WorldWideScience

Sample records for integral serendipitous detection

  1. INTEGRAL serendipitous upper limits on FRB180301

    Science.gov (United States)

    Savchenko, V.; Panessa, F.; Ferrigno, C.; Keane, E.; Bazzano, A.; Burgay, M.; Kuulkers, E.; Petroff, E.; Ubertini, P.; Diehl, R.

    2018-03-01

    On March 1 at T0 = 07:34:19.76 (UTC), a Fast Radio Burst (FRB180301) was detected during Breakthrough Listen observations with the 21-cm multibeam receiver of the CSIRO Parkes radio telescope (see ATel #11376).

  2. Galactic Sources Detected in the NuSTAR Serendipitous Survey

    Energy Technology Data Exchange (ETDEWEB)

    Tomsick, John A.; Clavel, Maïca; Chiu, Jeng-Lun [Space Sciences Laboratory, 7 Gauss Way, University of California, Berkeley, CA 94720-7450 (United States); Lansbury, George B.; Aird, James [Institute of Astronomy, University of Cambridge, Madingley Road, Cambridge CB3 0HA (United Kingdom); Rahoui, Farid [Department of Astronomy, Harvard University, 60 Garden Street, Cambridge, MA 02138 (United States); Fornasini, Francesca M.; Hong, JaeSub; Grindlay, Jonathan E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Alexander, David M. [Centre for Extragalactic Astronomy, Department of Physics, University of Durham, South Road, Durham DH1 3LE (United Kingdom); Bodaghee, Arash [Georgia College and State University, Milledgeville, GA 31061 (United States); Hailey, Charles J.; Mori, Kaya [Columbia Astrophysics Laboratory, Columbia University, New York, NY 10027 (United States); Harrison, Fiona A. [California Institute of Technology, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Krivonos, Roman A. [Space Research Institute of the Russian Academy of Sciences, Profsoyuznaya Str. 84/32, 117997, Moscow (Russian Federation); Stern, Daniel [Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Drive, Pasadena, CA 91109 (United States)

    2017-06-01

    The Nuclear Spectroscopic Telescope Array (NuSTAR) provides an improvement in sensitivity at energies above 10 keV by two orders of magnitude over non-focusing satellites, making it possible to probe deeper into the Galaxy and universe. Lansbury and collaborators recently completed a catalog of 497 sources serendipitously detected in the 3–24 keV band using 13 deg{sup 2} of NuSTAR coverage. Here, we report on an optical and X-ray study of 16 Galactic sources in the catalog. We identify 8 of them as stars (but some or all could have binary companions), and use information from Gaia to report distances and X-ray luminosities for 3 of them. There are 4 CVs or CV candidates, and we argue that NuSTAR J233426–2343.9 is a relatively strong CV candidate based partly on an X-ray spectrum from XMM-Newton . NuSTAR J092418–3142.2, which is the brightest serendipitous source in the Lansbury catalog, and NuSTAR J073959–3147.8 are low-mass X-ray binary candidates, but it is also possible that these 2 sources are CVs. One of the sources is a known high-mass X-ray binary (HMXB), and NuSTAR J105008–5958.8 is a new HMXB candidate that has strong Balmer emission lines in its optical spectrum and a hard X-ray spectrum. We discuss the implications of finding these HMXBs for the surface density (log N –log S ) and luminosity function of Galactic HMXBs. We conclude that with the large fraction of unclassified sources in the Galactic plane detected by NuSTAR in the 8–24 keV band, there could be a significant population of low-luminosity HMXBs.

  3. Serendipitous discovery of a strong-lensed galaxy in integral field spectroscopy from MUSE

    Science.gov (United States)

    Galbany, Lluís; Collett, Thomas E.; Méndez-Abreu, Jairo; Sánchez, Sebastián F.; Anderson, Joseph P.; Kuncarayakti, Hanindyo

    2018-06-01

    2MASX J04035024-0239275 is a bright red elliptical galaxy at redshift 0.0661 that presents two extended sources at 2″ to the north-east and 1″ to the south-west. The sizes and surface brightnesses of the two blue sources are consistent with a gravitationally-lensed background galaxy. In this paper we present MUSE observations of this galaxy from the All-weather MUse Supernova Integral-field Nearby Galaxies (AMUSING) survey, and report the discovery of a background lensed galaxy at redshift 0.1915, together with other 15 background galaxies at redshifts ranging from 0.09 to 0.9, that are not multiply imaged. We have extracted aperture spectra of the lens and all the sources and fit the stellar continuum with STARLIGHT to estimate their stellar and emission line properties. A trace of past merger and active nucleus activity is found in the lensing galaxy, while the background lensed galaxy is found to be star-forming. Modeling the lensing potential with a singular isothermal ellipsoid, we find an Einstein radius of 1."45±0."04, which corresponds to 1.9 kpc at the redshift of the lens and it is much smaller than its effective radius (reff ˜ 9″"). Comparing the Einstein mass and the STARLIGHT stellar mass within the same aperture yields a dark matter fraction of 18% ± 8 % within the Einstein radius. The advent of large surveys such as the Large Synoptic Survey Telescope (LSST) will discover a number of strong-lensed systems, and here we demonstrate how wide-field integral field spectroscopy offers an excellent approach to study them and to precisely model lensing effects.

  4. SERENDIPITOUS DETECTION OF X-RAY EMISSION FROM THE HOT BORN-AGAIN CENTRAL STAR OF THE PLANETARY NEBULA K 1-16

    Energy Technology Data Exchange (ETDEWEB)

    Montez, Rodolfo Jr. [Department of Physics and Astronomy, Vanderbilt University, Nashville, TN 37235 (United States); Kastner, Joel H., E-mail: rodolfo.montez.jr@gmail.com, E-mail: jhk@cis.rit.edu [Center for Imaging Science and Laboratory for Multiwavelength Astrophysics, Rochester Institute of Technology, 54 Lomb Memorial Drive, Rochester, NY 14623 (United States)

    2013-03-20

    We report the serendipitous detection of point-like X-ray emission from the hot, PG1159-type central star of the planetary nebula (CSPN) K 1-16 by the XMM-Newton and Chandra X-Ray Observatories. The CSPN lies superimposed on a galaxy cluster that includes an X-ray-bright quasar, but we have successfully isolated the CSPN X-ray emission from the strong diffuse background contributed by the quasar and intracluster gas. We have modeled the XMM-Newton and Chandra X-ray data, taking advantage of the contrasting detection efficiencies of the two observatories to better constrain the low-energy spectral response of Chandra's Advanced CCD Imaging Spectrometer. We find that the CSPN X-ray spectrum is well characterized by the combination of a non-local thermodynamic equilibrium model atmosphere with T{sub *} {approx} 135 kK and a carbon-rich, optically thin thermal plasma with T{sub X} {approx} 1 MK. These results for X-ray emission from the K 1-16 CSPN, combined with those obtained for other PG1159-type objects, lend support to the 'born-again' scenario for Wolf-Rayet and PG1159 CSPNe, wherein a late helium shell flash dredges up carbon-rich intershell material and ejects this material into the circumstellar environment.

  5. Henri Becquerel: serendipitous brilliance

    Science.gov (United States)

    Margaritondo, Giorgio

    2008-06-01

    Serendipity has always been an attendant to great science. Arno Penzias and Robert Wilson discovered the cosmic background radiation after first mistaking it for the effect of pigeon droppings on their microwave antenna. US spy satellites detected gamma-ray bursts when surveying the sky for evidence of secret Soviet nuclear tests during the Cold War. Satyendra Bose arrived at Bose-Einstein statistics only after discovering that a mathematical error explained the experimental data concerning the photoelectric effect. In the words of science-fiction writer Isaac Asimov, "The most exciting phrase in science is not 'Eureka!', but rather, 'That's funny...'.

  6. Exploring the Evolution of Star Formation and Dwarf Galaxy Properties with JWST /MIRI Serendipitous Spectroscopic Surveys

    Energy Technology Data Exchange (ETDEWEB)

    Bonato, Matteo; Sajina, Anna; McKinney, Jed; Marchesini, Danilo; Roebuck, Eric; Shipley, Heath [Department of Physics and Astronomy, Tufts University, 574 Boston Avenue, Medford, MA (United States); Zotti, Gianfranco De [INAF, Osservatorio Astronomico di Padova, Vicolo Osservatorio 5, I-35122 Padova (Italy); Baronchelli, Ivano; Yan, Lin [California Institute of Technology, Pasadena, CA (United States); Negrello, Mattia [School of Physics and Astronomy, Cardiff University, Queens Buildings, The Parade, Cardiff CF24 3AA (United Kingdom); Kurinsky, Noah [Department of Physics, Stanford University, Stanford, CA (United States); Pope, Alexandra [Department of Astronomy, University of Massachusetts Amherst, Amherst, MA (United States); Noriega-Crespo, Alberto [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD (United States); Kirkpatrick, Allison [Department of Astronomy, Yale University, New Haven, CT (United States)

    2017-02-20

    The James Webb Space Telescope ’s Medium Resolution Spectrometer (MRS), will offer nearly two orders of magnitude improvement in sensitivity and >3× improvement in spectral resolution over our previous space-based mid-IR spectrometer, the Spitzer IRS. In this paper, we make predictions for spectroscopic pointed observations and serendipitous detections with the MRS. Specifically, pointed observations of Herschel sources require only a few minutes on source integration for detections of several star-forming and active galactic nucleus lines, out to z = 3 and beyond. But the same data will also include tens of serendipitous 0 ≲ z ≲ 4 galaxies per field with infrared luminosities ranging ∼10{sup 6}–10{sup 13} L {sub ☉}. In particular, for the first time and for free we will be able to explore the L {sub IR} < 10{sup 9} L {sub ☉} regime out to z ∼ 3. We estimate that with ∼ 100 such fields, statistics of these detections will be sufficient to constrain the evolution of the low- L end of the infrared luminosity function, and hence the star formation rate function. The above conclusions hold for a wide range in the potential low- L end of the IR luminosity function, and account for the PAH deficit in low- L , low-metallicity galaxies.

  7. Integrated multisensor perimeter detection systems

    Science.gov (United States)

    Kent, P. J.; Fretwell, P.; Barrett, D. J.; Faulkner, D. A.

    2007-10-01

    The report describes the results of a multi-year programme of research aimed at the development of an integrated multi-sensor perimeter detection system capable of being deployed at an operational site. The research was driven by end user requirements in protective security, particularly in threat detection and assessment, where effective capability was either not available or prohibitively expensive. Novel video analytics have been designed to provide robust detection of pedestrians in clutter while new radar detection and tracking algorithms provide wide area day/night surveillance. A modular integrated architecture based on commercially available components has been developed. A graphical user interface allows intuitive interaction and visualisation with the sensors. The fusion of video, radar and other sensor data provides the basis of a threat detection capability for real life conditions. The system was designed to be modular and extendable in order to accommodate future and legacy surveillance sensors. The current sensor mix includes stereoscopic video cameras, mmWave ground movement radar, CCTV and a commercially available perimeter detection cable. The paper outlines the development of the system and describes the lessons learnt after deployment in a pilot trial.

  8. A serendipitous observation of the gamma-ray burst GRB 921013b field with EUVE

    DEFF Research Database (Denmark)

    Castro-Tirado, A.J.; Gorosabel, J.; Bowyer, S.

    1999-01-01

    hours after the burst is 1.8 x10(-16) erg s(-1) cm(-2) after correction for absorption by the Galactic interstellar medium. Even if we exclude an intrinsic absorption, this is well below the detection limit of the EUVE measurement. Although it is widely accepted that gamma-ray bursts are at cosmological......We report a serendipitous extreme ultraviolet observation by EUVE of the field containing GRB 921013b, similar to 11 hours after its occurrence. This burst was detected on 1992 October 13 by the WATCH and PHEBUS on Granat, and by the GRB experiment on Ulysses. The lack of any transient (or...

  9. Automatic detection, tracking and sensor integration

    Science.gov (United States)

    Trunk, G. V.

    1988-06-01

    This report surveys the state of the art of automatic detection, tracking, and sensor integration. In the area of detection, various noncoherent integrators such as the moving window integrator, feedback integrator, two-pole filter, binary integrator, and batch processor are discussed. Next, the three techniques for controlling false alarms, adapting thresholds, nonparametric detectors, and clutter maps are presented. In the area of tracking, a general outline is given of a track-while-scan system, and then a discussion is presented of the file system, contact-entry logic, coordinate systems, tracking filters, maneuver-following logic, tracking initiating, track-drop logic, and correlation procedures. Finally, in the area of multisensor integration the problems of colocated-radar integration, multisite-radar integration, radar-IFF integration, and radar-DF bearing strobe integration are treated.

  10. Ontologies for interaction : enabling serendipitous interoperability in smart environments

    NARCIS (Netherlands)

    Niezen, G.

    2012-01-01

    The thesis describes the design and development of an ontology and software framework to support user interaction in ubiquitous computing scenarios. The key goal of ubiquitous computing is "serendipitous interoperability", where devices that were not necessarily designed to work together should be

  11. GCN CIRCULAR 21507, LIGO/Virgo G298048: INTEGRAL detection of a prompt gamma-ray counterpart

    DEFF Research Database (Denmark)

    Savchenko, V.; Mereghetti, S.; Ferrigno, C.

    2017-01-01

    We investigated serendipitous INTEGRAL observations carried out at thetime of the LIGO/Virgo burst candidate G298048. The satellite was covering a fraction of the probability of the LIGO-Virgo localization. The best sensitivity depends on the source location. We investigated the SPI-ACS light...... analysis is ongoing, and will be reported in the coming circulars....

  12. Multisignal detecting system of pile integrity testing

    Science.gov (United States)

    Liu, Zuting; Luo, Ying; Yu, Shihai

    2002-05-01

    The low strain reflection wave method plays a principal rule in the integrating detection of base piles. However, there are some deficiencies with this method. For example, there is a blind area of detection on top of the tested pile; it is difficult to recognize the defects at deep-seated parts of the pile; there is still the planar of 3D domino effect, etc. It is very difficult to solve these problems only with the single-transducer pile integrity testing system. A new multi-signal piles integrity testing system is proposed in this paper, which is able to impulse and collect signals on multiple points on top of the pile. By using the multiple superposition data processing method, the detecting system can effectively restrain the interference and elevate the precision and SNR of pile integrity testing. The system can also be applied to the evaluation of engineering structure health.

  13. Integration of control and fault detection

    DEFF Research Database (Denmark)

    Niemann, Hans Henrik; Stoustrup, J.

    The integrated design of control and fault detection is studied. The result of the analysis is that it is possible to separate the design of the controller and the filter for fault detection in the case where the nominal model can be assumed to be fairly accurate. In the uncertain case, however......, the design of the filter and the controller can not be separated when an optiomal design is desired. For systems with significant uncertainties, there turn out to be a fundamental trade-off between the performance in the control loop and the performance in the filter....

  14. Maximum Temperature Detection System for Integrated Circuits

    Science.gov (United States)

    Frankiewicz, Maciej; Kos, Andrzej

    2015-03-01

    The paper describes structure and measurement results of the system detecting present maximum temperature on the surface of an integrated circuit. The system consists of the set of proportional to absolute temperature sensors, temperature processing path and a digital part designed in VHDL. Analogue parts of the circuit where designed with full-custom technique. The system is a part of temperature-controlled oscillator circuit - a power management system based on dynamic frequency scaling method. The oscillator cooperates with microprocessor dedicated for thermal experiments. The whole system is implemented in UMC CMOS 0.18 μm (1.8 V) technology.

  15. Integrated Spintronic Platforms for Biomolecular Recognition Detection

    Science.gov (United States)

    Martins, V. C.; Cardoso, F. A.; Loureiro, J.; Mercier, M.; Germano, J.; Cardoso, S.; Ferreira, R.; Fonseca, L. P.; Sousa, L.; Piedade, M. S.; Freitas, P. P.

    2008-06-01

    This paper covers recent developments in magnetoresistive based biochip platforms fabricated at INESC-MN, and their application to the detection and quantification of pathogenic waterborn microorganisms in water samples for human consumption. Such platforms are intended to give response to the increasing concern related to microbial contaminated water sources. The presented results concern the development of biological active DNA chips and protein chips and the demonstration of the detection capability of the present platforms. Two platforms are described, one including spintronic sensors only (spin-valve based or magnetic tunnel junction based), and the other, a fully scalable platform where each probe site consists of a MTJ in series with a thin film diode (TFD). Two microfluidic systems are described, for cell separation and concentration, and finally, the read out and control integrated electronics are described, allowing the realization of bioassays with a portable point of care unit. The present platforms already allow the detection of complementary biomolecular target recognition with 1 pM concentration.

  16. Serendipitous discovery of quadruply imaged quasars: two diamonds

    Science.gov (United States)

    Lucey, John R.; Schechter, Paul L.; Smith, Russell J.; Anguita, T.

    2018-05-01

    Gravitationally lensed quasars are powerful and versatile astrophysical tools, but they are challengingly rare. In particular, only ˜25 well-characterized quadruple systems are known to date. To refine the target catalogue for the forthcoming Taipan Galaxy Survey, the images of a large number of sources are being visually inspected in order to identify objects that are confused by a foreground star or galaxies that have a distinct multicomponent structure. An unexpected by-product of this work has been the serendipitous discovery of about a dozen galaxies that appear to be lensing quasars, i.e. pairs or quartets of foreground stellar objects in close proximity to the target source. Here, we report two diamond-shaped systems. Follow-up spectroscopy with the IMACS instrument on the 6.5m Magellan Baade telescope confirms one of these as a z = 1.975 quasar quadruply lensed by a double galaxy at z = 0.293. Photometry from publicly available survey images supports the conclusion that the other system is a highly sheared quadruply imaged quasar. In starting with objects thought to be galaxies, our lens finding technique complements the conventional approach of first identifying sources with quasar-like colours and subsequently finding evidence of lensing.

  17. Entrepreneurial Integration Skills

    DEFF Research Database (Denmark)

    Bauer, Florian; Schriber, Svante; King, David R.

    2016-01-01

    on 116 acquisitions, we find that entrepreneurial integration skills can display both advantages and disadvantages. While it helps to realize expected and serendipitous synergies, it can also trigger employee uncertainty due to decreased transparency. In supplementary analysis, we show measures...

  18. A Serendipitous MWA Search for Narrowband Signals from ‘Oumuamua

    Science.gov (United States)

    Tingay, S. J.; Kaplan, D. L.; Lenc, E.; Croft, S.; McKinley, B.; Beardsley, A.; Crosse, B.; Emrich, D.; Franzen, T. M. O.; Gaensler, B. M.; Horsley, L.; Johnston-Hollitt, M.; Kenney, D.; Morales, M. F.; Pallot, D.; Steele, K.; Trott, C. M.; Walker, M.; Wayth, R. B.; Williams, A.; Wu, C.

    2018-04-01

    We examine data from the Murchison Widefield Array (MWA) in the frequency range 72–102 MHz for a field of view that serendipitously contained the interstellar object ‘Oumuamua on 2017 November 28. Observations took place with a time resolution of 0.5 s and a frequency resolution of 10 kHz. Based on the interesting but highly unlikely suggestion that ‘Oumuamua is an interstellar spacecraft, due to some unusual orbital and morphological characteristics, we examine our data for signals that might indicate the presence of intelligent life associated with ‘Oumuamua. We searched our radio data for (1) impulsive narrowband signals, (2) persistent narrowband signals, and (3) impulsive broadband signals. We found no such signals with nonterrestrial origins and make estimates of the upper limits on equivalent isotropic radiated power (EIRP) for these three cases of approximately 7 kW, 840 W, and 100 kW, respectively. These transmitter powers are well within the capabilities of human technologies, and are therefore plausible for alien civilizations. While the chances of positive detection in any given search for extraterrestrial intelligence (SETI) experiment are vanishingly small, the characteristics of new generation telescopes such as the MWA (and, in the future, the Square Kilometre Array) make certain classes of SETI experiments easy, or even a trivial by-product of astrophysical observations. This means that the future costs of SETI experiments are very low, allowing large target lists to partially balance the low probability of a positive detection.

  19. SERENDIPITOUS DISCOVERY OF A PROJECTED PAIR OF QSOs SEPARATED BY 4.5 arcsec ON THE SKY

    Energy Technology Data Exchange (ETDEWEB)

    Heintz, K. E.; Fynbo, J. P. U.; Krogager, J.-K.; Vestergaard, M. [Dark Cosmology Centre, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 Copenhagen O (Denmark); Møller, P.; Arabsalmani, M. [European Southern Observatory, Karl-Schwarzschildstrasse 2, D-85748 Garching (Germany); Geier, S. [Gran Telescopio Canarias (GRANTECAN), Cuesta de San José s/n, E-38712, Breña Baja, La Palma (Spain); Noterdaeme, P. [Institut d’Astrophysique de Paris, CNRS-UPMC, UMR7095, 98bis bd Arago, F-75014 Paris (France); Ledoux, C. [European Southern Observatory, Alonso de Crdova 3107, Vitacura, Casilla 19001, Santiago 19 (Chile); Saturni, F. G. [University of Rome “La Sapienza”, p.le A. Moro 5, I-00185 Rome (Italy); Venemans, B., E-mail: heintz@dark-cosmology.dk [Max-Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany)

    2016-07-01

    We present the serendipitous discovery of a projected pair of quasi-stellar objects (QSOs) with an angular separation of Δ θ = 4.50 arcsec. The redshifts of the two QSOs are widely different: one, our program target, is a QSO with a spectrum consistent with being a narrow line Seyfert 1 active galactic nucleus at z = 2.05. For this target we detect Ly α , C iv, and C iii]. The other QSO, which by chance was included on the spectroscopic slit, is a Type 1 QSO at a redshift of z = 1.68, for which we detect C iv, C iii], and Mg ii. We compare this system to previously detected projected QSO pairs and find that only about a dozen previously known pairs have smaller angular separation.

  20. Counterfeit integrated circuits detection and avoidance

    CERN Document Server

    Tehranipoor, Mark (Mohammad); Forte, Domenic

    2015-01-01

    This timely and exhaustive study offers a much-needed examination of the scope and consequences of the electronic counterfeit trade.  The authors describe a variety of shortcomings and vulnerabilities in the electronic component supply chain, which can result in counterfeit integrated circuits (ICs).  Not only does this book provide an assessment of the current counterfeiting problems facing both the public and private sectors, it also offers practical, real-world solutions for combatting this substantial threat.   ·      Helps beginners and practitioners in the field by providing a comprehensive background on the counterfeiting problem; ·      Presents innovative taxonomies for counterfeit types, test methods, and counterfeit defects, which allows for a detailed analysis of counterfeiting and its mitigation; ·      Provides step-by-step solutions for detecting different types of counterfeit ICs; ·      Offers pragmatic and practice-oriented, realistic solutions to counterfeit IC d...

  1. Searching for propeller-phase ULXs in the XMM-Newton Serendipitous Source Catalogue

    Science.gov (United States)

    Earnshaw, H. P.; Roberts, T. P.; Sathyaprakash, R.

    2018-05-01

    We search for transient sources in a sample of ultraluminous X-ray sources (ULXs) from the 3XMM-DR4 release of the XMM-Newton Serendipitous Source Catalogue in order to find candidate neutron star ULXs alternating between an accreting state and the propeller regime, in which the luminosity drops dramatically. By examining their fluxes and flux upper limits, we identify five ULXs that demonstrate long-term variability of over an order of magnitude. Using Chandra and Swift data to further characterize their light curves, we find that two of these sources are detected only once and could be X-ray binaries in outburst that only briefly reach ULX luminosities. Two others are consistent with being super-Eddington accreting sources with high levels of inter-observation variability. One source, M51 ULX-4, demonstrates apparent bimodal flux behaviour that could indicate the propeller regime. It has a hard X-ray spectrum, but no significant pulsations in its timing data, although with an upper limit of 10 per cent of the signal pulsed at ˜1.5 Hz a pulsating ULX cannot be excluded, particularly if the pulsations are transient. By simulating XMM-Newton observations of a population of pulsating ULXs, we predict that there could be approximately 200 other bimodal ULXs that have not been observed sufficiently well by XMM-Newton to be identified as transient.

  2. ON THE SERENDIPITOUS DISCOVERY OF A Li-RICH GIANT IN THE GLOBULAR CLUSTER NGC 362

    Energy Technology Data Exchange (ETDEWEB)

    D’Orazi, Valentina; Gratton, Raffaele G.; Lucatello, Sara; Momany, Yazan [INAF—Osservatorio Astronomico di Padova, Vicolo dell’Osservatorio 5, I-35122, Padova (Italy); Angelou, George C. [Max Planck Institut für Sonnensystemforschung, Justus-von-Liebig-Weg 3, D-37077 Göttingen (Germany); Bragaglia, Angela; Carretta, Eugenio; Sollima, Antonio [INAF—Osservatorio Astronomico di Bologna, via Ranzani 1, I-40127, Bologna (Italy); Lattanzio, John C., E-mail: valentina.dorazi@oapd.inaf.it [Monash Centre for Astrophysics (MoCA), Monash University, Melbourne, VIC 3800 (Australia)

    2015-03-10

    We have serendipitously identified the first lithium-rich giant star located close to the red giant branch bump in a globular cluster. Through intermediate-resolution FLAMES spectra we derived a lithium abundance of A(Li) = 2.55 (assuming local thermodynamical equilibrium), which is extremely high considering the star’s evolutionary stage. Kinematic and photometric analysis confirm the object as a member of the globular cluster NGC 362. This is the fourth Li-rich giant discovered in a globular cluster, but is the only one known to exist at a luminosity close to the bump magnitude. The three previous detections are clearly more evolved, located close to, or beyond, the tip of their red giant branch. Our observations are able to discard the accretion of planets/brown dwarfs, as well as an enhanced mass-loss mechanism as a formation channel for this rare object. While the star sits just above the cluster bump luminosity, its temperature places it toward the blue side of the giant branch in the color–magnitude diagram. We require further dedicated observations to unambiguously identify the star as a red giant: we are currently unable to confirm whether Li production has occurred at the bump of the luminosity function or if the star is on the pre-zero-age horizontal branch. The latter scenario provides the opportunity for the star to have synthesized Li rapidly during the core helium flash or gradually during its red giant branch ascent via some extra mixing process.

  3. Spectral integration in binaural signal detection

    NARCIS (Netherlands)

    Breebaart, D.J.; Par, van de S.L.J.D.E.; Kohlrausch, A.G.

    1997-01-01

    For both monaural and binaural masking, the spectral content of the masker and of the signal to be detected are important stimulus properties influencing the detection process. It is generally accepted that the auditory system separates the incoming signals in several frequency bands. It is not

  4. How to detect integrability in cellular automata

    International Nuclear Information System (INIS)

    Joshi, N; Lafortune, S

    2005-01-01

    Ultra-discrete equations are generalized cellular automata in the sense that the dependent (and independent) variables take only integer values. We present a new method for identifying integrable ultra-discrete equations which is the equivalent of the singularity confinement property for difference equations and the Painleve property for differential equations. Using this criterion, we find integrable ultra-discrete equations which include the ultra-discrete Painleve equations. (letter to the editor)

  5. Multistage audiovisual integration of speech: dissociating identification and detection.

    Science.gov (United States)

    Eskelund, Kasper; Tuomainen, Jyrki; Andersen, Tobias S

    2011-02-01

    Speech perception integrates auditory and visual information. This is evidenced by the McGurk illusion where seeing the talking face influences the auditory phonetic percept and by the audiovisual detection advantage where seeing the talking face influences the detectability of the acoustic speech signal. Here, we show that identification of phonetic content and detection can be dissociated as speech-specific and non-specific audiovisual integration effects. To this end, we employed synthetically modified stimuli, sine wave speech (SWS), which is an impoverished speech signal that only observers informed of its speech-like nature recognize as speech. While the McGurk illusion only occurred for informed observers, the audiovisual detection advantage occurred for naïve observers as well. This finding supports a multistage account of audiovisual integration of speech in which the many attributes of the audiovisual speech signal are integrated by separate integration processes.

  6. Extragalactic Hard X-ray Surveys: From INTEGRAL to Simbol-X

    Science.gov (United States)

    Paltani, S.; Dwelly, T.; Walter, R.; McHardy, I. M.; Courvoisier, T. J.-L.

    2009-05-01

    We present some results of the deepest extragalactic survey performed by the INTEGRAL satellite. The fraction of very absorbed AGN is quite large. The sharp decrease in the absorption fraction with X-ray luminosity observed at lower-energy X-rays is not observed. The current lack of truly Compton-thick objects, with an upper limit of 14% to the size of this population, is just compatible with recent modeling of the cosmic X-ray background. We also study the prospects for a future hard X-ray serendipitous survey with Simbol-X. We show that Simbol-X will easily detect a large number of serendipitous AGN, allowing us to study the evolution of AGN up to redshifts about 2, opening the door to the cosmological study of hard X-ray selected AGN, which is barely possible with existing satellites like Swift and INTEGRAL.

  7. The NuSTAR Serendipitous Survey: Hunting for the Most Extreme Obscured AGN at >10 keV

    Science.gov (United States)

    Lansbury, G. B.; Alexander, D. M.; Aird, J.; Gandhi, P.; Stern, D.; Koss, M.; Lamperti, I.; Ajello, M.; Annuar, A.; Assef, R. J.; Ballantyne, D. R.; Baloković, M.; Bauer, F. E.; Brandt, W. N.; Brightman, M.; Chen, C.-T. J.; Civano, F.; Comastri, A.; Del Moro, A.; Fuentes, C.; Harrison, F. A.; Marchesi, S.; Masini, A.; Mullaney, J. R.; Ricci, C.; Saez, C.; Tomsick, J. A.; Treister, E.; Walton, D. J.; Zappacosta, L.

    2017-09-01

    We identify sources with extremely hard X-ray spectra (I.e., with photon indices of {{Γ }}≲ 0.6) in the 13 deg2 NuSTAR serendipitous survey, to search for the most highly obscured active galactic nuclei (AGNs) detected at > 10 {keV}. Eight extreme NuSTAR sources are identified, and we use the NuSTAR data in combination with lower-energy X-ray observations (from Chandra, Swift XRT, and XMM-Newton) to characterize the broadband (0.5-24 keV) X-ray spectra. We find that all of the extreme sources are highly obscured AGNs, including three robust Compton-thick (CT; {N}{{H}}> 1.5× {10}24 cm-2) AGNs at low redshift (z< 0.1) and a likely CT AGN at higher redshift (z = 0.16). Most of the extreme sources would not have been identified as highly obscured based on the low-energy (< 10 keV) X-ray coverage alone. The multiwavelength properties (e.g., optical spectra and X-ray-mid-IR luminosity ratios) provide further support for the eight sources being significantly obscured. Correcting for absorption, the intrinsic rest-frame 10-40 keV luminosities of the extreme sources cover a broad range, from ≈ 5× {10}42 to 1045 erg s-1. The estimated number counts of CT AGNs in the NuSTAR serendipitous survey are in broad agreement with model expectations based on previous X-ray surveys, except for the lowest redshifts (z< 0.07), where we measure a high CT fraction of {f}{CT}{obs}={30}-12+16 % . For the small sample of CT AGNs, we find a high fraction of galaxy major mergers (50% ± 33%) compared to control samples of “normal” AGNs.

  8. Train integrity detection risk analysis based on PRISM

    Science.gov (United States)

    Wen, Yuan

    2018-04-01

    GNSS based Train Integrity Monitoring System (TIMS) is an effective and low-cost detection scheme for train integrity detection. However, as an external auxiliary system of CTCS, GNSS may be influenced by external environments, such as uncertainty of wireless communication channels, which may lead to the failure of communication and positioning. In order to guarantee the reliability and safety of train operation, a risk analysis method of train integrity detection based on PRISM is proposed in this article. First, we analyze the risk factors (in GNSS communication process and the on-board communication process) and model them. Then, we evaluate the performance of the model in PRISM based on the field data. Finally, we discuss how these risk factors influence the train integrity detection process.

  9. An integrated microsystem with dielectrophoresis enrichment and impedance detection for detection of Escherichia coli

    Science.gov (United States)

    An integrated microsystem device with matched interdigitated microelectrode chip was fabricated for enrichment and detection of Escherichia coli O157:H7. The microsystem has integrated with positive dielectrophoresis (pDEP) enrichment and in situ impedance detection, whose total volume is only 3.0 ×...

