audiovisual integration of speech....

  13. Triiodothyronine regulates angiogenic growth factor and cytokine secretion by isolated human decidual cells in a cell-type specific and gestational age-dependent manner.

    Science.gov (United States)

    Vasilopoulou, E; Loubière, L S; Lash, G E; Ohizua, O; McCabe, C J; Franklyn, J A; Kilby, M D; Chan, S Y

    2014-06-01

    cell isolates were unaffected by T3 so changes in cell numbers could not account for any observed effects. In the first trimester, T3 decreased VEGF-A secretion by total decidual cells (P < 0.05) and increased angiopoietin-2 secretion by stromal-depleted cells (P < 0.05) but in the second trimester total decidual cells showed only increased angiogenin secretion (P < 0.05). In the first trimester, T3 reduced IL-10 secretion by total decidual cells (P < 0.05), and reduced granulocyte macrophage colony stimulating factor (P < 0.01), IL-8 (P < 0.05), IL-10 (P < 0.01), IL-1β (P < 0.05) and monocyte chemotactic protein -1 (P < 0.001) secretion by macrophages, but increased tumour necrosis factor-α secretion by stromal-depleted cells (P < 0.05) and increased IL-6 by uNK cells (P < 0.05). In contrast, in the second trimester T3 increased IL-10 secretion by total decidual cells (P < 0.01) but did not affect cytokine secretion by uNK cells and macrophages. Conditioned media from first trimester T3-treated total decidual cells and macrophages did not alter EVT invasion compared with untreated controls. Thus, treatment of decidual cells with T3 resulted in changes in both angiogenic growth factor and cytokine secretion in a cell type-specific and gestational age-dependent manner, with first trimester decidual macrophages being the most responsive to T3 treatment, but these changes in decidual cell secretome did not affect EVT invasion in vitro. Our results are based on in vitro findings and we cannot be certain if a similar response occurs in human pregnancy in vivo. Optimal maternal thyroid hormone concentrations could play a critical role in maintaining a balanced inflammatory response in early pregnancy to prevent fetal immune rejection and promote normal placental development through the regulation of the secretion of critical cytokines and angiogenic growth factors by human decidual cells. Our data suggest that there is an ontogenically determined regulatory 'switch' in T3

  14. Oligodeoxynucleotides Can Transiently Up- and Downregulate CHS Gene Expression in Flax by Changing DNA Methylation in a Sequence-Specific Manner

    Directory of Open Access Journals (Sweden)

    Magdalena Dzialo

    2017-05-01

    Full Text Available Chalcone synthase (CHS has been recognized as an essential enzyme in the phenylpropanoid biosynthesis pathway. Apart from the leading role in the production of phenolic compounds with many valuable biological activities beneficial to biomedicine, CHS is well appreciated in science. Genetic engineering greatly facilitates expanding knowledge on the function and genetics of CHS in plants. The CHS gene is one of the most intensively studied genes in flax. In our study, we investigated engineering of the CHS gene through genetic and epigenetic approaches. Considering the numerous restrictions concerning the application of genetically modified (GM crops, the main purpose of this research was optimization of the plant's modulation via epigenetics. In our study, plants modified through two methods were compared: a widely popular agrotransformation and a relatively recent oligodeoxynucleotide (ODN strategy. It was recently highlighted that the ODN technique can be a rapid and time-serving antecedent in quick analysis of gene function before taking vector-mediated transformation. In order to understand the molecular background of epigenetic variation in more detail and evaluate the use of ODNs as a tool for predictable and stable gene engineering, we concentrated on the integration of gene expression and gene-body methylation. The treatment of flax with a series of short oligonucleotides homologous to a different part of CHS gene isoforms revealed that those directed to regulatory gene regions (5′- and 3′-UTR activated gene expression, directed to non-coding region (introns caused gen activity reduction, while those homologous to a coding region may have a variable influence on its activity. Gene expression changes were accompanied by changes in its methylation status. However, only certain (CCGG motifs along the gene sequence were affected. The analyzed DNA motifs of the CHS flax gene are more accessible for methylation when located within a Cp

  15. An Integrated Framework to Specify Domain-Specific Modeling Languages

    DEFF Research Database (Denmark)

    Zarrin, Bahram; Baumeister, Hubert

    2018-01-01

    , a logic-based specification language. The drawback of MS DSL Tools is it does not provide a formal and rigorous approach for semantics specifications. In this framework, we use Microsoft DSL Tools to define the metamodel and graphical notations of DSLs, and an extended version of ForSpec as a formal......In this paper, we propose an integrated framework that can be used by DSL designers to implement their desired graphical domain-specific languages. This framework relies on Microsoft DSL Tools, a meta-modeling framework to build graphical domain-specific languages, and an extension of ForSpec...... language to define their semantics. Integrating these technologies under the umbrella of Microsoft Visual Studio IDE allows DSL designers to utilize a single development environment for developing their desired domain-specific languages....

  16. System specification for the integrated monitoring and surveillance system

    International Nuclear Information System (INIS)

    1997-09-01

    This System Specification establishes the requirements for the Plutonium Focus Area (PFA) Integrated Monitoring and Surveillance System (IMSS). In this document, ''Integrated Monitoring and Surveillance System'' is used to describe the concept of integrated sensors, computers, personnel, and systems that perform the functions of sensing conditions, acquiring data, monitoring environmental safety and health, controlling and accounting for materials, monitoring material stability, monitoring container integrity, transferring data, and analyzing, reporting, and storing data. This concept encompasses systems (e.g. sensors, personnel, databases, etc.) that are already in place at the sites but may require modifications or additions to meet all identified surveillance requirements. The purpose of this System Specification is to provide Department of Energy (DOE) sites that store plutonium materials with a consolidation of all known requirements for the storage and surveillance of 3013 packages of stabilized plutonium metals and oxides. This compilation may be used (1) as a baseline for surveillance system design specifications where 3013 packages of stabilized plutonium metals and oxides will be stored and monitored; (2) as a checklist for evaluating existing surveillance systems to ensure that all requirements are met for the storage and surveillance of 3013 packages of stabilized plutonium metals and oxides; and (3) as a baseline for preparing procurement specifications tailored for site specific storage and surveillance of 3013 packages of stabilized plutonium metals and oxides

  17. Multiloop Integral System Test (MIST): MIST Facility Functional Specification

    International Nuclear Information System (INIS)

    Habib, T.F.; Koksal, C.G.; Moskal, T.E.; Rush, G.C.; Gloudemans, J.R.

    1991-04-01

    The Multiloop Integral System Test (MIST) is part of a multiphase program started in 1983 to address small-break loss-of-coolant accidents (SBLOCAs) specific to Babcock and Wilcox designed plants. MIST is sponsored by the US Nuclear Regulatory Commission, the Babcock ampersand Wilcox Owners Group, the Electric Power Research Institute, and Babcock and Wilcox. The unique features of the Babcock and Wilcox design, specifically the hot leg U-bends and steam generators, prevented the use of existing integral system data or existing integral facilities to address the thermal-hydraulic SBLOCA questions. MIST was specifically designed and constructed for this program, and an existing facility -- the Once Through Integral System (OTIS) -- was also used. Data from MIST and OTIS are used to benchmark the adequacy of system codes, such as RELAP5 and TRAC, for predicting abnormal plant transients. The MIST Functional Specification documents as-built design features, dimensions, instrumentation, and test approach. It also presents the scaling basis for the facility and serves to define the scope of work for the facility design and construction. 13 refs., 112 figs., 38 tabs

  18. X-linked H3K27me3 demethylase Utx is required for embryonic development in a sex-specific manner

    NARCIS (Netherlands)

    Welstead, G.G.; Creyghton, M.P.; Bilodeau, S.; Cheng, A.W.; Markoulaki, S.; Young, R.A.; Jaenisch, R.

    2012-01-01

    Embryogenesis requires the timely and coordinated activation of developmental regulators. It has been suggested that the recently discovered class of histone demethylases (UTX and JMJD3) that specifically target the repressive H3K27me3 modification play an important role in the activation of

  19. Aberrant DNA Methylation in Human iPSCs Associates with MYC-Binding Motifs in a Clone-Specific Manner Independent of Genetics.

    Science.gov (United States)

    Panopoulos, Athanasia D; Smith, Erin N; Arias, Angelo D; Shepard, Peter J; Hishida, Yuriko; Modesto, Veronica; Diffenderfer, Kenneth E; Conner, Clay; Biggs, William; Sandoval, Efren; D'Antonio-Chronowska, Agnieszka; Berggren, W Travis; Izpisua Belmonte, Juan Carlos; Frazer, Kelly A

    2017-04-06

    Induced pluripotent stem cells (iPSCs) show variable methylation patterns between lines, some of which reflect aberrant differences relative to embryonic stem cells (ESCs). To examine whether this aberrant methylation results from genetic variation or non-genetic mechanisms, we generated human iPSCs from monozygotic twins to investigate how genetic background, clone, and passage number contribute. We found that aberrantly methylated CpGs are enriched in regulatory regions associated with MYC protein motifs and affect gene expression. We classified differentially methylated CpGs as being associated with genetic and/or non-genetic factors (clone and passage), and we found that aberrant methylation preferentially occurs at CpGs associated with clone-specific effects. We further found that clone-specific effects play a strong role in recurrent aberrant methylation at specific CpG sites across different studies. Our results argue that a non-genetic biological mechanism underlies aberrant methylation in iPSCs and that it is likely based on a probabilistic process involving MYC that takes place during or shortly after reprogramming. Published by Elsevier Inc.

  20. Differential presentation of endogenous and exogenous hepatitis B surface antigens influences priming of CD8(+) T cells in an epitope-specific manner.

    Science.gov (United States)

    Riedl, Petra; Reiser, Michael; Stifter, Katja; Krieger, Jana; Schirmbeck, Reinhold

    2014-07-01

    Little is known about whether presentation of endogenous and exogenous hepatitis B virus (HBV) surface antigens on APCs targeted by vaccination and/or virus-harboring hepatocytes influences de novo priming of CD8(+) T cells. We showed that surface antigen-expressing transfectants exclusively display a K(b) /S190 epitope, whereas cells pulsed with recombinant surface particles (rSPs) exclusively present a K(b) /S208 epitope to CD8(+) T cells. The differential presentation of these epitopes largely reflects the selective, but not exclusive, priming of K(b) /S190- and K(b) /S208-specific T cells in C57BL/6 mice by endogenous/DNA- or exogenous/protein-based vaccines, respectively. Silencing the K(b) /S190 epitope (K(b) /S190V194F ) in antigen-expressing vectors rescued the presentation of the K(b) /S208 epitope in stable transfectants and significantly enhanced priming of K(b) /S208-specific T cells in C57BL/6 mice. A K(b) /S190-mediated immunodominance operating in surface antigen-expressing cells, but not in rSP-pulsed cells, led to an efficient suppression in the presentation of the K(b) /S208 epitope and a consequent decrease in the priming of K(b) /S208-specific T cells. This K(b) /S190-mediated immunodominance also operated in 1.4HBV-S(mut) transgenic (tg) hepatocytes selectively expressing endogenous surface antigens and allowed priming of K(b) /S208- but not K(b) /S190-specific T cells in 1.4HBV-S(mut) tg mice. However, IFN-γ(+) K(b) /S208-specific T cells could not inhibit HBV replication in the liver of 1.4HBV-S(mut) tg mice. These results have practical implications for the design of T-cell-stimulating therapeutic vaccines. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Overexpression and cosuppression of xylem-related genes in an early xylem differentiation stage-specific manner by the AtTED4 promoter.

    Science.gov (United States)

    Endo, Satoshi; Iwamoto, Kuninori; Fukuda, Hiroo

    2018-02-01

    Tissue-specific overexpression of useful genes, which we can design according to their cause-and-effect relationships, often gives valuable gain-of-function phenotypes. To develop genetic tools in woody biomass engineering, we produced a collection of Arabidopsis lines that possess chimeric genes of a promoter of an early xylem differentiation stage-specific gene, Arabidopsis Tracheary Element Differentiation-related 4 (AtTED4) and late xylem development-associated genes, many of which are uncharacterized. The AtTED4 promoter directed the expected expression of transgenes in developing vascular tissues from young to mature stage. Of T2 lines examined, 42%, 49% and 9% were judged as lines with the nonrepeat type insertion, the simple repeat type insertion and the other repeat type insertion of transgenes. In 174 T3 lines, overexpression lines were confirmed for 37 genes, whereas only cosuppression lines were produced for eight genes. The AtTED4 promoter activity was high enough to overexpress a wide range of genes over wild-type expression levels, even though the wild-type expression is much higher than AtTED4 expression for several genes. As a typical example, we investigated phenotypes of pAtTED4::At5g60490 plants, in which both overexpression and cosuppression lines were included. Overexpression but not cosuppression lines showed accelerated xylem development, suggesting the positive role of At5g60490 in xylem development. Taken together, this study provides valuable results about behaviours of various genes expressed under an early xylem-specific promoter and about usefulness of their lines as genetic tools in woody biomass engineering. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  2. Bifidobacterium longum CCM 7952 Promotes Epithelial Barrier Function and Prevents Acute DSS-Induced Colitis in Strictly Strain-Specific Manner.

    Directory of Open Access Journals (Sweden)

    Dagmar Srutkova

    Full Text Available Reduced microbial diversity has been associated with inflammatory bowel disease (IBD and probiotic bacteria have been proposed for its prevention and/or treatment. Nevertheless, comparative studies of strains of the same subspecies for specific health benefits are scarce. Here we compared two Bifidobacterium longum ssp. longum strains for their capacity to prevent experimental colitis.Immunomodulatory properties of nine probiotic bifidobacteria were assessed by stimulation of murine splenocytes. The immune responses to B. longum ssp. longum CCM 7952 (Bl 7952 and CCDM 372 (Bl 372 were further characterized by stimulation of bone marrow-derived dendritic cell, HEK293/TLR2 or HEK293/NOD2 cells. A mouse model of dextran sulphate sodium (DSS-induced colitis was used to compare their beneficial effects in vivo.The nine bifidobacteria exhibited strain-specific abilities to induce cytokine production. Bl 372 induced higher levels of both pro- and anti-inflammatory cytokines in spleen and dendritic cell cultures compared to Bl 7952. Both strains engaged TLR2 and contain ligands for NOD2. In a mouse model of DSS-induced colitis, Bl 7952, but not Bl 372, reduced clinical symptoms and preserved expression of tight junction proteins. Importantly, Bl 7952 improved intestinal barrier function as demonstrated by reduced FITC-dextran levels in serum.We have shown that Bl 7952, but not Bl 372, protected mice from the development of experimental colitis. Our data suggest that although some immunomodulatory properties might be widespread among the genus Bifidobacterium, others may be rare and characteristic only for a specific strain. Therefore, careful selection might be crucial in providing beneficial outcome in clinical trials with probiotics in IBD.

  3. Specific and Complete Local Integration of Patterns in Bayesian Networks

    Directory of Open Access Journals (Sweden)

    Martin Biehl

    2017-05-01

    Full Text Available We present a first formal analysis of specific and complete local integration. Complete local integration was previously proposed as a criterion for detecting entities or wholes in distributed dynamical systems. Such entities in turn were conceived to form the basis of a theory of emergence of agents within dynamical systems. Here, we give a more thorough account of the underlying formal measures. The main contribution is the disintegration theorem which reveals a special role of completely locally integrated patterns (what we call ι-entities within the trajectories they occur in. Apart from proving this theorem we introduce the disintegration hierarchy and its refinement-free version as a way to structure the patterns in a trajectory. Furthermore, we construct the least upper bound and provide a candidate for the greatest lower bound of specific local integration. Finally, we calculate the ι -entities in small example systems as a first sanity check and find that ι -entities largely fulfil simple expectations.

  4. Brain aromatase and circulating corticosterone are rapidly regulated by combined acute stress and sexual interaction in a sex-specific manner.

    Science.gov (United States)

    Dickens, M J; Balthazart, J; Cornil, C A

    2012-10-01

    Neural production of 17β-oestradiol via aromatisation of testosterone may play a critical role in rapid, nongenomic regulation of physiological and behavioural processes. In brain nuclei implicated in the control of sexual behaviour, sexual or stressfull stimuli induce, respectively, a rapid inhibition or increase in preoptic aromatase activity (AA). In the present study, we tested quail that were either nonstressed or acutely stressed (15 min of restraint) immediately before sexual interaction (5 min) with stressed or nonstressed partners. We measured nuclei-specific AA changes, corresponding behavioural output, fertilisation rates and corticosterone (CORT) concentrations. In males, sexual interaction rapidly reversed stress-induced increases of AA in the medial preoptic nucleus (POM). This time scale (sexual stimuli on POM AA may actively preserve sexual behaviour despite stress exposure. We also found distinct sex differences in contextual physiological responses: males did not show any effect of partner status, whereas females responded to both their stress exposure and the male partner's stress exposure at the level of circulating CORT and AA. In addition, fertilisation rates and female CORT correlated with the male partner's exhibition of sexually aggressive behaviour, suggesting that female perception of the male can affect their physiology as much as direct stress. Overall, male reproduction appears relatively simple: sexual stimuli, irrespective of stress, drives major neural changes including rapid reversal of stress-induced changes of AA. By contrast, female reproduction appears more nuanced and context specific, with subjects responding physiologically and behaviourally to stress, the male partner's stress exposure, and female-directed male behaviour. © 2012 The Authors. Journal of Neuroendocrinology © 2012 British Society for Neuroendocrinology.

  5. High-voltage-activated calcium current subtypes in mouse DRG neurons adapt in a subpopulation-specific manner after nerve injury.

    Science.gov (United States)

    Murali, Swetha S; Napier, Ian A; Mohammadi, Sarasa A; Alewood, Paul F; Lewis, Richard J; Christie, MacDonald J

    2015-03-01

    Changes in ion channel function and expression are characteristic of neuropathic pain. Voltage-gated calcium channels (VGCCs) are integral for neurotransmission and membrane excitability, but relatively little is known about changes in their expression after nerve injury. In this study, we investigate whether peripheral nerve ligation is followed by changes in the density and proportion of high-voltage-activated (HVA) VGCC current subtypes in dorsal root ganglion (DRG) neurons, the contribution of presynaptic N-type calcium channels in evoked excitatory postsynaptic currents (EPSCs) recorded from dorsal horn neurons in the spinal cord, and the changes in expression of mRNA encoding VGCC subunits in DRG neurons. Using C57BL/6 mice [8- to 11-wk-old males (n = 91)] for partial sciatic nerve ligation or sham surgery, we performed whole cell patch-clamp recordings on isolated DRG neurons and dorsal horn neurons and measured the expression of all VGCC subunits with RT-PCR in DRG neurons. After nerve injury, the density of P/Q-type current was reduced overall in DRG neurons. There was an increase in the percentage of N-type and a decrease in that of P/Q-type current in medium- to large-diameter neurons. No changes were found in the contribution of presynaptic N-type calcium channels in evoked EPSCs recorded from dorsal horn neurons. The α2δ-1 subunit was upregulated by 1.7-fold and γ-3, γ-2, and β-4 subunits were all downregulated 1.7-fold in injured neurons compared with sham-operated neurons. This comprehensive characterization of HVA VGCC subtypes in mouse DRG neurons after nerve injury revealed changes in N- and P/Q-type current proportions only in medium- to large-diameter neurons. Copyright © 2015 the American Physiological Society.

  6. Prespacer processing and specific integration in a Type I-A CRISPR system

    Science.gov (United States)

    Rollie, Clare; Graham, Shirley; Rouillon, Christophe

    2018-01-01

    Abstract The CRISPR–Cas system for prokaryotic adaptive immunity provides RNA-mediated protection from viruses and mobile genetic elements. Adaptation is dependent on the Cas1 and Cas2 proteins along with varying accessory proteins. Here we analyse the process in Sulfolobus solfataricus, showing that while Cas1 and Cas2 catalyze spacer integration in vitro, host factors are required for specificity. Specific integration also requires at least 400 bp of the leader sequence, and is dependent on the presence of hydrolysable ATP, suggestive of an active process that may involve DNA remodelling. Specific spacer integration is associated with processing of prespacer 3′ ends in a PAM-dependent manner. This is reflected in PAM-dependent processing of prespacer 3′ ends in vitro in the presence of cell lysate or the Cas4 nuclease, in a reaction consistent with PAM-directed binding and protection of prespacer DNA. These results highlight the diverse interplay between CRISPR–Cas elements and host proteins across CRISPR types. PMID:29228332

  7. USER SPECIFICATIONS FOR PRESSURE VESSELS AND TECHNICAL INTEGRITY

    Directory of Open Access Journals (Sweden)

    K.S. Johnston

    2012-01-01

    Full Text Available

    ENGLISH ABSTRACT: Specifications translated from user requirements are prescribed in an attempt to capture and incorporate best practices with regards to the design, fabrication, testing, and operation of pressure vessels. The question as to whether these requirements affect the technical integrity of pressure vessels is often a subjective matter. This paper examines typical user requirement specifications against technical integrity of pressure vessels.
    The paper draws on a survey of a convenience sample of practising engineers in a diversified petrochemical company. When compared with failures on selected pressure vessels recorded by Phillips and Warwick, the respondent feedback confirms the user specifications that have the highest impact on technical integrity.

    AFRIKAANSE OPSOMMING: Gebruikersbehoeftes word saamgevat in spesifikasies wat lei tot goeie praktyk vir ontwerp, vervaarding, toetsing en bedryf van drukvate. Subjektiwiteit van die gebruikersbehoeftes mag soms die tegniese integriteit van ‘n drukvat beinvloed.
    Die navorsing maak by wyse van monsterneming gebruik van die kennis van ingenieurs wat werk in ‘n gediversifiseerde petrochemiese bedryf. Die terugvoering bevestig dat bogenoemde spesifikasies inderdaad die grootste invloed het op tegniese integriteit.

  8. Mind Your Manners

    Energy Technology Data Exchange (ETDEWEB)

    Wiley, H. S.

    2010-01-01

    There has been a lot of talk in the media about the loss of courtesy in modern society. By many criteria, it seems that people in general have lost a degree of politeness. Reading some of the online comments after several recent articles in The Scientist would seem to indicate that biologists have also lost their manners. This lack of basic manners alarms me not only because of the obvious danger to our sense of community, but also because this type of behavior could damage society’s positive perception of scientists. Every time scientists (or anonymous bloggers posing as scientists) rant about the idiocy of someone who disagrees with them, our collective credibility erodes. Yes, there are a number of issues that we as scientists should be passionate about, but our objectives are best served by retaining an objective demeanor and respecting those to whom we happen to disagree.

  9. The Cucumber vein yellowing virus silencing suppressor P1b can functionally replace HCPro in Plum pox virus infection in a host-specific manner.

    Science.gov (United States)

    Carbonell, Alberto; Dujovny, Gabriela; García, Juan Antonio; Valli, Adrian

    2012-02-01

    Plant viruses of the genera Potyvirus and Ipomovirus (Potyviridae family) use unrelated RNA silencing suppressors (RSS) to counteract antiviral RNA silencing responses. HCPro is the RSS of Potyvirus spp., and its activity is enhanced by the upstream P1 protein. Distinctively, the ipomovirus Cucumber vein yellowing virus (CVYV) lacks HCPro but contains two P1 copies in tandem (P1aP1b), the second of which functions as RSS. Using chimeras based on the potyvirus Plum pox virus (PPV), we found that P1b can functionally replace HCPro in potyviral infections of Nicotiana plants. Interestingly, P1a, the CVYV protein homologous to potyviral P1, disrupted the silencing suppression activity of P1b and reduced the infection efficiency of PPV in Nicotiana benthamiana. Testing the influence of RSS in host specificity, we found that a P1b-expressing chimera poorly infected PPV's natural host, Prunus persica. Conversely, P1b conferred on PPV chimeras the ability to replicate locally in cucumber, CVYV's natural host. The deleterious effect of P1a on PPV infection is host dependent, because the P1aP1b-expressing PPV chimera accumulated in cucumber to higher levels than PPV expressing P1b alone. These results demonstrate that a potyvirus can use different RSS, and that particular RSS and upstream P1-like proteins contribute to defining the virus host range.

  10. Fish oil supplementation from 9 to 18 months of age affects the insulin-like growth factor axis in a sex-specific manner in Danish infants

    DEFF Research Database (Denmark)

    Damsgaard, Camilla T.; Harsløf, Laurine B. S.; Andersen, Anders D.

    2016-01-01

    Several studies have investigated the effects of fish oil (FO) on infant growth, but little is known about the effects of FO and sex on insulin-like growth factor-1 (IGF-1), the main regulator of growth in childhood. We explored whether FO v. sunflower oil (SO) supplementation from 9 to 18 months...... of age affected IGF-1 and its binding protein-3 (IGFBP-3) and whether the potential effects were sex specific. Danish infants (n 115) were randomly allocated to 5 ml/d FO (1·2 g/d n-3 long-chain PUFA (n-3 LCPUFA)) or SO. We measured growth, IGF-1, IGFBP-3 and erythrocyte EPA, a biomarker of n-3 LCPUFA...... intake and status, at 9 and 18 months. Erythrocyte EPA increased strongly with FO compared with SO (PIGF-1 in the total population, but a sex×group interaction (P=0·02). Baseline-adjusted IGF-1 at 18 months was 11·1 µg/l (95 % CI 0·4, 21·8;P=0...

  11. Bacteria in the vaginal microbiome alter the innate immune response and barrier properties of the human vaginal epithelia in a species-specific manner.

    Science.gov (United States)

    Doerflinger, Sylvie Y; Throop, Andrea L; Herbst-Kralovetz, Melissa M

    2014-06-15

    Bacterial vaginosis increases the susceptibility to sexually transmitted infections and negatively affects women's reproductive health. To investigate host-vaginal microbiota interactions and the impact on immune barrier function, we colonized 3-dimensional (3-D) human vaginal epithelial cells with 2 predominant species of vaginal microbiota (Lactobacillus iners and Lactobacillus crispatus) or 2 prevalent bacteria associated with bacterial vaginosis (Atopobium vaginae and Prevotella bivia). Colonization of 3-D vaginal epithelial cell aggregates with vaginal microbiota was observed with direct attachment to host cell surface with no cytotoxicity. A. vaginae infection yielded increased expression membrane-associated mucins and evoked a robust proinflammatory, immune response in 3-D vaginal epithelial cells (ie, expression of CCL20, hBD-2, interleukin 1β, interleukin 6, interleukin 8, and tumor necrosis factor α) that can negatively affect barrier function. However, P. bivia and L. crispatus did not significantly upregulate pattern-recognition receptor-signaling, mucin expression, antimicrobial peptides/defensins, or proinflammatory cytokines in 3-D vaginal epithelial cell aggregates. Notably, L. iners induced pattern-recognition receptor-signaling activity, but no change was observed in mucin expression or secretion of interleukin 6 and interleukin 8. We identified unique species-specific immune signatures from vaginal epithelial cells elicited by colonization with commensal and bacterial vaginosis-associated bacteria. A. vaginae elicited a signature that is consistent with significant disruption of immune barrier properties, potentially resulting in enhanced susceptibility to sexually transmitted infections during bacterial vaginosis. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  12. Mapping to mouse chromosome 3 of the gene encoding latexin (Lxn) expressed in neocortical neurons in a region-specific manner

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Ming-hao; Uratani, Yoshihiko; Arimatsu, Yasuyoshi [Mitsubishi Kasei Institute of Life Sciences, Tokyo (Japan)

    1997-02-01

    Latexin was first found as a 29-kDa antigen expressed in a subset of neurons in infragranular layers of lateral, but not dorsal, neocortical areas in the rat using a monoclonal antibody PC3.1. It was found that the vast majority of latexin-expressing neurons in both layers V and VI within the lateral neocortex were generated concurrently at Embryonic Day 15, demonstrating a strict correlation between the molecular identity of neurons and the time of their generation. Since neurons expressing latexin are located in the restricted part of the neocortex, latexin has been used as a useful molecular marker to elucidate the mechanism underlying cortical regional specification. The latexin cDNA isolated from a cDNA library of the rat cerebral cortex encodes a protein composed of 223-amino-acid residues containing two potential Ca{sup 2+}/calmodulin-dependent protein kinase sites and one cGMP-dependent protein kinase phosphorylation site. The absence of any signal peptide or potential transmembrane domain is consistent with the apparent cytosolic localization of latexin in the rat brain. The transcripts of latexin were expressed in not only neutral but also nonneural tissues (e.g., lung, spleen, kidney, heart, and digestive tracts). Recently, it has been demonstrated that latexin purified from the rat brain has inhibitory activity against carboxypeptidase A1, carboxypeptidase A2, and mast cell carboxypeptidase A, with less carboxypeptidase B-inhibiting activity. The amino acid sequence deduced from the rat latexin cDNA has no strict homology to any sequences so far known. Genomic Southern blot analysis using a cDNA probe of rat latexin suggested that the gene encoding latexin in the rat has homologues in other mammalian species and in the chicken, but not in the nematode, fly, or frog. 9 refs., 1 fig.

  13. Electrophysiological evidence for speech-specific audiovisual integration.

    Science.gov (United States)

    Baart, Martijn; Stekelenburg, Jeroen J; Vroomen, Jean

    2014-01-01

    Lip-read speech is integrated with heard speech at various neural levels. Here, we investigated the extent to which lip-read induced modulations of the auditory N1 and P2 (measured with EEG) are indicative of speech-specific audiovisual integration, and we explored to what extent the ERPs were modulated by phonetic audiovisual congruency. In order to disentangle speech-specific (phonetic) integration from non-speech integration, we used Sine-Wave Speech (SWS) that was perceived as speech by half of the participants (they were in speech-mode), while the other half was in non-speech mode. Results showed that the N1 obtained with audiovisual stimuli peaked earlier than the N1 evoked by auditory-only stimuli. This lip-read induced speeding up of the N1 occurred for listeners in speech and non-speech mode. In contrast, if listeners were in speech-mode, lip-read speech also modulated the auditory P2, but not if listeners were in non-speech mode, thus revealing speech-specific audiovisual binding. Comparing ERPs for phonetically congruent audiovisual stimuli with ERPs for incongruent stimuli revealed an effect of phonetic stimulus congruency that started at ~200 ms after (in)congruence became apparent. Critically, akin to the P2 suppression, congruency effects were only observed if listeners were in speech mode, and not if they were in non-speech mode. Using identical stimuli, we thus confirm that audiovisual binding involves (partially) different neural mechanisms for sound processing in speech and non-speech mode. © 2013 Published by Elsevier Ltd.

  14. Acetylation and glycation of fibrinogen in vitro occur at specific lysine residues in a concentration dependent manner: A mass spectrometric and isotope labeling study

    International Nuclear Information System (INIS)

    Svensson, Jan; Bergman, Ann-Charlotte; Adamson, Ulf; Blombäck, Margareta; Wallén, Håkan; Jörneskog, Gun

    2012-01-01

    Highlights: ► Fibrinogen was incubated in vitro with glucose or aspirin. ► Acetylations and glycations were found at twelve lysine sites by mass spectrometry. ► The labeling by aspirin and glucose occurred dose-dependently. ► No competition between glucose and aspirin for binding to fibrinogen was found. -- Abstract: Aspirin may exert part of its antithrombotic effects through platelet-independent mechanisms. Diabetes is a condition in which the beneficial effects of aspirin are less prominent or absent – a phenomenon called “aspirin resistance”. We investigated whether acetylation and glycation occur at specific sites in fibrinogen and if competition between glucose and aspirin in binding to fibrinogen occurs. Our hypothesis was that such competition might be one explanation to “aspirin resistance” in diabetes. After incubation of fibrinogen in vitro with aspirin (0.8 mM, 24 h) or glucose (100 mM, 5–10 days), we found 12 modified sites with mass spectrometric techniques. Acetylations in the α-chain: αK191, αK208, αK224, αK429, αK457, αK539, αK562, in the β-chain: βK233, and in the γ-chain: γK170 and γK273. Glycations were found at βK133 and γK75, alternatively γK85. Notably, the lysine 539 is a site involved in FXIII-mediated cross-linking of fibrin. With isotope labeling in vitro, using [ 14 C-acetyl]salicylic acid and [ 14 C]glucose, a labeling of 0.013–0.084 and 0.12–0.5 mol of acetylated and glycated adduct/mol fibrinogen, respectively, was found for clinically (12.9–100 μM aspirin) and physiologically (2–8 mM glucose) relevant plasma concentrations. No competition between acetylation and glycation could be demonstrated. Thus, fibrinogen is acetylated at several lysine residues, some of which are involved in the cross-linking of fibrinogen. This may mechanistically explain why aspirin facilitates fibrin degradation. We find no support for the idea that glycation of fibrin(ogen) interferes with acetylation of

  15. Acetylation and glycation of fibrinogen in vitro occur at specific lysine residues in a concentration dependent manner: A mass spectrometric and isotope labeling study

    Energy Technology Data Exchange (ETDEWEB)

    Svensson, Jan, E-mail: jan.svensson@ki.se [Department of Molecular Medicine and Surgery, Karolinska Institutet, Karolinska University Hospital (Solna), SE-171 76 Stockholm (Sweden); Karolinska Institutet, Department of Clinical Sciences, Danderyd Hospital, SE-182 88 Stockholm (Sweden); Bergman, Ann-Charlotte [Department of Molecular Medicine and Surgery, Karolinska Institutet, Karolinska University Hospital (Solna), SE-171 76 Stockholm (Sweden); Adamson, Ulf [Karolinska Institutet, Department of Clinical Sciences, Danderyd Hospital, SE-182 88 Stockholm (Sweden); Blombaeck, Margareta [Department of Molecular Medicine and Surgery, Karolinska Institutet, Karolinska University Hospital (Solna), SE-171 76 Stockholm (Sweden); Wallen, Hakan; Joerneskog, Gun [Karolinska Institutet, Department of Clinical Sciences, Danderyd Hospital, SE-182 88 Stockholm (Sweden)

    2012-05-04

    Highlights: Black-Right-Pointing-Pointer Fibrinogen was incubated in vitro with glucose or aspirin. Black-Right-Pointing-Pointer Acetylations and glycations were found at twelve lysine sites by mass spectrometry. Black-Right-Pointing-Pointer The labeling by aspirin and glucose occurred dose-dependently. Black-Right-Pointing-Pointer No competition between glucose and aspirin for binding to fibrinogen was found. -- Abstract: Aspirin may exert part of its antithrombotic effects through platelet-independent mechanisms. Diabetes is a condition in which the beneficial effects of aspirin are less prominent or absent - a phenomenon called 'aspirin resistance'. We investigated whether acetylation and glycation occur at specific sites in fibrinogen and if competition between glucose and aspirin in binding to fibrinogen occurs. Our hypothesis was that such competition might be one explanation to 'aspirin resistance' in diabetes. After incubation of fibrinogen in vitro with aspirin (0.8 mM, 24 h) or glucose (100 mM, 5-10 days), we found 12 modified sites with mass spectrometric techniques. Acetylations in the {alpha}-chain: {alpha}K191, {alpha}K208, {alpha}K224, {alpha}K429, {alpha}K457, {alpha}K539, {alpha}K562, in the {beta}-chain: {beta}K233, and in the {gamma}-chain: {gamma}K170 and {gamma}K273. Glycations were found at {beta}K133 and {gamma}K75, alternatively {gamma}K85. Notably, the lysine 539 is a site involved in FXIII-mediated cross-linking of fibrin. With isotope labeling in vitro, using [{sup 14}C-acetyl]salicylic acid and [{sup 14}C]glucose, a labeling of 0.013-0.084 and 0.12-0.5 mol of acetylated and glycated adduct/mol fibrinogen, respectively, was found for clinically (12.9-100 {mu}M aspirin) and physiologically (2-8 mM glucose) relevant plasma concentrations. No competition between acetylation and glycation could be demonstrated. Thus, fibrinogen is acetylated at several lysine residues, some of which are involved in the cross-linking of

  16. Integrating Occupational Therapy Specific Assessments in Practice: Exploring Practitioner Experiences

    Directory of Open Access Journals (Sweden)

    Eric Asaba

    2017-01-01

    Full Text Available Background. Occupational therapists sometimes find it challenging to integrate client-centered and occupational therapy specific assessments in practice. The aim of this study was to explore the use of occupational therapy specific assessments such as the Assessment of Motor and Process Skills (AMPS among occupational therapists in Sweden and Japan. Methods. Interviews and qualitative thematic analyses were utilized. Findings. Four themes are reported: (1 use it or lose it, (2 simply no space until after hours, (3 biggest barriers can be colleagues, and (4 being more specific: communication. Conclusion. In keeping with previous studies, occupational therapists often find it challenging to implement client-centered and occupation-based assessment tools into practice. However, more work is needed to understand how best practices can be incorporated into a changing occupational therapy daily practice.

  17. A Single Amino Acid Change in the Marburg Virus Matrix Protein VP40 Provides a Replicative Advantage in a Species-Specific Manner

    Science.gov (United States)

    Koehler, Alexander; Kolesnikova, Larissa; Welzel, Ulla; Schudt, Gordian; Herwig, Astrid

    2015-01-01

    ABSTRACT Marburg virus (MARV) induces severe hemorrhagic fever in humans and nonhuman primates but only transient nonlethal disease in rodents. However, sequential passages of MARV in rodents boosts infection leading to lethal disease. Guinea pig-adapted MARV contains one mutation in the viral matrix protein VP40 at position 184 (VP40D184N). The contribution of the D184N mutation to the efficacy of replication in a new host is unknown. In the present study, we demonstrated that recombinant MARV containing the D184N mutation in VP40 [rMARVVP40(D184N)] grew to higher titers than wild-type recombinant MARV (rMARVWT) in guinea pig cells. Moreover, rMARVVP40(D184N) displayed higher infectivity in guinea pig cells. Comparative analysis of VP40 functions indicated that neither the interferon (IFN)-antagonistic function nor the membrane binding capabilities of VP40 were affected by the D184N mutation. However, the production of VP40-induced virus-like particles (VLPs) and the recruitment of other viral proteins to the budding site was improved by the D184N mutation in guinea pig cells, which resulted in the higher infectivity of VP40D184N-induced infectious VLPs (iVLPs) compared to that of VP40-induced iVLPs. In addition, the function of VP40 in suppressing viral RNA synthesis was influenced by the D184N mutation specifically in guinea pig cells, thus allowing greater rates of transcription and replication. Our results showed that the improved viral fitness of rMARVVP40(D184N) in guinea pig cells was due to the better viral assembly function of VP40D184N and its lower inhibitory effect on viral transcription and replication rather than modulation of the VP40-mediated suppression of IFN signaling. IMPORTANCE The increased virulence achieved by virus passaging in a new host was accompanied by mutations in the viral genome. Analyzing how these mutations affect the functions of viral proteins and the ability of the virus to grow within new host cells helps in the understanding

  18. Integrating Cloud-Computing-Specific Model into Aircraft Design

    Science.gov (United States)

    Zhimin, Tian; Qi, Lin; Guangwen, Yang

    Cloud Computing is becoming increasingly relevant, as it will enable companies involved in spreading this technology to open the door to Web 3.0. In the paper, the new categories of services introduced will slowly replace many types of computational resources currently used. In this perspective, grid computing, the basic element for the large scale supply of cloud services, will play a fundamental role in defining how those services will be provided. The paper tries to integrate cloud computing specific model into aircraft design. This work has acquired good results in sharing licenses of large scale and expensive software, such as CFD (Computational Fluid Dynamics), UG, CATIA, and so on.

  19. Reactor protection system design using application specific integrated circuits

    International Nuclear Information System (INIS)

    Battle, R.E.; Bryan, W.L.; Kisner, R.A.; Wilson, T.L. Jr.

    1992-01-01

    Implementing reactor protection systems (RPS) or other engineering safeguard systems with application specific integrated circuits (ASICs) offers significant advantages over conventional analog or software based RPSs. Conventional analog RPSs suffer from setpoints drifts and large numbers of discrete analog electronics, hardware logic, and relays which reduce reliability because of the large number of potential failures of components or interconnections. To resolve problems associated with conventional discrete RPSs and proposed software based RPS systems, a hybrid analog and digital RPS system implemented with custom ASICs is proposed. The actual design of the ASIC RPS resembles a software based RPS but the programmable software portion of each channel is implemented in a fixed digital logic design including any input variable computations. Set point drifts are zero as in proposed software systems, but the verification and validation of the computations is made easier since the computational logic an be exhaustively tested. The functionality is assured fixed because there can be no future changes to the ASIC without redesign and fabrication. Subtle error conditions caused by out of order evaluation or time dependent evaluation of system variables against protection criteria are eliminated by implementing all evaluation computations in parallel for simultaneous results. On- chip redundancy within each RPS channel and continuous self-testing of all channels provided enhanced assurance that a particular channel is available and faults are identified as soon as possible for corrective actions. The use of highly integrated ASICs to implement channel electronics rather than the use of discrete electronics greatly reduces the total number of components and interconnections in the RPS to further increase system reliability. A prototype ASIC RPS channel design and the design environment used for ASIC RPS systems design is discussed

  20. Context-specific effects of musical expertise on audiovisual integration

    Science.gov (United States)

    Bishop, Laura; Goebl, Werner

    2014-01-01

    Ensemble musicians exchange auditory and visual signals that can facilitate interpersonal synchronization. Musical expertise improves how precisely auditory and visual signals are perceptually integrated and increases sensitivity to asynchrony between them. Whether expertise improves sensitivity to audiovisual asynchrony in all instrumental contexts or only in those using sound-producing gestures that are within an observer's own motor repertoire is unclear. This study tested the hypothesis that musicians are more sensitive to audiovisual asynchrony in performances featuring their own instrument than in performances featuring other instruments. Short clips were extracted from audio-video recordings of clarinet, piano, and violin performances and presented to highly-skilled clarinetists, pianists, and violinists. Clips either maintained the audiovisual synchrony present in the original recording or were modified so that the video led or lagged behind the audio. Participants indicated whether the audio and video channels in each clip were synchronized. The range of asynchronies most often endorsed as synchronized was assessed as a measure of participants' sensitivities to audiovisual asynchrony. A positive relationship was observed between musical training and sensitivity, with data pooled across stimuli. While participants across expertise groups detected asynchronies most readily in piano stimuli and least readily in violin stimuli, pianists showed significantly better performance for piano stimuli than for either clarinet or violin. These findings suggest that, to an extent, the effects of expertise on audiovisual integration can be instrument-specific; however, the nature of the sound-producing gestures that are observed has a substantial effect on how readily asynchrony is detected as well. PMID:25324819

  1. Speech Mannerisms: Games Clients Play

    Science.gov (United States)

    Morgan, Lewis B.

    1978-01-01

    This article focuses on speech mannerisms often employed by clients in a helping relationship. Eight mannerisms are presented and discussed, as well as possible interpretations. Suggestions are given to help counselors respond to them. (Author)

  2. An integrated in silico approach to design specific inhibitors targeting human poly(a-specific ribonuclease.

    Directory of Open Access Journals (Sweden)

    Dimitrios Vlachakis

    Full Text Available Poly(A-specific ribonuclease (PARN is an exoribonuclease/deadenylase that degrades 3'-end poly(A tails in almost all eukaryotic organisms. Much of the biochemical and structural information on PARN comes from the human enzyme. However, the existence of PARN all along the eukaryotic evolutionary ladder requires further and thorough investigation. Although the complete structure of the full-length human PARN, as well as several aspects of the catalytic mechanism still remain elusive, many previous studies indicate that PARN can be used as potent and promising anti-cancer target. In the present study, we attempt to complement the existing structural information on PARN with in-depth bioinformatics analyses, in order to get a hologram of the molecular evolution of PARNs active site. In an effort to draw an outline, which allows specific drug design targeting PARN, an unequivocally specific platform was designed for the development of selective modulators focusing on the unique structural and catalytic features of the enzyme. Extensive phylogenetic analysis based on all the publicly available genomes indicated a broad distribution for PARN across eukaryotic species and revealed structurally important amino acids which could be assigned as potentially strong contributors to the regulation of the catalytic mechanism of PARN. Based on the above, we propose a comprehensive in silico model for the PARN's catalytic mechanism and moreover, we developed a 3D pharmacophore model, which was subsequently used for the introduction of DNP-poly(A amphipathic substrate analog as a potential inhibitor of PARN. Indeed, biochemical analysis revealed that DNP-poly(A inhibits PARN competitively. Our approach provides an efficient integrated platform for the rational design of pharmacophore models as well as novel modulators of PARN with therapeutic potential.

  3. Gesture-speech integration in children with specific language impairment.

    Science.gov (United States)

    Mainela-Arnold, Elina; Alibali, Martha W; Hostetter, Autumn B; Evans, Julia L

    2014-11-01

    Previous research suggests that speakers are especially likely to produce manual communicative gestures when they have relative ease in thinking about the spatial elements of what they are describing, paired with relative difficulty organizing those elements into appropriate spoken language. Children with specific language impairment (SLI) exhibit poor expressive language abilities together with within-normal-range nonverbal IQs. This study investigated whether weak spoken language abilities in children with SLI influence their reliance on gestures to express information. We hypothesized that these children would rely on communicative gestures to express information more often than their age-matched typically developing (TD) peers, and that they would sometimes express information in gestures that they do not express in the accompanying speech. Participants were 15 children with SLI (aged 5;6-10;0) and 18 age-matched TD controls. Children viewed a wordless cartoon and retold the story to a listener unfamiliar with the story. Children's gestures were identified and coded for meaning using a previously established system. Speech-gesture combinations were coded as redundant if the information conveyed in speech and gesture was the same, and non-redundant if the information conveyed in speech was different from the information conveyed in gesture. Children with SLI produced more gestures than children in the TD group; however, the likelihood that speech-gesture combinations were non-redundant did not differ significantly across the SLI and TD groups. In both groups, younger children were significantly more likely to produce non-redundant speech-gesture combinations than older children. The gesture-speech integration system functions similarly in children with SLI and TD, but children with SLI rely more on gesture to help formulate, conceptualize or express the messages they want to convey. This provides motivation for future research examining whether interventions

  4. Specification and Generation of Adapters for System Integration

    NARCIS (Netherlands)

    Mooij, A.J.; Voorhoeve, M.

    2013-01-01

    Large systems-of-systems are developed by integrating several smaller systems that have been developed independently. System integration often requires adaptation mechanisms for bridging any technical incompatibilities between the systems. In order to develop adapters in a faster way, we study ways

  5. Non-coplanar polychlorinated biphenyls (PCBs) are direct agonists for the human pregnane-X receptor and constitutive androstane receptor, and activate target gene expression in a tissue-specific manner

    International Nuclear Information System (INIS)

    Al-Salman, Fadheela; Plant, Nick

    2012-01-01

    The polychlorinated biphenyl group possesses high environmental persistence, leading to bioaccumulation and a number of adverse effects in mammals. Whilst coplanar PCBs elicit their toxic effects through agonism of the aryl hydrocarbon receptor; however, non-coplanar PCBs are not ligands for AhR, but may be ligands for members of the nuclear receptor family of proteins. To better understand the biological actions of non-coplanar PCBs, we have undertaken a systematic analysis of their ability to activate PXR and CAR-mediated effects. Cells were exposed to a range of non-coplanar PCBs (99, 138, 153, 180 and 194), or the coplanar PCB77: Direct activation of PXR and CAR was measured using a mammalian receptor activation assay in human liver cells, with rifampicin and CITCO used as positive controls ligands for PXR and CAR, respectively; activation of target gene expression was examined using reporter gene plasmids for CYP3A4 and MDR1 transfected into liver, intestine and lung cell lines. Several of the non-coplanar PCBs directly activated PXR and CAR, whilst the coplanar PCB77 did not. Non-coplanar PCBs were also able to activate PXR/CAR target gene expression in a substitution- and tissue-specific manner. Non-coplanar PCBs act as direct activators for the nuclear receptors PXR and CAR, and are able to elicit transcriptional activation of target genes in a substitution- and tissue-dependent manner. Chronic activation of PXR/CAR is linked to adverse effects and must be included in any risk assessment of PCBs. -- Highlights: ► Several Non-coplanar PCBs are able to directly activate both PXR and CAR in vitro. ► PCB153 is the most potent direct activator of PXR and CAR nuclear receptors. ► Non-coplanar PCB activation of CYP3A4/MDR1 reporter genes is structure-dependent. ► Non-coplanar PCB activate CYP3A4/MDR1 reporter genes in a tissue-dependent. ► PCB153 is the most potent activator of PXR/CAR target gene in all tissues.

  6. Closed expressions for specific massive multiloop self-energy integrals

    International Nuclear Information System (INIS)

    Berends, F.A.; Boehm, M.; Buza, M.; Scharf, R.

    1994-01-01

    In this paper the class of N loop massive scalar self-energy diagrams with N + 1 propagators is studied in an arbitrary number of dimensions. As it is known these integrals cannot be expressed in terms of polylogarithms. Here it is shown, however, that they can be described by generalized hypergeometric functions of several variables, namely Laricella functions. These results represent previous small and large momentum expansions in closed form. Numerical comparisons for the finite part in four dimensions with a two-dimensional integral representation show good agreement. (orig.)

  7. Application specific integrated circuit for high temperature oil well applications

    Energy Technology Data Exchange (ETDEWEB)

    Fallet, T.; Gakkestad, J.; Forre, G.

    1994-12-31

    This paper describes the design of an integrated BiCMOS circuit for high temperature applications. The circuit contains Pierce oscillators with automatic gain control, and measurements show that it is operating up to 266{sup o}C. The relative frequency variation up to 200 {sup o}C is less than 60 ppm caused mainly by the crystal element itself. 4 refs., 7 figs.

  8. Genetic polymorphism rs3760396 of the chemokine (C-C motif) ligand 2 gene (CCL2) associated with the susceptibility of lung cancer in a pathological subtype-specific manner in Han-ancestry Chinese: a case control study

    International Nuclear Information System (INIS)

    Li, Xu; Lin, Fangcai; Zhou, Hong

    2016-01-01

    Chemokines are well known inflammatory factors critical for tumor development in diverse tissues, including lung cancer. Chemokine (C-C motif) Ligand 2 (CCL2) was one of such chemokines important for both primary tumor development and metastasis of various cancers. Polymorphism at rs3760396 of CCL2 genes is associated with the prognosis of non-small cell lung cancer (NSCLC). The goal of our study was to examine the relationship of genetic polymorphisms rs3760396 with the susceptibility of lung cancer and its pathological subtypes in Han-ancestry Chinese population. rs3760396 G/C polymorphism of CCL2 was genotyped using PCR in 394 patients with lung cancer and 545 cancer-free controls from the same Northeast region of China. After controlling for gender, age and smoking status, no significant association was observed between rs3760396 polymorphism and overall lung cancer. However, minor allele G of rs3760396 polymorphism was significantly associated with increased risk of adenosquamous lung carcinoma with either allelic genetic model (OR = 5.29, P < 0.001), or dominant genetic model (OR = 9.88, P < 0.001), or genotypic model (GC genotype vs. CC genotype, OR = 10.73, P < 0.001). Although rs3760396 polymorphism was not significantly associated with increased risk of adenocarcinoma subtype, it was nominally associated with the pooled outcome of either adenocarcinoma or adenosquamous carcinoma under allelic genetic model (OR = 1.54, P = 0.023) or dominant genetic model (OR = 1.57, P = 0.031). Our study suggested rs3760396 polymorphism of CCL2 is associated not only with prognosis of NSCLC, but also with risk of lung cancer in a subtype-specific manner. Our results further supported previous evidence of the important role of CCL2 in lung cancer development

  9. Naloxone treatment alters gene expression in the mesolimbic reward system in 'junk food' exposed offspring in a sex-specific manner but does not affect food preferences in adulthood.

    Science.gov (United States)

    Gugusheff, J R; Ong, Z Y; Muhlhausler, B S

    2014-06-22

    We have previously reported that the opioid receptor blocker, naloxone, is less effective in reducing palatable food intake in offspring exposed to a maternal cafeteria diet during the perinatal period, implicating a desensitization of the central opioid pathway in the programming of food preferences. The present study aimed to investigate the effect of a maternal cafeteria diet and naloxone treatment on the development of the mesolimbic reward pathway and food choices in adulthood. We measured mRNA expression of key components of the reward pathway (mu-opioid receptor, proenkephalin, tyrosine hydroxylase, D1 and D2 receptors and the dopamine active transporter (DAT)) in the nucleus accumbens (NAc) and ventral tegmental area (VTA) of the offspring of control and cafeteria fed (JF) dams at weaning and after a 10-day naloxone treatment post-weaning and determined food preferences in adulthood in the remaining offspring. Naloxone treatment decreased the expression of DAT by 8.2 fold in female control offspring but increased it by 4.3 fold in female offspring of JF dams relative to the saline-injected reference groups. Proenkephalin mRNA expression was higher in the NAc of female JF offspring compared to controls, independent of naloxone treatment (Pfood preferences in adulthood in either control or JF offspring. These data indicate that prenatal exposure to a cafeteria diet alters the impact of opioid signaling blockade in the early post-weaning period on gene expression in the central reward pathway in a sex specific manner, but that these changes in gene expression do not appear to have any persistent impact on food preferences in adulthood. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Selective pressures to maintain attachment site specificity of integrative and conjugative elements.

    Directory of Open Access Journals (Sweden)

    Kayla L Menard

    Full Text Available Integrative and conjugative elements (ICEs are widespread mobile genetic elements that are usually found integrated in bacterial chromosomes. They are important agents of evolution and contribute to the acquisition of new traits, including antibiotic resistances. ICEs can excise from the chromosome and transfer to recipients by conjugation. Many ICEs are site-specific in that they integrate preferentially into a primary attachment site in the bacterial genome. Site-specific ICEs can also integrate into secondary locations, particularly if the primary site is absent. However, little is known about the consequences of integration of ICEs into alternative attachment sites or what drives the apparent maintenance and prevalence of the many ICEs that use a single attachment site. Using ICEBs1, a site-specific ICE from Bacillus subtilis that integrates into a tRNA gene, we found that integration into secondary sites was detrimental to both ICEBs1 and the host cell. Excision of ICEBs1 from secondary sites was impaired either partially or completely, limiting the spread of ICEBs1. Furthermore, induction of ICEBs1 gene expression caused a substantial drop in proliferation and cell viability within three hours. This drop was dependent on rolling circle replication of ICEBs1 that was unable to excise from the chromosome. Together, these detrimental effects provide selective pressure against the survival and dissemination of ICEs that have integrated into alternative sites and may explain the maintenance of site-specific integration for many ICEs.

  11. In Search of Integrated Specificity: Comment on Denson, Spanovic, and Miller (2009)

    Science.gov (United States)

    Miller, Gregory E.

    2009-01-01

    Psychologists have long been interested in the integrated specificity hypothesis, which maintains that stressors elicit fairly distinct behavioral, emotional, and biological responses that are molded by selective pressures to meet specific demands from the environment. This issue of "Psychological Bulletin" features a meta-analytic review of the…

  12. Sound specificity effects in spoken word recognition: The effect of integrality between words and sounds.

    Science.gov (United States)

    Strori, Dorina; Zaar, Johannes; Cooke, Martin; Mattys, Sven L

    2018-01-01

    Recent evidence has shown that nonlinguistic sounds co-occurring with spoken words may be retained in memory and affect later retrieval of the words. This sound-specificity effect shares many characteristics with the classic voice-specificity effect. In this study, we argue that the sound-specificity effect is conditional upon the context in which the word and sound coexist. Specifically, we argue that, besides co-occurrence, integrality between words and sounds is a crucial factor in the emergence of the effect. In two recognition-memory experiments, we compared the emergence of voice and sound specificity effects. In Experiment 1 , we examined two conditions where integrality is high. Namely, the classic voice-specificity effect (Exp. 1a) was compared with a condition in which the intensity envelope of a background sound was modulated along the intensity envelope of the accompanying spoken word (Exp. 1b). Results revealed a robust voice-specificity effect and, critically, a comparable sound-specificity effect: A change in the paired sound from exposure to test led to a decrease in word-recognition performance. In the second experiment, we sought to disentangle the contribution of integrality from a mere co-occurrence context effect by removing the intensity modulation. The absence of integrality led to the disappearance of the sound-specificity effect. Taken together, the results suggest that the assimilation of background sounds into memory cannot be reduced to a simple context effect. Rather, it is conditioned by the extent to which words and sounds are perceived as integral as opposed to distinct auditory objects.

  13. Sound specificity effects in spoken word recognition: The effect of integrality between words and sounds

    DEFF Research Database (Denmark)

    Strori, Dorina; Zaar, Johannes; Cooke, Martin

    2017-01-01

    Recent evidence has shown that nonlinguistic sounds co-occurring with spoken words may be retained in memory and affect later retrieval of the words. This sound-specificity effect shares many characteristics with the classic voice-specificity effect. In this study, we argue that the sound......-specificity effect is conditional upon the context in which the word and sound coexist. Specifically, we argue that, besides co-occurrence, integrality between words and sounds is a crucial factor in the emergence of the effect. In two recognition-memory experiments, we compared the emergence of voice and sound...... from a mere co-occurrence context effect by removing the intensity modulation. The absence of integrality led to the disappearance of the sound-specificity effect. Taken together, the results suggest that the assimilation of background sounds into memory cannot be reduced to a simple context effect...

  14. Buried Messages, Hidden Meanings: Speech Mannerisms Revisited.

    Science.gov (United States)

    Morgan, Lewis B.

    1988-01-01

    Introduces counselors to 10 commonly used mannerisms of speech and the part that each mannerism plays in the communication process, especially in the counseling context. Offers suggestions on how to respond to these speech mannerisms in a straightforward and effective manner. (Author)

  15. In search of integrated specificity: comment on Denson, Spanovic, and Miller (2009).

    Science.gov (United States)

    Miller, Gregory E

    2009-11-01

    Psychologists have long been interested in the integrated specificity hypothesis, which maintains that stressors elicit fairly distinct behavioral, emotional, and biological responses that are molded by selective pressures to meet specific demands from the environment. This issue of Psychological Bulletin features a meta-analytic review of the evidence for this proposition by T. F. Denson, M. Spanovic, and N. Miller. Their review concluded that the meta-analytic findings support the "core concept behind the integrated specificity model" (p. 845) and reveal that "within the context of a stressful event, organisms produce an integrated and coordinated response at multiple levels (i.e., cognitive, emotional, physiological)" (p. 845). I argue that conclusions such as this are unwarranted, given the data. Aside from some effects for cortisol, little evidence of specificity was presented, and most of the significant findings reported would be expected by chance alone. I also contend that Denson et al. failed to consider some important sources of evidence bearing on the specificity hypothesis, particularly how appraisals and emotions couple with autonomic nervous system endpoints and functional indices of immune response. If selective pressures did give rise to an integrated stress response, such pathways almost certainly would have been involved. By omitting such outcomes from the meta-analysis, Denson et al. overlooked what are probably the most definitive tests of the specificity hypothesis. As a result, the field is back where it started: with a lot of affection for the concept of integrated specificity but little in the way of definitive evidence to refute or accept it.

  16. Neutrophil glycoprotein Mo1 is an integral membrane protein of plasma membranes and specific granules

    International Nuclear Information System (INIS)

    Stevenson, K.B.; Nauseef, W.M.; Clark, R.A.

    1987-01-01

    The glucoprotein Mo1 has previously been demonstrated to be on the cell surface and in the specific granule fraction of neutrophils and to be translocated to the cell surface during degranulation. It is not known, however, whether Mo1 is an integral membrane protein or a soluble, intragranular constituent loosely associated with the specific granule membrane. Purified neutrophils were disrupted by nitrogen cavitation and separated on Percoll density gradients into four fractions enriched for azurophilic granules, specific granules, plasma membrane, and cytosol, respectively. The glycoproteins in these fractions were labeled with 3 H-borohydride reduction, extracted with Triton X-114, and immunoprecipitated with 60.3, an anti-Mo1 monoclonal antibody. Mo1 was detected only in the specific granule and plasma membrane fractions and partitioned exclusively into the detergent-rich fraction consistent with Mo1 being an integral membrane protein. In addition, treatment of specific granule membranes with a high salt, high urea buffer to remove adsorbed or peripheral proteins failed to dissociate Mo1. These data support the hypothesis that Mo1 is an integral membrane protein of plasma and specific granule membranes in human neutrophils

  17. Database specification for the Worldwide Port System (WPS) Regional Integrated Cargo Database (ICDB)

    Energy Technology Data Exchange (ETDEWEB)

    Faby, E.Z.; Fluker, J.; Hancock, B.R.; Grubb, J.W.; Russell, D.L. [Univ. of Tennessee, Knoxville, TN (United States); Loftis, J.P.; Shipe, P.C.; Truett, L.F. [Oak Ridge National Lab., TN (United States)

    1994-03-01

    This Database Specification for the Worldwide Port System (WPS) Regional Integrated Cargo Database (ICDB) describes the database organization and storage allocation, provides the detailed data model of the logical and physical designs, and provides information for the construction of parts of the database such as tables, data elements, and associated dictionaries and diagrams.