  10. Integrated Giant Magnetoresistance Technology for Approachable Weak Biomagnetic Signal Detections.

    Science.gov (United States)

    Shen, Hui-Min; Hu, Liang; Fu, Xin

    2018-01-07

    With the extensive applications of biomagnetic signals derived from active biological tissue in both clinical diagnoses and human-computer-interaction, there is an increasing need for approachable weak biomagnetic sensing technology. The inherent merits of giant magnetoresistance (GMR) and its high integration with multiple technologies makes it possible to detect weak biomagnetic signals with micron-sized, non-cooled and low-cost sensors, considering that the magnetic field intensity attenuates rapidly with distance. This paper focuses on the state-of-art in integrated GMR technology for approachable biomagnetic sensing from the perspective of discipline fusion between them. The progress in integrated GMR to overcome the challenges in weak biomagnetic signal detection towards high resolution portable applications is addressed. The various strategies for 1/ f noise reduction and sensitivity enhancement in integrated GMR technology for sub-pT biomagnetic signal recording are discussed. In this paper, we review the developments of integrated GMR technology for in vivo/vitro biomagnetic source imaging and demonstrate how integrated GMR can be utilized for biomagnetic field detection. Since the field sensitivity of integrated GMR technology is being pushed to fT/Hz 0.5 with the focused efforts, it is believed that the potential of integrated GMR technology will make it preferred choice in weak biomagnetic signal detection in the future.

  11. Integrated circuit authentication hardware Trojans and counterfeit detection

    CERN Document Server

    Tehranipoor, Mohammad; Zhang, Xuehui

    2013-01-01

    This book describes techniques to verify the authenticity of integrated circuits (ICs). It focuses on hardware Trojan detection and prevention and counterfeit detection and prevention. The authors discuss a variety of detection schemes and design methodologies for improving Trojan detection techniques, as well as various attempts at developing hardware Trojans in IP cores and ICs. While describing existing Trojan detection methods, the authors also analyze their effectiveness in disclosing various types of Trojans, and demonstrate several architecture-level solutions. 

  12. Integrated artificial intelligence algorithm for skin detection

    Directory of Open Access Journals (Sweden)

    Bush Idoko John

    2018-01-01

    Full Text Available The detection of skin colour has been a useful and renowned technique due to its wide range of application in both analyses based on diagnostic and human computer interactions. Various problems could be solved by simply providing an appropriate method for pixel-like skin parts. Presented in this study is a colour segmentation algorithm that works directly in RGB colour space without converting the colour space. Genfis function as used in this study formed the Sugeno fuzzy network and utilizing Fuzzy C-Mean (FCM clustering rule, clustered the data and for each cluster/class a rule is generated. Finally, corresponding output from data mapping of pseudo-polynomial is obtained from input dataset to the adaptive neuro fuzzy inference system (ANFIS.

  13. Multifeature Fusion Vehicle Detection Algorithm Based on Choquet Integral

    Directory of Open Access Journals (Sweden)

    Wenhui Li

    2014-01-01

    Full Text Available Vision-based multivehicle detection plays an important role in Forward Collision Warning Systems (FCWS and Blind Spot Detection Systems (BSDS. The performance of these systems depends on the real-time capability, accuracy, and robustness of vehicle detection methods. To improve the accuracy of vehicle detection algorithm, we propose a multifeature fusion vehicle detection algorithm based on Choquet integral. This algorithm divides the vehicle detection problem into two phases: feature similarity measure and multifeature fusion. In the feature similarity measure phase, we first propose a taillight-based vehicle detection method, and then vehicle taillight feature similarity measure is defined. Second, combining with the definition of Choquet integral, the vehicle symmetry similarity measure and the HOG + AdaBoost feature similarity measure are defined. Finally, these three features are fused together by Choquet integral. Being evaluated on public test collections and our own test images, the experimental results show that our method has achieved effective and robust multivehicle detection in complicated environments. Our method can not only improve the detection rate but also reduce the false alarm rate, which meets the engineering requirements of Advanced Driving Assistance Systems (ADAS.

  14. Multistage audiovisual integration of speech: dissociating identification and detection

    DEFF Research Database (Denmark)

    Eskelund, Kasper; Tuomainen, Jyrki; Andersen, Tobias

    2011-01-01

    Speech perception integrates auditory and visual information. This is evidenced by the McGurk illusion where seeing the talking face influences the auditory phonetic percept and by the audiovisual detection advantage where seeing the talking face influences the detectability of the acoustic speech...... signal. Here we show that identification of phonetic content and detection can be dissociated as speech-specific and non-specific audiovisual integration effects. To this end, we employed synthetically modified stimuli, sine wave speech (SWS), which is an impoverished speech signal that only observers...... informed of its speech-like nature recognize as speech. While the McGurk illusion only occurred for informed observers the audiovisual detection advantage occurred for naïve observers as well. This finding supports a multi-stage account of audiovisual integration of speech in which the many attributes...

  15. The benefits of SCADA integrated pipeline leak detection

    Energy Technology Data Exchange (ETDEWEB)

    Pichler, Ruprecht M.J. [Pichler Engineering GmbH, Munich (Germany)

    2003-07-01

    Software based leak detection and locating for pipelines based upon evaluation of hydraulic parameters is a widely used approach to online pipeline integrity monitoring. Typically, these software packages are installed in a stand-alone configuration with a narrow bandwidth interface to the pipeline SCADA system. However, the performance characteristics of the SCADA system and interface do have a substantial impact on the performance of the leak detection system. By a tight integration of leak detection software into the SCADA system, a source of false alarms typically experienced with leak detection systems can be eliminated, the overall performance of the leak detection system can be improved, and the project costs can be reduced. (author)

  16. An Electrochromatography Chip with Integrated Waveguides for UV Absorbance Detection

    DEFF Research Database (Denmark)

    Gustafsson, Omar; Mogensen, Klaus Bo; Ohlsson, Pelle Daniel

    2008-01-01

    A silicon-based microchip for electrochromatographic separations is presented. Apart from a microfluidic network, the microchip has integrated UV-transparent waveguides for detection and integrated couplers for optical fibers on the chip, yielding the most complete chromatography microchip to date...... to the waveguides. The entire oxidized silicon microchip structure is sealed with a glass lid. Reversed phase electrochromatographic separation of three neutral compounds is demonstrated using UV absorbance detection at 254 nm. Baseline separation of the analytes is achieved in less than two minutes....

  17. Integrated polymer waveguides for absorbance detection in chemical analysis systems

    DEFF Research Database (Denmark)

    Mogensen, Klaus Bo; El-Ali, Jamil; Wolff, Anders

    2003-01-01

    A chemical analysis system for absorbance detection with integrated polymer waveguides is reported for the first time. The fabrication procedure relies on structuring of a single layer of the photoresist SU-8, so both the microfluidic channel network and the optical components, which include planar....... The emphasis of this paper is on the signal-to-noise ratio of the detection and its relation to the sensitivity. Two absorbance cells with an optical path length of 100 μm and 1000 μm were characterized and compared in terms of sensitivity, limit of detection and effective path length for measurements...

  18. Size-selective detection in integrated optical interferometric biosensors

    NARCIS (Netherlands)

    Mulder, Harmen K P; Ymeti, Aurel; Subramaniam, Vinod; Kanger, Johannes S

    2012-01-01

    We present a new size-selective detection method for integrated optical interferometric biosensors that can strongly enhance their performance. We demonstrate that by launching multiple wavelengths into a Young interferometer waveguide sensor it is feasible to derive refractive index changes from

  19. INTEGRAL non detection of renewed activity from Terzan 5

    DEFF Research Database (Denmark)

    Vovk, I.; Kuulkers, E.; Chenevez, Jérôme

    2011-01-01

    The Globular Cluster Terzan5, was observed by the IBIS/ISGRI and JEM-X instruments on-board INTEGRAL during the Galactic Bulge monitoring program (ATel #438) from 2011 October 25 at 17:15 to 2011 October 25 at 20:56 (UTC). No significant X-ray emission was detected in the direction of the Globula...

  20. High sensitive quench detection method using an integrated test wire

    International Nuclear Information System (INIS)

    Fevrier, A.; Tavergnier, J.P.; Nithart, H.; Kiblaire, M.; Duchateau, J.L.

    1981-01-01

    A high sensitive quench detection method which works even in the presence of an external perturbing magnetic field is reported. The quench signal is obtained from the difference in voltages at the superconducting winding terminals and at the terminals at a secondary winding strongly coupled to the primary. The secondary winding could consist of a ''zero-current strand'' of the superconducting cable not connected to one of the winding terminals or an integrated normal test wire inside the superconducting cable. Experimental results on quench detection obtained by this method are described. It is shown that the integrated test wire method leads to efficient and sensitive quench detection, especially in the presence of an external perturbing magnetic field

  1. Epoxy encapsulant as serendipitous dosimeters during radiological/nuclear events

    Energy Technology Data Exchange (ETDEWEB)

    Barkyoumb, J.H. [Carderock Division, Naval Surface Warfare Center, 9500 MacArthur Blvd., West Bethesda, MD 20817-5700 (United States)], E-mail: jhbarky@earthlink.net; Mathur, V.K. [Carderock Division, Naval Surface Warfare Center, 9500 MacArthur Blvd., West Bethesda, MD 20817-5700 (United States)

    2008-02-15

    The radiation response of a smart chip (embedded integrated circuit) module has been reported earlier using the technique of optically stimulated luminescence (OSL). It was found that a smart chip module could be used to evaluate the personnel exposure in the accident dosimetry range. Through subsequent experiments, the radiation sensitivity of the chip module was traced to the epoxy encapsulant provided to protect the chip from the environment and physical damage and that the radiation sensitivity of the epoxy is due to the silica used as the 'filler' for controlling the thixotropic properties of the epoxy used for 'glob top' or 'dam-and-fill' encapsulation. It is desirable to retain the ability to use the smart chip as an accident dosimeter without requiring a modification of standard manufacturing process for which an infrastructure already exists to avoid additional costs. For this reason, we have investigated commercially available filled and unfilled epoxies both as received from the manufacturer and compared their response with epoxies to which commercial fillers are added. In this work we investigate the OSL response of various epoxies commonly used for potting of electronic circuits with and without various filler materials for their potential to be used as a casualty dosimeter in the exposure range of 0.5-10 Gy.

  2. An electrochromatography chip with integrated waveguides for UV absorbance detection

    International Nuclear Information System (INIS)

    Gustafsson, O; Mogensen, K B; Ohlsson, P D; Kutter, J P; Liu, Y; Jacobson, S C

    2008-01-01

    A silicon-based microchip for electrochromatographic separations is presented. Apart from a microfluidic network, the microchip has integrated UV-transparent waveguides for detection and integrated couplers for optical fibers on the chip, yielding the most complete chromatography microchip to date in terms of the integration of optical components. The microfluidic network and the optical components are fabricated in a single etching step in silicon and subsequently thermally oxidized. The separation column consists of a regular array of microfabricated solid support structures with a monolayer of an octylsilane covalently bonded to the surfaces to provide chromatographic interaction. The chip features a 1 mm long U-shaped detection cell and planar silicon dioxide waveguides that couple light to and from the detection cell. Microfabricated on-chip fiber couplers assure perfect alignment of optical fibers to the waveguides. The entire oxidized silicon microchip structure is sealed with a glass lid. Reversed phase electrochromatographic separation of three neutral compounds is demonstrated using UV absorbance detection at 254 nm. Baseline separation of the analytes is achieved in less than two minutes

  3. Integrated MEMS/NEMS Resonant Cantilevers for Ultrasensitive Biological Detection

    Directory of Open Access Journals (Sweden)

    Xinxin Li

    2009-01-01

    Full Text Available The paper reviews the recent researches implemented in Chinese Academy of Sciences, with achievements on integrated resonant microcantilever sensors. In the resonant cantilevers, the self-sensing elements and resonance exciting elements are both top-down integrated with silicon micromachining techniques. Quite a lot of effort is focused on optimization of the resonance mode and sensing structure for improvement of sensitivity. On the other hand, to enable the micro-cantilevers specifically sensitive to bio/chemical molecules, sensing materials are developed and modified on the cantilever surface with a self-assembled monolayer (SAM based bottom-up construction and surface functionalization. To improve the selectivity of the sensors and depress environmental noise, multiple and localized surface modifications are developed. The achieved volume production capability and satisfactory detecting resolution to trace-level biological antigen of alpha-fetoprotein (AFP give the micro-cantilever sensors a great promise for rapid and high-resoluble detection.

  4. INTEGRAL detects renewed activity from IGR J11435-6109

    DEFF Research Database (Denmark)

    Fiocchi, M.; Chenevez, J.; Sguera, V.

    2015-01-01

    During a recent INTEGRAL public observation of Musca region, performed between 2015-12-11 17:54 and 2015-12-12 12:54 (UTC), renewed activity from the transient X-ray pulsar IGR J11435-6109 has been detected. The 22-60 keV IBIS/ISGRI flux corresponds to (10+/-1) mCrab with an effective exposure time...

  5. RADIA: RNA and DNA integrated analysis for somatic mutation detection.

    Directory of Open Access Journals (Sweden)

    Amie J Radenbaugh

    Full Text Available The detection of somatic single nucleotide variants is a crucial component to the characterization of the cancer genome. Mutation calling algorithms thus far have focused on comparing the normal and tumor genomes from the same individual. In recent years, it has become routine for projects like The Cancer Genome Atlas (TCGA to also sequence the tumor RNA. Here we present RADIA (RNA and DNA Integrated Analysis, a novel computational method combining the patient-matched normal and tumor DNA with the tumor RNA to detect somatic mutations. The inclusion of the RNA increases the power to detect somatic mutations, especially at low DNA allelic frequencies. By integrating an individual's DNA and RNA, we are able to detect mutations that would otherwise be missed by traditional algorithms that examine only the DNA. We demonstrate high sensitivity (84% and very high precision (98% and 99% for RADIA in patient data from endometrial carcinoma and lung adenocarcinoma from TCGA. Mutations with both high DNA and RNA read support have the highest validation rate of over 99%. We also introduce a simulation package that spikes in artificial mutations to patient data, rather than simulating sequencing data from a reference genome. We evaluate sensitivity on the simulation data and demonstrate our ability to rescue back mutations at low DNA allelic frequencies by including the RNA. Finally, we highlight mutations in important cancer genes that were rescued due to the incorporation of the RNA.

  6. Integral Sensor Fault Detection and Isolation for Railway Traction Drive.

    Science.gov (United States)

    Garramiola, Fernando; Del Olmo, Jon; Poza, Javier; Madina, Patxi; Almandoz, Gaizka

    2018-05-13

    Due to the increasing importance of reliability and availability of electric traction drives in Railway applications, early detection of faults has become an important key for Railway traction drive manufacturers. Sensor faults are important sources of failures. Among the different fault diagnosis approaches, in this article an integral diagnosis strategy for sensors in traction drives is presented. Such strategy is composed of an observer-based approach for direct current (DC)-link voltage and catenary current sensors, a frequency analysis approach for motor current phase sensors and a hardware redundancy solution for speed sensors. None of them requires any hardware change requirement in the actual traction drive. All the fault detection and isolation approaches have been validated in a Hardware-in-the-loop platform comprising a Real Time Simulator and a commercial Traction Control Unit for a tram. In comparison to safety-critical systems in Aerospace applications, Railway applications do not need instantaneous detection, and the diagnosis is validated in a short time period for reliable decision. Combining the different approaches and existing hardware redundancy, an integral fault diagnosis solution is provided, to detect and isolate faults in all the sensors installed in the traction drive.

  7. Integrated immunoassay using tuneable surface acoustic waves and lensfree detection.

    Science.gov (United States)

    Bourquin, Yannyk; Reboud, Julien; Wilson, Rab; Zhang, Yi; Cooper, Jonathan M

    2011-08-21

    The diagnosis of infectious diseases in the Developing World is technologically challenging requiring complex biological assays with a high analytical performance, at minimal cost. By using an opto-acoustic immunoassay technology, integrating components commonly used in mobile phone technologies, including surface acoustic wave (SAW) transducers to provide pressure driven flow and a CMOS camera to enable lensfree detection technique, we demonstrate the potential to produce such an assay. To achieve this, antibody functionalised microparticles were manipulated on a low-cost disposable cartridge using the surface acoustic waves and were then detected optically. Our results show that the biomarker, interferon-γ, used for the diagnosis of diseases such as latent tuberculosis, can be detected at pM concentrations, within a few minutes (giving high sensitivity at a minimal cost). This journal is © The Royal Society of Chemistry 2011

  8. Integrated situational awareness for cyber attack detection, analysis, and mitigation

    Science.gov (United States)

    Cheng, Yi; Sagduyu, Yalin; Deng, Julia; Li, Jason; Liu, Peng

    2012-06-01

    Real-time cyberspace situational awareness is critical for securing and protecting today's enterprise networks from various cyber threats. When a security incident occurs, network administrators and security analysts need to know what exactly has happened in the network, why it happened, and what actions or countermeasures should be taken to quickly mitigate the potential impacts. In this paper, we propose an integrated cyberspace situational awareness system for efficient cyber attack detection, analysis and mitigation in large-scale enterprise networks. Essentially, a cyberspace common operational picture will be developed, which is a multi-layer graphical model and can efficiently capture and represent the statuses, relationships, and interdependencies of various entities and elements within and among different levels of a network. Once shared among authorized users, this cyberspace common operational picture can provide an integrated view of the logical, physical, and cyber domains, and a unique visualization of disparate data sets to support decision makers. In addition, advanced analyses, such as Bayesian Network analysis, will be explored to address the information uncertainty, dynamic and complex cyber attack detection, and optimal impact mitigation issues. All the developed technologies will be further integrated into an automatic software toolkit to achieve near real-time cyberspace situational awareness and impact mitigation in large-scale computer networks.

  9. Research on Integrated Geophysics Detect Potential Ground Fissure in City

    Science.gov (United States)

    Qian, R.

    2017-12-01

    North China confined aquifer lied 70 to 200 meters below the earth's surface has been exploited for several decades, which resulted in confined water table declining and has generated a mass of ground fissure. Some of them has reached the surface and the other is developing. As it is very difficult to stop the ground fissure coming into being, measures of avoiding are often taken. It brings great potential risk to urban architecture and municipal engineering. It is very important to find out specific distribution and characteristic of potential ground fissure in city with high resolution. The ground fissure is concealed, therefor, geophysical method is an important technology to detecting concealed ground fissure. However, it is very difficult to detect the characteristics of the superficial part of ground fissure directly, as it lies dozens of meters below and has only scores of centimeters fault displacement. This paper studies applied ground penetration radar, surface wave and shallow refleciton seismic to detect ground fissure. It sets up model of surface by taking advantage of high resolution of ground penetrating radar data, constrains Reilay wave inversion and improves its resolution. The high resolution reflection seismic is good at detecting the geology structure. The data processing and interpretation technique is developmented to avoid the pitfall and improve the aliability of the rusult. The experiment has been conducted in Shunyi District, Beijing in 2016. 5 lines were settled to collect data of integrated geophysical method. Development zone of concealed ground fissure was found and its ultra shallow layer location was detected by ground penetrating radar. A trial trench of 6 meters in depth was dug and obvious ground fissure development was found. Its upper end was 1.5 meters beneath the earth's surface with displacement of 0.3 meters. The favorable effect of this detection has provided a new way for detecting ground fissure in cities of China, such

  10. UAS Integration in the NAS: Detect and Avoid

    Science.gov (United States)

    Shively, Jay

    2018-01-01

    This presentation will cover the structure of the unmanned aircraft systems (UAS) integration into the national airspace system (NAS) project (UAS-NAS Project). The talk also details the motivation of the project to help develop standards for a detect-and-avoid (DAA) system, which is required in order to comply with requirements in manned aviation to see-and-avoid other traffic so as to maintain well clear. The presentation covers accomplishments reached by the project in Phase 1 of the research, and touches on the work to be done in Phase 2. The discussion ends with examples of the display work developed as a result of the Phase 1 research.

  11. Integrated Micro-Optical Fluorescence Detection System for Microfluidic Electrochromatography

    International Nuclear Information System (INIS)

    ALLERMAN, ANDREW A.; ARNOLD, DON W.; ASBILL, RANDOLPH E.; BAILEY, CHRISTOPHER G.; CARTER, TONY RAY; KEMME, SHANALYN A.; MATZKE, CAROLYN M.; SAMORA, SALLY; SWEATT, WILLIAM C.; WARREN, MIAL E.; WENDT, JOEL R.

    1999-01-01

    The authors describe the design and microfabrication of an extremely compact optical system as a key element in an integrated capillary-channel electrochromatograph with laser induced fluorescence detection. The optical design uses substrate-mode propagation within the fused silica substrate. The optical system includes a vertical cavity surface-emitting laser (VCSEL) array, two high performance microlenses and a commercial photodetector. The microlenses are multilevel diffractive optics patterned by electron beam lithography and etched by reactive ion etching in fused silica. Two generations of optical subsystems are described. The first generation design is integrated directly onto the capillary channel-containing substrate with a 6 mm separation between the VCSEL and photodetector. The second generation design separates the optical system onto its own module and the source to detector length is further compressed to 3.5 mm. The systems are designed for indirect fluorescence detection using infrared dyes. The first generation design has been tested with a 750 nm VCSEL exciting a 10(sup -4) M solution of CY-7 dye. The observed signal-to-noise ratio of better than 100:1 demonstrates that the background signal from scattered pump light is low despite the compact size of the optical system and meets the system sensitivity requirements

  12. Integrating Pavement Crack Detection and Analysis Using Autonomous Unmanned Aerial Vehicle Imagery

    Science.gov (United States)

    2015-03-27

    INTEGRATING PAVEMENT CRACK DETECTION AND ANALYSIS USING AUTONOMOUS UNMANNED AERIAL VEHICLE...protection in the United States. AFIT-ENV-MS-15-M-195 INTEGRATING PAVEMENT CRACK DETECTION AND ANALYSIS USING AUTONOMOUS UNMANNED AERIAL...APPROVED FOR PUBLIC RELEASE; DISTRIBUTION UNLIMITED. AFIT-ENV-MS-15-M-195 INTEGRATING PAVEMENT CRACK DETECTION AND ANALYSIS USING AUTONOMOUS

  13. Integrating physically based simulators with Event Detection Systems: Multi-site detection approach.

    Science.gov (United States)

    Housh, Mashor; Ohar, Ziv

    2017-03-01

    The Fault Detection (FD) Problem in control theory concerns of monitoring a system to identify when a fault has occurred. Two approaches can be distinguished for the FD: Signal processing based FD and Model-based FD. The former concerns of developing algorithms to directly infer faults from sensors' readings, while the latter uses a simulation model of the real-system to analyze the discrepancy between sensors' readings and expected values from the simulation model. Most contamination Event Detection Systems (EDSs) for water distribution systems have followed the signal processing based FD, which relies on analyzing the signals from monitoring stations independently of each other, rather than evaluating all stations simultaneously within an integrated network. In this study, we show that a model-based EDS which utilizes a physically based water quality and hydraulics simulation models, can outperform the signal processing based EDS. We also show that the model-based EDS can facilitate the development of a Multi-Site EDS (MSEDS), which analyzes the data from all the monitoring stations simultaneously within an integrated network. The advantage of the joint analysis in the MSEDS is expressed by increased detection accuracy (higher true positive alarms and fewer false alarms) and shorter detection time. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. SDSS-IV MaNGA: A Serendipitous Observation of a Potential Gas Accretion Event

    Science.gov (United States)

    Cheung, Edmond; Stark, David V.; Huang, Song; Rubin, Kate H. R.; Lin, Lihwai; Tremonti, Christy; Zhang, Kai; Yan, Renbin; Bizyaev, Dmitry; Boquien, Médéric; Brownstein, Joel R.; Drory, Niv; Gelfand, Joseph D.; Knapen, Johan H.; Maiolino, Roberto; Malanushenko, Olena; Masters, Karen L.; Merrifield, Michael R.; Pace, Zach; Pan, Kaike; Riffel, Rogemar A.; Roman-Lopes, Alexandre; Rujopakarn, Wiphu; Schneider, Donald P.; Stott, John P.; Thomas, Daniel; Weijmans, Anne-Marie

    2016-12-01

    The nature of warm, ionized gas outside of galaxies may illuminate several key galaxy evolutionary processes. A serendipitous observation by the MaNGA survey has revealed a large, asymmetric Hα complex with no optical counterpart that extends ≈8″ (≈6.3 kpc) beyond the effective radius of a dusty, starbursting galaxy. This Hα extension is approximately three times the effective radius of the host galaxy and displays a tail-like morphology. We analyze its gas-phase metallicities, gaseous kinematics, and emission-line ratios and discuss whether this Hα extension could be diffuse ionized gas, a gas accretion event, or something else. We find that this warm, ionized gas structure is most consistent with gas accretion through recycled wind material, which could be an important process that regulates the low-mass end of the galaxy stellar mass function.

  15. SDSS-IV MaNGA: A SERENDIPITOUS OBSERVATION OF A POTENTIAL GAS ACCRETION EVENT

    International Nuclear Information System (INIS)

    Cheung, Edmond; Stark, David V.; Huang, Song; Rubin, Kate H. R.; Lin, Lihwai; Tremonti, Christy; Zhang, Kai; Yan, Renbin; Bizyaev, Dmitry; Malanushenko, Olena; Boquien, Médéric; Brownstein, Joel R.; Drory, Niv; Gelfand, Joseph D.; Knapen, Johan H.; Maiolino, Roberto; Masters, Karen L.

    2016-01-01

    The nature of warm, ionized gas outside of galaxies may illuminate several key galaxy evolutionary processes. A serendipitous observation by the MaNGA survey has revealed a large, asymmetric H α complex with no optical counterpart that extends ≈8″ (≈6.3 kpc) beyond the effective radius of a dusty, starbursting galaxy. This H α extension is approximately three times the effective radius of the host galaxy and displays a tail-like morphology. We analyze its gas-phase metallicities, gaseous kinematics, and emission-line ratios and discuss whether this H α extension could be diffuse ionized gas, a gas accretion event, or something else. We find that this warm, ionized gas structure is most consistent with gas accretion through recycled wind material, which could be an important process that regulates the low-mass end of the galaxy stellar mass function.

  16. SDSS-IV MaNGA: A SERENDIPITOUS OBSERVATION OF A POTENTIAL GAS ACCRETION EVENT

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, Edmond; Stark, David V.; Huang, Song [Kavli Institute for the Physics and Mathematics of the Universe (WPI), The University of Tokyo Institutes for Advanced Study, The University of Tokyo, Kashiwa, Chiba 277-8583 (Japan); Rubin, Kate H. R. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Lin, Lihwai [Institute of Astronomy and Astrophysics, Academia Sinica, Taipei 106, Taiwan (China); Tremonti, Christy [Department of Astronomy, University of Wisconsin–Madison, 475 North Charter Street, Madison, WI 53706 (United States); Zhang, Kai; Yan, Renbin [Department of Physics and Astronomy, University of Kentucky, 505 Rose Street, Lexington, KY 40506-0055 (United States); Bizyaev, Dmitry; Malanushenko, Olena [Apache Point Observatory and New Mexico State University, P.O. Box 59, Sunspot, NM, 88349-0059 (United States); Boquien, Médéric [Unidad de Astronomía, Universidad de Antofagasta, Avenida Angamos 601, Antofagasta 1270300 (Chile); Brownstein, Joel R. [Department of Physics and Astronomy, University of Utah, 115 S. 1400 E., Salt Lake City, UT 84112 (United States); Drory, Niv [McDonald Observatory, Department of Astronomy, University of Texas at Austin, 1 University Station, Austin, TX 78712-0259 (United States); Gelfand, Joseph D. [NYU Abu Dhabi, P.O. Box 129188, Abu Dhabi (United Arab Emirates); Knapen, Johan H. [Instituto de Astrofísica de Canarias, E-38205 La Laguna, Tenerife (Spain); Maiolino, Roberto [Cavendish Laboratory, University of Cambridge, 19 J. J. Thomson Avenue, Cambridge CB3 0HE (United Kingdom); Masters, Karen L., E-mail: ec2250@gmail.com [Institute for Cosmology and Gravitation, University of Portsmouth, Dennis Sciama Building, Burnaby Road, Portsmouth PO1 3FX (United Kingdom); and others

    2016-12-01

    The nature of warm, ionized gas outside of galaxies may illuminate several key galaxy evolutionary processes. A serendipitous observation by the MaNGA survey has revealed a large, asymmetric H α complex with no optical counterpart that extends ≈8″ (≈6.3 kpc) beyond the effective radius of a dusty, starbursting galaxy. This H α extension is approximately three times the effective radius of the host galaxy and displays a tail-like morphology. We analyze its gas-phase metallicities, gaseous kinematics, and emission-line ratios and discuss whether this H α extension could be diffuse ionized gas, a gas accretion event, or something else. We find that this warm, ionized gas structure is most consistent with gas accretion through recycled wind material, which could be an important process that regulates the low-mass end of the galaxy stellar mass function.

  17. ESA's Integral detects closest cosmic gamma-ray burst

    Science.gov (United States)

    2004-08-01

    5 August 2004 A gamma-ray burst detected by ESA's Integral gamma-ray observatory on 3 December 2003 has been thoroughly studied for months by an armada of space and ground-based observatories. Astronomers have now concluded that this event, called GRB 031203, is the closest cosmic gamma-ray burst on record, but also the faintest. This also suggests that an entire population of sub-energetic gamma-ray bursts has so far gone unnoticed... Gamma ray burst model hi-res Size hi-res: 22 KB Credits: CXC/M. Weiss Artist impression of a low-energy gamma-ray burst This illustration describes a model for a gamma-ray burst, like the one detected by Integral on 3 December 2003 (GRB 031203). A jet of high-energy particles from a rapidly rotating black hole interacts with surrounding matter. Observations with Integral on 3 December 2003 and data on its afterglow, collected afterwards with XMM-Newton, Chandra and the Very Large Array telescope, show that GRB 031203 radiated only a fraction of the energy of normal gamma-ray bursts. Like supernovae, gamma-ray bursts are thought to be produced by the collapse of the core of a massive star. However, while the process leading to supernovae is relatively well understood, astronomers still do not know what happens when a core collapses to form a black hole. The discovery of 'under-energetic' gamma-ray bursts, like GRB 031203, should provide valuable clues as to links between supernovae, black holes and gamma-ray bursts. Lo-res JPG (22 Kb) Hi-res TIFF (5800 Kb) Cosmic gamma-ray bursts (GRBs) are flashes of gamma rays that can last from less than a second to a few minutes and occur at random positions in the sky. A large fraction of them is thought to result when a black hole is created from a dying star in a distant galaxy. Astronomers believe that a hot disc surrounding the black hole, made of gas and matter falling onto it, somehow emits an energetic beam parallel to the axis of rotation. According to the simplest picture, all GRBs

  18. An integrated leak detection system for the ALMR steam generator

    International Nuclear Information System (INIS)

    Dayal, Y.; Gaubatz, D.C.; Wong, K.K.; Greene, D.A.

    1995-01-01

    The steam generator (SG) of the Advanced Liquid Metal Reactor (ALMR) system serves as a heat exchanger between the shell side secondary loop hot liquid sodium and the tube side water/steam mixture. A leak in the tube will result in the injection of the higher pressure water/steam into the sodium and cause an exothermic sodium-water reaction. An initial small leak (less than 1 gm/sec) can escalate into an intermediate size leak in a relatively short time by self enlargement of the original flaw and by initiating leaks in neighboring tubes. If not stopped, complete rupture of one or more tubes can cause injection rates of thousands of gm/sec and result in the over pressurization of the secondary loop rupture disk and dumping of the sodium to relieve pressure. The down time associated with severe sodium-water reaction damage has great adverse economic consequence. An integrated leak detection system (ILDS) has been developed which utilizes both chemical and acoustic sensors for improved leak detection. The system provides SG leak status to the reactor operator and is reliable enough to trigger automatic control action to protect the SG. The ILDS chemical subsystem uses conventional in-sodium and cover gas hydrogen detectors and incorporates knowledge based effects due to process parameters for improved reliability. The ILDS acoustic subsystem uses an array of acoustic sensors and incorporates acoustic beamforming technology for highly reliable and accurate leak identification and location. The new ILDS combines the small leak detection capability of the chemical system with the reliability and rapid detection/location capability of the acoustic system to provide a significantly improved level of protection for the SG over a wide range of operation conditions. (author)

  19. Ultrafast electron microscopy integrated with a direct electron detection camera

    Directory of Open Access Journals (Sweden)

    Young Min Lee

    2017-07-01

    Full Text Available In the past decade, we have witnessed the rapid growth of the field of ultrafast electron microscopy (UEM, which provides intuitive means to watch atomic and molecular motions of matter. Yet, because of the limited current of the pulsed electron beam resulting from space-charge effects, observations have been mainly made to periodic motions of the crystalline structure of hundreds of nanometers or higher by stroboscopic imaging at high repetition rates. Here, we develop an advanced UEM with robust capabilities for circumventing the present limitations by integrating a direct electron detection camera for the first time which allows for imaging at low repetition rates. This approach is expected to promote UEM to a more powerful platform to visualize molecular and collective motions and dissect fundamental physical, chemical, and materials phenomena in space and time.