  18. Integration of aerial imaging and variable-rate technology for site-specific aerial herbicide application

    Science.gov (United States)

    As remote sensing and variable rate technology are becoming more available for aerial applicators, practical methodologies on effective integration of these technologies are needed for site-specific aerial applications of crop production and protection materials. The objectives of this study were to...

  19. Application specific integrated circuits and hybrid micro circuits for nuclear instrumentation

    International Nuclear Information System (INIS)

    Chandratre, V.B.; Sukhwani, Menka; Mukhopadhyay, P.K.; Shastrakar, R.S.; Sudheer, M.; Shedam, V.; Keni, Anubha

    2009-01-01

    Rapid development in semiconductor technology, sensors, detectors and requirements of high energy physics experiments as well as advances in commercially available nuclear instruments have lead to challenges for instrumentation. These challenges are met with development of Application Specific Integrated Circuits and Hybrid Micro Circuits. This paper discusses various activities in ASIC and HMC development in Bhabha Atomic Research Centre. (author)

  20. SELECTED REQUIREMENTS OF INTEGRATED MANAGEMENT SYSTEMS BASED ON PAS 99 SPECIFICATION

    Directory of Open Access Journals (Sweden)

    Paweł Nowicki

    2013-03-01

    Full Text Available The aim this research was to analyze the ways of integration of management systems in food sector. The study involved the documentation, audits, corrective and preventive actions and management's review phases described in the specification PAS 99, which is one of common elements of integrated management systems. Four organizations were selected for the study. The organizations had introduced and certified at least two standardized management systems. It was assumed that the investigated organizations should have implemented the HACCP system. Studies were conducted as a case study. The employees responsible for the functioning of management systems were interviewed in all four organizations. The study was conducted in the form of in-depth interviews based on pre-prepared script. The scenario was developed based on the PAS 99 guideline. The process of integration of management systems implemented in the studied companies reveals the full compliance of an integrated management system with PASS 99 in the policy area.

  1. Chemical Entity Semantic Specification: Knowledge representation for efficient semantic cheminformatics and facile data integration

    Science.gov (United States)

    2011-01-01

    Background Over the past several centuries, chemistry has permeated virtually every facet of human lifestyle, enriching fields as diverse as medicine, agriculture, manufacturing, warfare, and electronics, among numerous others. Unfortunately, application-specific, incompatible chemical information formats and representation strategies have emerged as a result of such diverse adoption of chemistry. Although a number of efforts have been dedicated to unifying the computational representation of chemical information, disparities between the various chemical databases still persist and stand in the way of cross-domain, interdisciplinary investigations. Through a common syntax and formal semantics, Semantic Web technology offers the ability to accurately represent, integrate, reason about and query across diverse chemical information. Results Here we specify and implement the Chemical Entity Semantic Specification (CHESS) for the representation of polyatomic chemical entities, their substructures, bonds, atoms, and reactions using Semantic Web technologies. CHESS provides means to capture aspects of their corresponding chemical descriptors, connectivity, functional composition, and geometric structure while specifying mechanisms for data provenance. We demonstrate that using our readily extensible specification, it is possible to efficiently integrate multiple disparate chemical data sources, while retaining appropriate correspondence of chemical descriptors, with very little additional effort. We demonstrate the impact of some of our representational decisions on the performance of chemically-aware knowledgebase searching and rudimentary reaction candidate selection. Finally, we provide access to the tools necessary to carry out chemical entity encoding in CHESS, along with a sample knowledgebase. Conclusions By harnessing the power of Semantic Web technologies with CHESS, it is possible to provide a means of facile cross-domain chemical knowledge integration with full

  2. Repeated administration of phytocannabinoid Δ(9)-THC or synthetic cannabinoids JWH-018 and JWH-073 induces tolerance to hypothermia but not locomotor suppression in mice, and reduces CB1 receptor expression and function in a brain region-specific manner.

    Science.gov (United States)

    Tai, S; Hyatt, W S; Gu, C; Franks, L N; Vasiljevik, T; Brents, L K; Prather, P L; Fantegrossi, W E

    2015-12-01

    These studies probed the relationship between intrinsic efficacy and tolerance/cross-tolerance between ∆(9)-THC and synthetic cannabinoid drugs of abuse (SCBs) by examining in vivo effects and cellular changes concomitant with their repeated administration in mice. Dose-effect relationships for hypothermic effects were determined in order to confirm that SCBs JWH-018 and JWH-073 are higher efficacy agonists than ∆(9)-THC in mice. Separate groups of mice were treated with saline, sub-maximal hypothermic doses of JWH-018 or JWH-073 (3.0mg/kg or 10.0mg/kg, respectively) or a maximally hypothermic dose of 30.0mg/kg ∆(9)-THC once per day for 5 consecutive days while core temperature and locomotor activity were monitored via biotelemetry. Repeated administration of all drugs resulted in tolerance to hypothermic effects, but not locomotor effects, and this tolerance was still evident 14 days after the last drug administration. Further studies treated mice with 30.0mg/kg ∆(9)-THC once per day for 4 days, then tested with SCBs on day 5. Mice with a ∆(9)-THC history were cross-tolerant to both SCBs, and this cross-tolerance also persisted 14 days after testing. Select brain regions from chronically treated mice were examined for changes in CB1 receptor expression and function. Expression and function of hypothalamic CB1Rs were reduced in mice receiving chronic drugs, but cortical CB1R expression and function were not altered. Collectively, these data demonstrate that repeated ∆(9)-THC, JWH-018 and JWH-073 can induce long-lasting tolerance to some in vivo effects, which is likely mediated by region-specific downregulation and desensitization of CB1Rs. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Augmenter of liver regeneration causes different kinetics of ERK1/2 and Akt/PKB phosphorylation than EGF and induces hepatocyte proliferation in an EGF receptor independent and liver specific manner

    Energy Technology Data Exchange (ETDEWEB)

    Ilowski, Maren; Putz, Christine [Department of Surgery, Ludwig-Maximilians-University of Munich Hospital Grosshadern, Munich (Germany); Weiss, Thomas S. [Department of Surgery, University of Regensburg Hospital, Regensburg (Germany); Brand, Stephan [Department of Internal Medicine II, Ludwig-Maximilians-University of Munich Hospital Grosshadern, Munich (Germany); Jauch, Karl-Walter [Department of Surgery, Ludwig-Maximilians-University of Munich Hospital Grosshadern, Munich (Germany); Hengstler, Jan G. [Leibniz Research Centre for Working Environment and Human Factors, TU Dortmund University, Dortmund (Germany); Thasler, Wolfgang Erwin, E-mail: wolfgang.thasler@med.uni-muenchen.de [Department of Surgery, Ludwig-Maximilians-University of Munich Hospital Grosshadern, Munich (Germany)

    2010-04-16

    Background/Aim: Augmenter of liver regeneration (ALR) is a potent growth factor which supports liver regeneration in experimental animals. The aim of this study was to compare proliferation as well as the kinetics of ERK1/2 and Akt/PKB phosphorylation by recombinant human ALR (rhALR) and EGF in human hepatocytes and extrahepatic cells. Methods: Kinetics of ERK1/2 and Akt/PKB phosphorylation were determined in primary human hepatocytes (phh) after stimulation with rhALR and EGF. Induction of proliferation was analyzed in phh and several cell lines of hepatic and extrahepatic origin by the MTT and [{sup 3}H]-thymidine assay. Results: The kinetics of ERK phosphorylation showed clear differences, whereby rhALR caused a transient and EGF a permanent increase during the observation period of 60 min. For both, Akt and ERK phosphorylation, EGF caused a faster effect with maximal levels observed already after 2 min, whereas rhALR caused maximal phosphorylation between 10 and 15 min. Using the EGF receptor inhibitor AG1478 we provide evidence of an EGF receptor independent induction of proliferation by rhALR. Furthermore, rhALR induced proliferation only in phh and the human liver derived cell lines HepG2 and Chang. In contrast, EGF enhanced proliferation in all analyzed cell types including cell lines of colon, bronchial, pancreatic and gastric origin (SW480, BC1, L36PL and GC1). Conclusion: rhALR and EGF induce different kinetics of ERK and Akt phosphorylation in human hepatocytes. The mitogenic effect of rhALR is liver specific and seems to be at least partially independent from EGF receptor mediated signaling.

  4. Developmental exposure to 50 parts-per-billion arsenic influences histone modifications and associated epigenetic machinery in a region- and sex-specific manner in the adult mouse brain

    International Nuclear Information System (INIS)

    Tyler, Christina R.; Hafez, Alexander K.; Solomon, Elizabeth R.; Allan, Andrea M.

    2015-01-01

    Epidemiological studies report that arsenic exposure via drinking water adversely impacts cognitive development in children and, in adults, can lead to greater psychiatric disease susceptibility, among other conditions. While it is known that arsenic toxicity has a profound effect on the epigenetic landscape, very few studies have investigated its effects on chromatin architecture in the brain. We have previously demonstrated that exposure to a low level of arsenic (50 ppb) during all three trimesters of fetal/neonatal development induces deficits in adult hippocampal neurogenesis in the dentate gyrus (DG), depressive-like symptoms, and alterations in gene expression in the adult mouse brain. As epigenetic processes control these outcomes, here we assess the impact of our developmental arsenic exposure (DAE) paradigm on global histone posttranslational modifications and associated chromatin-modifying proteins in the dentate gyrus and frontal cortex (FC) of adult male and female mice. DAE influenced histone 3 K4 trimethylation with increased levels in the male DG and FC and decreased levels in the female DG (no change in female FC). The histone methyltransferase MLL exhibited a similar sex- and region-specific expression profile as H3K4me3 levels, while histone demethylase KDM5B expression trended in the opposite direction. DAE increased histone 3 K9 acetylation levels in the male DG along with histone acetyltransferase (HAT) expression of GCN5 and decreased H3K9ac levels in the male FC along with decreased HAT expression of GCN5 and PCAF. DAE decreased expression of histone deacetylase enzymes HDAC1 and HDAC2, which were concurrent with increased H3K9ac levels but only in the female DG. Levels of H3 and H3K9me3 were not influenced by DAE in either brain region of either sex. These findings suggest that exposure to a low, environmentally relevant level of arsenic during development leads to long-lasting changes in histone methylation and acetylation in the adult

  5. Developmental exposure to 50 parts-per-billion arsenic influences histone modifications and associated epigenetic machinery in a region- and sex-specific manner in the adult mouse brain

    Energy Technology Data Exchange (ETDEWEB)

    Tyler, Christina R.; Hafez, Alexander K.; Solomon, Elizabeth R.; Allan, Andrea M., E-mail: aallan@salud.unm.edu

    2015-10-01

    Epidemiological studies report that arsenic exposure via drinking water adversely impacts cognitive development in children and, in adults, can lead to greater psychiatric disease susceptibility, among other conditions. While it is known that arsenic toxicity has a profound effect on the epigenetic landscape, very few studies have investigated its effects on chromatin architecture in the brain. We have previously demonstrated that exposure to a low level of arsenic (50 ppb) during all three trimesters of fetal/neonatal development induces deficits in adult hippocampal neurogenesis in the dentate gyrus (DG), depressive-like symptoms, and alterations in gene expression in the adult mouse brain. As epigenetic processes control these outcomes, here we assess the impact of our developmental arsenic exposure (DAE) paradigm on global histone posttranslational modifications and associated chromatin-modifying proteins in the dentate gyrus and frontal cortex (FC) of adult male and female mice. DAE influenced histone 3 K4 trimethylation with increased levels in the male DG and FC and decreased levels in the female DG (no change in female FC). The histone methyltransferase MLL exhibited a similar sex- and region-specific expression profile as H3K4me3 levels, while histone demethylase KDM5B expression trended in the opposite direction. DAE increased histone 3 K9 acetylation levels in the male DG along with histone acetyltransferase (HAT) expression of GCN5 and decreased H3K9ac levels in the male FC along with decreased HAT expression of GCN5 and PCAF. DAE decreased expression of histone deacetylase enzymes HDAC1 and HDAC2, which were concurrent with increased H3K9ac levels but only in the female DG. Levels of H3 and H3K9me3 were not influenced by DAE in either brain region of either sex. These findings suggest that exposure to a low, environmentally relevant level of arsenic during development leads to long-lasting changes in histone methylation and acetylation in the adult

  6. Site-Specific Integration of Exogenous Genes Using Genome Editing Technologies in Zebrafish

    Directory of Open Access Journals (Sweden)

    Atsuo Kawahara

    2016-05-01

    Full Text Available The zebrafish (Danio rerio is an ideal vertebrate model to investigate the developmental molecular mechanism of organogenesis and regeneration. Recent innovation in genome editing technologies, such as zinc finger nucleases (ZFNs, transcription activator-like effector nucleases (TALENs and the clustered regularly interspaced short palindromic repeats (CRISPR/CRISPR associated protein 9 (Cas9 system, have allowed researchers to generate diverse genomic modifications in whole animals and in cultured cells. The CRISPR/Cas9 and TALEN techniques frequently induce DNA double-strand breaks (DSBs at the targeted gene, resulting in frameshift-mediated gene disruption. As a useful application of genome editing technology, several groups have recently reported efficient site-specific integration of exogenous genes into targeted genomic loci. In this review, we provide an overview of TALEN- and CRISPR/Cas9-mediated site-specific integration of exogenous genes in zebrafish.

  7. An Exploratory Study into Perceived Task Complexity, Topic Specificity and Usefulness for Integrated Search

    DEFF Research Database (Denmark)

    Ingwersen, Peter; Lioma, Christina; Larsen, Birger

    2012-01-01

    We investigate the relations between user perceptions of work task complexity, topic specificity, and usefulness of retrieved results. 23 academic researchers submitted detailed descriptions of 65 real-life work tasks in the physics domain, and assessed documents retrieved from an integrated...... collection consisting of full text research articles in PDF, abstracts, and bibliographic records [6]. Bibliographic records were found to be more precise than full text PDFs, regardless of task complexity and topic specificity. PDFs were found to be more useful. Overall, for higher task complexity and topic...

  8. Large-scale modeling of condition-specific gene regulatory networks by information integration and inference.

    Science.gov (United States)

    Ellwanger, Daniel Christian; Leonhardt, Jörn Florian; Mewes, Hans-Werner

    2014-12-01

    Understanding how regulatory networks globally coordinate the response of a cell to changing conditions, such as perturbations by shifting environments, is an elementary challenge in systems biology which has yet to be met. Genome-wide gene expression measurements are high dimensional as these are reflecting the condition-specific interplay of thousands of cellular components. The integration of prior biological knowledge into the modeling process of systems-wide gene regulation enables the large-scale interpretation of gene expression signals in the context of known regulatory relations. We developed COGERE (http://mips.helmholtz-muenchen.de/cogere), a method for the inference of condition-specific gene regulatory networks in human and mouse. We integrated existing knowledge of regulatory interactions from multiple sources to a comprehensive model of prior information. COGERE infers condition-specific regulation by evaluating the mutual dependency between regulator (transcription factor or miRNA) and target gene expression using prior information. This dependency is scored by the non-parametric, nonlinear correlation coefficient η(2) (eta squared) that is derived by a two-way analysis of variance. We show that COGERE significantly outperforms alternative methods in predicting condition-specific gene regulatory networks on simulated data sets. Furthermore, by inferring the cancer-specific gene regulatory network from the NCI-60 expression study, we demonstrate the utility of COGERE to promote hypothesis-driven clinical research. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Application-specific integrated circuit design for a typical pressurized water reactor pressure channel trip

    International Nuclear Information System (INIS)

    Battle, R.E.; Manges, W.W.; Emery, M.S.; Vendermolen, R.I.; Bhatt, S.

    1994-01-01

    This article discusses the use of application-specific integrated circuits (ASICs) in nuclear plant safety systems. ASICs have certain advantages over software-based systems because they can be simple enough to be thoroughly tested, and they can be tailored to replace existing equipment. An architecture to replace a pressurized water reactor pressure channel trip is presented. Methods of implementing digital algorithms are also discussed

  10. Development of Integral Effect Test Facility P and ID and Technical Specification for SMART Fluid System

    International Nuclear Information System (INIS)

    Lee, Sang Il; Jung, Y. H.; Yang, H. J.; Song, S. Y.; Han, O. J.; Lee, B. J.; Kim, Y. A.; Lim, J. H.; Park, K. W.; Kim, N. G.

    2010-01-01

    SMART integral test loop is the thermal hydraulic test facility with a high pressure and temperature for simulating the major systems of the prototype reactor, SMART-330. The objective of this project is to conduct the basic design for constructing SMART ITL. The major results of this project include a series of design documents, technical specifications and P and ID. The results can be used as the fundamental materials for making the detailed design which is essential for manufacturing and installing SMART ITL

  11. Efficient site-specific integration in Plasmodium falciparum chromosomes mediated by mycobacteriophage Bxb1 integrase.

    Science.gov (United States)

    Nkrumah, Louis J; Muhle, Rebecca A; Moura, Pedro A; Ghosh, Pallavi; Hatfull, Graham F; Jacobs, William R; Fidock, David A

    2006-08-01

    Here we report an efficient, site-specific system of genetic integration into Plasmodium falciparum malaria parasite chromosomes. This is mediated by mycobacteriophage Bxb1 integrase, which catalyzes recombination between an incoming attP and a chromosomal attB site. We developed P. falciparum lines with the attB site integrated into the glutaredoxin-like cg6 gene. Transfection of these attB(+) lines with a dual-plasmid system, expressing a transgene on an attP-containing plasmid together with a drug resistance gene and the integrase on a separate plasmid, produced recombinant parasites within 2 to 4 weeks that were genetically uniform for single-copy plasmid integration. Integrase-mediated recombination resulted in proper targeting of parasite proteins to intra-erythrocytic compartments, including the apicoplast, a plastid-like organelle. Recombinant attB x attP parasites were genetically stable in the absence of drug and were phenotypically homogeneous. This system can be exploited for rapid genetic integration and complementation analyses at any stage of the P. falciparum life cycle, and it illustrates the utility of Bxb1-based integrative recombination for genetic studies of intracellular eukaryotic organisms.

  12. Integrating place-specific livelihood and equity outcomes into global assessments of bioenergy deployment

    International Nuclear Information System (INIS)

    Creutzig, Felix; Corbera, Esteve; Bolwig, Simon; Hunsberger, Carol

    2013-01-01

    Integrated assessment models suggest that the large-scale deployment of bioenergy could contribute to ambitious climate change mitigation efforts. However, such a shift would intensify the global competition for land, with possible consequences for 1.5 billion smallholder livelihoods that these models do not consider. Maintaining and enhancing robust livelihoods upon bioenergy deployment is an equally important sustainability goal that warrants greater attention. The social implications of biofuel production are complex, varied and place-specific, difficult to model, operationalize and quantify. However, a rapidly developing body of social science literature is advancing the understanding of these interactions. In this letter we link human geography research on the interaction between biofuel crops and livelihoods in developing countries to integrated assessments on biofuels. We review case-study research focused on first-generation biofuel crops to demonstrate that food, income, land and other assets such as health are key livelihood dimensions that can be impacted by such crops and we highlight how place-specific and global dynamics influence both aggregate and distributional outcomes across these livelihood dimensions. We argue that place-specific production models and land tenure regimes mediate livelihood outcomes, which are also in turn affected by global and regional markets and their resulting equilibrium dynamics. The place-specific perspective suggests that distributional consequences are a crucial complement to aggregate outcomes; this has not been given enough weight in comprehensive assessments to date. By narrowing the gap between place-specific case studies and global models, our discussion offers a route towards integrating livelihood and equity considerations into scenarios of future bioenergy deployment, thus contributing to a key challenge in sustainability sciences. (letter)

  13. Integrating place-specific livelihood and equity outcomes into global assessments of bioenergy deployment

    Science.gov (United States)

    Creutzig, Felix; Corbera, Esteve; Bolwig, Simon; Hunsberger, Carol

    2013-09-01

    Integrated assessment models suggest that the large-scale deployment of bioenergy could contribute to ambitious climate change mitigation efforts. However, such a shift would intensify the global competition for land, with possible consequences for 1.5 billion smallholder livelihoods that these models do not consider. Maintaining and enhancing robust livelihoods upon bioenergy deployment is an equally important sustainability goal that warrants greater attention. The social implications of biofuel production are complex, varied and place-specific, difficult to model, operationalize and quantify. However, a rapidly developing body of social science literature is advancing the understanding of these interactions. In this letter we link human geography research on the interaction between biofuel crops and livelihoods in developing countries to integrated assessments on biofuels. We review case-study research focused on first-generation biofuel crops to demonstrate that food, income, land and other assets such as health are key livelihood dimensions that can be impacted by such crops and we highlight how place-specific and global dynamics influence both aggregate and distributional outcomes across these livelihood dimensions. We argue that place-specific production models and land tenure regimes mediate livelihood outcomes, which are also in turn affected by global and regional markets and their resulting equilibrium dynamics. The place-specific perspective suggests that distributional consequences are a crucial complement to aggregate outcomes; this has not been given enough weight in comprehensive assessments to date. By narrowing the gap between place-specific case studies and global models, our discussion offers a route towards integrating livelihood and equity considerations into scenarios of future bioenergy deployment, thus contributing to a key challenge in sustainability sciences.

  14. Attention reorganizes connectivity across networks in a frequency specific manner

    DEFF Research Database (Denmark)

    Kwon, Soyoung; Watanabe, Masataka; Fischer, Elvira

    2017-01-01

    Attention allows our brain to focus its limited resources on a given task. It does so by selective modulation of neural activity and of functional connectivity (FC) across brain-wide networks. While there is extensive literature on activity changes, surprisingly few studies examined brain-wide FC...... modulations that can be cleanly attributed to attention compared to matched visual processing. In contrast to prior approaches, we used an ultra-long trial design that avoided transients from trial onsets, included slow fluctuations (...-segregated analyses. We found that FC derived from long blocks had a nearly two-fold higher gain compared to FC derived from traditional (short) block designs. Second, attention enhanced intrinsic (negative or positive) correlations across networks, such as between the default-mode network (DMN), the dorsal attention...

  15. Safe genetic modification of cardiac stem cells using a site-specific integration technique.

    Science.gov (United States)

    Lan, Feng; Liu, Junwei; Narsinh, Kazim H; Hu, Shijun; Han, Leng; Lee, Andrew S; Karow, Marisa; Nguyen, Patricia K; Nag, Divya; Calos, Michele P; Robbins, Robert C; Wu, Joseph C

    2012-09-11

    Human cardiac progenitor cells (hCPCs) are a promising cell source for regenerative repair after myocardial infarction. Exploitation of their full therapeutic potential may require stable genetic modification of the cells ex vivo. Safe genetic engineering of stem cells, using facile methods for site-specific integration of transgenes into known genomic contexts, would significantly enhance the overall safety and efficacy of cellular therapy in a variety of clinical contexts. We used the phiC31 site-specific recombinase to achieve targeted integration of a triple fusion reporter gene into a known chromosomal context in hCPCs and human endothelial cells. Stable expression of the reporter gene from its unique chromosomal integration site resulted in no discernible genomic instability or adverse changes in cell phenotype. Namely, phiC31-modified hCPCs were unchanged in their differentiation propensity, cellular proliferative rate, and global gene expression profile when compared with unaltered control hCPCs. Expression of the triple fusion reporter gene enabled multimodal assessment of cell fate in vitro and in vivo using fluorescence microscopy, bioluminescence imaging, and positron emission tomography. Intramyocardial transplantation of genetically modified hCPCs resulted in significant improvement in myocardial function 2 weeks after cell delivery, as assessed by echocardiography (P=0.002) and MRI (P=0.001). We also demonstrated the feasibility and therapeutic efficacy of genetically modifying differentiated human endothelial cells, which enhanced hind limb perfusion (Pmodification system is a safe, efficient tool to enable site-specific integration of reporter transgenes in progenitor and differentiated cell types.

  16. Integrating place-specific livelihood and equity outcomes into global assessments of bioenergy deployment

    DEFF Research Database (Denmark)

    Creutzig, Felix; Corbera, Esteve; Bolwig, Simon

    2013-01-01

    -study research focused on first-generation biofuel crops to demonstrate that food, income, land and other assets such as health are key livelihood dimensions that can be impacted by such crops and we highlight how place-specific and global dynamics influence both aggregate and distributional outcomes across......Integrated assessment models suggest that the large-scale deployment of bioenergy could contribute to ambitious climate change mitigation efforts. However, such a shift would intensify the global competition for land, with possible consequences for 1.5 billion smallholder livelihoods...... these livelihood dimensions. We argue that place-specific production models and land tenure regimes mediate livelihood outcomes, which are also in turn affected by global and regional markets and their resulting equilibrium dynamics. The place-specific perspective suggests that distributional consequences...

  17. Integrating Hypnosis with Other Therapies for Treating Specific Phobias: A Case Series.

    Science.gov (United States)

    Hirsch, Joseph A

    2018-04-01

    There is a high prevalence of anxiety disorders including specific phobias and panic disorder in the United States and Europe. A variety of therapeutic modalities including pharmacotherapy, cognitive behavioral therapy, systematic desensitization, hypnosis, in vivo exposure, and virtual reality exposure therapy have been applied. No one modality has been entirely successful. There has been only a limited attempt to combine psychological therapies in the treatment of specific phobias and panic disorder and what has been done has been primarily with systematic desensitization or cognitive behavioral therapy along with hypnotherapy. I present two cases of multiple specific phobias that were successfully treated with hypnotherapy combined with virtual reality exposure therapy or in vivo exposure therapy. The rationale for this integrative therapy and the neurobiological constructs are considered.

  18. Kant, Xunzi and the Artificiality of Manners

    Directory of Open Access Journals (Sweden)

    Anja BERNINGER

    2017-01-01

    Full Text Available Both Chinese and Western philosophers have argued for the ethical importance of manners. Their approaches are sometimes criticized on the grounds that manners are artificial. I compare Xunzi’s and Kant’s responses to this claim, and discuss the relevance of both positions for the development of a theory of manners. I show that there is no single artificiality claim, but rather four different claims: the claim that polite behavior lacks spontaneity, the claim that it is insincere, the claim that it goes against human nature, and the claim that it is arbitrary. While Kant is mainly concerned with the insincerity claim, Xunzi focusses on the claim that manners are arbitrary rules. Because of their different understandings of the function of manners both authors only provide a partial answer to the artificiality claim. To arrive at a full account of manners both perspectives must be combined.

  19. INTEGRATING COUNTRY-SPECIFIC CULTURE IN THE BRANDING STRATEGY FOR BUILDING GLOBAL SUCCESS

    Directory of Open Access Journals (Sweden)

    Alexandra IOANID

    2014-11-01

    Full Text Available A strong brand is the one that integrates its cultural origins and values with the cultural values of the countries where it operates, building relationships based on trust with the local consumers. The chances for a company to gain share market when starting operations in a new country grows a lot if the management allows enough regional flexibility on how the brands are marketed, according to the cultural characteristics of the potential local customers. In the actual globalized business environment, the brand marketer has the choice to adopt a global or a local approach in the marketing strategy, that most of the times determines the success or the failure of the business in a specific country. An important challenge for any marketer is the integration of the brand-culture with the country-culture and in this context, the paper analyses different cultures and offers some branding strategies valid for both products and services. This paper aims to demonstrate the importance of the country-specific culture integration in the marketing strategy of a company for growing the effectiveness of all its operations. The ideas mentioned in this paper are based on literature research and also on authors’ experience with multicultural environments.

  20. Operational Excellence through Schedule Optimization and Production Simulation of Application Specific Integrated Circuits.

    Energy Technology Data Exchange (ETDEWEB)

    Flory, John Andrew [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Padilla, Denise D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Gauthier, John H. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Zwerneman, April Marie [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Miller, Steven P [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-05-01

    Upcoming weapon programs require an aggressive increase in Application Specific Integrated Circuit (ASIC) production at Sandia National Laboratories (SNL). SNL has developed unique modeling and optimization tools that have been instrumental in improving ASIC production productivity and efficiency, identifying optimal operational and tactical execution plans under resource constraints, and providing confidence in successful mission execution. With ten products and unprecedented levels of demand, a single set of shared resources, highly variable processes, and the need for external supplier task synchronization, scheduling is an integral part of successful manufacturing. The scheduler uses an iterative multi-objective genetic algorithm and a multi-dimensional performance evaluator. Schedule feasibility is assessed using a discrete event simulation (DES) that incorporates operational uncertainty, variability, and resource availability. The tools provide rapid scenario assessments and responses to variances in the operational environment, and have been used to inform major equipment investments and workforce planning decisions in multiple SNL facilities.

  1. Integrating Iris and Signature Traits for Personal Authentication Using User-SpecificWeighting

    Directory of Open Access Journals (Sweden)

    Serestina Viriri

    2012-03-01

    Full Text Available Biometric systems based on uni-modal traits are characterized by noisy sensor data, restricted degrees of freedom, non-universality and are susceptible to spoof attacks. Multi-modal biometric systems seek to alleviate some of these drawbacks by providing multiple evidences of the same identity. In this paper, a user-score-based weighting technique for integrating the iris and signature traits is presented. This user-specific weighting technique has proved to be an efficient and effective fusion scheme which increases the authentication accuracy rate of multi-modal biometric systems. The weights are used to indicate the importance of matching scores output by each biometrics trait. The experimental results show that our biometric system based on the integration of iris and signature traits achieve a false rejection rate (FRR of 0.08% and a false acceptance rate (FAR of 0.01%.

  2. Integrative characterization of germ cell-specific genes from mouse spermatocyte UniGene library

    Directory of Open Access Journals (Sweden)

    Eddy Edward M

    2007-07-01

    Full Text Available Abstract Background The primary regulator of spermatogenesis, a highly ordered and tightly regulated developmental process, is an intrinsic genetic program involving male germ cell-specific genes. Results We analyzed the mouse spermatocyte UniGene library containing 2155 gene-oriented transcript clusters. We predict that 11% of these genes are testis-specific and systematically identified 24 authentic genes specifically and abundantly expressed in the testis via in silico and in vitro approaches. Northern blot analysis disclosed various transcript characteristics, such as expression level, size and the presence of isoform. Expression analysis revealed developmentally regulated and stage-specific expression patterns in all of the genes. We further analyzed the genes at the protein and cellular levels. Transfection assays performed using GC-2 cells provided information on the cellular characteristics of the gene products. In addition, antibodies were generated against proteins encoded by some of the genes to facilitate their identification and characterization in spermatogenic cells and sperm. Our data suggest that a number of the gene products are implicated in transcriptional regulation, nuclear integrity, sperm structure and motility, and fertilization. In particular, we found for the first time that Mm.333010, predicted to contain a trypsin-like serine protease domain, is a sperm acrosomal protein. Conclusion We identify 24 authentic genes with spermatogenic cell-specific expression, and provide comprehensive information about the genes. Our findings establish a new basis for future investigation into molecular mechanisms underlying male reproduction.

  3. Integration of Descending Command Systems for the Generation of Context-Specific Locomotor Behaviors

    Directory of Open Access Journals (Sweden)

    Linda H. Kim

    2017-10-01

    Full Text Available Over the past decade there has been a renaissance in our understanding of spinal cord circuits; new technologies are beginning to provide key insights into descending circuits which project onto spinal cord central pattern generators. By integrating work from both the locomotor and animal behavioral fields, we can now examine context-specific control of locomotion, with an emphasis on descending modulation arising from various regions of the brainstem. Here we examine approach and avoidance behaviors and the circuits that lead to the production and arrest of locomotion.

  4. Design and Verification of Application Specific Integrated Circuits in a Network of Online Labs

    Directory of Open Access Journals (Sweden)

    A.Y. Al-Zoubi

    2009-08-01

    Full Text Available A solution to implement a remote laboratory for testing and designing analog Application-Specific Integrated Circuits of the type (ispPAC10 is presented. The application allows electrical engineering students to access and perform measurements and conduct analog electronics experiments over the internet. PAC-Designer software, running on a Citrix server, is used in the circuit design in which the signals are generated and the responses are acquired by a data acquisition board controlled by LabVIEW. Three interconnected remote labs located in three different continents will be implementing the proposed system.

  5. A Domain Specific Embedded Language in C++ for Automatic Differentiation, Projection, Integration and Variational Formulations

    Directory of Open Access Journals (Sweden)

    Christophe Prud'homme

    2006-01-01

    Full Text Available In this article, we present a domain specific embedded language in C++ that can be used in various contexts such as numerical projection onto a functional space, numerical integration, variational formulations and automatic differentiation. Albeit these tools operate in different ways, the language overcomes this difficulty by decoupling expression constructions from evaluation. The language is implemented using expression templates and meta-programming techniques and uses various Boost libraries. The language is exercised on a number of non-trivial examples and a benchmark presents the performance behavior on a few test problems.

  6. CEO Appointments and the Loss of Firm-specific Knowledge - Putting Integrity Back into Hiring Decisions

    DEFF Research Database (Denmark)

    Rost, Katja; Salomo, Søren

    2008-01-01

    the last thirty years. Assuming that general managerial skills are becoming more important relative to firm-specific skills, the authors conclude that competition in the managerial labor market establishes optimal contracts. In our model and our empirical analysis we question this explanation by assuming...... that over the past decades the dishonesty of the predecessor has become relatively more important for the appointment decisions of firms. We conclude that outside hires are a suboptimal trend because external candidates even step up the regression of integrity in firms: As nobody has an incentive to invest...

  7. CEO Appointments and the Loss of Firm-Specific Knowledge - Putting Integrity Back into Hiring Decisions

    DEFF Research Database (Denmark)

    Rost, Katja; Salomo, Søren; Osterloh, Margit

    2008-01-01

    the last thirty years. Assuming that general managerial skills are becoming more important relative to firm-specific skills, the authors conclude that competition in the managerial labor market establishes optimal contracts. In our model and our empirical analysis we question this explanation by assuming...... that over the past decades the dishonesty of the predecessor has become relatively more important for the appointment decisions of firms. We conclude that outside hires are a suboptimal trend because external candidates even step up the regression of integrity in firms: As nobody has an incentive to invest...

  8. Field Assessment and Specification Review for Roller-Integrated Compaction Monitoring Technologies

    Directory of Open Access Journals (Sweden)

    David J. White

    2011-01-01

    Full Text Available Roller-integrated compaction monitoring (RICM technologies provide virtually 100-percent coverage of compacted areas with real-time display of the compaction measurement values. Although a few countries have developed quality control (QC and quality assurance (QA specifications, broader implementation of these technologies into earthwork construction operations still requires a thorough understanding of relationships between RICM values and traditional in situ point test measurements. The purpose of this paper is to provide: (a an overview of two technologies, namely, compaction meter value (CMV and machine drive power (MDP; (b a comprehensive review of field assessment studies, (c an overview of factors influencing statistical correlations, (d modeling for visualization and characterization of spatial nonuniformity; and (e a brief review of the current specifications.

  9. Testing Requirements to Manage Data Exchange Specifications in Enterprise Integration - A Schema Design Quality Focus.

    Energy Technology Data Exchange (ETDEWEB)

    Kulvatunyou, Boonserm [ORNL; Ivezic, Nenad [ORNL; Buhwan, Jeong [POSTECH University, South Korea

    2004-07-01

    In this paper, we describe the requirements to test W3C XML Schema usage when defining message schemas for data exchange in any large and evolving enterprise integration project. We then decompose the XML Schema testing into four (4) aspects including the message schema conformance to the XML Schema specification grammar, the message schema conformance to the XML Schema specification semantics, the message schema conformance to design quality testing, and canonical semantics testing of the message schema. We describe these four testing aspects in some detail and point to other related efforts. We further focus to provide some technical details for the message schema design quality testing. As a future work, we describe the requirements for canonical semantics testing and potential solution approaches. Finally, we describe an implementation architecture for the message schema design quality testing.

  10. Issues of verification and validation of application-specific integrated circuits in reactor trip systems

    International Nuclear Information System (INIS)

    Battle, R.E.; Alley, G.T.

    1993-01-01

    Concepts of using application-specific integrated circuits (ASICs) in nuclear reactor safety systems are evaluated. The motivation for this evaluation stems from the difficulty of proving that software-based protection systems are adequately reliable. Important issues concerning the reliability of computers and software are identified and used to evaluate features of ASICS. These concepts indicate that ASICs have several advantages over software for simple systems. The primary advantage of ASICs over software is that verification and validation (V ampersand V) of ASICs can be done with much higher confidence than can be done with software. A method of performing this V ampersand V on ASICS is being developed at Oak Ridge National Laboratory. The purpose of the method's being developed is to help eliminate design and fabrication errors. It will not solve problems with incorrect requirements or specifications

  11. [Integrity].

    Science.gov (United States)

    Gómez Rodríguez, Rafael Ángel

    2014-01-01

    To say that someone possesses integrity is to claim that that person is almost predictable about responses to specific situations, that he or she can prudentially judge and to act correctly. There is a closed interrelationship between integrity and autonomy, and the autonomy rests on the deeper moral claim of all humans to integrity of the person. Integrity has two senses of significance for medical ethic: one sense refers to the integrity of the person in the bodily, psychosocial and intellectual elements; and in the second sense, the integrity is the virtue. Another facet of integrity of the person is la integrity of values we cherish and espouse. The physician must be a person of integrity if the integrity of the patient is to be safeguarded. The autonomy has reduced the violations in the past, but the character and virtues of the physician are the ultimate safeguard of autonomy of patient. A field very important in medicine is the scientific research. It is the character of the investigator that determines the moral quality of research. The problem arises when legitimate self-interests are replaced by selfish, particularly when human subjects are involved. The final safeguard of moral quality of research is the character and conscience of the investigator. Teaching must be relevant in the scientific field, but the most effective way to teach virtue ethics is through the example of the a respected scientist.

  12. Systematic identification and integrative analysis of novel genes expressed specifically or predominantly in mouse epididymis

    Directory of Open Access Journals (Sweden)

    Lee Hoyong

    2006-12-01

    Full Text Available Abstract Background Maturation of spermatozoa, including development of motility and the ability to fertilize the oocyte, occurs during transit through the microenvironment of the epididymis. Comprehensive understanding of sperm maturation requires identification and characterization of unique genes expressed in the epididymis. Results We systematically identified 32 novel genes with epididymis-specific or -predominant expression in the mouse epididymis UniGene library, containing 1505 gene-oriented transcript clusters, by in silico and in vitro analyses. The Northern blot analysis revealed various characteristics of the genes at the transcript level, such as expression level, size and the presence of isoform. We found that expression of the half of the genes is regulated by androgens. Further expression analyses demonstrated that the novel genes are region-specific and developmentally regulated. Computational analysis showed that 15 of the genes lack human orthologues, suggesting their implication in male reproduction unique to the mouse. A number of the novel genes are putative epididymal protease inhibitors or β-defensins. We also found that six of the genes have secretory activity, indicating that they may interact with sperm and have functional roles in sperm maturation. Conclusion We identified and characterized 32 novel epididymis-specific or -predominant genes by an integrative approach. Our study is unique in the aspect of systematic identification of novel epididymal genes and should be a firm basis for future investigation into molecular mechanisms underlying sperm maturation in the epididymis.

  13. Aplikasi Pembelajaran Table Manners Berbasis Multimedia

    OpenAIRE

    Yosanny, Agustinna; Pradipta, Albert; Viles, Dody; Pensen, Pensen

    2011-01-01

    Table manners adalah aturan-aturan pokok yang berlaku di meja makan. Aturan ini biasanya diterapkan padajamuan makan resmi. Penelitian ini bertujuan untuk merancang dan mengembangkan suatu aplikasipembelajaran tentang table manners untuk memudahkan dalam mempelajari aturan-aturan yang perlu diketahuidalam jamuan makan resmi, meliputi etika sebelum dan saat proses menyantap makanan, serta penggunaanalat-alat makan. Metode penelitian yang digunakan adalah metode Interactive Multimedia System De...

  14. Test and verification of a reactor protection system application-specific integrated circuit

    International Nuclear Information System (INIS)

    Battle, R.E.; Turner, G.W.; Vandermolen, R.I.; Vitalbo, C.

    1997-01-01

    Application-specific integrated circuits (ASICs) were utilized in the design of nuclear plant safety systems because they have certain advantages over software-based systems and analog-based systems. An advantage they have over software-based systems is that an ASIC design can be simple enough to not include branch statements and also can be thoroughly tested. A circuit card on which an ASIC is mounted can be configured to replace various versions of older analog equipment with fewer design types required. The approach to design and testing of ASICs for safety system applications is discussed in this paper. Included are discussions of the ASIC architecture, how it is structured to assist testing, and of the functional and enhanced circuit testing

  15. Differential and Integral Calculus in careers of technical sciences. Specificities of their teaching

    Directory of Open Access Journals (Sweden)

    Iván Javier Villamar-Alvarado

    2017-12-01

    Full Text Available The Differential and Integral Calculus has great relevance for the professionals of the technical sciences since it provides them with a solid theoretical-conceptual body to process information, to use models that simulate real processes, to solve technical problems, to work in multidisciplinary projects and to communicate with precision. In spite of this relevance, there are numerous international dissatisfactions related to their learning by training engineers. The objective was to unveil the specificities of the teaching-learning process of this discipline that favor a successful appropriation of its content by the future engineers. The result was to unveil the didactic need to resolve the dialectical contradiction that manifests itself between the systematization of the engineering functionality of the aforementioned content and its contextualized interdisciplinary generalization. As a consequence, the need arises to create new didactic proposals that overcome this contradiction, as a way to perfect the teaching-learning process of this discipline in the engineering careers.

  16. An application specific integrated circuit and data acquisition system for digital X-ray imaging

    International Nuclear Information System (INIS)

    Beuville, E.; Cederstroem, B.; Danielsson, M.; Luo, L.; Nygren, D.; Oltman, E.; Vestlund, J.

    1998-01-01

    We have developed an application specific integrated circuit (ASIC) and data acquisition system for digital X-ray imaging. The chip consists of 16 parallel channels, each containing preamplifier, shaper, comparator and a 16 bit counter. We have demonstrated noiseless single-photon counting over a threshold of 7.2 keV using Silicon detectors and are presently capable of maximum counting rates of 2 MHz per channel. The ASIC is controlled by a personal computer through a commercial PCI card, which is also used for data acquisition. The content of the 16 bit counters are loaded into a shift register and transferred to the PC at any time at a rate of 20 MHz. The system is non-complicated, low cost and high performance and is optimised for digital X-ray imaging applications. (orig.)

  17. Application specific integrated circuit (ASIC) readout technologies for future ion beam analytical instruments

    Energy Technology Data Exchange (ETDEWEB)

    Whitlow, Harry J. E-mail: harry_j.whitlow@nuclear.lu.se

    2000-03-01

    New possibilities for ion beam analysis (IBA) are afforded by recent developments in detector technology which facilitate the parallel collection of data from a large number of channels. Application specific integrated circuit (ASIC) technologies, which have been widely employed for multi-channel readout systems in nuclear and particle physics, are more net-cost effective (160/channel for 1000 channels) and a more rational solution for readout of a large number of channels than afforded by conventional electronics. Based on results from existing and on-going chip designs, the possibilities and issues of ASIC readout technology are considered from the IBA viewpoint. Consideration is given to readout chip architecture and how the stringent resolution, linearity and stability requirements for IBA may be met. In addition the implications of the restrictions imposed by ASIC technology are discussed.

  18. An application specific integrated circuit and data acquisition system for digital X-ray imaging

    Energy Technology Data Exchange (ETDEWEB)

    Beuville, E.; Cederstroem, B.; Danielsson, M.; Luo, L.; Nygren, D.; Oltman, E.; Vestlund, J. [Lawrence Berkeley National Lab., CA (United States)

    1998-04-01

    We have developed an application specific integrated circuit (ASIC) and data acquisition system for digital X-ray imaging. The chip consists of 16 parallel channels, each containing preamplifier, shaper, comparator and a 16 bit counter. We have demonstrated noiseless single-photon counting over a threshold of 7.2 keV using Silicon detectors and are presently capable of maximum counting rates of 2 MHz per channel. The ASIC is controlled by a personal computer through a commercial PCI card, which is also used for data acquisition. The content of the 16 bit counters are loaded into a shift register and transferred to the PC at any time at a rate of 20 MHz. The system is non-complicated, low cost and high performance and is optimised for digital X-ray imaging applications. (orig.). 11 refs.

  19. Sport Skill-Specific Expertise Biases Sensory Integration for Spatial Referencing and Postural Control.

    Science.gov (United States)

    Thalassinos, Michalis; Fotiadis, Giorgos; Arabatzi, Fotini; Isableu, Brice; Hatzitaki, Vassilia

    2017-09-15

    The authors asked how sport expertise modulates visual field dependence and sensory reweighting for controlling posture. Experienced soccer athletes, ballet dancers, and nonathletes performed (a) a Rod and Frame test and (b) a 100-s bipedal stance task during which vision and proprioception were successively or concurrently disrupted in 20-s blocks. Postural adaptation was assessed in the mean center of pressure displacement, root mean square of center of pressure velocity and ankle muscles integrated electromyography activity. Soccer athletes were more field dependent than were nonathletes. During standing, dancers were more destabilized by vibration and required more time to reweigh sensory information compared with the other 2 groups. These findings reveal a sport skill-specific bias in the reweighing of sensory inputs for spatial orientation and postural control.

  20. Direct effects of ionizing radiation on integral membrane proteins. Noncovalent energy transfer requires specific interpeptide interactions

    International Nuclear Information System (INIS)

    Jhun, E.; Jhun, B.H.; Jones, L.R.; Jung, C.Y.

    1991-01-01

    The 12 transmembrane alpha helices (TMHs) of human erythrocyte glucose transporter were individually cut by pepsin digestion as membrane-bound 2.5-3.5-kDa peptide fragments. Radiation-induced chemical degradation of these fragments showed an average target size of 34 kDa. This is 10-12 x larger than the average size of an individual TMH, demonstrating that a significant energy transfer occurs among these TMHs in the absence of covalent linkage. Heating this TMH preparation at 100 degree C for 15 min reduced the target size to 5 kDa or less, suggesting that the noncovalent energy transfer requires specific helix-helix interactions. Purified phospholamban, a small (6-kDa) integral membrane protein containing a single TMH, formed a pentameric assembly in sodium dodecyl sulfate. The chemical degradation target size of this phospholamban pentamer was 5-6 kDa, illustrating that not all integral membrane protein assemblies permit intersubunit energy transfer. These findings together with other published observations suggest strongly that significant noncovalent energy transfer can occur within the tertiary and quaternary structure of membrane proteins and that as yet undefined proper molecular interactions are required for such covalent energy transfer. Our results with pepsin-digested glucose transporter also illustrate the importance of the interhelical interaction as a predominating force in maintaining the tertiary structure of a transmembrane protein

  1. Hanford Integrated Planning Process: 1993 Hanford Site-specific science and technology plan

    International Nuclear Information System (INIS)

    1993-12-01

    This document is the FY 1993 report on Hanford Site-specific science and technology (S ampersand T) needs for cleanup of the Site as developed via the Hanford Integrated Planning Process (HIPP). It identifies cleanup problems that lack demonstrated technology solutions and technologies that require additional development. Recommendations are provided regarding allocation of funding to address Hanford's highest-priority technology improvement needs, technology development needs, and scientific research needs, all compiled from a Sitewide perspective. In the past, the S ampersand T agenda for Hanford Site cleanup was sometimes driven by scientists and technologists, with minimal input from the ''problem owners'' (i.e., Westinghouse Hanford Company [WHC] staff who are responsible for cleanup activities). At other times, the problem-owners made decisions to proceed with cleanup without adequate scientific and technological inputs. Under both of these scenarios, there was no significant stakeholder involvement in the decision-making process. One of the key objectives of HIPP is to develop an understanding of the integrated S ampersand T requirements to support the cleanup mission, (a) as defined by the needs of the problem owners, the values of the stakeholders, and the technology development expertise that exists at Hanford and elsewhere. This requires a periodic, systematic assessment of these needs and values to appropriately define a comprehensive technology development program and a complementary scientific research program. Basic to our success is a methodology that is defensible from a technical perspective and acceptable to the stakeholders

  2. System/subsystem specifications for the Worldwide Port System (WPS) Regional Integrated Cargo Database (ICDB)

    Energy Technology Data Exchange (ETDEWEB)

    Rollow, J.P.; Shipe, P.C.; Truett, L.F. [Oak Ridge National Lab., TN (United States); Faby, E.Z.; Fluker, J.; Grubb, J.; Hancock, B.R. [Univ. of Tennessee, Knoxville, TN (United States); Ferguson, R.A. [Science Applications International Corp., Oak Ridge, TN (United States)

    1995-11-20

    A system is being developed by the Military Traffic Management Command (MTMC) to provide data integration and worldwide management and tracking of surface cargo movements. The Integrated Cargo Database (ICDB) will be a data repository for the WPS terminal-level system, will be a primary source of queries and cargo traffic reports, will receive data from and provide data to other MTMC and non-MTMC systems, will provide capabilities for processing Advance Transportation Control and Movement Documents (ATCMDs), and will process and distribute manifests. This System/Subsystem Specifications for the Worldwide Port System Regional ICDB documents the system/subsystem functions, provides details of the system/subsystem analysis in order to provide a communication link between developers and operational personnel, and identifies interfaces with other systems and subsystems. It must be noted that this report is being produced near the end of the initial development phase of ICDB, while formal software testing is being done. Following the initial implementation of the ICDB system, maintenance contractors will be in charge of making changes and enhancing software modules. Formal testing and user reviews may indicate the need for additional software units or changes to existing ones. This report describes the software units that are components of this ICDB system as of August 1995.

  3. A High-Performance Application Specific Integrated Circuit for Electrical and Neurochemical Traumatic Brain Injury Monitoring.

    Science.gov (United States)

    Pagkalos, Ilias; Rogers, Michelle L; Boutelle, Martyn G; Drakakis, Emmanuel M

    2018-05-22

    This paper presents the first application specific integrated chip (ASIC) for the monitoring of patients who have suffered a Traumatic Brain Injury (TBI). By monitoring the neurophysiological (ECoG) and neurochemical (glucose, lactate and potassium) signals of the injured human brain tissue, it is possible to detect spreading depolarisations, which have been shown to be associated with poor TBI patient outcome. This paper describes the testing of a new 7.5 mm 2 ASIC fabricated in the commercially available AMS 0.35 μm CMOS technology. The ASIC has been designed to meet the demands of processing the injured brain tissue's ECoG signals, recorded by means of depth or brain surface electrodes, and neurochemical signals, recorded using microdialysis coupled to microfluidics-based electrochemical biosensors. The potentiostats use switchedcapacitor charge integration to record currents with 100 fA resolution, and allow automatic gain changing to track the falling sensitivity of a biosensor. This work supports the idea of a "behind the ear" wireless microplatform modality, which could enable the monitoring of currently non-monitored mobile TBI patients for the onset of secondary brain injury. ©2018 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  4. An integrated domain specific language for post-processing and visualizing electrophysiological signals in Java.

    Science.gov (United States)

    Strasser, T; Peters, T; Jagle, H; Zrenner, E; Wilke, R

    2010-01-01

    Electrophysiology of vision - especially the electroretinogram (ERG) - is used as a non-invasive way for functional testing of the visual system. The ERG is a combined electrical response generated by neural and non-neuronal cells in the retina in response to light stimulation. This response can be recorded and used for diagnosis of numerous disorders. For both clinical practice and clinical trials it is important to process those signals in an accurate and fast way and to provide the results as structured, consistent reports. Therefore, we developed a freely available and open-source framework in Java (http://www.eye.uni-tuebingen.de/project/idsI4sigproc). The framework is focused on an easy integration with existing applications. By leveraging well-established software patterns like pipes-and-filters and fluent interfaces as well as by designing the application programming interfaces (API) as an integrated domain specific language (DSL) the overall framework provides a smooth learning curve. Additionally, it already contains several processing methods and visualization features and can be extended easily by implementing the provided interfaces. In this way, not only can new processing methods be added but the framework can also be adopted for other areas of signal processing. This article describes in detail the structure and implementation of the framework and demonstrate its application through the software package used in clinical practice and clinical trials at the University Eye Hospital Tuebingen one of the largest departments in the field of visual electrophysiology in Europe.

  5. Integrating English for Specific Purposes Courseware into Task-Based Learning in a Context of Preparing for International Trade Fairs

    Science.gov (United States)

    Tsai, Shu-Chiao

    2013-01-01

    This study reports on integrating courseware for participating in international trade fairs into English for specific purposes (ESP) instruction at a technical university in Taiwan. An Information and Communication Technology (ICT) approach combining courseware integration with Task Based Learning (TBL), was adopted. Evaluation of implementing…

  6. Autonomous Integrated Receive System (AIRS) requirements definition. Volume 4: Functional specification for the prototype Automated Integrated Receive System (AIRS)

    Science.gov (United States)

    Chie, C. M.

    1984-01-01

    The functional requirements for the performance, design, and testing for the prototype Automated Integrated Receive System (AIRS) to be demonstrated for the TDRSS S-Band Single Access Return Link are presented.

  7. Region-specific role for Pten in maintenance of epithelial phenotype and integrity

    Science.gov (United States)

    Flodby, Per; Sunohara, Mitsuhiro; Castillo, Dan R.; McConnell, Alicia M.; Krishnaveni, Manda S.; Banfalvi, Agnes; Li, Min; Stripp, Barry; Zhou, Beiyun; Crandall, Edward D.; Minoo, Parviz

    2017-01-01

    Previous studies have demonstrated resistance to naphthalene-induced injury in proximal airways of mice with lung epithelial-specific deletion of the tumor-suppressor gene Pten, attributed to increased proliferation of airway progenitors. We tested effects of Pten loss following bleomycin injury, a model typically used to study distal lung epithelial injury, in conditional PtenSFTPC-cre knockout mice. Pten-deficient airway epithelium exhibited marked hyperplasia, particularly in small bronchioles and at bronchoalveolar duct junctions, with reduced E-cadherin and β-catenin expression between cells toward the luminal aspect of the hyperplastic epithelium. Bronchiolar epithelial and alveolar epithelial type II (AT2) cells in PtenSFTPC-cre mice showed decreased expression of epithelial markers and increased expression of mesenchymal markers, suggesting at least partial epithelial-mesenchymal transition at baseline. Surprisingly, and in contrast to previous studies, mutant mice were exquisitely sensitive to bleomycin, manifesting rapid weight loss, respiratory distress, increased early mortality (by day 5), and reduced dynamic lung compliance. This was accompanied by sloughing of the hyperplastic airway epithelium with occlusion of small bronchioles by cellular debris, without evidence of increased parenchymal lung injury. Increased airway epithelial cell apoptosis due to loss of antioxidant defenses, reflected by decreased expression of superoxide dismutase 3, in combination with deficient intercellular adhesion, likely predisposed to airway sloughing in knockout mice. These findings demonstrate an important role for Pten in maintenance of airway epithelial phenotype integrity and indicate that responses to Pten deletion in respiratory epithelium following acute lung injury are highly context-dependent and region-specific. PMID:27864284

  8. Growth specificity of vertical ZnO nanorods on patterned seeded substrates through integrated chemical process

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, P. Suresh [Thin Film and Nanomaterials Laboratory, Department of Physics, Bharathiar University, Coimbatore 641 046 (India); Maniam, S.M. [Centre for Quantum Technologies, National University of Singapore (Singapore); Sundaramurthy, J. [Department of Chemical and Biomolecular Engineering, National University of Singapore (NUS) (Singapore); Arokiaraj, J. [3M R and D Center (Singapore); Mangalaraj, D., E-mail: dmraj800@yahoo.com [Department of Nanoscience and Technology, Bharathiar University, Coimbatore 641046 (India); Rajarathnam, D. [CERAR, University of South Australia, Mawson Lakes, SA-5095 (Australia); Srinivasan, M.P. [Department of Chemical and Biomolecular Engineering, National University of Singapore (NUS) (Singapore); Jian, L.K. [Singapore Synchrotron Light Source (SSLS), National University of Singapore (NUS) (Singapore)

    2012-03-15

    Highlights: Black-Right-Pointing-Pointer Simple integrated chemical process was adopted for specific ZnO nanorod growth. Black-Right-Pointing-Pointer Size and orientation of nanorods are well controlled by optimum reaction time and temperature. Black-Right-Pointing-Pointer Different site-selective ZnO nanorod growths are demonstrated. - Abstract: A simple and cost effective method has been employed for the random growth and oriented ZnO nanorod arrays over as-prepared and patterned seeded glass substrates by low temperature two step growth process and growth specificity by direct laser writing (DLW) process. Scanning electron microscopy (SEM) images and X-ray diffraction analysis confirm the growth of vertical ZnO nanorods with perfect (0 0 2) orientation along c-axis which is in conjunction with optimizing the parameters at different reaction times and temperatures. Transmission electron microscopy (TEM) images show the formation of vertical ZnO nanorods with diameter and length of {approx}120 nm and {approx}400 nm respectively. Photoluminescence (PL) spectroscopic studies show a narrow emission at {approx}385 nm and a broad visible emission from 450 to 600 nm. Further, site-selective ZnO nanorod growth is demonstrated for its high degree of control over size, orientation, uniformity, and periodicity on a positive photoresist ZnO seed layer by simple geometrical (line, circle and ring) patterns of 10 {mu}m and 5 {mu}m dimensions. The demonstrated control over size, orientation and periodicity of ZnO nanorods process opens up an opportunity to develop multifunctional properties which promises their potential applications in sensor, piezoelectric, and optoelectronic devices.

  9. Linux OS integrated modular avionics application development framework with apex API of ARINC653 specification

    Directory of Open Access Journals (Sweden)

    Anna V. Korneenkova

    2017-01-01

    Full Text Available The framework is made to provide tools to develop the integrated modular avionics (IMA applications, which could be launched on the target platform LynxOs-178 without modifying their source code. The framework usage helps students to form skills for developing modern modules of the avionics. In addition, students obtain deeper knowledge for the development of competencies in the field of technical creativity by using of the framework.The article describes the architecture and implementation of the Linux OS framework for ARINC653 compliant OS application development.The proposed approach reduces ARINC-653 application development costs and gives a unified tool to implement OS vendor independent code that meets specification. To achieve import substitution free and open-source Linux OS is used as an environment for developing IMA applications.The proposed framework is applicable for using as the tool to develop IMA applications and as the tool for development of the following competencies: the ability to master techniques of using software to solve practical problems, the ability to develop components of hardware and software systems and databases, using modern tools and programming techniques, the ability to match hardware and software tools in the information and automated systems, the readiness to apply the fundamentals of informatics and programming to designing, constructing and testing of software products, the readiness to apply basic methods and tools of software development, knowledge of various technologies of software development.

  10. Applying an Integrative Framework of Executive Function to Preschoolers With Specific Language Impairment.

    Science.gov (United States)

    Kapa, Leah L; Plante, Elena; Doubleday, Kevin

    2017-08-16

    The first goal of this research was to compare verbal and nonverbal executive function abilities between preschoolers with and without specific language impairment (SLI). The second goal was to assess the group differences on 4 executive function components in order to determine if the components may be hierarchically related as suggested within a developmental integrative framework of executive function. This study included 26 4- and 5-year-olds diagnosed with SLI and 26 typically developing age- and sex-matched peers. Participants were tested on verbal and nonverbal measures of sustained selective attention, working memory, inhibition, and shifting. The SLI group performed worse compared with typically developing children on both verbal and nonverbal measures of sustained selective attention and working memory, the verbal inhibition task, and the nonverbal shifting task. Comparisons of standardized group differences between executive function measures revealed a linear increase with the following order: working memory, inhibition, shifting, and sustained selective attention. The pattern of results suggests that preschoolers with SLI have deficits in executive functioning compared with typical peers, and deficits are not limited to verbal tasks. A significant linear relationship between group differences across executive function components supports the possibility of a hierarchical relationship between executive function skills.

  11. Applying an Integrative Framework of Executive Function to Preschoolers With Specific Language Impairment

    Science.gov (United States)

    Plante, Elena; Doubleday, Kevin

    2017-01-01

    Purpose The first goal of this research was to compare verbal and nonverbal executive function abilities between preschoolers with and without specific language impairment (SLI). The second goal was to assess the group differences on 4 executive function components in order to determine if the components may be hierarchically related as suggested within a developmental integrative framework of executive function. Method This study included 26 4- and 5-year-olds diagnosed with SLI and 26 typically developing age- and sex-matched peers. Participants were tested on verbal and nonverbal measures of sustained selective attention, working memory, inhibition, and shifting. Results The SLI group performed worse compared with typically developing children on both verbal and nonverbal measures of sustained selective attention and working memory, the verbal inhibition task, and the nonverbal shifting task. Comparisons of standardized group differences between executive function measures revealed a linear increase with the following order: working memory, inhibition, shifting, and sustained selective attention. Conclusion The pattern of results suggests that preschoolers with SLI have deficits in executive functioning compared with typical peers, and deficits are not limited to verbal tasks. A significant linear relationship between group differences across executive function components supports the possibility of a hierarchical relationship between executive function skills. PMID:28724132

  12. SOEKARNO: HIS MANNERISM AND METHOD OF COMMUNICATION

    OpenAIRE

    Justin Wejak

    2000-01-01

    The main purpose of this article is to discuss Soekarno's mannerism and method of communication. Certain aspects such as Soekarno's use of language in his speeches are highlighted here in order to provide some basic understanding of Soekarno - both as a person and a political leader of the nation. The article aims at stimulating further discussions concerning this very well known leader. This article also examines Soeharto's style of speech for a comparison.

  13. SOEKARNO: HIS MANNERISM AND METHOD OF COMMUNICATION

    Directory of Open Access Journals (Sweden)

    Justin Wejak

    2000-01-01

    Full Text Available The main purpose of this article is to discuss Soekarno's mannerism and method of communication. Certain aspects such as Soekarno's use of language in his speeches are highlighted here in order to provide some basic understanding of Soekarno - both as a person and a political leader of the nation. The article aims at stimulating further discussions concerning this very well known leader. This article also examines Soeharto's style of speech for a comparison.

  14. Simultaneous and Sequential Integration by Cre/loxP Site-Specific Recombination in Saccharomyces cerevisiae.

    Science.gov (United States)

    Choi, Ho-Jung; Kim, Yeon-Hee

    2018-05-28

    A Cre/ loxP -δ-integration system was developed to allow sequential and simultaneous integration of a multiple gene expression cassette in Saccharomyces cerevisiae . To allow repeated integrations, the reusable Candida glabrata MARKER ( CgMARKER ) carrying loxP sequences was used, and the integrated CgMARKER was efficiently removed by inducing Cre recombinase. The XYLP and XYLB genes encoding endoxylanase and β-xylosidase, respectively, were used as model genes for xylan metabolism in this system, and the copy number of these genes was increased to 15.8 and 16.9 copies/cell, respectively, by repeated integration. This integration system is a promising approach for the easy construction of yeast strains with enhanced metabolic pathways through multicopy gene expression.

  15. SPECIFICS AND WAYS OF DEVELOPMENT OF ENTERPRISE INTEGRATION IN THE FORMER SOVIET UNION

    Directory of Open Access Journals (Sweden)

    Еlena А. Hudorenko

    2014-01-01

    Full Text Available The article is focused on problems and futuredevelopment of integration processes in thepost-Soviet space. The author highlightssome of the key factors contributing to thedevelopment of centripetal and centrifugaltrends of the region. Special attention isgiven to the industrial policy of countriesinvolved in integration processes. The paper analyzes the role and importance of corporate integration as well as discovers ways ofits development.

  16. Visual-motor integration performance in children with severe specific language impairment.

    Science.gov (United States)

    Nicola, K; Watter, P

    2016-09-01

    This study investigated (1) the visual-motor integration (VMI) performance of children with severe specific language impairment (SLI), and any effect of age, gender, socio-economic status and concomitant speech impairment; and (2) the relationship between language and VMI performance. It is hypothesized that children with severe SLI would present with VMI problems irrespective of gender and socio-economic status; however, VMI deficits will be more pronounced in younger children and those with concomitant speech impairment. Furthermore, it is hypothesized that there will be a relationship between VMI and language performance, particularly in receptive scores. Children enrolled between 2000 and 2008 in a school dedicated to children with severe speech-language impairments were included, if they met the criteria for severe SLI with or without concomitant speech impairment which was verified by a government organization. Results from all initial standardized language and VMI assessments found during a retrospective review of chart files were included. The final study group included 100 children (males = 76), from 4 to 14 years of age with mean language scores at least 2SD below the mean. For VMI performance, 52% of the children scored below -1SD, with 25% of the total group scoring more than 1.5SD below the mean. Age, gender and the addition of a speech impairment did not impact on VMI performance; however, children living in disadvantaged suburbs scored significantly better than children residing in advantaged suburbs. Receptive language scores of the Clinical Evaluation of Language Fundamentals was the only score associated with and able to predict VMI performance. A small subgroup of children with severe SLI will also have poor VMI skills. The best predictor of poor VMI is receptive language scores on the Clinical Evaluation of Language Fundamentals. Children with poor receptive language performance may benefit from VMI assessment and multidisciplinary

  17. Integrating UML, the Q-model and a Multi-Agent Approach in Process Specifications and Behavioural Models of Organisations

    Directory of Open Access Journals (Sweden)

    Raul Savimaa

    2005-08-01

    Full Text Available Efficient estimation and representation of an organisation's behaviour requires specification of business processes and modelling of actors' behaviour. Therefore the existing classical approaches that concentrate only on planned processes are not suitable and an approach that integrates process specifications with behavioural models of actors should be used instead. The present research indicates that a suitable approach should be based on interactive computing. This paper examines the integration of UML diagrams for process specifications, the Q-model specifications for modelling timing criteria of existing and planned processes and a multi-agent approach for simulating non-deterministic behaviour of human actors in an organisation. The corresponding original methodology is introduced and some of its applications as case studies are reviewed.

  18. Going “old school”: From bedside manner to deskside manner

    Directory of Open Access Journals (Sweden)

    David Fleischman

    2015-08-01

    Full Text Available Interaction between tertiary educators and students, we contend, improves trust and betters student responses to emotional distress while at university. Therefore, we introduce the “Deskside Manner Framework” as an emerging practice in the tertiary teaching and learning context to aid student transition success. Based on concepts and practice that originated primarily in the medical profession and later in other high credence professional contexts, the deskside manner framework includes: show respect, critical listening, the four Bs and follow up. Deskside manner is transferrable and we aim to facilitate it through workshops and by developing a digital repository of educator-student interaction stories.  

  19. Specification of an integrated information architecture for a mobile teleoperated robot for home telecare.

    Science.gov (United States)

    Iannuzzi, David; Grant, Andrew; Corriveau, Hélène; Boissy, Patrick; Michaud, Francois

    2016-12-01

    The objective of this study was to design effectively integrated information architecture for a mobile teleoperated robot in remote assistance to the delivery of home health care. Three role classes were identified related to the deployment of a telerobot, namely, engineer, technology integrator, and health professional. Patients and natural caregivers were indirectly considered, this being a component of future field studies. Interviewing representatives of each class provided the functions, and information content and flows for each function. Interview transcripts enabled the formulation of UML (Universal Modeling Language) diagrams for feedback from participants. The proposed information architecture was validated with a use-case scenario. The integrated information architecture incorporates progressive design, ergonomic integration, and the home care needs from medical specialist, nursing, physiotherapy, occupational therapy, and social worker care perspectives. The integrated architecture iterative process promoted insight among participants. The use-case scenario evaluation showed the design's robustness. Complex innovation such as a telerobot must coherently mesh with health-care service delivery needs. The deployment of integrated information architecture bridging development, with specialist and home care applications, is necessary for home care technology innovation. It enables continuing evolution of robot and novel health information design in the same integrated architecture, while accounting for patient ecological need.

  20. Institutional traditions in teachers' manners of teaching

    Science.gov (United States)

    Lundqvist, Eva; Almqvist, Jonas; Östman, Leif

    2012-03-01

    The aim of this article is to make a close case study of one teacher's teaching in relation to established traditions within science education in Sweden. The teacher's manner of teaching is analysed with the help of an epistemological move analysis. The moves made by the teacher are then compared in a context of educational philosophy and selective tradition. In the analyses the focus is to study the process of teaching and learning in action in institutionalised and socially shared practices. The empirical material consists of video recordings of four lessons with the same group of students and the same teacher. The students are all in Year 7 in a Swedish 9-year compulsory school. During these lessons the students work with a subject area called "Properties of materials". The results show that the teacher makes a number of different moves with regard to how to proceed and come to a conclusion about what the substances are. Many of these moves are special in that they indicate that the students need to be able to handle the procedural level of school science. These moves do not deal directly with the knowledge production process, but with methodological aspects. The function of the moves turns the students' attention from one source of knowledge to another. The moves are aimed at helping the students to help themselves, since it is through their own activity and their own thinking that learning takes place. This is characteristic in the teacher's manner of teaching. When compared in a context of educational philosophy, this manner of teaching has similarities with progressentialism; a mixture of essentialism and progressivism. This educational philosophy is a central aspect of what is called the academic tradition—a selective tradition common in science education in Sweden between 1960 and 1990.

  1. Grid connected integrated community energy system. Phase II: final stage 2 report. Outline specifications of cogeneration plant; continued

    Energy Technology Data Exchange (ETDEWEB)

    1978-03-22

    Specifications are presented for the electrical equipment, site preparation, building construction and mechanical systems for a dual-purpose power plant to be located on the University of Minnesota campus. This power plant will supply steam and electrical power to a grid-connected Integrated Community Energy System. (LCL)

  2. Site-specific integration in CHO cells mediated by CRISPR/Cas9 and homology-directed DNA repair pathway

    DEFF Research Database (Denmark)

    Lee, Jae Seong; Beuchert Kallehauge, Thomas; Pedersen, Lasse Ebdrup

    2015-01-01

    gene integration into site-specific loci in CHO cells using CRISPR/Cas9 genome editing system and compatible donor plasmid harboring a gene of interest (GOI) and short homology arms. This strategy has enabled precise insertion of a 3.7-kb gene expression cassette at defined loci in CHO cells following...

  3. NuSEE: an integrated environment of software specification and V and V for PLC based safety-critical systems

    International Nuclear Information System (INIS)

    Koo, Seo Ryong; Seong, Poong Hyun; Yoo, Jun Beom; Cha, Sung Deok; Youn, Cheong; Han, Hyun Chul

    2006-01-01

    As the use of digital systems becomes more prevalent, adequate techniques for software specification and analysis have become increasingly important in Nuclear Power Plant (NPP) safety-critical systems. Additionally, the importance of software Verification and Validation (V and V) based on adequate specification has received greater emphasis in view of improving software quality. For thorough V and V of safety-critical systems, V and V should be performed throughout the software lifecycle. However, systematic V and V is difficult as it involves many manual-oriented tasks. Tool support is needed in order to more conveniently perform software V and V. In response, we developed four kinds of Computer Aided Software Engineering (CASE) tools to support system specification for a formal-based analysis according to the software lifecycle. In this work, we achieved optimized integration of each tool. The toolset, NuSEE, is an integrated environment for software specification and V and V for PLC based safety-critical systems. In accordance with the software lifecycle, NuSEE consists of NuSISRT for the concept phase, NuSRS for the requirements phase, NuSDS for the design phase and NuSCM for configuration management. It is believed that after further development our integrated environment will be a unique and promising software specification and analysis toolset that will support the entire software lifecycle for the development of PLC based NPP safety-critical systems

  4. Angular distributions of plasma edge velocity and integrated intensity: Update on specific impulse for Ablative Laser Propulsion

    Science.gov (United States)

    Lin, Jun; Pakhomov, Andrew V.

    2005-04-01

    This work concludes our discussion of the image processing technique developed earlier for determination of specific impulse (Isp) for Ablative Laser Propulsion (ALP). The plasma plumes are recorded with a time-resolved intensified charge-coupled device (ICCD) camera. The plasma was formed in vacuum (˜ 3×10-3 Torr) by focusing output pulses of a laser system (100-ps pulsewidth at 532 nm wavelength and ˜35 mJ energy) on surfaces of C (graphite), Al, Si, Fe, Cu, Zn, Sn, and Pb elements. Angular profiles for integrated intensity and plasma expansion velocity were determined for the tested elements. Such profiles were used further for assessment of specific impulse. Specific impulses derived from angular distributions of plasma expansion velocity and integral intensity appeared in excellent agreement with the data derived earlier from force measurements.

  5. Angular distributions of plasma edge velocity and integrated intensity: Update on specific impulse for Ablative Laser Propulsion

    International Nuclear Information System (INIS)

    Lin Jun; Pakhomov, Andrew V.

    2005-01-01

    This work concludes our discussion of the image processing technique developed earlier for determination of specific impulse (Isp) for Ablative Laser Propulsion (ALP). The plasma plumes are recorded with a time-resolved intensified charge-coupled device (ICCD) camera. The plasma was formed in vacuum (∼ 3x10-3 Torr) by focusing output pulses of a laser system (100-ps pulsewidth at 532 nm wavelength and ∼35 mJ energy) on surfaces of C (graphite), Al, Si, Fe, Cu, Zn, Sn, and Pb elements. Angular profiles for integrated intensity and plasma expansion velocity were determined for the tested elements. Such profiles were used further for assessment of specific impulse. Specific impulses derived from angular distributions of plasma expansion velocity and integral intensity appeared in excellent agreement with the data derived earlier from force measurements

  6. Detecting Specific Health-Related Events Using an Integrated Sensor System for Vital Sign Monitoring

    Directory of Open Access Journals (Sweden)

    Mourad Adnane

    2009-09-01

    Full Text Available In this paper, a new method for the detection of apnea/hypopnea periods in physiological data is presented. The method is based on the intelligent combination of an integrated sensor system for long-time cardiorespiratory signal monitoring and dedicated signal-processing packages. Integrated sensors are a PVDF film and conductive fabric sheets. The signal processing package includes dedicated respiratory cycle (RC and QRS complex detection algorithms and a new method using the respiratory cycle variability (RCV for detecting apnea/hypopnea periods in physiological data. Results show that our method is suitable for online analysis of long time series data.

  7. The Reviewing of Object Files: Object-Specific Integration of Information.

    Science.gov (United States)

    Kahneman, Daniel; And Others

    1992-01-01

    Seven experiments involving a total of 203 college students explored a form of object-specific priming and established a robust object-specific benefit that indicates that a new stimulus will be named faster if it physically matches a previous stimulus seen as part of the same perceptual object. (SLD)

  8. Patient-specific cardiovascular progenitor cells derived from integration-free induced pluripotent stem cells for vascular tissue regeneration.

    Science.gov (United States)

    Hu, Jiang; Wang, Yongyu; Jiao, Jiao; Liu, Zhongning; Zhao, Chao; Zhou, Zhou; Zhang, Zhanpeng; Forde, Kaitlynn; Wang, Lunchang; Wang, Jiangang; Baylink, David J; Zhang, Xiao-Bing; Gao, Shaorong; Yang, Bo; Chen, Y Eugene; Ma, Peter X

    2015-12-01

    Tissue-engineered blood vessels (TEBVs) are promising in regenerating a live vascular replacement. However, the vascular cell source is limited, and it is crucial to develop a scaffold that accommodates new type of vascular progenitor cells and facilitates in vivo lineage specification of the cells into functional vascular smooth muscle cells (VSMCs) to regenerate vascular tissue. In the present study, integration-free human induced pluripotent stem cells (hiPSCs) were established from patient peripheral blood mononuclear cells through episomal vector nucleofection of reprogramming factors. The established hiPSCs were then induced into mesoderm-originated cardiovascular progenitor cells (CVPCs) with a highly efficient directed lineage specification method. The derived CVPCs were demonstrated to be able to differentiate into functional VSMCs. Subcutaneous implantation of CVPCs seeded on macroporous nanofibrous poly(l-lactide) scaffolds led to in vivo VSMC lineage specification and matrix deposition inside the scaffolds. In summary, we established integration-free patient-specific hiPSCs from peripheral blood mononuclear cells, derived CVPCs through directed lineage specification, and developed an advanced scaffold for these progenitor cells to further differentiate in vivo into VSMCs and regenerate vascular tissue in a subcutaneous implantation model. This study has established an efficient patient-specific approach towards in vivo regeneration of vascular tissue. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Design and integration of components for site specific control of fertilizer application

    NARCIS (Netherlands)

    Bergeijk, van J.

    2001-01-01

    Keywords: Precision Agriculture, Site Specific Agriculture, Global Positioning System, GPS, Fertilizer Application, Information System.

    Spatial and temporal variability in soil, crop and climate characteristics results in non optimal use of fertilizers when the application

  10. Integration of hepatitis B virus DNA in chromosome-specific satellite sequences

    International Nuclear Information System (INIS)

    Shaul, Y.; Garcia, P.D.; Schonberg, S.; Rutter, W.J.

    1986-01-01

    The authors previously reported the cloning and detailed analysis of the integrated hepatitis B virus sequences in a human hepatoma cell line. They report here the integration of at least one of hepatitis B virus at human satellite DNA sequences. The majority of the cellular sequences identified by this satellite were organized as a multimeric composition of a 0.6-kilobase EcoRI fragment. This clone hybridized in situ almost exclusively to the centromeric heterochromatin of chromosomes 1 and 16 and to a lower extent to chromosome 2 and to the heterochromatic region of the Y chromosome. The immediate flanking host sequence appeared as a hierarchy of repeating units which were almost identical to a previously reported human satellite III DNA sequence

  11. Integrative functional genomic analyses implicate specific molecular pathways and circuits in autism

    OpenAIRE

    Parikshak, Neelroop N.; Luo, Rui; Zhang, Alice; Won, Hyejung; Lowe, Jennifer K.; Chandran, Vijayendran; Horvath, Steve; Geschwind, Daniel H.

    2013-01-01

    Genetic studies have identified dozens of autism spectrum disorder (ASD) susceptibility genes, raising two critical questions: 1) do these genetic loci converge on specific biological processes, and 2) where does the phenotypic specificity of ASD arise, given its genetic overlap with intellectual disability (ID)? To address this, we mapped ASD and ID risk genes onto co-expression networks representing developmental trajectories and transcriptional profiles representing fetal and adult cortica...

  12. Incorporating and evaluating an integrated gender-specific medicine curriculum: a survey study in Dutch GP training

    Science.gov (United States)

    Dielissen, Patrick W; Bottema, Ben JAM; Verdonk, Petra; Lagro-Janssen, Toine LM

    2009-01-01

    Background We recently set standards for gender-specific medicine training as an integrated part of the GP training curriculum. This paper describes the programme and evaluation of this training. Methods The programme is designed for GP registrars throughout the 3-year GP training. The modules emphasize interaction, application, and clinically integrated learning and teaching methods in peer groups. In 2005 - 2008, after completion of each tutorial, GP registrars were asked to fill in a questionnaire on a 5-point Likert scale to assess the programme's methods and content. GP registrars were also asked to identify two learning points related to the programme. Results The teaching programme consists of five 3-hour modules that include gender themes related to and frequently seen by GPs such as in doctor-patient communication and cardiovascular disease. GP registrars evaluated the training course positively. The written learning points suggest that GP registrars have increased their awareness of why attention to gender-specific information is relevant. Conclusion In summary, gender-specific medicine training has been successfully integrated into an existing GP training curriculum. The modules and teaching methods are transferable to other training institutes for postgraduate training. The evaluation of the teaching programme shows a positive impact on GP registrars' gender awareness. PMID:19737396

  13. Incorporating and evaluating an integrated gender-specific medicine curriculum: a survey study in Dutch GP training

    Directory of Open Access Journals (Sweden)

    Lagro-Janssen Toine LM

    2009-09-01

    Full Text Available Abstract Background We recently set standards for gender-specific medicine training as an integrated part of the GP training curriculum. This paper describes the programme and evaluation of this training. Methods The programme is designed for GP registrars throughout the 3-year GP training. The modules emphasize interaction, application, and clinically integrated learning and teaching methods in peer groups. In 2005 - 2008, after completion of each tutorial, GP registrars were asked to fill in a questionnaire on a 5-point Likert scale to assess the programme's methods and content. GP registrars were also asked to identify two learning points related to the programme. Results The teaching programme consists of five 3-hour modules that include gender themes related to and frequently seen by GPs such as in doctor-patient communication and cardiovascular disease. GP registrars evaluated the training course positively. The written learning points suggest that GP registrars have increased their awareness of why attention to gender-specific information is relevant. Conclusion In summary, gender-specific medicine training has been successfully integrated into an existing GP training curriculum. The modules and teaching methods are transferable to other training institutes for postgraduate training. The evaluation of the teaching programme shows a positive impact on GP registrars' gender awareness.

  14. CEO Appointments and the Loss of Firm-specific Knowledge - Putting Integrity Back into Hiring Decisions

    DEFF Research Database (Denmark)

    Rost, Katja; Salomo, Søren

    2008-01-01

    that over the past decades the dishonesty of the predecessor has become relatively more important for the appointment decisions of firms. We conclude that outside hires are a suboptimal trend because external candidates even step up the regression of integrity in firms: As nobody has an incentive to invest......A rarely studied trend in corporate governance is the increasing tendency to fill CEO openings through external hires rather than through internal promotions: Kevin J. Murphy and Ján Zábojník (2004) show that the proportion of outside hires has doubled and their pay premium almost quadrupled over...

  15. Site-specific landslide assessment in Alpine area using a reliable integrated monitoring system

    Science.gov (United States)

    Romeo, Saverio; Di Matteo, Lucio; Kieffer, Daniel Scott

    2016-04-01

    Rockfalls are one of major cause of landslide fatalities around the world. The present work discusses the reliability of integrated monitoring of displacements in a rockfall within the Alpine region (Salzburg Land - Austria), taking into account also the effect of the ongoing climate change. Due to the unpredictability of the frequency and magnitude, that threatens human lives and infrastructure, frequently it is necessary to implement an efficient monitoring system. For this reason, during the last decades, integrated monitoring systems of unstable slopes were widely developed and used (e.g., extensometers, cameras, remote sensing, etc.). In this framework, Remote Sensing techniques, such as GBInSAR technique (Groung-Based Interferometric Synthetic Aperture Radar), have emerged as efficient and powerful tools for deformation monitoring. GBInSAR measurements can be useful to achieve an early warning system using surface deformation parameters as ground displacement or inverse velocity (for semi-empirical forecasting methods). In order to check the reliability of GBInSAR and to monitor the evolution of landslide, it is very important to integrate different techniques. Indeed, a multi-instrumental approach is essential to investigate movements both in surface and in depth and the use of different monitoring techniques allows to perform a cross analysis of the data and to minimize errors, to check the data quality and to improve the monitoring system. During 2013, an intense and complete monitoring campaign has been conducted on the Ingelsberg landslide. By analyzing both historical temperature series (HISTALP) recorded during the last century and those from local weather stations, temperature values (Autumn-Winter, Winter and Spring) are clearly increased in Bad Hofgastein area as well as in Alpine region. As consequence, in the last decades the rockfall events have been shifted from spring to summer due to warmer winters. It is interesting to point out that

  16. Specific features of the temperature dependence of the exciton absorption integral in CdS crystals

    International Nuclear Information System (INIS)

    Novikov, A.B.; Solov'ev, L.E.; Talalaev, V.G.

    1986-01-01

    Cadmium sulfide crystals 0.4-2 μm thick in the 4.2-120 K temperature range are investigated experimentally. The shape of the first exciton absorption line in CdS and dependence of integral exciton absorption factor (IEAF) on the quenching constant j are calculated. Rapid growth of the absorption factor in the maximum of the absorption line and decrease of halfwidth of the factor are shown to take place with j increase. The calculation has disclosed that the Bouguer law is observed excluding negligible IEAF oscillations at variation of crystal thickness. Non-monotonous temperature dependence of IEAF is disclosed in some investigated samples; it, obviously, testifies to non-monotonous temperature dependence of j. Depolarization of the absorption line of high-energy exciton states with n=2 and n=3 is discovered in some samples for the first time

  17. All-organic microelectromechanical systems integrating specific molecular recognition--a new generation of chemical sensors.

    Science.gov (United States)

    Ayela, Cédric; Dubourg, Georges; Pellet, Claude; Haupt, Karsten

    2014-09-03

    Cantilever-type all-organic microelectromechanical systems based on molecularly imprinted polymers for specific analyte recognition are used as chemical sensors. They are produced by a simple spray-coating-shadow-masking process. Analyte binding to the cantilever generates a measurable change in its resonance frequency. This allows label-free detection by direct mass sensing of low-molecular-weight analytes at nanomolar concentrations. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. MUSI: an integrated system for identifying multiple specificity from very large peptide or nucleic acid data sets.

    Science.gov (United States)

    Kim, Taehyung; Tyndel, Marc S; Huang, Haiming; Sidhu, Sachdev S; Bader, Gary D; Gfeller, David; Kim, Philip M

    2012-03-01

    Peptide recognition domains and transcription factors play crucial roles in cellular signaling. They bind linear stretches of amino acids or nucleotides, respectively, with high specificity. Experimental techniques that assess the binding specificity of these domains, such as microarrays or phage display, can retrieve thousands of distinct ligands, providing detailed insight into binding specificity. In particular, the advent of next-generation sequencing has recently increased the throughput of such methods by several orders of magnitude. These advances have helped reveal the presence of distinct binding specificity classes that co-exist within a set of ligands interacting with the same target. Here, we introduce a software system called MUSI that can rapidly analyze very large data sets of binding sequences to determine the relevant binding specificity patterns. Our pipeline provides two major advances. First, it can detect previously unrecognized multiple specificity patterns in any data set. Second, it offers integrated processing of very large data sets from next-generation sequencing machines. The results are visualized as multiple sequence logos describing the different binding preferences of the protein under investigation. We demonstrate the performance of MUSI by analyzing recent phage display data for human SH3 domains as well as microarray data for mouse transcription factors.

  19. Medical Image Processing for Fully Integrated Subject Specific Whole Brain Mesh Generation

    Directory of Open Access Journals (Sweden)

    Chih-Yang Hsu

    2015-05-01

    Full Text Available Currently, anatomically consistent segmentation of vascular trees acquired with magnetic resonance imaging requires the use of multiple image processing steps, which, in turn, depend on manual intervention. In effect, segmentation of vascular trees from medical images is time consuming and error prone due to the tortuous geometry and weak signal in small blood vessels. To overcome errors and accelerate the image processing time, we introduce an automatic image processing pipeline for constructing subject specific computational meshes for entire cerebral vasculature, including segmentation of ancillary structures; the grey and white matter, cerebrospinal fluid space, skull, and scalp. To demonstrate the validity of the new pipeline, we segmented the entire intracranial compartment with special attention of the angioarchitecture from magnetic resonance imaging acquired for two healthy volunteers. The raw images were processed through our pipeline for automatic segmentation and mesh generation. Due to partial volume effect and finite resolution, the computational meshes intersect with each other at respective interfaces. To eliminate anatomically inconsistent overlap, we utilized morphological operations to separate the structures with a physiologically sound gap spaces. The resulting meshes exhibit anatomically correct spatial extent and relative positions without intersections. For validation, we computed critical biometrics of the angioarchitecture, the cortical surfaces, ventricular system, and cerebrospinal fluid (CSF spaces and compared against literature values. Volumina and surface areas of the computational mesh were found to be in physiological ranges. In conclusion, we present an automatic image processing pipeline to automate the segmentation of the main intracranial compartments including a subject-specific vascular trees. These computational meshes can be used in 3D immersive visualization for diagnosis, surgery planning with haptics

  20. Brain systems for probabilistic and dynamic prediction: computational specificity and integration.

    Directory of Open Access Journals (Sweden)

    Jill X O'Reilly

    2013-09-01

    Full Text Available A computational approach to functional specialization suggests that brain systems can be characterized in terms of the types of computations they perform, rather than their sensory or behavioral domains. We contrasted the neural systems associated with two computationally distinct forms of predictive model: a reinforcement-learning model of the environment obtained through experience with discrete events, and continuous dynamic forward modeling. By manipulating the precision with which each type of prediction could be used, we caused participants to shift computational strategies within a single spatial prediction task. Hence (using fMRI we showed that activity in two brain systems (typically associated with reward learning and motor control could be dissociated in terms of the forms of computations that were performed there, even when both systems were used to make parallel predictions of the same event. A region in parietal cortex, which was sensitive to the divergence between the predictions of the models and anatomically connected to both computational networks, is proposed to mediate integration of the two predictive modes to produce a single behavioral output.

  1. Experiences from the formal specification of the integration platform and the synthesis of SDT with the software bus

    International Nuclear Information System (INIS)

    Thunem, Harald; Mohn, Peter; Sandmark, Haakon; Stoelen, Ketil

    1999-04-01

    The three year programme 1997-1999 for the OECD Halden Reactor Project (HRP) identifies the need to gain experience from applying formal techniques in real-life system developments. This motivated the initiation of the HRP research activity Integration of Formal Specification in the Development of HAMMLAB 2000 (INT-FS). The principal objective was to experiment with formal techniques in system developments at the HRP; in particular, system developments connected to HAMMLAB 2000 - the computerised laboratory for man-machine-interaction experiments currently under construction. It was hoped that this experimentation with formal techniques should result in a better understanding of how such techniques should be utilised in a more industrial setting. To obtain more knowledge with respect to the practical effects and consequences of an increased level of formalization was another objective. This report summarises experiences, results and conclusions from a pre-study addressing INT-FS related issues connected to the development of the HAMMLAB 2000 Integration Platform (IP). The report starts by giving a brief overview of the IP. Then it describes and summarises experiences from the formalization of a top-level requirements specification for the IP. Finally, it discusses various approaches for the integration of applications generated automatically through the CASE-tool SDT and the Software Bus on which the communication within HAMMLAB 2000 will be based. The report concludes that the selected formalisms and tools are well-suited to describe IP-like systems. The report also concludes that the integration of SDT applications with the Software Bus will not be a major obstacle, and finally that a monitoring component for the IP is well-suited for development within INT-FS (author) (ml)

  2. Hierarchical mesosilicalite nanoformulation integrated with cisplatin exhibits target-specific efficient anticancer activity

    Science.gov (United States)

    Jermy, B. Rabindran; Acharya, Sadananda; Ravinayagam, Vijaya; Alghamdi, Hajer Saleh; Akhtar, Sultan; Basuwaidan, Rehab S.

    2018-04-01

    Hierarchically structured zeolitic ZSM-5 and meso MCM-41 interlinked domain had an impeccable use as catalysis in many applications. The aim of the study was to develop a new drug delivery nanoformulation, specifically, cisplatin/mesosilicalite using top-down approach for cancer therapy. Hierarchical mesosilicalite with variable porosity was synthesized using alkaline molar solution (0.2 and 0.7 M NaOH) and was loaded with cisplatin through equilibrium adsorption technique. Physico-chemical properties of the nanoformulation (IAUM-56—Imam Abdulrahman Bin Faisal University Mesosilicalite-56) were characterized using X-ray diffraction, surface area analysis (BET), Fourier transformed infrared spectroscopy (FT-IR), diffuse reflectance UV-Vis spectroscopy, and transmission electron microscopy. Drug release study and anticancer activity were assayed on HeLa and MCF7 cancer cells using MTT assay. X-ray diffraction pattern showed interrelated meso- and microphases, while BET analysis revealed considerable mesoporosity formation with a remodulation of isotherm hysteresis indicating the presence of hierarchical pores. FT-IR showed the presence of nanozeolitic subunits into mesostructure with a band at about 550 cm-1. IAUM-56 demonstrated high cytotoxic activity against HeLa cancer cells with an LC50 of 0.02 mg/ml, MCF7 cancer cells with an LC50 of 0.05 mg/ml, and less toxic to normal fibroblast cells with an LC50 of approximately ten times higher at 0.5 mg/ml. Overall, IAUM-56 showed a high rate of sustained release of cisplatin imparting target specific cytotoxic effect against tumor cells with at least tenfold lower toxicity on normal fibroblast cells. Our nanoformulation has the potential use in cancer therapy as a targeted drug delivery system.

  3. Thermal Radiometer Signal Processing Using Radiation Hard CMOS Application Specific Integrated Circuits for Use in Harsh Planetary Environments

    Science.gov (United States)

    Quilligan, G.; DuMonthier, J.; Aslam, S.; Lakew, B.; Kleyner, I.; Katz, R.

    2015-01-01

    Thermal radiometers such as proposed for the Europa Clipper flyby mission require low noise signal processing for thermal imaging with immunity to Total Ionizing Dose (TID) and Single Event Latchup (SEL). Described is a second generation Multi- Channel Digitizer (MCD2G) Application Specific Integrated Circuit (ASIC) that accurately digitizes up to 40 thermopile pixels with greater than 50 Mrad (Si) immunity TID and 174 MeV-sq cm/mg SEL. The MCD2G ASIC uses Radiation Hardened By Design (RHBD) techniques with a 180 nm CMOS process node.

  4. Integration

    DEFF Research Database (Denmark)

    Emerek, Ruth

    2004-01-01

    Bidraget diskuterer de forskellige intergrationsopfattelse i Danmark - og hvad der kan forstås ved vellykket integration......Bidraget diskuterer de forskellige intergrationsopfattelse i Danmark - og hvad der kan forstås ved vellykket integration...

  5. Integrative Analysis of Sex-Specific microRNA Networks Following Stress in Mouse Nucleus Accumbens.

    Science.gov (United States)

    Pfau, Madeline L; Purushothaman, Immanuel; Feng, Jian; Golden, Sam A; Aleyasin, Hossein; Lorsch, Zachary S; Cates, Hannah M; Flanigan, Meghan E; Menard, Caroline; Heshmati, Mitra; Wang, Zichen; Ma'ayan, Avi; Shen, Li; Hodes, Georgia E; Russo, Scott J

    2016-01-01

    Adult women are twice as likely as men to suffer from affective and anxiety disorders, although the mechanisms underlying heightened female stress susceptibility are incompletely understood. Recent findings in mouse Nucleus Accumbens (NAc) suggest a role for DNA methylation-driven sex differences in genome-wide transcriptional profiles. However, the role of another epigenetic process-microRNA (miR) regulation-has yet to be explored. We exposed male and female mice to Subchronic Variable Stress (SCVS), a stress paradigm that produces depression-like behavior in female, but not male, mice, and performed next generation mRNA and miR sequencing on NAc tissue. We applied a combination of differential expression, miR-mRNA network and functional enrichment analyses to characterize the transcriptional and post-transcriptional landscape of sex differences in NAc stress response. We find that male and female mice exhibit largely non-overlapping miR and mRNA profiles following SCVS. The two sexes also show enrichment of different molecular pathways and functions. Collectively, our results suggest that males and females mount fundamentally different transcriptional and post-transcriptional responses to SCVS and engage sex-specific molecular processes following stress. These findings have implications for the pathophysiology and treatment of stress-related disorders in women.

  6. B827 Chemical Synthhesis Project - Industrial Control System Integration - Statement of Work & Specification with Attachments 1-14

    Energy Technology Data Exchange (ETDEWEB)

    Wade, F. E. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2017-04-21

    The Chemical Synthesis Pilot Process at the Lawrence Livermore National Laboratory (LLNL) Site 300 827 Complex will be used to synthesize small quantities of material to support research and development. The project will modernize and increase current capabilities for chemical synthesis at LLNL. The primary objective of this project is the conversion of a non-automated hands-on process to a remoteoperation process, while providing enhanced batch process step control, stored recipe-specific parameter sets, process variable visibility, monitoring, alarm and warning handling, and comprehensive batch record data logging. This Statement of Work and Specification provides the industrial-grade process control requirements for the chemical synthesis batching control system, hereafter referred to as the “Control System” to be delivered by the System Integrator.

  7. Auditory-visual integration modulates location-specific repetition suppression of auditory responses.

    Science.gov (United States)

    Shrem, Talia; Murray, Micah M; Deouell, Leon Y

    2017-11-01

    Space is a dimension shared by different modalities, but at what stage spatial encoding is affected by multisensory processes is unclear. Early studies observed attenuation of N1/P2 auditory evoked responses following repetition of sounds from the same location. Here, we asked whether this effect is modulated by audiovisual interactions. In two experiments, using a repetition-suppression paradigm, we presented pairs of tones in free field, where the test stimulus was a tone presented at a fixed lateral location. Experiment 1 established a neural index of auditory spatial sensitivity, by comparing the degree of attenuation of the response to test stimuli when they were preceded by an adapter sound at the same location versus 30° or 60° away. We found that the degree of attenuation at the P2 latency was inversely related to the spatial distance between the test stimulus and the adapter stimulus. In Experiment 2, the adapter stimulus was a tone presented from the same location or a more medial location than the test stimulus. The adapter stimulus was accompanied by a simultaneous flash displayed orthogonally from one of the two locations. Sound-flash incongruence reduced accuracy in a same-different location discrimination task (i.e., the ventriloquism effect) and reduced the location-specific repetition-suppression at the P2 latency. Importantly, this multisensory effect included topographic modulations, indicative of changes in the relative contribution of underlying sources across conditions. Our findings suggest that the auditory response at the P2 latency is affected by spatially selective brain activity, which is affected crossmodally by visual information. © 2017 Society for Psychophysiological Research.

  8. S3QL: A distributed domain specific language for controlled semantic integration of life sciences data

    Directory of Open Access Journals (Sweden)

    de Lencastre Hermínia

    2011-07-01

    Full Text Available Abstract Background The value and usefulness of data increases when it is explicitly interlinked with related data. This is the core principle of Linked Data. For life sciences researchers, harnessing the power of Linked Data to improve biological discovery is still challenged by a need to keep pace with rapidly evolving domains and requirements for collaboration and control as well as with the reference semantic web ontologies and standards. Knowledge organization systems (KOSs can provide an abstraction for publishing biological discoveries as Linked Data without complicating transactions with contextual minutia such as provenance and access control. We have previously described the Simple Sloppy Semantic Database (S3DB as an efficient model for creating knowledge organization systems using Linked Data best practices with explicit distinction between domain and instantiation and support for a permission control mechanism that automatically migrates between the two. In this report we present a domain specific language, the S3DB query language (S3QL, to operate on its underlying core model and facilitate management of Linked Data. Results Reflecting the data driven nature of our approach, S3QL has been implemented as an application programming interface for S3DB systems hosting biomedical data, and its syntax was subsequently generalized beyond the S3DB core model. This achievement is illustrated with the assembly of an S3QL query to manage entities from the Simple Knowledge Organization System. The illustrative use cases include gastrointestinal clinical trials, genomic characterization of cancer by The Cancer Genome Atlas (TCGA and molecular epidemiology of infectious diseases. Conclusions S3QL was found to provide a convenient mechanism to represent context for interoperation between public and private datasets hosted at biomedical research institutions and linked data formalisms.

  9. Silence and table manners: when environments activate norms.

    Science.gov (United States)

    Joly, Janneke F; Stapel, Diederik A; Lindenberg, Siegwart M

    2008-08-01

    Two studies tested the conditions under which an environment (e.g., library, restaurant) raises the relevance of environment-specific social norms (e.g., being quiet, using table manners). As hypothesized, the relevance of such norms is raised when environments are goal relevant ("I am going there later") and when they are humanized with people or the remnants of their presence (e.g., a glass of wine on a table). Two studies show that goal-relevant environments and humanized environments raise the perceived importance of norms (Study 1) and the intention to conform to norms (Study 2). Interestingly, in both studies, these effects reach beyond norms related to the environments used in the studies.

  10. Teaching physics in a physiologically meaningful manner

    Directory of Open Access Journals (Sweden)

    Michael Plomer

    2010-09-01

    Full Text Available The learning outcome of a physics laboratory course for medical students was examined in an interdisciplinary field study and discussed for the electrical physiology (“Propagation of Excitation and Nerve Cells”. At the Ludwig-Maximilians-University of Munich (LMU at a time about 300 medicine students were assessed in two successive years. Students from the control group worked with standard experiments, while students from the treatment group performed newly developed “addressee-specific” experiments, designed to guide students to transfer physics knowledge to physiological problems. The assessment took place within the laboratory course on physiology, after the students had finished their laboratory classes in physics, and consisted of the construction of a concept map with additional multiple choice questions. The results showed that standard physics experiments are not adequate for teaching students to transfer physical principles to physiology. Introducing new addressee-specific experiments enriched the physics laboratory course by improving student attitudes toward physics and demonstrating better ability of students to relate concepts of physics and medicine, and overall to improve their understanding of the physics taught in the course.

  11. Longevity Genes Revealed by Integrative Analysis of Isoform-Specific daf-16/FoxO Mutants of Caenorhabditis elegans.

    Science.gov (United States)

    Chen, Albert Tzong-Yang; Guo, Chunfang; Itani, Omar A; Budaitis, Breane G; Williams, Travis W; Hopkins, Christopher E; McEachin, Richard C; Pande, Manjusha; Grant, Ana R; Yoshina, Sawako; Mitani, Shohei; Hu, Patrick J

    2015-10-01

    FoxO transcription factors promote longevity across taxa. How they do so is poorly understood. In the nematode Caenorhabditis elegans, the A- and F-isoforms of the FoxO transcription factor DAF-16 extend life span in the context of reduced DAF-2 insulin-like growth factor receptor (IGFR) signaling. To elucidate the mechanistic basis for DAF-16/FoxO-dependent life span extension, we performed an integrative analysis of isoform-specific daf-16/FoxO mutants. In contrast to previous studies suggesting that DAF-16F plays a more prominent role in life span control than DAF-16A, isoform-specific daf-16/FoxO mutant phenotypes and whole transcriptome profiling revealed a predominant role for DAF-16A over DAF-16F in life span control, stress resistance, and target gene regulation. Integration of these datasets enabled the prioritization of a subset of 92 DAF-16/FoxO target genes for functional interrogation. Among 29 genes tested, two DAF-16A-specific target genes significantly influenced longevity. A loss-of-function mutation in the conserved gene gst-20, which is induced by DAF-16A, reduced life span extension in the context of daf-2/IGFR RNAi without influencing longevity in animals subjected to control RNAi. Therefore, gst-20 promotes DAF-16/FoxO-dependent longevity. Conversely, a loss-of-function mutation in srr-4, a gene encoding a seven-transmembrane-domain receptor family member that is repressed by DAF-16A, extended life span in control animals, indicating that DAF-16/FoxO may extend life span at least in part by reducing srr-4 expression. Our discovery of new longevity genes underscores the efficacy of our integrative strategy while providing a general framework for identifying specific downstream gene regulatory events that contribute substantially to transcription factor functions. As FoxO transcription factors have conserved functions in promoting longevity and may be dysregulated in aging-related diseases, these findings promise to illuminate fundamental

  12. EFFECTIVENESS OF INTEGRATED NEUROMUSCULAR INHIBITORY TECHNIQUE (INIT WITH SPECIFIC STRENGTH TRAINING EXERCISES IN SUBJECTS WITH UPPER TRAPEZIUS TRIGGER POINTS

    Directory of Open Access Journals (Sweden)

    B. Jyothirmai

    2015-10-01

    Full Text Available Background: Upper trapezius trigger points is a common cause for neck pain, decreased cervical range of motion and functional activities. The purpose of the study was to evaluate the effectiveness of integrated neuromuscular inhibitory technique (INIT along with specific strength training exercises in reducing pain, improving ROM and functional activities in subjects with upper trapezius trigger point. Methods: Thirty subjects were diagnosed with upper trapezius trigger points were included in the study. These patients were randomly allocated to intervention group (n=15, which underwent a 4- weeks training program of INIT along with specific strength training & control group (n=15 that received INIT alone. The outcome measures were taken before and after treatment. Outcomes were measured by visual analogue scale, cervical range of motion and neck disability index. Within the groups VAS, NDI, and cervical lateral flexion and rotation showed significant change in the mean value. The comparison of pre and post VAS in experimental group and control group showed a significant change in the experimental group .Paired sample t- test was used to analyze changes from before and after intervention programmed. Results: There is a statistically significant (p<0.00 improvement in both variables from baseline to 4th week in experimental group and control group but compared to control group, experimental group shows highly significant values in all parameters. Conclusion: INIT along with specific strength training is proved to be effective in reducing pain, decreasing disability and improving range of motion in individuals with upper trapezius trigger points.

  13. Do children with obesity have worse table manners? Associations between child table manners, weight status and weight gain.

    Science.gov (United States)

    Briones, Naomi F; Cesaro, Robert J; Appugliese, Danielle P; Miller, Alison L; Rosenblum, Katherine L; Pesch, Megan H

    2018-06-01

    Children with obesity experience stigma stemming from stereotypes, one such stereotype is that people with obesity are "sloppy" or have poor manners. Teaching children "proper table manners" has been proposed as an obesity prevention strategy. Little is known about the association between children's weight status and table manners. To examine correlates of child table manners and to examine the association of child table manners with child obese weight status and prospective change in child body mass index z-score (BMIz). Mother-child dyads (N = 228) participated in a videotaped laboratory eating task with cupcakes. Coding schemes to capture child table manners (making crumbs, chewing with mouth open, getting food on face, shoving food in mouth, slouching, and getting out of seat), and maternal attentiveness to child table manners, were reliably applied. Anthropometrics were measured at baseline and at follow-up two years later. Regression analyses examined the association of participant characteristics with child table manners, as well as the associations of child table manners with child obese weight status, and prospective change in BMIz/year. Predictors of poorer child table manners were younger child age, greater cupcake consumption, and greater maternal attentiveness to child table manners. Poorer child table manners were not associated with child obese (vs. not) weight status, but were associated with a prospective decrease in BMIz/year in children with overweight/obesity. Obesity interventions to improve table manners may be perpetuating unfavorable stereotypes and stigma. Future work investigating these associations is warranted to inform childhood obesity guidelines around table manners. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. An Energy efficient application specific integrated circuit for electrocardiogram feature detection and its potential for ambulatory cardiovascular disease detection.

    Science.gov (United States)

    Jain, Sanjeev Kumar; Bhaumik, Basabi

    2016-03-01

    A novel algorithm based on forward search is developed for real-time electrocardiogram (ECG) signal processing and implemented in application specific integrated circuit (ASIC) for QRS complex related cardiovascular disease diagnosis. The authors have evaluated their algorithm using MIT-BIH database and achieve sensitivity of 99.86% and specificity of 99.93% for QRS complex peak detection. In this Letter, Physionet PTB diagnostic ECG database is used for QRS complex related disease detection. An ASIC for cardiovascular disease detection is fabricated using 130-nm CMOS high-speed process technology. The area of the ASIC is 0.5 mm(2). The power dissipation is 1.73 μW at the operating frequency of 1 kHz with a supply voltage of 0.6 V. The output from the ASIC is fed to their Android application that generates diagnostic report and can be sent to a cardiologist through email. Their ASIC result shows average failed detection rate of 0.16% for six leads data of 290 patients in PTB diagnostic ECG database. They also have implemented a low-leakage version of their ASIC. The ASIC dissipates only 45 pJ with a supply voltage of 0.9 V. Their proposed ASIC is most suitable for energy efficient telemetry cardiovascular disease detection system.

  15. A resolvase-like protein is requered for the site-specific integration of the temperate lactococcal bacteriophage TP901-1

    DEFF Research Database (Denmark)

    Christiansen, Bettina; Brøndsted, Lone; Vogensen, Finn K.

    1996-01-01

    upstream of attP. The N-terminal 150 to 1180 amino acids of Orf1 showed 38 to 44% similarity to the resolvase group of site-specific integrases, while no similarity to know proteins was found in the C-terminal end. Bacteriophage 'TP901-1 therefore contains a unique integration system that does not resemble...... the Int class of site-specific integrases usually found in temperate bacteriophages. The constructed integration vector, pBC170, integrates into the chromosomal attachment site very efficiently and forms stable transformants with a frequency corresponding to 20% of the transformation efficiency....

  16. Integrated imaging using MRI and 123I metaiodobenzylguanidine scintigraphy to improve sensitivity and specificity in the diagnosis of pediatric neuroblastoma.

    Science.gov (United States)

    Pfluger, Thomas; Schmied, Christoph; Porn, Ute; Leinsinger, Gerda; Vollmar, Christian; Dresel, Stefan; Schmid, Irene; Hahn, Klaus

    2003-10-01

    The objectives of this study were to compare MRI and iodine-123 ((123)I) metaiodobenzylguanidine (MIBG) scintigraphy in the detection of neuroblastoma lesions in pediatric patients and to assess the additional value of combined imaging. Fifty MRI and 50 (123)I MIBG examinations (mean interval, 6.4 days) were analyzed retrospectively with regard to suspected or proven neuroblastoma lesions (n = 193) in 28 patients. MRI and MIBG scans were reviewed by two independent observers each. Separate and combined analyses of MRI and MIBG scintigraphy were compared with clinical and histologic findings. With regard to the diagnosis of neuroblastoma lesion, MIBG scintigraphy, MRI, and combined analysis showed a sensitivity of 69%, 86%, and 99% and a specificity of 85%, 77%, and 95%, respectively. On MRI, 15 false-positive findings were recorded: posttherapeutic reactive changes (n = 10), benign adrenal tumors (n = 3), and enlarged lymph nodes (n = 2). On MIBG scintigraphy, 10 false-positive findings occurred: ganglioneuromas (n = 2), benign liver tumors (n = 2), and physiologic uptake (n = 6). Thirteen neuroblastoma metastases and two residual masses under treatment with chemotherapy were judged to be false-negative findings on MRI. Two primary or residual neuroblastomas and one orbital metastasis were misinterpreted as Wilms' tumor, reactive changes after surgery, and rhabdomyosarcoma on MRI. Thirty-two bone metastases, six other neuroblastoma metastases, and one adrenal neuroblastoma showed no MIBG uptake. On combined imaging, one false-negative (bone metastasis) and three false-positive (two ganglioneuromas and one pheochromocytoma) findings remained. In the assessment of neuroblastoma lesions in pediatric patients, MRI showed a higher sensitivity and MIBG scintigraphy a higher specificity. However, integrated imaging showed an increase in both sensitivity and specificity.

  17. 26 CFR 1.9005-4 - Manner of exercising election.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 13 2010-04-01 2010-04-01 false Manner of exercising election. 1.9005-4 Section 1.9005-4 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES General Actuarial Valuations § 1.9005-4 Manner of exercising election. (a...

  18. 26 CFR 1.9004-4 - Manner of exercising election.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 13 2010-04-01 2010-04-01 false Manner of exercising election. 1.9004-4 Section 1.9004-4 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES General Actuarial Valuations § 1.9004-4 Manner of exercising election. (a...

  19. 26 CFR 1.9002-8 - Manner of exercising elections.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 13 2010-04-01 2010-04-01 false Manner of exercising elections. 1.9002-8 Section 1.9002-8 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES General Actuarial Valuations § 1.9002-8 Manner of exercising elections...

  20. 26 CFR 1.9003-4 - Manner of exercising election.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 13 2010-04-01 2010-04-01 false Manner of exercising election. 1.9003-4 Section 1.9003-4 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES General Actuarial Valuations § 1.9003-4 Manner of exercising election. (a...

  1. 26 CFR 1.853-4 - Manner of making election.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 9 2010-04-01 2010-04-01 false Manner of making election. 1.853-4 Section 1.853-4 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Regulated Investment Companies and Real Estate Investment Trusts § 1.853-4 Manner of...

  2. Mannerisms of the Elderly and Approaches to Rapport.

    Science.gov (United States)

    French, Warren A.; And Others

    1980-01-01

    Many older adults react to old age with empirically identified distinguishable mannerisms. Using these mannerisms, or behavior patterns, as a basis for rapport, gerontologists can: (1) uncover causes of adjustment problems; (2) assess seriousness of problems; and (3) implement counseling suggestions. (Author/JAC)

  3. 29 CFR 1905.21 - Manner of service.

    Science.gov (United States)

    2010-07-01

    ...-STEIGER OCCUPATIONAL SAFETY AND HEALTH ACT OF 1970 Hearings § 1905.21 Manner of service. Service of any... 29 Labor 5 2010-07-01 2010-07-01 false Manner of service. 1905.21 Section 1905.21 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR...

  4. Energy storage technologies and hybrid architectures for specific diesel-driven rail duty cycles: Design and system integration aspects

    International Nuclear Information System (INIS)

    Meinert, M.; Prenleloup, P.; Schmid, S.; Palacin, R.

    2015-01-01

    Highlights: • We assessed integration of energy storage systems into hybrid system architectures. • We considered mechanical and electrical energy storage systems. • Potential of different combinations has been analyzed by standardized duty cycles. • Most promising are diesel-driven suburban, regional and shunting operations. • Double-layer capacitors and Lithium-ion batteries have the highest potential. - Abstract: The use of diesel-driven traction is an intrinsic part of the functioning of railway systems and it is expected to continue being so for the foreseeable future. The recent introduction of more restrictive greenhouse gas emission levels and other legislation aiming at the improvement of the environmental performance of railway systems has led to the need of exploring alternatives for cleaner diesel rolling stock. This paper focuses on assessing energy storage systems and the design of hybrid system architectures to determine their potential use in specific diesel-driven rail duty cycles. Hydrostatic accumulators, flywheels, Lithium-ion batteries and double-layer capacitors have been assessed and used to design hybrid system architectures. The potential of the different technology combinations has been analyzed using standardized duty cycles enhanced with gradient profiles related to suburban, regional and shunting operations. The results show that double-layer capacitors and Lithium-ion batteries have the highest potential to be successfully integrated into the system architecture of diesel-driven rail vehicles. Furthermore, the results also suggest that combining these two energy storage technologies into a single hybridisation package is a highly promising design that draws on their strengthens without any significant drawbacks.

  5. Cell-laden hydrogel/titanium microhybrids: Site-specific cell delivery to metallic implants for improved integration.

    Science.gov (United States)

    Koenig, Geraldine; Ozcelik, Hayriye; Haesler, Lisa; Cihova, Martina; Ciftci, Sait; Dupret-Bories, Agnes; Debry, Christian; Stelzle, Martin; Lavalle, Philippe; Vrana, Nihal Engin

    2016-03-01

    Porous titanium implants are widely used in dental, orthopaedic and otorhinolaryngology fields to improve implant integration to host tissue. A possible step further to improve the integration with the host is the incorporation of autologous cells in porous titanium structures via cell-laden hydrogels. Fast gelling hydrogels have advantageous properties for in situ applications such as localisation of specific cells and growth factors at a target area without dispersion. The ability to control the cell types in different regions of an implant is important in applications where the target tissue (i) has structural heterogeneity (multiple cell types with a defined spatial configuration with respect to each other); (ii) has physical property gradients essential for its function (such as in the case of osteochondral tissue transition). Due to their near immediate gelation, such gels can also be used for site-specific modification of porous titanium structures, particularly for implants which would face different tissues at different locations. Herein, we describe a step by step design of a model system: the model cell-laden gel-containing porous titanium implants in the form of titanium microbead/hydrogel (maleimide-dextran or maleimide-PVA based) microhybrids. These systems enable the determination of the effect of titanium presence on gel properties and encapsulated cell behaviour as a miniaturized version of full-scale implants, providing a system compatible with conventional analysis methods. We used a fibroblast/vascular endothelial cell co-cultures as our model system and by utilising single microbeads we have quantified the effect of gel microenvironment (degradability, presence of RGD peptides within gel formulation) on cell behaviour and the effect of the titanium presence on cell behaviour and gel formation. Titanium presence slightly changed gel properties without hindering gel formation or affecting cell viability. Cells showed a preference to move towards

  6. Electromechanical modeling of a honeycomb core integrated vibration energy converter with increased specific power for energy harvesting applications

    Science.gov (United States)

    Chandrasekharan, Nataraj

    Innovation in integrated circuit technology along with improved manufacturing processes has resulted in considerable reduction in power consumption of electromechanical devices. Majority of these devices are currently powered by batteries. However, the issues posed by batteries, including the need for frequent battery recharge/replacement has resulted in a compelling need for alternate energy to achieve self-sufficient device operation or to supplement battery power. Vibration based energy harvesting methods through piezoelectric transduction provides with a promising potential towards replacing or supplementing battery power source. However, current piezoelectric energy harvesters generate low specific power (power-to-weight ratio) when compared to batteries that the harvesters seek to replace or supplement. In this study, the potential of integrating lightweight cellular honeycomb structures with existing piezoelectric device configurations (bimorph) to achieve higher specific power is investigated. It is shown in this study that at low excitation frequency ranges, replacing the solid continuous substrate of a conventional piezoelectric bimorph with honeycomb structures of the same material results in a significant increase in power-to-weight ratio of the piezoelectric harvester. In order to maximize the electrical response of vibration based power harvesters, the natural frequency of these harvesters is designed to match the input driving frequency. The commonly used technique of adding a tip mass is employed to lower the natural frequency (to match driving frequency) of both, solid and honeycomb substrate bimorphs. At higher excitation frequency, the natural frequency of the traditional solid substrate bimorph can only be altered (to match driving frequency) through a change in global geometric design parameters, typically achieved by increasing the thickness of the harvester. As a result, the size of the harvester is increased and can be disadvantageous

  7. Microfluidic-integrated patterned ITO immunosensor for rapid detection of prostate-specific membrane antigen biomarker in prostate cancer.

    Science.gov (United States)

    Seenivasan, Rajesh; Singh, Chandra K; Warrick, Jay W; Ahmad, Nihal; Gunasekaran, Sundaram

    2017-09-15

    An optically transparent patterned indium tin oxide (ITO) three-electrode sensor integrated with a microfluidic channel was designed for label-free immunosensing of prostate-specific membrane antigen (PSMA), a prostate cancer (PCa) biomarker, expressed on prostate tissue and circulating tumor cells but also found in serum. The sensor relies on cysteamine capped gold nanoparticles (N-AuNPs) covalently linked with anti-PSMA antibody (Ab) for target specificity. A polydimethylsiloxane (PDMS) microfluidic channel is used to efficiently and reproducibly introduce sample containing soluble proteins/cells to the sensor. The PSMA is detected and quantified by measuring the change in differential pulse voltammetry signal of a redox probe ([Fe(CN) 6 ] 3- /[Fe(CN) 6 ] 4- ) that is altered upon binding of PSMA with PSMA-Ab immobilized on N-AuNPs/ITO. Detection of PSMA expressing cells and soluble PSMA was tested. The limit of detection (LOD) of the sensor for PSMA-based PCa cells is 6/40µL (i.e., 150 cells/mL) (n=3) with a linear range of 15-400 cells/40µL (i.e., 375-10,000 cells/mL), and for the soluble PSMA is 0.499ng/40µL (i.e., 12.5ng/mL) (n=3) with the linear range of 0.75-250ng/40µL (i.e., 19-6250ng/mL), both with an incubation time of 10min. The results indicate that the sensor has a suitable sensitivity and dynamic range for routine detection of PCa circulating tumor cells and can be adapted to detect other biomarkers/cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. The aPKC-CBP Pathway Regulates Adult Hippocampal Neurogenesis in an Age-Dependent Manner

    Directory of Open Access Journals (Sweden)

    Ayden Gouveia

    2016-10-01

    Full Text Available While epigenetic modifications have emerged as attractive substrates to integrate environmental changes into the determination of cell identity and function, specific signals that directly activate these epigenetic modifications remain unknown. Here, we examine the role of atypical protein kinase C (aPKC-mediated Ser436 phosphorylation of CBP, a histone acetyltransferase, in adult hippocampal neurogenesis and memory. Using a knockin mouse strain (CbpS436A in which the aPKC-CBP pathway is deficient, we observe impaired hippocampal neuronal differentiation, maturation, and memory and diminished binding of CBP to CREB in 6-month-old CbpS436A mice, but not at 3 months of age. Importantly, elevation of CREB activity rescues these deficits, and CREB activity is reduced whereas aPKC activity is increased in the murine hippocampus as they age from 3 to 6 months regardless of genotype. Thus, the aPKC-CBP pathway is a homeostatic compensatory mechanism that modulates hippocampal neurogenesis and memory in an age-dependent manner in response to reduced CREB activity.

  9. [Perception manner of mother of obese persons in adolescence].

    Science.gov (United States)

    Radoszewska, Joanna

    2007-01-01

    There are specific relation properties of mother to the obese child. The mother representation in child is understand as a experience manner of herself. Representation (mental image) include perceptions, knowledge about characteristics and behaviors of a person and evaluation and experiences that provoke in others. The aim of this article is a trial of an answer what is a mental representation of mother experienced by obese girls and boys in adolescence. 21 obese persons (12 girls and 9 boys) and 23 persons of normal body mass (15 girls and 8 boys) have been investigated. The mean age of the investigated obese persons were 14.53, and for a person of normal body mass was 15.31. All persons were investigated by a clinical interview with 6 questions concerning mental mother representation. The obtained results were analyzed in relation to mental mother representation contents: cognitive, emotional, social, sexual, certificate, behavioral and somatic. Obese persons more often than the person of the normal body mass identify to mental mother representation somatic contents, more rarely social, sexual and behavioral contents. Obese girls more rarely than girls of the normal body mass identify to social contents, more often to somatic. Obese girls more rarely than obese boys identify to mental mother representation emotional contents, more often to somatic contents. The specific relation properties of mother to obese person in adolescence could be manifested in difficulties in turn on contents of mental mother representation, in external, somatic point of concern for mental mother representation, difficulties in contact with mental contents of mother representation.

  10. A Sol-gel Integrated Dual-readout Microarray Platform for Quantification and Identification of Prostate-specific Antigen.