  20. Ultrafast electron microscopy integrated with a direct electron detection camera.

    Science.gov (United States)

    Lee, Young Min; Kim, Young Jae; Kim, Ye-Jin; Kwon, Oh-Hoon

    2017-07-01

    In the past decade, we have witnessed the rapid growth of the field of ultrafast electron microscopy (UEM), which provides intuitive means to watch atomic and molecular motions of matter. Yet, because of the limited current of the pulsed electron beam resulting from space-charge effects, observations have been mainly made to periodic motions of the crystalline structure of hundreds of nanometers or higher by stroboscopic imaging at high repetition rates. Here, we develop an advanced UEM with robust capabilities for circumventing the present limitations by integrating a direct electron detection camera for the first time which allows for imaging at low repetition rates. This approach is expected to promote UEM to a more powerful platform to visualize molecular and collective motions and dissect fundamental physical, chemical, and materials phenomena in space and time.

  1. Complex Building Detection Through Integrating LIDAR and Aerial Photos

    Science.gov (United States)

    Zhai, R.

    2015-02-01

    This paper proposes a new approach on digital building detection through the integration of LiDAR data and aerial imagery. It is known that most building rooftops are represented by different regions from different seed pixels. Considering the principals of image segmentation, this paper employs a new region based technique to segment images, combining both the advantages of LiDAR and aerial images together. First, multiple seed points are selected by taking several constraints into consideration in an automated way. Then, the region growing procedures proceed by combining the elevation attribute from LiDAR data, visibility attribute from DEM (Digital Elevation Model), and radiometric attribute from warped images in the segmentation. Through this combination, the pixels with similar height, visibility, and spectral attributes are merged into one region, which are believed to represent the whole building area. The proposed methodology was implemented on real data and competitive results were achieved.

  2. Detection of a novel, integrative aging process suggests complex physiological integration.

    Science.gov (United States)

    Cohen, Alan A; Milot, Emmanuel; Li, Qing; Bergeron, Patrick; Poirier, Roxane; Dusseault-Bélanger, Francis; Fülöp, Tamàs; Leroux, Maxime; Legault, Véronique; Metter, E Jeffrey; Fried, Linda P; Ferrucci, Luigi

    2015-01-01

    Many studies of aging examine biomarkers one at a time, but complex systems theory and network theory suggest that interpretations of individual markers may be context-dependent. Here, we attempted to detect underlying processes governing the levels of many biomarkers simultaneously by applying principal components analysis to 43 common clinical biomarkers measured longitudinally in 3694 humans from three longitudinal cohort studies on two continents (Women's Health and Aging I & II, InCHIANTI, and the Baltimore Longitudinal Study on Aging). The first axis was associated with anemia, inflammation, and low levels of calcium and albumin. The axis structure was precisely reproduced in all three populations and in all demographic sub-populations (by sex, race, etc.); we call the process represented by the axis "integrated albunemia." Integrated albunemia increases and accelerates with age in all populations, and predicts mortality and frailty--but not chronic disease--even after controlling for age. This suggests a role in the aging process, though causality is not yet clear. Integrated albunemia behaves more stably across populations than its component biomarkers, and thus appears to represent a higher-order physiological process emerging from the structure of underlying regulatory networks. If this is correct, detection of this process has substantial implications for physiological organization more generally.

  3. Detection of a novel, integrative aging process suggests complex physiological integration.

    Directory of Open Access Journals (Sweden)

    Alan A Cohen

    Full Text Available Many studies of aging examine biomarkers one at a time, but complex systems theory and network theory suggest that interpretations of individual markers may be context-dependent. Here, we attempted to detect underlying processes governing the levels of many biomarkers simultaneously by applying principal components analysis to 43 common clinical biomarkers measured longitudinally in 3694 humans from three longitudinal cohort studies on two continents (Women's Health and Aging I & II, InCHIANTI, and the Baltimore Longitudinal Study on Aging. The first axis was associated with anemia, inflammation, and low levels of calcium and albumin. The axis structure was precisely reproduced in all three populations and in all demographic sub-populations (by sex, race, etc.; we call the process represented by the axis "integrated albunemia." Integrated albunemia increases and accelerates with age in all populations, and predicts mortality and frailty--but not chronic disease--even after controlling for age. This suggests a role in the aging process, though causality is not yet clear. Integrated albunemia behaves more stably across populations than its component biomarkers, and thus appears to represent a higher-order physiological process emerging from the structure of underlying regulatory networks. If this is correct, detection of this process has substantial implications for physiological organization more generally.

  4. Medicine Delivery Device with Integrated Sterilization and Detection

    Science.gov (United States)

    Shearn, Michael J.; Greer, Harold F.; Manohara, Harish

    2013-01-01

    Sterile delivery devices can be created by integrating a medicine delivery instrument with surfaces that are coated with germicidal and anti-fouling material. This requires that a large-surface-area template be developed within a constrained volume to ensure good contact between the delivered medicine and the germicidal material. Both of these can be integrated using JPL-developed silicon nanotip or cryo-etch black silicon technologies with atomic layer deposition (ALD) coating of specific germicidal layers. The application of semiconductor processing techniques and technologies to the problems of fluid manipulation and delivery has enabled the integration of chemical, electrical, and mechanical manipulation of samples all within a single microfluidic device. This approach has been successfully applied at JPL to the automated processing, detection, and analysis of minute quantities (parts per trillion level) of biomaterials to develop instruments for in situ exploration or extraterrestrial bodies. The same nanofabrication techniques that are used to produce a microfluidics device are also capable of synthesizing extremely high-surface-area templates in precise locations, and coating those surfaces with conformal films to manipulate their surface properties. This methodology has been successfully applied at JPL to produce patterned and coated silicon nanotips (also known as black silicon) to manipulate the hydrophilicity of surfaces to direct the spreading of fluids in microdevices. JPL's ALD technique is an ideal method to produce the highly conformal coatings required for this type of application. Certain materials, such as TiO2, have germicidal and anti-fouling properties when they are illuminated with UV light. The proposed delivery device contacts medicine with this high-surface-area black silicon surface coated with a thin-film germicidal deposited conformally with ALD. The coating can also be illuminated with ultraviolet light for the purpose of sterilization

  5. An integrated micro-chip for rapid detection of magnetic particles

    KAUST Repository

    Gooneratne, Chinthaka P.; Liang, Cai; Giouroudi, Ioanna; Kosel, Jü rgen

    2012-01-01

    This paper proposes an integrated micro-chip for the manipulation and detection of magnetic particles (MPs). A conducting ring structure is used to manipulate MPs toward giant magnetoresistance(GMR) sensing elements for rapid detection

  6. An Integrated Intrusion Detection Model of Cluster-Based Wireless Sensor Network.

    Science.gov (United States)

    Sun, Xuemei; Yan, Bo; Zhang, Xinzhong; Rong, Chuitian

    2015-01-01

    Considering wireless sensor network characteristics, this paper combines anomaly and mis-use detection and proposes an integrated detection model of cluster-based wireless sensor network, aiming at enhancing detection rate and reducing false rate. Adaboost algorithm with hierarchical structures is used for anomaly detection of sensor nodes, cluster-head nodes and Sink nodes. Cultural-Algorithm and Artificial-Fish-Swarm-Algorithm optimized Back Propagation is applied to mis-use detection of Sink node. Plenty of simulation demonstrates that this integrated model has a strong performance of intrusion detection.

  7. Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems

    Directory of Open Access Journals (Sweden)

    Carl A. Batt

    2009-05-01

    Full Text Available The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform.

  8. Uncovering extreme AGN variability in serendipitous X-ray source surveys

    Science.gov (United States)

    Moran, Edward C.; Garcia Soto, Aylin; LaMassa, Stephanie; Urry, Meg

    2018-01-01

    Constraints on the duty cycle and duration of accretion episodes in active galactic nuclei (AGNs) are vital for establishing how most AGNs are fueled, which is essential for a complete picture of black hole/galaxy co-evolution. Perhaps the best handle we have on these activity parameters is provided by AGNs that have displayed dramatic changes in their bolometric luminosities and, in some cases, spectroscopic classifications. Given that X-ray emission is directly linked to black-hole accretion, X-ray surveys should provide a straightforward means of identifying AGNs that have undergone dramatic changes in their accretion states. However, it appears that such events are very rare, so wide-area surveys separated in time by many years are needed to maximize discovery rates. We have cross-correlated the Einstein IPC Two-Sigma Catalog with the ROSAT All-Sky Survey Faint Source Catalog to identify a sample of soft X-ray sources that varied by factors ranging from 7 to more than 100 over a ten year timescale. When possible, we have constructed long-term X-ray light curves for the sources by combining the Einstein and RASS fluxes with those obtained from serendipitous pointed observations by ROSAT, Chandra,XMM, and Swift. Optical follow-up observations indicate that many of the extremely variable sources in our sample are indeed radio-quiet AGNs. Interestingly, the majority of objects that dimmed between ~1980 and ~1990 are still (or are again) broad-line AGNs rather than“changing-look” candidates that have more subtle AGN signatures in their spectra — despite the fact that none of the sources examined thus far has returned to its highest observed luminosity. Future X-ray observations will provide the opportunity to characterize the X-ray behavior of these anonymous, extreme AGNs over a four decade span.

  9. Outburst from the SFXT IGR J17544-2619 detected by INTEGRAL

    DEFF Research Database (Denmark)

    Paizis, A.; Kuulkers, E.; Chenevez, J.

    2015-01-01

    During public INTEGRAL Galactic bulge monitoring observations (ATel #438) performed on 2015 February 20-21 at UT 23:04-02:45, we detected the SFXT IGR J17544-2619 (see ATel #7137 for the recent Swift detection of the source outburst). The source was detected using IBIS/ISGRI in the 18-40 keV rang...

  10. An Integrative Approach to Accurate Vehicle Logo Detection

    Directory of Open Access Journals (Sweden)

    Hao Pan

    2013-01-01

    required for many applications in intelligent transportation systems and automatic surveillance. The task is challenging considering the small target of logos and the wide range of variability in shape, color, and illumination. A fast and reliable vehicle logo detection approach is proposed following visual attention mechanism from the human vision. Two prelogo detection steps, that is, vehicle region detection and a small RoI segmentation, rapidly focalize a small logo target. An enhanced Adaboost algorithm, together with two types of features of Haar and HOG, is proposed to detect vehicles. An RoI that covers logos is segmented based on our prior knowledge about the logos’ position relative to license plates, which can be accurately localized from frontal vehicle images. A two-stage cascade classier proceeds with the segmented RoI, using a hybrid of Gentle Adaboost and Support Vector Machine (SVM, resulting in precise logo positioning. Extensive experiments were conducted to verify the efficiency of the proposed scheme.

  11. Symbol lock detection implemented with nonoverlapping integration intervals

    Science.gov (United States)

    Shihabi, Mazen M. (Inventor); Hinedi, Sami M. (Inventor); Shah, Biren N. (Inventor)

    1995-01-01

    A symbol lock detector is introduced for an incoming coherent digital communication signal which utilizes a subcarrier modulated with binary symbol data, d(sub k), and known symbol interval T by integrating binary values of the signal over nonoverlapping first and second intervals selected to be T/2, delaying the first integral an interval T/2, and either summing or multiplying the second integral with the first one that preceded it to form a value X(sub k). That value is then averaged over a number M of symbol intervals to produce a static value Y. A symbol lock decision can then be made when the static value Y exceeds a threshold level delta.

  12. Integral Histogram with Random Projection for Pedestrian Detection.

    Directory of Open Access Journals (Sweden)

    Chang-Hua Liu

    Full Text Available In this paper, we give a systematic study to report several deep insights into the HOG, one of the most widely used features in the modern computer vision and image processing applications. We first show that, its magnitudes of gradient can be randomly projected with random matrix. To handle over-fitting, an integral histogram based on the differences of randomly selected blocks is proposed. The experiments show that both the random projection and integral histogram outperform the HOG feature obviously. Finally, the two ideas are combined into a new descriptor termed IHRP, which outperforms the HOG feature with less dimensions and higher speed.

  13. GIS-based Integration of Interdisciplinary Ecological Data to Detect ...

    African Journals Online (AJOL)

    Key words: mangrove, satellite imagery, environment, aerial photography, GIS, Kenya Historic environmental, faunal, floral and socioeconomic data of Gazi Bay in coastal Kenya were collated and integrated into a GIS environment and data of impacts due to various factors were then related to remotely sensed data.

  14. Functional brain networks underlying detection and integration of disconfirmatory evidence.

    Science.gov (United States)

    Lavigne, Katie M; Metzak, Paul D; Woodward, Todd S

    2015-05-15

    Processing evidence that disconfirms a prior interpretation is a fundamental aspect of belief revision, and has clear social and clinical relevance. This complex cognitive process requires (at minimum) an alerting stage and an integration stage, and in the current functional magnetic resonance imaging (fMRI) study, we used multivariate analysis methodology on two datasets in an attempt to separate these sequentially-activated cognitive stages and link them to distinct functional brain networks. Thirty-nine healthy participants completed one of two versions of an evidence integration experiment involving rating two consecutive animal images, both of which consisted of two intact images of animal faces morphed together at different ratios (e.g., 70/30 bird/dolphin followed by 10/90 bird/dolphin). The two versions of the experiment differed primarily in terms of stimulus presentation and timing, which facilitated functional interpretation of brain networks based on differences in the hemodynamic response shapes between versions. The data were analyzed using constrained principal component analysis for fMRI (fMRI-CPCA), which allows distinct, simultaneously active task-based networks to be separated, and these were interpreted using both temporal (task-based hemodynamic response shapes) and spatial (dominant brain regions) information. Three networks showed increased activity during integration of disconfirmatory relative to confirmatory evidence: (1) a network involved in alerting to the requirement to revise an interpretation, identified as the salience network (dorsal anterior cingulate cortex and bilateral insula); (2) a sensorimotor response-related network (pre- and post-central gyri, supplementary motor area, and thalamus); and (3) an integration network involving rostral prefrontal, orbitofrontal and posterior parietal cortex. These three networks were staggered in their peak activity (alerting, responding, then integrating), but at certain time points (e

  15. Deposition and detection of particles during integrated circuit manufacturing

    NARCIS (Netherlands)

    Wali, F.; Knotter, D. Martin; Kelly, John J.; Kuper, F.G.

    2006-01-01

    Abstract—Deposition mechanism of silica particles on silicon wafers was investigated by depositing specially prepared mono-dispersed particles (mean diameter = 330 nm). To measure particles of the size below the detection limit of our particle measurement tools, silica particles with luminance core

  16. Magnetic force microscopy method and apparatus to detect and image currents in integrated circuits

    Science.gov (United States)

    Campbell, Ann. N.; Anderson, Richard E.; Cole, Jr., Edward I.

    1995-01-01

    A magnetic force microscopy method and improved magnetic tip for detecting and quantifying internal magnetic fields resulting from current of integrated circuits. Detection of the current is used for failure analysis, design verification, and model validation. The interaction of the current on the integrated chip with a magnetic field can be detected using a cantilevered magnetic tip. Enhanced sensitivity for both ac and dc current and voltage detection is achieved with voltage by an ac coupling or a heterodyne technique. The techniques can be used to extract information from analog circuits.

  17. Integrating Oil Debris and Vibration Gear Damage Detection Technologies Using Fuzzy Logic

    Science.gov (United States)

    Dempsey, Paula J.; Afjeh, Abdollah A.

    2002-01-01

    A diagnostic tool for detecting damage to spur gears was developed. Two different measurement technologies, wear debris analysis and vibration, were integrated into a health monitoring system for detecting surface fatigue pitting damage on gears. This integrated system showed improved detection and decision-making capabilities as compared to using individual measurement technologies. This diagnostic tool was developed and evaluated experimentally by collecting vibration and oil debris data from fatigue tests performed in the NASA Glenn Spur Gear Fatigue Test Rig. Experimental data were collected during experiments performed in this test rig with and without pitting. Results show combining the two measurement technologies improves the detection of pitting damage on spur gears.

  18. Amplitude Integrated Electroencephalography Compared With Conventional Video EEG for Neonatal Seizure Detection: A Diagnostic Accuracy Study.

    Science.gov (United States)

    Rakshasbhuvankar, Abhijeet; Rao, Shripada; Palumbo, Linda; Ghosh, Soumya; Nagarajan, Lakshmi

    2017-08-01

    This diagnostic accuracy study compared the accuracy of seizure detection by amplitude-integrated electroencephalography with the criterion standard conventional video EEG in term and near-term infants at risk of seizures. Simultaneous recording of amplitude-integrated EEG (2-channel amplitude-integrated EEG with raw trace) and video EEG was done for 24 hours for each infant. Amplitude-integrated EEG was interpreted by a neonatologist; video EEG was interpreted by a neurologist independently. Thirty-five infants were included in the analysis. In the 7 infants with seizures on video EEG, there were 169 seizure episodes on video EEG, of which only 57 were identified by amplitude-integrated EEG. Amplitude-integrated EEG had a sensitivity of 33.7% for individual seizure detection. Amplitude-integrated EEG had an 86% sensitivity for detection of babies with seizures; however, it was nonspecific, in that 50% of infants with seizures detected by amplitude-integrated EEG did not have true seizures by video EEG. In conclusion, our study suggests that amplitude-integrated EEG is a poor screening tool for neonatal seizures.

  19. Neutron imaging integrated circuit and method for detecting neutrons

    Science.gov (United States)

    Nagarkar, Vivek V.; More, Mitali J.

    2017-12-05

    The present disclosure provides a neutron imaging detector and a method for detecting neutrons. In one example, a method includes providing a neutron imaging detector including plurality of memory cells and a conversion layer on the memory cells, setting one or more of the memory cells to a first charge state, positioning the neutron imaging detector in a neutron environment for a predetermined time period, and reading a state change at one of the memory cells, and measuring a charge state change at one of the plurality of memory cells from the first charge state to a second charge state less than the first charge state, where the charge state change indicates detection of neutrons at said one of the memory cells.

  20. INTEGRAL detection of SWIFT J2037.2+4151

    DEFF Research Database (Denmark)

    Westergaard, Niels Jørgen Stenfeldt; Budtz-Jørgensen, Carl; Chenevez, Jérôme

    2006-01-01

    The source detected by SWIFT (ATEL #853) was independently found in archived JEM-X public data in 5 pointings covering 18200s between 2004-07-19, 19:14 UTC and 2004-07-20, 03:27 UTC. Positioned within 1.2 degrees of Cyg X-3 it has been inside the JEM-X field-of-view more than 400 times with an of...

  1. An integrated microfluidic analysis microsystems with bacterial capture enrichment and in-situ impedance detection

    Science.gov (United States)

    Liu, Hai-Tao; Wen, Zhi-Yu; Xu, Yi; Shang, Zheng-Guo; Peng, Jin-Lan; Tian, Peng

    2017-09-01

    In this paper, an integrated microfluidic analysis microsystems with bacterial capture enrichment and in-situ impedance detection was purposed based on microfluidic chips dielectrophoresis technique and electrochemical impedance detection principle. The microsystems include microfluidic chip, main control module, and drive and control module, and signal detection and processing modulet and result display unit. The main control module produce the work sequence of impedance detection system parts and achieve data communication functions, the drive and control circuit generate AC signal which amplitude and frequency adjustable, and it was applied on the foodborne pathogens impedance analysis microsystems to realize the capture enrichment and impedance detection. The signal detection and processing circuit translate the current signal into impendence of bacteria, and transfer to computer, the last detection result is displayed on the computer. The experiment sample was prepared by adding Escherichia coli standard sample into chicken sample solution, and the samples were tested on the dielectrophoresis chip capture enrichment and in-situ impedance detection microsystems with micro-array electrode microfluidic chips. The experiments show that the Escherichia coli detection limit of microsystems is 5 × 104 CFU/mL and the detection time is within 6 min in the optimization of voltage detection 10 V and detection frequency 500 KHz operating conditions. The integrated microfluidic analysis microsystems laid the solid foundation for rapid real-time in-situ detection of bacteria.

  2. Improved Anomaly Detection using Integrated Supervised and Unsupervised Processing

    Science.gov (United States)

    Hunt, B.; Sheppard, D. G.; Wetterer, C. J.

    There are two broad technologies of signal processing applicable to space object feature identification using nonresolved imagery: supervised processing analyzes a large set of data for common characteristics that can be then used to identify, transform, and extract information from new data taken of the same given class (e.g. support vector machine); unsupervised processing utilizes detailed physics-based models that generate comparison data that can then be used to estimate parameters presumed to be governed by the same models (e.g. estimation filters). Both processes have been used in non-resolved space object identification and yield similar results yet arrived at using vastly different processes. The goal of integrating the results of the two is to seek to achieve an even greater performance by building on the process diversity. Specifically, both supervised processing and unsupervised processing will jointly operate on the analysis of brightness (radiometric flux intensity) measurements reflected by space objects and observed by a ground station to determine whether a particular day conforms to a nominal operating mode (as determined from a training set) or exhibits anomalous behavior where a particular parameter (e.g. attitude, solar panel articulation angle) has changed in some way. It is demonstrated in a variety of different scenarios that the integrated process achieves a greater performance than each of the separate processes alone.

  3. INTEGRAL/JEM-X detection of a possible new outburst from GRS 1747-312

    DEFF Research Database (Denmark)

    Chenevez, Jérôme; Bozzo, E.; Bordas, P.

    2013-01-01

    During the observations performed during INTEGRAL monitoring of the Galactic Bulge region (see ATel #438) on 2013 March 11, we detected enhanced emission from the direction of the globular cluster Terzan 6 using the INTEGRAL/JEM-X instrument. This likely indicates that the bursting low-mass X-ray...

  4. X-ray scan detection for cargo integrity

    Science.gov (United States)

    Valencia, Juan; Miller, Steve

    2011-04-01

    The increase of terrorism and its global impact has made the determination of the contents of cargo containers a necessity. Existing technology allows non-intrusive inspections to determine the contents of a container rapidly and accurately. However, some cargo shipments are exempt from such inspections. Hence, there is a need for a technology that enables rapid and accurate means of detecting whether such containers were non-intrusively inspected. Non-intrusive inspections are most commonly performed utilizing high powered X-ray equipment. The challenge is creating a device that can detect short duration X-ray scans while maintaining a portable, battery powered, low cost, and easy to use platform. The Pacific Northwest National Laboratory (PNNL) has developed a methodology and prototype device focused on this challenge. The prototype, developed by PNNL, is a battery powered electronic device that continuously measures its X-ray and Gamma exposure, calculates the dose equivalent rate, and makes a determination of whether the device has been exposed to the amount of radiation experienced during an X-ray inspection. Once an inspection is detected, the device will record a timestamp of the event and relay the information to authorized personnel via a visual alert, USB connection, and/or wireless communication. The results of this research demonstrate that PNNL's prototype device can be effective at determining whether a container was scanned by X-ray equipment typically used for cargo container inspections. This paper focuses on laboratory measurements and test results acquired with the PNNL prototype device using several X-ray radiation levels.

  5. Electrophoresis microchip with integrated waveguides for simultaneous native UV fluorescence and absorbance detection

    DEFF Research Database (Denmark)

    Ohlsson, Pelle Daniel; Sala, Olga Ordeig; Mogensen, Klaus Bo

    2009-01-01

    Simultaneous label-free detection of UV absorbance and native UV-excited fluorescence in an electrophoresis microchip is presented. UV transparent integrated waveguides launch light at a wavelength of 254 nm from a mercury lamp along the length of a 1-mm. long detection cell. Transmitted UV light...

  6. Advancing early detection of autism spectrum disorder by applying an integrated two-stage screening approach

    NARCIS (Netherlands)

    Oosterling, Iris J.; Wensing, Michel; Swinkels, Sophie H.; van der Gaag, Rutger Jan; Visser, Janne C.; Woudenberg, Tim; Minderaa, Ruud; Steenhuis, Mark-Peter; Buitelaar, Jan K.

    Background: Few field trials exist on the impact of implementing guidelines for the early detection of autism spectrum disorders (ASD). The aims of the present study were to develop and evaluate a clinically relevant integrated early detection programme based on the two-stage screening approach of

  7. Integrated Detection of Pathogens and Host Biomarkers for Wounds

    Energy Technology Data Exchange (ETDEWEB)

    Jaing, C

    2012-03-19

    The increasing incidence and complications arising from combat wounds has necessitated a reassessment of methods for effective treatment. Infection, excessive inflammation, and incidence of drug-resistant organisms all contribute toward negative outcomes for afflicted individuals. The organisms and host processes involved in wound progression, however, are incompletely understood. We therefore set out, using our unique technical resources, to construct a profile of combat wounds which did or did not successfully resolve. We employed the Lawrence Livermore Microbial Detection Array and identified a number of nosocomial pathogens present in wound samples. Some of these identities corresponded with bacterial isolates previously cultured, while others were not obtained via standard microbiology. Further, we optimized proteomics protocols for the identification of host biomarkers indicative of various stages in wound progression. In combination with our pathogen data, our biomarker discovery efforts will provide a profile corresponding to wound complications, and will assist significantly in treatment of these complex cases.

  8. The NuSTAR Serendipitous Survey: The 40-month Catalog and the Properties of the Distant High-energy X-Ray Source Population

    Science.gov (United States)

    Lansbury, G. B.; Stern, D.; Aird, J.; Alexander, D. M.; Fuentes, C.; Harrison, F. A.; Treister, E.; Bauer, F. E.; Tomsick, J. A.; Baloković, M.; Del Moro, A.; Gandhi, P.; Ajello, M.; Annuar, A.; Ballantyne, D. R.; Boggs, S. E.; Brandt, W. N.; Brightman, M.; Chen, C.-T. J.; Christensen, F. E.; Civano, F.; Comastri, A.; Craig, W. W.; Forster, K.; Grefenstette, B. W.; Hailey, C. J.; Hickox, R. C.; Jiang, B.; Jun, H. D.; Koss, M.; Marchesi, S.; Melo, A. D.; Mullaney, J. R.; Noirot, G.; Schulze, S.; Walton, D. J.; Zappacosta, L.; Zhang, W. W.

    2017-02-01

    We present the first full catalog and science results for the Nuclear Spectroscopic Telescope Array (NuSTAR) serendipitous survey. The catalog incorporates data taken during the first 40 months of NuSTAR operation, which provide ≈20 Ms of effective exposure time over 331 fields, with an areal coverage of 13 deg2, and 497 sources detected in total over the 3-24 keV energy range. There are 276 sources with spectroscopic redshifts and classifications, largely resulting from our extensive campaign of ground-based spectroscopic follow-up. We characterize the overall sample in terms of the X-ray, optical, and infrared source properties. The sample is primarily composed of active galactic nuclei (AGNs), detected over a large range in redshift from z = 0.002 to 3.4 (median of =0.56), but also includes 16 spectroscopically confirmed Galactic sources. There is a large range in X-ray flux, from {log}({f}3-24{keV}/{erg} {{{s}}}-1 {{cm}}-2)≈ -14 to -11, and in rest-frame 10-40 keV luminosity, from {log}({L}10-40{keV}/{erg} {{{s}}}-1)≈ 39 to 46, with a median of 44.1. Approximately 79% of the NuSTAR sources have lower-energy ( {10}44 erg s-1) to ≈80% at the lowest luminosities ({L}{{X}}< {10}43 erg s-1). Our optical spectroscopic analysis finds that the observed fraction of optically obscured AGNs (I.e., the type 2 fraction) is {F}{Type2}={53}-15+14 % , for a well-defined subset of the 8-24 keV selected sample. This is higher, albeit at a low significance level, than the type 2 fraction measured for redshift- and luminosity-matched AGNs selected by <10 keV X-ray missions.

  9. Detecting Specific Health-Related Events Using an Integrated Sensor System for Vital Sign Monitoring

    Directory of Open Access Journals (Sweden)

    Mourad Adnane

    2009-09-01

    Full Text Available In this paper, a new method for the detection of apnea/hypopnea periods in physiological data is presented. The method is based on the intelligent combination of an integrated sensor system for long-time cardiorespiratory signal monitoring and dedicated signal-processing packages. Integrated sensors are a PVDF film and conductive fabric sheets. The signal processing package includes dedicated respiratory cycle (RC and QRS complex detection algorithms and a new method using the respiratory cycle variability (RCV for detecting apnea/hypopnea periods in physiological data. Results show that our method is suitable for online analysis of long time series data.

  10. INTEGRAL detects an X-ray burst from SAX J1747.0-2853 with no detectable persistent emission

    DEFF Research Database (Denmark)

    Chenevez, Jérôme; Brandt, Søren Kristian; Kuulkers, Erik

    2009-01-01

    A new season of observations for the INTEGRAL Galactic Bulge monitoring (see ATel #438) has started on 2009 Feb. 21st. During the latest observation between 2009 Feb 25 13:21 and 17:02 (UT) a type I X-ray burst from SAX J1747.0-2853 (1A 1743-288, aka GX .2-0.2) was detected by JEM-X at UT 14:50:5...

  11. Serendipitous discovery of light-induced (In Situ) formation of an Azo-bridged dimeric sulfonated naphthol as a potent PTP1B inhibitor.

    Science.gov (United States)

    Bongard, Robert D; Lepley, Michael; Thakur, Khushabu; Talipov, Marat R; Nayak, Jaladhi; Lipinski, Rachel A Jones; Bohl, Chris; Sweeney, Noreena; Ramchandran, Ramani; Rathore, Rajendra; Sem, Daniel S

    2017-05-31

    Protein tyrosine phosphatases (PTPs) like dual specificity phosphatase 5 (DUSP5) and protein tyrosine phosphatase 1B (PTP1B) are drug targets for diseases that include cancer, diabetes, and vascular disorders such as hemangiomas. The PTPs are also known to be notoriously difficult targets for designing inihibitors that become viable drug leads. Therefore, the pipeline for approved drugs in this class is minimal. Furthermore, drug screening for targets like PTPs often produce false positive and false negative results. Studies presented herein provide important insights into: (a) how to detect such artifacts, (b) the importance of compound re-synthesis and verification, and (c) how in situ chemical reactivity of compounds, when diagnosed and characterized, can actually lead to serendipitous discovery of valuable new lead molecules. Initial docking of compounds from the National Cancer Institute (NCI), followed by experimental testing in enzyme inhibition assays, identified an inhibitor of DUSP5. Subsequent control experiments revealed that this compound demonstrated time-dependent inhibition, and also a time-dependent change in color of the inhibitor that correlated with potency of inhibition. In addition, the compound activity varied depending on vendor source. We hypothesized, and then confirmed by synthesis of the compound, that the actual inhibitor of DUSP5 was a dimeric form of the original inhibitor compound, formed upon exposure to light and oxygen. This compound has an IC 50 of 36 μM for DUSP5, and is a competitive inhibitor. Testing against PTP1B, for selectivity, demonstrated the dimeric compound was actually a more potent inhibitor of PTP1B, with an IC 50 of 2.1 μM. The compound, an azo-bridged dimer of sulfonated naphthol rings, resembles previously reported PTP inhibitors, but with 18-fold selectivity for PTP1B versus DUSP5. We report the identification of a potent PTP1B inhibitor that was initially identified in a screen for DUSP5, implying common

  12. The NuSTAR serendipitous survey: the 40-month catalog and the properties of the distant high-energy X-ray source population

    DEFF Research Database (Denmark)

    Lansbury, G. B.; Stern, D.; Aird, J.

    2017-01-01

    We present the first full catalog and science results for the Nuclear Spectroscopic Telescope Array (NuSTAR) serendipitous survey. The catalog incorporates data taken during the first 40 months of NuSTAR operation, which provide ≈20 Ms of effective exposure time over 331 fields, with an areal cov...

  13. Read My Lips: Brain Dynamics Associated with Audiovisual Integration and Deviance Detection.

    Science.gov (United States)

    Tse, Chun-Yu; Gratton, Gabriele; Garnsey, Susan M; Novak, Michael A; Fabiani, Monica

    2015-09-01

    Information from different modalities is initially processed in different brain areas, yet real-world perception often requires the integration of multisensory signals into a single percept. An example is the McGurk effect, in which people viewing a speaker whose lip movements do not match the utterance perceive the spoken sounds incorrectly, hearing them as more similar to those signaled by the visual rather than the auditory input. This indicates that audiovisual integration is important for generating the phoneme percept. Here we asked when and where the audiovisual integration process occurs, providing spatial and temporal boundaries for the processes generating phoneme perception. Specifically, we wanted to separate audiovisual integration from other processes, such as simple deviance detection. Building on previous work employing ERPs, we used an oddball paradigm in which task-irrelevant audiovisually deviant stimuli were embedded in strings of non-deviant stimuli. We also recorded the event-related optical signal, an imaging method combining spatial and temporal resolution, to investigate the time course and neuroanatomical substrate of audiovisual integration. We found that audiovisual deviants elicit a short duration response in the middle/superior temporal gyrus, whereas audiovisual integration elicits a more extended response involving also inferior frontal and occipital regions. Interactions between audiovisual integration and deviance detection processes were observed in the posterior/superior temporal gyrus. These data suggest that dynamic interactions between inferior frontal cortex and sensory regions play a significant role in multimodal integration.

  14. An integration time adaptive control method for atmospheric composition detection of occultation

    Science.gov (United States)

    Ding, Lin; Hou, Shuai; Yu, Fei; Liu, Cheng; Li, Chao; Zhe, Lin

    2018-01-01

    When sun is used as the light source for atmospheric composition detection, it is necessary to image sun for accurate identification and stable tracking. In the course of 180 second of the occultation, the magnitude of sun light intensity through the atmosphere changes greatly. It is nearly 1100 times illumination change between the maximum atmospheric and the minimum atmospheric. And the process of light change is so severe that 2.9 times per second of light change can be reached. Therefore, it is difficult to control the integration time of sun image camera. In this paper, a novel adaptive integration time control method for occultation is presented. In this method, with the distribution of gray value in the image as the reference variable, and the concepts of speed integral PID control, the integration time adaptive control problem of high frequency imaging. The large dynamic range integration time automatic control in the occultation can be achieved.

  15. An Energy efficient application specific integrated circuit for electrocardiogram feature detection and its potential for ambulatory cardiovascular disease detection.

    Science.gov (United States)

    Jain, Sanjeev Kumar; Bhaumik, Basabi

    2016-03-01

    A novel algorithm based on forward search is developed for real-time electrocardiogram (ECG) signal processing and implemented in application specific integrated circuit (ASIC) for QRS complex related cardiovascular disease diagnosis. The authors have evaluated their algorithm using MIT-BIH database and achieve sensitivity of 99.86% and specificity of 99.93% for QRS complex peak detection. In this Letter, Physionet PTB diagnostic ECG database is used for QRS complex related disease detection. An ASIC for cardiovascular disease detection is fabricated using 130-nm CMOS high-speed process technology. The area of the ASIC is 0.5 mm(2). The power dissipation is 1.73 μW at the operating frequency of 1 kHz with a supply voltage of 0.6 V. The output from the ASIC is fed to their Android application that generates diagnostic report and can be sent to a cardiologist through email. Their ASIC result shows average failed detection rate of 0.16% for six leads data of 290 patients in PTB diagnostic ECG database. They also have implemented a low-leakage version of their ASIC. The ASIC dissipates only 45 pJ with a supply voltage of 0.9 V. Their proposed ASIC is most suitable for energy efficient telemetry cardiovascular disease detection system.

  16. Optimal Detection of a Localized Perturbation in Random Networks of Integrate-and-Fire Neurons

    Science.gov (United States)

    Bernardi, Davide; Lindner, Benjamin

    2017-06-01

    Experimental and theoretical studies suggest that cortical networks are chaotic and coding relies on averages over large populations. However, there is evidence that rats can respond to the short stimulation of a single cortical cell, a theoretically unexplained fact. We study effects of single-cell stimulation on a large recurrent network of integrate-and-fire neurons and propose a simple way to detect the perturbation. Detection rates obtained from simulations and analytical estimates are similar to experimental response rates if the readout is slightly biased towards specific neurons. Near-optimal detection is attained for a broad range of intermediate values of the mean coupling between neurons.

  17. Monolithic integration of optical waveguides for absorbance detection in microfabricated electrophoresis devices

    DEFF Research Database (Denmark)

    Mogensen, Klaus Bo; Petersen, Nickolaj Jacob; Hübner, Jörg

    2001-01-01

    . The waveguides on the device were connected to optical fibers, which enabled alignment free operation due to the absence of free-space optics. A 750 mum long U-shaped detection cell was used to facilitate longitudinal absorption detection. To minimize geometrically induced band broadening at the turn in the U......The fabrication and performance of an electrophoretic separation chip with integrated of optical waveguides for absorption detection is presented. The device was fabricated on a silicon substrate by standard microfabrication techniques with the use of two photolithographic mask steps...

  18. INTEGRAL detection of a hard X-ray transient in NGC 6440

    DEFF Research Database (Denmark)

    Kuulkers, E.; Bozzo, E.; Bazzano, A.

    2015-01-01

    Referred to by ATel #: 7106, 7136, 7183 Tweet During INTEGRAL Galactic bulge monitoring (e.g., ATel #438) observations performed on UT 2015 February 17 at 12.53-16:45, IBIS/ISGRI detected renewed activity at hard X-rays from a transient within the Globular Cluster NGC 6440. The best determined...

  19. Taxonomy of Conflict Detection and Resolution Approaches for Unmanned Aerial Vehicle in an Integrated Airspace

    NARCIS (Netherlands)

    Jenie, Y.I.; van Kampen, E.; Ellerbroek, J.; Hoekstra, J.M.

    2016-01-01

    This paper proposes a taxonomy of Conflict Detection and Resolution (CD&R) approaches for Unmanned Aerial Vehicles (UAV) operation in an integrated airspace. Possible approaches for UAVs are surveyed and broken down based on their types of surveillance, coordination, maneuver, and autonomy. The

  20. VERSE: a novel approach to detect virus integration in host genomes through reference genome customization.

    Science.gov (United States)

    Wang, Qingguo; Jia, Peilin; Zhao, Zhongming

    2015-01-01

    Fueled by widespread applications of high-throughput next generation sequencing (NGS) technologies and urgent need to counter threats of pathogenic viruses, large-scale studies were conducted recently to investigate virus integration in host genomes (for example, human tumor genomes) that may cause carcinogenesis or other diseases. A limiting factor in these studies, however, is rapid virus evolution and resulting polymorphisms, which prevent reads from aligning readily to commonly used virus reference genomes, and, accordingly, make virus integration sites difficult to detect. Another confounding factor is host genomic instability as a result of virus insertions. To tackle these challenges and improve our capability to identify cryptic virus-host fusions, we present a new approach that detects Virus intEgration sites through iterative Reference SEquence customization (VERSE). To the best of our knowledge, VERSE is the first approach to improve detection through customizing reference genomes. Using 19 human tumors and cancer cell lines as test data, we demonstrated that VERSE substantially enhanced the sensitivity of virus integration site detection. VERSE is implemented in the open source package VirusFinder 2 that is available at http://bioinfo.mc.vanderbilt.edu/VirusFinder/.

  1. Detecting Functional Connectivity During Audiovisual Integration with MEG: A Comparison of Connectivity Metrics.

    Science.gov (United States)

    Ard, Tyler; Carver, Frederick W; Holroyd, Tom; Horwitz, Barry; Coppola, Richard

    2015-08-01

    In typical magnetoencephalography and/or electroencephalography functional connectivity analysis, researchers select one of several methods that measure a relationship between regions to determine connectivity, such as coherence, power correlations, and others. However, it is largely unknown if some are more suited than others for various types of investigations. In this study, the authors investigate seven connectivity metrics to evaluate which, if any, are sensitive to audiovisual integration by contrasting connectivity when tracking an audiovisual object versus connectivity when tracking a visual object uncorrelated with the auditory stimulus. The authors are able to assess the metrics' performances at detecting audiovisual integration by investigating connectivity between auditory and visual areas. Critically, the authors perform their investigation on a whole-cortex all-to-all mapping, avoiding confounds introduced in seed selection. The authors find that amplitude-based connectivity measures in the beta band detect strong connections between visual and auditory areas during audiovisual integration, specifically between V4/V5 and auditory cortices in the right hemisphere. Conversely, phase-based connectivity measures in the beta band as well as phase and power measures in alpha, gamma, and theta do not show connectivity between audiovisual areas. The authors postulate that while beta power correlations detect audiovisual integration in the current experimental context, it may not always be the best measure to detect connectivity. Instead, it is likely that the brain utilizes a variety of mechanisms in neuronal communication that may produce differential types of temporal relationships.

  2. Earlier activity from XTE J1739-302/IGR J17391-3021 detected by INTEGRAL

    DEFF Research Database (Denmark)

    Chenevez, Jérôme; Beckmann, V.; Kuulkers, E.

    2008-01-01

    The recently reported outburst from the supergiant fast X-ray transient XTE J1739-302/IGR J17391-3021 (ATEL #1466) began already about five hours earlier than the Swift/BAT trigger on 2008-04-08. The INTEGRAL/JEM-X monitor detected a flare starting at 16:18 (UTC) on the same day during recent Gal...

  3. Design and evaluation of the ReKon : an integrated detection and assessment perimeter system.

    Energy Technology Data Exchange (ETDEWEB)

    Dabling, Jeffrey Glenn; Andersen, Jason Jann; McLaughlin, James O. [Stonewater Control Systems, Inc., Kannapolis, NC

    2013-02-01

    Kontek Industries (Kannapolis, NC) and their subsidiary, Stonewater Control Systems (Kannapolis, NC), have entered into a cooperative research and development agreement with Sandia to jointly develop and evaluate an integrated perimeter security system solution, one that couples access delay with detection and assessment. This novel perimeter solution was designed to be configurable for use at facilities ranging from high-security military sites to commercial power plants, to petro/chemical facilities of various kinds. A prototype section of the perimeter has been produced and installed at the Sandia Test and Evaluation Center in Albuquerque, NM. This prototype system integrated fiber optic break sensors, active infrared sensors, fence disturbance sensors, video motion detection, and ground sensors. This report documents the design, testing, and performance evaluation of the developed ReKon system. The ability of the system to properly detect pedestrian or vehicle attempts to bypass, breach, or otherwise defeat the system is characterized, as well as the Nuisance Alarm Rate.

  4. Towards Effective Network Intrusion Detection: A Hybrid Model Integrating Gini Index and GBDT with PSO

    Directory of Open Access Journals (Sweden)

    Longjie Li

    2018-01-01

    Full Text Available In order to protect computing systems from malicious attacks, network intrusion detection systems have become an important part in the security infrastructure. Recently, hybrid models that integrating several machine learning techniques have captured more attention of researchers. In this paper, a novel hybrid model was proposed with the purpose of detecting network intrusion effectively. In the proposed model, Gini index is used to select the optimal subset of features, the gradient boosted decision tree (GBDT algorithm is adopted to detect network attacks, and the particle swarm optimization (PSO algorithm is utilized to optimize the parameters of GBDT. The performance of the proposed model is experimentally evaluated in terms of accuracy, detection rate, precision, F1-score, and false alarm rate using the NSL-KDD dataset. Experimental results show that the proposed model is superior to the compared methods.

  5. Integration and road tests of a self-sensing CNT concrete pavement system for traffic detection

    Science.gov (United States)

    Han, Baoguo; Zhang, Kun; Burnham, Tom; Kwon, Eil; Yu, Xun

    2013-01-01

    In this paper, a self-sensing carbon nanotube (CNT) concrete pavement system for traffic detection is proposed and tested in a roadway. Pre-cast and cast-in-place self-sensing CNT concrete sensors were simultaneously integrated into a controlled pavement test section at the Minnesota Road Research Facility (MnROAD), USA. Road tests of the system were conducted by using an MnROAD five-axle semi-trailer tractor truck and a van, respectively, both in the winter and summer. Test results show that the proposed self-sensing pavement system can accurately detect the passing of different vehicles under different vehicular speeds and test environments. These findings indicate that the developed self-sensing CNT concrete pavement system can achieve real-time vehicle flow detection with a high detection rate and a low false-alarm rate.

  6. An integrated micro-chip for rapid detection of magnetic particles

    KAUST Repository

    Gooneratne, Chinthaka P.

    2012-03-09

    This paper proposes an integrated micro-chip for the manipulation and detection of magnetic particles (MPs). A conducting ring structure is used to manipulate MPs toward giant magnetoresistance(GMR) sensing elements for rapid detection. The GMRsensor is fabricated in a horseshoe shape in order to detect the majority of MPs that are trapped around the conducting structure. The GMR sensing elements are connected in a Wheatstone bridge circuit topology for optimum noise suppression. Full fabrication details of the micro-chip, characterization of the GMRsensors, and experimental results with MPs are presented in this paper. Experimental results showed that the micro-chip can detect MPs from low concentration samples after they were guided toward the GMRsensors by applying current to the conducting ring structure.

  7. Integration and road tests of a self-sensing CNT concrete pavement system for traffic detection

    International Nuclear Information System (INIS)

    Han, Baoguo; Zhang, Kun; Yu, Xun; Burnham, Tom; Kwon, Eil

    2013-01-01

    In this paper, a self-sensing carbon nanotube (CNT) concrete pavement system for traffic detection is proposed and tested in a roadway. Pre-cast and cast-in-place self-sensing CNT concrete sensors were simultaneously integrated into a controlled pavement test section at the Minnesota Road Research Facility (MnROAD), USA. Road tests of the system were conducted by using an MnROAD five-axle semi-trailer tractor truck and a van, respectively, both in the winter and summer. Test results show that the proposed self-sensing pavement system can accurately detect the passing of different vehicles under different vehicular speeds and test environments. These findings indicate that the developed self-sensing CNT concrete pavement system can achieve real-time vehicle flow detection with a high detection rate and a low false-alarm rate. (paper)

  8. Detection of hepatocarcinoma in rats by integration of the fluorescence spectrum: Experimental model

    Science.gov (United States)

    Marcassa, J. C.; Ferreira, J.; Zucoloto, S.; Castro E Silva, O., Jr.; Marcassa, L. G.; Bagnato, V. S.

    2006-05-01

    The incorporation of spectroscopic techniques into diagnostic procedures may greatly improve the chances for precise diagnostics. One promising technique is fluorescence spectroscopy, which has recently been used to detect many different types of diseases. In this work, we use laser-induced tissue fluorescence to detect hepatocarcinoma in rats using excitation light at wavelengths of 443 and 532 nm. Hepatocarcinoma was induced chemically in Wistar rats. The collected fluorescence spectrum ranges from the excitation wavelength up to 850 nm. A mathematical procedure carried out on the spectrum determines a figure of merit value, which allows the detection of hepatocarcinoma. The figure of merit involves a procedure which evaluates the ratio between the backscattered excitation wavelength and the broad emission fluorescence band. We demonstrate that a normalization allowed by integration of the fluorescence spectra is a simple operation that may allow the detection of hepatocarcinoma.

  9. Dielectric Spectroscopic Detection of Early Failures in 3-D Integrated Circuits.

    Science.gov (United States)

    Obeng, Yaw; Okoro, C A; Ahn, Jung-Joon; You, Lin; Kopanski, Joseph J

    The commercial introduction of three dimensional integrated circuits (3D-ICs) has been hindered by reliability challenges, such as stress related failures, resistivity changes, and unexplained early failures. In this paper, we discuss a new RF-based metrology, based on dielectric spectroscopy, for detecting and characterizing electrically active defects in fully integrated 3D devices. These defects are traceable to the chemistry of the insolation dielectrics used in the through silicon via (TSV) construction. We show that these defects may be responsible for some of the unexplained early reliability failures observed in TSV enabled 3D devices.

  10. Study on Method of Geohazard Change Detection Based on Integrating Remote Sensing and GIS

    International Nuclear Information System (INIS)

    Zhao, Zhenzhen; Yan, Qin; Liu, Zhengjun; Luo, Chengfeng

    2014-01-01

    Following a comprehensive literature review, this paper looks at analysis of geohazard using remote sensing information. This paper compares the basic types and methods of change detection, explores the basic principle of common methods and makes an respective analysis of the characteristics and shortcomings of the commonly used methods in the application of geohazard. Using the earthquake in JieGu as a case study, this paper proposes a geohazard change detection method integrating RS and GIS. When detecting the pre-earthquake and post-earthquake remote sensing images at different phases, it is crucial to set an appropriate threshold. The method adopts a self-adapting determination algorithm for threshold. We select a training region which is obtained after pixel information comparison and set a threshold value. The threshold value separates the changed pixel maximum. Then we apply the threshold value to the entire image, which could also make change detection accuracy maximum. Finally, we output the result to the GIS system to make change analysis. The experimental results show that this method of geohazard change detection based on integrating remote sensing and GIS information has higher accuracy with obvious advantages compared with the traditional methods

  11. A Bernoulli Gaussian Watermark for Detecting Integrity Attacks in Control Systems

    Energy Technology Data Exchange (ETDEWEB)

    Weerakkody, Sean [Carnegie Mellon Univ., Pittsburgh, PA (United States); Ozel, Omur [Carnegie Mellon Univ., Pittsburgh, PA (United States); Sinopoli, Bruno [Carnegie Mellon Univ., Pittsburgh, PA (United States)

    2017-11-02

    We examine the merit of Bernoulli packet drops in actively detecting integrity attacks on control systems. The aim is to detect an adversary who delivers fake sensor measurements to a system operator in order to conceal their effect on the plant. Physical watermarks, or noisy additive Gaussian inputs, have been previously used to detect several classes of integrity attacks in control systems. In this paper, we consider the analysis and design of Gaussian physical watermarks in the presence of packet drops at the control input. On one hand, this enables analysis in a more general network setting. On the other hand, we observe that in certain cases, Bernoulli packet drops can improve detection performance relative to a purely Gaussian watermark. This motivates the joint design of a Bernoulli-Gaussian watermark which incorporates both an additive Gaussian input and a Bernoulli drop process. We characterize the effect of such a watermark on system performance as well as attack detectability in two separate design scenarios. Here, we consider a correlation detector for attack recognition. We then propose efficiently solvable optimization problems to intelligently select parameters of the Gaussian input and the Bernoulli drop process while addressing security and performance trade-offs. Finally, we provide numerical results which illustrate that a watermark with packet drops can indeed outperform a Gaussian watermark.

  12. Integrated Detection and Prediction of Influenza Activity for Real-Time Surveillance: Algorithm Design.

    Science.gov (United States)

    Spreco, Armin; Eriksson, Olle; Dahlström, Örjan; Cowling, Benjamin John; Timpka, Toomas

    2017-06-15

    Influenza is a viral respiratory disease capable of causing epidemics that represent a threat to communities worldwide. The rapidly growing availability of electronic "big data" from diagnostic and prediagnostic sources in health care and public health settings permits advance of a new generation of methods for local detection and prediction of winter influenza seasons and influenza pandemics. The aim of this study was to present a method for integrated detection and prediction of influenza virus activity in local settings using electronically available surveillance data and to evaluate its performance by retrospective application on authentic data from a Swedish county. An integrated detection and prediction method was formally defined based on a design rationale for influenza detection and prediction methods adapted for local surveillance. The novel method was retrospectively applied on data from the winter influenza season 2008-09 in a Swedish county (population 445,000). Outcome data represented individuals who met a clinical case definition for influenza (based on International Classification of Diseases version 10 [ICD-10] codes) from an electronic health data repository. Information from calls to a telenursing service in the county was used as syndromic data source. The novel integrated detection and prediction method is based on nonmechanistic statistical models and is designed for integration in local health information systems. The method is divided into separate modules for detection and prediction of local influenza virus activity. The function of the detection module is to alert for an upcoming period of increased load of influenza cases on local health care (using influenza-diagnosis data), whereas the function of the prediction module is to predict the timing of the activity peak (using syndromic data) and its intensity (using influenza-diagnosis data). For detection modeling, exponential regression was used based on the assumption that the beginning

  13. Integration of Disaster Detection and Warning System for a Smart Vehicle

    Directory of Open Access Journals (Sweden)

    Chun-Chieh Wang

    2014-02-01

    Full Text Available For firefighters and rescuers, the disaster relief works are difficulty performed in the tunnels because of their constricted space. To reduce the losses of accident, the safety of tunnels and factories should be ordinarily kept under surveillance. Hence, a multisensor based smart tracked vehicle is designed for the application of autonomous detection and surveillance in this paper. Besides, multisensors, communication modules, wireless cameras, an electronic compass, and a GPS module are installed in the vehicle. The key feature is the integration of disaster detection and warning systems so that the vehicle can move autonomously. Furthermore, a LabVIEW graphical programming software is applied to design a human machine interface (HMI and integrate all systems such that the vehicle can be guided by High Speed Downlink Packet Access (HSHPA based remote control. Moreover, basic stamp microcontrollers are utilized as its control kernel such that the remote monitoring and control system (RMCS can be constructed successfully.

  14. X-ray-ing the Low Luminosity Supermassive Black Hole Accretion: the Crucial Role of Public Serendipitous Catalogs.

    Science.gov (United States)

    Constantin, Anca; Green, Paul; Haggard, Daryl

    2018-01-01

    For most of the nearby active galaxies, a mix of processes including emission from star-forming regions, other ionization sources (shocks, turbulence, etc.), nuclear obscuration, as well as host galaxy starlight obfuscate the true nature of their dominant ionization mechanism. X-ray emission is one of the most reliable primary signatures of accretion activity, and with the advent of the public catalogs, it became one of the most effective diagnostics as well. Working with large and significantly less biased samples that only serendipitous X-ray catalogs are able to provide, we were able to: 1) provide the most accurate estimates of the AGN fraction as a function of a diverse set of parameters; 2) confirm with X-rays a sequence from star-forming to active to passive galaxies that matches trends in both optical host galaxy characteristics and in the large scale environment; 3) discover intriguing similarities between accretion onto supermassive and stellar size black holes, with direct consequences for the physical significance of the Gamma-L/Ledd relation for AGN of both type I and II in the local universe. This presentation will summarize these exciting results, and will also report on novel extended efforts to decipher the link between the water megamaser emission and galactic nuclear activity, which are made possible only by the availability of the large sample statistics of carefully curated X-ray measurements uniquely offered by the combined Chandra and XMM catalogs.

  15. Pyrolyzed Photoresist Electrodes for Integration in Microfluidic Chips for Transmitter Detection from Biological Cells

    DEFF Research Database (Denmark)

    Larsen, Simon Tylsgaard; Argyraki, Aikaterini; Amato, Letizia

    2013-01-01

    In this study, we show how pyrolyzed photoresist carbon electrodes can be used for amperometric detection of potassium-induced transmitter release from large groups of neuronal PC 12 cells. This opens the way for the use of carbon film electrodes in microfabricated devices for neurochemical drug ...... by the difference in photoresist viscosity. By adding a soft bake step to the fabrication procedure, the flatness of pyrolyzed AZ 5214 electrodes could be improved which would facilitate their integration in microfluidic chip devices....

  16. INTEGRAL/JEM-X detection of fading emission from GT Mus

    DEFF Research Database (Denmark)

    Fiocchi, M.; Chenevez, J.; Sguera, V.

    2015-01-01

    On November 15th 2015 the MAXI/GSC detected a big flare from the RS CVn star GT Mus with a flux of ~100 mCrab in the 2-20 keV energy band. (ATel #8285). During recent INTEGRAL observations of the Musca region performed between 17 Nov 16:08 and 18 Nov 00:05 (UTC) the source GT Mus was within the f...

  17. INTEGRAL confirms the detection of renewed activity from the NS transient H 1658-298

    DEFF Research Database (Denmark)

    Sanchez-Fernandez, C.; Eckert, D.; Bozzo, E.

    2015-01-01

    INTEGRAL observed the Galactic Center Region between (UT) 2015-08-22 05:26 and 18:44. Enhanced X-ray emission was detected by the Joint European Monitor for X-rays (JEM-X) in the 3-10 keV band, (15 mCrab; 9-sigma significance) at the following position: (R.A., Dec) = (255.5284, -29.94175) = (17 0...

  18. An integrated fluorescence detection system in poly(dimethylsiloxane) for microfluidic applications.

    Science.gov (United States)

    Chabinyc, M L; Chiu, D T; McDonald, J C; Stroock, A D; Christian, J F; Karger, A M; Whitesides, G M

    2001-09-15

    This paper describes a prototype of an integrated fluorescence detection system that uses a microavalanche photodiode (microAPD) as the photodetector for microfluidic devices fabricated in poly(dimethylsiloxane) (PDMS). The prototype device consisted of a reusable detection system and a disposable microfluidic system that was fabricated using rapid prototyping. The first step of the procedure was the fabrication of microfluidic channels in PDMS and the encapsulation of a multimode optical fiber (100-microm core diameter) in the PDMS; the tip of the fiber was placed next to the side wall of one of the channels. The optical fiber was used to couple light into the microchannel for the excitation of fluorescent analytes. The photodetector, a prototype solid-state microAPD array, was embedded in a thick slab (1 cm) of PDMS. A thin (80 microm) colored polycarbonate filter was placed on the top of the embedded microAPD to absorb scattered excitation light before it reached the detector. The microAPD was placed below the microchannel and orthogonal to the axis of the optical fiber. The close proximity (approximately 200 microm) of the microAPD to the microchannel made it unnecessary to incorporate transfer optics; the pixel size of the microAPD (30 microm) matched the dimensions of the channels (50 microm). A blue light-emitting diode was used for fluorescence excitation. The microAPD was operated in Geiger mode to detect the fluorescence. The detection limit of the prototype (approximately 25 nM) was determined by finding the minimum detectable concentration of a solution of fluorescein. The device was used to detect the separation of a mixture of proteins and small molecules by capillary electrophoresis; the separation illustrated the suitability of this integrated fluorescence detection system for bioanalytical applications.

  19. Optimized acoustic biochip integrated with microfluidics for biomarkers detection in molecular diagnostics.

    Science.gov (United States)

    Papadakis, G; Friedt, J M; Eck, M; Rabus, D; Jobst, G; Gizeli, E

    2017-09-01

    The development of integrated platforms incorporating an acoustic device as the detection element requires addressing simultaneously several challenges of technological and scientific nature. The present work was focused on the design of a microfluidic module, which, combined with a dual or array type Love wave acoustic chip could be applied to biomedical applications and molecular diagnostics. Based on a systematic study we optimized the mechanics of the flow cell attachment and the sealing material so that fluidic interfacing/encapsulation would impose minimal losses to the acoustic wave. We have also investigated combinations of operating frequencies with waveguide materials and thicknesses for maximum sensitivity during the detection of protein and DNA biomarkers. Within our investigations neutravidin was used as a model protein biomarker and unpurified PCR amplified Salmonella DNA as the model genetic target. Our results clearly indicate the need for experimental verification of the optimum engineering and analytical parameters, in order to develop commercially viable systems for integrated analysis. The good reproducibility of the signal together with the ability of the array biochip to detect multiple samples hold promise for the future use of the integrated system in a Lab-on-a-Chip platform for application to molecular diagnostics.

  20. Integrated fiber optic sensors for hot spot detection and temperature field reconstruction in satellites

    International Nuclear Information System (INIS)

    Rapp, S; Baier, H

    2010-01-01

    Large satellites are often equipped with more than 1000 temperature sensors during the test campaign. Hundreds of them are still used for monitoring during launch and operation in space. This means an additional mass and especially high effort in assembly, integration and verification on a system level. So the use of fiber Bragg grating temperature sensors is investigated as they offer several advantages. They are lightweight, small in size and electromagnetically immune, which fits well in space applications. Their multiplexing capability offers the possibility to build extensive sensor networks including dozens of sensors of different types, such as strain sensors, accelerometers and temperature sensors. The latter allow the detection of hot spots and the reconstruction of temperature fields via proper algorithms, which is shown in this paper. A temperature sensor transducer was developed, which can be integrated into satellite sandwich panels with negligible mechanical influence. Mechanical and thermal vacuum tests were performed to verify the space compatibility of the developed sensor system. Proper reconstruction algorithms were developed to estimate the temperature field and detect thermal hot spots on the panel surface. A representative hardware demonstrator has been built and tested, which shows the capability of using an integrated fiber Bragg grating temperature sensor network for temperature field reconstruction and hot spot detection in satellite structures

  1. Detection of Hepatocyte Clones Containing Integrated Hepatitis B Virus DNA Using Inverse Nested PCR.

    Science.gov (United States)

    Tu, Thomas; Jilbert, Allison R

    2017-01-01

    Chronic hepatitis B virus (HBV) infection is a major cause of liver cirrhosis and hepatocellular carcinoma (HCC), leading to ~600,000 deaths per year worldwide. Many of the steps that occur during progression from the normal liver to cirrhosis and/or HCC are unknown. Integration of HBV DNA into random sites in the host cell genome occurs as a by-product of the HBV replication cycle and forms a unique junction between virus and cellular DNA. Analyses of integrated HBV DNA have revealed that HCCs are clonal and imply that they develop from the transformation of hepatocytes, the only liver cell known to be infected by HBV. Integrated HBV DNA has also been shown, at least in some tumors, to cause insertional mutagenesis in cancer driver genes, which may facilitate the development of HCC. Studies of HBV DNA integration in the histologically normal liver have provided additional insight into HBV-associated liver disease, suggesting that hepatocytes with a survival or growth advantage undergo high levels of clonal expansion even in the absence of oncogenic transformation. Here we describe inverse nested PCR (invPCR), a highly sensitive method that allows detection, sequencing, and enumeration of virus-cell DNA junctions formed by the integration of HBV DNA. The invPCR protocol is composed of two major steps: inversion of the virus-cell DNA junction and single-molecule nested PCR. The invPCR method is highly specific and inexpensive and can be tailored to DNA extracted from large or small amounts of liver. This procedure also allows detection of genome-wide random integration of any known DNA sequence and is therefore a useful technique for molecular biology, virology, and genetic research.

  2. An integrated logit model for contamination event detection in water distribution systems.

    Science.gov (United States)

    Housh, Mashor; Ostfeld, Avi

    2015-05-15

    The problem of contamination event detection in water distribution systems has become one of the most challenging research topics in water distribution systems analysis. Current attempts for event detection utilize a variety of approaches including statistical, heuristics, machine learning, and optimization methods. Several existing event detection systems share a common feature in which alarms are obtained separately for each of the water quality indicators. Unifying those single alarms from different indicators is usually performed by means of simple heuristics. A salient feature of the current developed approach is using a statistically oriented model for discrete choice prediction which is estimated using the maximum likelihood method for integrating the single alarms. The discrete choice model is jointly calibrated with other components of the event detection system framework in a training data set using genetic algorithms. The fusing process of each indicator probabilities, which is left out of focus in many existing event detection system models, is confirmed to be a crucial part of the system which could be modelled by exploiting a discrete choice model for improving its performance. The developed methodology is tested on real water quality data, showing improved performances in decreasing the number of false positive alarms and in its ability to detect events with higher probabilities, compared to previous studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. INTEGRAL/IBIS detects renewed activity from H 1417-624

    DEFF Research Database (Denmark)

    Fiocchi, M.; Sguera, A.; Sidoli, L.

    2014-01-01

    During a recent INTEGRAL Galactic Plane Scanning observation (PI: A. Bazzano), started on 2014 January 19 at 07:51 UTC, IBIS/ISGRI detected renewed activity from the transient system H 1417-624. The source H 1417-624 was detected at about 10 sigma in the IBIS map 18-40 keV, with a flux of 14....... H 1417-624 is a Be X-ray Transient (Apparao et al. 1980, A&A 89, 249; Grindlay et al. 1984, ApJ 276, 621) showing a neutron star spin period of 17.54 s and an orbital period of 42.12 days (Finger et al. 1996, A&A Supp. Ser. 120, 209). It was previously detected in 1994 and 1995 (during a strong type...