    Science.gov (United States)

    Lee, SangWook; Lee, Jong Hyun; Kwon, Hyuck Gi; Laurell, Thomas; Jeong, Ok Chan; Kim, Soyoun

    2018-01-01

    Here, we report a sol-gel integrated affinity microarray for on-chip matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) that enables capture and identification of prostate?specific antigen (PSA) in samples. An anti-PSA antibody (H117) was mixed with a sol?gel, and the mixture was spotted onto a porous silicon (pSi) surface without additional surface modifications. The antibody easily penetrates the sol-gel macropore fluidic network structure, making possible high affinities. To assess the capture affinity of the platform, we performed a direct assay using fluorescein isothiocyanate-labeled PSA. Pure PSA was subjected to on-chip MALDI-TOF-MS analysis, yielding three clear mass peptide peaks (m/z = 1272, 1407, and 1872). The sol-gel microarray platform enables dual readout of PSA both fluorometric and MALDI-TOF MS analysis in biological samples. Here we report a useful method for a means for discovery of biomarkers in complex body fluids.

  11. Predictive Direct Torque Control Application-Specific Integrated Circuit of an Induction Motor Drive with a Fuzzy Controller

    Directory of Open Access Journals (Sweden)

    Guo-Ming Sung

    2017-06-01

    Full Text Available This paper proposes a modified predictive direct torque control (PDTC application-specific integrated circuit (ASIC of a motor drive with a fuzzy controller for eliminating sampling and calculating delay times in hysteresis controllers. These delay times degrade the control quality and increase both torque and flux ripples in a motor drive. The proposed fuzzy PDTC ASIC calculates the stator’s magnetic flux and torque by detecting the three-phase current, three-phase voltage, and rotor speed, and eliminates the ripples in the torque and flux by using a fuzzy controller and predictive scheme. The Verilog hardware description language was used to implement the hardware architecture, and the ASIC was fabricated by the Taiwan Semiconductor Manufacturing Company through a 0.18-μm 1P6M CMOS process that involved a cell-based design method. The measurements revealed that the proposed fuzzy PDTC ASIC of the three-phase induction motor yielded a test coverage of 96.03%, fault coverage of 95.06%, chip area of 1.81 × 1.81 mm2, and power consumption of 296 mW, at an operating frequency of 50 MHz and a supply voltage of 1.8 V.

  12. Improving the livelihoods of wool producers in a sustainable manner ...

    African Journals Online (AJOL)

    Improving the livelihoods of wool producers in a sustainable manner by optimizing the woolled sheep production systems within the communal farming area of the Eastern Cape. “A vision that is future directed”

  13. The Manners of Liberalism: A Question of Limits.

    Science.gov (United States)

    Allen, William B.

    1982-01-01

    The argument that liberal education leads people to substitute intellectual tolerance or ambiguity for righteous indignation is criticized, with reference to Harriet Beecher Stowe's portrayal of Thomas Jefferson, his liberalism, and democratic manners. (MSE)

  14. Silence and table manners : When environments activate norms (Retracted article. See vol. 38, pg. 1378, 2012)

    NARCIS (Netherlands)

    Joly, Janneke F.; Stapel, Diederik A.; Lindenberg, Siegwart M.

    Two studies tested the conditions under which an environment (e. g., library, restaurant) raises the relevance of environment-specific social norms (e. g., being quiet, using table manners). As hypothesized, the relevance of such norms is raised when environments are goal relevant ("I am going there

  15. 29 CFR 1614.703 - Manner and format of data.

    Science.gov (United States)

    2010-07-01

    ... § 1614.704(a) through (m). (3) When posting data pursuant to § 1614.704(d) and (j), bases of... 29 Labor 4 2010-07-01 2010-07-01 false Manner and format of data. 1614.703 Section 1614.703 Labor... Retaliation Act of 2002 (No FEAR Act) § 1614.703 Manner and format of data. (a) Agencies shall post their...

  16. 'Integration'

    DEFF Research Database (Denmark)

    Olwig, Karen Fog

    2011-01-01

    , while the countries have adopted disparate policies and ideologies, differences in the actual treatment and attitudes towards immigrants and refugees in everyday life are less clear, due to parallel integration programmes based on strong similarities in the welfare systems and in cultural notions...... of equality in the three societies. Finally, it shows that family relations play a central role in immigrants’ and refugees’ establishment of a new life in the receiving societies, even though the welfare society takes on many of the social and economic functions of the family....

  17. Integrated genetic and epigenetic analysis identifies haplotype-specific methylation in the FTO type 2 diabetes and obesity susceptibility locus.

    Directory of Open Access Journals (Sweden)

    Christopher G Bell

    2010-11-01

    Full Text Available Recent multi-dimensional approaches to the study of complex disease have revealed powerful insights into how genetic and epigenetic factors may underlie their aetiopathogenesis. We examined genotype-epigenotype interactions in the context of Type 2 Diabetes (T2D, focussing on known regions of genomic susceptibility. We assayed DNA methylation in 60 females, stratified according to disease susceptibility haplotype using previously identified association loci. CpG methylation was assessed using methylated DNA immunoprecipitation on a targeted array (MeDIP-chip and absolute methylation values were estimated using a Bayesian algorithm (BATMAN. Absolute methylation levels were quantified across LD blocks, and we identified increased DNA methylation on the FTO obesity susceptibility haplotype, tagged by the rs8050136 risk allele A (p = 9.40×10(-4, permutation p = 1.0×10(-3. Further analysis across the 46 kb LD block using sliding windows localised the most significant difference to be within a 7.7 kb region (p = 1.13×10(-7. Sequence level analysis, followed by pyrosequencing validation, revealed that the methylation difference was driven by the co-ordinated phase of CpG-creating SNPs across the risk haplotype. This 7.7 kb region of haplotype-specific methylation (HSM, encapsulates a Highly Conserved Non-Coding Element (HCNE that has previously been validated as a long-range enhancer, supported by the histone H3K4me1 enhancer signature. This study demonstrates that integration of Genome-Wide Association (GWA SNP and epigenomic DNA methylation data can identify potential novel genotype-epigenotype interactions within disease-associated loci, thus providing a novel route to aid unravelling common complex diseases.

  18. Site-specific integration of CAR gene into Jurkat T cells with a linear close-ended AAV-based DNA vector for CAR-T engineering.

    Science.gov (United States)

    Zhang, Yun; Liu, Xiaomei; Zhang, Jinju; Zhang, Chun

    2016-09-01

    To develop a site-specific integration strategy for CAR-T engineering by using a non-viral vector dependent on adeno-associated viral (AAV) genome, which tends to be integrated into AAVS1 site with the help of its Rep proteins. AAV-dependent vectors were produced in Sf9 cells. Structural analyses revealed the vector as covalently close-ended, linear duplex molecules, which was termed "CELiD" DNA. A plasmid CMV-Rep was constructed to express the integrases Rep78 and Rep68. Jurkat cells were co-electroporated with "CELiD" DNA and plasmid CMV-Rep in order to specifically integrate CAR gene into AAVS1 site. We examined 71 stably transfected Jurkat clones by nested PCR, sequencing and southern blotting, of which 30 clones bore CAR gene within AAVS1 site. The site-specific integration efficiency was nearly 42.2 %. The AAV-dependent vector preferentially integrated CAR into AAVS1 site, which could be further used in human T cell modification and enhance the security of CAR-T therapy.

  19. Plasma cell-free DNA and its DNA integrity as biomarker to distinguish prostate cancer from benign prostatic hyperplasia in patients with increased serum prostate-specific antigen.

    Science.gov (United States)

    Feng, Jiang; Gang, Feng; Li, Xiao; Jin, Tang; Houbao, Huang; Yu, Cao; Guorong, Li

    2013-08-01

    To investigate whether plasma cell-free DNA (cfDNA) or its integrity could differentiate prostate cancer from benign prostate hyperplasia (BPH) in patients with serum prostate-specific antigen (PSA) ≥ 4 ng/ml. Ninety-six patients with prostate cancer and 112 patients with BPH were enrolled. cfDNA levels in plasma before prostate biopsy were quantified by real-time PCR amplification of ALU gene (product size of 115 bp), and quantitative ratio of ALU (247 bp) to ALU (115 bp) reflected the integrity of cfDNA. In patients with serum PSA ≥ 4 ng/ml, there were significant differences in plasma cfDNA or its integrity between the patients with prostate cancer (19.74 ± 4.43, 0.34 ± 0.05) and patients with BPH (7.36 ± 1.58, 0.19 ± 0.03; P Prostate cancer could be differentiated with a sensitivity of 73.2 % and a specificity of 72.7 % by cfDNA (AUC = 0.864). The integrity of cfDNA had a sensitivity of 81.7 % and a specificity of 78.8 % for the distinguishing prostate cancer from BPH (AUC = 0.910). cfDNA and its integrity could be applied to differentiate prostate cancer from BPH in patients with serum PSA ≥ 4 ng/ml.

  20. Apportioning sources of organic matter in streambed sediments: An integrated molecular and compound-specific stable isotope approach

    Energy Technology Data Exchange (ETDEWEB)

    Cooper, Richard J., E-mail: Richard.J.Cooper@uea.ac.uk [School of Environmental Sciences, University of East Anglia, Norwich Research Park, Norwich NR4 7TJ (United Kingdom); Pedentchouk, Nikolai; Hiscock, Kevin M.; Disdle, Paul [School of Environmental Sciences, University of East Anglia, Norwich Research Park, Norwich NR4 7TJ (United Kingdom); Krueger, Tobias [IRI THESys, Humboldt University, 10099 Berlin (Germany); Rawlins, Barry G. [British Geological Survey, Keyworth, Nottingham NG12 5GG (United Kingdom)

    2015-07-01

    apportionment of organic matter sources. Median organic matter contributions ranged from 22% to 52% for trees, 29% to 50% for herbaceous perennials, 17% to 34% for C{sub 3} graminoids and 3% to 7% for C{sub 4} graminoids. The results presented here clearly demonstrate the effectiveness of an integrated molecular and stable isotope analysis for quantitatively apportioning, with uncertainty, plant-specific organic matter contributions to streambed sediments via a Bayesian mixing model approach. - Highlights: • Organic contributions from trees, herbs and C{sub 3}/C{sub 4} graminoids are apportioned. • δ{sup 2}H provides strong discrimination between plant functional types. • δ{sup 13}C provides strong contrasts between C{sub 3} and C{sub 4} plants. • δ{sup 2}H and δ{sup 13}C values could not differentiate aquatic and terrestrial species. • n-Alkane ratios compliment isotopic discrimination.

  1. Rapid development of stable transgene CHO cell lines by CRISPR/Cas9-mediated site-specific integration into C12orf35.

    Science.gov (United States)

    Zhao, Menglin; Wang, Jiaxian; Luo, Manyu; Luo, Han; Zhao, Meiqi; Han, Lei; Zhang, Mengxiao; Yang, Hui; Xie, Yueqing; Jiang, Hua; Feng, Lei; Lu, Huili; Zhu, Jianwei

    2018-07-01

    Chinese hamster ovary (CHO) cells are the most widely used mammalian hosts for recombinant protein production. However, by conventional random integration strategy, development of a high-expressing and stable recombinant CHO cell line has always been a difficult task due to the heterogenic insertion and its caused requirement of multiple rounds of selection. Site-specific integration of transgenes into CHO hot spots is an ideal strategy to overcome these challenges since it can generate isogenic cell lines with consistent productivity and stability. In this study, we investigated three sites with potential high transcriptional activities: C12orf35, HPRT, and GRIK1, to determine the possible transcriptional hot spots in CHO cells, and further construct a reliable site-specific integration strategy to develop recombinant cell lines efficiently. Genes encoding representative proteins mCherry and anti-PD1 monoclonal antibody were targeted into these three loci respectively through CRISPR/Cas9 technology. Stable cell lines were generated successfully after a single round of selection. In comparison with a random integration control, all the targeted integration cell lines showed higher productivity, among which C12orf35 locus was the most advantageous in both productivity and cell line stability. Binding affinity and N-glycan analysis of the antibody revealed that all batches of product were of similar quality independent on integrated sites. Deep sequencing demonstrated that there was low level of off-target mutations caused by CRISPR/Cas9, but none of them contributed to the development process of transgene cell lines. Our results demonstrated the feasibility of C12orf35 as the target site for exogenous gene integration, and strongly suggested that C12orf35 targeted integration mediated by CRISPR/Cas9 is a reliable strategy for the rapid development of recombinant CHO cell lines.

  2. An integrated specification for the nexus of water pollution and economic growth in China: Panel cointegration, long-run causality and environmental Kuznets curve.

    Science.gov (United States)

    Zhang, Chen; Wang, Yuan; Song, Xiaowei; Kubota, Jumpei; He, Yanmin; Tojo, Junji; Zhu, Xiaodong

    2017-12-31

    This paper concentrates on a Chinese context and makes efforts to develop an integrated process to explicitly elucidate the relationship between economic growth and water pollution discharge-chemical oxygen demand (COD) discharge and ammonia nitrogen (NH 3 -N), using two unbalanced panel data sets covering the period separately from 1990 to 2014, and 2001 to 2014. In our present study, the panel unit root tests, cointegration tests, and Granger causality tests allowing for cross-sectional dependence, nonstationary, and heterogeneity are conducted to examine the causal effects of economic growth on COD/NH 3 -N discharge. Further, we simultaneously apply semi-parametric fixed effects estimation and parametric fixed effects estimation to investigate environmental Kuznets curve relationship for COD/NH 3 -N discharge. Our empirical results show a long-term bidirectional causality between economic growth and COD/NH 3 -N discharge in China. Within the Stochastic Impacts by Regression on Population, Affluence and Technology framework, we find evidence in support of an inverted U-shaped curved link between economic growth and COD/NH 3 -N discharge. To the best of our knowledge, there have not been any efforts made in investigating the nexus of economic growth and water pollution in such an integrated manner. Therefore, this study takes a fresh look on this topic. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Sesquilinear uniform vector integral

    Indian Academy of Sciences (India)

    theory, together with his integral, dominate contemporary mathematics. ... directions belonging to Bartle and Dinculeanu (see [1], [6], [7] and [2]). ... in this manner, namely he integrated vector functions with respect to measures of bounded.

  4. Life sciences payload definition and integration study, task C and D. Volume 4: Preliminary equipment item specification catalog

    Science.gov (United States)

    1973-01-01

    A specification catalog to define the equipment to be used for conducting life sciences experiments in a space laboratory is presented. The specification sheets list the purpose of the equipment item, and any specific technical requirements which can be identified. The status of similar hardware for ground use is stated with comments regarding modifications required to achieve spaceflight qualified hardware. Pertinent sketches, commercial catalog sheets, or drawings of the applicable equipment are included.

  5. 21 CFR 1306.05 - Manner of issuance of prescriptions.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Manner of issuance of prescriptions. 1306.05 Section 1306.05 Food and Drugs DRUG ENFORCEMENT ADMINISTRATION, DEPARTMENT OF JUSTICE PRESCRIPTIONS... revised, effective June 1, 2010. For the convenience of the user, therevised text is set forth as follows...

  6. Grand Manner Aesthetics in Landscape: From Canvas to Celluloid

    Science.gov (United States)

    Auger, Emily E.

    2009-01-01

    The methods by which environmental issues are aestheticized in late-twentieth-century film is directly and historically related to those established for grand manner painters by Nicholas Poussin (1594-1665) and taught at the French academy from the seventeenth through the nineteenth centuries. That these fundamentals were part of the training of…

  7. Stereotypes: A Preliminary Report on Mannerisms and Blindisms.

    Science.gov (United States)

    Leonhardt, M.

    1990-01-01

    The article describes current research on stereotypes in a group of blind children in Barcelona, Spain. Mannerisms and blindisms covering a range of verbal and motor behavior are defined and discussed, as are the variables of behavior related to them. (Author/DB)

  8. 26 CFR 1.1071-4 - Manner of election.

    Science.gov (United States)

    2010-04-01

    ... corporation, the statement shall be signed with the corporate name, followed by the signature and title of an officer of the corporation empowered to sign for the corporation, and the corporate seal must be affixed...) INCOME TAXES Changes to Effectuate F.c.c. Policy § 1.1071-4 Manner of election. (a) An election under the...

  9. 20 CFR 335.2 - Manner of claiming sickness benefits.

    Science.gov (United States)

    2010-04-01

    ..., or in the case of a female employee, pregnancy, miscarriage, or childbirth, an employee must file the... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Manner of claiming sickness benefits. 335.2 Section 335.2 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD UNEMPLOYMENT...

  10. 18 CFR 344.2 - Manner of submitting quotations.

    Science.gov (United States)

    2010-04-01

    ... quotations. 344.2 Section 344.2 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY REGULATIONS UNDER THE INTERSTATE COMMERCE ACT FILING QUOTATIONS FOR U.S. GOVERNMENT SHIPMENTS AT REDUCED RATES § 344.2 Manner of submitting quotations. (a) The quotation or tender...

  11. Rehabilitation-specific challenges and advantages in the integration of migrant physicians in Germany: a multiperspective qualitative interview study in rehabilitative settings.

    Science.gov (United States)

    Jansen, E; Hänel, P; Klingler, C

    2018-07-01

    In Germany, rehabilitative healthcare institutions increasingly rely on migrant physicians to meet their staffing needs. Yet until now, research on the integration of migrant physicians has focussed entirely on the acute care setting. This study is the first to address the specific advantages and challenges to integration in the field of rehabilitative medicine where a high number of migrant physicians work. From the experiences of migrant physicians and their colleagues, we provide actionable suggestions to counteract potential sources of conflict and thereby improve the integration of migrant physicians in the German workforce. We conducted a qualitative interview study. We conducted 23 interviews with a total of 26 participants occupying a variety of roles in two different rehabilitation centres (maximum variation sampling). Interviews were recorded, transcribed verbatim and parsed through thematic analysis. Our research revealed advantages and challenges to integration in three distinct areas: rehabilitative care institutions, competencies of migrant professionals and interpersonal relations. The first set of issues hinges on the work processes within rehabilitative hospitals, professional prospects there and the location of the institutions themselves. Second, migrant physicians may encounter difficulties because of limited linguistic skills and country-specific knowledge. And finally, aspects of their interactions with care teams and patients may constitute barriers to integration. Some of the factors influencing the integration of migrant physicians are the same in both rehabilitative and acute medicine, but the rehabilitative setting presents distinct advantages and challenges that are worthy of study in their own right. We outline several measures which could help overcome challenges to the integration of migrant physicians, including those associated with professional relationships. Further research is needed to develop concrete support programmes

  12. Stability of transmembrane amyloid β-peptide and membrane integrity tested by molecular modeling of site-specific Aβ42 mutations.

    Directory of Open Access Journals (Sweden)

    Chetan Poojari

    Full Text Available Interactions of the amyloid β-protein (Aβ with neuronal cell membranes, leading to the disruption of membrane integrity, are considered to play a key role in the development of Alzheimer's disease. Natural mutations in Aβ42, such as the Arctic mutation (E22G have been shown to increase Aβ42 aggregation and neurotoxicity, leading to the early-onset of Alzheimer's disease. A correlation between the propensity of Aβ42 to form protofibrils and its effect on neuronal dysfunction and degeneration has been established. Using rational mutagenesis of the Aβ42 peptide it was further revealed that the aggregation of different Aβ42 mutants in lipid membranes results in a variety of polymorphic aggregates in a mutation dependent manner. The mutant peptides also have a variable ability to disrupt bilayer integrity. To further test the connection between Aβ42 mutation and peptide-membrane interactions, we perform molecular dynamics simulations of membrane-inserted Aβ42 variants (wild-type and E22G, D23G, E22G/D23G, K16M/K28M and K16M/E22G/D23G/K28M mutants as β-sheet monomers and tetramers. The effects of charged residues on transmembrane Aβ42 stability and membrane integrity are analyzed at atomistic level. We observe an increased stability for the E22G Aβ42 peptide and a decreased stability for D23G compared to wild-type Aβ42, while D23G has the largest membrane-disruptive effect. These results support the experimental observation that the altered toxicity arising from mutations in Aβ is not only a result of the altered aggregation propensity, but also originates from modified Aβ interactions with neuronal membranes.

  13. Pre-service teachers' competencies for technology integration: Insights from a mathematics-specific instructional technology course

    NARCIS (Netherlands)

    Agyei, D.D.; Voogt, Joke; Resta, P.

    2012-01-01

    A combination of various measures (self-report, learning outcomes and written reports) was employed to investigate 104 pre-service teachers’ competencies in spreadsheet integration after enrolling in an Instructional Technology course. The pre-service teachers engaged in a “learning technology by

  14. Pre-Service Teachers' TPACK Competencies for Spreadsheet Integration: Insights from a Mathematics-Specific Instructional Technology Course

    Science.gov (United States)

    Agyei, Douglas D.; Voogt, Joke M.

    2015-01-01

    This article explored the impact of strategies applied in a mathematics instructional technology course for developing technology integration competencies, in particular in the use of spreadsheets, in pre-service teachers. In this respect, 104 pre-service mathematics teachers from a teacher training programme in Ghana enrolled in the mathematics…

  15. Pre-service teachers’ TPACK competencies for spreadsheet integration: insights from a mathematics-specific instructional technology course

    NARCIS (Netherlands)

    Agyei, D.D.; Voogt, J.M.

    2015-01-01

    This article explored the impact of strategies applied in a mathematics instructional technology course for developing technology integration competencies, in particular in the use of spreadsheets, in pre-service teachers. In this respect, 104 pre-service mathematics teachers from a teacher training

  16. Mutant PIK3CA Induces EMT in a Cell Type Specific Manner.

    Directory of Open Access Journals (Sweden)

    Divya Bhagirath

    Full Text Available Breast cancer is characterized into different molecular subtypes, and each subtype is characterized by differential gene expression that are associated with distinct survival outcomes in patients. PIK3CA mutations are commonly associated with most breast cancer subtypes. More recently PIK3CA mutations have been shown to induce tumor heterogeneity and are associated with activation of EGFR-signaling and reduced relapse free survival in basal subtype of breast cancer. Thus, understanding what determines PIK3CA induced heterogeneity and oncogenesis, is an important area of investigation. In this study, we assessed the effect of mutant PIK3CA together with mutant Ras plus mutant p53 on oncogenic behavior of two distinct stem/progenitor breast cell lines, designated as K5+/K19- and K5+/K19+. Constructs were ectopically overexpressed in K5+/K19- and K5+/K19+ stem/progenitor cells, followed by various in-vitro and in-vivo analyses. Oncogene combination m-Ras/m-p53/m-PIK3CA efficiently transformed both K5+/K19- and K5+/K19+ cell lines in-vitro, as assessed by anchorage-independent soft agar colony formation assay. Significantly, while this oncogene combination induced a complete epithelial-to-mesenchymal transition (EMT in K5+/K19- cell line, mostly epithelial phenotype with minor EMT component was seen in K5+/K19+ cell line. However, both K5+/K19- and K5+/K19+ transformed cells exhibited increased invasion and migration abilities. Analyses of CD44 and CD24 expression showed both cell lines had tumor-initiating CD44+/CD24low cell population, however transformed K5+/K19- cells had more proportion of these cells. Significantly, both cell types exhibited in-vivo tumorigenesis, and maintained their EMT and epithelial nature in-vivo in mice tumors. Notably, while both cell types exhibited increase in tumor-initiating cell population, differential EMT phenotype was observed in these cell lines. These results suggest that EMT is a cell type dependent phenomenon and does not dictate oncogenesis.

  17. Maternal obesity reprograms offspring's executive brain centers in a sex-specific manner?

    DEFF Research Database (Denmark)

    Plucińska, Kaja; Barger, Steven W

    2018-01-01

    . The group found that high-fat diet feeding in utero increases weight gain in offspring and dynamically alters DNA methylation in the PFC of male but not female brains. These epigenetic marks were associated with a shift in brain one-carbon metabolism (folate and methionine) intermediates and were normalized...

  18. VDR haploinsufficiency impacts body composition and skeletal acquisition in a gender-specific manner.

    Science.gov (United States)

    de Paula, Francisco J A; Dick-de-Paula, Ingrid; Bornstein, Sheila; Rostama, Bahman; Le, Phuong; Lotinun, Sutada; Baron, Roland; Rosen, Clifford J

    2011-09-01

    The vitamin D receptor (VDR) is crucial for virtually all of vitamin D's actions and is thought to be ubiquitously expressed. We hypothesized that disruption of one allele of the VDR gene would impact bone development and would have metabolic consequences. Body composition and bone mass (BMD) in VDR heterozygous (VDR HET) mice were compared to those obtained in male and female VDR KO and WT mice at 8 weeks of age. Male mice were also evaluated at 16 weeks, and bone marrow mesenchymal stem cell (MSC) differentiation was evaluated in VDR female mice. Additionally, female VDR HET and WT mice received intermittent PTH treatment or vehicle (VH) for 4 weeks. BMD was determined at baseline and after treatment. MRI was done in vivo at the end of treatment; μCT and bone histomorphometry were performed after killing the animals. VDR HET male mice had normal skeletal development until 16 weeks of age but showed significantly less gain in fat mass than WT mice. In contrast, female VDR HET mice showed decreased total-body BMD at age 8 weeks but had a normal skeletal response to PTH. MSC differentiation was also impaired in VDR HET female mice. Thus, female VDR HET mice show early impairment in bone acquisition, while male VDR HET mice exhibit a lean phenotype. Our results indicate that the VDR HET mouse is a useful model for studying the metabolic and skeletal impact of decreased vitamin D sensitivity.

  19. Adipogenic Differentiation of Mesenchymal Stem Cells Alters Their Immunomodulatory Properties in a Tissue-Specific Manner.

    Science.gov (United States)

    Munir, Hafsa; Ward, Lewis S C; Sheriff, Lozan; Kemble, Samuel; Nayar, Saba; Barone, Francesca; Nash, Gerard B; McGettrick, Helen M

    2017-06-01

    Chronic inflammation is associated with formation of ectopic fat deposits that might represent damage-induced aberrant mesenchymal stem cell (MSC) differentiation. Such deposits are associated with increased levels of inflammatory infiltrate and poor prognosis. Here we tested the hypothesis that differentiation from MSC to adipocytes in inflamed tissue might contribute to chronicity through loss of immunomodulatory function. We assessed the effects of adipogenic differentiation of MSC isolated from bone marrow or adipose tissue on their capacity to regulate neutrophil recruitment by endothelial cells and compared the differentiated cells to primary adipocytes from adipose tissue. Bone marrow derived MSC were immunosuppressive, inhibiting neutrophil recruitment to TNFα-treated endothelial cells (EC), but MSC-derived adipocytes were no longer able to suppress neutrophil adhesion. Changes in IL-6 and TGFβ1 signalling appeared critical for the loss of the immunosuppressive phenotype. In contrast, native stromal cells, adipocytes derived from them, and mature adipocytes from adipose tissue were all immunoprotective. Thus disruption of normal tissue stroma homeostasis, as occurs in chronic inflammatory diseases, might drive "abnormal" adipogenesis which adversely influences the behavior of MSC and contributes to pathogenic recruitment of leukocytes. Interestingly, stromal cells programmed in native fat tissue retain an immunoprotective phenotype. Stem Cells 2017;35:1636-1646. © 2017 The Authors STEM CELLS published by Wiley Periodicals, Inc. on behalf of AlphaMed Press.

  20. Competitive interactions are mediated in a sex-specific manner by arbuscular mycorrhiza in Antennaria dioica

    OpenAIRE

    Varga, S.; Vega-Frutis, R.; Kytöviita, M.-M.; Franken, P.

    2017-01-01

    Plants usually interact with other plants, and the outcome of such interaction ranges from facilitation to competition depending on the identity of the plants, including their sexual expression. Arbuscular mycorrhizal (AM) fungi have been shown to modify competitive interactions in plants. However, few studies have evaluated how AM fungi influence plant intraspecific and interspecific interactions in dioecious species. The competitive abilities of female and male plants of Antennaria dioic...

  1. Integrated Multidisciplinary Optimization Objects

    Science.gov (United States)

    Alston, Katherine

    2014-01-01

    OpenMDAO is an open-source MDAO framework. It is used to develop an integrated analysis and design environment for engineering challenges. This Phase II project integrated additional modules and design tools into OpenMDAO to perform discipline-specific analysis across multiple flight regimes at varying levels of fidelity. It also showcased a refined system architecture that allows the system to be less customized to a specific configuration (i.e., system and configuration separation). By delivering a capable and validated MDAO system along with a set of example applications to be used as a template for future users, this work greatly expands NASA's high-fidelity, physics-based MDAO capabilities and enables the design of revolutionary vehicles in a cost-effective manner. This proposed work complements M4 Engineering's expertise in developing modeling and simulation toolsets that solve relevant subsonic, supersonic, and hypersonic demonstration applications.

  2. NARRATIVE PERSPECTIVE MEDIATED BY MANNER OF MOTION VERBS

    Directory of Open Access Journals (Sweden)

    Olesea BODEAN-VOZIAN

    2016-12-01

    Full Text Available There is typological variation in the way languages encode manner as an element of a motion event. Languages like English view it as relevant, and the lexicalization of the variety of ways to move results in a rich class of motion verbs, contrary to other types of languages, like Romanian, which leave the manner element to be encoded by verbids or adverbs (for these reasons some linguists refer to the first type as manner-rich and second type as manner-poor languages. Still, several studies contrasting typologically different languages showed that languages of the latter type are not so poor in manner-of-motion verbs. The question then might rather be: which manner components are more likely to be lexicalized?For research purposes, we distinguish manner in terms of objective elements (medium, speed or intensity and subjective elements (attitude, intention. The aim of the study is to focus on the manner-of-motion verbs that embed an evaluative or qualitative dimension of motion and to examine the way these verbs encode somebody’s perspective in a narrative. The first question in such a case is whose evaluation or point of view is being represented. The second one is how the subjective point of view (narrative perspective mediated through manner-of-motion verbs in an English narrative (The Lord of the Rings, by J.R.R. Tolkien is translated into Romanian, supposedly a manner-poor or low-manner language.PERSPECTIVA NARATIVĂ MEDIATĂ DE VERBELE DE MIŞCARE DE MODExistă o variaţie tipologică în felul în care limbile codifică modul ca element al unui eveniment de mişcare. Limbile precum engleza îl percep drept unul relevant, iar lexicalizarea gamei de mijloace de redare a mişcării a dat naştere unei clase bogate de verbe de mişcare, contrar altor tipuri de limbi, aşa ca româna, în care elementul ce redă modul este codificat de gerunziu sau adverbe. Din aceasta cauză, unii lingvişti numesc primul tip limbi bogate în verbe de mod (

  3. Practicing leadership-as-practice in content and manner

    OpenAIRE

    Raelin, Joe; Kempster, Stephen John; Youngs, Howard; Caroll, Brigid; Jackson, Brad

    2018-01-01

    A collective and collaborative response to an article appearing in Leadership’s “Leading Questions” department is prepared by a team subscribing to the leadership-as-practice approach. The focus is to represent the manner in which leadership-as-practice operates as a leadership theory and in its communal practice orientation. Among the themes addressed are leadership-as-practice’s theory development, its contribution in comparison to critical leadership theory, its approach to power, and its ...

  4. MANNER OF STOCKS SORTING USING CLUSTER ANALYSIS METHODS

    Directory of Open Access Journals (Sweden)

    Jana Halčinová

    2014-06-01

    Full Text Available The aim of the present article is to show the possibility of using the methods of cluster analysis in classification of stocks of finished products. Cluster analysis creates groups (clusters of finished products according to similarity in demand i.e. customer requirements for each product. Manner stocks sorting of finished products by clusters is described a practical example. The resultants clusters are incorporated into the draft layout of the distribution warehouse.

  5. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

    Science.gov (United States)

    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

    2012-04-27

    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

  6. Review of Variable Generation Integration Charges

    Energy Technology Data Exchange (ETDEWEB)

    Porter, K.; Fink, S.; Buckley, M.; Rogers, J.; Hodge, B. M.

    2013-03-01

    The growth of wind and solar generation in the United States, and the expectation of continued growth of these technologies, dictates that the future power system will be operated in a somewhat different manner because of increased variability and uncertainty. A small number of balancing authorities have attempted to determine an 'integration cost' to account for these changes to their current operating practices. Some balancing authorities directly charge wind and solar generators for integration charges, whereas others add integration charges to projected costs of wind and solar in integrated resource plans or in competitive solicitations for generation. This report reviews the balancing authorities that have calculated variable generation integration charges and broadly compares and contrasts the methodologies they used to determine their specific integration charges. The report also profiles each balancing authority and how they derived wind and solar integration charges.

  7. Non-natural manners of death among users of illicit drugs: Substance findings.

    Science.gov (United States)

    Delaveris, Gerd Jorunn M; Teige, Brita; Rogde, Sidsel

    2014-05-01

    The aim of the study was to explore differences and similarities between the various non-natural manners of death (accident, suicide, homicide) regarding toxicological findings in illicit drug users. Medicolegal autopsy reports from the Institute of Forensic Medicine University of Oslo concerning deaths from 2000 to 2009 were investigated. Those aged 20-59 whose manner of death was non-natural and who tested positive for any narcotic drug (morphine/heroin, amphetamines, ecstasy, cannabis, LSD, PCP, and high levels of GHB in addition to methadone and buprenorphine) were selected. All substance findings were registered and categorized (narcotics, ethanol, and medicinal products). Of the 1603 autopsies that met the selection criteria, 1204 were accidental intoxications, 122 accidents other than intoxication, 114 suicides by intoxication, 119 non-intoxication suicides, and 44 victims of homicide. Poly drug use was found in all manners of death. The drug profile as well as the mean number of substances (illicit drugs and medicinal products) varied from 2.9 to 4.6 substances per case, depending on the manner of death. Intoxication suicides had the highest number of substances and a total drug profile similar to accidental intoxications. Non-intoxication suicides had a total drug profile similar to homicide and accidents other than intoxication. The number of substances found per case increased during the decade, mainly due to increased findings of methadone, cannabis, amphetamines, and benzodiazepines. Methadone findings increased much more than buprenorphine. Methadone was found 20 times more often than buprenorphine in accidental intoxication cases. In summary, poly drug findings are common in adults who suffer a non-natural death while using illicit drugs. The different manners of death have some specific characteristics and significant differences regarding drug profile. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  8. Same-same but different: integrating central university support and faculty-specific knowledge for mentor training. A Practice Report

    Directory of Open Access Journals (Sweden)

    Deborah Rodrigo

    2014-08-01

    Full Text Available Mentoring literature often cites a tension between local initiatives that target the needs of specific groups and more efficient centralised programs addressing common concerns across a larger population. For several years, the University of Sydney has had a Mentoring Network consisting of the faculties of Arts and Social Sciences, Health Sciences, Science, Sydney Law School and the Business School. These faculties have worked together to develop a community of best practice for mentoring programs at our large, multi-campus institution, and for the past two years have included a representative from Student Support Services to incorporate a centralised support component into their faculty-specific training programs. This Practice Report showcases the work of the University of Sydney Mentoring Network in combining central university services with faculty-based mentoring.

  9. Drilling Specifications: Well Installations in the 300 Area to Support PNNL's Integrated Field-Scale Subsurface Research Challenge (IFC) Project

    International Nuclear Information System (INIS)

    Bjornstad, Bruce N.; Vermeul, Vince R.

    2008-01-01

    Part of the 300 Area Integrated Field-Scale Subsurface Research Challenge (IFC) will be installation of a network of high density borings and wells to monitor migration of fluids and contaminants (uranium), both in groundwater and vadose zone, away from an surface infiltration plot (Figure A-1). The infiltration plot will be located over an area of suspected contamination at the former 300 Area South Process Pond (SPP). The SPP is located in the southeastern portion of the Hanford Site, within the 300-FF-5 Operable Unit. Pacific Northwest National Laboratory (PNNL) with the support of FH shall stake the well locations prior to the start of drilling. Final locations will be based on accessibility and will avoid any surface or underground structures or hazards as well as surface contamination

  10. An integrated chemical biology approach identifies specific vulnerability of Ewing's sarcoma to combined inhibition of Aurora kinases A and B.

    Science.gov (United States)

    Winter, Georg E; Rix, Uwe; Lissat, Andrej; Stukalov, Alexey; Müllner, Markus K; Bennett, Keiryn L; Colinge, Jacques; Nijman, Sebastian M; Kubicek, Stefan; Kovar, Heinrich; Kontny, Udo; Superti-Furga, Giulio

    2011-10-01

    Ewing's sarcoma is a pediatric cancer of the bone that is characterized by the expression of the chimeric transcription factor EWS-FLI1 that confers a highly malignant phenotype and results from the chromosomal translocation t(11;22)(q24;q12). Poor overall survival and pronounced long-term side effects associated with traditional chemotherapy necessitate the development of novel, targeted, therapeutic strategies. We therefore conducted a focused viability screen with 200 small molecule kinase inhibitors in 2 different Ewing's sarcoma cell lines. This resulted in the identification of several potential molecular intervention points. Most notably, tozasertib (VX-680, MK-0457) displayed unique nanomolar efficacy, which extended to other cell lines, but was specific for Ewing's sarcoma. Furthermore, tozasertib showed strong synergies with the chemotherapeutic drugs etoposide and doxorubicin, the current standard agents for Ewing's sarcoma. To identify the relevant targets underlying the specific vulnerability toward tozasertib, we determined its cellular target profile by chemical proteomics. We identified 20 known and unknown serine/threonine and tyrosine protein kinase targets. Additional target deconvolution and functional validation by RNAi showed simultaneous inhibition of Aurora kinases A and B to be responsible for the observed tozasertib sensitivity, thereby revealing a new mechanism for targeting Ewing's sarcoma. We further corroborated our cellular observations with xenograft mouse models. In summary, the multilayered chemical biology approach presented here identified a specific vulnerability of Ewing's sarcoma to concomitant inhibition of Aurora kinases A and B by tozasertib and danusertib, which has the potential to become a new therapeutic option.

  11. Integrated transcriptome catalogue and organ-specific profiling of gene expression in fertile garlic (Allium sativum L.).

    Science.gov (United States)

    Kamenetsky, Rina; Faigenboim, Adi; Shemesh Mayer, Einat; Ben Michael, Tomer; Gershberg, Chen; Kimhi, Sagie; Esquira, Itzhak; Rohkin Shalom, Sarit; Eshel, Dani; Rabinowitch, Haim D; Sherman, Amir

    2015-01-22

    Garlic is cultivated and consumed worldwide as a popular condiment and green vegetable with medicinal and neutraceutical properties. Garlic cultivars do not produce seeds, and therefore, this plant has not been the subject of either classical breeding or genetic studies. However, recent achievements in fertility restoration in a number of genotypes have led to flowering and seed production, thus enabling genetic studies and breeding in garlic. A transcriptome catalogue of fertile garlic was produced from multiplexed gene libraries, using RNA collected from various plant organs, including inflorescences and flowers. Over 32 million 250-bp paired-end reads were assembled into an extensive transcriptome of 240,000 contigs. An abundant transcriptome assembled separately from 102,000 highly expressed contigs was annotated and analyzed for gene ontology and metabolic pathways. Organ-specific analysis showed significant variation of gene expression between plant organs, with the highest number of specific reads in inflorescences and flowers. Analysis of the enriched biological processes and molecular functions revealed characteristic patterns for stress response, flower development and photosynthetic activity. Orthologues of key flowering genes were differentially expressed, not only in reproductive tissues, but also in leaves and bulbs, suggesting their role in flower-signal transduction and the bulbing process. More than 100 variants and isoforms of enzymes involved in organosulfur metabolism were differentially expressed and had organ-specific patterns. In addition to plant genes, viral RNA of at least four garlic viruses was detected, mostly in the roots and cloves, whereas only 1-4% of the reads were found in the foliage leaves. The de novo transcriptome of fertile garlic represents a new resource for research and breeding of this important crop, as well as for the development of effective molecular markers for useful traits, including fertility and seed production

  12. Integrated analysis of DNA methylation and gene expression reveals specific signaling pathways associated with platinum resistance in ovarian cancer

    Directory of Open Access Journals (Sweden)

    Chung Jae

    2009-06-01

    Full Text Available Abstract Background Cisplatin and carboplatin are the primary first-line therapies for the treatment of ovarian cancer. However, resistance to these platinum-based drugs occurs in the large majority of initially responsive tumors, resulting in fully chemoresistant, fatal disease. Although the precise mechanism(s underlying the development of platinum resistance in late-stage ovarian cancer patients currently remains unknown, CpG-island (CGI methylation, a phenomenon strongly associated with aberrant gene silencing and ovarian tumorigenesis, may contribute to this devastating condition. Methods To model the onset of drug resistance, and investigate DNA methylation and gene expression alterations associated with platinum resistance, we treated clonally derived, drug-sensitive A2780 epithelial ovarian cancer cells with increasing concentrations of cisplatin. After several cycles of drug selection, the isogenic drug-sensitive and -resistant pairs were subjected to global CGI methylation and mRNA expression microarray analyses. To identify chemoresistance-associated, biological pathways likely impacted by DNA methylation, promoter CGI methylation and mRNA expression profiles were integrated and subjected to pathway enrichment analysis. Results Promoter CGI methylation revealed a positive association (Spearman correlation of 0.99 between the total number of hypermethylated CGIs and GI50 values (i.e., increased drug resistance following successive cisplatin treatment cycles. In accord with that result, chemoresistance was reversible by DNA methylation inhibitors. Pathway enrichment analysis revealed hypermethylation-mediated repression of cell adhesion and tight junction pathways and hypomethylation-mediated activation of the cell growth-promoting pathways PI3K/Akt, TGF-beta, and cell cycle progression, which may contribute to the onset of chemoresistance in ovarian cancer cells. Conclusion Selective epigenetic disruption of distinct biological

  13. An integrated translation of design data of a nuclear power plant from a specification-driven plant design system to neutral model data

    Energy Technology Data Exchange (ETDEWEB)

    Mun, Duhwan, E-mail: dhmun@moeri.re.k [Marine Safety and Pollution Response Research Department, Maritime and Ocean Engineering Research Institute, KORDI, 171 Jang-dong, Yuseong-gu, Daejeon 305-343 (Korea, Republic of); Yang, Jeongsam, E-mail: jyang@ajou.ac.k [Division of Industrial and Information Systems Engineering, Ajou University, San 5, Wonchun-dong, Yeongtong-gu, Suwon 443-749 (Korea, Republic of)

    2010-03-15

    How to efficiently integrate and manage lifecycle data of a nuclear power plant has gradually become an important object of study. Because plants usually have a very long period of operation and maintenance, the plant design data need to be presented in a computer-interpretable form and to be independent of any commercial systems. The conversion of plant design data from various design systems into neutral model data is therefore an important technology for the effective operation and maintenance of plants. In this study, a neutral model for the efficient integration of plant design data is chosen from among the currently available options and extended in order to cover the information model requirements of nuclear power plants in Korea. After the mapping of the neutral model and the data model of a specification-driven plant design system, a plant data translator is also implemented in accordance with the schema mapping results.

  14. An integrated translation of design data of a nuclear power plant from a specification-driven plant design system to neutral model data

    International Nuclear Information System (INIS)

    Mun, Duhwan; Yang, Jeongsam

    2010-01-01

    How to efficiently integrate and manage lifecycle data of a nuclear power plant has gradually become an important object of study. Because plants usually have a very long period of operation and maintenance, the plant design data need to be presented in a computer-interpretable form and to be independent of any commercial systems. The conversion of plant design data from various design systems into neutral model data is therefore an important technology for the effective operation and maintenance of plants. In this study, a neutral model for the efficient integration of plant design data is chosen from among the currently available options and extended in order to cover the information model requirements of nuclear power plants in Korea. After the mapping of the neutral model and the data model of a specification-driven plant design system, a plant data translator is also implemented in accordance with the schema mapping results.

  15. Are Sport-Specific Profiles of Tendon Stiffness and Cross-Sectional Area Determined by Structural or Functional Integrity?

    Directory of Open Access Journals (Sweden)

    Hans-Peter Wiesinger

    Full Text Available The present study aimed to determine whether distinct sets of tendon properties are seen in athletes engaged in sports with contrasting requirements for tendon function and structural integrity. Patellar and Achilles tendon morphology and force-deformation relation were measured by combining ultrasonography, electromyography and dynamometry in elite ski jumpers, distance runners, water polo players and sedentary individuals. Tendon cross-sectional area normalized to body mass2/3 was smaller in water polo players than in other athletes (patellar and Achilles tendon; -28 to -24% or controls (patellar tendon only; -9%. In contrast, the normalized cross-sectional area was larger in runners (patellar tendon only; +26% and ski jumpers (patellar and Achilles tendon; +21% and +13%, respectively than in controls. Tendon stiffness normalized to body mass2/3 only differed in ski jumpers, compared to controls (patellar and Achilles tendon; +11% and +27%, respectively and to water polo players (Achilles tendon only; +23%. Tendon size appears as an adjusting variable to changes in loading volume and/or intensity, possibly to preserve ultimate strength or fatigue resistance. However, uncoupled morphological and mechanical properties indicate that functional requirements may also influence tendon adaptations.

  16. Simultaneous inference of phenotype-associated genes and relevant tissues from GWAS data via Bayesian integration of multiple tissue-specific gene networks.

    Science.gov (United States)

    Wu, Mengmeng; Lin, Zhixiang; Ma, Shining; Chen, Ting; Jiang, Rui; Wong, Wing Hung

    2017-12-01

    Although genome-wide association studies (GWAS) have successfully identified thousands of genomic loci associated with hundreds of complex traits in the past decade, the debate about such problems as missing heritability and weak interpretability has been appealing for effective computational methods to facilitate the advanced analysis of the vast volume of existing and anticipated genetic data. Towards this goal, gene-level integrative GWAS analysis with the assumption that genes associated with a phenotype tend to be enriched in biological gene sets or gene networks has recently attracted much attention, due to such advantages as straightforward interpretation, less multiple testing burdens, and robustness across studies. However, existing methods in this category usually exploit non-tissue-specific gene networks and thus lack the ability to utilize informative tissue-specific characteristics. To overcome this limitation, we proposed a Bayesian approach called SIGNET (Simultaneously Inference of GeNEs and Tissues) to integrate GWAS data and multiple tissue-specific gene networks for the simultaneous inference of phenotype-associated genes and relevant tissues. Through extensive simulation studies, we showed the effectiveness of our method in finding both associated genes and relevant tissues for a phenotype. In applications to real GWAS data of 14 complex phenotypes, we demonstrated the power of our method in both deciphering genetic basis and discovering biological insights of a phenotype. With this understanding, we expect to see SIGNET as a valuable tool for integrative GWAS analysis, thereby boosting the prevention, diagnosis, and treatment of human inherited diseases and eventually facilitating precision medicine.

  17. Low spatial frequency bias in schizophrenia is not face specific: When the integration of coarse and fine information fails

    Directory of Open Access Journals (Sweden)

    Vincent eLaprevote

    2013-05-01

    Full Text Available Studies have shown that patients with schizophrenia exhibit visual processing impairments, particularly regarding the processing of spatial frequencies. In a previous work, we found that, compared to healthy volunteers, patients were biased towards low spatial frequencies (LSF to identify facial expression at a glance. Given the ubiquity of faces in visual perception, it remains an open question whether the LSF bias is face specific or also occurs with other visual objects. Here, fifteen patients with schizophrenia and eleven healthy control adults performed a categorization task with hybrid stimuli. These stimuli were single images consisting of two different objects, a fruit and an animal, each in a specific spatial frequency range, either low (LSF or high (HSF. Observers were asked to report if they saw an animal or a fruit. The reported category demonstrated which spatial scale was preferentially perceived in each trial. In a control experiment, participants performed the same task but with images of only a single object, either a LSF or HSF filtered animal or fruit, to verify that participants could perceive both HSF or LSF when presented in isolation. The results on the categorization task showed that patients chose more frequently LSF with hybrid stimuli compared to healthy controls. However, both populations performed equally well with HSF and LSF filtered pictures in the control experiment, demonstrating that the LSF preference found with hybrid stimuli in patients was not due to an inability to perceive HSF.The LSF preference found in schizophrenia confirms our previous study conducted with faces, and shows that this LSF bias generalizes to other categories of objects. When a broad range of spatial frequencies are present in the image, as in normal conditions of viewing, patients preferentially rely on coarse visual information contained in LSF. This result may be interpreted as a dysfunction of the guidance of HSF processing by LSF

  18. Quality specifications in postgraduate medical e-learning: an integrative literature review leading to a postgraduate medical e-learning model.

    Science.gov (United States)

    De Leeuw, R A; Westerman, Michiel; Nelson, E; Ket, J C F; Scheele, F

    2016-07-08

    E-learning is driving major shifts in medical education. Prioritizing learning theories and quality models improves the success of e-learning programs. Although many e-learning quality standards are available, few are focused on postgraduate medical education. We conducted an integrative review of the current postgraduate medical e-learning literature to identify quality specifications. The literature was thematically organized into a working model. Unique quality specifications (n = 72) were consolidated and re-organized into a six-domain model that we called the Postgraduate Medical E-learning Model (Postgraduate ME Model). This model was partially based on the ISO-19796 standard, and drew on cognitive load multimedia principles. The domains of the model are preparation, software design and system specifications, communication, content, assessment, and maintenance. This review clarified the current state of postgraduate medical e-learning standards and specifications. It also synthesized these specifications into a single working model. To validate our findings, the next-steps include testing the Postgraduate ME Model in controlled e-learning settings.

  19. Integrative modeling of eQTLs and cis-regulatory elements suggests mechanisms underlying cell type specificity of eQTLs.

    Directory of Open Access Journals (Sweden)

    Christopher D Brown

    Full Text Available Genetic variants in cis-regulatory elements or trans-acting regulators frequently influence the quantity and spatiotemporal distribution of gene transcription. Recent interest in expression quantitative trait locus (eQTL mapping has paralleled the adoption of genome-wide association studies (GWAS for the analysis of complex traits and disease in humans. Under the hypothesis that many GWAS associations tag non-coding SNPs with small effects, and that these SNPs exert phenotypic control by modifying gene expression, it has become common to interpret GWAS associations using eQTL data. To fully exploit the mechanistic interpretability of eQTL-GWAS comparisons, an improved understanding of the genetic architecture and causal mechanisms of cell type specificity of eQTLs is required. We address this need by performing an eQTL analysis in three parts: first we identified eQTLs from eleven studies on seven cell types; then we integrated eQTL data with cis-regulatory element (CRE data from the ENCODE project; finally we built a set of classifiers to predict the cell type specificity of eQTLs. The cell type specificity of eQTLs is associated with eQTL SNP overlap with hundreds of cell type specific CRE classes, including enhancer, promoter, and repressive chromatin marks, regions of open chromatin, and many classes of DNA binding proteins. These associations provide insight into the molecular mechanisms generating the cell type specificity of eQTLs and the mode of regulation of corresponding eQTLs. Using a random forest classifier with cell specific CRE-SNP overlap as features, we demonstrate the feasibility of predicting the cell type specificity of eQTLs. We then demonstrate that CREs from a trait-associated cell type can be used to annotate GWAS associations in the absence of eQTL data for that cell type. We anticipate that such integrative, predictive modeling of cell specificity will improve our ability to understand the mechanistic basis of human

  20. Performance of an optical encoder based on a nondiffractive beam implemented with a specific photodetection integrated circuit and a diffractive optical element.

    Science.gov (United States)

    Quintián, Fernando Perez; Calarco, Nicolás; Lutenberg, Ariel; Lipovetzky, José

    2015-09-01

    In this paper, we study the incremental signal produced by an optical encoder based on a nondiffractive beam (NDB). The NDB is generated by means of a diffractive optical element (DOE). The detection system is composed by an application specific integrated circuit (ASIC) sensor. The sensor consists of an array of eight concentric annular photodiodes, each one provided with a programmable gain amplifier. In this way, the system is able to synthesize a nonuniform detectivity. The contrast, amplitude, and harmonic content of the sinusoidal output signal are analyzed. The influence of the cross talk among the annular photodiodes is placed in evidence through the dependence of the signal contrast on the wavelength.

  1. Note: A 102 dB dynamic-range charge-sampling readout for ionizing particle/radiation detectors based on an application-specific integrated circuit (ASIC)

    Science.gov (United States)

    Pullia, A.; Zocca, F.; Capra, S.

    2018-02-01

    An original technique for the measurement of charge signals from ionizing particle/radiation detectors has been implemented in an application-specific integrated circuit form. The device performs linear measurements of the charge both within and beyond its output voltage swing. The device features an unprecedented spectroscopic dynamic range of 102 dB and is suitable for high-resolution ion and X-γ ray spectroscopy. We believe that this approach may change a widespread paradigm according to which no high-resolution spectroscopy is possible when working close to or beyond the limit of the preamplifier's output voltage swing.

  2. Integration of genome-scale metabolic networks into whole-body PBPK models shows phenotype-specific cases of drug-induced metabolic perturbation.

    Science.gov (United States)

    Cordes, Henrik; Thiel, Christoph; Baier, Vanessa; Blank, Lars M; Kuepfer, Lars

    2018-01-01

    Drug-induced perturbations of the endogenous metabolic network are a potential root cause of cellular toxicity. A mechanistic understanding of such unwanted side effects during drug therapy is therefore vital for patient safety. The comprehensive assessment of such drug-induced injuries requires the simultaneous consideration of both drug exposure at the whole-body and resulting biochemical responses at the cellular level. We here present a computational multi-scale workflow that combines whole-body physiologically based pharmacokinetic (PBPK) models and organ-specific genome-scale metabolic network (GSMN) models through shared reactions of the xenobiotic metabolism. The applicability of the proposed workflow is illustrated for isoniazid, a first-line antibacterial agent against Mycobacterium tuberculosis , which is known to cause idiosyncratic drug-induced liver injuries (DILI). We combined GSMN models of a human liver with N-acetyl transferase 2 (NAT2)-phenotype-specific PBPK models of isoniazid. The combined PBPK-GSMN models quantitatively describe isoniazid pharmacokinetics, as well as intracellular responses, and changes in the exometabolome in a human liver following isoniazid administration. Notably, intracellular and extracellular responses identified with the PBPK-GSMN models are in line with experimental and clinical findings. Moreover, the drug-induced metabolic perturbations are distributed and attenuated in the metabolic network in a phenotype-dependent manner. Our simulation results show that a simultaneous consideration of both drug pharmacokinetics at the whole-body and metabolism at the cellular level is mandatory to explain drug-induced injuries at the patient level. The proposed workflow extends our mechanistic understanding of the biochemistry underlying adverse events and may be used to prevent drug-induced injuries in the future.

  3. Integrated use of biomarkers and bioaccumulation data in Zebra mussel (Dreissena polymorpha) for site-specific quality assessment.

    Science.gov (United States)

    Binelli, A; Ricciardi, F; Riva, C; Provini, A

    2006-01-01

    One of the useful biological tools for environmental management is the measurement of biomarkers whose changes are related to the exposure to chemicals or environmental stress. Since these responses might vary with different contaminants or depending on the pollutant concentration reached in the organism, the support of bioaccumulation data is needed to prevent false conclusions. In this study, several persistent organic pollutants -- 23 polychlorinated biphenyl (PCB) congeners, 11 polycyclic aromatic hydrocarbons (PAHs), six dichlorodiphenyltricholroethane (DDT) relatives, hexachlorobenzene (HCB), chlorpyrifos and its oxidized metabolite -- and some herbicides (lindane and the isomers alpha, beta, delta; terbutilazine; alachlor; metolachlor) were measured in the soft tissues of the freshwater mollusc Zebra mussel (Dreissena polymorpha) from 25 sampling sites in the Italian portions of the sub-alpine great lakes along with the measure of ethoxyresorufin dealkylation (EROD) and acetylcholinesterase (AChE) activity. The linkage between bioaccumulation and biomarker data allowed us to create site-specific environmental quality indexes towards man-made chemicals. This classification highlighted three different degrees of xenobiotic contamination of the Italian sub-alpine great lakes: a high water quality in Lake Lugano with negligible pollutant levels and no effects on enzyme activities, an homogeneous poor quality for Lakes Garda, Iseo and Como, and the presence of some xenobiotic point-sources in Lake Maggiore, whose ecological status could be jeopardized, also due to the heavy DDT contamination revealed since 1996.

  4. The discovery of putative urine markers for the specific detection of prostate tumor by integrative mining of public genomic profiles.

    Directory of Open Access Journals (Sweden)

    Min Chen

    Full Text Available Urine has emerged as an attractive biofluid for the noninvasive detection of prostate cancer (PCa. There is a strong imperative to discover candidate urinary markers for the clinical diagnosis and prognosis of PCa. The rising flood of various omics profiles presents immense opportunities for the identification of prospective biomarkers. Here we present a simple and efficient strategy to derive candidate urine markers for prostate tumor by mining cancer genomic profiles from public databases. Prostate, bladder and kidney are three major tissues from which cellular matters could be released into urine. To identify urinary markers specific for PCa, upregulated entities that might be shed in exosomes of bladder cancer and kidney cancer are first excluded. Through the ontology-based filtering and further assessment, a reduced list of 19 entities encoding urinary proteins was derived as putative PCa markers. Among them, we have found 10 entities closely associated with the process of tumor cell growth and development by pathway enrichment analysis. Further, using the 10 entities as seeds, we have constructed a protein-protein interaction (PPI subnetwork and suggested a few urine markers as preferred prognostic markers to monitor the invasion and progression of PCa. Our approach is amenable to discover and prioritize potential markers present in a variety of body fluids for a spectrum of human diseases.

  5. An Integrated Metabolomic and Microbiome Analysis Identified Specific Gut Microbiota Associated with Fecal Cholesterol and Coprostanol in Clostridium difficile Infection.

    Directory of Open Access Journals (Sweden)

    Vijay C Antharam

    Full Text Available Clostridium difficile infection (CDI is characterized by dysbiosis of the intestinal microbiota and a profound derangement in the fecal metabolome. However, the contribution of specific gut microbes to fecal metabolites in C. difficile-associated gut microbiome remains poorly understood. Using gas-chromatography mass spectrometry (GC-MS and 16S rRNA deep sequencing, we analyzed the metabolome and microbiome of fecal samples obtained longitudinally from subjects with Clostridium difficile infection (n = 7 and healthy controls (n = 6. From 155 fecal metabolites, we identified two sterol metabolites at >95% match to cholesterol and coprostanol that significantly discriminated C. difficile-associated gut microbiome from healthy microbiota. By correlating the levels of cholesterol and coprostanol in fecal extracts with 2,395 bacterial operational taxonomic units (OTUs determined by 16S rRNA sequencing, we identified 63 OTUs associated with high levels of coprostanol and 2 OTUs correlated with low coprostanol levels. Using indicator species analysis (ISA, 31 of the 63 coprostanol-associated bacteria correlated with health, and two Veillonella species were associated with low coprostanol levels that correlated strongly with CDI. These 65 bacterial taxa could be clustered into 12 sub-communities, with each community containing a consortium of organisms that co-occurred with one another. Our studies identified 63 human gut microbes associated with cholesterol-reducing activities. Given the importance of gut bacteria in reducing and eliminating cholesterol from the GI tract, these results support the recent finding that gut microbiome may play an important role in host lipid metabolism.

  6. Effects of education and race on cognitive decline: An integrative analysis of generalizability versus study-specific results

    Science.gov (United States)

    Gross, Alden L.; Mungas, Dan M.; Crane, Paul K.; Gibbons, Laura E.; MacKay-Brandt, Anna; Manly, Jennifer J.; Mukherjee, Shubhabrata; Romero, Heather; Sachs, Bonnie; Thomas, Michael; Potter, Guy G.; Jones, Richard N.

    2015-01-01

    Objective To examine variability across multiple prospective cohort studies in level and rate of cognitive decline by race/ethnicity and years of education. Method To compare data across studies, we harmonized estimates of common latent factors representing overall or general cognitive performance, memory, and executive function derived from the: 1) Washington Heights, Hamilton Heights, Inwood Columbia Aging Project (N=4,115), 2) Spanish and English Neuropsychological Assessment Scales (N=525), 3) Duke Memory, Health, and Aging study (N=578), and 4) Neurocognitive Outcomes of Depression in the Elderly (N=585). We modeled cognitive change over age for cognitive outcomes by race, education, and study. We adjusted models for sex, dementia status, and study-specific characteristics. Results For baseline levels of overall cognitive performance, memory, and executive function, differences in race and education tended to be larger than between-study differences and consistent across studies. This pattern did not hold for rate of cognitive decline: effects of education and race/ethnicity on cognitive change were not consistently observed across studies, and when present were small, with racial/ethnic minorities and those with lower education declining at faster rates. Discussion In this diverse set of datasets, non-Hispanic whites and those with higher education had substantially higher baseline cognitive test scores. However, differences in the rate of cognitive decline by race/ethnicity and education did not follow this pattern. This study suggests that baseline test scores and longitudinal change have different determinants, and future studies to examine similarities and differences of causes of cognitive decline in racially/ethnically and educationally diverse older groups is needed. PMID:26523693

  7. An Integrated Metabolomic and Microbiome Analysis Identified Specific Gut Microbiota Associated with Fecal Cholesterol and Coprostanol in Clostridium difficile Infection.