  4. Serendipitous discovery of warm absorbers in the Seyfert 2 galaxy IRAS 18325-5926

    International Nuclear Information System (INIS)

    Zhang Shuinai; Gu Qiusheng; Peng Zhixin; Ji Li

    2011-01-01

    Warm absorption is a common phenomenon in Seyfert 1s and quasars, but is rare in Seyfert 2s. We report the detection of warm absorbers with high energy resolution in the Seyfert 2 galaxy IRAS 18325-5926 for the first time with Chandra HETGS spectra. An intrinsic absorbing line system with an outflow velocity ∼ 400 km s -1 was found, which is contributed by two warm absorbers with FWHM of 570 km s -1 and 1360 km s -1 , respectively. The two absorbers were adjacent, and moving transversely across our line of sight. We constrained the distance between the center and the absorbers to be a small value, suggesting that the absorbers may originate from the highly ionized accretion disk wind ejected five years ago. The perspective of this type 2 Seyfert provides the best situation in which to investigate the vertical part of the funnel-like outflows. Another weak absorbing line system with zero redshift was also detected, which could be due to Galactic absorption with very high temperature or an intrinsic outflow with a very high velocity ∼ 6000 km s -1 . (research papers)

  5. Integration of nanoparticle cell lysis and microchip PCR for one-step rapid detection of bacteria.

    Science.gov (United States)

    Wan, Weijie; Yeow, John T W

    2012-04-01

    This paper describes an integrated microchip system as an efficient and cost-effective solution involving Nanotechnology and Lab-on-a-Chip technology for the rapid detection of bacteria. The system is based on using surface-modified gold nanoparticles for efficient cell lysis followed by microchip PCR without having to remove the nanoparticles from the PCR solution. Poly(quaternary ammonium) modified gold nanoparticles are used to provide a novel and efficient cell lysis method without the need to go through time-consuming, expensive and complicated microfabrication processes as most of current cell lysis methods for Lab-on-a-Chip applications do. It also facilitates the integration of cell lysis and PCR by sharing the same reaction chamber as PCR uses. It is integrated with a prototype microchip PCR system consisting of a physical microchip PCR device and an automated temperature control mechanism. The research work explores solutions for the problem of PCR inhibition caused by gold nanoparticles as well as for the problem of non-specific PCR amplification in the integrated microchip system. It also explores the possibility of greatly reducing PCR cycling time to achieve the same result compared to the protocol for a regular PCR machine. The simplicity of the setup makes it easy to be integrated with other Lab-on-a-Chip functional modules to create customized solutions for target applications.

  6. Integrated sample-to-detection chip for nucleic acid test assays.

    Science.gov (United States)

    Prakash, R; Pabbaraju, K; Wong, S; Tellier, R; Kaler, K V I S

    2016-06-01

    Nucleic acid based diagnostic techniques are routinely used for the detection of infectious agents. Most of these assays rely on nucleic acid extraction platforms for the extraction and purification of nucleic acids and a separate real-time PCR platform for quantitative nucleic acid amplification tests (NATs). Several microfluidic lab on chip (LOC) technologies have been developed, where mechanical and chemical methods are used for the extraction and purification of nucleic acids. Microfluidic technologies have also been effectively utilized for chip based real-time PCR assays. However, there are few examples of microfluidic systems which have successfully integrated these two key processes. In this study, we have implemented an electro-actuation based LOC micro-device that leverages multi-frequency actuation of samples and reagents droplets for chip based nucleic acid extraction and real-time, reverse transcription (RT) PCR (qRT-PCR) amplification from clinical samples. Our prototype micro-device combines chemical lysis with electric field assisted isolation of nucleic acid in a four channel parallel processing scheme. Furthermore, a four channel parallel qRT-PCR amplification and detection assay is integrated to deliver the sample-to-detection NAT chip. The NAT chip combines dielectrophoresis and electrostatic/electrowetting actuation methods with resistive micro-heaters and temperature sensors to perform chip based integrated NATs. The two chip modules have been validated using different panels of clinical samples and their performance compared with standard platforms. This study has established that our integrated NAT chip system has a sensitivity and specificity comparable to that of the standard platforms while providing up to 10 fold reduction in sample/reagent volumes.

  7. Serendipitous discovery of an infrared bow shock near PSR J1549–4848 with Spitzer

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Zhongxiang [Shanghai Astronomical Observatory, Chinese Academy of Sciences, 80 Nandan Road, Shanghai 200030 (China); Kaplan, David L. [Physics Department, University of Wisconsin-Milwaukee, Milwaukee, WI 53211 (United States); Slane, Patrick [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Morrell, Nidia [Las Campanas Observatory, Observatories of the Carnegie Institution of Washington, La Serena (Chile); Kaspi, Victoria M. [Department of Physics, McGill University, 3600 University Street, Montreal, QC H3A 2T8 (Canada)

    2013-06-01

    We report on the discovery of an infrared cometary nebula around PSR J1549–4848 in our Spitzer survey of a few middle-aged radio pulsars. Following the discovery, multi-wavelength imaging and spectroscopic observations of the nebula were carried out. We detected the nebula in Spitzer Infrared Array Camera 8.0, Multiband Imaging Photometer for Spitzer 24 and 70 μm imaging, and in Spitzer IRS 7.5-14.4 μm spectroscopic observations, and also in the Wide-field Infrared Survey Explorer all-sky survey at 12 and 22 μm. These data were analyzed in detail, and we find that the nebula can be described with a standard bow shock shape, and that its spectrum contains polycyclic aromatic hydrocarbon and H{sub 2} emission features. However, it is not certain which object drives the nebula. We analyze the field stars and conclude that none of them can be the associated object because stars with a strong wind or mass ejection that usually produce bow shocks are much brighter than the field stars. The pulsar is approximately 15'' away from the region in which the associated object is expected to be located. In order to resolve the discrepancy, we suggest that a highly collimated wind could be emitted from the pulsar and produce the bow shock. X-ray imaging to detect the interaction of the wind with the ambient medium- and high-spatial resolution radio imaging to determine the proper motion of the pulsar should be carried out, which will help verify the association of the pulsar with the bow shock nebula.

  8. Microsphere integrated microfluidic disk: synergy of two techniques for rapid and ultrasensitive dengue detection.

    Science.gov (United States)

    Hosseini, Samira; Aeinehvand, Mohammad M; Uddin, Shah M; Benzina, Abderazak; Rothan, Hussin A; Yusof, Rohana; Koole, Leo H; Madou, Marc J; Djordjevic, Ivan; Ibrahim, Fatimah

    2015-11-09

    The application of microfluidic devices in diagnostic systems is well-established in contemporary research. Large specific surface area of microspheres, on the other hand, has secured an important position for their use in bioanalytical assays. Herein, we report a combination of microspheres and microfluidic disk in a unique hybrid platform for highly sensitive and selective detection of dengue virus. Surface engineered polymethacrylate microspheres with carefully designed functional groups facilitate biorecognition in a multitude manner. In order to maximize the utility of the microspheres' specific surface area in biomolecular interaction, the microfluidic disk was equipped with a micromixing system. The mixing mechanism (microballoon mixing) enhances the number of molecular encounters between spheres and target analyte by accessing the entire sample volume more effectively, which subsequently results in signal amplification. Significant reduction of incubation time along with considerable lower detection limits were the prime motivations for the integration of microspheres inside the microfluidic disk. Lengthy incubations of routine analytical assays were reduced from 2 hours to 5 minutes while developed system successfully detected a few units of dengue virus. Obtained results make this hybrid microsphere-microfluidic approach to dengue detection a promising avenue for early detection of this fatal illness.

  9. Integrated Kidney Exosome Analysis for the Detection of Kidney Transplant Rejection.

    Science.gov (United States)

    Park, Jongmin; Lin, Hsing-Ying; Assaker, Jean Pierre; Jeong, Sangmoo; Huang, Chen-Han; Kurdi, A; Lee, Kyungheon; Fraser, Kyle; Min, Changwook; Eskandari, Siawosh; Routray, Sujit; Tannous, Bakhos; Abdi, Reza; Riella, Leonardo; Chandraker, Anil; Castro, Cesar M; Weissleder, Ralph; Lee, Hakho; Azzi, Jamil R

    2017-11-28

    Kidney transplant patients require life-long surveillance to detect allograft rejection. Repeated biopsy, albeit the clinical gold standard, is an invasive procedure with the risk of complications and comparatively high cost. Conversely, serum creatinine or urinary proteins are noninvasive alternatives but are late markers with low specificity. We report a urine-based platform to detect kidney transplant rejection. Termed iKEA (integrated kidney exosome analysis), the approach detects extracellular vesicles (EVs) released by immune cells into urine; we reasoned that T cells, attacking kidney allografts, would shed EVs, which in turn can be used as a surrogate marker for inflammation. We optimized iKEA to detect T-cell-derived EVs and implemented a portable sensing system. When applied to clinical urine samples, iKEA revealed high level of CD3-positive EVs in kidney rejection patients and achieved high detection accuracy (91.1%). Fast, noninvasive, and cost-effective, iKEA could offer new opportunities in managing transplant recipients, perhaps even in a home setting.

  10. An automated and integrated framework for dust storm detection based on ogc web processing services

    Science.gov (United States)

    Xiao, F.; Shea, G. Y. K.; Wong, M. S.; Campbell, J.

    2014-11-01

    Dust storms are known to have adverse effects on public health. Atmospheric dust loading is also one of the major uncertainties in global climatic modelling as it is known to have a significant impact on the radiation budget and atmospheric stability. The complexity of building scientific dust storm models is coupled with the scientific computation advancement, ongoing computing platform development, and the development of heterogeneous Earth Observation (EO) networks. It is a challenging task to develop an integrated and automated scheme for dust storm detection that combines Geo-Processing frameworks, scientific models and EO data together to enable the dust storm detection and tracking processes in a dynamic and timely manner. This study develops an automated and integrated framework for dust storm detection and tracking based on the Web Processing Services (WPS) initiated by Open Geospatial Consortium (OGC). The presented WPS framework consists of EO data retrieval components, dust storm detecting and tracking component, and service chain orchestration engine. The EO data processing component is implemented based on OPeNDAP standard. The dust storm detecting and tracking component combines three earth scientific models, which are SBDART model (for computing aerosol optical depth (AOT) of dust particles), WRF model (for simulating meteorological parameters) and HYSPLIT model (for simulating the dust storm transport processes). The service chain orchestration engine is implemented based on Business Process Execution Language for Web Service (BPEL4WS) using open-source software. The output results, including horizontal and vertical AOT distribution of dust particles as well as their transport paths, were represented using KML/XML and displayed in Google Earth. A serious dust storm, which occurred over East Asia from 26 to 28 Apr 2012, is used to test the applicability of the proposed WPS framework. Our aim here is to solve a specific instance of a complex EO data

  11. Integrated Circuits for Rapid Sample Processing and Electrochemical Detection of Biomarkers

    Science.gov (United States)

    Besant, Justin

    The trade-off between speed and sensitivity of detection is a fundamental challenge in the design of point-of-care diagnostics. As the relevant molecules in many diseases exist natively at extremely low levels, many gold-standard diagnostic tests are designed with high sensitivity at the expense of long incubations needed to amplify the target analytes. The central aim of this thesis is to design new strategies to detect biologically relevant analytes with both high speed and sensitivity. The response time of a biosensor is limited by the ability of the target analyte to accumulate to detectable levels at the sensor surface. We overcome this limitation by designing a range of integrated devices to optimize the flux of the analyte to the sensor by increasing the effective analyte concentration, shortening the required diffusion distance, and confining the analyte in close proximity to the sensor. We couple these devices with novel ultrasensitive electrochemical transduction strategies to convert rare analytes into a detectable signal. We showcase the clinical utility of these approaches with several applications including cancer diagnosis, bacterial identification, and antibiotic susceptibility profiling. We design and optimize a device to isolate rare cancer cells from the bloodstream with near 100% efficiency and 10 000-fold specificity. We analyse pathogen specific nucleic acids by lysing bacteria in close proximity to an electrochemical sensor and find that this approach has 10-fold higher sensitivity than standard lysis in bulk solution. We design an electronic chip to readout the antibiotic susceptibility profile with an hour-long incubation by concentrating bacteria into nanoliter chambers with integrated electrodes. Finally, we report a strategy for ultrasensitive visual readout of nucleic acids as low as 100 fM within 10 minutes using an amplification cascade. The strategies presented could guide the development of fast, sensitive and low-cost diagnostics

  12. Integrated three-dimensional optical MEMS for chip-based fluorescence detection

    Science.gov (United States)

    Hung, Kuo-Yung; Tseng, Fan-Gang; Khoo, Hwa-Seng

    2009-04-01

    This paper presents a novel fluorescence sensing chip for parallel protein microarray detection in the context of a 3-in-1 protein chip system. This portable microchip consists of a monolithic integration of CMOS-based avalanche photo diodes (APDs) combined with a polymer micro-lens, a set of three-dimensional (3D) inclined mirrors for separating adjacent light signals and a low-noise transformer-free dc-dc boost mini-circuit to power the APDs (ripple below 1.28 mV, 0-5 V input, 142 V and 12 mA output). We fabricated our APDs using the planar CMOS process so as to facilitate the post-CMOS integration of optical MEMS components such as the lenses. The APD arrays were arranged in unique circular patterns appropriate for detecting the specific fluorescently labelled protein spots in our study. The array-type APDs were designed so as to compensate for any alignment error as detected by a positional error signal algorithm. The condenser lens was used as a structure for light collection to enhance the fluorescent signals by about 25%. This element also helped to reduce the light loss due to surface absorption. We fabricated an inclined mirror to separate two adjacent fluorescent signals from different specimens. Excitation using evanescent waves helped reduce the interference of the excitation light source. This approach also reduced the number of required optical lenses and minimized the complexity of the structural design. We achieved detection floors for anti-rabbit IgG and Cy5 fluorescent dye as low as 0.5 ng/µl (~3.268 nM). We argue that the intrinsic nature of point-to-point and batch-detection methods as showcased in our chip offers advantages over the serial-scanning approach used in traditional scanner systems. In addition, our system is low cost and lightweight.

  13. Protein complex detection in PPI networks based on data integration and supervised learning method.

    Science.gov (United States)

    Yu, Feng; Yang, Zhi; Hu, Xiao; Sun, Yuan; Lin, Hong; Wang, Jian

    2015-01-01

    Revealing protein complexes are important for understanding principles of cellular organization and function. High-throughput experimental techniques have produced a large amount of protein interactions, which makes it possible to predict protein complexes from protein-protein interaction (PPI) networks. However, the small amount of known physical interactions may limit protein complex detection. The new PPI networks are constructed by integrating PPI datasets with the large and readily available PPI data from biomedical literature, and then the less reliable PPI between two proteins are filtered out based on semantic similarity and topological similarity of the two proteins. Finally, the supervised learning protein complex detection (SLPC), which can make full use of the information of available known complexes, is applied to detect protein complex on the new PPI networks. The experimental results of SLPC on two different categories yeast PPI networks demonstrate effectiveness of the approach: compared with the original PPI networks, the best average improvements of 4.76, 6.81 and 15.75 percentage units in the F-score, accuracy and maximum matching ratio (MMR) are achieved respectively; compared with the denoising PPI networks, the best average improvements of 3.91, 4.61 and 12.10 percentage units in the F-score, accuracy and MMR are achieved respectively; compared with ClusterONE, the start-of the-art complex detection method, on the denoising extended PPI networks, the average improvements of 26.02 and 22.40 percentage units in the F-score and MMR are achieved respectively. The experimental results show that the performances of SLPC have a large improvement through integration of new receivable PPI data from biomedical literature into original PPI networks and denoising PPI networks. In addition, our protein complexes detection method can achieve better performance than ClusterONE.

  14. Application of a fast skyline computation algorithm for serendipitous searching problems

    Science.gov (United States)

    Koizumi, Kenichi; Hiraki, Kei; Inaba, Mary

    2018-02-01

    Skyline computation is a method of extracting interesting entries from a large population with multiple attributes. These entries, called skyline or Pareto optimal entries, are known to have extreme characteristics that cannot be found by outlier detection methods. Skyline computation is an important task for characterizing large amounts of data and selecting interesting entries with extreme features. When the population changes dynamically, the task of calculating a sequence of skyline sets is called continuous skyline computation. This task is known to be difficult to perform for the following reasons: (1) information of non-skyline entries must be stored since they may join the skyline in the future; (2) the appearance or disappearance of even a single entry can change the skyline drastically; (3) it is difficult to adopt a geometric acceleration algorithm for skyline computation tasks with high-dimensional datasets. Our new algorithm called jointed rooted-tree (JR-tree) manages entries using a rooted tree structure. JR-tree delays extend the tree to deep levels to accelerate tree construction and traversal. In this study, we presented the difficulties in extracting entries tagged with a rare label in high-dimensional space and the potential of fast skyline computation in low-latency cell identification technology.

  15. Serendipitous discovery of a dwarf Nova in the Kepler field near the G dwarf KIC 5438845

    International Nuclear Information System (INIS)

    Brown, Alexander; Ayres, Thomas R.; Neff, James E.; Wells, Mark A.; Kowalski, Adam; Hawley, Suzanne; Berdyugina, Svetlana; Harper, Graham M.; Korhonen, Heidi; Piskunov, Nikolai; Saar, Steven; Walkowicz, Lucianne

    2015-01-01

    The Kepler satellite provides a unique window into stellar temporal variability by observing a wide variety of stars with multi-year, near-continuous, high precision, optical photometric time series. While most Kepler targets are faint stars with poorly known physical properties, many unexpected discoveries should result from a long photometric survey of such a large area of sky. During our Kepler Guest Observer programs that monitored late-type stars for starspot and flaring variability, we discovered a previously unknown dwarf nova that lies within a few arcseconds of the mid-G dwarf star KIC 5438845. This dwarf nova underwent nine outbursts over a 4 year time span. The two largest outbursts lasted ∼17–18 days and show strong modulations with a 110.8 minute period and a declining amplitude during the outburst decay phase. These properties are characteristic of an SU UMa-type cataclysmic variable. By analogy with other dwarf nova light curves, we associate the 110.8 minute (1.847 hr) period with the superhump period, close to but slightly longer than the orbital period of the binary. No precursor outbursts are seen before the super-outbursts and the overall super-outburst morphology corresponds to Osaki and Meyer “Case B” outbursts, which are initiated when the outer edge of the disk reaches the tidal truncation radius. “Case B” outbursts are rare within the Kepler light curves of dwarf novae. The dwarf nova is undergoing relatively slow mass transfer, as evidenced by the long intervals between outbursts, but the mass transfer rate appears to be steady, because the smaller “normal” outbursts show a strong correlation between the integrated outburst energy and the elapsed time since the previous outburst. At super-outburst maximum the system was at V ∼ 18, but in quiescence it is fainter than V ∼ 22, which will make any detailed quiescent follow-up of this system difficult.

  16. Development of a high-throughput microfluidic integrated microarray for the detection of chimeric bioweapons.

    Energy Technology Data Exchange (ETDEWEB)

    Sheppod, Timothy; Satterfield, Brent; Hukari, Kyle W.; West, Jason A. A.; Hux, Gary A.

    2006-10-01

    The advancement of DNA cloning has significantly augmented the potential threat of a focused bioweapon assault, such as a terrorist attack. With current DNA cloning techniques, toxin genes from the most dangerous (but environmentally labile) bacterial or viral organism can now be selected and inserted into robust organism to produce an infinite number of deadly chimeric bioweapons. In order to neutralize such a threat, accurate detection of the expressed toxin genes, rather than classification on strain or genealogical decent of these organisms, is critical. The development of a high-throughput microarray approach will enable the detection of unknowns chimeric bioweapons. The development of a high-throughput microarray approach will enable the detection of unknown bioweapons. We have developed a unique microfluidic approach to capture and concentrate these threat genes (mRNA's) upto a 30 fold concentration. These captured oligonucleotides can then be used to synthesize in situ oligonucleotide copies (cDNA probes) of the captured genes. An integrated microfluidic architecture will enable us to control flows of reagents, perform clean-up steps and finally elute nanoliter volumes of synthesized oligonucleotides probes. The integrated approach has enabled a process where chimeric or conventional bioweapons can rapidly be identified based on their toxic function, rather than being restricted to information that may not identify the critical nature of the threat.

  17. Simultaneous detection of lactate and glucose by integrated printed circuit board based array sensing chip

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xuelian [Institute for Clean Energy and Advanced Materials, Southwest University, Chongqing 400715 (China); School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Zang, Jianfeng [Department of Mechanical Engineering and Materials Science, Duke University, Durham, NC 27708 (United States); Liu, Yingshuai; Lu, Zhisong [Institute for Clean Energy and Advanced Materials, Southwest University, Chongqing 400715 (China); Li, Qing, E-mail: Qli@swu.edu.cn [School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Li, Chang Ming, E-mail: ecmli@swu.edu.cn [Institute for Clean Energy and Advanced Materials, Southwest University, Chongqing 400715 (China)

    2013-04-10

    Highlights: ► An integrated printed circuit board (PCB) based array sensing chip was developed. ► Simultaneous detection of lactate and glucose in serum has been demonstrated. ► The array electronic biochip has high signal to noise ratio and high sensitivity. ► Additional electrodes were designed on the chip to correct interferences. -- Abstract: An integrated printed circuit board (PCB) based array sensing chip was developed to simultaneously detect lactate and glucose in mouse serum. The novelty of the chip relies on a concept demonstration of inexpensive high-throughput electronic biochip, a chip design for high signal to noise ratio and high sensitivity by construction of positively charged chitosan/redox polymer Polyvinylimidazole-Os (PVI-Os)/carbon nanotube (CNT) composite sensing platform, in which the positively charged chitosan/PVI-Os is mediator and electrostatically immobilizes the negatively charged enzyme, while CNTs function as an essential cross-linker to network PVI-Os and chitosan due to its negative charged nature. Additional electrodes on the chip with the same sensing layer but without enzymes were prepared to correct the interferences for high specificity. Low detection limits of 0.6 μM and 5 μM were achieved for lactate and glucose, respectively. This work could be extended to inexpensive array sensing chips with high sensitivity, good specificity and high reproducibility for various sensor applications.

  18. CHARACTERIZATION OF A SAMPLE OF INTERMEDIATE-TYPE AGNs. I. SPECTROSCOPIC PROPERTIES AND SERENDIPITOUS DISCOVERY OF NEW DUAL AGNs

    Energy Technology Data Exchange (ETDEWEB)

    Benitez, Erika; Cruz-Gonzalez, Irene; Martinez, Benoni; Jimenez-Bailon, Elena [Instituto de Astronomia, Universidad Nacional Autonoma de Mexico, Apdo. Postal 70-264, Mexico D.F. 04510 (Mexico); Mendez-Abreu, Jairo; Lopez-Martin, Luis [Instituto de Astrofisica de Canarias, E-38200 La Laguna, Tenerife (Spain); Fuentes-Carrera, Isaura [Escuela Superior de Fisica y Matematicas, Instituto Politecnico Nacional (ESFM-IPN), U.P. Adolfo Lopez Mateos, Mexico D.F. 07730 (Mexico); Leon-Tavares, Jonathan [Aalto University Metsaehovi Radio Observatory, Metsaehovintie 114, FI-02540, Kylmaelae (Finland); Chavushyan, Vahram H., E-mail: erika@astro.unam.mx [Instituto Nacional de Astrofisica, Optica y Electronica, Apdo. Postal 51-216, 72000 Puebla (Mexico)

    2013-01-20

    A sample of 10 nearby intermediate-type active galactic nuclei (AGNs) drawn from the Sloan Digital Sky Survey is presented. The aim of this work is to provide estimations of the black hole (BH) mass for the sample galaxies from the dynamics of the broad-line region. For this purpose, a detailed spectroscopic analysis of the objects was done. Using Baldwin-Phillips-Terlevich diagnostic diagrams, we have carefully classified the objects as true intermediate-type AGNs and found that 80%{sup +7.2%} {sub -17.3%} are composite AGNs. The BH mass estimated for the sample is within 6.54 {+-} 0.16 < log M {sub BH} < 7.81 {+-} 0.14. Profile analysis shows that five objects (J120655.63+501737.1, J121607.08+504930.0, J141238.14+391836.5, J143031.18+524225.8, and J162952.88+242638.3) have narrow double-peaked emission lines in both the red (H{alpha}, [N II] {lambda}{lambda}6548,6583 and [S II] {lambda}{lambda}6716, 6731) and the blue (H{beta} and [O III] {lambda}{lambda}4959, 5007) regions of the spectra, with velocity differences ({Delta}V) between the double peaks within 114 km s{sup -1} < {Delta}V < 256 km s{sup -1}. Two of them, J121607.08+504930.0 and J141238.14+391836.5, are candidates for dual AGNs since their double-peaked emission lines are dominated by AGN activity. In searches of dual AGNs, type 1, type II, and intermediate-type AGNs should be carefully separated, due to the high serendipitous number of narrow double-peaked sources (50% {+-} 14.4%) found in our sample.

  19. VizieR Online Data Catalog: NuSTAR serendipitous survey: the 40-month catalog (Lansbury+, 2017)

    Science.gov (United States)

    Lansbury, G. B.; Stern, D.; Aird, J.; Alexander, D. M.; Fuentes, C.; Harrison, F. A.; Treister, E.; Bauer, F. E.; Tomsick, J. A.; Balokovic, M.; Del Moro, A.; Gandhi, P.; Ajello, M.; Annuar, A.; Ballantyne, D. R.; Boggs, S. E.; Brandt, W. N.; Brightman, M.; Chen, C.-T. J.; Christensen, F. E.; Civano, F.; Comastri, A.; Craig, W. W.; Forster, K.; Grefenstette, B. W.; Hailey, C. J.; Hickox, R. C.; Jiang, B.; Jun, H. D.; Koss, M.; Marchesi, S.; Melo, A. D.; Mullaney, J. R.; Noirot, G.; Schulze, S.; Walton, D. J.; Zappacosta, L.; Zhang, W. W.

    2017-09-01

    Over the period from 2012 July to 2015 November, which is the focus of the current study, there are 510 individual NuSTAR exposures that have been incorporated into the serendipitous survey. These exposures were performed over 331 unique fields (i.e., 331 individual sky regions, each with contiguous coverage composed of one or more NuSTAR exposures), yielding a total sky area coverage of 13deg2. Table 1 lists the fields chronologically. The fields have a cumulative exposure time of 20.4Ms. We have undertaken a campaign of dedicated spectroscopic follow-up in the optical-IR bands, obtaining spectroscopic identifications for a large fraction (56%) of the total sample. Since NuSTAR performs science pointings across the whole sky, a successful ground-based follow-up campaign requires the use of observatories at a range of geographic latitudes, and preferably across a range of dates throughout the sidereal year. This has been achieved through observing programs with, primarily, the following telescopes over a multiyear period (2012 Oct 10 to 2016 Jul 10): the Hale Telescope at Palomar Observatory (5.1m; PIs F. A. Harrison and D. Stern); Keck I and II at the W. M. Keck Observatory (10m; PIs F. A. Harrison and D. Stern); the New Technology Telescope (NTT) at La Silla Observatory (3.6m; PI G. B. Lansbury); the Magellan I (Baade) and Magellan II (Clay) Telescopes at Las Campanas Observatory (6.5m; PIs E. Treister and F. E. Bauer); and the Gemini-South observatory (8.1m; PI E. Treister). (5 data files).

  20. IGR J18284-0345: a new hard X-ray transient detected by INTEGRAL

    DEFF Research Database (Denmark)

    Blanchard, T.; Beckmann, V.; Chenevez, Jérôme

    2009-01-01

    V. The intrinsic absorption is not well constrained and has been fixed to the Galactic value of NH = 5.6e21 1/cm**2. The model flux of IGR J18284-0345 is 3.5e-11 erg/cm**2/sec and 1.4e-10 erg/cm**2/sec in the 2-10 keV and 2-30 keV band, respectively. No source has been reported within the Swift/XRT error circle...... at 2009 March 20 at 15:58 UT for an effective on source time of 1.9 ksec. Swift/XRT detected one source within the INTEGRAL error circle at RA=277.125, DEC=-3.762 with an uncertainty of 4 arcsec. The spectrum can be fit together with the INTEGRAL data by a black body model with kT = 4.0±0.2 ke...

  1. Localization and Imaging of Integrated Circuit Defect Using Simple Optical Feedback Detection

    Directory of Open Access Journals (Sweden)

    Vernon Julius Cemine

    2004-12-01

    Full Text Available High-contrast microscopy of semiconductor and metal edifices in integrated circuits is demonstrated by combining laser-scanning confocal reflectance microscopy, one-photon optical-beam-induced current (1P-OBIC imaging, and optical feedback detection via a commercially available semiconductor laser that also serves as the excitation source. The confocal microscope has a compact in-line arrangement with no external photodetector. Confocal and 1P-OBIC images are obtained simultaneously from the same focused beam that is scanned across the sample plane. Image pairs are processed to generate exclusive high-contrast distributions of the semiconductor, metal, and dielectric sites in a GaAs photodiode array sample. The method is then utilized to demonstrate defect localization and imaging in an integrated circuit.

  2. Ge-Based Spin-Photodiodes for Room-Temperature Integrated Detection of Photon Helicity

    KAUST Repository

    Rinaldi, Christian

    2012-05-02

    Spin-photodiodes based on Fe/MgO/Ge(001) heterostructures are reported. These devices perform the room-temperature integrated electrical detection of the spin polarization of a photocurrent generated by circularly polarized photons with a wavelength of 1300 nm, for light pulses with intensity I 0 down to 200 μW. A forward and reverse-biased average photocurrent variation of 5.9% is measured for the complete reversal of the incident light helicity. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. The Impact of Integrated Maneuver Guidance Information on UAS Pilots Performing the Detect and Avoid Task

    Science.gov (United States)

    Rorie, Conrad; Fern, Lisa

    2015-01-01

    The integrated human-in-the-loop (iHITL) simulation examined the effect of four different Detect-and-Avoid (DAA) display concepts on unmanned aircraft system (UAS) pilots' ability to maintain safe separation. The displays varied in the type and amount of guidance they provided to pilots. The study's background and methodology are discussed, followed by the 'measured response' data (i.e., pilots' end-to-end response time in reacting to traffic alerts on their DAA display). Results indicate that display type had a significant impact on how long pilot's spent interacting with the interface (i.e., edit times).

  4. Crack detection with an eddy-current probe integrated into an endoscope

    International Nuclear Information System (INIS)

    Elfinger, F.X.

    1982-01-01

    Objective and quantitive crack detection in inaccessible machine internals is possible without dismantling the equipment through the combination of endoscopic and eddy-current techniques, whereby the endoscope is used both as an optical and a mechanical manipulator. Thus the availability of machinery can be increased and the overhaul costs lowered. The integrated endoscope/eddy-current probe should be utilised whenever normal endoscopic inspection indicates a possible crack location which cannot be assessed definitively through visual observation alone. Its use is also advantageous in monitoring crack propagation within a component. (orig.) [de

  5. INTEGRAL detection of high energy emission from XMMSL1 J171900.4-353217

    DEFF Research Database (Denmark)

    Ishibashi, W.; Bozzo, Enrico; Terrier, Mereghetti, Paizis, Ducci, Gotz, Bazzano, Fiocchi, De Rosa, Tarana, Del Santo, Natalucci, Panessa, Capitanio, Sguer, Bianchin, Watanabe, Kuiper, Barragan, -

    2010-01-01

    During the observations of the SNR RXJ1713.7-3946, performed from 2010 August 12 at 00:14 to 2010 August 14 at 16:02 (UTC; PI R. Terrier), INTEGRAL detected hard X-ray emission from a position consistent with that of the recently discovered transient XMMSL1 J171900.4-353217. The source was within...... the IBIS/ISGRI FOV for a total exposure time of 170 ks and was detected at a significance level of 6.5 sigma (20-40 keV energy band). The best fit position obtained from the OSA software is at RA: 259.738 DEC: -35.508 (J2000), with an associated error of 3.9 arcmin. The ISGRI spectrum is best fit...