    Science.gov (United States)

    Antharam, Vijay C; McEwen, Daniel C; Garrett, Timothy J; Dossey, Aaron T; Li, Eric C; Kozlov, Andrew N; Mesbah, Zhubene; Wang, Gary P

    2016-01-01

    Clostridium difficile infection (CDI) is characterized by dysbiosis of the intestinal microbiota and a profound derangement in the fecal metabolome. However, the contribution of specific gut microbes to fecal metabolites in C. difficile-associated gut microbiome remains poorly understood. Using gas-chromatography mass spectrometry (GC-MS) and 16S rRNA deep sequencing, we analyzed the metabolome and microbiome of fecal samples obtained longitudinally from subjects with Clostridium difficile infection (n = 7) and healthy controls (n = 6). From 155 fecal metabolites, we identified two sterol metabolites at >95% match to cholesterol and coprostanol that significantly discriminated C. difficile-associated gut microbiome from healthy microbiota. By correlating the levels of cholesterol and coprostanol in fecal extracts with 2,395 bacterial operational taxonomic units (OTUs) determined by 16S rRNA sequencing, we identified 63 OTUs associated with high levels of coprostanol and 2 OTUs correlated with low coprostanol levels. Using indicator species analysis (ISA), 31 of the 63 coprostanol-associated bacteria correlated with health, and two Veillonella species were associated with low coprostanol levels that correlated strongly with CDI. These 65 bacterial taxa could be clustered into 12 sub-communities, with each community containing a consortium of organisms that co-occurred with one another. Our studies identified 63 human gut microbes associated with cholesterol-reducing activities. Given the importance of gut bacteria in reducing and eliminating cholesterol from the GI tract, these results support the recent finding that gut microbiome may play an important role in host lipid metabolism.

  8. Integrated analysis of RNA-binding protein complexes using in vitro selection and high-throughput sequencing and sequence specificity landscapes (SEQRS).

    Science.gov (United States)

    Lou, Tzu-Fang; Weidmann, Chase A; Killingsworth, Jordan; Tanaka Hall, Traci M; Goldstrohm, Aaron C; Campbell, Zachary T

    2017-04-15

    RNA-binding proteins (RBPs) collaborate to control virtually every aspect of RNA function. Tremendous progress has been made in the area of global assessment of RBP specificity using next-generation sequencing approaches both in vivo and in vitro. Understanding how protein-protein interactions enable precise combinatorial regulation of RNA remains a significant problem. Addressing this challenge requires tools that can quantitatively determine the specificities of both individual proteins and multimeric complexes in an unbiased and comprehensive way. One approach utilizes in vitro selection, high-throughput sequencing, and sequence-specificity landscapes (SEQRS). We outline a SEQRS experiment focused on obtaining the specificity of a multi-protein complex between Drosophila RBPs Pumilio (Pum) and Nanos (Nos). We discuss the necessary controls in this type of experiment and examine how the resulting data can be complemented with structural and cell-based reporter assays. Additionally, SEQRS data can be integrated with functional genomics data to uncover biological function. Finally, we propose extensions of the technique that will enhance our understanding of multi-protein regulatory complexes assembled onto RNA. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Is physiotherapy integrated virtual walking effective on pain, function, and kinesiophobia in patients with non-specific low-back pain? Randomised controlled trial.

    Science.gov (United States)

    Yilmaz Yelvar, Gul Deniz; Çırak, Yasemin; Dalkılınç, Murat; Parlak Demir, Yasemin; Guner, Zeynep; Boydak, Ayşenur

    2017-02-01

    According to literature, virtual reality was found to reduce pain and kinesiophobia in patients with chronic pain. The purpose of the study was to investigate short-term effect of the virtual reality on pain, function, and kinesiophobia in patients with subacute and chronic non-specific low-back pain METHODS: This randomised controlled study in which 44 patients were randomly assigned to the traditional physiotherapy (control group, 22 subjects) or virtual walking integrated physiotherapy (experimental group, 22 subjects). Before and after treatment, Visual Analog Scale (VAS), TAMPA Kinesiophobia Scale (TKS), Oswestry Disability Index (ODI), Nottingham Health Profile (NHP), Timed-up and go Test (TUG), 6-Minute Walk Test (6MWT), and Single-Leg Balance Test were assessed. The interaction effect between group and time was assessed by using repeated-measures analysis of covariance. After treatment, both groups showed improvement in all parameters. However, VAS, TKS, TUG, and 6MWT scores showed significant differences in favor of the experimental group. Virtual walking integrated physiotherapy reduces pain and kinesiophobia, and improved function in patients with subacute and chronic non-specific low-back pain in short term.

  10. Metal stressors consistently modulate bacterial conjugal plasmid uptake potential in a phylogenetically conserved manner

    DEFF Research Database (Denmark)

    Klümper, Uli; Dechesne, Arnaud; Riber, Leise

    2017-01-01

    The environmental stimulants and inhibitors of conjugal plasmid transfer in microbial communities are poorly understood. Specifically, it is not known whether exposure to stressors may cause a community to alter its plasmid uptake ability. We assessed whether metals (Cu, Cd, Ni, Zn) and one metal...... that community permissiveness is sensitive to metal(loid) stress in a manner that is both partially consistent across stressors and phylogenetically conserved.The ISME Journal advance online publication, 2 August 2016; doi:10.1038/ismej.2016.98....

  11. The description of morality and manners in Vsevolod Solovyov’s short prose

    OpenAIRE

    Nikolsky Evgeny Vladimirovich

    2013-01-01

    This article contains a genre specificity of short prose by Vsevolod Solovyov, whose work is devoted to the Russian history between the 18th and 19th centuries. According to professor N.L. Vershinina, the author distinguishes the difference between the description of morality and manners. The main difference is in the presence of author’s point of view on the describing occurrences. In this case, such works are considered to be a kind of morality, which characterizes Solovyov’s works. Showing...

  12. The description of morality and manners in Vsevolod Solovyov’s short prose

    Directory of Open Access Journals (Sweden)

    Nikolsky Evgeny Vladimirovich

    2013-06-01

    Full Text Available This article contains a genre specificity of short prose by Vsevolod Solovyov, whose work is devoted to the Russian history between the 18th and 19th centuries. According to professor N.L. Vershinina, the author distinguishes the difference between the description of morality and manners. The main difference is in the presence of author’s point of view on the describing occurrences. In this case, such works are considered to be a kind of morality, which characterizes Solovyov’s works. Showing every-day life, he examined the process of turning barbarism into a civilizing society.

  13. Association between abnormal serum myelin-specific protein levels and white matter integrity in first-episode and drug-naïve patients with major depressive disorder.

    Science.gov (United States)

    Jiang, Linling; Cheng, Yuqi; Jiang, Hongyan; Xu, Jian; Lu, Jin; Shen, Zonglin; Lu, Yi; Liu, Fang; Li, Luqiong; Xu, Xiufeng

    2018-05-01

    Although the structural abnormalities of white matter (WM) have been described in patients with major depressive disorder (MDD), the neuropathological changes remain unclear. The current study aimed to investigate the myelin oligodendrocyte glycoprotein (MOG) and myelin-associated glycoprotein (MAG) levels and their correlations with WM integrity in first-episode, drug-naïve MDD patients. We obtained diffusion tensor images of 102 first-episode, drug-naïve MDD patients and 81 age- and sex-matched controls. Serum MOG and MAG levels of all participants were measured and compared between the two groups. The correlations between WM integrity and MOG and MAG levels were examined. MOG and MAG serum levels were significantly higher in MDD patients than in controls. Patients with MDD also showed decreased fractional anisotropy (FA) and axial diffusivity in the WM of the bilateral thalamus, right hippocampus, right temporal lobe, and left pulvinar. At the whole-brain level, no regions showed any correlations of diffusivity parameters with MOG or MAG levels in healthy subjects. However, we observed two-way correlations between the MOG and MAG levels and the FA and mean diffusivity values in the WM of the left middle frontal lobe, right inferior parietal lobe, and right supplementary motor area in MDD patients. Further investigation with a larger sample size and longitudinal studies are required to better understand the neuropathology of WM integrity in MDD. Our findings represent the first evidence of a relationship between abnormal serum myelin-specific protein levels and impaired WM integrity, which may help to better understand the neurobiological mechanisms of MDD. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Integrative proteomics, genomics, and translational immunology approaches reveal mutated forms of Proteolipid Protein 1 (PLP1) and mutant-specific immune response in multiple sclerosis.

    Science.gov (United States)

    Qendro, Veneta; Bugos, Grace A; Lundgren, Debbie H; Glynn, John; Han, May H; Han, David K

    2017-03-01

    In order to gain mechanistic insights into multiple sclerosis (MS) pathogenesis, we utilized a multi-dimensional approach to test the hypothesis that mutations in myelin proteins lead to immune activation and central nervous system autoimmunity in MS. Mass spectrometry-based proteomic analysis of human MS brain lesions revealed seven unique mutations of PLP1; a key myelin protein that is known to be destroyed in MS. Surprisingly, in-depth genomic analysis of two MS patients at the genomic DNA and mRNA confirmed mutated PLP1 in RNA, but not in the genomic DNA. Quantification of wild type and mutant PLP RNA levels by qPCR further validated the presence of mutant PLP RNA in the MS patients. To seek evidence linking mutations in abundant myelin proteins and immune-mediated destruction of myelin, specific immune response against mutant PLP1 in MS patients was examined. Thus, we have designed paired, wild type and mutant peptide microarrays, and examined antibody response to multiple mutated PLP1 in sera from MS patients. Consistent with the idea of different patients exhibiting unique mutation profiles, we found that 13 out of 20 MS patients showed antibody responses against specific but not against all the mutant-PLP1 peptides. Interestingly, we found mutant PLP-directed antibody response against specific mutant peptides in the sera of pre-MS controls. The results from integrative proteomic, genomic, and immune analyses reveal a possible mechanism of mutation-driven pathogenesis in human MS. The study also highlights the need for integrative genomic and proteomic analyses for uncovering pathogenic mechanisms of human diseases. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Influence of manner of heating on functioning of fireplace

    International Nuclear Information System (INIS)

    Kouki, J.

    1994-01-01

    In connection with a bioenergy research programme, there is an ongoing project for developing of wood-fired fireplaces. The overall target in the project is through research and development to improve the combustion and heating characteristics of fireplaces so that their harmful flue gas emissions are reduced and they become more appropriate sources of supplementary and reserve energy (e.g. when installed in electrically heated houses). In connection with this project, TTS Institute's Forestry Department conducted a study on the heating properties of a lightweight iron stove. Correct manner of heating is a means to reducing the amount of harmful flue gases produced by fireplaces and of raising their combustion efficiency. The content of environmentally harmful gases in the flue gases was at Its maximum when the stove was operated with little draught and with the combustion chamber full of fuel. By increasing the draught from 4 Pa to 32 Pa, the carbon monoxide content of the non-combusted gases was reduced almost by 75 percent. This was accompanied by nearly a doubling of the free heat loss of the flue gases. As well as being influenced by the draught in the flue, the functioning of the stove and completeness of combustion was influenced by the moisture content of the chopped firewood. A rise in the moisture level from 13 % to 40 % led to nearly a fivefold increase in the proportion of combustible gases in the flue gases

  16. Dose-Specific Adverse Drug Reaction Identification in Electronic Patient Records: Temporal Data Mining in an Inpatient Psychiatric Population

    DEFF Research Database (Denmark)

    Eriksson, Robert; Werge, Thomas; Jensen, Lars Juhl

    2014-01-01

    patient-specific adverse events (AEs) and links these to specific drugs and dosages in a temporal manner, based on integration of text mining results and structured data. The structured data contained precise information on drug identity, dosage and strength.When applying the method to the 3,394 patients...... all indication areas.The aim of this study was to take advantage of techniques for temporal data mining of EPRs in order to detect ADRs in a patient- and dose-specific manner.We used a psychiatric hospital’s EPR system to investigate undesired drug effects. Within one workflow the method identified...

  17. Element Specific Versus Integral Structural and Magnetic Properties of Co:ZnO and Gd:GaN Probed with Hard X-ray Absorption Spectroscopy

    Directory of Open Access Journals (Sweden)

    Andreas Ney

    2010-06-01

    Full Text Available Dilute magnetic semiconductors (DMS are envisioned as sources of spin-polarized carriers for future semiconductor devices which simultaneously utilize spin and charge of the carriers. The hope of discovering a DMS with ferromagnetic order up to room temperature still motivates research on suitable DMS materials. Two candidate wide-band gap DMS are Gd:GaN and Co:ZnO. We have used hard X-ray absorption spectroscopy (XAS and in particular X-ray linear dichroism (XLD and X-ray magnetic circular dichroism (XMCD to study both DMS materials with element specificity and compare these findings with results from integral SQUID magnetometry as well as electron paramagnetic resonance (EPR.

  18. Using hierarchical linear models to test differences in Swedish results from OECD’s PISA 2003: Integrated and subject-specific science education

    Directory of Open Access Journals (Sweden)

    Maria Åström

    2012-06-01

    Full Text Available The possible effects of different organisations of the science curriculum in schools participating in PISA 2003 are tested with a hierarchical linear model (HLM of two levels. The analysis is based on science results. Swedish schools are free to choose how they organise the science curriculum. They may choose to work subject-specifically (with Biology, Chemistry and Physics, integrated (with Science or to mix these two. In this study, all three ways of organising science classes in compulsory school are present to some degree. None of the different ways of organising science education displayed statistically significant better student results in scientific literacy as measured in PISA 2003. The HLM model used variables of gender, country of birth, home language, preschool attendance, an economic, social and cultural index as well as the teaching organisation.

  19. 24 CFR 888.202 - Manner of publication.

    Science.gov (United States)

    2010-04-01

    ... 202 SUPPORTIVE HOUSING FOR THE ELDERLY PROGRAM AND SECTION 811 SUPPORTIVE HOUSING FOR PERSONS WITH DISABILITIES PROGRAM) SECTION 8 HOUSING ASSISTANCE PAYMENTS PROGRAM-FAIR MARKET RENTS AND CONTRACT RENT ANNUAL... published as market conditions indicate. In the case of revised factors applicable only to specific areas...

  20. Effect of a specific combination of carvacrol, cinnamaldehyde, and Capsicum oleoresin on the growth performance, carcass quality and gut integrity of broiler chickens

    Directory of Open Access Journals (Sweden)

    M. H. H. Awaad

    2014-05-01

    Full Text Available Aim: The effect of a specific combination (SC of carvacrol, cinnamaldehyde, and Capsicum oleoresin was investigated on productive performance and immune response in broiler chickens. Materials and Methods: Six hundred one-day-old broiler chickens were randomly allocated into two groups for 5 weeks. The SC was supplemented at 100 ppm of ration (presence or absence. Results: Treatment of broiler chickens with the SC improved productive performance variables as compared with the blank control birds. It decreased total mortality, increased final body weight, weight gain, production number and decreased final feed conversion ratio (FCR (P<0.05. The SC had a positive effect on carcass quality and enhanced HI titer against Newcastle disease (ND virus vaccine, as compared to their untreated control group (P<0.05. The SC treated birds had higher values of intestinal diameter than the control ones. Conclusion: It could be concluded that administration of a specific combination of carvacrol, cinnamaldehyde, and Capsicum oleoresin to broiler chickens improved chicken zootechnical performance response variables, had a potent immuno-modulatory effect (potentiated immune response and improved gut integrity. Eventually, this combination could be used as a replacement to the controversial feed additives (antibiotic growth promoters.

  1. TALE activators regulate gene expression in a position- and strand-dependent manner in mammalian cells.

    Science.gov (United States)

    Uhde-Stone, Claudia; Cheung, Edna; Lu, Biao

    2014-01-24

    Transcription activator-like effectors (TALEs) are a class of transcription factors that are readily programmable to regulate gene expression. Despite their growing popularity, little is known about binding site parameters that influence TALE-mediated gene activation in mammalian cells. We demonstrate that TALE activators modulate gene expression in mammalian cells in a position- and strand-dependent manner. To study the effects of binding site location, we engineered TALEs customized to recognize specific DNA sequences located in either the promoter or the transcribed region of reporter genes. We found that TALE activators robustly activated reporter genes when their binding sites were located within the promoter region. In contrast, TALE activators inhibited the expression of reporter genes when their binding sites were located on the sense strand of the transcribed region. Notably, this repression was independent of the effector domain utilized, suggesting a simple blockage mechanism. We conclude that TALE activators in mammalian cells regulate genes in a position- and strand-dependent manner that is substantially different from gene activation by native TALEs in plants. These findings have implications for optimizing the design of custom TALEs for genetic manipulation in mammalian cells. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. A Spaceborne Synthetic Aperture Radar Partial Fixed-Point Imaging System Using a Field- Programmable Gate Array-Application-Specific Integrated Circuit Hybrid Heterogeneous Parallel Acceleration Technique.

    Science.gov (United States)

    Yang, Chen; Li, Bingyi; Chen, Liang; Wei, Chunpeng; Xie, Yizhuang; Chen, He; Yu, Wenyue

    2017-06-24

    With the development of satellite load technology and very large scale integrated (VLSI) circuit technology, onboard real-time synthetic aperture radar (SAR) imaging systems have become a solution for allowing rapid response to disasters. A key goal of the onboard SAR imaging system design is to achieve high real-time processing performance with severe size, weight, and power consumption constraints. In this paper, we analyse the computational burden of the commonly used chirp scaling (CS) SAR imaging algorithm. To reduce the system hardware cost, we propose a partial fixed-point processing scheme. The fast Fourier transform (FFT), which is the most computation-sensitive operation in the CS algorithm, is processed with fixed-point, while other operations are processed with single precision floating-point. With the proposed fixed-point processing error propagation model, the fixed-point processing word length is determined. The fidelity and accuracy relative to conventional ground-based software processors is verified by evaluating both the point target imaging quality and the actual scene imaging quality. As a proof of concept, a field- programmable gate array-application-specific integrated circuit (FPGA-ASIC) hybrid heterogeneous parallel accelerating architecture is designed and realized. The customized fixed-point FFT is implemented using the 130 nm complementary metal oxide semiconductor (CMOS) technology as a co-processor of the Xilinx xc6vlx760t FPGA. A single processing board requires 12 s and consumes 21 W to focus a 50-km swath width, 5-m resolution stripmap SAR raw data with a granularity of 16,384 × 16,384.

  3. A Spaceborne Synthetic Aperture Radar Partial Fixed-Point Imaging System Using a Field- Programmable Gate Array−Application-Specific Integrated Circuit Hybrid Heterogeneous Parallel Acceleration Technique

    Directory of Open Access Journals (Sweden)

    Chen Yang

    2017-06-01

    Full Text Available With the development of satellite load technology and very large scale integrated (VLSI circuit technology, onboard real-time synthetic aperture radar (SAR imaging systems have become a solution for allowing rapid response to disasters. A key goal of the onboard SAR imaging system design is to achieve high real-time processing performance with severe size, weight, and power consumption constraints. In this paper, we analyse the computational burden of the commonly used chirp scaling (CS SAR imaging algorithm. To reduce the system hardware cost, we propose a partial fixed-point processing scheme. The fast Fourier transform (FFT, which is the most computation-sensitive operation in the CS algorithm, is processed with fixed-point, while other operations are processed with single precision floating-point. With the proposed fixed-point processing error propagation model, the fixed-point processing word length is determined. The fidelity and accuracy relative to conventional ground-based software processors is verified by evaluating both the point target imaging quality and the actual scene imaging quality. As a proof of concept, a field- programmable gate array−application-specific integrated circuit (FPGA-ASIC hybrid heterogeneous parallel accelerating architecture is designed and realized. The customized fixed-point FFT is implemented using the 130 nm complementary metal oxide semiconductor (CMOS technology as a co-processor of the Xilinx xc6vlx760t FPGA. A single processing board requires 12 s and consumes 21 W to focus a 50-km swath width, 5-m resolution stripmap SAR raw data with a granularity of 16,384 × 16,384.

  4. The Generating Mechanism of the Perlocutionary Effects of Train Manner Posters

    OpenAIRE

    水田, 洋子

    2013-01-01

    Manner posters, which are used for the purpose of improving people’s manners in public spaces, attempt to be effective without being impositional. How do they meet the challenge? Manner posters can be considered to perform speech acts with written words and visual devices. The current work investigates the generating mechanism of their perlocutionary effects such as persuasion. It provides a case study of Japanese train manner posters by Tokyo Metro in 2008-2010. The analysis is conducted wit...

  5. 48 CFR 1371.101 - Inspection and manner of doing work.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Inspection and manner of... DEPARTMENT SUPPLEMENTAL REGULATIONS ACQUISITIONS INVOLVING SHIP CONSTRUCTION AND SHIP REPAIR Provisions and Clauses 1371.101 Inspection and manner of doing work. Insert clause 1352.271-70, Inspection and Manner of...

  6. 45 CFR 1621.4 - Complaints by clients about manner or quality of legal assistance.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false Complaints by clients about manner or quality of...) LEGAL SERVICES CORPORATION CLIENT GRIEVANCE PROCEDURES § 1621.4 Complaints by clients about manner or... clients about the manner or quality of legal assistance that has been rendered by the recipient to the...

  7. Autonomic Fuselet Specification and Composition

    National Research Council Canada - National Science Library

    Mills, Peter H

    2006-01-01

    ... model for its business logic, and to perform workflow composition from a goal and specifications to executable model in a manner that enables feedback mechanisms that can assess and adapt the process...

  8. Effect of hydrogel elasticity and ephrinB2-immobilized manner on Runx2 expression of human mesenchymal stem cells.

    Science.gov (United States)

    Toda, Hiroyuki; Yamamoto, Masaya; Uyama, Hiroshi; Tabata, Yasuhiko

    2017-08-01

    The objective of this study is to design the manner of ephrinB2 immobilized onto polyacrylamide (PAAm) hydrogels with varied elasticity and evaluate the effect of hydrogels elasticity and the immobilized manner of ephrinB2 on the Runx2 expression of human mesenchymal stem cells (hMSC). The PAAm hydrogels were prepared by the radical polymerization of acrylamide (AAm), and N,N'-methylenebisacrylamide (BIS). By changing the BIS concentration, the elasticity of PAAm hydrogels changed from 1 to 70kPa. For the bio-specific immobilization of ephrinB2, a chimeric protein of ephrinB2 and Fc domain was immobilized onto protein A-conjugated PAAm hydrogels by making use of the bio-specific interaction between the Fc domain and protein A. When hMSC were cultured on the ephrinB2-immobilized PAAm hydrogels with varied elasticity, the morphology of hMSC was of cuboidal shape on the PAAm hydrogels immobilized with ephrinB2 compared with non-conjugated ones, irrespective of the hydrogels elasticity. The bio-specific immobilization of ephrinB2 enhanced the level of Runx2 expression. The expression level was significantly high for the hydrogels of 3.6 and 5.9kPa elasticity with bio-specific immobilization of ephrinB2 compared with other hydrogels with the same elasticity. The hydrogels showed a significantly down-regulated RhoA activity. It is concluded that the Runx2 expression of hMSC is synergistically influenced by the hydrogels elasticity and their immobilized manner of ephrinB2 immobilized. Differentiation fate of mesenchymal stem cells (MSC) is modified by biochemical and biophysical factors, such as elasticity and signal proteins. However, there are few experiments about combinations of them. In this study, to evaluate the synergistic effect of them on cell properties of MSC, we established to design the manner of Eph signal ligand, ephrinB2, immobilized onto polyacrylamide hydrogels with varied elasticity. The gene expression level of an osteogenic maker, Runx2, was enhanced

  9. Temporal and SUMO-specific SUMOylation contribute to the dynamics of Polo-like kinase 1 (PLK1) and spindle integrity during mouse oocyte meiosis.

    Science.gov (United States)

    Feitosa, Weber Beringui; Hwang, KeumSil; Morris, Patricia L

    2018-02-15

    During mammalian meiosis, Polo-like kinase 1 (PLK1) is essential during cell cycle progression. In oocyte maturation, PLK1 expression is well characterized but timing of posttranslational modifications regulating its activity and subcellular localization are less clear. Small ubiquitin-related modifier (SUMO) posttranslational modifier proteins have been detected in mammalian gametes but their precise function during gametogenesis is largely unknown. In the present paper we report for mouse oocytes that both PLK1 and phosphorylated PLK1 undergo SUMOylation in meiosis II (MII) oocytes using immunocytochemistry, immunoprecipitation and in vitro SUMOylation assays. At MII, PLK1 is phosphorylated at threonine-210 and serine-137. MII oocyte PLK1 and phosphorylated PLK1 undergo SUMOylation by SUMO-1, -2 and -3 as shown by individual in vitro assays. Using these assays, forms of phosphorylated PLK1 normalized to PLK1 increased significantly and correlated with SUMOylated PLK1 levels. During meiotic progression and maturation, SUMO-1-SUMOylation of PLK1 is involved in spindle formation whereas SUMO-2/3-SUMOylation may regulate PLK1 activity at kinetochore-spindle attachment sites. Microtubule integrity is required for PLK1 localization with SUMO-1 but not with SUMO-2/3. Inhibition of SUMOylation disrupts proper meiotic bipolar spindle organization and spindle-kinetochore attachment. The data show that both temporal and SUMO-specific-SUMOylation play important roles in orchestrating functional dynamics of PLK1 during mouse oocyte meiosis, including subcellular compartmentalization. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Development of multiple strain competitive index assays for Listeria monocytogenes using pIMC; a new site-specific integrative vector

    Directory of Open Access Journals (Sweden)

    Cronin Michael

    2008-06-01

    Full Text Available Abstract Background The foodborne, gram-positive pathogen, Listeria monocytogenes, is capable of causing lethal infections in compromised individuals. In the post genomic era of L. monocytogenes research, techniques are required to identify and validate genes involved in the pathogenicity and environmental biology of the organism. The aim here was to develop a widely applicable method to tag L. monocytogenes strains, with a particular emphasis on the development of multiple strain competitive index assays. Results We have constructed a new site-specific integrative vector, pIMC, based on pPL2, for the selection of L. monocytogenes from complex samples. The pIMC vector was further modified through the incorporation of IPTG inducible markers (antibiotic and phenotypic to produce a suite of four vectors which allowed the discrimination of multiple strains from a single sample. We were able to perform murine infection studies with up to four EGDe isolates within a single mouse and showed that the tags did not impact upon growth rate or virulence. The system also allowed the identification of subtle differences in virulence between strains of L. monocytogenes commonly used in laboratory studies. Conclusion This study has developed a competitive index assay that can be broadly applied to all L. monocytogenes strains. Improved statistical robustness of the data was observed, resulting in fewer mice being required for virulence assays. The competitive index assays provide a powerful method to analyse the virulence or fitness of L. monocytogenes in complex biological samples.

  11. Evidence for a Specific Integrative Mechanism for Episodic Memory Mediated by AMPA/kainate Receptors in a Circuit Involving Medial Prefrontal Cortex and Hippocampal CA3 Region.

    Science.gov (United States)

    de Souza Silva, Maria A; Huston, Joseph P; Wang, An-Li; Petri, David; Chao, Owen Yuan-Hsin

    2016-07-01

    We asked whether episodic-like memory requires neural mechanisms independent of those that mediate its component memories for "what," "when," and "where," and if neuronal connectivity between the medial prefrontal cortex (mPFC) and the hippocampus (HPC) CA3 subregion is essential for episodic-like memory. Unilateral lesion of the mPFC was combined with unilateral lesion of the CA3 in the ipsi- or contralateral hemispheres in rats. Episodic-like memory was tested using a task, which assesses the integration of memories for "what, where, and when" concomitantly. Tests for novel object recognition (what), object place (where), and temporal order memory (when) were also applied. Bilateral disconnection of the mPFC-CA3 circuit by N-methyl-d-aspartate (NMDA) lesions disrupted episodic-like memory, but left the component memories for object, place, and temporal order, per se, intact. Furthermore, unilateral NMDA lesion of the CA3 plus injection of (6-cyano-7-nitroquinoxaline-2,3-dione) (CNQX) (AMPA/kainate receptor antagonist), but not AP-5 (NMDA receptor antagonist), into the contralateral mPFC also disrupted episodic-like memory, indicating the mPFC AMPA/kainate receptors as critical for this circuit. These results argue for a selective neural system that specifically subserves episodic memory, as it is not critically involved in the control of its component memories for object, place, and time. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  12. Interleukin-10 is produced by a specific subset of taste receptor cells and critical for maintaining structural integrity of mouse taste buds.

    Science.gov (United States)

    Feng, Pu; Chai, Jinghua; Zhou, Minliang; Simon, Nirvine; Huang, Liquan; Wang, Hong

    2014-02-12

    Although inflammatory responses are a critical component in defense against pathogens, too much inflammation is harmful. Mechanisms have evolved to regulate inflammation, including modulation by the anti-inflammatory cytokine interleukin-10 (IL-10). Previously we have shown that taste buds express various molecules involved in innate immune responses, including the proinflammatory cytokine tumor necrosis factor (TNF). Here, using a reporter mouse strain, we show that taste cells also express the anti-inflammatory cytokine IL-10. Remarkably, IL-10 is produced by only a specific subset of taste cells, which are different from the TNF-producing cells in mouse circumvallate and foliate taste buds: IL-10 expression was found exclusively in the G-protein gustducin-expressing bitter receptor cells, while TNF was found in sweet and umami receptor cells as reported previously. In contrast, IL-10R1, the ligand-binding subunit of the IL-10 receptor, is predominantly expressed by TNF-producing cells, suggesting a novel cellular hierarchy for regulating TNF production and effects in taste buds. In response to inflammatory challenges, taste cells can increase IL-10 expression both in vivo and in vitro. These findings suggest that taste buds use separate populations of taste receptor cells that coincide with sweet/umami and bitter taste reception to modulate local inflammatory responses, a phenomenon that has not been previously reported. Furthermore, IL-10 deficiency in mice leads to significant reductions in the number and size of taste buds, as well as in the number of taste receptor cells per taste bud, suggesting that IL-10 plays critical roles in maintaining structural integrity of the peripheral gustatory system.

  13. Realizing Relevance: The Influence of Domain-Specific Information on Generation of New Knowledge through Integration in 4- to 8-Year-Old Children

    Science.gov (United States)

    Bauer, Patricia J.; Larkina, Marina

    2017-01-01

    In accumulating knowledge, direct modes of learning are complemented by productive processes, including self-generation based on integration of separate episodes. Effects of the number of potentially relevant episodes on integration were examined in 4- to 8-year-olds (N = 121; racially/ethnically heterogeneous sample, English speakers, from large…

  14. Core Didactic Thematics and Methodology in Business Spanish: Developing Leadership with Integrity as a Priority for Language for the Professions and Specific Purposes

    Science.gov (United States)

    Doyle, Michael S.

    2017-01-01

    Business Spanish typically teaches the vocabulary, content, and context of the functional areas of business, and how to conduct business in a cultural setting. But it should do more than just that. Leadership with integrity should be primed and personalized as a signature and integrative core value that frameworks any ensuing learning of the…

  15. 26 CFR 1.669(b)-2 - Manner of exercising election.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 8 2010-04-01 2010-04-01 false Manner of exercising election. 1.669(b)-2 Section 1.669(b)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Years Beginning Before January 1, 1969 § 1.669(b)-2 Manner of exercising election. (a) By whom election...

  16. 26 CFR 301.6316-5 - Manner of paying tax by foreign currency.

    Science.gov (United States)

    2010-04-01

    ... currency to be deposited shall be that amount which, when converted at the rate of exchange used on the... 26 Internal Revenue 18 2010-04-01 2010-04-01 false Manner of paying tax by foreign currency. 301....6316-5 Manner of paying tax by foreign currency. (a) Time and place to pay. The unpaid tax required to...

  17. Point of View: Manner of Realising The Matter in Adichie's Half of A ...

    African Journals Online (AJOL)

    manner' to create meaning or matter. The best form of art is the blending of form and content; means and end; manner and matter. Therefore, the uniqueness of any novelist's product is contingent upon how well or otherwise their peculiar ...

  18. 26 CFR 1.871-1 - Classification and manner of taxing alien individuals.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 9 2010-04-01 2010-04-01 false Classification and manner of taxing alien... (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Nonresident Aliens and Foreign Corporations § 1.871-1 Classification and manner of taxing alien individuals. (a) Classes of aliens. For purposes of the income tax...

  19. 26 CFR 1.522-2 - Manner of taxation of cooperative associations subject to section 522.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 7 2010-04-01 2010-04-01 true Manner of taxation of cooperative associations subject to section 522. 1.522-2 Section 1.522-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF...-2 Manner of taxation of cooperative associations subject to section 522. (a) In general. Farmers...

  20. Benford's Law for Quality Assurance of Manner of Death Counts in Small and Large Databases.

    Science.gov (United States)

    Daniels, Jeremy; Caetano, Samantha-Jo; Huyer, Dirk; Stephen, Andrew; Fernandes, John; Lytwyn, Alice; Hoppe, Fred M

    2017-09-01

    To assess if Benford's law, a mathematical law used for quality assurance in accounting, can be applied as a quality assurance measure for the manner of death determination. We examined a regional forensic pathology service's monthly manner of death counts (N = 2352) from 2011 to 2013, and provincial monthly and weekly death counts from 2009 to 2013 (N = 81,831). We tested whether each dataset's leading digit followed Benford's law via the chi-square test. For each database, we assessed whether number 1 was the most common leading digit. The manner of death counts first digit followed Benford's law in all the three datasets. Two of the three datasets had 1 as the most frequent leading digit. The manner of death data in this study showed qualities consistent with Benford's law. The law has potential as a quality assurance metric in the manner of death determination for both small and large databases. © 2017 American Academy of Forensic Sciences.

  1. Generation of covalently closed circular DNA of hepatitis B viruses via intracellular recycling is regulated in a virus specific manner.

    Directory of Open Access Journals (Sweden)

    Josef Köck

    Full Text Available Persistence of hepatitis B virus (HBV infection requires covalently closed circular (cccDNA formation and amplification, which can occur via intracellular recycling of the viral polymerase-linked relaxed circular (rc DNA genomes present in virions. Here we reveal a fundamental difference between HBV and the related duck hepatitis B virus (DHBV in the recycling mechanism. Direct comparison of HBV and DHBV cccDNA amplification in cross-species transfection experiments showed that, in the same human cell background, DHBV but not HBV rcDNA converts efficiently into cccDNA. By characterizing the distinct forms of HBV and DHBV rcDNA accumulating in the cells we find that nuclear import, complete versus partial release from the capsid and complete versus partial removal of the covalently bound polymerase contribute to limiting HBV cccDNA formation; particularly, we identify genome region-selectively opened nuclear capsids as a putative novel HBV uncoating intermediate. However, the presence in the nucleus of around 40% of completely uncoated rcDNA that lacks most if not all of the covalently bound protein strongly suggests a major block further downstream that operates in the HBV but not DHBV recycling pathway. In summary, our results uncover an unexpected contribution of the virus to cccDNA formation that might help to better understand the persistence of HBV infection. Moreover, efficient DHBV cccDNA formation in human hepatoma cells should greatly facilitate experimental identification, and possibly inhibition, of the human cell factors involved in the process.

  2. Are RGS2 Gene Polymorphisms Associated With High Blood Pressure in an Ethnicity- and Gender-Specific Manner?

    NARCIS (Netherlands)

    Hahntow, Ines N.; Mairuhu, Gideon; van Valkengoed, Irene G. M.; Baas, Frank; Alewijnse, Astrid E.; Koopmans, Richard P.; Michel, Martin C.

    2009-01-01

    BackgroundPolymorphisms in the Regulator of G-protein Signaling 2 (RGS2) gene have been reported to be associated with hypertension (HT) in Japanese women and black Americans of either gender but not in white Americans or Japanese men. We have tested whether these proposed ethnicity- and

  3. Orexin/hypocretin neuron activation is correlated with alcohol seeking and preference in a topographically specific manner.

    Science.gov (United States)

    Moorman, David E; James, Morgan H; Kilroy, Elisabeth A; Aston-Jones, Gary

    2016-03-01

    Orexin (ORX) (also known as hypocretin) neurons are located exclusively in the posterior hypothalamus, and are involved in a wide range of behaviours, including motivation for drugs of abuse such as alcohol. Hypothalamic subregions contain functionally distinct populations of ORX neurons that may play different roles in regulating drug-motivated and alcohol-motivated behaviours. To investigate the role of ORX neurons in ethanol (EtOH) seeking, we measured Fos activation of ORX neurons in rats following three different measures of EtOH seeking and preference: (i) context-induced reinstatement, or ABA renewal; (ii) cue-induced reinstatement of extinguished responding for EtOH; and (iii) a home cage task in which preference for EtOH (vs. water) was measured in the absence of either reinforcer. We found significant activation of ORX neurons in multiple subregions across all three behavioural tests. Notably, ORX neuron activation in the lateral hypothalamus correlated with the degree of seeking in context reinstatement and the degree of preference in home cage preference testing. In addition, Fos activation in ORX neurons in the dorsomedial hypothalamic and perifornical areas was correlated with context and home cage seeking/preference, respectively. Surprisingly, we found no relationship between the degree of cue-induced reinstatement and ORX neuron activation in any region, despite robust activation overall during reinstatement. These results demonstrate a strong relationship between ORX neuron activation and EtOH seeking/preference, but one that is differentially expressed across ORX field subregions, depending on reinstatement modality. © 2016 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  4. Genetic Variant in Flavin-Containing Monooxygenase 3 Alters Lipid Metabolism in Laying Hens in a Diet-Specific Manner

    OpenAIRE

    Wang, Jing; Long, Cheng; Zhang, Haijun; Zhang, Yanan; Wang, Hao; Yue, Hongyuan; Wang, Xiaocui; Wu, Shugeng; Qi, Guanghai

    2016-01-01

    Genetic variant T329S in flavin-containing monooxygenase 3 (FMO3) impairs trimethylamine (TMA) metabolism in birds. The TMA metabolism that under complex genetic and dietary regulation, closely linked to cardiovascular disease risk. We determined whether the genetic defects in TMA metabolism may change other metabolic traits in birds, determined whether the genetic effects depend on diets, and to identify genes or gene pathways that underlie the metabolic alteration induced by genetic and die...

  5. Dietary fat and fiber interactively modulate apoptosis and mitochondrial bioenergetic profiles in mouse colon in a site-specific manner

    NARCIS (Netherlands)

    Fan, Yang-Yi; Vaz, Frederic M.; Chapkin, Robert S.

    2017-01-01

    We have demonstrated that the combination of bioactive components generated by fish oil (containing n-3 polyunsaturated fatty acids) and fermentable fiber (leading to butyrate production) act coordinately to protect against colon cancer. This is, in part, the result of an enhancement of apoptosis at

  6. Maternal air pollution exposure induces fetal neuroinflammation and predisposes offspring to obesity in aduthood in a sex-specific manner

    Science.gov (United States)

    Emerging evidence suggests environmental chemical exposures during critical windows of development may contribute to the escalating prevalence of obesity. We tested the hypothesis that prenatal air pollution exposure would predispose the offspring to weight gain in adulthood. Pre...

  7. Prenatal stress induces depressive-like behavior in a sex-specific manner; impact of familiar versus novel environments

    DEFF Research Database (Denmark)

    Sickmann, Helle Mark; Arentzen, Tine S; Kristensen, Morten Pilgaard

    in dams exposed to PS. Locomotor activity in a familiar environment (housing cage) during the rodent inactive phase was significantly enhanced in PS females compared to controls (Δ= 49 %, n = 15-37; p ...-15; p familiar environment whereas male offspring seems vulnerable in a novel environment. The central...

  8. Specific nuclear localizing sequence directs two myosin isoforms to the cell nucleus in calmodulin-sensitive manner

    Czech Academy of Sciences Publication Activity Database

    Dzijak, Rastislav; Yildirim, Sukriye; Kahle, Michal; Novák, Petr; Hnilicová, Jarmila; Venit, Tomáš; Hozák, Pavel

    2012-01-01

    Roč. 7, č. 1 (2012), e30529 E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA204/07/1592; GA ČR(CZ) GD204/09/H084; GA ČR GAP305/11/2232; GA MŠk LC545; GA MŠk(CZ) LC06063 Institutional research plan: CEZ:AV0Z50520514 Institutional support: RVO:68378050 ; RVO:61388971 Keywords : NM1 * nuclear import * NLS * calmodulin Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.730, year: 2012

  9. BMP Signaling Regulates the Fate of Chondro-osteoprogenitor Cells in Facial Mesenchyme in a Stage-Specific Manner

    Czech Academy of Sciences Publication Activity Database

    Celá, Petra; Buchtová, Marcela; Veselá, Iva; Fu, K.; Bogardi, J. P.; Song, Y.; Barlow, A.; Buxton, P.; Medalová, J.; Francis-West, P.; Richman, J. M.

    2016-01-01

    Roč. 245, č. 9 (2016), s. 947-962 ISSN 1058-8388 R&D Projects: GA ČR GA304/09/0725; GA ČR GB14-37368G Institutional support: RVO:67985904 Keywords : noggin * chicken embryo * cartilage Subject RIV: EA - Cell Biology Impact factor: 2.004, year: 2016

  10. Framing alters risk-taking behavior on a modified Balloon Analogue Risk Task (BART) in a sex-specific manner.

    Science.gov (United States)

    Gabriel, Kara I; Williamson, Ashley

    2010-12-01

    Framing uncertain scenarios to emphasize potential positive or negative elements influences decision making and behavior. The current experiment investigated sex differences in framing effects on risk-taking propensity in a modified version of the Balloon Analogue Risk Task (BART). Male and female undergraduates completed questionnaires on sensation seeking, impulsiveness, and risk and benefit perception prior to viewing one of three framing conditions for the BART: (1) positively-framed instructions emphasizing the ability to earn money if balloons were inflated to large size; (2) negatively framed instructions emphasizing the possibility that money could be lost if balloons were inflated to bursting; and (3) completely framed instructions noting both possible outcomes. Results revealed correlations between BART performance and impulsiveness for both sexes. Compared to positive and complete framing, negatively framed instructions decreased balloon inflation time in women but not men, indicating sex differences in response to treatments designed to alter risk-taking behavior.

  11. Chronic stress alters concentrations of corticosterone receptors in a tissue-specific manner in wild house sparrows (Passer domesticus).

    Science.gov (United States)

    Lattin, Christine R; Romero, L Michael

    2014-07-15

    The physiological stress response results in release of glucocorticoid hormones such as corticosterone (CORT). Whereas short-term activation of this response helps animals cope with environmental stressors, chronic activation can result in negative effects including metabolic dysregulation and reproductive failure. However, there is no consensus hormonal profile of a chronically stressed animal, suggesting that researchers may need to look beyond hormone titers to interpret the impacts of chronic stress. In this study, we brought wild house sparrows (Passer domesticus) into captivity. We then compared glucocorticoid and mineralocorticoid receptor concentrations in sparrows exposed either to a standardized chronic stress protocol (n=26) or to standard husbandry conditions (controls; n=20). We used radioligand binding assays to quantify receptors in whole brain, liver, kidneys, spleen, gonads, gastrocnemius and pectoralis muscle, omental and subcutaneous fat, and bib and back skin. In most tissues, CORT receptors did not differ between controls and stressed animals, although we found marginal increases in receptor density in kidney and testes in stressed birds at some time points. Only in pectoralis muscle was there a robust effect of chronic stress, with both receptor types higher in stressed animals. Increased pectoralis sensitivity to CORT with chronic stress may be part of the underlying mechanism for muscle wasting in animals administered exogenous CORT. Furthermore, the change in pectoralis was not paralleled by gastrocnemius receptors. This difference may help explain previous reports of a greater effect of CORT on pectoralis than on other muscle types, and indicate that birds use this muscle as a protein reserve. © 2014. Published by The Company of Biologists Ltd.

  12. Voluntary Wheel Running Reduces the Acute Inflammatory Response to Liver Carcinogen in a Sex-specific Manner

    DEFF Research Database (Denmark)

    Bay, M L; Gehl, Julie; Pedersen, Bente Klarlund

    2017-01-01

    demonstrated to inhibit tumor growth, including diethylnitrosamine-(DEN)-induced hepatocarcinoma. Having observed a sex-dependent development of DEN-induced hepatocarcinoma, we aimed to evaluate the effect of exercise and sex on the acute inflammatory response to DEN. Thus, we randomized male and female mice...

  13. The H3K27 demethylase, Utx, regulates adipogenesis in a differentiation stage-dependent manner.

    Directory of Open Access Journals (Sweden)

    Kazushige Ota

    Full Text Available Understanding the molecular mechanisms that drive adipogenesis is important in developing new treatments for obesity and diabetes. Epigenetic regulations determine the capacity of adipogenesis. In this study, we examined the role of a histone H3 lysine 27 demethylase, the ubiquitously transcribed tetratricopeptide repeat protein on the X chromosome (Utx, in the differentiation of mouse embryonic stem cells (mESCs to adipocytes. Using gene trapping, we examined Utx-deficient male mESCs to determine whether loss of Utx would enhance or inhibit the differentiation of mESCs to adipocytes. Utx-deficient mESCs showed diminished potential to differentiate to adipocytes compared to that of controls. In contrast, Utx-deficient preadipocytes showed enhanced differentiation to adipocytes. Microarray analyses indicated that the β-catenin/c-Myc signaling pathway was differentially regulated in Utx-deficient cells during adipocyte differentiation. Therefore, our data suggest that Utx governs adipogenesis by regulating c-Myc in a differentiation stage-specific manner and that targeting the Utx signaling pathway could be beneficial for the treatment of obesity, diabetes, and congenital utx-deficiency disorders.

  14. TGF-β's delay skeletal muscle progenitor cell differentiation in an isoform-independent manner

    International Nuclear Information System (INIS)

    Schabort, Elske J.; Merwe, Mathilde van der; Loos, Benjamin; Moore, Frances P.; Niesler, Carola U.

    2009-01-01

    Satellite cells are a quiescent heterogenous population of mononuclear stem and progenitor cells which, once activated, differentiate into myotubes and facilitate skeletal muscle repair or growth. The Transforming Growth Factor-β (TGF-β) superfamily members are elevated post-injury and their importance in the regulation of myogenesis and wound healing has been demonstrated both in vitro and in vivo. Most studies suggest a negative role for TGF-β on satellite cell differentiation. However, none have compared the effect of these three isoforms on myogenesis in vitro. This is despite known isoform-specific effects of TGF-β1, -β2 and -β3 on wound repair in other tissues. In the current study we compared the effect of TGF-β1, -β2 and -β3 on proliferation and differentiation of the C2C12 myoblast cell-line. We found that, irrespective of the isoform, TGF-β increased proliferation of C2C12 cells by changing the cellular localisation of PCNA to promote cell division and prevent cell cycle exit. Concomitantly, TGF-β1, -β2 and -β3 delayed myogenic commitment by increasing MyoD degradation and decreasing myogenin expression. Terminal differentiation, as measured by a decrease in myosin heavy chain (MHC) expression, was also delayed. These results demonstrate that TGF-β promotes proliferation and delays differentiation of C2C12 myoblasts in an isoform-independent manner

  15. Integral equations

    CERN Document Server

    Moiseiwitsch, B L

    2005-01-01

    Two distinct but related approaches hold the solutions to many mathematical problems--the forms of expression known as differential and integral equations. The method employed by the integral equation approach specifically includes the boundary conditions, which confers a valuable advantage. In addition, the integral equation approach leads naturally to the solution of the problem--under suitable conditions--in the form of an infinite series.Geared toward upper-level undergraduate students, this text focuses chiefly upon linear integral equations. It begins with a straightforward account, acco

  16. Wnt ligands signal in a cooperative manner to promote foregut organogenesis

    OpenAIRE

    Miller, Mayumi F.; Cohen, Ethan David; Baggs, Julie E.; Lu, Min Min; Hogenesch, John B.; Morrisey, Edward E.

    2012-01-01

    Endoderm-mesenchyme cross-talk is a central process in the development of foregut-derived organs. How signaling pathways integrate the activity of multiple ligands to guide organ development is poorly understood. We show that two Wnt ligands, Wnt2 and Wnt7b, cooperatively induce Wnt signaling without affecting the stabilization of the Wnt canonical effector β-catenin despite it being necessary for Wnt2–Wnt7b cooperativity. Wnt2–Wnt7b cooperation is specific for mesenchymal cell lineages and t...

  17. Culture-specific communication management for virtual agents

    DEFF Research Database (Denmark)

    Endrass, Birgit; Rehm, Matthias; André, Elisabeth

    2009-01-01

    Human interaction depends on several individual factors such as personality, social relations, age or gender. But also the society we live in influences our behaviour. Thus culture affects the way communication is led. As virtual agents interact in a more and more human-like manner, culture......, the use of pauses in speech as well as the occurrence of overlapping speech was analyzed and integrated into a demonstrator using virtual agents. In a preliminary study, we investigated whether subjects perceive a difference between agent dialogs that are in line with culture-specific findings and agent...

  18. Concept-guided development of classroom use of ICT : Concept-specific types of ICT use and their integration into teachers’ practices

    NARCIS (Netherlands)

    de Koster, S.

    2017-01-01

    Does a concept-guided approach in schools with either a ‘traditional’ or an ‘innovative’ educational concept contribute to the development of ICT use that becomes integrated in the teachers’ classroom practices? In order to answer this question we performed four, mainly qualitative, studies in five

  19. ONC201 kills solid tumor cells by triggering an integrated stress response dependent on ATF4 activation by specific eIF2α kinases

    OpenAIRE

    Kline, C. Leah B.; Van den Heuvel, A. Pieter J.; Allen, Joshua E.; Prabhu, Varun V.; Dicker, David T.; El-Deiry, Wafik S.

    2016-01-01

    ONC201 (also called TIC10) is a small molecule that inactivates the cell proliferation- and cell survival-promoting kinases AKT and ERK and induces cell death through the pro-apoptotic protein TRAIL. ONC201 is currently in early phase clinical testing for various malignancies. Here, we found through gene expression and protein analyses that ONC201 triggered an increase in TRAIL abundance and cell death through an integrated stress response (ISR) involving the transcription factor ATF4, the tr...

  20. Assessment of Ethical Ideals and Ethical Manners in Care of Older People

    OpenAIRE

    Frilund, Marianne; Fagerström, Lisbeth; Eriksson, Katie; Eklund, Patrik

    2013-01-01

    The aim of this study is to establish structured clusters and well-defined ontological entities (nodes) describing ethical values as both ideal and opportunity for ethical manner as perceived by the caregiver. In this study, we use Bayesian Belief Networks (BBNs) to analyse ethical values (ethos) and ethical manners in daily work with older people. Material is based on questionnaire data collected by the instrument for the self-assessment of individual ethos in the care of older people (ISAEC...

  1. Human, recombinant interleukin-2 induces in vitro histamine release in a dose-dependent manner

    DEFF Research Database (Denmark)

    Nielsen, Hans Jørgen; Petersen, L J; Skov, P S

    1995-01-01

    significantly in the supernatant from cells stimulated by rIL-2 in a dose-dependent manner both in patients and volunteers. Total cell-bound histamine was 49.3 +/- 4.1 ng/ml in patients compared to 78.5 +/- 7.7 ng/ml in volunteers (p ... was significantly enhanced in cancer patients compared to volunteers (*p manner in both cancer patients and volunteers. This may in part explain the severe toxicity observed during high...

  2. Pragmatic awareness of Suggestions: From (Im)Polite Mannerism to Attitudinal Appropriateness

    OpenAIRE

    Hamid Allami; Nasim Boustani

    2017-01-01

    The present research seeks to determine: (a) Iranian EFL learners’ application of suggestion semantic formulae ;(b) their attitude of appropriateness in terms of confidence in the employment of appropriate supportive moves; (c), their (im)polite mannerism with respect to the selected strategies; and (d) the relationship between attitude of appropriateness and mannerism of (im)politeness. An Oxford Quick placement Test (OQPT) was administered among 60 Iranian EFL learners to check their langua...

  3. Globalized conflicts, globalized responses. Changing manners of contestation among indigenous communities

    DEFF Research Database (Denmark)

    Benyei, Petra; Turreira Garcia, Nerea; Orta-Martínez, Martí

    2017-01-01

    In a globalized world, environmental conflicts affecting indigenous communities (including hunter-gatherer groups) have intensified and grown in their transnational character. These changes have affected the choice of manners of contestation of these groups, favouring in some cases the emergence...... activities and confront conflicts through a truly bottom-up approach. The chapter ends discussing how, despite the potential of such new manners of contestation, the power imbalances that currently underpin many indigenous conflicts are first to be addressed....

  4. A Mission to Reform Manners: Religion, Secularization, and Empire in Early Modern England

    OpenAIRE

    Taback, Naomi Johanna

    2013-01-01

    This dissertation looks at three voluntary societies formed in London shortly after the revolution of 1688. These societies, with overlapping membership, shared a broad vision for the improvement of manners and morals throughout the burgeoning British Empire. The Society for Reformation of Manners, founded in 1691, called for the enforcement of the civil laws against prostitution, swearing, drunkenness, gambling, and other moral crimes. The Society for Promoting Christian Knowledge, founde...

  5. An Integrated Platform for Dynamic Software Updating and its Application in Self-* systems

    DEFF Research Database (Denmark)

    Gregersen, Allan Raundahl; Jørgensen, Bo Nørregaard; Hadaytullah

    2012-01-01

    Practical dynamic updating of modern Java applications requires tool support to become an integral part of the software development and maintenance lifecycle. In this paper we present Javeleon, an easy-to-use tool for dynamic updates of Java applications. To support integration with specific...... frameworks, component systems and application servers, Javeleon currently provides tight integration with the NetBeans Platform, facilitating dynamic updating for applications built on top of the NetBeans Platform in an unconstrained manner. Javeleon supports state-preserving unanticipated runtime evolution...

  6. Basurto-IGPP. A manual-directed approach of integrative group psychotherapy in psychosis.

    Science.gov (United States)

    Ruiz-Parra, Eduardo; González-Torres, M A; Eguiluz, I; de la Sierra, E; Trojaola, B; Catalán, A

    2010-01-01

    A manual on Integrative Group Psychotherapy for outpatients with schizophrenia and other psychoses (Basurto-PGIP) is presented. The model takes into account group specific therapeutic factors. It integrates influences from other integrative psychotherapeutic models, interpersonal group therapy, group analysis and recent developments in cognitive behavioural therapy for psychotic symptoms. The manual is structured in levels of different complexity that can be applied in a progressive manner. The intervention tries to adapt to patients features, therapists ability and training, and centres resources. It can be applied in two possible settings: a short term closed group and a long term open group. Advantages and disadvantages of the model are described.

  7. Apolipoprotein A-IV constrains HPA and behavioral stress responsivity in a strain-dependent manner.

    Science.gov (United States)

    Packard, Amy E B; Zhang, Jintao; Myers, Brent; Ko, Chih-Wei; Wang, Fei; Tso, Patrick; Ulrich-Lai, Yvonne M

    2017-12-01

    There is a critical gap in our knowledge of the mechanisms that govern interactions between daily life experiences (e.g., stress) and metabolic diseases, despite evidence that stress can have profound effects on cardiometabolic health. Apolipoprotein A-IV (apoA-IV) is a protein found in chylomicrons (lipoprotein particles that transport lipids throughout the body) where it participates in lipid handling and the regulation of peripheral metabolism. Moreover, apoA-IV is expressed in brain regions that regulate energy balance including the arcuate nucleus. Given that both peripheral and central metabolic processes are important modulators of hypothalamic-pituitary-adrenocortical (HPA) axis activity, the present work tests the hypothesis that apoA-IV activity affects stress responses. As emerging data suggests that apoA-IV actions can vary with background strain, we also explore the strain-dependence of apoA-IV stress regulation. These studies assess HPA axis, metabolic (hyperglycemia), and anxiety-related behavioral responses to psychogenic stress in control (wildtype) and apoA-IV-deficient (KO) mice on either the C57Bl/6J (C57) or 129×1/SvJ (129) background strain. The results indicate that apoA-IV KO increases post-stress corticosterone and anxiety-related behavior specifically in the 129 strain, and increases stress-induced hyperglycemia exclusively in the C57 strain. These data support the hypothesis that apoA-IV is a novel factor that limits stress reactivity in a manner that depends on genetic background. An improved understanding of the complex relationship among lipid homeostasis, stress sensitivity, and genetics is needed to optimize the development of personalized treatments for stress- and metabolism-related diseases. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Dopamine D3 receptor knockout mice exhibit abnormal nociception in a sex-different manner.

    Science.gov (United States)

    Liu, Peng; Xing, Bo; Chu, Zheng; Liu, Fei; Lei, Gang; Zhu, Li; Gao, Ya; Chen, Teng; Dang, Yong-Hui

    2017-07-01

    Pain is a complex and subjective experience. Previous studies have shown that mice lacking the dopamine D3 receptor (D3RKO) exhibit hypoalgesia, indicating a role of the D3 receptor in modulation of nociception. Given that there are sex differences in pain perception, there may be differences in responses to nociceptive stimuli between male and female D3RKO mice. In the current study, we examined the role of the D3 receptor in modulating nociception in male and female D3RKO mice. Acute thermal pain was modeled by hot-plate test. This test was performed at different temperatures including 52°C, 55°C, and 58°C. The von Frey hair test was applied to evaluate mechanical pain. And persistent pain produced by peripheral tissue injury and inflammation was modeled by formalin test. In the hot-plate test, compared with wild-type (WT) mice, D3RKO mice generally exhibited longer latencies at each of the three temperatures. Specially, male D3RKO mice showed hypoalgesia compared with male WT mice when the temperature was 55°C, while for the female mice, there was a statistical difference between genotypes when the test condition was 52°C. In the von Frey hair test, both male and female D3RKO mice exhibited hypoalgesia. In the formalin test, the male D3RKO mice displayed a similar nociceptive behavior as their sex-matched WT littermates, whereas significantly depressed late-phase formalin-induced nociceptive behaviors were observed in the female mutants. These findings indicated that the D3 receptor affects nociceptive behaviors in a sex-specific manner and that its absence induces more analgesic behavior in the female knockout mice. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  9. Maternal prenatal cortisol predicts infant negative emotionality in a sex-dependent manner.

    Science.gov (United States)

    Braithwaite, Elizabeth C; Pickles, Andrew; Sharp, Helen; Glover, Vivette; O'Donnell, Kieran J; Tibu, Florin; Hill, Jonathan

    2017-06-01

    Prenatal stress influences fetal developmental trajectories, which may implicate glucocorticoid mechanisms. There is also emerging evidence that effects of prenatal stress on offspring development are sex-dependent. However, little is known about the prospective relationship between maternal prenatal cortisol levels and infant behaviour, and whether it may be different in male and female infants. We sought to address this question using data from a prospective longitudinal cohort, stratified by risk. The Wirral Child Health and Development Study (WCHADS) cohort (n=1233) included a stratified random sub-sample (n=216) who provided maternal saliva samples, assayed for cortisol, at home over two days at 32weeks of pregnancy (on waking, 30-min post-waking and during the evening) and a measure of infant negative emotionality from the Neonatal Behavioural Assessment Scale (NBAS) at five weeks-of-age. General population estimates of associations among measures were obtained using inverse probability weights. Maternal prenatal cortisol sampled on waking predicted infant negative emotionality in a sex-dependent manner (interaction term, p=0.005); female infants exposed to high levels of prenatal cortisol were more negative (Beta=0.440, p=0.042), whereas male infants were less negative (Beta=-0.407, p=0.045). There was no effect of the 30-min post-waking measure or evening cortisol. Our findings add to an emerging body of work that has highlighted sex differences in fetal programming, whereby females become more reactive following prenatal stress, and males less reactive. A more complete understanding of sex-specific developmental trajectories in the context of prenatal stress is essential for the development of targeted prevention strategies. Copyright © 2017. Published by Elsevier Inc.

  10. CRISPR-spacer integration reporter plasmids reveal distinct genuine acquisition specificities among CRISPR-Cas I-E variants of Escherichia coli.

    Science.gov (United States)

    Díez-Villaseñor, César; Guzmán, Noemí M; Almendros, Cristóbal; García-Martínez, Jesús; Mojica, Francisco J M

    2013-05-01

    Prokaryotes immunize themselves against transmissible genetic elements by the integration (acquisition) in clustered regularly interspaced short palindromic repeats (CRISPR) loci of spacers homologous to invader nucleic acids, defined as protospacers. Following acquisition, mono-spacer CRISPR RNAs (termed crRNAs) guide CRISPR-associated (Cas) proteins to degrade (interference) protospacers flanked by an adjacent motif in extrachomosomal DNA. During acquisition, selection of spacer-precursors adjoining the protospacer motif and proper orientation of the integrated fragment with respect to the leader (sequence leading transcription of the flanking CRISPR array) grant efficient interference by at least some CRISPR-Cas systems. This adaptive stage of the CRISPR action is poorly characterized, mainly due to the lack of appropriate genetic strategies to address its study and, at least in Escherichia coli, the need of Cas overproduction for insertion detection. In this work, we describe the development and application in Escherichia coli strains of an interference-independent assay based on engineered selectable CRISPR-spacer integration reporter plasmids. By using this tool without the constraint of interference or cas overexpression, we confirmed fundamental aspects of this process such as the critical requirement of Cas1 and Cas2 and the identity of the CTT protospacer motif for the E. coli K12 system. In addition, we defined the CWT motif for a non-K12 CRISPR-Cas variant, and obtained data supporting the implication of the leader in spacer orientation, the preferred acquisition from plasmids harboring cas genes and the occurrence of a sequential cleavage at the insertion site by a ruler mechanism.

  11. CRISPR-spacer integration reporter plasmids reveal distinct genuine acquisition specificities among CRISPR-Cas I-E variants of Escherichia coli

    Science.gov (United States)

    Díez-Villaseñor, César; Guzmán, Noemí M.; Almendros, Cristóbal; García-Martínez, Jesús; Mojica, Francisco J.M.

    2013-01-01

    Prokaryotes immunize themselves against transmissible genetic elements by the integration (acquisition) in clustered regularly interspaced short palindromic repeats (CRISPR) loci of spacers homologous to invader nucleic acids, defined as protospacers. Following acquisition, mono-spacer CRISPR RNAs (termed crRNAs) guide CRISPR-associated (Cas) proteins to degrade (interference) protospacers flanked by an adjacent motif in extrachomosomal DNA. During acquisition, selection of spacer-precursors adjoining the protospacer motif and proper orientation of the integrated fragment with respect to the leader (sequence leading transcription of the flanking CRISPR array) grant efficient interference by at least some CRISPR-Cas systems. This adaptive stage of the CRISPR action is poorly characterized, mainly due to the lack of appropriate genetic strategies to address its study and, at least in Escherichia coli, the need of Cas overproduction for insertion detection. In this work, we describe the development and application in Escherichia coli strains of an interference-independent assay based on engineered selectable CRISPR-spacer integration reporter plasmids. By using this tool without the constraint of interference or cas overexpression, we confirmed fundamental aspects of this process such as the critical requirement of Cas1 and Cas2 and the identity of the CTT protospacer motif for the E. coli K12 system. In addition, we defined the CWT motif for a non-K12 CRISPR-Cas variant, and obtained data supporting the implication of the leader in spacer orientation, the preferred acquisition from plasmids harboring cas genes and the occurrence of a sequential cleavage at the insertion site by a ruler mechanism. PMID:23445770

  12. CROSS-COMPLIANCE Facilitating the CAP reform: Compliance and competitiveness of European agriculture : Specific Targeted Research or Innovation Project (STREP) Integrating and Strengthening the European Research Area

    NARCIS (Netherlands)

    Jongeneel, R.A.; Bezlepkina, I.; Winsten, J.; Fox, G.

    2008-01-01

    The prime aim or the project was on assessing the impacts of compliance with standards, more specifically those part of cross-compliance, on EU’s external competitiveness. This is why in several deliverables and also in the main text of this Deliverable 13 a lot of attention is given to the EU and

  13. Life sciences payload definition and integration study. Volume 3: Preliminary equipment item specification catalog for the carry-on laboratories. [for Spacelab

    Science.gov (United States)

    1974-01-01

    All general purpose equipment items contained in the final carry-on laboratory (COL) design concepts are described in terms of specific requirements identified for COL use, hardware status, and technical parameters such as weight, volume, power, range, and precision. Estimated costs for each item are given, along with projected development times.

  14. TWRSview system requirements specification

    International Nuclear Information System (INIS)

    Caldwell, J.A.; Lee, A.K.

    1995-12-01

    This document provides the system requirements specification for the TWRSview software system. The TWRSview software system is being developed to integrate electronic data supporting the development of the TWRS technical baseline

  15. Site-Specific Growth and in Situ Integration of Different Nanowire Material Networks on a Single Chip: Toward a Nanowire-Based Electronic Nose for Gas Detection.

    Science.gov (United States)

    Hrachowina, Lukas; Domènech-Gil, Guillem; Pardo, Antonio; Seifner, Michael S; Gràcia, Isabel; Cané, Carles; Romano-Rodríguez, Albert; Barth, Sven

    2018-03-23

    A new method for the site-selective synthesis of nanowires has been developed to enable material growth with defined morphology and, at the same time, different composition on the same chip surface. The chemical vapor deposition approach for the growth of these nanowire-based resistive devices using micromembranes can be easily modified and represents a simple, adjustable fabrication process for the direct integration of nanowire meshes in multifunctional devices. This proof-of-concept study includes the deposition of SnO 2 , WO 3 , and Ge nanowires on the same chip. The individual resistors exhibit adequate gas sensing responses toward changing gas concentrations of CO, NO 2 , and humidity diluted in synthetic air. The data have been processed by principal component analysis with cluster responses that can be easily separated, and thus, the devices described herein are in principle suitable for environmental monitoring.

  16. The Role of Theory-Specific Techniques and Therapeutic Alliance in Promoting Positive Outcomes: Integrative Psychotherapy for World Trade Center Responders.

    Science.gov (United States)

    Haugen, Peter Tejas; Werth, Aditi Sinha; Foster, Alyce Lauren; Owen, Jesse

    2016-12-01

    World Trade Center responders demonstrate high symptom burden, underscoring the importance of refining treatment approaches for this cohort. One method is examining the impact of therapy techniques on outcomes, and the interactions between technique and alliance on outcomes. This study a) examined the interaction of early treatment techniques on integrative psychotherapy outcomes and b) explored whether associations differed at varying levels of alliance. Twenty-nine adult responders diagnosed with partial or full posttraumatic stress disorder received outpatient psychotherapy and completed weekly measures of alliance, technique, and symptom distress. Analyses indicated significant interactions between 1) alliance and psychodynamic interventions on outcomes and 2) alliance and cognitive behavioral (CB) interventions on outcomes. Clients with high alliance had better outcomes when their therapist used fewer CB techniques. No meaningful differences were found between technique and outcomes for clients with lower alliance. These findings reiterate the critical roles technique and responsiveness to the alliance play in engendering successful outcomes.

  17. Pragmatic awareness of Suggestions: From (ImPolite Mannerism to Attitudinal Appropriateness

    Directory of Open Access Journals (Sweden)

    Hamid Allami

    2017-09-01

    Full Text Available The present research seeks to determine: (a Iranian EFL learners’ application of suggestion semantic formulae ;(b their attitude of appropriateness in terms of confidence in the employment of appropriate supportive moves; (c, their (impolite mannerism with respect to the selected strategies; and (d the relationship between attitude of appropriateness and mannerism of (impoliteness. An Oxford Quick placement Test (OQPT was administered among 60 Iranian EFL learners to check their language proficiency level and to satisfy the assumption of homogeneity among the learners. These participants along with 10 American native speakers then underwent a suggestion DCT. The questionnaire included questions addressing interlocutors’ with higher, lower or equal power status and intimate or strange social distance. The DCT also involved attitudinal appropriateness scale and (impoliteness mannerism likert scale to examine the learners’ degree of confidence and mannerism. Besides similarities and differences in the application of suggestion semantic formulae between the Iranian learners and American speakers, the results revealed variations in the two groups’ performances for appropriateness and (impoliteness. The results also indicated a positive relationship between the attitude and mannerism scales.

  18. The Reflection of Javanese Life Manner on the Dongkrek Art and Ritual Performance in Madiun Society

    Directory of Open Access Journals (Sweden)

    Sharfina Nur Amalina

    2018-05-01

    Full Text Available This article focuses in the analysis of Javanese life manner within Dongkrek art and ritual performance in Mejayan, Madiun, Indonesia. The purpose of research is to reflect a life manner of Javanese society within a Dongkrek show. The qualitative-descriptive was used as research approach. Data were collected by interview, literature review, and other relevant resources. The results of research show a five points of Javanese manner of life in Dongkrek, represent in the phrase Ambrasta Dur Hangkara, Memayu Hayuning Bawana, Sura Dira Jayaning Lebur Dening Pangastuti, Sadulur Papat Kalima Pancer, and Manunggaling Kawula Gusti. Those phrases contain many moral values that generally can be accepted by society. The phrase represents a human relationship, the manner of life, ways of life, world-view, willingness, and the transcendental relationship between humans and God. It means the purpose of the Javanese manner of life is to reach the perfection of life. The perfection of life is resting on the faith towards to the God through the maturity of spirituality.

  19. The Synthetic Amphipathic Peptidomimetic LTX109 Is a Potent Fungicide That Disturbs Plasma Membrane Integrity in a Sphingolipid Dependent Manner

    DEFF Research Database (Denmark)

    Bojsen, Rasmus; Torbensen, Rasmus; Larsen, Camilla Eggert

    2013-01-01

    The peptidomimetic LTX109 (arginine-tertbutyl tryptophan-arginine-phenylethan) was previously shown to have antibacterial properties. Here, we investigated the activity of this novel antimicrobial peptidomimetic on the yeast Saccharomyces cerevisiae. We found that LTX109 was an efficient fungicid...

  20. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  1. ONC201 kills solid tumor cells by triggering an integrated stress response dependent on ATF4 activation by specific eIF2α kinases.

    Science.gov (United States)

    Kline, C Leah B; Van den Heuvel, A Pieter J; Allen, Joshua E; Prabhu, Varun V; Dicker, David T; El-Deiry, Wafik S

    2016-02-16

    ONC201 (also called TIC10) is a small molecule that inactivates the cell proliferation- and cell survival-promoting kinases Akt and ERK and induces cell death through the proapoptotic protein TRAIL. ONC201 is currently in early-phase clinical testing for various malignancies. We found through gene expression and protein analyses that ONC201 triggered an increase in TRAIL abundance and cell death through an integrated stress response (ISR) involving the transcription factor ATF4, the transactivator CHOP, and the TRAIL receptor DR5. ATF4 was not activated in ONC201-resistant cancer cells, and in ONC201-sensitive cells, knockdown of ATF4 or CHOP partially abrogated ONC201-induced cytotoxicity and diminished the ONC201-stimulated increase in DR5 abundance. The activation of ATF4 in response to ONC201 required the kinases HRI and PKR, which phosphorylate and activate the translation initiation factor eIF2α. ONC201 rapidly triggered cell cycle arrest, which was associated with decreased abundance of cyclin D1, decreased activity of the kinase complex mTORC1, and dephosphorylation of the retinoblastoma (Rb) protein. The abundance of X-linked inhibitor of apoptosis protein (XIAP) negatively correlated with the extent of apoptosis in response to ONC201. These effects of ONC201 were independent of whether cancer cells had normal or mutant p53. Thus, ONC201 induces cell death through the coordinated induction of TRAIL by an ISR pathway. Copyright © 2016, American Association for the Advancement of Science.

  2. Transformation of chlorpyrifos in integrated recirculating constructed wetlands (IRCWs) as revealed by compound-specific stable isotope (CSIA) and microbial community structure analysis.

    Science.gov (United States)

    Tang, Xiaoyan; Yang, Yang; Huang, Wenda; McBride, Murray B; Guo, Jingjing; Tao, Ran; Dai, Yunv

    2017-06-01

    Carbon isotope analysis and 454 pyrosequencing methods were used to investigate in situ biodegradation of chlorpyrifos during its transport through three model integrated recirculating constructed wetlands (IRCWs). Results show that plant and Fe-impregnated biochar promoted degradation of chlorpyrifos and its metabolite 3,5,6-trichloro-2-pyridinol (TCP). Carbon isotope ratios in the IRCWs shifted to -31.24±0.58‰ (IRCW1, plant free), -26.82±0.60‰ (IRCW2, with plant) and -24.76±0.94‰ (IRCW3, with plant and Fe-biochar). The enrichment factors (Ɛ bulk,c ) were determined as -0.69±0.06‰ (IRCW1), -0.91±0.07‰ (IRCW2) and -1.03±0.09‰ (IRCW3). Microbial community analysis showed that IRCW3 was dominated by members of Bacillus, which can utilize and degrade chlorpyrifos. These results reveal that plant and Fe-biochar can induce carbon isotope fractionation and have a positive impact on the chlorpyrifos degradation efficiency by influencing the development of beneficial microbial communities. Copyright © 2017. Published by Elsevier Ltd.

  3. An Integrated “Multi-Omics” Comparison of Embryo and Endosperm Tissue-Specific Features and Their Impact on Rice Seed Quality

    Directory of Open Access Journals (Sweden)

    Marc Galland

    2017-11-01

    Full Text Available Although rice is a key crop species, few studies have addressed both rice seed physiological and nutritional quality, especially at the tissue level. In this study, an exhaustive “multi-omics” dataset on the mature rice seed was obtained by combining transcriptomics, label-free shotgun proteomics and metabolomics from embryo and endosperm, independently. These high-throughput analyses provide a new insight on the tissue-specificity related to rice seed quality. Foremost, we pinpointed that extensive post-transcriptional regulations occur at the end of rice seed development such that the embryo proteome becomes much more diversified than the endosperm proteome. Secondly, we observed that survival in the dry state in each seed compartment depends on contrasted metabolic and enzymatic apparatus in the embryo and the endosperm, respectively. Thirdly, it was remarkable to identify two different sets of starch biosynthesis enzymes as well as seed storage proteins (glutelins in both embryo and endosperm consistently with the supernumerary embryo hypothesis origin of the endosperm. The presence of a putative new glutelin with a possible embryonic favored abundance is described here for the first time. Finally, we quantified the rate of mRNA translation into proteins. Consistently, the embryonic panel of protein translation initiation factors is much more diverse than that of the endosperm. This work emphasizes the value of tissue-specificity-centered “multi-omics” study in the seed to highlight new features even from well-characterized pathways. It paves the way for future studies of critical genetic determinants of rice seed physiological and nutritional quality.

  4. Metabolic reconstruction of Setaria italica: a systems biology approach for integrating tissue-specific omics and pathway analysis of bioenergy grasses

    Directory of Open Access Journals (Sweden)

    Cristiana Gomes De Oliveira Dal'molin

    2016-08-01

    Full Text Available The urgent need for major gains in industrial crops productivity and in biofuel production from bioenergy grasses have reinforced attention on understanding C4 photosynthesis. Systems biology studies of C4 model plants may reveal important features of C4 metabolism. Here we chose foxtail millet (Setaria italica, as a C4 model plant and developed protocols to perform systems biology studies. As part of the systems approach, we have developed and used a genome-scale metabolic reconstruction in combination with the use of multi-omics technologies to gain more insights into the metabolism of S.italica. mRNA, protein and metabolite abundances, were measured in mature and immature stem/leaf phytomers and the multi-omics data were integrated into the metabolic reconstruction framework to capture key metabolic features in different developmental stages of the plant. RNA-Seq reads were mapped to the S. italica resulting for 83% coverage of the protein coding genes of S. italica. Besides revealing similarities and differences in central metabolism of mature and immature tissues, transcriptome analysis indicates significant gene expression of two malic enzyme isoforms (NADP- ME and NAD-ME. Although much greater expression levels of NADP-ME genes are observed and confirmed by the correspondent protein abundances in the samples, the expression of multiple genes combined to the significant abundance of metabolites that participates in C4 metabolism of NAD-ME and NADP-ME subtypes suggest that S. italica may use mixed decarboxylation modes of C4 photosynthetic pathways under different plant developmental stages. The overall analysis also indicates different levels of regulation in mature and immature tissues in carbon fixation, glycolysis, TCA cycle, amino acids, fatty acids, lignin and cellulose syntheses. Altogether, the multi-omics analysis reveals different biological entities and their interrelation and regulation over plant development. With this study

  5. Metabolic Reconstruction of Setaria italica: A Systems Biology Approach for Integrating Tissue-Specific Omics and Pathway Analysis of Bioenergy Grasses.

    Science.gov (United States)

    de Oliveira Dal'Molin, Cristiana G; Orellana, Camila; Gebbie, Leigh; Steen, Jennifer; Hodson, Mark P; Chrysanthopoulos, Panagiotis; Plan, Manuel R; McQualter, Richard; Palfreyman, Robin W; Nielsen, Lars K

    2016-01-01

    The urgent need for major gains in industrial crops productivity and in biofuel production from bioenergy grasses have reinforced attention on understanding C4 photosynthesis. Systems biology studies of C4 model plants may reveal important features of C4 metabolism. Here we chose foxtail millet (Setaria italica), as a C4 model plant and developed protocols to perform systems biology studies. As part of the systems approach, we have developed and used a genome-scale metabolic reconstruction in combination with the use of multi-omics technologies to gain more insights into the metabolism of S. italica. mRNA, protein, and metabolite abundances, were measured in mature and immature stem/leaf phytomers, and the multi-omics data were integrated into the metabolic reconstruction framework to capture key metabolic features in different developmental stages of the plant. RNA-Seq reads were mapped to the S. italica resulting for 83% coverage of the protein coding genes of S. italica. Besides revealing similarities and differences in central metabolism of mature and immature tissues, transcriptome analysis indicates significant gene expression of two malic enzyme isoforms (NADP- ME and NAD-ME). Although much greater expression levels of NADP-ME genes are observed and confirmed by the correspondent protein abundances in the samples, the expression of multiple genes combined to the significant abundance of metabolites that participates in C4 metabolism of NAD-ME and NADP-ME subtypes suggest that S. italica may use mixed decarboxylation modes of C4 photosynthetic pathways under different plant developmental stages. The overall analysis also indicates different levels of regulation in mature and immature tissues in carbon fixation, glycolysis, TCA cycle, amino acids, fatty acids, lignin, and cellulose syntheses. Altogether, the multi-omics analysis reveals different biological entities and their interrelation and regulation over plant development. With this study, we demonstrated

  6. Mind your "smoking manners": the tobacco industry tactics to normalize smoking in Japan.

    Science.gov (United States)

    Kashiwabara, Mina; Armada, Francisco

    2013-11-09

    The tobacco industry has adapted its promotional strategies as tobacco-control measures have increased. This paper describes the tobacco industry's strategies on smoking manners and illustrates how these interfere with tobacco-control policy in Japan where tobacco control remains weak. Information on the tobacco industry's promotional strategies in Japan was collected through direct observation, a review of tobacco industry documents and a literature review. The limitation of the study would be a lack of industry documents from Japan as we relied on a database of a U.S. institution to collect internal documents from the tobacco industry. Japan Tobacco began using the manners strategies in the early 1960s. Collaborating with wide range of actors -including local governments and companies- the tobacco industry has promoted smoking manners to wider audiences through its advertising and corporate social responsibility activities. The tobacco industry in Japan has taken advantage of the cultural value placed on manners in Japan to increase the social acceptability of smoking, eventually aiming to diminish public support for smoke-free policies that threatens the industry's business. A stronger enforcement of the WHO Framework Convention on Tobacco Control is critical to counteracting such strategies.

  7. 26 CFR 1.881-1 - Manner of taxing foreign corporations.

    Science.gov (United States)

    2010-04-01

    ... tax avoidance purposes, whether or not such corporation is engaged in trade or business in the United... TAX (CONTINUED) INCOME TAXES Foreign Corporations § 1.881-1 Manner of taxing foreign corporations. (a) Classes of foreign corporations. For purposes of the income tax, foreign corporations are divided into two...

  8. 17 CFR 17.02 - Form, manner and time of filing reports.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Form, manner and time of filing reports. 17.02 Section 17.02 Commodity and Securities Exchanges COMMODITY FUTURES TRADING... markets located in that time zone, and central time for information concerning all other markets. (b...

  9. Organizing artistic activities in a recurrent manner : (on the nature of) entrepreneurship in the performing arts

    NARCIS (Netherlands)

    Bergamini, Michela; Van de Velde, Ward; Van Looy, Bart; Visscher, Klaasjan

    2017-01-01

    A majority of performing arts organizations active in classical music, theatre, and contemporary dance rely on funding from "third parties" in order to organize productions in a recurrent manner. We adopt an entrepreneurial perspective to inform the debate on the economic sustainability of

  10. Herp regulates Hrd1-mediated ubiquitylation in a ubiquitin-like domain-dependent manner

    DEFF Research Database (Denmark)

    Kny, Melanie; Standera, Sybille; Hartmann-Petersen, Rasmus

    2011-01-01

    in ER-associated protein degradation (ERAD) and interacts directly with the ubiquitin ligase Hrd1, which is found in high molecular mass complexes of the ER membrane. Here we present the first evidence that Herp regulates Hrd1-mediated ubiquitylation in a ubiquitin-like (UBL) domain-dependent manner. We...

  11. Impact of Video Feedback on Teachers' Eye-Contact Mannerisms in Microteaching.

    Science.gov (United States)

    Karasar, Niyazi

    To test the impact of video feedback on teachers' eye-contact mannerisms in microteaching in inservice vocational teacher education, the study utilized video recordings from the data bank generated by previous studies conducted at the Ohio State University's Center for Vocational and Technical Education. The tapes were assigned through a…

  12. Rheological properties of a nematic cell oriented in a planar manner

    International Nuclear Information System (INIS)

    Barbero, G.; Meyer, C.; Lelidis, I.

    2010-01-01

    We propose a simple model to investigate the rheological properties of a nematic cell oriented in a planar manner. The storage and loss modulus are evaluated in the case of strong and weak anchoring conditions. The contribution of the surface viscosity to the rheological parameters is also considered.

  13. Weighting of Acoustic Cues to a Manner Distinction by Children with and without Hearing Loss

    Science.gov (United States)

    Nittrouer, Susan; Lowenstein, Joanna H.

    2015-01-01

    Purpose: Children must develop optimal perceptual weighting strategies for processing speech in their first language. Hearing loss can interfere with that development, especially if cochlear implants are required. The three goals of this study were to measure, for children with and without hearing loss: (a) cue weighting for a manner distinction,…

  14. 40 CFR 141.203 - Tier 2 Public Notice-Form, manner, and frequency of notice.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Tier 2 Public Notice-Form, manner, and frequency of notice. 141.203 Section 141.203 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY...., house renters, apartment dwellers, university students, nursing home patients, prison inmates, etc...

  15. 40 CFR 141.204 - Tier 3 Public Notice-Form, manner, and frequency of notice.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Tier 3 Public Notice-Form, manner, and frequency of notice. 141.204 Section 141.204 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY...., house renters, apartment dwellers, university students, nursing home patients, prison inmates, etc...

  16. Design and characterization of a laterally mounted phased-array transducer breast-specific MRgHIFU device with integrated 11-channel receiver array.

    Science.gov (United States)

    Payne, A; Merrill, R; Minalga, E; Vyas, U; de Bever, J; Todd, N; Hadley, R; Dumont, E; Neumayer, L; Christensen, D; Roemer, R; Parker, D

    2012-03-01

    This work presents the design and preliminary evaluation of a new laterally mounted phased-array MRI-guided high-intensity focused ultrasound (MRgHIFU) system with an integrated 11-channel phased-array radio frequency (RF) coil intended for breast cancer treatment. The design goals for the system included the ability to treat the majority of tumor locations, to increase the MR image's signal-to-noise ratio (SNR) throughout the treatment volume and to provide adequate comfort for the patient. In order to treat the majority of the breast volume, the device was designed such that the treated breast is suspended in a 17-cm diameter treatment cylinder. A laterally shooting 1-MHz, 256-element phased-array ultrasound transducer with flexible positioning is mounted outside the treatment cylinder. This configuration achieves a reduced water volume to minimize RF coil loading effects, to position the coils closer to the breast for increased signal sensitivity, and to reduce the MR image noise associated with using water as the coupling fluid. This design uses an 11-channel phased-array RF coil that is placed on the outer surface of the cylinder surrounding the breast. Mechanical positioning of the transducer and electronic steering of the focal spot enable placement of the ultrasound focus at arbitrary locations throughout the suspended breast. The treatment platform allows the patient to lie prone in a face-down position. The system was tested for comfort with 18 normal volunteers and SNR capabilities in one normal volunteer and for heating accuracy and stability in homogeneous phantom and inhomogeneous ex vivo porcine tissue. There was a 61% increase in mean relative SNR achieved in a homogeneous phantom using the 11-channel RF coil when compared to using only a single-loop coil around the chest wall. The repeatability of the system's energy delivery in a single location was excellent, with less than 3% variability between repeated temperature measurements at the same

  17. Integrated site-specific quantification of faecal bacteria and detection of DNA markers in faecal contamination source tracking as a microbial risk tracking tool in urban Lake ecosystems

    Science.gov (United States)

    Donde, Oscar Omondi; Tian, Cuicui; Xiao, Bangding

    2017-11-01

    The presence of feacal-derived pathogens in water is responsible for several infectious diseases and deaths worldwide. As a solution, sources of fecal pollution in waters must be accurately assessed, properly determined and strictly controlled. However, the exercise has remained challenging due to the existing overlapping characteristics by different members of faecal coliform bacteria and the inadequacy of information pertaining to the contribution of seasonality and weather condition on tracking the possible sources of pollution. There are continued efforts to improve the Faecal Contamination Source Tracking (FCST) techniques such as Microbial Source Tracking (MST). This study aimed to make contribution to MST by evaluating the efficacy of combining site specific quantification of faecal contamination indicator bacteria and detection of DNA markers while accounting for seasonality and weather conditions' effects in tracking the major sources of faecal contamination in a freshwater system (Donghu Lake, China). The results showed that the use of cyd gene in addition to lacZ and uidA genes differentiates E. coli from other closely related faecal bacteria. The use of selective media increases the pollution source tracking accuracy. BSA addition boosts PCR detection and increases FCST efficiency. Seasonality and weather variability also influence the detection limit for DNA markers.

  18. Coastal Modelling Environment version 1.0: a framework for integrating landform-specific component models in order to simulate decadal to centennial morphological changes on complex coasts

    Directory of Open Access Journals (Sweden)

    A. Payo

    2017-07-01

    Full Text Available The ability to model morphological changes on complex, multi-landform coasts over decadal to centennial timescales is essential for sustainable coastal management worldwide. One approach involves coupling of landform-specific simulation models (e.g. cliffs, beaches, dunes and estuaries that have been independently developed. An alternative, novel approach explored in this paper is to capture the essential characteristics of the landform-specific models using a common spatial representation within an appropriate software framework. This avoid the problems that result from the model-coupling approach due to between-model differences in the conceptualizations of geometries, volumes and locations of sediment. In the proposed framework, the Coastal Modelling Environment (CoastalME, change in coastal morphology is represented by means of dynamically linked raster and geometrical objects. A grid of raster cells provides the data structure for representing quasi-3-D spatial heterogeneity and sediment conservation. Other geometrical objects (lines, areas and volumes that are consistent with, and derived from, the raster structure represent a library of coastal elements (e.g. shoreline, beach profiles and estuary volumes as required by different landform-specific models. As a proof-of-concept, we illustrate the capabilities of an initial version of CoastalME by integrating a cliff–beach model and two wave propagation approaches. We verify that CoastalME can reproduce behaviours of the component landform-specific models. Additionally, the integration of these component models within the CoastalME framework reveals behaviours that emerge from the interaction of landforms, which have not previously been captured, such as the influence of the regional bathymetry on the local alongshore sediment-transport gradient and the effect on coastal change on an undefended coastal segment and on sediment bypassing of coastal structures.

  19. A systematic evaluation of integration free reprogramming methods for deriving clinically relevant patient specific induced pluripotent stem (iPS cells.

    Directory of Open Access Journals (Sweden)

    Pollyanna A Goh

    Full Text Available A systematic evaluation of three different methods for generating induced pluripotent stem (iPS cells was performed using the same set of parental cells in our quest to develop a feeder independent and xeno-free method for somatic cell reprogramming that could be transferred into a GMP environment. When using the BJ fibroblast cell line, the highest reprogramming efficiency (1.89% of starting cells was observed with the mRNA based method which was almost 20 fold higher than that observed with the retrovirus (0.2% and episomal plasmid (0.10% methods. Standard characterisation tests did not reveal any differences in an array of pluripotency markers between the iPS lines derived using the various methods. However, when the same methods were used to reprogram three different primary fibroblasts lines, two derived from patients with rapid onset parkinsonism dystonia and one from an elderly healthy volunteer, we consistently observed higher reprogramming efficiencies with the episomal plasmid method, which was 4 fold higher when compared to the retroviral method and over 50 fold higher than the mRNA method. Additionally, with the plasmid reprogramming protocol, recombinant vitronectin and synthemax® could be used together with commercially available, fully defined, xeno-free essential 8 medium without significantly impacting the reprogramming efficiency. To demonstrate the robustness of this protocol, we reprogrammed a further 2 primary patient cell lines, one with retinosa pigmentosa and the other with Parkinsons disease. We believe that we have optimised a simple and reproducible method which could be used as a starting point for developing GMP protocols, a prerequisite for generating clinically relevant patient specific iPS cells.

  20. Ten alien chromosome additions of Gossypium hirsutum-Gossypium bickii developed by integrative uses of GISH and species-specific SSR markers.

    Science.gov (United States)

    Tang, Dong; Feng, Shouli; Li, Sai; Chen, Yu; Zhou, Baoliang

    2018-03-27

    Gossypium bickii: (2n = 26, G 1 G 1 ), a wild diploid cotton, carries many favourable traits. However, these favourable traits cannot be directly transferred into G. hirsutum (2n = 52, AADD) cultivars due to the differences in genomes. Monosomic alien addition lines (MAALs) are considered an invaluable tool for the introgression of genes of interest from wild relatives into cultivated crops. In this study, the G. hirsutum-G. bickii amphidiploid (2n = 78, AADDG 1 G 1 ) was backcrossed with G. hirsutum to develop alien additions containing individual G. bickii chromosomes in a G. hirsutum background. Genomic in situ hybridization was employed to detect the number of alien chromosomes added to the backcross progenies. A total of 183 G. bickii-specific DNA markers were developed to discriminate the identities of the G. bickii chromosomes added to G. hirsutum and assess the alien chromosome transmissibility. Chromosomes 4G b and 13G b showed the highest transmissibility, while chromosomes 1G b , 7G b and 11G b showed the lowest. Ten of the 13 possible G. hirsutum-G. bickii MAALs were isolated and characterized, which will lay the foundation for transferring resistance genes of G. bickii into G. hirsutum, as well as for gene assignment, physical mapping, and selective isolation and mapping of cDNAs for particular G. bickii chromosomes. The strategies of how to use MAALs to develop varieties with the trait of interest from wild species (such as glanded plant-glandless seed) were proposed and discussed.

  1. The nucleoid protein Dps binds genomic DNA of Escherichia coli in a non-random manner

    Science.gov (United States)

    Kondrashov, F. A.; Toshchakov, S. V.; Dominova, I.; Shvyreva, U. S.; Vrublevskaya, V. V.; Morenkov, O. S.; Panyukov, V. V.

    2017-01-01

    Dps is a multifunctional homododecameric protein that oxidizes Fe2+ ions accumulating them in the form of Fe2O3 within its protein cavity, interacts with DNA tightly condensing bacterial nucleoid upon starvation and performs some other functions. During the last two decades from discovery of this protein, its ferroxidase activity became rather well studied, but the mechanism of Dps interaction with DNA still remains enigmatic. The crucial role of lysine residues in the unstructured N-terminal tails led to the conventional point of view that Dps binds DNA without sequence or structural specificity. However, deletion of dps changed the profile of proteins in starved cells, SELEX screen revealed genomic regions preferentially bound in vitro and certain affinity of Dps for artificial branched molecules was detected by atomic force microscopy. Here we report a non-random distribution of Dps binding sites across the bacterial chromosome in exponentially growing cells and show their enrichment with inverted repeats prone to form secondary structures. We found that the Dps-bound regions overlap with sites occupied by other nucleoid proteins, and contain overrepresented motifs typical for their consensus sequences. Of the two types of genomic domains with extensive protein occupancy, which can be highly expressed or transcriptionally silent only those that are enriched with RNA polymerase molecules were preferentially occupied by Dps. In the dps-null mutant we, therefore, observed a differentially altered expression of several targeted genes and found suppressed transcription from the dps promoter. In most cases this can be explained by the relieved interference with Dps for nucleoid proteins exploiting sequence-specific modes of DNA binding. Thus, protecting bacterial cells from different stresses during exponential growth, Dps can modulate transcriptional integrity of the bacterial chromosome hampering RNA biosynthesis from some genes via competition with RNA polymerase

  2. Considerations on the manner to account for fast fracture risk in the design of PWR vessels

    International Nuclear Information System (INIS)

    Pellisier-Tanon, A.; Grandemange, J.M.

    1985-08-01

    The way followed in France for analyzing fast fracture resistance of PWR primary components is the one of a deterministic analysis with safety coefficients imposed in the fracture criteria. The study of margins towards fast fracture of the 900 MWe program vessels undertaken in 1982 includes parametric evaluations of the influence of essential variables. It has stimulated further thoughts on the level of safety to fix in the analysis methodology, on the orientations for the choice of safety factors and on the manner to introduce them in the analysis. A first chapter tries to characterize the French approach in comparison to those of other countries. A second chapter examines the manner according to which safety factors can be introduced in the deterministic analysis. It presents the principle for a logical approach accounting for the interdependency of all factors and variables. It establishes criteria for the selection of defect kind and size for the computation

  3. Systems integration.

    Science.gov (United States)

    Siemieniuch, C E; Sinclair, M A

    2006-01-01

    The paper presents a view of systems integration, from an ergonomics/human factors perspective, emphasising the process of systems integration as is carried out by humans. The first section discusses some of the fundamental issues in systems integration, such as the significance of systems boundaries, systems lifecycle and systems entropy, issues arising from complexity, the implications of systems immortality, and so on. The next section outlines various generic processes for executing systems integration, to act as guides for practitioners. These address both the design of the system to be integrated and the preparation of the wider system in which the integration will occur. Then the next section outlines some of the human-specific issues that would need to be addressed in such processes; for example, indeterminacy and incompleteness, the prediction of human reliability, workload issues, extended situation awareness, and knowledge lifecycle management. For all of these, suggestions and further readings are proposed. Finally, the conclusions section reiterates in condensed form the major issues arising from the above.

  4. p21-activated Kinase1(PAK1) can promote ERK activation in a kinase independent manner

    DEFF Research Database (Denmark)

    Wang, Zhipeng; Fu, Meng; Wang, Lifeng

    2013-01-01

    204) although phosphorylation of b-Raf (Ser445) and c-Raf (Ser 338) remained unchanged. Furthermore, increased activation of the PAK1 activator Rac1 induced the formation of a triple complex of Rac1, PAK1 and Mek1, independent of the kinase activity of PAK1. These data suggest that PAK1 can stimulate...... MEK activity in a kinase independent manner, probably by serving as a scaffold to facilitate interaction of c-Raf....

  5. Native Language Integrated Queries with CppLINQ in C++

    Science.gov (United States)

    Vassilev, V.

    2015-05-01

    Programming language evolution brought to us the domain-specific languages (DSL). They proved to be very useful for expressing specific concepts, turning into a vital ingredient even for general-purpose frameworks. Supporting declarative DSLs (such as SQL) in imperative languages (such as C++) can happen in the manner of language integrated query (LINQ). We investigate approaches to integrate LINQ programming language, native to C++. We review its usability in the context of high energy physics. We present examples using CppLINQ for a few types data analysis workflows done by the end-users doing data analysis. We discuss evidences how this DSL technology can simplify massively parallel grid system such as PROOF.

  6. Integrated Toys

    DEFF Research Database (Denmark)

    Petersson, Eva

    2005-01-01

    the theoretical foundations of play and learning. In this presentation, we explore pedagogical potentials of new technologies and traditional toys integrated into a physical and virtual toy (hereinafter called integrated toy) with specific focus on the open-ended toy and non-formal learning. The integrated toy......Toys play a crucial role in supporting children’s learning and creation of meaning in their everyday life. Children also play with toys out of an interest to interact with others e.g. peers and adults. Tendencies of digital technology in toys have led to greater opportunities for manipulation...... and interaction supporting children’s play and learning such that technology is ever-present in the play environments of children. Although electronics have been deployed in tools for play and learning, most of it has facilitated individual learning. Computer games, for instance, most often are designed...

  7. An array of virtual Frisch-grid CdZnTe detectors and a front-end application-specific integrated circuit for large-area position-sensitive gamma-ray cameras

    Energy Technology Data Exchange (ETDEWEB)

    Bolotnikov, A. E., E-mail: bolotnik@bnl.gov; Ackley, K.; Camarda, G. S.; Cherches, C.; Cui, Y.; De Geronimo, G.; Fried, J.; Hossain, A.; Mahler, G.; Maritato, M.; Roy, U.; Salwen, C.; Vernon, E.; Yang, G.; James, R. B. [Brookhaven National Laboratory, Upton, New York 11793 (United States); Hodges, D. [University of Texas at El Paso, El Paso, Texas 79968 (United States); Lee, W. [Korea University, Seoul 136-855 (Korea, Republic of); Petryk, M. [SUNY Binghamton, Vestal, New York 13902 (United States)

    2015-07-15

    We developed a robust and low-cost array of virtual Frisch-grid CdZnTe detectors coupled to a front-end readout application-specific integrated circuit (ASIC) for spectroscopy and imaging of gamma rays. The array operates as a self-reliant detector module. It is comprised of 36 close-packed 6 × 6 × 15 mm{sup 3} detectors grouped into 3 × 3 sub-arrays of 2 × 2 detectors with the common cathodes. The front-end analog ASIC accommodates up to 36 anode and 9 cathode inputs. Several detector modules can be integrated into a single- or multi-layer unit operating as a Compton or a coded-aperture camera. We present the results from testing two fully assembled modules and readout electronics. The further enhancement of the arrays’ performance and reduction of their cost are possible by using position-sensitive virtual Frisch-grid detectors, which allow for accurate corrections of the response of material non-uniformities caused by crystal defects.

  8. Integrating self-determined needs into the relationship among product design, willingness-to-pay a premium, and word-of-mouth: a cross-cultural gender-specific study.

    Science.gov (United States)

    Gilal, Faheem Gul; Zhang, Jian; Gilal, Naeem Gul; Gilal, Rukhsana Gul

    2018-01-01

    The present study integrates self-determined needs satisfaction into a relationship between product design (eg, aesthetic, functional, and symbolic design) and consumer behavior (eg, willingness-to-pay [WTP] a premium and negative word-of-mouth [WOM]) and to explore whether gender can differentiate the effects of aesthetic, functional, and symbolic product designs on self-determined needs satisfaction. To this end, participants from Pakistan and China were recruited, and the hypotheses for this study were tested using structural equation modeling and SPSS-PROCESS. The effects of three product designs on self-determined needs satisfaction were significantly positive across samples. The results further show that self-determined needs satisfaction had the strongest positive effect on WTP a premium and the strongest negative effect on vindictive WOM for Pakistanis. Self-determined needs frustration had the strongest negative effect on the WTP a premium for Chinese participants and an equivalent magnitude effect on vindictive WOM for Pakistani and Chinese participants. The cross-cultural gender-specific findings revealed that Pakistani men are more aesthetic and hedonic than women in Pakistan. Surprisingly, Chinese women resemble Pakistani men in the sense that they prefer aesthetically pleasing products. Chinese men resemble Pakistani women in terms of little interest in symbolic products, whereas Chinese women and Pakistani men respond similarly regarding their decisions to choose symbolic products. To the best of the authors' knowledge, the present study is one of the initial attempts to integrate self-determined needs into the relationship between product design and consumer WTP a premium and WOM, and further explore cross-cultural gender-specific differences across Pakistan and China. The findings of the present study may help international marketers in terms of segmenting, targeting, and positioning their markets.

  9. Integrated Nuclear-Renewable Energy Systems: Foundational Workshop Report

    Energy Technology Data Exchange (ETDEWEB)

    Bragg-Sitton, Shannon [Idaho National Lab. (INL), Idaho Falls, ID (United States); Boardman, Richard [Idaho National Lab. (INL), Idaho Falls, ID (United States); Ruth, Mark [National Renewable Energy Lab. (NREL), Golden, CO (United States); Zinaman, Owen [National Renewable Energy Lab. (NREL), Golden, CO (United States); Forsberg, Charles [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States); Collins, John [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2014-08-01

    The U.S. Department of Energy (DOE) recognizes the need to transform the energy infrastructure of the U.S. and elsewhere to systems that can drastically reduce environmental impacts in an efficient and economically viable manner while utilizing both hydrocarbon resources and clean energy generation sources. Thus, DOE is supporting research and development that could lead to more efficient utilization of clean energy generation sources, including renewable and nuclear options. A concept being advanced by the DOE Offices of Nuclear Energy (NE) and Energy Efficiency and Renewable Energy (EERE) is tighter coupling of nuclear and renewable energy sources in a manner that produces new energy currency for the combined electricity grid, industrial manufacturing, and the transportation energy sectors. This integration concept has been referred to as a “hybrid system” that is capable of providing the right type of energy, at the right time, in the right place. At the direction of DOE-NE and DOE-EERE leadership, project leads at Idaho National Laboratory (INL), National Renewable Energy Laboratory (NREL) and Massachusetts Institute of Technology (MIT) have identified and engaged stakeholders in discussing integrated energy systems that would optimize renewable and nuclear energy integration on a region-by-region basis. Subsequent work will entail conduct of technical, economic, environmental and socio-political evaluations of the leading integrated system options based on a set of criteria established with stakeholder input. The Foundational Workshop for Integrated Nuclear – Renewable Energy Systems was organized around the following objectives: 1. Identify and refine priority region-specific opportunities for integrated nuclear-renewable energy systems in the U.S.; 2. Select Figures of Merit (FOM) to rank and prioritize candidate systems; 3. Discuss enabling technology development needs; 4. Identify analysis requirements, capabilities and gaps to estimate FOM for

  10. Integrated Nuclear-Renewable Energy Systems: Foundational Workshop Report

    International Nuclear Information System (INIS)

    2014-01-01

    The U.S. Department of Energy (DOE) recognizes the need to transform the energy infrastructure of the U.S. and elsewhere to systems that can drastically reduce environmental impacts in an efficient and economically viable manner while utilizing both hydrocarbon resources and clean energy generation sources. Thus, DOE is supporting research and development that could lead to more efficient utilization of clean energy generation sources, including renewable and nuclear options. A concept being advanced by the DOE Offices of Nuclear Energy (NE) and Energy Efficiency and Renewable Energy (EERE) is tighter coupling of nuclear and renewable energy sources in a manner that produces new energy currency for the combined electricity grid, industrial manufacturing, and the transportation energy sectors. This integration concept has been referred to as a ''hybrid system'' that is capable of providing the right type of energy, at the right time, in the right place. At the direction of DOE-NE and DOE-EERE leadership, project leads at Idaho National Laboratory (INL), National Renewable Energy Laboratory (NREL) and Massachusetts Institute of Technology (MIT) have identified and engaged stakeholders in discussing integrated energy systems that would optimize renewable and nuclear energy integration on a region-by-region basis. Subsequent work will entail conduct of technical, economic, environmental and socio-political evaluations of the leading integrated system options based on a set of criteria established with stakeholder input. The Foundational Workshop for Integrated Nuclear - Renewable Energy Systems was organized around the following objectives: 1. Identify and refine priority region-specific opportunities for integrated nuclear-renewable energy systems in the U.S.; 2. Select Figures of Merit (FOM) to rank and prioritize candidate systems; 3. Discuss enabling technology development needs; 4. Identify analysis requirements, capabilities and gaps to

  11. Integral or integrated marketing

    Directory of Open Access Journals (Sweden)

    Davčik Nebojša

    2006-01-01

    Full Text Available Marketing theorists and experts try to develop business efficient organization and to get marketing performance at higher, business integrated level since its earliest beginnings. The core issue in this paperwork is the dialectic and practical approach dilemma should we develop integrated or integral marketing approach in the organization. The presented company cases as well as dialectic and functional explanations of this dilemma clearly shows that integrated marketing is narrower approach than integral marketing if we take as focal point new, unique and completed entity. In the integration the essence is in getting different parts together, which do not have to make necessary the new entity. The key elements in the definition of the integral marketing are necessity and holistic, e.g. necessity to develop new, holistic entity.

  12. The interactions of multisensory integration with endogenous and exogenous attention

    Science.gov (United States)

    Tang, Xiaoyu; Wu, Jinglong; Shen, Yong

    2016-01-01

    Stimuli from multiple sensory organs can be integrated into a coherent representation through multiple phases of multisensory processing; this phenomenon is called multisensory integration. Multisensory integration can interact with attention. Here, we propose a framework in which attention modulates multisensory processing in both endogenous (goal-driven) and exogenous (stimulus-driven) ways. Moreover, multisensory integration exerts not only bottom-up but also top-down control over attention. Specifically, we propose the following: (1) endogenous attentional selectivity acts on multiple levels of multisensory processing to determine the extent to which simultaneous stimuli from different modalities can be integrated; (2) integrated multisensory events exert top-down control on attentional capture via multisensory search templates that are stored in the brain; (3) integrated multisensory events can capture attention efficiently, even in quite complex circumstances, due to their increased salience compared to unimodal events and can thus improve search accuracy; and (4) within a multisensory object, endogenous attention can spread from one modality to another in an exogenous manner. PMID:26546734

  13. The interactions of multisensory integration with endogenous and exogenous attention.

    Science.gov (United States)

    Tang, Xiaoyu; Wu, Jinglong; Shen, Yong

    2016-02-01

    Stimuli from multiple sensory organs can be integrated into a coherent representation through multiple phases of multisensory processing; this phenomenon is called multisensory integration. Multisensory integration can interact with attention. Here, we propose a framework in which attention modulates multisensory processing in both endogenous (goal-driven) and exogenous (stimulus-driven) ways. Moreover, multisensory integration exerts not only bottom-up but also top-down control over attention. Specifically, we propose the following: (1) endogenous attentional selectivity acts on multiple levels of multisensory processing to determine the extent to which simultaneous stimuli from different modalities can be integrated; (2) integrated multisensory events exert top-down control on attentional capture via multisensory search templates that are stored in the brain; (3) integrated multisensory events can capture attention efficiently, even in quite complex circumstances, due to their increased salience compared to unimodal events and can thus improve search accuracy; and (4) within a multisensory object, endogenous attention can spread from one modality to another in an exogenous manner. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Toward population management in an integrated care model.

    Science.gov (United States)

    Maddux, Franklin W; McMurray, Stephen; Nissenson, Allen R

    2013-01-01

    Under the Patient Protection and Affordable Care Act of 2010, accountable care organizations (ACOs) will be the primary mechanism for achieving the dual goals of high-quality patient care at managed per capita costs. To achieve these goals in the newly emerging health care environment, the nephrology community must plan for and direct integrated delivery and coordination of renal care, focusing on population management. Even though the ESRD patient population is a complex group with comorbid conditions that may confound integration of care, the nephrology community has unique experience providing integrated care through ACO-like programs. Specifically, the recent ESRD Management Demonstration Project sponsored by the Centers for Medicare & Medicaid Services and the current ESRD Prospective Payment System with it Quality Incentive Program have demonstrated that integrated delivery of renal care can be accomplished in a manner that provides improved clinical outcomes with some financial margin of savings. Moving forward, integrated renal care will probably be linked to provider performance and quality outcomes measures, and clinical integration initiatives will share several common elements, namely performance-based payment models, coordination of communication via health care information technology, and development of best practices for care coordination and resource utilization. Integration initiatives must be designed to be measured and evaluated, and, consistent with principles of continuous quality improvement, each initiative will provide for iterative improvements of the initiative. © 2013 S. Karger AG, Basel.

  15. Tissue transglutaminase inhibits the TRPV5-dependent calcium transport in an N-glycosylation-dependent manner

    DEFF Research Database (Denmark)

    Boros, Sandor; Xi, Qi; Dimke, Henrik Anthony

    2011-01-01

    Tissue transglutaminase (tTG) is a multifunctional Ca(2+)-dependent enzyme, catalyzing protein crosslinking. The transient receptor potential vanilloid (TRPV) family of cation channels was recently shown to contribute to the regulation of TG activities in keratinocytes and hence skin barrier form......, these observations imply that tTG is a novel extracellular enzyme inhibiting the activity of TRPV5. The inhibition of TRPV5 occurs in an N-glycosylation-dependent manner, signifying a common final pathway by which distinct extracellular factors regulate channel activity....

  16. A Brief Analysis on The Mannerism of Strange Stories of A Chinese Studio by Pu Songling

    Directory of Open Access Journals (Sweden)

    Andyni Khosasih

    2012-10-01

    Full Text Available Strange Stories of a Chinese Studio, commonly known as 聊斋 (Liaozhai is a short novel written in classical Chinese from Qing dynasty. This novel was written in 1680, year 19 of Emperor Kangxi’s reign. The novel has 491 chapters. Article explored Pu Songling’s mannerism, such as the contents, material collection, innovation of artistic literary elements and images of women. It can be concluded that  the novel reflects the broadness of humanistic world and thoroughly describes images of women. It broke through the restriction of thoughts in feudalism society.  

  17. Foundations for Psychotherapy Integration

    Directory of Open Access Journals (Sweden)

    António Branco Vasco

    2014-10-01

    Full Text Available The movement for integration in psychotheray is clearly one of the main trends that can be observed in the field. The author stresses three main reasons for this state of affairs and as a way of justifying the importance of integration: historical and psychosocial, empirical and philosophical. A specific way of thinking in integrative terms is also outlined - "paradigmatic complementarity."

  18. Biochanin a and Daidzein Influence Meiotic Maturation of Pig Oocytes in a Different Manner

    Directory of Open Access Journals (Sweden)

    Hošková K.

    2014-09-01

    Full Text Available The aim of the study was to determine the influence of different concentrations of phytoestrogens biochanin A (BIO A; 20, 40, 50μg ml-1 and daidzein (DAI; 10, 20, 40, 50μg ml-1 on the course of meiotic maturation of pig oocytes. After a 24-hour cultivation, a stage of nuclear maturation was achieved and the areas of cumulus-oocyte complexes (COCs, as an indicator of cumulus expansion, were evaluated. The effects of both contaminants on oocytes were mani - fested from the lowest concentration used. Nuclear maturation was inhibited in a dose-dependent manner in the case of BIO A. Effects of DAI reached a plateau at a concentration of 20μg ml-1.Possible relationship to limited solubility of DAI was excluded because limits of DAI solubility in culture medium were confirmed at 50 μg ml-1.The cumulus expansion was also influenced in a different manner - reduction of the COC’s area by BIO A was dose-dependent, whereas DAI had the strongest effect on CCs in the lowest and highest concentrations used. Both phytoestrogens negatively influence the meiotic maturation of porcine oocytes but there are significant differences in their concrete effects which could relate to the diverse mechanisms of their acting on target cells.

  19. A top-down manner-based DCNN architecture for semantic image segmentation.

    Directory of Open Access Journals (Sweden)

    Kai Qiao

    Full Text Available Given their powerful feature representation for recognition, deep convolutional neural networks (DCNNs have been driving rapid advances in high-level computer vision tasks. However, their performance in semantic image segmentation is still not satisfactory. Based on the analysis of visual mechanism, we conclude that DCNNs in a bottom-up manner are not enough, because semantic image segmentation task requires not only recognition but also visual attention capability. In the study, superpixels containing visual attention information are introduced in a top-down manner, and an extensible architecture is proposed to improve the segmentation results of current DCNN-based methods. We employ the current state-of-the-art fully convolutional network (FCN and FCN with conditional random field (DeepLab-CRF as baselines to validate our architecture. Experimental results of the PASCAL VOC segmentation task qualitatively show that coarse edges and error segmentation results are well improved. We also quantitatively obtain about 2%-3% intersection over union (IOU accuracy improvement on the PASCAL VOC 2011 and 2012 test sets.

  20. L-carnosine affects the growth of Saccharomyces cerevisiae in a metabolism-dependent manner.

    Science.gov (United States)

    Cartwright, Stephanie P; Bill, Roslyn M; Hipkiss, Alan R

    2012-01-01

    The dipeptide L-carnosine (β-alanyl-L-histidine) has been described as enigmatic: it inhibits growth of cancer cells but delays senescence in cultured human fibroblasts and extends the lifespan of male fruit flies. In an attempt to understand these observations, the effects of L-carnosine on the model eukaryote, Saccharomyces cerevisiae, were examined on account of its unique metabolic properties; S. cerevisiae can respire aerobically, but like some tumor cells, it can also exhibit a metabolism in which aerobic respiration is down regulated. L-Carnosine exhibited both inhibitory and stimulatory effects on yeast cells, dependent upon the carbon source in the growth medium. When yeast cells were not reliant on oxidative phosphorylation for energy generation (e.g. when grown on a fermentable carbon source such as 2% glucose), 10-30 mM L-carnosine slowed growth rates in a dose-dependent manner and increased cell death by up to 17%. In contrast, in media containing a non-fermentable carbon source in which yeast are dependent on aerobic respiration (e.g. 2% glycerol), L-carnosine did not provoke cell death. This latter observation was confirmed in the respiratory yeast, Pichia pastoris. Moreover, when deletion strains in the yeast nutrient-sensing pathway were treated with L-carnosine, the cells showed resistance to its inhibitory effects. These findings suggest that L-carnosine affects cells in a metabolism-dependent manner and provide a rationale for its effects on different cell types.

  1. Representing Space through the Interplay between Attention and Multisensory Integration

    Directory of Open Access Journals (Sweden)

    Emiliano Macaluso

    2011-10-01

    Full Text Available Multisensory integration has been traditionally thought to rely on a restricted set of multisensory brain areas, and to occur automatically and pre-attentively. More recently, it has become evident that multisensory interactions can be found almost everywhere in the brain, including areas involved in attention control and areas modulated by attention. In a series of fMRI experiments, we manipulated concurrently the position of multisensory stimuli and the distribution of spatial attention. This enabled us to highlight the role of high-order fronto-parietal areas, as well as sensory-specific occipital cortex, for multisensory processing and spatial attention control. We found that specific task constraints regarding the nature of attentional deployment (endogenous vs. exogenous, the spatial relationship between stimulus position and attended location, and attentional load shape the interplay between attention and multisensory processing. We suggest that multisensory integration acts as a saliency-defining process that can interact with attentional control beyond any within-modality mechanism. We propose that an anatomically-distributed, but functionally-integrated, representation of space makes use of multisensory interactions to help attention selecting relevant spatial locations. Stimuli at the attended location undergo enhanced processing, including boosting of multisensory signals there. In this perspective, attention and multisensory integration operate in an interactive manner jointly determining the activity of a wide-spread network that includes high-order fronto-parietal regions and sensory-specific areas.

  2. Inside interesting integrals (with an introduction to contour integration) : a collection of sneaky tricks, sly substitutions, and numerous other stupendously clever, awesomely wicked, and devilishly seductive maneuvers for computing nearly 200 perplexing definite integrals from physics, engineering, and mathematics (plus 60 challenge problems with complete, detailed solutions)

    CERN Document Server

    Nahin, Paul J

    2015-01-01

    What’s the point of calculating definite integrals since you can’t possibly do them all? What makes doing the specific integrals in this book of value aren’t the specific answers we’ll obtain, but rather the methods we’ll use in obtaining those answers; methods you can use for evaluating the integrals you will encounter in the future. This book is written in a light-hearted manner for students who have completed the first year of college or high school AP calculus, and have just a bit of exposure to the concept of a differential equation. Every result is fully derived. If you are fascinated by definite integrals, then this is a book for you.

  3. Integral-preserving integrators

    International Nuclear Information System (INIS)

    McLaren, D I; Quispel, G R W

    2004-01-01

    Ordinary differential equations having a first integral may be solved numerically using one of several methods, with the integral preserved to machine accuracy. One such method is the discrete gradient method. It is shown here that the order of the method can be bootstrapped repeatedly to higher orders of accuracy. The method is illustrated using the Henon-Heiles system. (letter to the editor)

  4. SUN1 Regulates HIV-1 Nuclear Import in a Manner Dependent on the Interaction between the Viral Capsid and Cellular Cyclophilin A.

    Science.gov (United States)

    Luo, Xinlong; Yang, Wei; Gao, Guangxia

    2018-07-01

    Human immunodeficiency virus type 1 (HIV-1) can infect nondividing cells via passing through the nuclear pore complex. The nuclear membrane-imbedded protein SUN2 was recently reported to be involved in the nuclear import of HIV-1. Whether SUN1, which shares many functional similarities with SUN2, is involved in this process remained to be explored. Here we report that overexpression of SUN1 specifically inhibited infection by HIV-1 but not that by simian immunodeficiency virus (SIV) or murine leukemia virus (MLV). Overexpression of SUN1 did not affect reverse transcription but led to reduced accumulation of the 2-long-terminal-repeat (2-LTR) circular DNA and integrated viral DNA, suggesting a block in the process of nuclear import. HIV-1 CA was mapped as a determinant for viral sensitivity to SUN1. Treatment of SUN1-expressing cells with cyclosporine (CsA) significantly reduced the sensitivity of the virus to SUN1, and an HIV-1 mutant containing CA-G89A, which does not interact with cyclophilin A (CypA), was resistant to SUN1 overexpression. Downregulation of endogenous SUN1 inhibited the nuclear entry of the wild-type virus but not that of the G89A mutant. These results indicate that SUN1 participates in the HIV-1 nuclear entry process in a manner dependent on the interaction of CA with CypA. IMPORTANCE HIV-1 infects both dividing and nondividing cells. The viral preintegration complex (PIC) can enter the nucleus through the nuclear pore complex. It has been well known that the viral protein CA plays an important role in determining the pathways by which the PIC enters the nucleus. In addition, the interaction between CA and the cellular protein CypA has been reported to be important in the selection of nuclear entry pathways, though the underlying mechanisms are not very clear. Here we show that both SUN1 overexpression and downregulation inhibited HIV-1 nuclear entry. CA played an important role in determining the sensitivity of the virus to SUN1: the regulatory

  5. Light at night acutely impairs glucose tolerance in a time-, intensity- and wavelength-dependent manner in rats.

    Science.gov (United States)

    Opperhuizen, Anne-Loes; Stenvers, Dirk J; Jansen, Remi D; Foppen, Ewout; Fliers, Eric; Kalsbeek, Andries

    2017-07-01

    Exposure to light at night (LAN) has increased dramatically in recent decades. Animal studies have shown that chronic dim LAN induced obesity and glucose intolerance. Furthermore, several studies in humans have demonstrated that chronic exposure to artificial LAN may have adverse health effects with an increased risk of metabolic disorders, including type 2 diabetes. It is well-known that acute exposure to LAN affects biological clock function, hormone secretion and the activity of the autonomic nervous system, but data on the effects of LAN on glucose homeostasis are lacking. This study aimed to investigate the acute effects of LAN on glucose metabolism. Male Wistar rats were subjected to i.v. glucose or insulin tolerance tests while exposed to 2 h of LAN in the early or late dark phase. In subsequent experiments, different light intensities and wavelengths were used. LAN exposure early in the dark phase at ZT15 caused increased glucose responses during the first 20 min after glucose infusion (p light of 50 and 150 lx induced greater glucose responses than 5 and 20 lx, whereas all intensities other than 5 lx reduced locomotor activity. Green light induced glucose intolerance, but red and blue light did not, suggesting the involvement of a specific retina-brain pathway. Together, these data show that exposure to LAN has acute adverse effects on glucose metabolism in a time-, intensity- and wavelength-dependent manner.