  6. Modeling and Detecting Feature Interactions among Integrated Services of Home Network Systems

    Science.gov (United States)

    Igaki, Hiroshi; Nakamura, Masahide

    This paper presents a framework for formalizing and detecting feature interactions (FIs) in the emerging smart home domain. We first establish a model of home network system (HNS), where every networked appliance (or the HNS environment) is characterized as an object consisting of properties and methods. Then, every HNS service is defined as a sequence of method invocations of the appliances. Within the model, we next formalize two kinds of FIs: (a) appliance interactions and (b) environment interactions. An appliance interaction occurs when two method invocations conflict on the same appliance, whereas an environment interaction arises when two method invocations conflict indirectly via the environment. Finally, we propose offline and online methods that detect FIs before service deployment and during execution, respectively. Through a case study with seven practical services, it is shown that the proposed framework is generic enough to capture feature interactions in HNS integrated services. We also discuss several FI resolution schemes within the proposed framework.

  7. An integrated circuit/microsystem/nano-enhanced four species radiation sensor for inexpensive fissionable material detection

    Science.gov (United States)

    Waguespack, Randy Paul

    2011-12-01

    Small scale radiation detectors sensitive to alpha, beta, electromagnetic, neutron radiation are needed to combat the threat of nuclear terrorism and maintain national security. There are many types of radiation detectors on the market, and the type of detector chosen is usually determined by the type of particle to be detected. In the case of fissionable material, an ideal detector needs to detect all four types of radiation, which is not the focus of many detectors. For fissionable materials, the two main types of radiation that must be detected are gamma rays and neutrons. Our detector uses a glass or quartz scintillator doped with 10B nanoparticles to detect all four types of radiation particles. Boron-10 has a thermal neutron cross section of 3,840 barns. The interaction between the neutron and boron results in a secondary charge particle in the form of an alpha particle to be emitted, which is detectable by the scintillator. Radiation impinging on the scintillator matrix produces varying optical pulses dependent on the energy of the particles. The optical pulses are then detected by a photomultiplier (PM) tube, creating a current proportional to the energy of the particle. Current pulses from the PM tube are differentiated by on-chip pulse height spectroscopy, allowing for source discrimination. The pulse height circuitry has been fabricated with discrete circuits and designed into an integrated circuit package. The ability to replace traditional PM tubes with a smaller, less expensive photomultiplier will further reduce the size of the device and enhance the cost effectiveness and portability of the detector.

  8. Evaluation of an integrated graphical display to promote acute change detection in ICU patients

    Science.gov (United States)

    Anders, Shilo; Albert, Robert; Miller, Anne; Weinger, Matthew B.; Doig, Alexa K.; Behrens, Michael; Agutter, Jim

    2012-01-01

    Objective The purpose of this study was to evaluate ICU nurses’ ability to detect patient change using an integrated graphical information display (IGID) versus a conventional tabular ICU patient information display (i.e. electronic chart). Design Using participants from two different sites, we conducted a repeated measures simulator-based experiment to assess ICU nurses’ ability to detect abnormal patient variables using a novel IGID versus a conventional tabular information display. Patient scenarios and display presentations were fully counterbalanced. Measurements We measured percent correct detection of abnormal patient variables, nurses’ perceived workload (NASA-TLX), and display usability ratings. Results 32 ICU nurses (87% female, median age of 29 years, and median ICU experience of 2.5 years) using the IGID detected more abnormal variables compared to the tabular display [F (1,119)=13.0, p < 0.05]. There was a significant main effect of site [F (1, 119)=14.2], with development site participants doing better. There were no significant differences in nurses’ perceived workload. The IGID display was rated as more usable than the conventional display, [F (1, 60)=31.7]. Conclusion Overall, nurses reported more important physiological information with the novel IGID than tabular display. Moreover, the finding of site differences may reflect local influences in work practice and involvement in iterative display design methodology. Information displays developed using user-centered design should accommodate the full diversity of the intended user population across use sites. PMID:22534099

  9. Efficiency of Portable Antennas for Detecting Passive Integrated Transponder Tags in Stream-Dwelling Salmonids.

    Directory of Open Access Journals (Sweden)

    Nolan P Banish

    Full Text Available Portable antennas have become an increasingly common technique for tracking fish marked with passive integrated transponder (PIT tags. We used logistic regression to evaluate how species, fish length, and physical habitat characteristics influence portable antenna detection efficiency in stream-dwelling brown trout (Salmo trutta, bull trout (Salvelinus confluentus, and redband trout (Oncorhynchus mykiss newberrii marked with 12-mm PIT tags. We redetected 56% (20/36 of brown trout, 34% (68/202 of bull trout, and 33% (20/61 of redband trout after a recovery period of 21 to 46 hours. Models indicate support for length and species and minor support for percent boulder, large woody debris, and percent cobble as parameters important for describing variation in detection efficiency, although 95% confidence intervals for estimates were large. The odds of detecting brown trout (1.5 ± 2.2 [mean ± SE] are approximately four times as high as bull trout (0.4 ± 1.6 or redband trout (0.3 ± 1.8 and species-specific differences may be related to length. Our reported detection efficiency for brown trout falls within the range of other studies, but is the first reported for bull trout and redband trout. Portable antennas may be a relatively unbiased way of redetecting varying sizes of all three salmonid species.

  10. Determination of ammonium on an integrated microchip with LED-induced fluorescence detection.

    Science.gov (United States)

    Xue, Shuhua; Uchiyama, Katsumi; Li, Hai-Fang

    2012-01-01

    A simply fabricated microfluidic device integrated with a fluorescence detection system has been developed for on-line determination of ammonium in aqueous samples. A 365-nm light-emitting diode (LED) as an excitation source and a minor band pass filter were mounted into a polydimethylsiloxane (PDMS)-based microchip for the purpose of miniaturization of the entire analytical system. The ammonium sample reacted with o-phthaldialdehyde (OPA) on-chip with sodium sulfite as reducing reagent to produce a fluorescent isoindole derivative, which can emit fluorescence signal at about 425 nm when excited at 365 nm. Effects of pH, flow rate of solutions, concentrations of OPA-reagent, phosphate and sulfite salt were investigated. The calibration curve of ammonium in the range of 0.018-1.8 microg/mL showed a good linear relationship with R2 = 0.9985, and the detection limit was (S/N = 3) 3.6 x 10(-4) microg/mL. The relative standard deviation was 2.8% (n = 11) by calculating at 0.18 microg/mL ammonium for repeated detection. The system was applied to determine the ammonium concentration in rain and river waters, even extent to other analytes fluorescence detection by the presented device.

  11. Electrical Impedance Spectroscopy for Detection of Cells in Suspensions Using Microfluidic Device with Integrated Microneedles

    Directory of Open Access Journals (Sweden)

    Muhammad Asraf Mansor

    2017-02-01

    Full Text Available In this study, we introduce novel method of flow cytometry for cell detection based on impedance measurements. The state of the art method for impedance flow cytometry detection utilizes an embedded electrode in the microfluidic to perform measurement of electrical impedance of the presence of cells at the sensing area. Nonetheless, this method requires an expensive and complicated electrode fabrication process. Furthermore, reuse of the fabricated electrode also requires an intensive and tedious cleaning process. Due to that, we present a microfluidic device with integrated microneedles. The two microneedles are placed at the half height of the microchannel for cell detection and electrical measurement. A commercially-available Tungsten needle was utilized for the microneedles. The microneedles are easily removed from the disposable PDMS (Polydimethylsiloxane microchannel and can be reused with a simple cleaning process, such as washing by ultrasonic cleaning. Although this device was low cost, it preserves the core functionality of the sensor, which is capable of detecting passing cells at the sensing area. Therefore, this device is suitable for low-cost medical and food safety screening and testing process in developing countries.

  12. Rapid, Sensitive, and Reusable Detection of Glucose by a Robust Radiofrequency Integrated Passive Device Biosensor Chip

    Science.gov (United States)

    Kim, Nam-Young; Adhikari, Kishor Kumar; Dhakal, Rajendra; Chuluunbaatar, Zorigt; Wang, Cong; Kim, Eun-Soo

    2015-01-01

    Tremendous demands for sensitive and reliable label-free biosensors have stimulated intensive research into developing miniaturized radiofrequency resonators for a wide range of biomedical applications. Here, we report the development of a robust, reusable radiofrequency resonator based integrated passive device biosensor chip fabricated on a gallium arsenide substrate for the detection of glucose in water-glucose solutions and sera. As a result of the highly concentrated electromagnetic energy between the two divisions of an intertwined spiral inductor coupled with an interdigital capacitor, the proposed glucose biosensor chip exhibits linear detection ranges with high sensitivity at center frequency. This biosensor, which has a sensitivity of up to 199 MHz/mgmL−1 and a short response time of less than 2 sec, exhibited an ultralow detection limit of 0.033 μM and a reproducibility of 0.61% relative standard deviation. In addition, the quantities derived from the measured S-parameters, such as the propagation constant (γ), impedance (Z), resistance (R), inductance (L), conductance (G) and capacitance (C), enabled the effective multi-dimensional detection of glucose. PMID:25588958

  13. Efficiency of portable antennas for detecting passive integrated transponder tags in stream-dwelling salmonids

    Science.gov (United States)

    Banish, Nolan P.; Burdick, Summer M.; Moyer, Katherine R.

    2016-01-01

    Portable antennas have become an increasingly common technique for tracking fish marked with passive integrated transponder (PIT) tags. We used logistic regression to evaluate how species, fish length, and physical habitat characteristics influence portable antenna detection efficiency in stream-dwelling brown trout (Salmo trutta), bull trout (Salvelinus confluentus), and redband trout (Oncorhynchus mykiss newberrii) marked with 12-mm PIT tags. We redetected 56% (20/36) of brown trout, 34% (68/202) of bull trout, and 33% (20/61) of redband trout after a recovery period of 21 to 46 hours. Models indicate support for length and species and minor support for percent boulder, large woody debris, and percent cobble as parameters important for describing variation in detection efficiency, although 95% confidence intervals for estimates were large. The odds of detecting brown trout (1.5 ± 2.2 [mean ± SE]) are approximately four times as high as bull trout (0.4 ± 1.6) or redband trout (0.3 ± 1.8) and species-specific differences may be related to length. Our reported detection efficiency for brown trout falls within the range of other studies, but is the first reported for bull trout and redband trout. Portable antennas may be a relatively unbiased way of redetecting varying sizes of all three salmonid species.

  14. A FRAMEWORK FOR ATTRIBUTE-BASED COMMUNITY DETECTION WITH APPLICATIONS TO INTEGRATED FUNCTIONAL GENOMICS.

    Science.gov (United States)

    Yu, Han; Hageman Blair, Rachael

    2016-01-01

    Understanding community structure in networks has received considerable attention in recent years. Detecting and leveraging community structure holds promise for understanding and potentially intervening with the spread of influence. Network features of this type have important implications in a number of research areas, including, marketing, social networks, and biology. However, an overwhelming majority of traditional approaches to community detection cannot readily incorporate information of node attributes. Integrating structural and attribute information is a major challenge. We propose a exible iterative method; inverse regularized Markov Clustering (irMCL), to network clustering via the manipulation of the transition probability matrix (aka stochastic flow) corresponding to a graph. Similar to traditional Markov Clustering, irMCL iterates between "expand" and "inflate" operations, which aim to strengthen the intra-cluster flow, while weakening the inter-cluster flow. Attribute information is directly incorporated into the iterative method through a sigmoid (logistic function) that naturally dampens attribute influence that is contradictory to the stochastic flow through the network. We demonstrate advantages and the exibility of our approach using simulations and real data. We highlight an application that integrates breast cancer gene expression data set and a functional network defined via KEGG pathways reveal significant modules for survival.

  15. Integrated guidance and control design of a flight vehicle with side-window detection

    Directory of Open Access Journals (Sweden)

    Tianyu ZHENG

    2018-04-01

    Full Text Available This paper considers the guidance and control problem of a flight vehicle with side-window detection. In order to guarantee the target remaining in the seeker's sight of view, the line of sight and the attitude of the flight vehicle should be under some constraints caused by the side-window, which leads to coupling between the guidance and the attitude dynamics model. To deal with the side-window constraints and the coupling, a novel Integrated Guidance and Control (IGC design approach is proposed. Firstly, the relative motion equations are derived in the body-Line of Sight (LOS coordinate system. And the guidance and control problem of the flight vehicle is formulated into an IGC problem with state constraints. Then, based on the singular perturbation method, the IGC problem is decomposed into the control design of the quasi-steady-state subsystem and the boundary-layer subsystem which can be designed separately. Finally, the receding horizon control is applied to the control design for the two subsystems. Simulation results show the effectiveness of the proposed approach. Keywords: Integrated guidance and control, Receding horizon control, Side-window detection, Singular perturbation, Terminal guidance

  16. Intermediate-duration burst from AX J1754.2-2754 detected by INTEGRAL

    DEFF Research Database (Denmark)

    Chenevez, Jérôme; Beeck, Sarah; Brandt, Søren

    2017-01-01

    any emission from the source, and we infer a 3-σ upper limit on the persistent flux of 10-10 erg/cm2/s between 3-40 keV. We tentatively interpret this as an intermediate-duration burst (see, e.g., Cumming et al., ApJ 646, 429, 2006) with a superexpansion phase (see in 't Zand & Weinberg, A&A 520, 81...... is not detected outside the burst interval, with a 3-σ upper limit of 4 mCrab in the JEM-X range, and the burst is only marginally detected by the IBIS/ISGRI instrument in the 20-40 keV energy band. Previous observations regularly taken since February 13, when the region became visible by INTEGRAL, do not reveal....... At this distance, the upper-limit on the persistent emission translates to a 3-40 keV luminosity of 5.2×1035 erg/s, which is consistent with previous values measured when the source was observed in outburst with Chandra (Jonker & Keek 2008, ATel #1643) and Swift (Maccarone et al. 2012, ATel #4109). INTEGRAL...

  17. The neural circuits of innate fear: detection, integration, action, and memorization

    Science.gov (United States)

    Silva, Bianca A.; Gross, Cornelius T.

    2016-01-01

    How fear is represented in the brain has generated a lot of research attention, not only because fear increases the chances for survival when appropriately expressed but also because it can lead to anxiety and stress-related disorders when inadequately processed. In this review, we summarize recent progress in the understanding of the neural circuits processing innate fear in rodents. We propose that these circuits are contained within three main functional units in the brain: a detection unit, responsible for gathering sensory information signaling the presence of a threat; an integration unit, responsible for incorporating the various sensory information and recruiting downstream effectors; and an output unit, in charge of initiating appropriate bodily and behavioral responses to the threatful stimulus. In parallel, the experience of innate fear also instructs a learning process leading to the memorization of the fearful event. Interestingly, while the detection, integration, and output units processing acute fear responses to different threats tend to be harbored in distinct brain circuits, memory encoding of these threats seems to rely on a shared learning system. PMID:27634145

  18. Fabrication of high performance microlenses for an integrated capillary channel electrochromatograph with fluorescence detection

    International Nuclear Information System (INIS)

    Wendt, J. R.; Warren, M. E.; Sweatt, W. C.; Bailey, C. G.; Matzke, C. M.; Arnold, D. W.; Allerman, A. A.; Carter, T. R.; Asbill, R. E.; Samora, S.

    1999-01-01

    We describe the microfabrication of an extremely compact optical system as a key element in an integrated capillary channel electrochromatograph with fluorescence detection. The optical system consists of a vertical cavity surface-emitting laser (VCSEL), two high performance microlenses, and a commercial photodetector. The microlenses are multilevel diffractive optics patterned by electron beam lithography and etched by reactive ion etching in fused silica. The design uses substrate-mode propagation within the fused silica substrate. Two generations of optical subsystems are described. The first generation design has a 6 mm optical length and is integrated directly onto the capillary channel-containing substrate. The second generation design separates the optical system onto its own substrate module and the optical path length is further compressed to 3.5 mm. The first generation design has been tested using direct fluorescence detection with a 750 nm VCSEL pumping a 10 -4 M solution of CY-7 dye. The observed signal-to-noise ratio of better than 100:1 demonstrates that the background signal from scattered pump light is low despite the compact size of the optical system and is adequate for system sensitivity requirements. (c) 1999 American Vacuum Society

  19. A 24 GHz integrated SiGe BiCMOS vital signs detection radar front-end

    DEFF Research Database (Denmark)

    Jensen, Brian Sveistrup; Johansen, Tom K.; Zhurbenko, Vitaliy

    2013-01-01

    In this paper a 24 GHz integrated front-end transceiver for vital signs detection (VSD) radars is described. The heterodyne radar transceiver integrates LO buffering and quadrature splitting circuits, up- and down-conversion SSB mixers and two cascaded receiver LNA's. The chip has been manufactured...

  20. On-chip integrated labelling, transport and detection of tumour cells.

    Science.gov (United States)

    Woods, Jane; Docker, Peter T; Dyer, Charlotte E; Haswell, Stephen J; Greenman, John

    2011-11-01

    Microflow cytometry represents a promising tool for the investigation of diagnostic and prognostic cellular cancer markers, particularly if integrated within a device that allows primary cells to be freshly isolated from the solid tumour biopsies that more accurately reflect patient-specific in vivo tissue microenvironments at the time of staining. However, current tissue processing techniques involve several sequential stages with concomitant cell losses, and as such are inappropriate for use with small biopsies. Accordingly, we present a simple method for combined antibody-labelling and dissociation of heterogeneous cells from a tumour mass, which reduces the number of processing steps. Perfusion of ex vivo tissue at 4°C with antibodies and enzymes slows cellular activity while allowing sufficient time for the diffusion of minimally active enzymes. In situ antibody-labelled cells are then dissociated at 37°C from the tumour mass, whereupon hydrogel-filled channels allow the release of relatively low cell numbers (<1000) into a biomimetic microenvironment. This novel approach to sample processing is then further integrated with hydrogel-based electrokinetic transport of the freshly liberated fluorescent cells for downstream detection. It is anticipated that this integrated microfluidic methodology will have wide-ranging biomedical and clinical applications. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Multi-channel integrated circuits for the detection and measurement of ionizing radiation

    International Nuclear Information System (INIS)

    Engel, G.L.; Duggireddi, N.; Vangapally, V.; Elson, J.M.; Sobotka, L.G.; Charity, R.J.

    2011-01-01

    The Integrated Circuits (IC) Design Research Laboratory at Southern Illinois University Edwardsville (SIUE) has collaborated with the Nuclear Reactions Group at Washington University (WU) to develop a family of multi-channel integrated circuits. To date, the collaboration has successfully produced two micro-chips. The first was an analog shaped and peak sensing chip with on-board constant-fraction discriminators and sparsified readout. This chip is known as Heavy-Ion Nuclear Physics-16 Channel (HINP16C). The second chip, christened PSD8C, was designed to logically complement (in terms of detector types) the HINP16C chip. Pulse Shape Discrimination-8 Channel (PSD8C), featuring three settable charge integration windows per channel, performs pulse shape discrimination (PSD). This paper summarizes the design, capabilities, and features of the HINP16C and PSD8C ICs. It proceeds to discuss the modifications, made to the ICs and their associated systems, which have attempted to improve ease of use, increase performance, and extend capabilities. The paper concludes with a brief discussion of what may be the next chip (employing a multi-sampling scheme) to be added to our CMOS ASIC 'tool box' for radiation detection instrumentation.

  2. INTEGRATION OF IMAGE-DERIVED AND POS-DERIVED FEATURES FOR IMAGE BLUR DETECTION

    Directory of Open Access Journals (Sweden)

    T.-A. Teo

    2016-06-01

    Full Text Available The image quality plays an important role for Unmanned Aerial Vehicle (UAV’s applications. The small fixed wings UAV is suffering from the image blur due to the crosswind and the turbulence. Position and Orientation System (POS, which provides the position and orientation information, is installed onto an UAV to enable acquisition of UAV trajectory. It can be used to calculate the positional and angular velocities when the camera shutter is open. This study proposes a POS-assisted method to detect the blur image. The major steps include feature extraction, blur image detection and verification. In feature extraction, this study extracts different features from images and POS. The image-derived features include mean and standard deviation of image gradient. For POS-derived features, we modify the traditional degree-of-linear-blur (blinear method to degree-of-motion-blur (bmotion based on the collinear condition equations and POS parameters. Besides, POS parameters such as positional and angular velocities are also adopted as POS-derived features. In blur detection, this study uses Support Vector Machines (SVM classifier and extracted features (i.e. image information, POS data, blinear and bmotion to separate blur and sharp UAV images. The experiment utilizes SenseFly eBee UAV system. The number of image is 129. In blur image detection, we use the proposed degree-of-motion-blur and other image features to classify the blur image and sharp images. The classification result shows that the overall accuracy using image features is only 56%. The integration of image-derived and POS-derived features have improved the overall accuracy from 56% to 76% in blur detection. Besides, this study indicates that the performance of the proposed degree-of-motion-blur is better than the traditional degree-of-linear-blur.

  3. Integration of Biosensors and Drug Delivery Technologies for Early Detection and Chronic Management of Illness

    Directory of Open Access Journals (Sweden)

    Viness Pillay

    2013-06-01

    Full Text Available Recent advances in biosensor design and sensing efficacy need to be amalgamated with research in responsive drug delivery systems for building superior health or illness regimes and ensuring good patient compliance. A variety of illnesses require continuous monitoring in order to have efficient illness intervention. Physicochemical changes in the body can signify the occurrence of an illness before it manifests. Even with the usage of sensors that allow diagnosis and prognosis of the illness, medical intervention still has its downfalls. Late detection of illness can reduce the efficacy of therapeutics. Furthermore, the conventional modes of treatment can cause side-effects such as tissue damage (chemotherapy and rhabdomyolysis and induce other forms of illness (hepatotoxicity. The use of drug delivery systems enables the lowering of side-effects with subsequent improvement in patient compliance. Chronic illnesses require continuous monitoring and medical intervention for efficient treatment to be achieved. Therefore, designing a responsive system that will reciprocate to the physicochemical changes may offer superior therapeutic activity. In this respect, integration of biosensors and drug delivery is a proficient approach and requires designing an implantable system that has a closed loop system. This offers regulation of the changes by means of releasing a therapeutic agent whenever illness biomarkers prevail. Proper selection of biomarkers is vital as this is key for diagnosis and a stimulation factor for responsive drug delivery. By detecting an illness before it manifests by means of biomarkers levels, therapeutic dosing would relate to the severity of such changes. In this review various biosensors and drug delivery systems are discussed in order to assess the challenges and future perspectives of integrating biosensors and drug delivery systems for detection and management of chronic illness.

  4. Real-Time Lane Detection on Suburban Streets Using Visual Cue Integration

    Directory of Open Access Journals (Sweden)

    Shehan Fernando

    2014-04-01

    Full Text Available The detection of lane boundaries on suburban streets using images obtained from video constitutes a challenging task. This is mainly due to the difficulties associated with estimating the complex geometric structure of lane boundaries, the quality of lane markings as a result of wear, occlusions by traffic, and shadows caused by road-side trees and structures. Most of the existing techniques for lane boundary detection employ a single visual cue and will only work under certain conditions and where there are clear lane markings. Also, better results are achieved when there are no other on-road objects present. This paper extends our previous work and discusses a novel lane boundary detection algorithm specifically addressing the abovementioned issues through the integration of two visual cues. The first visual cue is based on stripe-like features found on lane lines extracted using a two-dimensional symmetric Gabor filter. The second visual cue is based on a texture characteristic determined using the entropy measure of the predefined neighbourhood around a lane boundary line. The visual cues are then integrated using a rule-based classifier which incorporates a modified sequential covering algorithm to improve robustness. To separate lane boundary lines from other similar features, a road mask is generated using road chromaticity values estimated from CIE L*a*b* colour transformation. Extraneous points around lane boundary lines are then removed by an outlier removal procedure based on studentized residuals. The lane boundary lines are then modelled with Bezier spline curves. To validate the algorithm, extensive experimental evaluation was carried out on suburban streets and the results are presented.

  5. Performance Analysis of Hierarchical Group Key Management Integrated with Adaptive Intrusion Detection in Mobile ad hoc Networks

    Science.gov (United States)

    2016-04-05

    applications in wireless networks such as military battlefields, emergency response, mobile commerce , online gaming, and collaborative work are based on the...www.elsevier.com/locate/peva Performance analysis of hierarchical group key management integrated with adaptive intrusion detection in mobile ad hoc...Accepted 19 September 2010 Available online 26 September 2010 Keywords: Mobile ad hoc networks Intrusion detection Group communication systems Group

  6. Effects of Audio-Visual Integration on the Detection of Masked Speech and Non-Speech Sounds

    Science.gov (United States)

    Eramudugolla, Ranmalee; Henderson, Rachel; Mattingley, Jason B.

    2011-01-01

    Integration of simultaneous auditory and visual information about an event can enhance our ability to detect that event. This is particularly evident in the perception of speech, where the articulatory gestures of the speaker's lips and face can significantly improve the listener's detection and identification of the message, especially when that…

  7. Waterborne disease outbreak detection: an integrated approach using health administrative databases.

    Science.gov (United States)

    Coly, S; Vincent, N; Vaissiere, E; Charras-Garrido, M; Gallay, A; Ducrot, C; Mouly, D

    2017-08-01

    Hundreds of waterborne disease outbreaks (WBDO) of acute gastroenteritis (AGI) due to contaminated tap water are reported in developed countries each year. Such outbreaks are probably under-detected. The aim of our study was to develop an integrated approach to detect and study clusters of AGI in geographical areas with homogeneous exposure to drinking water. Data for the number of AGI cases are available at the municipality level while exposure to tap water depends on drinking water networks (DWN). These two geographical units do not systematically overlap. This study proposed to develop an algorithm which would match the most relevant grouping of municipalities with a specific DWN, in order that tap water exposure can be taken into account when investigating future disease outbreaks. A space-time detection method was applied to the grouping of municipalities. Seven hundred and fourteen new geographical areas (groupings of municipalities) were obtained compared with the 1,310 municipalities and the 1,706 DWN. Eleven potential WBDO were identified in these groupings of municipalities. For ten of them, additional environmental investigations identified at least one event that could have caused microbiological contamination of DWN in the days previous to the occurrence of a reported WBDO.

  8. Automated processing integrated with a microflow cytometer for pathogen detection in clinical matrices.

    Science.gov (United States)

    Golden, J P; Verbarg, J; Howell, P B; Shriver-Lake, L C; Ligler, F S

    2013-02-15

    A spinning magnetic trap (MagTrap) for automated sample processing was integrated with a microflow cytometer capable of simultaneously detecting multiple targets to provide an automated sample-to-answer diagnosis in 40 min. After target capture on fluorescently coded magnetic microspheres, the magnetic trap automatically concentrated the fluorescently coded microspheres, separated the captured target from the sample matrix, and exposed the bound target sequentially to biotinylated tracer molecules and streptavidin-labeled phycoerythrin. The concentrated microspheres were then hydrodynamically focused in a microflow cytometer capable of 4-color analysis (two wavelengths for microsphere identification, one for light scatter to discriminate single microspheres and one for phycoerythrin bound to the target). A three-fold decrease in sample preparation time and an improved detection limit, independent of target preconcentration, was demonstrated for detection of Escherichia coli 0157:H7 using the MagTrap as compared to manual processing. Simultaneous analysis of positive and negative controls, along with the assay reagents specific for the target, was used to obtain dose-response curves, demonstrating the potential for quantification of pathogen load in buffer and serum. Published by Elsevier B.V.

  9. A Serendipitous Scientist.

    Science.gov (United States)

    Lefkowitz, Robert J

    2018-01-06

    Growing up in a middle-class Jewish home in the Bronx, I had only one professional goal: to become a physician. However, as with most of my Vietnam-era MD colleagues, I found my residency training interrupted by the Doctor Draft in 1968. Some of us who were academically inclined fulfilled this obligation by serving in the US Public Health Service as commissioned officers stationed at the National Institutes of Health. This experience would eventually change the entire trajectory of my career. Here I describe how, over a period of years, I transitioned from the life of a physician to that of a physician-scientist; my 50 years of work on cellular receptors; and some miscellaneous thoughts on subjects as varied as Nobel prizes, scientific lineages, mentoring, publishing, and funding.

  10. The Serendipitous Research Process

    Science.gov (United States)

    Nutefall, Jennifer E.; Ryder, Phyllis Mentzell

    2010-01-01

    This article presents the results of an exploratory study asking faculty in the first-year writing program and instruction librarians about their research process focusing on results specifically related to serendipity. Steps to prepare for serendipity are highlighted as well as a model for incorporating serendipity into a first-year writing…

  11. Integrated detection, estimation, and guidance in pursuit of a maneuvering target

    Science.gov (United States)

    Dionne, Dany

    The thesis focuses on efficient solutions of non-cooperative pursuit-evasion games with imperfect information on the state of the system. This problem is important in the context of interception of future maneuverable ballistic missiles. However, the theoretical developments are expected to find application to a broad class of hybrid control and estimation problems in industry. The validity of the results is nevertheless confirmed using a benchmark problem in the area of terminal guidance. A specific interception scenario between an incoming target with no information and a single interceptor missile with noisy measurements is analyzed in the form of a linear hybrid system subject to additive abrupt changes. The general research is aimed to achieve improved homing accuracy by integrating ideas from detection theory, state estimation theory and guidance. The results achieved can be summarized as follows. (i) Two novel maneuver detectors are developed to diagnose abrupt changes in a class of hybrid systems (detection and isolation of evasive maneuvers): a new implementation of the GLR detector and the novel adaptive- H0 GLR detector. (ii) Two novel state estimators for target tracking are derived using the novel maneuver detectors. The state estimators employ parameterized family of functions to described possible evasive maneuvers. (iii) A novel adaptive Bayesian multiple model predictor of the ballistic miss is developed which employs semi-Markov models and ideas from detection theory. (iv) A novel integrated estimation and guidance scheme that significantly improves the homing accuracy is also presented. The integrated scheme employs banks of estimators and guidance laws, a maneuver detector, and an on-line governor; the scheme is adaptive with respect to the uncertainty affecting the probability density function of the filtered state. (v) A novel discretization technique for the family of continuous-time, game theoretic, bang-bang guidance laws is introduced. The

  12. Validation of an integrated software for the detection of rapid eye movement sleep behavior disorder.

    Science.gov (United States)

    Frauscher, Birgit; Gabelia, David; Biermayr, Marlene; Stefani, Ambra; Hackner, Heinz; Mitterling, Thomas; Poewe, Werner; Högl, Birgit

    2014-10-01

    Rapid eye movement sleep without atonia (RWA) is the polysomnographic hallmark of REM sleep behavior disorder (RBD). To partially overcome the disadvantages of manual RWA scoring, which is time consuming but essential for the accurate diagnosis of RBD, we aimed to validate software specifically developed and integrated with polysomnography for RWA detection against the gold standard of manual RWA quantification. Academic referral center sleep laboratory. Polysomnographic recordings of 20 patients with RBD and 60 healthy volunteers were analyzed. N/A. Motor activity during REM sleep was quantified manually and computer assisted (with and without artifact detection) according to Sleep Innsbruck Barcelona (SINBAR) criteria for the mentalis ("any," phasic, tonic electromyographic [EMG] activity) and the flexor digitorum superficialis (FDS) muscle (phasic EMG activity). Computer-derived indices (with and without artifact correction) for "any," phasic, tonic mentalis EMG activity, phasic FDS EMG activity, and the SINBAR index ("any" mentalis + phasic FDS) correlated well with the manually derived indices (all Spearman rhos 0.66-0.98). In contrast with computerized scoring alone, computerized scoring plus manual artifact correction (median duration 5.4 min) led to a significant reduction of false positives for "any" mentalis (40%), phasic mentalis (40.6%), and the SINBAR index (41.2%). Quantification of tonic mentalis and phasic FDS EMG activity was not influenced by artifact correction. The computer algorithm used here appears to be a promising tool for REM sleep behavior disorder detection in both research and clinical routine. A short check for plausibility of automatic detection should be a basic prerequisite for this and all other available computer algorithms. © 2014 Associated Professional Sleep Societies, LLC.

  13. INTEGRAL Detection of the First Prompt Gamma-Ray Signal Coincident with the Gravitational-wave Event GW170817

    DEFF Research Database (Denmark)

    Savchenko, V.; Ferrigno, C.; Kuulkers, E.

    2017-01-01

    We report the INTernational Gamma-ray Astrophysics Laboratory (INTEGRAL) detection of the short gamma-ray burst GRB 170817A (discovered by Fermi-GBM) with a signal-to-noise ratio of 4.6, and, for the first time, its association with the gravitational waves (GWs) from binary neutron star (BNS......) merging event GW170817 detected by the LIGO and Virgo observatories. The significance of association between the gamma-ray burst observed by INTEGRAL and GW170817 is 3.2σ, while the association between the Fermi-GBM and INTEGRAL detections is 4.2σ. GRB 170817A was detected by the SPI-ACS instrument about...