  6. Integrating self-determined needs into the relationship among product design, willingness-to-pay a premium, and word-of-mouth: a cross-cultural gender-specific study

    Directory of Open Access Journals (Sweden)

    Gilal FG

    2018-06-01

    Full Text Available Faheem Gul Gilal,1 Jian Zhang,1 Naeem Gul Gilal,2 Rukhsana Gul Gilal3 1Donlinks School of Economics and Management, University of Science and Technology Beijing, Beijing, People’s Republic of China; 2School of Management, Huazhong University of Science and Technology, Wuhan, Hubei, People’s Republic of China; 3Department of Business Administration, Sukkur IBA University, Sindh, Pakistan Background: The present study integrates self-determined needs satisfaction into a relationship between product design (eg, aesthetic, functional, and symbolic design and consumer behavior (eg, willingness-to-pay [WTP] a premium and negative word-of-mouth [WOM] and to explore whether gender can differentiate the effects of aesthetic, functional, and symbolic product designs on self-determined needs satisfaction. Methods: To this end, participants from Pakistan and China were recruited, and the hypotheses for this study were tested using structural equation modeling and SPSS-PROCESS. Results: The effects of three product designs on self-determined needs satisfaction were significantly positive across samples. The results further show that self-determined needs satisfaction had the strongest positive effect on WTP a premium and the strongest negative effect on vindictive WOM for Pakistanis. Self-determined needs frustration had the strongest negative effect on the WTP a premium for Chinese participants and an equivalent magnitude effect on vindictive WOM for Pakistani and Chinese participants. The cross-cultural gender-specific findings revealed that Pakistani men are more aesthetic and hedonic than women in Pakistan. Surprisingly, Chinese women resemble Pakistani men in the sense that they prefer aesthetically pleasing products. Chinese men resemble Pakistani women in terms of little interest in symbolic products, whereas Chinese women and Pakistani men respond similarly regarding their decisions to choose symbolic products. Conclusion: To the best of the

  7. Potentiation Effects of Half-Squats Performed in a Ballistic or Nonballistic Manner.

    Science.gov (United States)

    Suchomel, Timothy J; Sato, Kimitake; DeWeese, Brad H; Ebben, William P; Stone, Michael H

    2016-06-01

    This study examined and compared the acute effects of ballistic and nonballistic concentric-only half-squats (COHSs) on squat jump performance. Fifteen resistance-trained men performed a squat jump 2 minutes after a control protocol or 2 COHSs at 90% of their 1 repetition maximum (1RM) COHS performed in a ballistic or nonballistic manner. Jump height (JH), peak power (PP), and allometrically scaled peak power (PPa) were compared using three 3 × 2 repeated-measures analyses of variance. Statistically significant condition × time interaction effects existed for JH (p = 0.037), PP (p = 0.041), and PPa (p = 0.031). Post hoc analysis revealed that the ballistic condition produced statistically greater JH (p = 0.017 and p = 0.036), PP (p = 0.031 and p = 0.026), and PPa (p = 0.024 and p = 0.023) than the control and nonballistic conditions, respectively. Small effect sizes for JH, PP, and PPa existed during the ballistic condition (d = 0.28-0.44), whereas trivial effect sizes existed during the control (d = 0.0-0.18) and nonballistic (d = 0.0-0.17) conditions. Large statistically significant relationships existed between the JH potentiation response and the subject's relative back squat 1RM (r = 0.520; p = 0.047) and relative COHS 1RM (r = 0.569; p = 0.027) during the ballistic condition. In addition, large statistically significant relationship existed between JH potentiation response and the subject's relative back squat strength (r = 0.633; p = 0.011), whereas the moderate relationship with the subject's relative COHS strength trended toward significance (r = 0.483; p = 0.068). Ballistic COHS produced superior potentiation effects compared with COHS performed in a nonballistic manner. Relative strength may contribute to the elicited potentiation response after ballistic and nonballistic COHS.

  8. Intermittent Hypoxia Disrupts Glucose Homeostasis in Liver Cells in an Insulin-Dependent and Independent Manner

    Directory of Open Access Journals (Sweden)

    Chen Juan Gu

    2018-05-01

    Full Text Available Background/Aims: Obstructive sleep apnea is associated with diabetes and insulin resistance, but the underlying mechanisms remain unclear. The purpose of the current study was to determine the molecular effects of intermittent hypoxia (IH on hepatic insulin signaling and glucose homeostasis, and whether c-Jun NH2-terminal-kinase (JNK contributed to metabolic responses to IH in liver cells. Methods: The human HepG2 cells and rat FAO cells were exposed to 10, 30, 120, 240 or 360 cycles of IH (1% O2 for 60 s followed by 21% O2 for 60s, 7.5 cycles per hour or normoxia as a control. In a subgroup, we exposed cells to 360 cycles of IH with the JNK inhibitor SP600125. After IH exposure, cell glycogen content and glucose output were measured using colorimetric assay kits. Canonical insulin signaling and gluconeogenic genes were measured by western blot and quantitative polymerase chain reaction. Results: IH decreased insulin-stimulated protein kinase B (AKT/glycogen synthase kinase-3β (GSK-3β phosphorylation in a time-dependent manner, while inhibiting forkhead box protein O1 (FOXO1 expression and phosphoenolpyruvate carboxykinase (PEPCK transcription independent of insulin signaling. JNK inhibitor SP600125 partially restored AKT/ GSK-3β phosphorylation and glycogen synthesis, but did not affect other IH-induced glucose metabolic changes. Conclusion: IH in vitro impaired insulin signal transduction in liver cells as assessed by inhibited AKT/GSK-3β phosphorylation via JNK activation. IH inhibited FOXO1 and gluconeogenesis in an insulin-independent manner.

  9. L-carnosine affects the growth of Saccharomyces cerevisiae in a metabolism-dependent manner.

    Directory of Open Access Journals (Sweden)

    Stephanie P Cartwright

    Full Text Available The dipeptide L-carnosine (β-alanyl-L-histidine has been described as enigmatic: it inhibits growth of cancer cells but delays senescence in cultured human fibroblasts and extends the lifespan of male fruit flies. In an attempt to understand these observations, the effects of L-carnosine on the model eukaryote, Saccharomyces cerevisiae, were examined on account of its unique metabolic properties; S. cerevisiae can respire aerobically, but like some tumor cells, it can also exhibit a metabolism in which aerobic respiration is down regulated. L-Carnosine exhibited both inhibitory and stimulatory effects on yeast cells, dependent upon the carbon source in the growth medium. When yeast cells were not reliant on oxidative phosphorylation for energy generation (e.g. when grown on a fermentable carbon source such as 2% glucose, 10-30 mM L-carnosine slowed growth rates in a dose-dependent manner and increased cell death by up to 17%. In contrast, in media containing a non-fermentable carbon source in which yeast are dependent on aerobic respiration (e.g. 2% glycerol, L-carnosine did not provoke cell death. This latter observation was confirmed in the respiratory yeast, Pichia pastoris. Moreover, when deletion strains in the yeast nutrient-sensing pathway were treated with L-carnosine, the cells showed resistance to its inhibitory effects. These findings suggest that L-carnosine affects cells in a metabolism-dependent manner and provide a rationale for its effects on different cell types.

  10. Investigation of organic matter migrating from polymeric pipes into drinking water under different flow manners.

    Science.gov (United States)

    Zhang, Ling; Liu, Shuming; Liu, Wenjun

    2014-02-01

    Polymeric pipes, such as unplasticized polyvinyl chloride (uPVC) pipes, polypropylene random (PPR) pipes and polyethylene (PE) pipes are increasingly used for drinking water distribution lines. Plastic pipes may include some additives like metallic stabilizers and other antioxidants for the protection of the material during its production and use. Thus, some compounds can be released from those plastic pipes and cast a shadow on drinking water quality. This work develops a new procedure to investigate three types of polymer pipes (uPVC, PE and PPR) with respect to the migration of total organic carbon (TOC) into drinking water. The migration test was carried out in stagnant conditions with two types of migration processes, a continuous migration process and a successive migration process. These two types of migration processes are specially designed to mimic the conditions of different flow manners in drinking water pipelines, i.e., the situation of continuous stagnation with long hydraulic retention times and normal flow status with regular water renewing in drinking water networks. The experimental results showed that TOC release differed significantly with different plastic materials and under different flow manners. The order of materials with respect to the total amount of TOC migrating into drinking water was observed as PE > PPR > uPVC under both successive and continuous migration conditions. A higher amount of organic migration from PE and PPR pipes was likely to occur due to more organic antioxidants being used in pipe production. The results from the successive migration tests indicated the trend of the migration intensity of different pipe materials over time, while the results obtained from the continuous migration tests implied that under long stagnant conditions, the drinking water quality could deteriorate quickly with the consistent migration of organic compounds and the dramatic consumption of chlorine to a very low level. Higher amounts of TOC

  11. Integration of gastronomy and physics for innovation

    NARCIS (Netherlands)

    Linden, van der E.

    2013-01-01

    Integration of physics with gastronomy can yield innovations in an efficient manner. An important element of this integration is the structure of food. The creation of food recipes often deals with designing new structures and a clear understanding of how food structure influences food properties is

  12. Cortical thinning in the anterior cingulate cortex predicts multiple sclerosis patients' fluency performance in a lateralised manner

    Directory of Open Access Journals (Sweden)

    Olivia Geisseler

    2016-01-01

    Full Text Available Cognitive impairment is as an important feature of Multiple Sclerosis (MS, and might be even more relevant to patients than mobility restrictions. Compared to the multitude of studies investigating memory deficits or basic cognitive slowing, executive dysfunction is a rarely studied cognitive domain in MS, and its neural correlates remain largely unexplored. Even rarer are topological studies on specific cognitive functions in MS. Here we used several structural MRI parameters – including cortical thinning and T2 lesion load – to investigate neural correlates of executive dysfunction, both on a global and a regional level by means of voxel- and vertex-wise analyses. Forty-eight patients with relapsing-remitting MS and 48 healthy controls participated in the study. Five executive functions were assessed, i.e. verbal and figural fluency, working memory, interference control and set shifting. Patients scored lower than controls in verbal and figural fluency only, and displayed widespread cortical thinning. On a global level, cortical thickness independently predicted verbal fluency performance, when controlling for lesion volume and central brain atrophy estimates. On a regional level, cortical thinning in the anterior cingulate region correlated with deficits in verbal and figural fluency and did so in a lateralised manner: Left-sided thinning was related to reduced verbal – but not figural – fluency, whereas the opposite pattern was observed for right-sided thinning. We conclude that executive dysfunction in MS patients can specifically affect verbal and figural fluency. The observed lateralised clinico-anatomical correlation has previously been described in brain-damaged patients with large focal lesions only, for example after stroke. Based on focal grey matter atrophy, we here show for the first time comparable lateralised findings in a white matter disease with widespread pathology.

  13. Letrozole regulates actin cytoskeleton polymerization dynamics in a SRC-1 dependent manner in the hippocampus of mice.

    Science.gov (United States)

    Zhao, Yangang; Yu, Yanlan; Zhang, Yuanyuan; He, Li; Qiu, Linli; Zhao, Jikai; Liu, Mengying; Zhang, Jiqiang

    2017-03-01

    In the hippocampus, local estrogens (E 2 ) derived from testosterone that is catalyzed by aromatase play important roles in the regulation of hippocampal neural plasticity, but the underlying mechanisms remain unclear. The actin cytoskeleton contributes greatly to hippocampal synaptic plasticity; however, whether it is regulated by local E 2 and the related mechanisms remain to be elucidated. In this study, we first examined the postnatal developmental profiles of hippocampal aromatase and specific proteins responsible for actin cytoskeleton dynamics. Then we used aromatase inhibitor letrozole (LET) to block local E 2 synthesis and examined the changes of these proteins and steroid receptor coactivator-1 (SRC-1), the predominant coactivator for steroid nuclear receptors. Finally, SRC-1 specific RNA interference was used to examine the effects of SRC-1 on the expression of these actin remodeling proteins. The results showed a V-type profile for aromatase and increased profiles for actin cytoskeleton proteins in both male and female hippocampus without obvious sex differences. LET treatment dramatically decreased the F-actin/G-actin ratio, the expression of Rictor, phospho-AKT (ser473), Profilin-1, phospho-Cofilin (Ser3), and SRC-1 in a dose-dependent manner. In vitro studies demonstrated that LET induced downregulation of these proteins could be reversed by E 2 , and E 2 induced increase of these proteins were significantly suppressed by SRC-1 shRNA interference. These results for the first time clearly demonstrated that local E 2 inhibition could induce aberrant actin polymerization; they also showed an important role of SRC-1 in the mediation of local E 2 action on hippocampal synaptic plasticity by regulation of actin cytoskeleton dynamics. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Integrated Design

    DEFF Research Database (Denmark)

    Jørgensen, Michael; Nielsen, M. W.; Strømann-Andersen, Jakob Bjørn

    2011-01-01

    and describe the decision process. Specific attention is given to how the engineering input was presented and how it was able to facilitate the design development. Site and context, building shape, organization of functions and HVAC-systems were all included to obtain a complete picture of the building......, low-energy consumption, and high-quality indoor environment. We use this case study to investigate how technical knowledge about building performance can be integrated into the conceptual design stage. We have selected certain points during the design process that represented design challenges...

  15. Integration of software for scenario exploration

    International Nuclear Information System (INIS)

    Oyamada, Kiyoshi; Ikeda, Takao

    1999-03-01

    The scenario exploration methodology using shadow models is a variation of the environmental simulation method. Key aspect of the scenario exploration is the use of shadow models which are not corresponding to any specific assumptions on physical processes and, instead, abstract their general features relevant to the effects on nuclide transport in a general manner so that benefit of using simulation approach can be maximized. In developing the shadow models, all the modelling options that have not yet been denied by the experts are kept and parametrized in a very general framework. This, in turn, enables one to treat various types of the uncertainty in performance assessment, i.e., scenario uncertainty, conceptual model uncertainty, mathematical model uncertainty and parameter uncertainty, in a common framework of uncertainty / sensitivity analysis. Objective of the current study is to review / modify the tools which have been developed separately and, thence, not fully consistent from one to the other and to integrate them into a unified methodology and software. Tasks for this are; 1. modification / integration of tools for scenario exploration of nuclide transport in the EBS and the near-field host rock, 2. verification of the software modified and integrated, 3. installation of the software at JNC. (author)

  16. Specifying Specification.

    Science.gov (United States)

    Paulo, Norbert

    2016-03-01

    This paper tackles the accusation that applied ethics is no serious academic enterprise because it lacks theoretical bracing. It does so in two steps. In the first step I introduce and discuss a highly acclaimed method to guarantee stability in ethical theories: Henry Richardson's specification. The discussion shows how seriously ethicists take the stability of the connection between the foundational parts of their theories and their further development as well as their "application" to particular problems or cases. A detailed scrutiny of specification leads to the second step, where I use insights from legal theory to inform the debate around stability from that point of view. This view reveals some of specification's limitations. I suggest that, once specification is sufficiently specified, it appears astonishingly similar to deduction as used in legal theory. Legal theory also provides valuable insight into the functional range of deduction and its relation to other forms of reasoning. This leads to a richer understanding of stability in normative theories and to a smart division of labor between deduction and other forms of reasoning. The comparison to legal theory thereby provides a framework for how different methods such as specification, deduction, balancing, and analogy relate to one another.

  17. Habitual Chocolate Consumption May Increase Body Weight in a Dose-Response Manner

    Science.gov (United States)

    Greenberg, James A.; Buijsse, Brian

    2013-01-01

    Objective Habitual chocolate intake was recently found to be associated with lower body weight in three cross-sectional epidemiological studies. Our objective was to assess whether these cross-sectional results hold up in a more rigorous prospective analysis. Methods We used data from the Atherosclerosis Risk in Communities cohort. Usual dietary intake was assessed by questionnaire at baseline (1987–98), and after six years. Participants reported usual chocolate intake as the frequency of eating a 1-oz (∼28 g) serving. Body weight and height were measured at the two visits. Missing data were replaced by multiple imputation. Linear mixed-effects models were used to evaluate cross-sectional and prospective associations between chocolate intake and adiposity. Results Data were from 15,732 and 12,830 participants at the first and second visit, respectively. More frequent chocolate consumption was associated with a significantly greater prospective weight gain over time, in a dose-response manner. For instance, compared to participants who ate a chocolate serving less often than monthly, those who ate it 1–4 times a month and at least weekly experienced an increase in Body Mass Index (kg/m2) of 0.26 (95% CI 0.08, 0.44) and 0.39 (0.23, 0.55), respectively, during the six-year study period. In cross-sectional analyses the frequency of chocolate consumption was inversely associated with body weight. This inverse association was attenuated after excluding participants with preexisting obesity-related illness. Compared to participants without such illness, those with it had higher BMI and reported less frequent chocolate intake, lower caloric intake, and diets richer in fruits and vegetables. They tended to make these dietary changes after becoming ill. Conclusions Our prospective analysis found that a chocolate habit was associated with long-term weight gain, in a dose-response manner. Our cross-sectional finding that chocolate intake was associated with lower body

  18. Habitual chocolate consumption may increase body weight in a dose-response manner.

    Science.gov (United States)

    Greenberg, James A; Buijsse, Brian

    2013-01-01

    Habitual chocolate intake was recently found to be associated with lower body weight in three cross-sectional epidemiological studies. Our objective was to assess whether these cross-sectional results hold up in a more rigorous prospective analysis. We used data from the Atherosclerosis Risk in Communities cohort. Usual dietary intake was assessed by questionnaire at baseline (1987-98), and after six years. Participants reported usual chocolate intake as the frequency of eating a 1-oz (~28 g) serving. Body weight and height were measured at the two visits. Missing data were replaced by multiple imputation. Linear mixed-effects models were used to evaluate cross-sectional and prospective associations between chocolate intake and adiposity. Data were from 15,732 and 12,830 participants at the first and second visit, respectively. More frequent chocolate consumption was associated with a significantly greater prospective weight gain over time, in a dose-response manner. For instance, compared to participants who ate a chocolate serving less often than monthly, those who ate it 1-4 times a month and at least weekly experienced an increase in Body Mass Index (kg/m2) of 0.26 (95% CI 0.08, 0.44) and 0.39 (0.23, 0.55), respectively, during the six-year study period. In cross-sectional analyses the frequency of chocolate consumption was inversely associated with body weight. This inverse association was attenuated after excluding participants with preexisting obesity-related illness. Compared to participants without such illness, those with it had higher BMI and reported less frequent chocolate intake, lower caloric intake, and diets richer in fruits and vegetables. They tended to make these dietary changes after becoming ill. Our prospective analysis found that a chocolate habit was associated with long-term weight gain, in a dose-response manner. Our cross-sectional finding that chocolate intake was associated with lower body weight did not apply to participants without

  19. Habitual chocolate consumption may increase body weight in a dose-response manner.

    Directory of Open Access Journals (Sweden)

    James A Greenberg

    Full Text Available OBJECTIVE: Habitual chocolate intake was recently found to be associated with lower body weight in three cross-sectional epidemiological studies. Our objective was to assess whether these cross-sectional results hold up in a more rigorous prospective analysis. METHODS: We used data from the Atherosclerosis Risk in Communities cohort. Usual dietary intake was assessed by questionnaire at baseline (1987-98, and after six years. Participants reported usual chocolate intake as the frequency of eating a 1-oz (~28 g serving. Body weight and height were measured at the two visits. Missing data were replaced by multiple imputation. Linear mixed-effects models were used to evaluate cross-sectional and prospective associations between chocolate intake and adiposity. RESULTS: Data were from 15,732 and 12,830 participants at the first and second visit, respectively. More frequent chocolate consumption was associated with a significantly greater prospective weight gain over time, in a dose-response manner. For instance, compared to participants who ate a chocolate serving less often than monthly, those who ate it 1-4 times a month and at least weekly experienced an increase in Body Mass Index (kg/m2 of 0.26 (95% CI 0.08, 0.44 and 0.39 (0.23, 0.55, respectively, during the six-year study period. In cross-sectional analyses the frequency of chocolate consumption was inversely associated with body weight. This inverse association was attenuated after excluding participants with preexisting obesity-related illness. Compared to participants without such illness, those with it had higher BMI and reported less frequent chocolate intake, lower caloric intake, and diets richer in fruits and vegetables. They tended to make these dietary changes after becoming ill. CONCLUSIONS: Our prospective analysis found that a chocolate habit was associated with long-term weight gain, in a dose-response manner. Our cross-sectional finding that chocolate intake was associated with

  20. Rule-based Information Integration

    NARCIS (Netherlands)

    de Keijzer, Ander; van Keulen, Maurice

    2005-01-01

    In this report, we show the process of information integration. We specifically discuss the language used for integration. We show that integration consists of two phases, the schema mapping phase and the data integration phase. We formally define transformation rules, conversion, evolution and

  1. The canonical Wnt signaling pathway promotes chondrocyte differentiation in a Sox9-dependent manner

    International Nuclear Information System (INIS)

    Yano, Fumiko; Kugimiya, Fumitaka; Ohba, Shinsuke; Ikeda, Toshiyuki; Chikuda, Hirotaka; Ogasawara, Toru; Ogata, Naoshi; Takato, Tsuyoshi; Nakamura, Kozo; Kawaguchi, Hiroshi; Chung, Ung-il

    2005-01-01

    To better understand the role of the canonical Wnt signaling pathway in cartilage development, we adenovirally expressed a constitutively active (Canada) or a dominant negative (dn) form of lymphoid enhancer factor-1 (LEF-1), the main nuclear effector of the pathway, in undifferentiated mesenchymal cells, chondrogenic cells, and primary chondrocytes, and examined the expression of markers for chondrogenic differentiation and hypertrophy. caLEF-1 and LiCl, an activator of the canonical pathway, promoted both chondrogenic differentiation and hypertrophy, whereas dnLEF-1 and the gene silencing of β-catenin suppressed LiCl-promoted effects. To investigate whether these effects were dependent on Sox9, a master regulator of cartilage development, we stimulated Sox9-deficient ES cells with the pathway. caLEF-1 and LiCl promoted both chondrogenic differentiation and hypertrophy in wild-type, but not in Sox9-deficient, cells. The response of Sox9-deficient cells was restored by the adenoviral expression of Sox9. Thus, the canonical Wnt signaling pathway promotes chondrocyte differentiation in a Sox9-dependent manner

  2. Stat3 signaling regulates embryonic stem cell fate in a dose-dependent manner

    Directory of Open Access Journals (Sweden)

    Chih-I Tai

    2014-09-01

    Full Text Available Stat3 is essential for mouse embryonic stem cell (mESC self-renewal mediated by LIF/gp130 receptor signaling. Current understanding of Stat3-mediated ESC self-renewal mechanisms is very limited, and has heretofore been dominated by the view that Stat3 signaling functions in a binary “on/off” manner. Here, in contrast to this binary viewpoint, we demonstrate a contextual, rheostat-like mechanism for Stat3's function in mESCs. Activation and expression levels determine whether Stat3 functions in a self-renewal or a differentiation role in mESCs. We also show that Stat3 induces rapid differentiation of mESCs toward the trophectoderm (TE lineage when its activation level exceeds certain thresholds. Stat3 induces this differentiation phenotype via induction of Tfap2c and its downstream target Cdx2. Our findings provide a novel concept in the realm of Stat3, self-renewal signaling, and pluripotent stem cell biology. Ultimately, this finding may facilitate the development of conditions for the establishment of authentic non-rodent ESCs.

  3. The Probiotic Lactobacillus Prevents Citrobacter rodentium-Induced Murine Colitis in a TLR2-Dependent Manner.

    Science.gov (United States)

    Ryu, Seung-Hyun; Park, Jong-Hyung; Choi, Soo-Young; Jeon, Hee-Yeon; Park, Jin-Il; Kim, Jun-Young; Ham, Seung-Hoon; Choi, Yang-Kyu

    2016-07-28

    The main objective of this study was to investigate whether Lactobacillus rhamnosus GG (LGG) ameliorated the effects of Citrobactor rodentium infection in Toll-like receptor 2 (TLR2) knockout (KO) and TLR4 KO mice, as well as in wild-type C57BL/6 (B6) mice. TLR2 KO, TLR4 KO, and B6 mice were divided into three groups per each strain. Each group had an uninfected control group (n = 5), C. rodentium-infected group (n = 8), and LGG-pretreated C. rodentium-infected group (n = 8). The survival rate of B6 mice infected with C. rodentium was higher when pretreated with LGG. Pretreatment with LGG ameliorated C. rodentium-induced mucosal hyperplasia in B6 and TLR4 KO mice. However, in C-rodentium-infected TLR2 KO mice, mucosal hyperplasia persisted, regardless of pretreatment with LGG. In addition, LGG-pretreated B6 and TLR4 KO mice showed a decrease in spleen weight and downregulation of tumor necrosis factor alpha, interferon gamma, and monocyte chemotactic protein 1 mRNA expression compared with the non-pretreated group. In contrast, such changes were not observed in TLR2 KO mice, regardless of pretreatment with LGG. From the above results, we conclude that pretreatment with LGG ameliorates C. rodentium-induced colitis in B6 and TLR4 KO mice, but not in TLR2 KO mice. Therefore, LGG protects mice from C. rodentium-induced colitis in a TLR2-dependent manner.

  4. Fesselin is a target protein for calmodulin in a calcium-dependent manner

    International Nuclear Information System (INIS)

    KoIakowski, Janusz; Wrzosek, Antoni; Dabrowska, Renata

    2004-01-01

    Fesselin is a basic protein isolated from smooth muscle which binds G-actin and accelerates its polymerization as well as cross-links assembled filaments [J. Muscle Res. Cell Motil. 20 (1999) 539; Biochemistry 40 (2001) 14252]. In this report experimental evidence is provided for the first time proving that fesselin can interact with calmodulin in a Ca 2+ -dependent manner in vitro. Using ion exchange, followed by calmodulin-affinity chromatography, enabled us to simplify and shorten the fesselin preparation procedure and increase its yield by about three times in comparison to the procedure described by Leinweber et al. [J. Muscle Res. Cell Motil. 20 (1999) 539]. Fesselin interaction with dansyl-labelled calmodulin causes a 2-fold increase in maximum fluorescence intensity of the fluorophore and a 21 nm blue shift of the spectrum. The transition of complex formation between fesselin and calmodulin occurs at submicromolar concentration of calcium ions. The dissociation constant of fesselin Ca 2+ /calmodulin complexes amounted to 10 -8 M. The results suggest the existence of a direct link between Ca 2+ /calmodulin and fesselin at the level of actin cytoskeleton dynamics in smooth muscle

  5. Comprehending non-native speakers: theory and evidence for adjustment in manner of processing.

    Science.gov (United States)

    Lev-Ari, Shiri

    2014-01-01

    Non-native speakers have lower linguistic competence than native speakers, which renders their language less reliable in conveying their intentions. We suggest that expectations of lower competence lead listeners to adapt their manner of processing when they listen to non-native speakers. We propose that listeners use cognitive resources to adjust by increasing their reliance on top-down processes and extracting less information from the language of the non-native speaker. An eye-tracking study supports our proposal by showing that when following instructions by a non-native speaker, listeners make more contextually-induced interpretations. Those with relatively high working memory also increase their reliance on context to anticipate the speaker's upcoming reference, and are less likely to notice lexical errors in the non-native speech, indicating that they take less information from the speaker's language. These results contribute to our understanding of the flexibility in language processing and have implications for interactions between native and non-native speakers.

  6. Bilirubin Modulates Acetylcholine Receptors In Rat Superior Cervical Ganglionic Neurons In a Bidirectional Manner

    Science.gov (United States)

    Zhang, Chengmi; Wang, Zhenmeng; Dong, Jing; Pan, Ruirui; Qiu, Haibo; Zhang, Jinmin; Zhang, Peng; Zheng, Jijian; Yu, Weifeng

    2014-01-01

    Autonomic dysfunction as a partial contributing factor to cardiovascular instability in jaundiced patients is often associated with increased serum bilirubin levels. Whether increased serum bilirubin levels could directly inhibit sympathetic ganglion transmission by blocking neuronal nicotinic acetylcholine receptors (nAChRs) remains to be elucidated. Conventional patch-clamp recordings were used to study the effect of bilirubin on nAChRs currents from enzymatically dissociated rat superior cervical ganglia (SCG) neurons. The results showed that low concnetrations (0.5 and 2 μM) of bilirubin enhanced the peak ACh-evoked currents, while high concentrations (3 to 5.5 µM) of bilirubin suppressed the currents with an IC50 of 4 ± 0.5 μM. In addition, bilirubin decreased the extent of desensitization of nAChRs in a concentration-dependent manner. This inhibitory effect of bilirubin on nAChRs channel currents was non-competitive and voltage independent. Bilirubin partly improved the inhibitory effect of forskolin on ACh-induced currents without affecting the action of H-89. These data suggest that the dual effects of enhancement and suppression of bilirubin on nAChR function may be ascribed to the action mechanism of positive allosteric modulation and direct blockade. Thus, suppression of sympathetic ganglionic transmission through postganglionic nAChRs inhibition may partially contribute to the adverse cardiovascular effects in jaundiced patients. PMID:25503810

  7. MCP-1 expressed by osteoclasts stimulates osteoclastogenesis in an autocrine/paracrine manner

    International Nuclear Information System (INIS)

    Miyamoto, Kana; Ninomiya, Ken; Sonoda, Koh-Hei; Miyauchi, Yoshiteru; Hoshi, Hiroko; Iwasaki, Ryotaro; Miyamoto, Hiroya

    2009-01-01

    Monocyte chemoattractant protein-1 (MCP-1) is a chemokine that plays a critical role in the recruitment and activation of leukocytes. Here, we describe that multinuclear osteoclast formation was significantly inhibited in cells derived from MCP-1-deficient mice. MCP-1 has been implicated in the regulation of osteoclast cell-cell fusion; however defects of multinuclear osteoclast formation in the cells from mice deficient in DC-STAMP, a seven transmembrane receptor essential for osteoclast cell-cell fusion, was not rescued by recombinant MCP-1. The lack of MCP-1 in osteoclasts resulted in a down-regulation of DC-STAMP, NFATc1, and cathepsin K, all of which were highly expressed in normal osteoclasts, suggesting that osteoclast differentiation was inhibited in MCP-1-deficient cells. MCP-1 alone did not induce osteoclastogenesis, however, the inhibition of osteoclastogenesis in MCP-1-deficient cells was restored by addition of recombinant MCP-1, indicating that osteoclastogenesis was regulated in an autocrine/paracrine manner by MCP-1 under the stimulation of RANKL in osteoclasts.

  8. Paternal engagement during childbirth depending on the manner of their preparation.

    Science.gov (United States)

    Sioma-Markowska, Urszula; Poręba, Ryszard; Machura, Mariola; Skrzypulec-Plinta, Violetta

    2016-01-01

    The analysis of the forms of paternal activity depending on the manner of their preparation, including stages of labor. A prospective survey-based study involved 250 fathers who participated in their child's birth. The fathers included in the study were present during all stages of family-assisted natural labor. The study was conducted one day after childbirth with the use of a survey prepared by the authors. Statistical calculations were conducted using the Statistica PL software. The frequency of individual qualitative features (non-measurable) was assessed by means of a non-parametric χ² (chi-squared) test. The statistical significance level was p fathers included in the study (52.4%) participated in childbirth with no prior preparation. The dominant form of preparation involved self-education from books, magazines and the Internet (24%). 23.6% of fathers participated in ante-natal classes. The study demonstrated that fathers prepared for childbirth in ante-natal classes more often engaged in the supportive role, provided nursing care and carried out instrumental monitoring during each stage of childbirth. The fathers prepared for childbirth in ante-natal classes more often engage in the supportive role, provide nursing care and carry out instrumental control during each stage of childbirth. Ante-natal classes should be promoted as an optimal form of preparation for active participation in childbirth. Moreover, other forms of paternal ante-natal education as well as continued education in a delivery room should be developed.

  9. Unacknowledged threats proffered "in a manner of speaking": recognizing workplace bullying as shaming.

    Science.gov (United States)

    Dzurec, Laura Cox; Kennison, Monica; Albataineh, Raya

    2014-07-01

    The purpose of this study was to examine workplace bullying victims' perceptions of what they heard their bully counterparts say through their use of prosody. From a sampling frame of 89 manuscripts referenced in the authors' previous studies, we identified a subset (n = 10) that included quotes regarding bullying victims' perceptions of communication experiences with their bully perpetrators. We used hermeneutics and a recursive metasynthesis to interpret quotes embedded in the manuscripts chosen for this study. Two-thirds of language is expressed nonverbally through prosody or "manner of speaking"-rhythm, stress, intonation, and vocabulary choice. We found that as bullies communicated with their intended victims over time, they used prosody across subtle, linked communications, or boldly and openly in public venues, to establish a context-embedded, one-way communication process of "doublespeak." Bullies' confusing prosodic communication processes served to recontexualize victims' situations and, through mechanisms largely unacknowledged by the victims, to subtly demean their personhood, and to shame them and render them voiceless. This study directs formal attention to the language of workplace bullying. Further study might strengthen opportunities to effectively address and curtail the long-term personal, professional, and organizational injuries deriving from workplace bullying. © 2014 Sigma Theta Tau International.

  10. Nuclear size is sensitive to NTF2 protein levels in a manner dependent on Ran binding

    Science.gov (United States)

    Vuković, Lidija D.; Jevtić, Predrag; Zhang, Zhaojie; Stohr, Bradley A.; Levy, Daniel L.

    2016-01-01

    ABSTRACT Altered nuclear size is associated with many cancers, and determining whether cancer-associated changes in nuclear size contribute to carcinogenesis necessitates an understanding of mechanisms of nuclear size regulation. Although nuclear import rates generally positively correlate with nuclear size, NTF2 levels negatively affect nuclear size, despite the role of NTF2 (also known as NUTF2) in nuclear recycling of the import factor Ran. We show that binding of Ran to NTF2 is required for NTF2 to inhibit nuclear expansion and import of large cargo molecules in Xenopus laevis egg and embryo extracts, consistent with our observation that NTF2 reduces the diameter of the nuclear pore complex (NPC) in a Ran-binding-dependent manner. Furthermore, we demonstrate that ectopic NTF2 expression in Xenopus embryos and mammalian tissue culture cells alters nuclear size. Finally, we show that increases in nuclear size during melanoma progression correlate with reduced NTF2 expression, and increasing NTF2 levels in melanoma cells is sufficient to reduce nuclear size. These results show a conserved capacity for NTF2 to impact on nuclear size, and we propose that NTF2 might be a new cancer biomarker. PMID:26823604

  11. Integration of generic issues

    International Nuclear Information System (INIS)

    Thatcher, D.

    1989-01-01

    The NRC has recognized the need to integrate generic issues (GIs). The GI process includes a number of phases, all of which should recognize the potential for overlap and conflict among related issues. In addition to the issues themselves, other related NRC and industry programs and activities need to be factored into the GI process. Integration has taken place, or is taking place, for a number of GIs. Each case of integration involves a specific set of circumstances and, as a result, the way in which integration proceeds can vary. This paper discusses the integration of issues in the generic issue process and provides a number of examples

  12. Report: EPA Needs Policies and Procedures to Manage Public Pesticide Petitions in a Transparent and Efficient Manner

    Science.gov (United States)

    Report #16-P-0019, October 27, 2015. OPP’s lack of policies and procedures to manage public pesticide petitions in a transparent and efficient manner can result in unreasonable delay lawsuits costing the agency time and resources.

  13. Probe specificity

    International Nuclear Information System (INIS)

    Laget, J.M.

    1986-11-01

    Specificity and complementarity of hadron and electron probes must be systematically developed to answer three questions currently asked in intermediate energy nuclear physics: what is nucleus structure at short distances, what is nature of short range correlations, what is three body force nature [fr

  14. Spent nuclear fuel project integrated schedule plan

    International Nuclear Information System (INIS)

    Squires, K.G.

    1995-01-01

    The Spent Nuclear Fuel Integrated Schedule Plan establishes the organizational responsibilities, rules for developing, maintain and status of the SNF integrated schedule, and an implementation plan for the integrated schedule. The mission of the SNFP on the Hanford site is to provide safe, economic, environmentally sound management of Hanford SNF in a manner which stages it to final disposition. This particularly involves K Basin fuel

  15. Spent nuclear fuel project integrated schedule plan

    Energy Technology Data Exchange (ETDEWEB)

    Squires, K.G.

    1995-03-06

    The Spent Nuclear Fuel Integrated Schedule Plan establishes the organizational responsibilities, rules for developing, maintain and status of the SNF integrated schedule, and an implementation plan for the integrated schedule. The mission of the SNFP on the Hanford site is to provide safe, economic, environmentally sound management of Hanford SNF in a manner which stages it to final disposition. This particularly involves K Basin fuel.

  16. CCL22-specific T Cells

    DEFF Research Database (Denmark)

    Martinenaite, Evelina; Munir Ahmad, Shamaila; Hansen, Morten

    2016-01-01

    Tumor cells and tumor-infiltrating macrophages produce the chemokine CCL22, which attracts regulatory T cells (Tregs) into the tumor microenvironment, decreasing anticancer immunity. Here, we investigated the possibility of targeting CCL22-expressing cells by activating specific T cells. We...... analyzed the CCL22 protein signal sequence, identifying a human leukocyte antigen A2- (HLA-A2-) restricted peptide epitope, which we then used to stimulate peripheral blood mononuclear cells (PMBCs) to expand populations of CCL22-specific T cells in vitro. T cells recognizing an epitope derived from...... the signal-peptide of CCL22 will recognize CCL22-expressing cells even though CCL22 is secreted out of the cell. CCL22-specific T cells recognized and killed CCL22-expressing cancer cells. Furthermore, CCL22-specific T cells lysed acute monocytic leukemia cells in a CCL22 expression-dependent manner. Using...

  17. Retroviral integration: Site matters

    Science.gov (United States)

    Demeulemeester, Jonas; De Rijck, Jan

    2015-01-01

    Here, we review genomic target site selection during retroviral integration as a multistep process in which specific biases are introduced at each level. The first asymmetries are introduced when the virus takes a specific route into the nucleus. Next, by co‐opting distinct host cofactors, the integration machinery is guided to particular chromatin contexts. As the viral integrase captures a local target nucleosome, specific contacts introduce fine‐grained biases in the integration site distribution. In vivo, the established population of proviruses is subject to both positive and negative selection, thereby continuously reshaping the integration site distribution. By affecting stochastic proviral expression as well as the mutagenic potential of the virus, integration site choice may be an inherent part of the evolutionary strategies used by different retroviruses to maximise reproductive success. PMID:26293289

  18. Immobilization of immunoglobulin G in a highly oriented manner on a protein-A terminated multilayer system

    Energy Technology Data Exchange (ETDEWEB)

    Zengin, Adem [Department of Chemistry, Faculty of Art and Science, Gazi University, 06500 Besevler, Ankara (Turkey); Caykara, Tuncer, E-mail: caykara@gazi.edu.tr [Department of Chemistry, Faculty of Art and Science, Gazi University, 06500 Besevler, Ankara (Turkey)

    2011-01-01

    In this study, we have fabricated a multilayer system consisting of 3-glycidoxypropyldimethylmethoxysilane (GPDS), poly(dimethylsiloxane) bis 3-aminopropyl terminated (PDMS) and protein-A on a silicon wafer surface for oriented immobilization of immunoglobilin G (IgG). The multilayer system with a different component in each layer was characterized by ellipsometry, contact-angle goniometer, X-ray photoelectron spectroscopy (XPS) and atomic force microscopy (AFM) and fluorescence microscopy. The epoxy-terminated monolayer was formed by the chemisorption of GPDS molecules on the hydroxylated silicon surface. The PDMS film about 4.5 nm thick was produced on the GPDS-monolayer by the chemical reaction between the amine groups at the end of PDMS chain and the epoxy groups of GPDS molecules. By introducing the PDMS chains, the hydrophilic character of GPDS-monolayer decreased. Study of the time dependence of polymer grafting showed that the chemisorption of GPDS is fast, whereas at least 16 h is needed to generate the homogeneous PDMS layer. For immobilization of IgG molecules in a highly oriented manner, protein-A molecules were first chemically bound to an ultrathin ({approx}4.5 nm) PDMS reactive polymer layer and later used to capture IgG. It was shown that the existence of protein-A in the multilayer system has a strong influence on the binding properties of IgG not only in the efficiency of binding, but also in its specificity. In conclusion, the multilayer system with protein-A has the potential to be further developed into an efficient immunoassay protein chip.

  19. GTP depletion synergizes the anti-proliferative activity of chemotherapeutic agents in a cell type-dependent manner

    International Nuclear Information System (INIS)

    Lin, Tao; Meng, Lingjun; Tsai, Robert Y.L.

    2011-01-01

    Highlights: → Strong synergy between mycophenolic acid (MPA) and 5-FU in MDA-MB-231 cells. → Cell type-dependent synergy between MPA and anti-proliferative agents. → The synergy of MPA on 5-FU is recapitulated by RNA polymerase-I inhibition. → The synergy of MPA on 5-FU requires the expression of nucleostemin. -- Abstract: Mycophenolic acid (MPA) depletes intracellular GTP by blocking de novo guanine nucleotide synthesis. GTP is used ubiquitously for DNA/RNA synthesis and as a signaling molecule. Here, we made a surprising discovery that the anti-proliferative activity of MPA acts synergistically with specific chemotherapeutic agents in a cell type-dependent manner. In MDA-MB-231 cells, MPA shows an extremely potent synergy with 5-FU but not with doxorubicin or etoposide. The synergy between 5-FU and MPA works most effectively against the highly tumorigenic mammary tumor cells compared to the less tumorigenic ones, and does not work in the non-breast cancer cell types that we tested, with the exception of PC3 cells. On the contrary, MPA shows the highest synergy with paclitaxel but not with 5-FU in SCC-25 cells, derived from oral squamous cell carcinomas. Mechanistically, the synergistic effect of MPA on 5-FU in MDA-MB-231 cells can be recapitulated by inhibiting the RNA polymerase-I activity and requires the expression of nucleostemin. This work reveals that the synergy between MPA and anti-proliferative agents is determined by cell type-dependent factors.

  20. UV-induced nuclear import of XPA is mediated by importin-α4 in an ATR-dependent manner.

    Directory of Open Access Journals (Sweden)

    Zhengke Li

    Full Text Available Xeroderma pigmentosum Group A (XPA is a crucial factor in mammalian nucleotide excision repair (NER and nuclear import of XPA from the cytoplasm for NER is regulated in cellular DNA damage responses in S-phase. In this study, experiments were carried out to determine the transport mechanisms that are responsible for the UV (ultraviolet-induced nuclear import of XPA. We found that, in addition to the nuclear localization signal (NLS of XPA, importin-α4 or/and importin-α7 are required for the XPA nuclear import. Further investigation indicated that, importin-α4 and importin-α7 directly interacted with XPA in cells. Interestingly, the binding of importin-α4 to XPA was dependent on UV-irradiation, while the binding of importin-α7 was not, suggesting a role for importin-α7 in nuclear translocation of XPA in the absence of DNA damage, perhaps with specificity to certain non-S-phases of the cell-cycle. Consistent with the previous report of a dependence of UV-induced XPA nuclear import on ataxia telangiectasia and Rad3-related protein (ATR in S-phase, knockdown of ATR reduced the amount of XPA interacting with importin-α4. In contrast, the GTPase XPA binding protein 1 (XAB1, previously proposed to be required for XPA nuclear import, showed no effect on the nuclear import of XPA in our siRNA knockdown analysis. In conclusion, our results suggest that upon DNA damage transport adaptor importin-α4 imports XPA into the nucleus in an ATR-dependent manner, while XAB1 has no role in this process. In addition, these findings reveal a potential new therapeutic target for the sensitization of cancer cells to chemotherapy.

  1. Proliferation marker pKi-67 affects the cell cycle in a self-regulated manner.

    Science.gov (United States)

    Schmidt, Mirko H H; Broll, Rainer; Bruch, Hans-Peter; Duchrow, Michael

    2002-01-01

    The proliferation marker pKi-67 is commonly used in research and pathology to detect proliferating cells. In a previous work, we found the protein to be associated with regulators of the cell cycle, controlling S-phase progression, as well as entry into and exit from mitosis. Here we investigate whether pKi-67 has a regulative effect on the cell cycle itself. For that purpose we cloned four fragments of pKi-67, together representing nearly the whole protein, and an N-terminal pKi-67 antisense oligonucleotide into a tetracycline inducible gene expression system. The sense fragments were C-terminally modified by addition of either a nuclear localization sequence (NLS) or a STOP codon to address the impact of their intracellular distribution. FACS based cell cycle analysis revealed that expression of nearly all pKi-67 domains and the antisense oligonucleotide led to a decreased amount of cells in S-phase and an increased number of cells in G(2)/M- and G(1)-phase. Subsequent analysis of the endogenous pKi-67 mRNA and protein levels revealed that the constructs with the most significant impact on the cell cycle were able to silence pKi-67 transcription as well. We conclude from the data that pKi-67 influences progression of S-phase and mitosis in a self-regulated manner and, therefore, effects the cell cycle checkpoints within both phases. Furthermore, we found pKi-67 mediates an anti-apoptotic effect on the cell and we verified that this marker, although it is a potential ribosomal catalyst, is not expressed in differentiated tissues with a high transcriptional activity. Copyright 2002 Wiley-Liss, Inc.

  2. Isoproterenol Increases RANKL Expression in a ATF4/NFATc1-Dependent Manner in Mouse Osteoblastic Cells

    Directory of Open Access Journals (Sweden)

    Kyunghwa Baek

    2017-10-01

    Full Text Available Sympathetic nervous system stimulation-induced β-adrenergic signal transduction is known to induce bone loss and increase of osteoclast activity. Although isoproterenol, a nonspecific β-adrenergic receptor agonist, has been shown to increase receptor activator of NF-κB ligand (RANKL, the details of the regulatory mechanisms remain unclear. In the present study, we investigated the role of the nuclear factor of activated T-cells (NFAT in isoproterenol-induced RANKL expression in C2C12 and in primary cultured mouse calvarial cells. Isoproterenol increased nuclear factor of activated T-cells cytoplasmic 1 (NFATc1 and RANKL expressions at both mRNA and protein levels and increased NFAT reporter activity. NFATc1 knockdown blocked isoproterenol-mediated RANKL expression. Isoproterenol also promoted cAMP response element-binding protein 1 (CREB1 and activating transcription factor 4 (ATF4 phosphorylation. Isoproterenol-mediated transcriptional activation of NFAT was blocked by protein kinase A (PKA inhibitor H89. Isoproterenol-induced CREB1, ATF4, NFATc1, and RANKL expressions were suppressed by H89. Mutations in cAMP response element-like or NFAT-binding element suppressed isoproterenol-induced RANKL promoter activity. Chromatin immunoprecipitation analysis demonstrated that isoproterenol increased NFAT-binding and ATF4-binding activities on the mouse RANKL promoter, but did not increase CREB1-binding activity. Association of NFATc1 and ATF4 was not observed in a co-immunoprecipitation study. ATF4 knockdown suppressed isoproterenol-induced NFAT binding to the RANKL promoter, whereas NFATc1 knockdown did not suppress isoproterenol-induced ATF4 binding to the RANKL promoter. ATF4 knockdown suppressed isoproterenol-induced expressions of NFATc1 and RANKL. These results suggest that isoproterenol increases RANKL expression in an ATF4/NFATc1-dependent manner.

  3. Relationship between the Manner of Mobile Phone Use and Depression, Anxiety, and Stress in University Students.

    Science.gov (United States)

    Višnjić, Aleksandar; Veličković, Vladica; Sokolović, Dušan; Stanković, Miodrag; Mijatović, Kristijan; Stojanović, Miodrag; Milošević, Zoran; Radulović, Olivera

    2018-04-08

    Objectives : There is insufficient evidence regarding the potential risk of mobile phone use on mental health. Therefore, the aim of this research was to examine the relationship between mobile phone use and mental health by measuring the levels of depression, anxiety, and stress among university students in Serbia and Italy. Methods : This cross-sectional study was carried out at two distinguished universities in Serbia and Italy from March to May of the 2015/2016 academic year and included 785 students of both genders. The questionnaire was compiled and developed from different published sources regarding the manner and intensity of mobile phone use, along with the Depression Anxiety Stress Scale (DASS 42) for measuring psychological health. The statistical analysis of the data included the application of binary logistic regression and correlation tests. Results: Statistical analysis indicates that anxiety symptoms are somewhat more present in younger students (odds ratio (OR) = 0.86, 95% confidence interval (CI): 0.76-0.96), in those who send more text messages SMSs (OR = 1.15, 95% CI: 1.11-1.31), and in those who browse the internet less frequently (OR = 0.84, 95% CI: 0.73-0.95). Stress is more common in students who make fewer calls a day (OR = 0.79, 95% CI: 0.64-0.97), as well in those who spend more time talking on the mobile phone per day (OR = 1.28, 95% CI: 1.12-1.56). The strongest predictor of high stress levels was keeping the mobile phone less than 1 m away during sleeping (OR = 1.48, 95% CI: 1.12-2.08). Conclusions: The results indicated that the intensity and modality of mobile phone use could be a factor that can influence causal pathways leading to mental health problems in the university student population.

  4. Adiponectin influences progesterone production from MA-10 Leydig cells in a dose-dependent manner.

    Science.gov (United States)

    Landry, David; Paré, Aurélie; Jean, Stéphanie; Martin, Luc J

    2015-04-01

    Obesity in men is associated with lower testosterone levels, related to reduced sperm concentration and the development of various diseases with aging. Hormones produced by the adipose tissue may have influences on both metabolism and reproductive function. Among them, the production and secretion of adiponectin is inversely correlated to total body fat. Adiponectin receptors (AdipoR1 and AdipoR2) have been found to be expressed in testicular Leydig cells (producing testosterone). Since StAR and Cyp11a1 are essential for testosterone synthesis and adiponectin has been shown to regulate StAR mRNA in swine granulosa cells, we hypothesized that adiponectin might also regulate these genes in Leydig cells. Our objective was to determine whether adiponectin regulates StAR and Cyp11a1 genes in Leydig cells and to better define its mechanisms of action. Methods used in the current study are qPCR for the mRNA levels, transfections for promoter activities, and enzyme-linked immunosorbent assay for the progesterone concentration. We have found that adiponectin cooperates with cAMP-dependent stimulation to activate StAR and Cyp11a1 mRNA expressions in a dose-dependent manner in MA-10 Leydig cells as demonstrated by transfection of a luciferase reporter plasmid. These results led to a significant increase in progesterone production from MA-10 cells. Thus, our data suggest that high doses of adiponectin typical of normal body weight may promote testosterone production from Leydig cells.

  5. A time-dependent degeneration manner of condyle in rat CFA-induced inflamed TMJ.

    Science.gov (United States)

    Xu, Liqin; Guo, Huilin; Li, Cheng; Xu, Jie; Fang, Wei; Long, Xing

    2016-01-01

    Temporomandibular joint (TMJ) inflammation is a potential risk factor of osteoarthritis (OA) but the detailed degenerative changes in the inflamed TMJ remain unclear. In this study, we evaluated the changes of condylar cartilage and subchondral bone in rat inflamed TMJ induced by Freund's complete adjuvant (CFA). Articular cavity was injected with CFA and the TMJ samples were collected 1, 2, 3, and 4-week post-injection. Hematoxylin & Eosin (H&E) staining, toluidine blue (TB) staining, Safranin O (S.O) staining, Masson trichrome staining and micro-CT were used to assess TMJ degeneration during inflammation. Osteoclast and osteoblast activities were analyzed by tartrate-resistant acid phosphatase (TRAP) staining and osteocalcin (OCN) immunohistochemistry staining respectively. The expression of receptor activator of NF-kB ligand (RANKL) and osteoprotegerin (OPG) in condylar cartilage and subchondral bone was also evaluated through immunohistochemistry and RANKL/OPG ratio was evaluated. Reduced cartilage thickness, decreased number of chondrocytes, and down-regulated proteoglycan expression were observed in the condylar cartilage in the inflamed TMJ. Enhanced osteoclast activity, and expanded bone marrow cavity were reached the peak in the 2-week after CFA-injection. Meanwhile the RANKL/OPG ratio in the cartilage and subchondral bone also increased in the 2-week CFA-injection. Immature, unmineralized new bones with irregular trabecular bone structure, atypical condylar shape, up-regulated OCN expression, and decreased bone mineral density (BMD) were found in the inflamed TMJ. The time-dependent degeneration manner of TMJ cartilage and subchondral bone was found in CFA-induced arthritis rat model. The degeneration in the TMJ with inflammation might be a risk factor and should be concerned.

  6. Relationship between the Manner of Mobile Phone Use and Depression, Anxiety, and Stress in University Students

    Science.gov (United States)

    Višnjić, Aleksandar; Veličković, Vladica; Sokolović, Dušan; Stanković, Miodrag; Stojanović, Miodrag; Milošević, Zoran; Radulović, Olivera

    2018-01-01

    Objectives: There is insufficient evidence regarding the potential risk of mobile phone use on mental health. Therefore, the aim of this research was to examine the relationship between mobile phone use and mental health by measuring the levels of depression, anxiety, and stress among university students in Serbia and Italy. Methods: This cross-sectional study was carried out at two distinguished universities in Serbia and Italy from March to May of the 2015/2016 academic year and included 785 students of both genders. The questionnaire was compiled and developed from different published sources regarding the manner and intensity of mobile phone use, along with the Depression Anxiety Stress Scale (DASS 42) for measuring psychological health. The statistical analysis of the data included the application of binary logistic regression and correlation tests. Results: Statistical analysis indicates that anxiety symptoms are somewhat more present in younger students (odds ratio (OR) = 0.86, 95% confidence interval (CI): 0.76–0.96), in those who send more text messages (SMSs) (OR = 1.15, 95% CI: 1.11–1.31), and in those who browse the internet less frequently (OR = 0.84, 95% CI: 0.73–0.95). Stress is more common in students who make fewer calls a day (OR = 0.79, 95% CI: 0.64–0.97), as well in those who spend more time talking on the mobile phone per day (OR = 1.28, 95% CI: 1.12–1.56). The strongest predictor of high stress levels was keeping the mobile phone less than 1 m away during sleeping (OR = 1.48, 95% CI: 1.12–2.08). Conclusions: The results indicated that the intensity and modality of mobile phone use could be a factor that can influence causal pathways leading to mental health problems in the university student population. PMID:29642471

  7. Metformin decreases lung cancer risk in diabetic patients in a dose-dependent manner.

    Science.gov (United States)

    Tsai, Ming-Ju; Yang, Chih-Jen; Kung, Ya-Ting; Sheu, Chau-Chyun; Shen, Yu-Ting; Chang, Pi-Yu; Huang, Ming-Shyan; Chiu, Herng-Chia

    2014-11-01

    Higher risk of lung cancer has been noted in patients with type 2 diabetes mellitus (DM). Some observational studies have shown a reduced risk of lung cancer in DM patients taking metformin, but a dose-response relationship has never been reported. The aim of this study is to exam the association between the dose of metformin and the incidence of lung cancer in a Chinese population. The dataset used for this nationwide population-based study is a cohort of 1 million subjects randomly sampled from individuals enrolled in the Taiwan National Health Insurance system. We enrolled all subjects with newly diagnosed type 2 DM between 1997 and 2007. Subjects with a diagnosis of neoplasm before DM diagnosis, those using metformin before DM diagnosis, those with polycystic ovary syndrome, and those with a DM diagnosis before their 15 years of age were excluded. The demographic data and duration, cumulative dose and intensity of metformin use were compared between patients developing lung cancer and those without lung cancer. Totally, 47,356 subjects were identified. After adjusting for age, gender, and modified Charlson Comorbidity Index score, the utilization of metformin was an independent protecting factor, and the risk of developing lung cancer decreased progressively with either the higher cumulative dose or the higher intensity of metformin use. This study revealed that the use of metformin decreased the risk of lung cancer in a dose-dependent manner in patients with type 2 DM. The chemo-preventive effect of metformin deserves further study. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  8. Listeria monocytogenes alters mast cell phenotype, mediator and osteopontin secretion in a listeriolysin-dependent manner.

    Directory of Open Access Journals (Sweden)

    Catherine E Jobbings

    Full Text Available Whilst mast cells participate in the immune defence against the intracellular bacterium Listeria monocytogenes, there is conflicting evidence regarding the ability of L. monocytogenes to infect mast cells. It is known that the pore-forming toxin listeriolysin (LLO is important for mast cell activation, degranulation and the release of pro-inflammatory cytokines. Mast cells, however, are a potential source of a wide range of cytokines, chemokines and other mediators including osteopontin, which contributes to the clearing of L. monocytogenes infections in vivo, although its source is unknown. We therefore aimed to resolve the controversy of mast cell infection by L. monocytogenes and investigated the extent of mediator release in response to the bacterium. In this paper we show that the infection of bone marrow-derived mast cells by L. monocytogenes is inefficient and LLO-independent. LLO, however, is required for calcium-independent mast cell degranulation as well as for the transient and selective downregulation of cell surface CD117 (c-kit on mast cells. We demonstrate that in addition to the key pro-inflammatory cytokines TNF-α and IL-6, mast cells release a wide range of other mediators in response to L. monocytogenes. Osteopontin, IL-2, IL-4, IL-13 and granulocyte macrophage colony-stimulating factor (GM-CSF, and chemokines including CCL2, CCL3, CCL4 and CCL5 are released in a MyD88-dependent manner. The wide range of mediators released by mast cells in response to L. monocytogenes may play an important role in the recruitment and activation of a variety of immune cells in vivo. The cocktail of mediators, however, is unlikely to skew the immune response to a particular effector response. We propose that mast cells provide a hitherto unreported source of osteopontin, and may provide an important role in co-ordinating the immune response during Listeria infection.

  9. Neuron-astrocyte interaction enhance GABAergic synaptic transmission in a manner dependent on key metabolic enzymes.

    Directory of Open Access Journals (Sweden)

    Przemysław eKaczor

    2015-04-01

    Full Text Available GABA is the major inhibitory neurotransmitter in the adult brain and mechanisms of GABAergic inhibition have been intensely investigated in the past decades. Recent studies provided evidence for an important role of astrocytes in shaping GABAergic currents. One of the most obvious, but yet poorly understood, mechanisms of the cross-talk between GABAergic currents and astrocytes is metabolism including neurotransmitter homeostasis. In particular, how modulation of GABAergic currents by astrocytes depends on key enzymes involved in cellular metabolism remains largely unknown. To address this issue, we have considered two simple models of neuronal cultures: nominally astrocyte-free neuronal culture (NC and neuronal-astrocytic co-cultures (ANCC and miniature Inhibitory Postsynaptic Currents (mIPSCs were recorded in control conditions and in the presence of respective enzyme blockers. We report that enrichment of neuronal culture with astrocytes results in a marked increase in mIPSC frequency. This enhancement of GABAergic activity was accompanied by increased number of GAD65 and vGAT puncta, indicating that at least a part of the frequency enhancement was due to increased number of synaptic contacts. Inhibition of glutamine synthetase (with MSO strongly reduced mIPSC frequency in ANCC but had no effect in NC. Moreover, treatment of ANCC with inhibitor of glycogen phosphorylase (BAYU6751 or with selective inhibitor of astrocytic Krebs cycle,fluoroacetate, resulted in a marked reduction of mIPSC frequency in ANCC having no effect in NC. We conclude that GABAergic synaptic transmission strongly depends on neuron-astrocyte interaction in a manner dependent on key metabolic enzymes as well as on the Krebs cycle.

  10. Information Systems Integration and Enterprise Application Integration (EAI) Adoption: A Case from Financial Services

    Science.gov (United States)

    Lam, Wing

    2007-01-01

    Increasingly, organizations find that they need to integrate large number of information systems in order to support enterprise-wide business initiatives such as e-business, supply chain management and customer relationship management. To date, organizations have largely tended to address information systems (IS) integration in an ad-hoc manner.…

  11. Integrated system for seismic evaluations

    International Nuclear Information System (INIS)

    Xu, J.; Philippacopoulos, A.J.; Miller, C.A.; Costantino, C.J.; Graves, H.

    1989-01-01

    This paper describes the various features of the Seismic Module of the CARES system (Computer Analysis for Rapid Evaluation of Structures). This system was developed by Brookhaven National Laboratory (BNL) for the US Nuclear Regulatory Commission to perform rapid evaluations of structural behavior and capability of nuclear power plant facilities. The CARES is structured in a modular format. Each module performs a specific type of analysis i.e., static or dynamic, linear or nonlinear, etc. This paper describes the features of the Seismic Module in particular. The development of the Seismic Module of the CARES system is based on an approach which incorporates all major aspects of seismic analysis currently employed by the industry into an integrated system that allows for carrying out interactively computations of structural response to seismic motions. The code operates on a PC computer system and has multi-graphics capabilities. It has been designed with user friendly features and it allows for interactive manipulation of various analysis phases during the seismic design process. The capabilities of the seismic module include (a) generation of artificial time histories compatible with given design ground response spectra, (b) development of Power Spectral Density (PSD) functions associated with the seismic input, (c) deconvolution analysis using vertically propagating shear waves through a given soil profile, and (d) development of in-structure response spectra or corresponding PSD's. It should be pointed out that these types of analyses can also be performed individually by using available computer codes such as FLUSH, SAP, etc. The uniqueness of the CARES, however, lies on its ability to perform all required phases of the seismic analysis in an integrated manner. 5 refs., 6 figs

  12. Disease specific protein corona

    Science.gov (United States)

    Rahman, M.; Mahmoudi, M.