  14. Hierarchically structured photonic crystals for integrated chemical separation and colorimetric detection.

    Science.gov (United States)

    Fu, Qianqian; Zhu, Biting; Ge, Jianping

    2017-02-16

    A SiO 2 colloidal photonic crystal film with a hierarchical porous structure is fabricated to demonstrate an integrated separation and colorimetric detection of chemical species for the first time. This new photonic crystal based thin layer chromatography process requires no dyeing, developing and UV irradiation compared to the traditional TLC. The assembling of mesoporous SiO 2 particles via a supersaturation-induced-precipitation process forms uniform and hierarchical photonic crystals with micron-scale cracks and mesopores, which accelerate the diffusion of developers and intensify the adsorption/desorption between the analytes and silica for efficient separation. Meanwhile, the chemical substances infiltrated to the voids of photonic crystals cause an increase of the refractive index and a large contrast of structural colors towards the unloaded part, so that the sample spots can be directly recognized with the naked eye before and after separation.

  15. Decision making from economic and signal detection perspectives: development of an integrated framework

    Science.gov (United States)

    Lynn, Spencer K.; Wormwood, Jolie B.; Barrett, Lisa F.; Quigley, Karen S.

    2015-01-01

    Behavior is comprised of decisions made from moment to moment (i.e., to respond one way or another). Often, the decision maker cannot be certain of the value to be accrued from the decision (i.e., the outcome value). Decisions made under outcome value uncertainty form the basis of the economic framework of decision making. Behavior is also based on perception—perception of the external physical world and of the internal bodily milieu, which both provide cues that guide decision making. These perceptual signals are also often uncertain: another person's scowling facial expression may indicate threat or intense concentration, alternatives that require different responses from the perceiver. Decisions made under perceptual uncertainty form the basis of the signals framework of decision making. Traditional behavioral economic approaches to decision making focus on the uncertainty that comes from variability in possible outcome values, and typically ignore the influence of perceptual uncertainty. Conversely, traditional signal detection approaches to decision making focus on the uncertainty that arises from variability in perceptual signals and typically ignore the influence of outcome value uncertainty. Here, we compare and contrast the economic and signals frameworks that guide research in decision making, with the aim of promoting their integration. We show that an integrated framework can expand our ability to understand a wider variety of decision-making behaviors, in particular the complexly determined real-world decisions we all make every day. PMID:26217275

  16. Field-effect piezoresistors for vibration detection of nanobeams by using monolithically integrated MOS capacitors

    International Nuclear Information System (INIS)

    Cheng, Haitao; Yang, Heng; Li, XinXin; Wang, Yuelin

    2013-01-01

    A novel piezoresistive sensing method is presented herein for the detection of nanobeam resonator based on a monolithically integrated MOS (metal–oxide–semiconductor) capacitor structure. The bottom layer of the nanobeam located beneath the MOS capacitor is utilized as a piezoresistor for the detection of internal stress resulting from nanobeam deformation, and therefore the challenging process of ultra-shallow junction doping is avoided. When a bias voltage applied on the MOS gate exceeds the threshold, the depletion layer width is built up to the maximum, and the piezoresistive cancellation effect beside the neutral plane is eliminated. Based on a conventional microelectromechanical (MEMS) process, an MOS capacitor is fabricated at the terminal of a double-clamped nanobeam with dimensions of 46 µm × 7 µm × 149 nm. The measured R–V curve of this MOS structure presents a 64.7 nm thick piezoresistor which closely agrees with the design. This double-clamped nanobeam is excited into mechanical resonance by mounting it on a piezoelectric ceramic, and the amplitude–frequency response is measured by a network analyzer. The measured resonant frequency is 3.97 MHz and the quality (Q)-factor is 82 in atmosphere environment. Besides, this piezoresistive sensing method is verified by a laser-Doppler vibrometry. (paper)

  17. Enhanced Missing Proteins Detection in NCI60 Cell Lines Using an Integrative Search Engine Approach.

    Science.gov (United States)

    Guruceaga, Elizabeth; Garin-Muga, Alba; Prieto, Gorka; Bejarano, Bartolomé; Marcilla, Miguel; Marín-Vicente, Consuelo; Perez-Riverol, Yasset; Casal, J Ignacio; Vizcaíno, Juan Antonio; Corrales, Fernando J; Segura, Victor

    2017-12-01

    The Human Proteome Project (HPP) aims deciphering the complete map of the human proteome. In the past few years, significant efforts of the HPP teams have been dedicated to the experimental detection of the missing proteins, which lack reliable mass spectrometry evidence of their existence. In this endeavor, an in depth analysis of shotgun experiments might represent a valuable resource to select a biological matrix in design validation experiments. In this work, we used all the proteomic experiments from the NCI60 cell lines and applied an integrative approach based on the results obtained from Comet, Mascot, OMSSA, and X!Tandem. This workflow benefits from the complementarity of these search engines to increase the proteome coverage. Five missing proteins C-HPP guidelines compliant were identified, although further validation is needed. Moreover, 165 missing proteins were detected with only one unique peptide, and their functional analysis supported their participation in cellular pathways as was also proposed in other studies. Finally, we performed a combined analysis of the gene expression levels and the proteomic identifications from the common cell lines between the NCI60 and the CCLE project to suggest alternatives for further validation of missing protein observations.

  18. Detection vs. selection: integration of genetic, epigenetic and environmental cues in fluctuating environments.

    Science.gov (United States)

    McNamara, John M; Dall, Sasha R X; Hammerstein, Peter; Leimar, Olof

    2016-10-01

    There are many inputs during development that influence an organism's fit to current or upcoming environments. These include genetic effects, transgenerational epigenetic influences, environmental cues and developmental noise, which are rarely investigated in the same formal framework. We study an analytically tractable evolutionary model, in which cues are integrated to determine mature phenotypes in fluctuating environments. Environmental cues received during development and by the mother as an adult act as detection-based (individually observed) cues. The mother's phenotype and a quantitative genetic effect act as selection-based cues (they correlate with environmental states after selection). We specify when such cues are complementary and tend to be used together, and when using the most informative cue will predominate. Thus, we extend recent analyses of the evolutionary implications of subsets of these effects by providing a general diagnosis of the conditions under which detection and selection-based influences on development are likely to evolve and coexist. © 2016 John Wiley & Sons Ltd/CNRS.

  19. Multichannel detection of ionic currents through two nanopores fabricated on integrated Si3N4 membranes.

    Science.gov (United States)

    Yanagi, Itaru; Akahori, Rena; Aoki, Mayu; Harada, Kunio; Takeda, Ken-Ichi

    2016-08-16

    Integration of solid-state nanopores and multichannel detection of signals from each nanopore are effective measures for realizing high-throughput nanopore sensors. In the present study, we demonstrated fabrication of Si3N4 membrane arrays and the simultaneous measurement of ionic currents through two nanopores formed in two adjacent membranes. Membranes with thicknesses as low as 6.4 nm and small nanopores with diameters of less than 2 nm could be fabricated using the poly-Si sacrificial-layer process and multilevel pulse-voltage injection. Using the fabricated nanopore membranes, we successfully achieved simultaneous detection of clear ionic-current blockades when single-stranded short homopolymers (poly(dA)60) passed through two nanopores. In addition, we investigated the signal crosstalk and leakage current among separated chambers. When two nanopores were isolated on the front surface of the membrane, there was no signal crosstalk or leakage current between the chambers. However, when two nanopores were isolated on the backside of the Si substrate, signal crosstalk and leakage current were observed owing to high-capacitance coupling between the chambers and electrolysis of water on the surface of the Si substrate. The signal crosstalk and leakage current could be suppressed by oxidizing the exposed Si surface in the membrane chip. Finally, the observed ionic-current blockade when poly(dA)60 passed through the nanopore in the oxidized chip was approximately half of that observed in the non-oxidized chip.

  20. A Microchip for Integrated Single-Cell Gene Expression Profiling and Genotoxicity Detection

    Directory of Open Access Journals (Sweden)

    Hui Dong

    2016-09-01

    Full Text Available Microfluidics-based single-cell study is an emerging approach in personalized treatment or precision medicine studies. Single-cell gene expression holds a potential to provide treatment selections with maximized efficacy to help cancer patients based on a genetic understanding of their disease. This work presents a multi-layer microchip for single-cell multiplexed gene expression profiling and genotoxicity detection. Treated by three drug reagents (i.e., methyl methanesulfonate, docetaxel and colchicine with varied concentrations and time lengths, individual human cancer cells (MDA-MB-231 are lysed on-chip, and the released mRNA templates are captured and reversely transcribed into single strand DNA. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, cyclin-dependent kinase inhibitor 1A (CDKN1A, and aurora kinase A (AURKA genes from single cells are amplified and real-time quantified through multiplex polymerase chain reaction. The microchip is capable of integrating all steps of single-cell multiplexed gene expression profiling, and providing precision detection of drug induced genotoxic stress. Throughput has been set to be 18, and can be further increased following the same approach. Numerical simulation of on-chip single cell trapping and heat transfer has been employed to evaluate the chip design and operation.

  1. Real-time QRS detection using integrated variance for ECG gated cardiac MRI

    Directory of Open Access Journals (Sweden)

    Schmidt Marcus

    2016-09-01

    Full Text Available During magnetic resonance imaging (MRI, a patient’s vital signs are required for different purposes. In cardiac MRI (CMR, an electrocardiogram (ECG of the patient is required for triggering the image acquisition process. However, a reliable QRS detection of an ECG signal acquired inside an MRI scanner is a challenging task due to the magnetohydrodynamic (MHD effect which interferes with the ECG. The aim of this work was to develop a reliable QRS detector usable inside the MRI which also fulfills the standards for medical devices (IEC 60601-2-27. Therefore, a novel real-time QRS detector based on integrated variance measurements is presented. The algorithm was trained on ANSI/AAMI EC13 test waveforms and was then applied to two databases with 12-lead ECG signals recorded inside and outside an MRI scanner. Reliable results for both databases were achieved for the ECG signals recorded inside (DBMRI: sensitivity Se = 99.94%, positive predictive value +P = 99.84% and outside (DBInCarT: Se = 99.29%, +P = 99.72% the MRI. Due to the accurate R-peak detection in real-time this can be used for monitoring and triggering in MRI exams.

  2. Network-Based Real-time Integrated Fire Detection and Alarm (FDA) System with Building Automation

    Science.gov (United States)

    Anwar, F.; Boby, R. I.; Rashid, M. M.; Alam, M. M.; Shaikh, Z.

    2017-11-01

    Fire alarm systems have become increasingly an important lifesaving technology in many aspects, such as applications to detect, monitor and control any fire hazard. A large sum of money is being spent annually to install and maintain the fire alarm systems in buildings to protect property and lives from the unexpected spread of fire. Several methods are already developed and it is improving on a daily basis to reduce the cost as well as increase quality. An integrated Fire Detection and Alarm (FDA) systems with building automation was studied, to reduce cost and improve their reliability by preventing false alarm. This work proposes an improved framework for FDA system to ensure a robust intelligent network of FDA control panels in real-time. A shortest path algorithmic was chosen for series of buildings connected by fiber optic network. The framework shares information and communicates with each fire alarm panels connected in peer to peer configuration and declare the network state using network address declaration from any building connected in network. The fiber-optic connection was proposed to reduce signal noises, thus increasing large area coverage, real-time communication and long-term safety. Based on this proposed method an experimental setup was designed and a prototype system was developed to validate the performance in practice. Also, the distributed network system was proposed to connect with an optional remote monitoring terminal panel to validate proposed network performance and ensure fire survivability where the information is sequentially transmitted. The proposed FDA system is different from traditional fire alarm and detection system in terms of topology as it manages group of buildings in an optimal and efficient manner.Introduction

  3. Microfluidics & nanotechnology: Towards fully integrated analytical devices for the detection of cancer biomarkers

    KAUST Repository

    Perozziello, Gerardo; Candeloro, Patrizio; Gentile, Francesco T.; Nicastri, Annalisa; Perri, Angela Mena; Coluccio, Maria Laura; Adamo, A.; Pardeo, Francesca; Catalano, Rossella; Parrotta, Elvira; Espinosa, Horacio Dante; Cuda, Giovanni; Di Fabrizio, Enzo M.

    2014-01-01

    In this paper, we describe an innovative modular microfluidic platform allowing filtering, concentration and analysis of peptides from a complex mixture. The platform is composed of a microfluidic filtering device and a superhydrophobic surface integrating surface enhanced Raman scattering (SERS) sensors. The microfluidic device was used to filter specific peptides (MW 1553.73 D) derived from the BRCA1 protein, a tumor-suppressor molecule which plays a pivotal role in the development of breast cancers, from albumin (66.5 KD), the most represented protein in human plasma. The filtering process consisted of driving the complex mixture through a porous membrane having a cut-off of 12-14 kD by hydrodynamic flow. The filtered samples coming out of the microfluidic device were subsequently deposited on a superhydrophobic surface formed by micro pillars on top of which nanograins were fabricated. The nanograins coupled to a Raman spectroscopy instrument acted as a SERS sensor and allowed analysis of the filtered sample on top of the surface once it evaporated. By using the presented platform, we demonstrate being able to sort small peptides from bigger proteins and to detect them by using a label-free technique at a resolution down to 0.1 ng μL-1. The combination of microfluidics and nanotechnology to develop the presented microfluidic platform may give rise to a new generation of biosensors capable of detecting low concentration samples from complex mixtures without the need for any sample pretreatment or labelling. The developed devices could have future applications in the field of early diagnosis of severe illnesses, e.g. early cancer detection. This journal is

  4. Integrated ensemble noise-reconstructed empirical mode decomposition for mechanical fault detection

    Science.gov (United States)

    Yuan, Jing; Ji, Feng; Gao, Yuan; Zhu, Jun; Wei, Chenjun; Zhou, Yu

    2018-05-01

    A new branch of fault detection is utilizing the noise such as enhancing, adding or estimating the noise so as to improve the signal-to-noise ratio (SNR) and extract the fault signatures. Hereinto, ensemble noise-reconstructed empirical mode decomposition (ENEMD) is a novel noise utilization method to ameliorate the mode mixing and denoised the intrinsic mode functions (IMFs). Despite the possibility of superior performance in detecting weak and multiple faults, the method still suffers from the major problems of the user-defined parameter and the powerless capability for a high SNR case. Hence, integrated ensemble noise-reconstructed empirical mode decomposition is proposed to overcome the drawbacks, improved by two noise estimation techniques for different SNRs as well as the noise estimation strategy. Independent from the artificial setup, the noise estimation by the minimax thresholding is improved for a low SNR case, which especially shows an outstanding interpretation for signature enhancement. For approximating the weak noise precisely, the noise estimation by the local reconfiguration using singular value decomposition (SVD) is proposed for a high SNR case, which is particularly powerful for reducing the mode mixing. Thereinto, the sliding window for projecting the phase space is optimally designed by the correlation minimization. Meanwhile, the reasonable singular order for the local reconfiguration to estimate the noise is determined by the inflection point of the increment trend of normalized singular entropy. Furthermore, the noise estimation strategy, i.e. the selection approaches of the two estimation techniques along with the critical case, is developed and discussed for different SNRs by means of the possible noise-only IMF family. The method is validated by the repeatable simulations to demonstrate the synthetical performance and especially confirm the capability of noise estimation. Finally, the method is applied to detect the local wear fault

  5. INTEGRAL hard X-ray detection of HMXB GX 304-1 and H1417-624

    DEFF Research Database (Denmark)

    Manousakis, A.; Beckmann, V.; Bianchin, V.

    2008-01-01

    We report on the first detection of the Be star HMXBs GX 304-1 and H1417-624 above 20 keV with the IBIS/ISGRI X-ray imager on board INTEGRAL. From 2008-06-24 to 2008-07-09, INTEGRAL performed monitoring observations of the Galactic plane around l=305 degrees for a total exposure time of 352 ksec....

  6. Integrating malaria surveillance with climate data for outbreak detection and forecasting: the EPIDEMIA system.

    Science.gov (United States)

    Merkord, Christopher L; Liu, Yi; Mihretie, Abere; Gebrehiwot, Teklehaymanot; Awoke, Worku; Bayabil, Estifanos; Henebry, Geoffrey M; Kassa, Gebeyaw T; Lake, Mastewal; Wimberly, Michael C

    2017-02-23

    Early indication of an emerging malaria epidemic can provide an opportunity for proactive interventions. Challenges to the identification of nascent malaria epidemics include obtaining recent epidemiological surveillance data, spatially and temporally harmonizing this information with timely data on environmental precursors, applying models for early detection and early warning, and communicating results to public health officials. Automated web-based informatics systems can provide a solution to these problems, but their implementation in real-world settings has been limited. The Epidemic Prognosis Incorporating Disease and Environmental Monitoring for Integrated Assessment (EPIDEMIA) computer system was designed and implemented to integrate disease surveillance with environmental monitoring in support of operational malaria forecasting in the Amhara region of Ethiopia. A co-design workshop was held with computer scientists, epidemiological modelers, and public health partners to develop an initial list of system requirements. Subsequent updates to the system were based on feedback obtained from system evaluation workshops and assessments conducted by a steering committee of users in the public health sector. The system integrated epidemiological data uploaded weekly by the Amhara Regional Health Bureau with remotely-sensed environmental data freely available from online archives. Environmental data were acquired and processed automatically by the EASTWeb software program. Additional software was developed to implement a public health interface for data upload and download, harmonize the epidemiological and environmental data into a unified database, automatically update time series forecasting models, and generate formatted reports. Reporting features included district-level control charts and maps summarizing epidemiological indicators of emerging malaria outbreaks, environmental risk factors, and forecasts of future malaria risk. Successful implementation and

  7. Integration of Organic Light Emitting Diodes and Organic Photodetectors for Lab-on-a-Chip Bio-Detection Systems

    Directory of Open Access Journals (Sweden)

    Graeme Williams

    2014-02-01

    Full Text Available The rapid development of microfluidics and lab-on-a-chip (LoC technologies have allowed for the efficient separation and manipulation of various biomaterials, including many diagnostically relevant species. Organic electronics have similarly enjoyed a great deal of research, resulting in tiny, highly efficient, wavelength-selective organic light-emitting diodes (OLEDs and organic photodetectors (OPDs. We consider the blend of these technologies for rapid detection and diagnosis of biological species. In the ideal system, optically active or fluorescently labelled biological species can be probed via light emission from OLEDs, and their subsequent light emission can be detected with OPDs. The relatively low cost and simple fabrication of the organic electronic devices suggests the possibility of disposable test arrays. Further, with full integration, the finalized system can be miniaturized and made simple to use. In this review, we consider the design constraints of OLEDs and OPDs required to achieve fully organic electronic optical bio-detection systems. Current approaches to integrated LoC optical sensing are first discussed. Fully realized OLED- and OPD-specific photoluminescence detection systems from literature are then examined, with a specific focus on their ultimate limits of detection. The review highlights the enormous potential in OLEDs and OPDs for integrated optical sensing, and notes the key avenues of research for cheap and powerful LoC bio-detection systems.

  8. Clinical validation of integrated nucleic acid and protein detection on an electrochemical biosensor array for urinary tract infection diagnosis.

    Directory of Open Access Journals (Sweden)

    Ruchika Mohan

    Full Text Available BACKGROUND: Urinary tract infection (UTI is a common infection that poses a substantial healthcare burden, yet its definitive diagnosis can be challenging. There is a need for a rapid, sensitive and reliable analytical method that could allow early detection of UTI and reduce unnecessary antibiotics. Pathogen identification along with quantitative detection of lactoferrin, a measure of pyuria, may provide useful information towards the overall diagnosis of UTI. Here, we report an integrated biosensor platform capable of simultaneous pathogen identification and detection of urinary biomarker that could aid the effectiveness of the treatment and clinical management. METHODOLOGY/PRINCIPAL FINDINGS: The integrated pathogen 16S rRNA and host lactoferrin detection using the biosensor array was performed on 113 clinical urine samples collected from patients at risk for complicated UTI. For pathogen detection, the biosensor used sandwich hybridization of capture and detector oligonucleotides to the target analyte, bacterial 16S rRNA. For detection of the protein biomarker, the biosensor used an analogous electrochemical sandwich assay based on capture and detector antibodies. For this assay, a set of oligonucleotide probes optimized for hybridization at 37°C to facilitate integration with the immunoassay was developed. This probe set targeted common uropathogens including E. coli, P. mirabilis, P. aeruginosa and Enterococcus spp. as well as less common uropathogens including Serratia, Providencia, Morganella and Staphylococcus spp. The biosensor assay for pathogen detection had a specificity of 97% and a sensitivity of 89%. A significant correlation was found between LTF concentration measured by the biosensor and WBC and leukocyte esterase (p<0.001 for both. CONCLUSION/SIGNIFICANCE: We successfully demonstrate simultaneous detection of nucleic acid and host immune marker on a single biosensor array in clinical samples. This platform can be used for

  9. An integrated theory of attention and decision making in visual signal detection.

    Science.gov (United States)

    Smith, Philip L; Ratcliff, Roger

    2009-04-01

    The simplest attentional task, detecting a cued stimulus in an otherwise empty visual field, produces complex patterns of performance. Attentional cues interact with backward masks and with spatial uncertainty, and there is a dissociation in the effects of these variables on accuracy and on response time. A computational theory of performance in this task is described. The theory links visual encoding, masking, spatial attention, visual short-term memory (VSTM), and perceptual decision making in an integrated dynamic framework. The theory assumes that decisions are made by a diffusion process driven by a neurally plausible, shunting VSTM. The VSTM trace encodes the transient outputs of early visual filters in a durable form that is preserved for the time needed to make a decision. Attention increases the efficiency of VSTM encoding, either by increasing the rate of trace formation or by reducing the delay before trace formation begins. The theory provides a detailed, quantitative account of attentional effects in spatial cuing tasks at the level of response accuracy and the response time distributions. (c) 2009 APA, all rights reserved

  10. Using ontology databases for scalable query answering, inconsistency detection, and data integration

    Science.gov (United States)

    Dou, Dejing

    2011-01-01

    An ontology database is a basic relational database management system that models an ontology plus its instances. To reason over the transitive closure of instances in the subsumption hierarchy, for example, an ontology database can either unfold views at query time or propagate assertions using triggers at load time. In this paper, we use existing benchmarks to evaluate our method—using triggers—and we demonstrate that by forward computing inferences, we not only improve query time, but the improvement appears to cost only more space (not time). However, we go on to show that the true penalties were simply opaque to the benchmark, i.e., the benchmark inadequately captures load-time costs. We have applied our methods to two case studies in biomedicine, using ontologies and data from genetics and neuroscience to illustrate two important applications: first, ontology databases answer ontology-based queries effectively; second, using triggers, ontology databases detect instance-based inconsistencies—something not possible using views. Finally, we demonstrate how to extend our methods to perform data integration across multiple, distributed ontology databases. PMID:22163378

  11. Integrated circuit microsensor for selectively detection nitrogen dioxide and diisopropyl methylphosphonate

    Energy Technology Data Exchange (ETDEWEB)

    Kolesar, E.S. Jr. (Air Force Inst. of Technology, Dept. of Electrical and Computer Engineering, Wright-Patterson Air Force Base, Dayton, OH (United States)); Brothers, C.P. Jr. (Air Force Inst. of Technology, Dept. of Electrical and Computer Engineering, Wright-Patterson Air Force Base, Dayton, OH (United States)); Howe, C.P. (Air Force Inst. of Technology, Dept. of Electrical and Computer Engineering, Wright-Patterson Air Force Base, Dayton, OH (United States)); Jenkins, T.J. (Air Force Inst. of Technology, Dept. of Electrical and Computer Engineering, Wright-Patterson Air Force Base, Dayton, OH (United States)); Moosey, A.T. (Air Force Inst. of Technology, Dept. of Electrical and Computer Engineering, Wright-Patterson Air Force Base, Dayton, OH (United States)); Shin, J.E. (Air Force Inst. of Technology, Dept. of Electrical and Computer Engineering, Wright-Patterson Air Force Base, Dayton, OH (United States)); Wiseman, J.M. (Air Force Inst. of Technology, Dept. of Electrical an

    1992-11-20

    A novel gas-sensitive microsensor, known as the interdigitated gate electrode field effect transistor (IGEFET), was realized by selectively depositing a chemically-active, electron-beam evaporated copper phthalocyanine (CuPc) thin film onto an integrated circuit (IC). When isothermally operated at 150 C, the microsensor can selectively and reversibly detect parts-per-billion concentration levels of nitrogen dioxide (NO[sub 2]) and diisopropyl methylphosphonate (DIMP). The selectivity feature of the microsensor was established by operating it with a 5 V peak amplitude, 2 [mu]s duration, 1000 Hz repetition frequency pulse, and then analyzing its time- and frequency-domain responses. The envelopes associated with the normalized-difference Fourier transform magnitude spectra, and their derivatives, reveal features which unambiguously distinguish the NO[sub 2] and DIMP challenge gas responses. Furthermore, the area beneath each response envelope may correspondingly be interpreted as the microsensor's sensitivity for a specific challenge gas concentration. Scanning electron microscopy (SEM) was used to characterize the morphology of the CuPc thin film. Additionally, infrared (IR) spectroscopy was employed to verify the [alpha]- and [beta]-phases of the sublimed CuPc thin films and to study the NO[sub 2]- and DIMP-CuPc interactions. (orig.)

  12. Particle Filter with Integrated Voice Activity Detection for Acoustic Source Tracking

    Directory of Open Access Journals (Sweden)

    Anders M. Johansson

    2007-01-01

    Full Text Available In noisy and reverberant environments, the problem of acoustic source localisation and tracking (ASLT using an array of microphones presents a number of challenging difficulties. One of the main issues when considering real-world situations involving human speakers is the temporally discontinuous nature of speech signals: the presence of silence gaps in the speech can easily misguide the tracking algorithm, even in practical environments with low to moderate noise and reverberation levels. A natural extension of currently available sound source tracking algorithms is the integration of a voice activity detection (VAD scheme. We describe a new ASLT algorithm based on a particle filtering (PF approach, where VAD measurements are fused within the statistical framework of the PF implementation. Tracking accuracy results for the proposed method is presented on the basis of synthetic audio samples generated with the image method, whereas performance results obtained with a real-time implementation of the algorithm, and using real audio data recorded in a reverberant room, are published elsewhere. Compared to a previously proposed PF algorithm, the experimental results demonstrate the improved robustness of the method described in this work when tracking sources emitting real-world speech signals, which typically involve significant silence gaps between utterances.

  13. Time integration and statistical regulation applied to mobile objects detection in a sequence of images

    International Nuclear Information System (INIS)

    Letang, Jean-Michel

    1993-01-01

    This PhD thesis deals with the detection of moving objects in monocular image sequences. The first section presents the inherent problems of motion analysis in real applications. We propose a method robust to perturbations frequently encountered during acquisition of outdoor scenes. It appears three main directions for investigations, all of them pointing out the importance of the temporal axis, which is a specific dimension for motion analysis. In the first part, the image sequence is considered as a set of temporal signals. The temporal multi-scale decomposition enables the characterization of various dynamical behaviors of the objects being in the scene at a given instant. A second module integrates motion information. This elementary trajectography of moving objects provides a temporal prediction map, giving a confidence level of motion presence. Interactions between both sets of data are expressed within a statistical regularization. Markov random field models supply a formal framework to convey a priori knowledge of the primitives to be evaluated. A calibration method with qualitative boxes is presented to estimate model parameters. Our approach requires only simple computations and leads to a rather fast algorithm, that we evaluate in the last section over various typical sequences. (author) [fr

  14. Rapid detection of Salmonella in pet food: design and evaluation of integrated methods based on real-time PCR detection.

    Science.gov (United States)

    Balachandran, Priya; Friberg, Maria; Vanlandingham, V; Kozak, K; Manolis, Amanda; Brevnov, Maxim; Crowley, Erin; Bird, Patrick; Goins, David; Furtado, Manohar R; Petrauskene, Olga V; Tebbs, Robert S; Charbonneau, Duane

    2012-02-01

    Reducing the risk of Salmonella contamination in pet food is critical for both companion animals and humans, and its importance is reflected by the substantial increase in the demand for pathogen testing. Accurate and rapid detection of foodborne pathogens improves food safety, protects the public health, and benefits food producers by assuring product quality while facilitating product release in a timely manner. Traditional culture-based methods for Salmonella screening are laborious and can take 5 to 7 days to obtain definitive results. In this study, we developed two methods for the detection of low levels of Salmonella in pet food using real-time PCR: (i) detection of Salmonella in 25 g of dried pet food in less than 14 h with an automated magnetic bead-based nucleic acid extraction method and (ii) detection of Salmonella in 375 g of composite dry pet food matrix in less than 24 h with a manual centrifugation-based nucleic acid preparation method. Both methods included a preclarification step using a novel protocol that removes food matrix-associated debris and PCR inhibitors and improves the sensitivity of detection. Validation studies revealed no significant differences between the two real-time PCR methods and the standard U.S. Food and Drug Administration Bacteriological Analytical Manual (chapter 5) culture confirmation method.

  15. Integration

    DEFF Research Database (Denmark)

    Emerek, Ruth

    2004-01-01

    Bidraget diskuterer de forskellige intergrationsopfattelse i Danmark - og hvad der kan forstås ved vellykket integration......Bidraget diskuterer de forskellige intergrationsopfattelse i Danmark - og hvad der kan forstås ved vellykket integration...

  16. A hidden pygmy devil from the Philippines: Arulenus miae sp. nov.-a new species serendipitously discovered in an amateur Facebook post (Tetrigidae: Discotettiginae).

    Science.gov (United States)

    Skejo, Josip; Caballero, Joy Honezza S

    2016-01-21

    Arulenus miae Skejo & Caballero sp. nov. is described from Buknidon and Davao, Mindanao, the Philippines. The species was serendipitously found in an amateur photo posted in Orthoptera Facebook group by Leif Gabrielsen. Holotype and paratype are deposited in Nederlands Centrum voor Biodiversiteit in Leiden, the Netherlands. Detailed comparison with Arulenus validispinus Stål, 1877 is given. A new diagnosis of the genus and A. validispinus is given. The paper is part of the revision of the subfamily Discotettiginae. This study provides a good example of how social networks can be used as a modern tool of discovering biodiversity if the regulations of the International Code of the Zoological Nomenclature are followed. A brief insight into habitat and ecology of this rainforest and mountainous species is presented.

  17. Integrated Optimization of Long-Range Underwater Signal Detection, Feature Extraction, and Classification for Nuclear Treaty Monitoring

    NARCIS (Netherlands)

    Tuma, M.; Rorbech, V.; Prior, M.; Igel, C.

    2016-01-01

    We designed and jointly optimized an integrated signal processing chain for detection and classification of long-range passive-acoustic underwater signals recorded by the global geophysical monitoring network of the Comprehensive Nuclear-Test-Ban Treaty Organization. Starting at the level of raw

  18. Microspot-based ELISA in microfluidics: chemiluminescence and colorimetry detection using integrated thin-film hydrogenated amorphous silicon photodiodes.

    Science.gov (United States)

    Novo, Pedro; Prazeres, Duarte Miguel França; Chu, Virginia; Conde, João Pedro

    2011-12-07

    Microfluidic technology has the potential to decrease the time of analysis and the quantity of sample and reactants required in immunoassays, together with the potential of achieving high sensitivity, multiplexing, and portability. A lab-on-a-chip system was developed and optimized using optical and fluorescence microscopy. Primary antibodies are adsorbed onto the walls of a PDMS-based microchannel via microspotting. This probe antibody is then recognised using secondary FITC or HRP labelled antibodies responsible for providing fluorescence or chemiluminescent and colorimetric signals, respectively. The system incorporated a micron-sized thin-film hydrogenated amorphous silicon photodiode microfabricated on a glass substrate. The primary antibody spots in the PDMS-based microfluidic were precisely aligned with the photodiodes for the direct detection of the antibody-antigen molecular recognition reactions using chemiluminescence and colorimetry. The immunoassay takes ~30 min from assay to the integrated detection. The conditions for probe antibody microspotting and for the flow-through ELISA analysis in the microfluidic format with integrated detection were defined using antibody solutions with concentrations in the nM-μM range. Sequential colorimetric or chemiluminescence detection of specific antibody-antigen molecular recognition was quantitatively detected using the photodiode. Primary antibody surface densities down to 0.182 pmol cm(-2) were detected. Multiplex detection using different microspotted primary antibodies was demonstrated.