    2015-03-01

    It is now well accepted that upon their entrance into the biological environments, the surface of nanomaterials would be covered by various biomacromolecules (e.g., proteins and lipids). The absorption of these biomolecules, so called `protein corona', onto the surface of (nano)biomaterials confers them a new `biological identity'. Although the formation of protein coronas on the surface of nanoparticles has been widely investigated, there are few reports on the effect of various diseases on the biological identity of nanoparticles. As the type of diseases may tremendously changes the composition of the protein source (e.g., human plasma/serum), one can expect that amount and composition of associated proteins in the corona composition may be varied, in disease type manner. Here, we show that corona coated silica and polystyrene nanoparticles (after interaction with in the plasma of the healthy individuals) could induce unfolding of fibrinogen, which promotes release of the inflammatory cytokines. However, no considerable releases of inflammatory cytokines were observed for corona coated graphene sheets. In contrast, the obtained corona coated silica and polystyrene nanoparticles from the hypofibrinogenemia patients could not induce inflammatory cytokine release where graphene sheets do. Therefore, one can expect that disease-specific protein coronas can provide a novel approach for applying nanomedicine to personalized medicine, improving diagnosis and treatment of different diseases tailored to the specific conditions and circumstances.

  13. APPLICATION OF BOUNDARY INTEGRAL EQUATION METHOD FOR THERMOELASTICITY PROBLEMS

    Directory of Open Access Journals (Sweden)

    Vorona Yu.V.

    2015-12-01

    Full Text Available Boundary Integral Equation Method is used for solving analytically the problems of coupled thermoelastic spherical wave propagation. The resulting mathematical expressions coincide with the solutions obtained in a conventional manner.

  14. An integrated stewardship model : Antimicrobial, infection prevention and diagnostic (AID)

    NARCIS (Netherlands)

    Dik, Jan-Willem H.; Poelman, Randy; Friedrich, Alexander W.; Panday, Prashant Nannan; Lo-Ten-Foe, Jerome R.; van Assen, Sander; van Gemert-Pijnen, Julia E. W. C.; Niesters, Hubert G. M.; Hendrix, Ron; Sinha, Bhanu

    2016-01-01

    Considering the threat of antimicrobial resistance and the difficulties it entails in treating infections, it is necessary to cross borders and approach infection management in an integrated, multidisciplinary manner. We propose the antimicrobial, infection prevention and diagnostic stewardship

  15. An integrated stewardship model: antimicrobial, infection prevention and diagnostic (AID)

    NARCIS (Netherlands)

    Dik, Jan-Willem H.; Poelman, Randy; Friedrich, Alexander W.; Panday, Prashant N.; Lo-Ten-Foe, Jerome R.; van Assen, Sander; van Gemert-Pijnen, Julia E.W.C.; Niesters, Hubert G.M.; Hendrix, Ron; Sinha, Bhanu

    2015-01-01

    Considering the threat of antimicrobial resistance and the difficulties it entails in treating infections, it is necessary to cross borders and approach infection management in an integrated, multidisciplinary manner. We propose the antimicrobial, infection prevention and diagnostic stewardship

  16. Magnesium sulfate differentially modulates fetal membrane inflammation in a time-dependent manner.

    Science.gov (United States)

    Cross, Sarah N; Nelson, Rachel A; Potter, Julie A; Norwitz, Errol R; Abrahams, Vikki M

    2018-04-30

    Chorioamnionitis and infection-associated inflammation are major causes of preterm birth. Magnesium sulfate (MgSO 4 ) is widely used in obstetrics as a tocolytic; however, its mechanism of action is unclear. This study sought to investigate how MgSO 4 modulates infection-associated inflammation in fetal membranes (FMs), and whether the response was time dependent. Human FM explants were treated with or without bacterial lipopolysaccharide (LPS); with or without MgSO 4 added either: 1 hour before LPS; at the same time as LPS; 1 hour post-LPS; or 2 hours post-LPS. Explants were also treated with or without viral dsRNA and LPS, alone or in combination; and MgSO 4 added 1 hour post-LPS After 24 hours, supernatants were measured for cytokines/chemokines; and tissue lysates measured for caspase-1 activity. Lipopolysaccharide-induced FM inflammation by upregulating the secretion of a number of inflammatory cytokines/chemokines. Magnesium sulfate administered 1-hour post-LPS inhibited FM secretion of IL-1β, IL-6, G-CSF, RANTES, and TNFα. Magnesium sulfate administered 2 hours post-LPS augmented FM secretion of these factors as well as IL-8, IFNγ, VEGF, GROα and IP-10. Magnesium sulfate delivered 1- hour post-LPS inhibited LPS-induced caspase-1 activity, and inhibited the augmented IL-1β response triggered by combination viral dsRNA and LPS. Magnesium sulfate differentially modulates LPS-induced FM inflammation in a time-dependent manner, in part through its modulation of caspase-1 activity. Thus, the timing of MgSO 4 administration may be critical in optimizing its anti-inflammatory effects in the clinical setting. MgSO 4 might also be useful at preventing FM inflammation triggered by a polymicrobial viral-bacterial infection. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. GestuRe and ACtion Exemplar (GRACE) video database: stimuli for research on manners of human locomotion and iconic gestures.

    Science.gov (United States)

    Aussems, Suzanne; Kwok, Natasha; Kita, Sotaro

    2018-06-01

    Human locomotion is a fundamental class of events, and manners of locomotion (e.g., how the limbs are used to achieve a change of location) are commonly encoded in language and gesture. To our knowledge, there is no openly accessible database containing normed human locomotion stimuli. Therefore, we introduce the GestuRe and ACtion Exemplar (GRACE) video database, which contains 676 videos of actors performing novel manners of human locomotion (i.e., moving from one location to another in an unusual manner) and videos of a female actor producing iconic gestures that represent these actions. The usefulness of the database was demonstrated across four norming experiments. First, our database contains clear matches and mismatches between iconic gesture videos and action videos. Second, the male actors and female actors whose action videos matched the gestures in the best possible way, perform the same actions in very similar manners and different actions in highly distinct manners. Third, all the actions in the database are distinct from each other. Fourth, adult native English speakers were unable to describe the 26 different actions concisely, indicating that the actions are unusual. This normed stimuli set is useful for experimental psychologists working in the language, gesture, visual perception, categorization, memory, and other related domains.

  18. Buried waste integrated demonstration technology integration process

    International Nuclear Information System (INIS)

    Ferguson, J.S.; Ferguson, J.E.

    1992-04-01

    A Technology integration Process was developed for the Idaho National Energy Laboratories (INEL) Buried Waste Integrated Demonstration (BWID) Program to facilitate the transfer of technology and knowledge from industry, universities, and other Federal agencies into the BWID; to successfully transfer demonstrated technology and knowledge from the BWID to industry, universities, and other Federal agencies; and to share demonstrated technologies and knowledge between Integrated Demonstrations and other Department of Energy (DOE) spread throughout the DOE Complex. This document also details specific methods and tools for integrating and transferring technologies into or out of the BWID program. The document provides background on the BWID program and technology development needs, demonstrates the direction of technology transfer, illustrates current processes for this transfer, and lists points of contact for prospective participants in the BWID technology transfer efforts. The Technology Integration Process was prepared to ensure compliance with the requirements of DOE's Office of Technology Development (OTD)

  19. Long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele‐specific MYC expression in HeLa cells

    Science.gov (United States)

    Shen, Congle; Liu, Yongzhen; Shi, Shu; Zhang, Ruiyang; Zhang, Ting; Xu, Qiang; Zhu, Pengfei; Lu, Fengmin

    2017-01-01

    Human papillomavirus (HPV) infection is the most important risk factor for cervical cancer development. In HeLa cell line, the HPV viral genome is integrated at 8q24 in one allele of chromosome 8. It has been reported that the HPV fragment integrated in HeLa genome can cis‐activate the expression of proto‐oncogene MYC, which is located at 500 kb downstream of the integrated site. However, the underlying molecular mechanism of this regulation is unknown. A recent study reported that MYC was highly expressed exclusively from the HPV‐integrated haplotype, and a long‐range chromatin interaction between the integrated HPV fragment and MYC gene has been hypothesized. In this study, we provided the experimental evidences supporting this long‐range chromatin interaction in HeLa cells by using Chromosome Conformation Capture (3C) method. We found that the integrated HPV fragment, MYC and 8q24.22 was close to each other and might form a trimer in spatial location. When knocking out the integrated HPV fragment or 8q24.22 region from chromosome 8 by CRISPR/Cas9 system, the expression of MYC reduced dramatically in HeLa cells. Interestingly, decreased expression was only observed in three from eight cell clones, when only one 8q24.22 allele was knocked out. Functionally, HPV knockout caused senescence‐associated acidic β‐gal activity in HeLa cells. These data indicate a long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region, providing an alternative mechanism relevant to the carcinogenicity of HPV integration. PMID:28470669

  20. Long-distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele-specific MYC expression in HeLa cells.

    Science.gov (United States)

    Shen, Congle; Liu, Yongzhen; Shi, Shu; Zhang, Ruiyang; Zhang, Ting; Xu, Qiang; Zhu, Pengfei; Chen, Xiangmei; Lu, Fengmin

    2017-08-01

    Human papillomavirus (HPV) infection is the most important risk factor for cervical cancer development. In HeLa cell line, the HPV viral genome is integrated at 8q24 in one allele of chromosome 8. It has been reported that the HPV fragment integrated in HeLa genome can cis-activate the expression of proto-oncogene MYC, which is located at 500 kb downstream of the integrated site. However, the underlying molecular mechanism of this regulation is unknown. A recent study reported that MYC was highly expressed exclusively from the HPV-integrated haplotype, and a long-range chromatin interaction between the integrated HPV fragment and MYC gene has been hypothesized. In this study, we provided the experimental evidences supporting this long-range chromatin interaction in HeLa cells by using Chromosome Conformation Capture (3C) method. We found that the integrated HPV fragment, MYC and 8q24.22 was close to each other and might form a trimer in spatial location. When knocking out the integrated HPV fragment or 8q24.22 region from chromosome 8 by CRISPR/Cas9 system, the expression of MYC reduced dramatically in HeLa cells. Interestingly, decreased expression was only observed in three from eight cell clones, when only one 8q24.22 allele was knocked out. Functionally, HPV knockout caused senescence-associated acidic β-gal activity in HeLa cells. These data indicate a long-distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region, providing an alternative mechanism relevant to the carcinogenicity of HPV integration. © 2017 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

  1. HRT Specification

    CERN Document Server

    Möller, M

    1996-01-01

    In the context of the AIS Project (Advanced Informatics Systems for administration and management) a study has been conducted that resulted in the definition of a high level information systems model. Thirteen proposed systems were defined for detailed analysis. The Finance, Foundation, Human Resources, Logistics and Purchasing areas have been studied in detail. These studies have lead to the purchase and implementation of the ORIAC and SIRIAC packages, the Foundation database, the Oracle HR package, the Triton package and EDH and BHT. This specification describes the Human Resources Toolkit (HRT) intended to be used for accessing data in the HR and Foundation systems. This toolkit should help the divisions carry out their Human Resource management, planning and follow-up. It will have extensive report generation capabilities and offer a variety of standard graphs. It should have an easy-to-use graphical user interface and run on the CERN standard desktop platforms.

  2. Maternal exposure to Western diet affects adult body composition and voluntary wheel running in a genotype-specific manner in mice.

    Science.gov (United States)

    Hiramatsu, Layla; Kay, Jarren C; Thompson, Zoe; Singleton, Jennifer M; Claghorn, Gerald C; Albuquerque, Ralph L; Ho, Brittany; Ho, Brett; Sanchez, Gabriela; Garland, Theodore

    2017-10-01

    Some human diseases, including obesity, Type II diabetes, and numerous cancers, are thought to be influenced by environments experienced in early life, including in utero. Maternal diet during the perinatal period may be especially important for adult offspring energy balance, potentially affecting both body composition and physical activity. This effect may be mediated by the genetic background of individuals, including, for example, potential "protective" mechanisms for individuals with inherently high levels of physical activity or high basal metabolic rates. To examine some of the genetic and environmental factors that influence adult activity levels, we used an ongoing selection experiment with 4 replicate lines of mice bred for high voluntary wheel running (HR) and 4 replicate, non-selected control lines (C). Dams (half HR and half C) were fed a "Western" diet (WD, high in fat and sucrose) or a standard diet (SD) from 2weeks prior to mating until their pups could feed on solid food (14days of age). We analyzed dam and litter characteristics from birth to weaning, and offspring mass and physical activity into adulthood. One male offspring from each litter received additional metabolic and behavioral tests. Maternal WD caused pups to eat solid food significantly earlier for C litters, but not for HR litters (interaction of maternal environment and genotype). With dam mass as a covariate, mean pup mass was increased by maternal WD but litter size was unaffected. HR dams had larger litters and tended to have smaller pups than C dams. Home-cage activity of juvenile focal males was increased by maternal WD. Juvenile lean mass, fat mass, and fat percent were also increased by maternal WD, but food consumption (with body mass as a covariate) was unaffected (measured only for focal males). Behavior in an elevated plus maze, often used to indicate anxiety, was unaffected by maternal WD. Maximal aerobic capacity (VO 2 max) was also unaffected by maternal WD, but HR had higher VO 2 max than C mice. Adult lean, fat, and total body masses were significantly increased by maternal WD, with greater increase for fat than for lean mass. Overall, no aspect of adult wheel running (total distance, duration, average running speed, maximum speed) or home-cage activity was statistically affected by maternal WD. However, analysis of the 8 individual lines revealed that maternal WD significantly increased wheel running in one of the 4 HR lines. On average, all groups lost fat mass after 6days of voluntary wheel running, but the absolute amount lost was greater for mice with maternal WD resulting in no effect of maternal WD on absolute or % body fat after wheel access. All groups gained lean and total body mass during wheel access, regardless of maternal WD or linetype. Measured after wheel access, circulating leptin, adiponectin, and corticosterone concentrations were unaffected by maternal WD and did not differ between HR and C mice. With body mass as a covariate, heart ventricle mass was increased by maternal WD in both HR and C mice, but fat pads, liver, spleen, and brain masses were unaffected. As found previously, HR mice had larger brains than C mice. Body mass of grand-offspring was unaffected by grand-maternal WD, but grand-offspring wheel running was significantly increased for one HR line and decreased for another HR line by grand-maternal WD. In summary, maternal Western diet had long-lasting and general effects on offspring adult morphology, but effects on adult behavior were limited and contingent on sex and genetic background. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Ghrelin and hypothalamic NPY/AgRP expression in mice are affected by chronic early-life stress exposure in a sex-specific manner

    NARCIS (Netherlands)

    Yam, K.Y.; Ruigrok, S.R.; Ziko, I.; De Luca, S.N.; Lucassen, P.J.; Spencer, S.J.; Korosi, A.

    2017-01-01

    Early-life stress (ES) is a risk factor for metabolic disorders (e.g. obesity) with a notoriously higher prevalence in women compared to men. However, mechanisms underlying these effects remain elusive. The development of the hypothalamic feeding and metabolic regulatory circuits occurs mostly in

  4. Gestational Exposure to Air Pollution Alters Cortical Volume, Microglial Morphology, and Microglia-Neuron Interactions in a Sex-Specific Manner

    Directory of Open Access Journals (Sweden)

    Jessica L. Bolton

    2017-05-01

    Full Text Available Microglia are the resident immune cells of the brain, important for normal neural development in addition to host defense in response to inflammatory stimuli. Air pollution is one of the most pervasive and harmful environmental toxicants in the modern world, and several large scale epidemiological studies have recently linked prenatal air pollution exposure with an increased risk of neurodevelopmental disorders such as autism spectrum disorder (ASD. Diesel exhaust particles (DEP are a primary toxic component of air pollution, and markedly activate microglia in vitro and in vivo in adult rodents. We have demonstrated that prenatal exposure to DEP in mice, i.e., to the pregnant dams throughout gestation, results in a persistent vulnerability to behavioral deficits in adult offspring, especially in males, which is intriguing given the greater incidence of ASD in males to females (∼4:1. Moreover, there is a striking upregulation of toll-like receptor (TLR 4 gene expression within the brains of the same mice, and this expression is primarily in microglia. Here we explored the impact of gestational exposure to DEP or vehicle on microglial morphology in the developing brains of male and female mice. DEP exposure increased inflammatory cytokine protein and altered the morphology of microglia, consistent with activation or a delay in maturation, only within the embryonic brains of male mice; and these effects were dependent on TLR4. DEP exposure also increased cortical volume at embryonic day (E18, which switched to decreased volume by post-natal day (P30 in males, suggesting an impact on the developing neural stem cell niche. Consistent with this hypothesis, we found increased microglial-neuronal interactions in male offspring that received DEP compared to all other groups. Taken together, these data suggest a mechanism by which prenatal exposure to environmental toxins may affect microglial development and long-term function, and thereby contribute to the risk of neurodevelopmental disorders.

  5. Lef1 haploinsufficient mice display a low turnover and low bone mass phenotype in a gender- and age-specific manner.

    Directory of Open Access Journals (Sweden)

    Tommy Noh

    Full Text Available We investigated the role of Lef1, one of the four transcription factors that transmit Wnt signaling to the genome, in the regulation of bone mass. Microcomputed tomographic analysis of 13- and 17-week-old mice revealed significantly reduced trabecular bone mass in Lef1(+/- females compared to littermate wild-type females. This was attributable to decreased osteoblast activity and bone formation as indicated by histomorphometric analysis of bone remodeling. In contrast to females, bone mass was unaffected by Lef1 haploinsufficiency in males. Similarly, females were substantially more responsive than males to haploinsufficiency in Gsk3beta, a negative regulator of the Wnt pathway, displaying in this case a high bone mass phenotype. Lef1 haploinsufficiency also led to low bone mass in males lacking functional androgen receptor (AR (tfm mutants. The protective skeletal effect of AR against Wnt-related low bone mass is not necessarily a result of direct interaction between the AR and Wnt signaling pathways, because Lef1(+/- female mice had normal bone mass at the age of 34 weeks. Thus, our results indicate an age- and gender-dependent role for Lef1 in regulating bone formation and bone mass in vivo. The resistance to Lef1 haploinsufficiency in males with active AR and in old females could be due to the reduced bone turnover in these mice.

  6. Unopposed Estrogen Supplementation/Progesterone Deficiency in Post-Reproductive Age Affects the Secretory Profile of Resident Macrophages in a Tissue-Specific Manner in the Rat.

    Science.gov (United States)

    Stanojević, Stanislava; Kovačević-Jovanović, Vesna; Dimitrijević, Mirjana; Vujić, Vesna; Ćuruvija, Ivana; Blagojević, Veljko; Leposavić, Gordana

    2015-11-01

    The influence of unopposed estrogen replacement/isolated progesterone deficiency on macrophage production of pro-inflammatory/anti-inflammatory mediators in the post-reproductive age was studied. Considering that in the rats post-ovariectomy the circulating estradiol, but not progesterone level rises to the values in sham-operated controls, 20-month-old rats ovariectomized at the age of 10 months served as an experimental model. Estrogen and progesterone receptor expression, secretion of pro- and anti-inflammatory cytokines, and arginine metabolism end-products were examined in splenic and peritoneal macrophages under basal conditions and following lipopolysaccharide (LPS) stimulation in vitro. Almost all peritoneal and a subset of splenic macrophages expressed the intracellular progesterone receptor. Ovariectomy diminished cytokine production by splenic (IL-1β) and peritoneal (TNF-α, IL-1β, IL-10) macrophages and increased the production of IL-10 by splenic and TGF-β by peritoneal cells under basal conditions. Following LPS stimulation, splenic macrophages from ovariectomized rats produced less TNF-α and more IL-10, whereas peritoneal macrophages produced less IL-1β and TGF-β than the corresponding cells from sham-operated rats. Ovariectomy diminished urea production in both subpopulations of LPS-stimulated macrophages. Although long-lasting isolated progesterone deficiency in the post-reproductive age differentially affects cytokine production in the macrophages from distinct tissue compartments, in both subpopulations, it impairs the pro-inflammatory/anti-inflammatory cytokine secretory balance. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. FTO Is Associated with Aortic Valve Stenosis in a Gender Specific Manner of Heterozygote Advantage: A Population-Based Case-Control Study.

    Directory of Open Access Journals (Sweden)

    Cindy Thron

    Full Text Available Single nucleotide polymorphisms (SNPs within the Fat mass and obesity associated (FTO gene have been linked with increased body weight. However, the data on an association of FTO with cardiovascular diseases remains conflicting. Therefore, we ascertained whether FTO is associated with aortic valve stenosis (AVS, one of the most frequent cardiovascular diseases in the Western world.In this population-based case-control study the FTO SNP rs9939609 was analyzed in 300 German patients with AVS and 429 German controls of the KORA survey S4, representing a random population. Blood samples were collected prior to aortic valve replacement in AVS cases and FTO rs9939609 was genotyped via ARMS-PCR. Genotype frequencies differed significantly between AVS cases and KORA controls (p = 0.004. Separate gender-analyses uncovered an association of FTO with AVS exclusively in males; homozygote carriers for the risk-allele (A had a higher risk to develop AVS (p = 0.017, odds ratio (OR 1.727; 95% confidence interval (CI 1.087-2.747, recessive model, whereas heterozygote carriers for the risk-allele showed a lower risk (p = 0.002, OR 0.565, 95% CI 0.384-0.828, overdominant model. After adjustment for multiple co-variables, the odds ratios of heterozygotes remained significant for an association with AVS (p = 0.008, OR 0.565, 95% CI 0.369-0.861.This study revealed an association of FTO rs9939609 with AVS. Furthermore, this association was restricted to men, with heterozygotes having a significantly lower chance to develop AVS. Lastly, the association between FTO and AVS was independent of BMI and other variables such as diabetes mellitus.

  8. The Copper Metabolism MURR1 Domain protein 1 (COMMD1) modulates the aggregation of misfolded protein species in a client-specific manner

    NARCIS (Netherlands)

    W.I.M. Vonk (Willianne I.); V. Kakkar (Vaishali); P. Bartuzi (Paulina); D. Jaarsma (Dick); R. Berger (Ruud); M.A. Hofker (Marten); L.W.J. Klomp (Leo W.); C. Wijmenga (Cisca); H. Kampinga (Harm); B. van de Sluis (Bart)

    2014-01-01

    textabstractThe Copper Metabolism MURR1 domain protein 1 (COMMD1) is a protein involved in multiple cellular pathways, including copper homeostasis, NF-κB and hypoxia signalling. Acting as a scaffold protein, COMMD1 mediates the levels, stability and proteolysis of its substrates (e.g. the

  9. The Acinetobacter baumannii Two-Component System AdeRS Regulates Genes Required for Multidrug Efflux, Biofilm Formation, and Virulence in a Strain-Specific Manner

    Directory of Open Access Journals (Sweden)

    Grace E. Richmond

    2016-04-01

    Full Text Available The opportunistic pathogen Acinetobacter baumannii is able to persist in the environment and is often multidrug resistant (MDR, causing difficulties in the treatment of infections. Here, we show that the two-component system AdeRS, which regulates the production of the AdeABC multidrug resistance efflux pump, is required for the formation of a protective biofilm in an ex vivo porcine mucosal model, which mimics a natural infection of the human epithelium. Interestingly, deletion of adeB impacted only on the ability of strain AYE to form a biofilm on plastic and only on the virulence of strain Singapore 1 for Galleria mellonella. RNA-Seq revealed that loss of AdeRS or AdeB significantly altered the transcriptional landscape, resulting in the changed expression of many genes, notably those associated with antimicrobial resistance and virulence interactions. For example, A. baumannii lacking AdeRS displayed decreased expression of adeABC, pil genes, com genes, and a pgaC-like gene, whereas loss of AdeB resulted in increased expression of pil and com genes and decreased expression of ferric acinetobactin transport system genes. These data define the scope of AdeRS-mediated regulation, show that changes in the production of AdeABC mediate important phenotypes controlled by AdeRS, and suggest that AdeABC is a viable target for antimicrobial drug and antibiofilm discovery.

  10. Regional homogeneity, resting-state functional connectivity and amplitude of low frequency fluctuation associated with creativity measured by divergent thinking in a sex-specific manner.

    Science.gov (United States)

    Takeuchi, Hikaru; Taki, Yasuyuki; Nouchi, Rui; Yokoyama, Ryoichi; Kotozaki, Yuka; Nakagawa, Seishu; Sekiguchi, Atsushi; Iizuka, Kunio; Yamamoto, Yuki; Hanawa, Sugiko; Araki, Tsuyoshi; Makoto Miyauchi, Carlos; Shinada, Takamitsu; Sakaki, Kohei; Nozawa, Takayuki; Ikeda, Shigeyuki; Yokota, Susumu; Daniele, Magistro; Sassa, Yuko; Kawashima, Ryuta

    2017-05-15

    Brain connectivity is traditionally thought to be important for creativity. Here we investigated the associations of creativity measured by divergent thinking (CMDT) with resting-state functional magnetic imaging (fMRI) measures and their sex differences. We examined these relationships in the brains of 1277 healthy young adults. Whole-brain analyses revealed a significant interaction between verbal CMDT and sex on (a) regional homogeneity within an area from the left anterior temporal lobe (b) on the resting state functional connectivity (RSFC) between the mPFC and the left inferior frontal gyrus and (c) on fractional amplitude of low frequency fluctuations (fALFF) in several distinct areas, including the precuneus and middle cingulate gyrus, left middle temporal gyrus, right middle frontal gyrus, and cerebellum. These interactions were mediated by positive correlations in females and negative correlations in males. These findings suggest that greater CMDT in females is reflected by (a) regional coherence (regional homogeneity) of brain areas responsible for representing and combining concepts as well as (b) the efficient functional connection (RSFC) between the key areas for the default state of cognitive activity and speech production, and (c) greater spontaneous neural activity (fALFF) during the resting of brain areas involved in frontal lobe functions, default cognitive activities, and language functions. Furthermore, these findings suggest that the associations between creativity and resting state brain connectivity patterns are different between males and females. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. The protein encoded by the proto-oncogene DEK changes the topology of chromatin and reduces the efficiency of DNA replication in a chromatin-specific manner

    DEFF Research Database (Denmark)

    Alexiadis, V; Waldmann, T; Andersen, Jens S.

    2000-01-01

    The structure of chromatin regulates the genetic activity of the underlying DNA sequence. We report here that the protein encoded by the proto-oncogene DEK, which is involved in acute myelogenous leukemia, induces alterations of the superhelical density of DNA in chromatin. The change in topology...

  12. Native bacterial endophytes promote host growth in a species-specific manner; phytohormone manipulations do not result in common growth responses.

    Directory of Open Access Journals (Sweden)

    Hoang Hoa Long

    Full Text Available BACKGROUND: All plants in nature harbor a diverse community of endophytic bacteria which can positively affect host plant growth. Changes in plant growth frequently reflect alterations in phytohormone homoeostasis by plant-growth-promoting (PGP rhizobacteria which can decrease ethylene (ET levels enzymatically by 1-aminocyclopropane-1-carboxylate (ACC deaminase or produce indole acetic acid (IAA. Whether these common PGP mechanisms work similarly for different plant species has not been rigorously tested. METHODOLOGY/PRINCIPAL FINDINGS: We isolated bacterial endophytes from field-grown Solanum nigrum; characterized PGP traits (ACC deaminase activity, IAA production, phosphate solubilization and seedling colonization; and determined their effects on their host, S. nigrum, as well as on another Solanaceous native plant, Nicotiana attenuata. In S. nigrum, a majority of isolates that promoted root growth were associated with ACC deaminase activity and IAA production. However, in N. attenuata, IAA but not ACC deaminase activity was associated with root growth. Inoculating N. attenuata and S. nigrum with known PGP bacteria from a culture collection (DSMZ reinforced the conclusion that the PGP effects are not highly conserved. CONCLUSIONS/SIGNIFICANCE: We conclude that natural endophytic bacteria with PGP traits do not have general and predictable effects on the growth and fitness of all host plants, although the underlying mechanisms are conserved.

  13. Prolonged fasting activates hypoxia inducible factors-1α, -2α and -3α in a tissue-specific manner in northern elephant seal pups.

    Science.gov (United States)

    Soñanez-Organis, José G; Vázquez-Medina, José P; Crocker, Daniel E; Ortiz, Rudy M

    2013-09-10

    Hypoxia inducible factors (HIFs) are important regulators of energy homeostasis and cellular adaptation to low oxygen conditions. Northern elephant seals are naturally adapted to prolonged periods (1-2 months) of food deprivation (fasting) which result in metabolic changes that may activate HIF-1. However, the effects of prolonged fasting on HIFs are not well defined. We obtained the full-length cDNAs of HIF-1α and HIF-2α, and partial cDNA of HIF-3α in northern elephant seal pups. We also measured mRNA and nuclear protein content of HIF-1α, -2α, -3α in muscle and adipose during prolonged fasting (1, 3, 5 & 7 weeks), along with mRNA expression of HIF-mediated genes, LDH and VEGF. HIF-1α, -2α and -3α are 2595, 2852 and 1842 bp and encode proteins of 823, 864 and 586 amino acid residues with conserved domains needed for their function (bHLH and PAS) and regulation (ODD and TAD). HIF-1α and -2α mRNA expression increased 3- to 5-fold after 7 weeks of fasting in adipose and muscle, whereas HIF-3α increased 5-fold after 7 weeks of fasting in adipose. HIF-2α protein expression was detected in nuclear fractions from adipose and muscle, increasing approximately 2-fold, respectively with fasting. Expression of VEGF increased 3-fold after 7 weeks in adipose and muscle, whereas LDH mRNA expression increased 12-fold after 7 weeks in adipose. While the 3 HIFα genes are expressed in muscle and adipose, only HIF-2α protein was detectable in the nucleus suggesting that HIF-2α may contribute more significantly in the up-regulation of genes involved in the metabolic adaptation during fasting in the elephant seal. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. UPR transducer BBF2H7 allows export of type II collagen in a cargo- and developmental stage–specific manner

    Science.gov (United States)

    Toyama, Takuya; Nakamura, Yuki; Tamada, Kentaro; Shimizu, Hitomi; Ninagawa, Satoshi; Okada, Tetsuya; Ishikawa-Fujiwara, Tomoko; Aoyama, Eriko; Takigawa, Masaharu

    2017-01-01

    The unfolded protein response (UPR) handles unfolded/misfolded proteins accumulated in the endoplasmic reticulum (ER). However, it is unclear how vertebrates correctly use the total of ten UPR transducers. We have found that ER stress occurs physiologically during early embryonic development in medaka fish and that the smooth alignment of notochord cells requires ATF6 as a UPR transducer, which induces ER chaperones for folding of type VIII (short-chain) collagen. After secretion of hedgehog for tissue patterning, notochord cells differentiate into sheath cells, which synthesize type II collagen. In this study, we show that this vacuolization step requires both ATF6 and BBF2H7 as UPR transducers and that BBF2H7 regulates a complete set of genes (Sec23/24/13/31, Tango1, Sedlin, and KLHL12) essential for the enlargement of COPII vesicles to accommodate long-chain collagen for export, leading to the formation of the perinotochordal basement membrane. Thus, the most appropriate UPR transducer is activated to cope with the differing physiological ER stresses of different content types depending on developmental stage. PMID:28500182

  15. House sparrows' (Passer domesticus) behaviour in a novel environment is modulated by social context and familiarity in a sex-specific manner.

    Science.gov (United States)

    Tuliozi, Beniamino; Fracasso, Gerardo; Hoi, Herbert; Griggio, Matteo

    2018-01-01

    Exploratory behaviour is one of the best-investigated behavioural traits. However, little is known about how differences in familiarity, i.e. in the knowledge and previous experience with a companion can influence the exploration of a novel environment. However, to our knowledge, such a critical feature of the social environment has never been the target of a study relating it to exploratory behaviour in birds. Here we examined if familiarity with a conspecific could affect behavioural responses of individuals confronted with a novel environment. We recorded the latency to land on the ground, latency to feed, time spent feeding and number of sectors visited of 48 female and 48 male house sparrows ( Passer domesticus ) in an indoor aviary in three contexts: alone (individual context), with an unfamiliar and with a familiar same-sex companion. House sparrows landed sooner on the ground when in the familiar context than when in the individual context. Birds in unfamiliar pairs followed each other less than familiar birds, but this difference diminished with time spent exploring. Moreover, males and females differed in their behavioural responses in the unfamiliar context. Females with a familiar companion landed sooner than when they were paired with an unfamiliar conspecific, whereas only the presence of a companion but not familiarity reduced males latency to land on the ground. Finally, when considering the unfamiliar context males had shorter latencies to forage and thus spent more time eating than females. The presence or absence of a companion and its familiarity with the focal individual influenced differently the behavioural responses of male and female house sparrows in a novel environment. As house sparrows are strongly sociable, the influence of the social environment is likely to be of paramount importance to understand the selective pressures acting on them, particularly in recently colonized areas with ephemeral food sources. Our results shed light on the complex influence that the social environment has on the behavioural responses of a cosmopolitan bird.

  16. Plant growth regulators ameliorate or exacerbate abiotic and biotic stress effects on Zea mays kernel weight in a genotype-specific manner

    OpenAIRE

    Wang, Yishi; Stutts, Lauren; Stapleton, Ann

    2016-01-01

    Plant growth regulators have documented roles in plant responses to single stresses. In combined-stress environments, plants display novel genetic architecture for growth traits and the response to growth regulators is unclear. We investigated the role of plant growth regulators in combined-stress responses in Zea mays. Twelve maize inbreds were exposed to all combinations of the following stressors: drought, nitrogen, and density stress. Chemical treatments were utilized to alter balances of...

  17. Prenatal stress increases the obesogenic effects of a high-fat-sucrose diet in adult rats in a sex-specific manner.

    Science.gov (United States)

    Paternain, L; de la Garza, A L; Batlle, M A; Milagro, F I; Martínez, J A; Campión, J

    2013-03-01

    Stress during pregnancy can induce metabolic disorders in adult offspring. To analyze the possible differential response to a high-fat-sucrose (HFS) diet in offspring affected by prenatal stress (PNS) or not, pregnant Wistar rats (n = 11) were exposed to a chronic mild stress during the third week of gestation. The aim of this study was to model a chronic depressive-like state that develops over time in response to exposure of rats to a series of mild and unpredictable stressors. Control dams (n = 11) remained undisturbed. Adult offspring were fed chow or HFS diet (20% protein, 35% carbohydrate, 45% fat) for 10 weeks. Changes in adiposity, biochemical profile, and retroperitoneal adipose tissue gene expression by real-time polymerase chain reaction were analyzed. An interaction was observed between HFS and PNS concerning visceral adiposity, with higher fat mass in HFS-fed stressed rats, statistically significant only in females. HFS modified lipid profile and increased insulin resistance biomarkers, while PNS reduced insulin concentrations and the homeostasis model assessment index. HFS diet increased gene (mRNA) expression for leptin and apelin and decreased cyclin-dependent kinase inhibitor 1A and fatty acid synthase (Fasn), whereas PNS increased Fasn and stearoyl-CoA desaturase1. An interaction between diet and PNS was observed for adiponutrin (Adpn) and peroxisome proliferator-activated receptor-γ coactivator1-α (Ppargc1a) gene expression: Adpn was increased by the PNS only in HFS-fed rats, whereas Ppargc1a was increased by the PNS only in chow-fed rats. From these results, it can be concluded that experience of maternal stress during intrauterine development can enhance predisposition to obesity induced by a HFS diet intake.

  18. Prenatal Stress and Acute Stress Later in Life Impacts the Responses in Tests for Depressive-Like Behavior in a Sex-Specific Manner

    DEFF Research Database (Denmark)

    Sickmann, Helle Mark; Skoven, Christian; Arentzen, Tina S.

    in locomotor activity, depressive- and anxiety-like behavior as well as sleep architecture. Some animals were analyzed for CNS microstructural changes based on diffusion MRI. Subsets of PS and control rats were exposed to an acute stressor prior to the behavioral tests. Rearing/climbing activity in a familiar...

  19. FTO Is Associated with Aortic Valve Stenosis in a Gender Specific Manner of Heterozygote Advantage: A Population-Based Case-Control Study.

    Science.gov (United States)

    Thron, Cindy; Akhyari, Payam; Godehardt, Erhard; Lichtenberg, Artur; Rüther, Ulrich; Seehaus, Stefanie

    2015-01-01

    Single nucleotide polymorphisms (SNPs) within the Fat mass and obesity associated (FTO) gene have been linked with increased body weight. However, the data on an association of FTO with cardiovascular diseases remains conflicting. Therefore, we ascertained whether FTO is associated with aortic valve stenosis (AVS), one of the most frequent cardiovascular diseases in the Western world. In this population-based case-control study the FTO SNP rs9939609 was analyzed in 300 German patients with AVS and 429 German controls of the KORA survey S4, representing a random population. Blood samples were collected prior to aortic valve replacement in AVS cases and FTO rs9939609 was genotyped via ARMS-PCR. Genotype frequencies differed significantly between AVS cases and KORA controls (p = 0.004). Separate gender-analyses uncovered an association of FTO with AVS exclusively in males; homozygote carriers for the risk-allele (A) had a higher risk to develop AVS (p = 0.017, odds ratio (OR) 1.727; 95% confidence interval (CI) 1.087-2.747, recessive model), whereas heterozygote carriers for the risk-allele showed a lower risk (p = 0.002, OR 0.565, 95% CI 0.384-0.828, overdominant model). After adjustment for multiple co-variables, the odds ratios of heterozygotes remained significant for an association with AVS (p = 0.008, OR 0.565, 95% CI 0.369-0.861). This study revealed an association of FTO rs9939609 with AVS. Furthermore, this association was restricted to men, with heterozygotes having a significantly lower chance to develop AVS. Lastly, the association between FTO and AVS was independent of BMI and other variables such as diabetes mellitus.

  20. A Rice CaMBP Gene is Induced in Organ-Specific Manner by Both Chilling and Heat-Shock Treatments

    Directory of Open Access Journals (Sweden)

    Jia WAN

    2008-09-01

    Full Text Available A rice CaMBP gene, OsCaMBP (AB363406, was isolated from a chilling treated rice using the fluorescent differential display (FDD screening method. Its cDNA sequence (2094 bp contains an opening reading frame (ORF encoding a 569 amino acids protein (63.2 kD. OsCaMBP has the typical structural features of the CaMBP family, including the conserved IQ calmodulin-binding motif at the N-terminus. Homology analysis revealed 38.25%–47.28% identities of OsCaMBP with other CaMBPs in plants. RT-PCR analysis showed that the expression of OsCaMBP was remarkably inducible under the chilling (8°C and heat-shock (42°C treatments. OsCaMBP was undetectable under the normal conditions, and induced under the chilling treatment for 1 h, as well as the heat-shock treatment for 15 min, suggesting that the gene plays important roles in the signaling pathway in rice under both chilling and heat-shock stresses.

  1. Development of the manners of acting in university students from the Extension Universitaria

    Directory of Open Access Journals (Sweden)

    Ilsa María Reyes-Torres

    2016-09-01

    Full Text Available Se asegura que la Extensión Universitaria se convierte  en un vehículo más para la formación integral de los estudiantes siempre y cuando esta potencie acciones con la comunidad universitaria en un sentido horizontal e integrador, y que contribuya a elevar su calidad de vida, a enriquecer y fomentar la cultura preservada por la Universidad. En el presente trabajo se expone una propuesta de acciones a partir del proyecto cultural extensionista en las diferentes dimensiones donde se integran los procesos universitarios que conllevan, a su vez, al  desarrollo de los modos de actuación de los estudiantes universitarios.

  2. Vitamin A Affects Flatfish Development in a Thyroid Hormone Signaling and Metamorphic Stage Dependent Manner

    Directory of Open Access Journals (Sweden)

    Ignacio Fernández

    2017-06-01

    Full Text Available Vitamin A (VA and retinoid derivatives are known morphogens controlling vertebrate development. Despite the research effort conducted during the last decade, the precise mechanism of how VA induces post-natal bone changes, and particularly those operating through crosstalk with the thyroid hormones (THs remain to be fully understood. Since effects and mechanisms seem to be dose and time-dependent, flatfish are an interesting study model as they undergo a characteristic process of metamorphosis driven by THs that can be followed by external appearance. Here, we studied the effects of VA imbalance that might determine Senegalese sole (Solea senegalensis skeletogenetic phenotype through development of thyroid follicles, THs homeostasis and signaling when a dietary VA excess was specifically provided during pre-, pro- or post-metamorphic stages using enriched rotifers and Artemia as carriers. The increased VA content in enriched live prey was associated to a higher VA content in fish at all developmental stages. Dietary VA content clearly affected thyroid follicle development, T3 and T4 immunoreactive staining, skeletogenesis and mineralization in a dose and time-dependent fashion. Gene expression analysis showed that VA levels modified the mRNA abundance of VA- and TH-specific nuclear receptors at specific developmental stages. Present results provide new and key knowledge to better understand how VA and TH pathways interact at tissue, cellular and nuclear level at different developmental periods in Senegalese sole, unveiling how dietary modulation might determine juvenile phenotype and physiology.

  3. Boudin trafficking reveals the dynamic internalisation of specific septate junction components in Drosophila.

    Science.gov (United States)

    Tempesta, Camille; Hijazi, Assia; Moussian, Bernard; Roch, Fernando

    2017-01-01

    The maintenance of paracellular barriers in invertebrate epithelia depends on the integrity of specific cell adhesion structures known as septate junctions (SJ). Multiple studies in Drosophila have revealed that these junctions have a stereotyped architecture resulting from the association in the lateral membrane of a large number of components. However, little is known about the dynamic organisation adopted by these multi-protein complexes in living tissues. We have used live imaging techniques to show that the Ly6 protein Boudin is a component of these adhesion junctions and can diffuse systemically to associate with the SJ of distant cells. We also observe that this protein and the claudin Kune-kune are endocytosed in epidermal cells during embryogenesis. Our data reveal that the SJ contain a set of components exhibiting a high membrane turnover, a feature that could contribute in a tissue-specific manner to the morphogenetic plasticity of these adhesion structures.

  4. dSir2 in the Adult Fat Body, but Not in Muscles, Regulates Life Span in a Diet-Dependent Manner

    Directory of Open Access Journals (Sweden)

    Kushal Kr. Banerjee

    2012-12-01

    Full Text Available Sir2, an evolutionarily conserved NAD+-dependent deacetylase, has been implicated as a key factor in mediating organismal life span. However, recent contradictory findings have brought into question the role of Sir2 and its orthologs in regulating organismal longevity. In this study, we report that Drosophila Sir2 (dSir2 in the adult fat body regulates longevity in a diet-dependent manner. We used inducible Gal4 drivers to knock down and overexpress dSir2 in a tissue-specific manner. A diet-dependent life span phenotype of dSir2 perturbations (both knockdown and overexpression in the fat body, but not muscles, negates the effects of background genetic mutations. In addition to providing clarity to the field, our study contrasts the ability of dSir2 in two metabolic tissues to affect longevity. We also show that dSir2 knockdown abrogates fat-body dFOXO-dependent life span extension. This report highlights the importance of the interplay between genetic factors and dietary inputs in determining organismal life spans.

  5. Global regulator SATB1 recruits beta-catenin and regulates T(H2 differentiation in Wnt-dependent manner.

    Directory of Open Access Journals (Sweden)

    Dimple Notani

    2010-01-01

    Full Text Available In vertebrates, the conserved Wnt signalling cascade promotes the stabilization and nuclear accumulation of beta-catenin, which then associates with the lymphoid enhancer factor/T cell factor proteins (LEF/TCFs to activate target genes. Wnt/beta -catenin signalling is essential for T cell development and differentiation. Here we show that special AT-rich binding protein 1 (SATB1, the T lineage-enriched chromatin organizer and global regulator, interacts with beta-catenin and recruits it to SATB1's genomic binding sites. Gene expression profiling revealed that the genes repressed by SATB1 are upregulated upon Wnt signalling. Competition between SATB1 and TCF affects the transcription of TCF-regulated genes upon beta-catenin signalling. GATA-3 is a T helper type 2 (T(H2 specific transcription factor that regulates production of T(H2 cytokines and functions as T(H2 lineage determinant. SATB1 positively regulated GATA-3 and siRNA-mediated knockdown of SATB1 downregulated GATA-3 expression in differentiating human CD4(+ T cells, suggesting that SATB1 influences T(H2 lineage commitment by reprogramming gene expression. In the presence of Dickkopf 1 (Dkk1, an inhibitor of Wnt signalling, GATA-3 is downregulated and the expression of signature T(H2 cytokines such as IL-4, IL-10, and IL-13 is reduced, indicating that Wnt signalling is essential for T(H2 differentiation. Knockdown of beta-catenin also produced similar results, confirming the role of Wnt/beta-catenin signalling in T(H2 differentiation. Furthermore, chromatin immunoprecipitation analysis revealed that SATB1 recruits beta-catenin and p300 acetyltransferase on GATA-3 promoter in differentiating T(H2 cells in a Wnt-dependent manner. SATB1 coordinates T(H2 lineage commitment by reprogramming gene expression. The SATB1:beta-catenin complex activates a number of SATB1 regulated genes, and hence this study has potential to find novel Wnt responsive genes. These results demonstrate that SATB1

  6. Considerations of the manner of accounting for fast fracture risk in the design of PWR vessels

    International Nuclear Information System (INIS)

    Pellissier-Tanon, A.; Grandemange, J.M.

    1986-01-01

    The French approach to the prevention of fast fracture in PWR vessels is to consider it as a whole and to choose the most convenient way to meet this general goal from an economic and technical point of view. According to this approach, there are no specific limits imposed on such factors as end of life RTsub(NDT) or neutron fluence, which are taken as criteria in other countries. The RCCM design and construction code specifications on chemical content and RTsub(NDT) for beltline and non-irradiated parts establish a sound basis for safety. However, for the most critical parts, the existence of large margins with respect to fast fracture is demonstrated by analysis for all second, third and fourth category design transients. To this aim, the RCCM code needs to demonstrate specified safety margins, depending on the transient category, for reference defects defined in kind and size, in order to bound realistically any defects which have a chance of occurring in the part during manufacture. This approach, which enables the disclosure of the influence of all significant design factors on fracture risk, ensures the most consistent way to improve design safety. (author)

  7. Considerations of the manner of accounting for fast fracture risk in the design of PWR vessels

    Energy Technology Data Exchange (ETDEWEB)

    1986-01-01

    The French approach to the prevention of fast fracture in PWR vessels is to consider it as a whole and to choose the most convenient way to meet this general goal from an economic and technical point of view. According to this approach, there are no specific limits imposed on such factors as end of life RTsub(NDT) or neutron fluence, which are taken as criteria in other countries. The RCCM design and construction code specifications on chemical content and RTsub(NDT) for beltline and non-irradiated parts establish a sound basis for safety. However, for the most critical parts, the existence of large margins with respect to fast fracture is demonstrated by analysis for all second, third and fourth category design transients. To this aim, the RCCM code needs to demonstrate specified safety margins, depending on the transient category, for reference defects defined in kind and size, in order to bound realistically any defects which have a chance of occurring in the part during manufacture. This approach, which enables the disclosure of the influence of all significant design factors on fracture risk, ensures the most consistent way to improve design safety.

  8. Drosophila mitotypes determine developmental time in a diet and temperature dependent manner.

    Science.gov (United States)

    Towarnicki, Samuel G; Ballard, J William O

    2017-07-01

    It is well known that specific mitochondrial (mt) DNA mutations can reduce organismal fitness and influence mitochondrial-nuclear interactions. However, determining specific mtDNA mutations that are beneficial has been elusive. In this study, we vary the diet and environmental temperature to study larval development time of two Drosophila melanogaster mitotypes (Alstonville and Dahomey), in two nuclear genetic backgrounds, and investigate developmental differences through weight, feeding rate, and movement. To manipulate the diet, we utilize the nutritional geometric framework to manipulate isocaloric diets of differing macronutrient ratios (1:2 and 1:16 protein: carbohydrate (P:C) ratios) and raise flies at three temperatures (19°C, 23°C and 27°C). Larvae with Dahomey mtDNA develop more slowly than Alstonville when fed the 1:2 P:C diet at all temperatures and developed more quickly when fed the 1:16 P:C diet at 23°C and 27°C. We determined that Dahomey larvae eat more, move less, and weigh more than Alstonville larvae when raised on the 1:16 P:C diet and that these physiological responses are modified by temperature. We suggest that 1 (or more) of 4 mtDNA changes is likely responsible for the observed effects and posit the mtDNA changes moderate a physiological trade-off between consumption and foraging. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Bioreactor design for successive culture of anchorage-dependent cells operated in an automated manner.

    Science.gov (United States)

    Kino-Oka, Masahiro; Ogawa, Natsuki; Umegaki, Ryota; Taya, Masahito

    2005-01-01

    A novel bioreactor system was designed to perform a series of batchwise cultures of anchorage-dependent cells by means of automated operations of medium change and passage for cell transfer. The experimental data on contamination frequency ensured the biological cleanliness in the bioreactor system, which facilitated the operations in a closed environment, as compared with that in flask culture system with manual handlings. In addition, the tools for growth prediction (based on growth kinetics) and real-time growth monitoring by measurement of medium components (based on small-volume analyzing machinery) were installed into the bioreactor system to schedule the operations of medium change and passage and to confirm that culture proceeds as scheduled, respectively. The successive culture of anchorage-dependent cells was conducted with the bioreactor running in an automated way. The automated bioreactor gave a successful culture performance with fair accordance to preset scheduling based on the information in the latest subculture, realizing 79- fold cell expansion for 169 h. In addition, the correlation factor between experimental data and scheduled values through the bioreactor performance was 0.998. It was concluded that the proposed bioreactor with the integration of the prediction and monitoring tools could offer a feasible system for the manufacturing process of cultured tissue products.

  10. PAI-1 modulates cell migration in a LRP1-dependent manner via β-catenin and ERK1/2

    DEFF Research Database (Denmark)

    Kozlova, Nina; Jensen, Jan Kristian; Chi, Tabughang Franklin

    2015-01-01

    was proposed to modulate the β-catenin pathway. Therefore, we used wild-type mouse embryonic fibroblasts (MEFs), and MEFs deficient of LRP1 to study PAI-1 as modulator of the β-catenin pathway. We found that PAI-1 influences MEF proliferation and motility in a LRP1-dependent manner and that β...

  11. 26 CFR 1.754-1 - Time and manner of making election to adjust basis of partnership property.

    Science.gov (United States)

    2010-04-01

    ... general. A partnership having an election in effect under this section may revoke such election with the... required to be filed. A partnership which wishes to revoke such an election shall file with the district... 26 Internal Revenue 8 2010-04-01 2010-04-01 false Time and manner of making election to adjust...

  12. INTEGRATION OF FACILITY MODELING CAPABILITIES FOR NUCLEAR NONPROLIFERATION ANALYSIS

    Energy Technology Data Exchange (ETDEWEB)

    Gorensek, M.; Hamm, L.; Garcia, H.; Burr, T.; Coles, G.; Edmunds, T.; Garrett, A.; Krebs, J.; Kress, R.; Lamberti, V.; Schoenwald, D.; Tzanos, C.; Ward, R.

    2011-07-18

    Developing automated methods for data collection and analysis that can facilitate nuclear nonproliferation assessment is an important research area with significant consequences for the effective global deployment of nuclear energy. Facility modeling that can integrate and interpret observations collected from monitored facilities in order to ascertain their functional details will be a critical element of these methods. Although improvements are continually sought, existing facility modeling tools can characterize all aspects of reactor operations and the majority of nuclear fuel cycle processing steps, and include algorithms for data processing and interpretation. Assessing nonproliferation status is challenging because observations can come from many sources, including local and remote sensors that monitor facility operations, as well as open sources that provide specific business information about the monitored facilities, and can be of many different types. Although many current facility models are capable of analyzing large amounts of information, they have not been integrated in an analyst-friendly manner. This paper addresses some of these facility modeling capabilities and illustrates how they could be integrated and utilized for nonproliferation analysis. The inverse problem of inferring facility conditions based on collected observations is described, along with a proposed architecture and computer framework for utilizing facility modeling tools. After considering a representative sampling of key facility modeling capabilities, the proposed integration framework is illustrated with several examples.

  13. Integration of facility modeling capabilities for nuclear nonproliferation analysis

    International Nuclear Information System (INIS)

    Garcia, Humberto; Burr, Tom; Coles, Garill A.; Edmunds, Thomas A.; Garrett, Alfred; Gorensek, Maximilian; Hamm, Luther; Krebs, John; Kress, Reid L.; Lamberti, Vincent; Schoenwald, David; Tzanos, Constantine P.; Ward, Richard C.

    2012-01-01

    Developing automated methods for data collection and analysis that can facilitate nuclear nonproliferation assessment is an important research area with significant consequences for the effective global deployment of nuclear energy. Facility modeling that can integrate and interpret observations collected from monitored facilities in order to ascertain their functional details will be a critical element of these methods. Although improvements are continually sought, existing facility modeling tools can characterize all aspects of reactor operations and the majority of nuclear fuel cycle processing steps, and include algorithms for data processing and interpretation. Assessing nonproliferation status is challenging because observations can come from many sources, including local and remote sensors that monitor facility operations, as well as open sources that provide specific business information about the monitored facilities, and can be of many different types. Although many current facility models are capable of analyzing large amounts of information, they have not been integrated in an analyst-friendly manner. This paper addresses some of these facility modeling capabilities and illustrates how they could be integrated and utilized for nonproliferation analysis. The inverse problem of inferring facility conditions based on collected observations is described, along with a proposed architecture and computer framework for utilizing facility modeling tools. After considering a representative sampling of key facility modeling capabilities, the proposed integration framework is illustrated with several examples.

  14. Integration Of Facility Modeling Capabilities For Nuclear Nonproliferation Analysis

    International Nuclear Information System (INIS)

    Gorensek, M.; Hamm, L.; Garcia, H.; Burr, T.; Coles, G.; Edmunds, T.; Garrett, A.; Krebs, J.; Kress, R.; Lamberti, V.; Schoenwald, D.; Tzanos, C.; Ward, R.

    2011-01-01

    Developing automated methods for data collection and analysis that can facilitate nuclear nonproliferation assessment is an important research area with significant consequences for the effective global deployment of nuclear energy. Facility modeling that can integrate and interpret observations collected from monitored facilities in order to ascertain their functional details will be a critical element of these methods. Although improvements are continually sought, existing facility modeling tools can characterize all aspects of reactor operations and the majority of nuclear fuel cycle processing steps, and include algorithms for data processing and interpretation. Assessing nonproliferation status is challenging because observations can come from many sources, including local and remote sensors that monitor facility operations, as well as open sources that provide specific business information about the monitored facilities, and can be of many different types. Although many current facility models are capable of analyzing large amounts of information, they have not been integrated in an analyst-friendly manner. This paper addresses some of these facility modeling capabilities and illustrates how they could be integrated and utilized for nonproliferation analysis. The inverse problem of inferring facility conditions based on collected observations is described, along with a proposed architecture and computer framework for utilizing facility modeling tools. After considering a representative sampling of key facility modeling capabilities, the proposed integration framework is illustrated with several examples.

  15. Integration of facility modeling capabilities for nuclear nonproliferation analysis

    International Nuclear Information System (INIS)

    Burr, Tom; Gorensek, M.B.; Krebs, John; Kress, Reid L.; Lamberti, Vincent; Schoenwald, David; Ward, Richard C.

    2012-01-01

    Developing automated methods for data collection and analysis that can facilitate nuclearnonproliferation assessment is an important research area with significant consequences for the effective global deployment of nuclear energy. Facilitymodeling that can integrate and interpret observations collected from monitored facilities in order to ascertain their functional details will be a critical element of these methods. Although improvements are continually sought, existing facilitymodeling tools can characterize all aspects of reactor operations and the majority of nuclear fuel cycle processing steps, and include algorithms for data processing and interpretation. Assessing nonproliferation status is challenging because observations can come from many sources, including local and remote sensors that monitor facility operations, as well as open sources that provide specific business information about the monitored facilities, and can be of many different types. Although many current facility models are capable of analyzing large amounts of information, they have not been integrated in an analyst-friendly manner. This paper addresses some of these facilitymodelingcapabilities and illustrates how they could be integrated and utilized for nonproliferationanalysis. The inverse problem of inferring facility conditions based on collected observations is described, along with a proposed architecture and computer framework for utilizing facilitymodeling tools. After considering a representative sampling of key facilitymodelingcapabilities, the proposed integration framework is illustrated with several examples.

  16. Integrated economics

    International Nuclear Information System (INIS)

    Bratton, T.J.

    1992-01-01

    This article offers ideas for evaluating integrated solid waste management systems through the use of a conceptual cost overview. The topics of the article include the integrated solid waste management system; making assumptions about community characteristics, waste generation rates, waste collection responsibility, integrated system components, sizing and economic life of system facilities, system implementation schedule, facility ownership, and system administration; integrated system costs; integrated system revenues; system financing; cost projections; and making decisions

  17. Synesthesia induced colors do not bias attention in the same manner as physical colors do

    DEFF Research Database (Denmark)

    Sørensen, Thomas Alrik; Ásgeirsson, Árni Gunnar

    2015-01-01

    and performance in visual search, much like physical stimulus features. It has been demonstrated that the content of visual memory can guide attention (e.g. Carlisle & Woodman, 2011). This effect can be measured in the response time costs or benefits related to the presence of memorized color in a visual search......Grapheme-color synesthesia affects visual cognition in significant ways. The congruence or incongruence of physical stimuli with synesthetic color affects how quickly and accurately synesthetes respond to stimuli, and the induced color experience may help them memorize achromatic material...... display. Retaining color information in memory biases attention towards that specific color in visual search, apparent by response time costs when a matching distractor is present, but a benefit when the target matches the retained color. We investigated whether a synesthetic color is automatically...

  18. Meeting the Challenge of Chronic Conditions in a Sustainable Manner: Building on the AHC Learning.

    Science.gov (United States)

    Delgado, Pedro

    2016-01-01

    The Atlantic Healthcare Collaboration for Innovation and Improvement in Chronic Disease (AHC) set out to achieve three aims: to create a patient- and family-centred approach to manage chronic diseases; to build a network of organizational, regional and provincial teams to share evidence-informed, systems-level solutions and work together to develop, implement and sustain improvement initiatives; and to promote the sustainability of the participating health systems. Important elements of all three aims were achieved and the synthesis provides a meaningful contribution to systems working to improve chronic care. This paper explores those achievements as well as some of the areas for improvement, including replicability, expanded outcome measurement, greater detail around patient and family engagement, increased focus on specific outcomes and processes, and further articulation of lessons learned and recommendations.

  19. Paternal body mass index (BMI is associated with offspring intrauterine growth in a gender dependent manner.

    Directory of Open Access Journals (Sweden)

    You-Peng Chen

    Full Text Available BACKGROUND: Environmental alternations leading to fetal programming of cardiovascular diseases in later life have been attributed to maternal factors. However, animal studies showed that paternal obesity may program cardio-metabolic diseases in the offspring. In the current study we tested the hypothesis that paternal BMI may be associated with fetal growth. METHODS AND RESULTS: We analyzed the relationship between paternal body mass index (BMI and birth weight, ultrasound parameters describing the newborn's body shape as well as parameters describing the newborns endocrine system such as cortisol, aldosterone, renin activity and fetal glycated serum protein in a birth cohort of 899 father/mother/child triplets. Since fetal programming is an offspring sex specific process, male and female offspring were analyzed separately. Multivariable regression analyses considering maternal BMI, paternal and maternal age, hypertension during pregnancy, maternal total glycated serum protein, parity and either gestational age (for birth weight or time of ultrasound investigation (for ultrasound parameters as confounding showed that paternal BMI is associated with growth of the male but not female offspring. Paternal BMI correlated with birth parameters of male offspring only: birth weight; biparietal diameter, head circumference; abdominal diameter, abdominal circumference; and pectoral diameter. Cortisol was likewise significantly correlated with paternal BMI in male newborns only. CONCLUSIONS: Paternal BMI affects growth of the male but not female offspring. Paternal BMI may thus represent a risk factor for cardiovascular diseases of male offspring in later life. It remains to be demonstrated whether this is linked to an offspring sex specific paternal programming of cortisol secretion.

  20. Integrated Work Management: Overview, Course 31881

    Energy Technology Data Exchange (ETDEWEB)

    Simpson, Lewis Edward [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-06-30

    Integrated work management (IWM) is the process used for formally implementing the five-step process associated with integrated safety management (ISM) and integrated safeguards and security management (ISSM) at Los Alamos National Laboratory (LANL). IWM also directly supports the LANL Environmental Management System (EMS). IWM helps all workers and managers perform work safely and securely and in a manner that protects people, the environment, property, and the security of the nation. The IWM process applies to all work activities at LANL, from working in the office to designing experiments to assembling and detonating explosives. The primary LANL document that establishes and describes IWM requirements is Procedure (P) 300, Integrated Work Management.