  19. A new sensor for detection of coolant leakage in nuclear power plants using off-axis integrated cavity output spectroscopy

    International Nuclear Information System (INIS)

    Lee, Lim; Park, Hyunmin; Kim, Taek-Soo; Ko, Kwang-Hoon; Jeong, Do-Young

    2012-01-01

    A new sensor based on laser absorption spectroscopy was developed for the detection of coolant leakage which may happen in pressurized heavy water reactor (PHWR). Off-axis integrated output spectroscopy (OA-ICOS) technique was adopted for developing a simple and robust sensor with sufficient sensitivity. Leak events could be monitored by detecting a small change in semi-heavy water (HDO) concentration induced by the exchange reaction of leaked heavy water (D 2 O) with light water (H 2 O). From the results of feasibility tests, we have shown that the measured area of absorption features was linearly correlated with HDO concentration, and the minimum detectable change of HDO concentration with the developed sensor was evaluated as 3.2 ppm. This new sensor is expected to be a reliable and promising device for the detection of coolant leakage since it has some advantages on real-time monitoring and early detection for nuclear safety.

  20. INTEGRAL/IBIS detection of hard X-ray activity from the HMXB 4U 1036-56

    DEFF Research Database (Denmark)

    Sguera, V.; Bazzano, A.; Fiocchi, M.

    2015-01-01

    The Be high mass X-ray binary (HMXB) 4U 1036-56 has been recently detected by INTEGRAL/JEM-X during enhanced activity in the soft X-ray band 3-10 KeV (ATel #8425). On the contrary no emission was detected by INTEGRAL/IBIS in the band 22-60 keV, leading to a 3sigma upper limit of 6 mCrab. INTEGRAL...... was never in the field of view of JEM-X monitor during this observation. The IBIS/ISGRI spectrum is reasonably fitted by a power law with photon index 2.3+/-0.8. The average flux is 1.8 x 10-10 erg cm-2 s-1 (18-60 keV) which, at the 5 kpc source distance, translates into a luminosity of 5.4 x 1035 erg s-1....

  1. [Integrity].

    Science.gov (United States)

    Gómez Rodríguez, Rafael Ángel

    2014-01-01

    To say that someone possesses integrity is to claim that that person is almost predictable about responses to specific situations, that he or she can prudentially judge and to act correctly. There is a closed interrelationship between integrity and autonomy, and the autonomy rests on the deeper moral claim of all humans to integrity of the person. Integrity has two senses of significance for medical ethic: one sense refers to the integrity of the person in the bodily, psychosocial and intellectual elements; and in the second sense, the integrity is the virtue. Another facet of integrity of the person is la integrity of values we cherish and espouse. The physician must be a person of integrity if the integrity of the patient is to be safeguarded. The autonomy has reduced the violations in the past, but the character and virtues of the physician are the ultimate safeguard of autonomy of patient. A field very important in medicine is the scientific research. It is the character of the investigator that determines the moral quality of research. The problem arises when legitimate self-interests are replaced by selfish, particularly when human subjects are involved. The final safeguard of moral quality of research is the character and conscience of the investigator. Teaching must be relevant in the scientific field, but the most effective way to teach virtue ethics is through the example of the a respected scientist.

  2. Micro-Spec: an Integrated, Direct-Detection Spectrometer for Far-Infrared and Submillimeter Astronomy

    Science.gov (United States)

    Cataldo, Giuseppe

    2014-01-01

    The far-infrared and submillimeter portions of the electromagnetic spectrum provide a unique view of the astrophysical processes present in the early universe. Our ability to fully explore this rich spectral region has been limited, however, by the size and cost of the cryogenic spectrometers required to carry out such measurements. Micro-Spec (u-Spec) is a high-sensitivity, direct-detection spectrometer concept working in the 450-1000 micromillimeter wavelength range which will enable a wide range of flight missions that would otherwise be challenging due to the large size of current instruments with the required spectral resolution and sensitivity. The spectrometer design utilizes two internal antenna arrays, one for transmitting and one for receiving, superconducting microstrip transmission lines for power division and phase delay, and an array of microwave kinetic inductance detectors (MKIDs) to achieve these goals. The instrument will be integrated on a approximately 10 square cm silicon chip and can therefore become an important capability under the low background conditions accessible via space and high-altitude borne platforms. In this paper, an optical design methodology for Micro-Spec is presented, with particular attention given to its twodimensional diffractive region, where the light of different wavelengths is focused on the different detectors. The method is based on the maximization of the instrument resolving power and minimization of the RMS phase error on the instrument focal plane. This two-step optimization can generate geometrical configurations given specific requirements on spectrometer size, operating spectral range and performance. A point design with resolving power of 257, an RMS phase error less than 0.1 radians and four stigmatic points was developed for initial demonstration and will be the basis of future instruments with resolving power up to about 1200.

  3. Early detection and integrated care for adolescents and young adults with severe psychotic disorders: rationales and design of the Integrated Care in Early Psychosis Study (ACCESS III).

    Science.gov (United States)

    Lambert, Martin; Schöttle, Daniel; Sengutta, Mary; Ruppelt, Friederike; Rohenkohl, Anja; Luedecke, Daniel; Nawara, Luise Antonia; Galling, Britta; Falk, Anne-Lena; Wittmann, Linus; Niehaus, Vivien; Sarikaya, Gizem; Handwerk, Ute; Rothländer, Wiebke; Rietschel, Liz; Gagern, Charlotte; Lange, Benjamin; Meigel-Schleiff, Christina; Naber, Dieter; Schulte-Markwort, Michael; Krüger, Helmut; Unger, Hans-Peter; Sippel, Sven; Ott, Sabine; Romer, Georg; Daubmann, Anne; Wegscheider, Karl; Correll, Christoph U; Schimmelmann, Benno G; Bock, Thomas; Gallinat, Jürgen; Karow, Anne

    2018-02-01

    The Integrated Care in Early Psychosis (ACCESS III) Study examined the efficacy and cost-effectiveness of a combined intervention consisting of strategies to improve early detection and quality of care (integrated care including therapeutic assertive community treatment) in adolescents and young adults in the early phase of a severe psychotic disorder from 2011 to 2014. This is a prospective, single-centre, 1-year cohort study comparing an intervention condition (early detection plus integrated care, n = 120) to the historical control condition (standard care, SC, n = 105) for adolescents and young adults aged 12-29 years suffering from a severe, early-phase psychotic disorder (i.e. within 2 years of treatment). Primary outcome is the rate of combined symptomatic (i.e. Positive and Negative Syndrome Scale (PANSS) criteria) and functional (i.e. Global Assessment of Functioning scale (GAF) ≥ 60 points criterion) remission over at least 6 months at study endpoint. Secondary outcome comprises the comparison of the reduction in the duration of untreated psychosis within the 4-year study duration between integrated care and SC, course of psychopathology, functioning, quality of life, satisfaction with care, cost and quality-adjusted life years (QALYs) in comparison to a historical control group. To the authors' knowledge, this is the first study assessing the efficacy and cost-effectiveness of a combined intervention consisting of early detection strategies and strategies to improve quality of care in both adolescents and young adults with early-phase psychosis. The results will be published in 2016. © 2016 John Wiley & Sons Australia, Ltd.

  4. INTEGRAL Detection of the First Prompt Gamma-Ray Signal Coincident with the Gravitational-wave Event GW170817

    Energy Technology Data Exchange (ETDEWEB)

    Savchenko, V.; Ferrigno, C.; Bozzo, E.; Courvoisier, T. J.-L. [ISDC, Department of Astronomy, University of Geneva, Chemin d’Écogia, 16 CH-1290 Versoix (Switzerland); Kuulkers, E. [European Space Research and Technology Centre (ESA/ESTEC), Keplerlaan 1, 2201 AZ Noordwijk (Netherlands); Bazzano, A.; Natalucci, L.; Rodi, J. [INAF-Institute for Space Astrophysics and Planetology, Via Fosso del Cavaliere 100, I-00133-Rome (Italy); Brandt, S.; Chenevez, J. [DTU Space, National Space Institute Elektrovej, Building 327 DK-2800 Kongens Lyngby (Denmark); Diehl, R.; Von Kienlin, A. [Max-Planck-Institut für Extraterrestrische Physik, Garching (Germany); Domingo, A. [Centro de Astrobiología (CAB-CSIC/INTA, ESAC Campus), Camino bajo del Castillo S/N, E-28692 Villanueva de la Cañada, Madrid (Spain); Hanlon, L.; Martin-Carrillo, A. [Space Science Group, School of Physics, University College Dublin, Belfield, Dublin 4 (Ireland); Jourdain, E. [IRAP, Université de Toulouse, CNRS, UPS, CNES, 9 Av. Roche, F-31028 Toulouse (France); Laurent, P.; Lebrun, F. [APC, AstroParticule et Cosmologie, Université Paris Diderot, CNRS/IN2P3, CEA/Irfu, Observatoire de Paris Sorbonne Paris Cité, 10 rue Alice Domont et Léonie Duquet, F-75205 Paris Cedex 13 (France); Lutovinov, A. [Space Research Institute of Russian Academy of Sciences, Profsoyuznaya 84/32, 117997 Moscow (Russian Federation); Mereghetti, S. [INAF, IASF-Milano, via E.Bassini 15, I-20133 Milano (Italy); and others

    2017-10-20

    We report the INTernational Gamma-ray Astrophysics Laboratory ( INTEGRAL ) detection of the short gamma-ray burst GRB 170817A (discovered by Fermi -GBM) with a signal-to-noise ratio of 4.6, and, for the first time, its association with the gravitational waves (GWs) from binary neutron star (BNS) merging event GW170817 detected by the LIGO and Virgo observatories. The significance of association between the gamma-ray burst observed by INTEGRAL and GW170817 is 3.2σ, while the association between the Fermi -GBM and INTEGRAL detections is 4.2σ. GRB 170817A was detected by the SPI-ACS instrument about 2 s after the end of the GW event. We measure a fluence of (1.4 ± 0.4 ± 0.6) × 10{sup −7} erg cm{sup −2} (75–2000 keV), where, respectively, the statistical error is given at the 1σ confidence level, and the systematic error corresponds to the uncertainty in the spectral model and instrument response. We also report on the pointed follow-up observations carried out by INTEGRAL , starting 19.5 hr after the event, and lasting for 5.4 days. We provide a stringent upper limit on any electromagnetic signal in a very broad energy range, from 3 keV to 8 MeV, constraining the soft gamma-ray afterglow flux to <7.1 × 10{sup −11} erg cm{sup −2} s{sup −1} (80–300 keV). Exploiting the unique capabilities of INTEGRAL , we constrained the gamma-ray line emission from radioactive decays that are expected to be the principal source of the energy behind a kilonova event following a BNS coalescence. Finally, we put a stringent upper limit on any delayed bursting activity, for example, from a newly formed magnetar.

  5. Integration of Microchip Electrophoresis with Electrochemical Detection Using an Epoxy-Based Molding Method to Embed Multiple Electrode Materials

    Science.gov (United States)

    Johnson, Alicia S.; Selimovic, Asmira; Martin, R. Scott

    2012-01-01

    This paper describes the use of epoxy-encapsulated electrodes to integrate microchip-based electrophoresis with electrochemical detection. Devices with various electrode combinations can easily be developed. This includes a palladium decoupler with a downstream working electrode material of either gold, mercury/gold, platinum, glassy carbon, or a carbon fiber bundle. Additional device components such as the platinum wires for the electrophoresis separation and the counter electrode for detection can also be integrated into the epoxy base. The effect of the decoupler configuration was studied in terms of the separation performance, detector noise, and the ability to analyze samples of a high ionic strength. The ability of both glassy carbon and carbon fiber bundle electrodes to analyze a complex mixture was demonstrated. It was also shown that a PDMS-based valving microchip can be used along with the epoxy embedded electrodes to integrate microdialysis sampling with microchip electrophoresis and electrochemical detection, with the microdialysis tubing also being embedded in the epoxy substrate. This approach enables one to vary the detection electrode material as desired in a manner where the electrodes can be polished and modified in a similar fashion to electrochemical flow cells used in liquid chromatography. PMID:22038707

  6. Integrated optical detection of autonomous capillary microfluidic immunoassays:a hand-held point-of-care prototype.

    Science.gov (United States)

    Novo, P; Chu, V; Conde, J P

    2014-07-15

    The miniaturization of biosensors using microfluidics has potential in enabling the development of point-of-care devices, with the added advantages of reduced time and cost of analysis with limits-of-detection comparable to those obtained through traditional laboratory techniques. Interfacing microfluidic devices with the external world can be difficult especially in aspects involving fluid handling and the need for simple sample insertion that avoids special equipment or trained personnel. In this work we present a point-of-care prototype system by integrating capillary microfluidics with a microfabricated photodiode array and electronic instrumentation into a hand-held unit. The capillary microfluidic device is capable of autonomous and sequential fluid flow, including control of the average fluid velocity at any given point of the analysis. To demonstrate the functionality of the prototype, a model chemiluminescence ELISA was performed. The performance of the integrated optical detection in the point-of-care prototype is equal to that obtained with traditional bench-top instrumentation. The photodiode signals were acquired, displayed and processed by a simple graphical user interface using a computer connected to the microcontroller through USB. The prototype performed integrated chemiluminescence ELISA detection in about 15 min with a limit-of-detection of ≈2 nM with an antibody-antigen affinity constant of ≈2×10(7) M(-1). Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Multiple sensor integration for seizure onset detection in human patients comparing conventional disc versus novel tripolar concentric ring electrodes.

    Science.gov (United States)

    Makeyev, Oleksandr; Ding, Quan; Martínez-Juárez, Iris E; Gaitanis, John; Kay, Steven M; Besio, Walter G

    2013-01-01

    As epilepsy affects approximately one percent of the world population, electrical stimulation of the brain has recently shown potential for additive seizure control therapy. Closed-loop systems that apply electrical stimulation when seizure onset is automatically detected require high accuracy of automatic seizure detection based on electrographic brain activity. To improve this accuracy we propose to use noninvasive tripolar concentric ring electrodes that have been shown to have significantly better signal-to-noise ratio, spatial selectivity, and mutual information compared to conventional disc electrodes. The proposed detection methodology is based on integration of multiple sensors using exponentially embedded family (EEF). In this preliminary study it is validated on over 26.3 hours of data collected using both tripolar concentric ring and conventional disc electrodes concurrently each from 7 human patients with epilepsy including five seizures. For a cross-validation based group model EEF correctly detected 100% and 80% of seizures respectively with tripolar concentric ring electrodes.

  8. Development of an integrated microsystem for the multiplexed detection of breast cancer markers in serum using electrochemical immunosensors

    Science.gov (United States)

    Fragoso, Alex; Laboria, Noemi; Botero, Mary Luz; Bejarano, Diego; Latta, Daniel; Hansen-Hagge, Thomas E.; Kemmner, Wolfgang; Katakis, Ioanis; Gärtner, Claudia; Drese, Klaus; O'Sullivan, Ciara K.

    2010-02-01

    A microsystem integrating electrochemical biosensoric detection for the simultaneous multiplexed detection of protein markers of breast cancer is reported. The immobilization of antibodies against each of carcinoembryonic antigen (CEA), prostate specific antigen (PSA) and cancer antigen 15-3 (CA15-3) was achieved via crosslinking to a bipodal dithiol chemisorbed on gold electrodes. This bipodal dithiol had the double function of eliminating non-specific binding and optimal spacing of the anchor antibodies for maximum accessibility to the target proteins. Storage conditions were optimized, demonstrating a long-term stability of the reporter conjugates jointly stored within a single reservoir in the microsystem. The final system has been optimized in terms of incubation times, temperatures and simultaneous, multiplexed detection of the protein markers was achieved in less than 10 minutes with less than ng/mL detection limits. The microsystem has been validated using real patient serum samples and excellent correlation with ELISA results obtained.

  9. Seep Detection using E/V Nautilus Integrated Seafloor Mapping and Remotely Operated Vehicles on the United States West Coast

    Science.gov (United States)

    Gee, L. J.; Raineault, N.; Kane, R.; Saunders, M.; Heffron, E.; Embley, R. W.; Merle, S. G.

    2017-12-01

    Exploration Vessel (E/V) Nautilus has been mapping the seafloor off the west coast of the United States, from Washington to California, for the past three years with a Kongsberg EM302 multibeam sonar. This system simultaneously collects bathymetry, seafloor and water column backscatter data, allowing an integrated approach to mapping to more completely characterize a region, and has identified over 1,000 seafloor seeps. Hydrographic multibeam sonars like the EM302 were designed for mapping the bathymetry. It is only in the last decade that major mapping projects included an integrated approach that utilizes the seabed and water column backscatter information in addition to the bathymetry. Nautilus mapping in the Eastern Pacific over the past three years has included a number of seep-specific expeditions, and utilized and adapted the preliminary mapping guidelines that have emerged from research. The likelihood of seep detection is affected by many factors: the environment: seabed geomorphology, surficial sediment, seep location/depth, regional oceanography and biology, the nature of the seeps themselves: size variation, varying flux, depth, and transience, the detection system: design of hydrographic multibeam sonars limits use for water column detection, the platform: variations in the vessel and operations such as noise, speed, and swath overlap. Nautilus integrated seafloor mapping provided multiple indicators of seep locations, but it remains difficult to assess the probability of seep detection. Even when seeps were detected, they have not always been located during ROV dives. However, the presence of associated features (methane hydrate and bacterial mats) serve as evidence of potential seep activity and reinforce the transient nature of the seeps. Not detecting a seep in the water column data does not necessarily indicate that there is not a seep at a given location, but with multiple passes over an area and by the use of other contextual data, an area may

  10. Sensor integration of multiple tripolar concentric ring electrodes improves pentylenetetrazole-induced seizure onset detection in rats.

    Science.gov (United States)

    Makeyev, Oleksandr; Ding, Quan; Kay, Steven M; Besio, Walter G

    2012-01-01

    As epilepsy affects approximately one percent of the world population, electrical stimulation of the brain has recently shown potential for additive seizure control therapy. Previously, we applied noninvasive transcranial focal stimulation via tripolar concentric ring electrodes on the scalp of rats after inducing seizures with pentylenetetrazole. We developed a system to detect seizures and automatically trigger the stimulation and evaluated the system on the electrographic activity from rats. In this preliminary study we propose and validate a novel seizure onset detection algorithm based on exponentially embedded family. Unlike the previously proposed approach it integrates the data from multiple electrodes allowing an improvement of the detector performance.

  11. Towards a fully automated lab-on-a-disc system integrating sample enrichment and detection of analytes from complex matrices

    DEFF Research Database (Denmark)

    Andreasen, Sune Zoëga

    the technology on a large scale from fulfilling its potential for maturing into applied technologies and products. In this work, we have taken the first steps towards realizing a capable and truly automated “sample-to-answer” analysis system, aimed at small molecule detection and quantification from a complex...... sample matrix. The main result is a working prototype of a microfluidic system, integrating both centrifugal microfluidics for sample handling, supported liquid membrane extraction (SLM) for selective and effective sample treatment, as well as in-situ electrochemical detection. As a case study...

  12. Integration of bio-inspired, control-based visual and olfactory data for the detection of an elusive target

    Science.gov (United States)

    Duong, Tuan A.; Duong, Nghi; Le, Duong

    2017-01-01

    In this paper, we present an integration technique using a bio-inspired, control-based visual and olfactory receptor system to search for elusive targets in practical environments where the targets cannot be seen obviously by either sensory data. Bio-inspired Visual System is based on a modeling of extended visual pathway which consists of saccadic eye movements and visual pathway (vertebrate retina, lateral geniculate nucleus and visual cortex) to enable powerful target detections of noisy, partial, incomplete visual data. Olfactory receptor algorithm, namely spatial invariant independent component analysis, that was developed based on data of old factory receptor-electronic nose (enose) of Caltech, is adopted to enable the odorant target detection in an unknown environment. The integration of two systems is a vital approach and sets up a cornerstone for effective and low-cost of miniaturized UAVs or fly robots for future DOD and NASA missions, as well as for security systems in Internet of Things environments.

  13. I-123 iomazenil single photon emission computed tomography for detecting loss of neuronal integrity in patients with traumatic brain injury

    OpenAIRE

    Abiko, Kagari; Ikoma, Katsunori; Shiga, Tohru; Katoh, Chietsugu; Hirata, Kenji; Kuge, Yuji; Kobayashi, Kentaro; Tamaki, Nagara

    2017-01-01

    Background Traumatic brain injury (TBI) causes brain dysfunction in many patients. Using C-11 flumazenil (FMZ) positron emission tomography (PET), we have detected and reported the loss of neuronal integrity, leading to brain dysfunction in TBI patients. Similarly to FMZ PET, I-123 iomazenil (IMZ) single photon emission computed tomography (SPECT) is widely used to determine the distribution of the benzodiazepine receptor (BZR) in the brain cortex. The purpose of this study is to examine whet...

  14. Waveguide-integrated single- and multi-photon detection at telecom wavelengths using superconducting nanowires

    International Nuclear Information System (INIS)

    Ferrari, Simone; Kahl, Oliver; Kovalyuk, Vadim; Goltsman, Gregory N.; Korneev, Alexander; Pernice, Wolfram H. P.

    2015-01-01

    We investigate single- and multi-photon detection regimes of superconducting nanowire detectors embedded in silicon nitride nanophotonic circuits. At near-infrared wavelengths, simultaneous detection of up to three photons is observed for 120 nm wide nanowires biased far from the critical current, while narrow nanowires below 100 nm provide efficient single photon detection. A theoretical model is proposed to determine the different detection regimes and to calculate the corresponding internal quantum efficiency. The predicted saturation of the internal quantum efficiency in the single photon regime agrees well with plateau behavior observed at high bias currents

  15. Waveguide-integrated single- and multi-photon detection at telecom wavelengths using superconducting nanowires

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, Simone; Kahl, Oliver [Institute of Nanotechnology, Karlsruhe Institute of Technology, Karlsruhe 76132 (Germany); Kovalyuk, Vadim [Institute of Nanotechnology, Karlsruhe Institute of Technology, Karlsruhe 76132 (Germany); Department of Physics, Moscow State Pedagogical University, Moscow 119992 (Russian Federation); Goltsman, Gregory N. [Department of Physics, Moscow State Pedagogical University, Moscow 119992 (Russian Federation); National Research University Higher School of Economics, 20 Myasnitskaya Ulitsa, Moscow 101000 (Russian Federation); Korneev, Alexander [Department of Physics, Moscow State Pedagogical University, Moscow 119992 (Russian Federation); Moscow Institute of Physics and Technology (State University), Moscow 141700 (Russian Federation); Pernice, Wolfram H. P., E-mail: wolfram.pernice@kit.edu [Institute of Nanotechnology, Karlsruhe Institute of Technology, Karlsruhe 76132 (Germany); Department of Physics, University of Münster, 48149 Münster (Germany)

    2015-04-13

    We investigate single- and multi-photon detection regimes of superconducting nanowire detectors embedded in silicon nitride nanophotonic circuits. At near-infrared wavelengths, simultaneous detection of up to three photons is observed for 120 nm wide nanowires biased far from the critical current, while narrow nanowires below 100 nm provide efficient single photon detection. A theoretical model is proposed to determine the different detection regimes and to calculate the corresponding internal quantum efficiency. The predicted saturation of the internal quantum efficiency in the single photon regime agrees well with plateau behavior observed at high bias currents.

  16. Integration of a framework with a learning management system for detection, assessment and assistance of university students with reading difficulties

    Directory of Open Access Journals (Sweden)

    Carolina Mejía Corredor

    2015-12-01

    Full Text Available Rev.esc.adm.neg Dyslexia is a common learning disability in Spanish-speaking university students, and requires special attention from higher educational institutions in order to support affected individuals during their learning process. In previous studies, a framework to detect, assess and assist university students with reading difficulties related to dyslexia was developed. In this paper, the integration of this framework with a Learning Management System (LMS is presented. Two case studies were performed to test the functionality and the usability of this integration. The first case study was carried out with 20 students, while the second one with four teachers. The results show that both students and teachers were satisfied with the integration performed in Moodle.ce, among others.

  17. SERENDIPITOUS DISCOVERY OF A MASSIVE cD GALAXY AT z = 1.096: IMPLICATIONS FOR THE EARLY FORMATION AND LATE EVOLUTION OF cD GALAXIES

    Energy Technology Data Exchange (ETDEWEB)

    Liu, F. S. [College of Physical Science and Technology, Shenyang Normal University, Shenyang 110034 (China); Guo Yicheng; Koo, David C.; Trump, Jonathan R.; Barro, Guillermo; Yesuf, Hassen; Faber, S. M.; Cheung, Edmond [UCO/Lick Observatory, Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); Giavalisco, M. [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Cassata, P. [Aix Marseille Universite, CNRS, LAM-Laboratoire d' Astrophysique de Marseille, F-13388 Marseille (France); Koekemoer, A. M.; Grogin, Norman A. [Space Telescope Science Institute, 3700 San Martin Boulevard, Baltimore, MD 21218 (United States); Pentericci, L.; Castellano, M. [INAF Osservatorio Astronomico di Roma, Via Frascati 33, I-00040 Monteporzio (RM) (Italy); Mao, Shude [National Astronomical Observatories, Chinese Academy of Sciences, A20 Datun Road, Beijing 100012 (China); Xia, X. Y. [Tianjin Astrophysics Center, Tianjin Normal University, Tianjin 300387 (China); Hathi, Nimish P. [Observatories of the Carnegie Institution for Science, Pasadena, CA 91101 (United States); Huang, Kuang-Han [Johns Hopkins University, 3400 North Charles Street, Baltimore, MD 21218 (United States); Kocevski, Dale [Department of Physics and Astronomy, University of Kentucky, Lexington, KY 40506-0055 (United States); McGrath, Elizabeth J., E-mail: fengshan@ucolick.org [Department of Physics and Astronomy, Colby College, Mayflower Hill Drive, Waterville, ME 0490 (United States); and others

    2013-06-01

    We have made a serendipitous discovery of a massive ({approx}5 Multiplication-Sign 10{sup 11} M{sub Sun }) cD galaxy at z = 1.096 in a candidate-rich cluster in the Hubble Ultra Deep Field (HUDF) area of GOODS-South. This brightest cluster galaxy (BCG) is the most distant cD galaxy confirmed to date. Ultra-deep HST/WFC3 images reveal an extended envelope starting from {approx}10 kpc and reaching {approx}70 kpc in radius along the semimajor axis. The spectral energy distributions indicate that both its inner component and outer envelope are composed of an old, passively evolving (specific star formation rate <10{sup -4} Gyr{sup -1}) stellar population. The cD galaxy lies on the same mass-size relation as the bulk of quiescent galaxies at similar redshifts. The cD galaxy has a higher stellar mass surface density ({approx}M{sub *}/R{sub 50}{sup 2}) but a similar velocity dispersion ({approx}{radical}(M{sub *}/R{sub 50})) to those of more massive, nearby cDs. If the cD galaxy is one of the progenitors of today's more massive cDs, its size (R{sub 50}) and stellar mass have had to increase on average by factors of 3.4 {+-} 1.1 and 3.3 {+-} 1.3 over the past {approx}8 Gyr, respectively. Such increases in size and stellar mass without being accompanied by significant increases in velocity dispersion are consistent with evolutionary scenarios driven by both major and minor dissipationless (dry) mergers. If such cD envelopes originate from dry mergers, our discovery of even one example proves that some BCGs entered the dry merger phase at epochs earlier than z = 1. Our data match theoretical models which predict that the continuance of dry mergers at z < 1 can result in structures similar to those of massive cD galaxies seen today. Moreover, our discovery is a surprise given that the extreme depth of the HUDF is essential to reveal such an extended cD envelope at z > 1 and, yet, the HUDF covers only a minuscule region of sky ({approx}3.1 Multiplication-Sign 10{sup -8

  18. SERENDIPITOUS DISCOVERY OF A MASSIVE cD GALAXY AT z = 1.096: IMPLICATIONS FOR THE EARLY FORMATION AND LATE EVOLUTION OF cD GALAXIES

    International Nuclear Information System (INIS)

    Liu, F. S.; Guo Yicheng; Koo, David C.; Trump, Jonathan R.; Barro, Guillermo; Yesuf, Hassen; Faber, S. M.; Cheung, Edmond; Giavalisco, M.; Cassata, P.; Koekemoer, A. M.; Grogin, Norman A.; Pentericci, L.; Castellano, M.; Mao, Shude; Xia, X. Y.; Hathi, Nimish P.; Huang, Kuang-Han; Kocevski, Dale; McGrath, Elizabeth J.

    2013-01-01

    We have made a serendipitous discovery of a massive (∼5 × 10 11 M ☉ ) cD galaxy at z = 1.096 in a candidate-rich cluster in the Hubble Ultra Deep Field (HUDF) area of GOODS-South. This brightest cluster galaxy (BCG) is the most distant cD galaxy confirmed to date. Ultra-deep HST/WFC3 images reveal an extended envelope starting from ∼10 kpc and reaching ∼70 kpc in radius along the semimajor axis. The spectral energy distributions indicate that both its inner component and outer envelope are composed of an old, passively evolving (specific star formation rate –4 Gyr –1 ) stellar population. The cD galaxy lies on the same mass-size relation as the bulk of quiescent galaxies at similar redshifts. The cD galaxy has a higher stellar mass surface density (∼M * /R 50 2 ) but a similar velocity dispersion (∼√(M * /R 50 )) to those of more massive, nearby cDs. If the cD galaxy is one of the progenitors of today's more massive cDs, its size (R 50 ) and stellar mass have had to increase on average by factors of 3.4 ± 1.1 and 3.3 ± 1.3 over the past ∼8 Gyr, respectively. Such increases in size and stellar mass without being accompanied by significant increases in velocity dispersion are consistent with evolutionary scenarios driven by both major and minor dissipationless (dry) mergers. If such cD envelopes originate from dry mergers, our discovery of even one example proves that some BCGs entered the dry merger phase at epochs earlier than z = 1. Our data match theoretical models which predict that the continuance of dry mergers at z 1 and, yet, the HUDF covers only a minuscule region of sky (∼3.1 × 10 –8 ). Adding that cDs are rare, our serendipitous discovery hints that such cDs may be more common than expected, perhaps even ubiquitous. Images reaching HUDF depths of more area (especially with cluster BCGs at z > 1) are needed to confirm this conjecture.

  19. Label-free detection of HIV-1 infected cells via integration of optical tweezers and photoluminescence spectroscopy

    Science.gov (United States)

    Lugongolo, Masixole Yvonne; Ombinda-Lemboumba, Saturnin; Noto, Luyanda Lunga; Maaza, Malik; Mthunzi-Kufa, Patience

    2018-02-01

    The human immunodeficiency virus-1 (HIV-1) is currently detected using conventional qualitative and quantitative tests to determine the presence or absence of HIV in blood samples. However, the approach of these tests detects the presence of either viral antibodies or viral RNA that require labelling which may be costly, sophisticated and time consuming. A label-free approach of detecting the presence of HIV is therefore desirable. Of note optical tweezers can be coupled with other technologies including spectroscopy, which also investigates light-matter interactions. For example, coupling of optical tweezers with luminescence spectroscopy techniques has emerged as a powerful tool in biology for micro-manipulation, detection and analysis of individual cells. Integration of optical techniques has enabled studying biological particles in a label-free manner, whilst detecting functional groups and other essential molecules within mixed populations of cells. In the current study, an optical trapping system coupled to luminescence spectroscopy was utilised to detect the presence of HIV infection in TZM-bl cells in vitro. This was performed by infecting TZM-bl cells with the ZM53 HIV-1 pseudovirus, and incubating them for 48 hours prior analysis. The differences between infected and uninfected cells were thereafter displayed as shown by the spectrographs obtained. Combination of these two techniques has a potential in the field of infectious disease diagnostics.

  20. Laser-induced heating integrated with a microfluidic platform for real-time DNA replication and detection

    Science.gov (United States)

    Hung, Min-Sheng; Ho, Chia-Chin; Chen, Chih-Pin

    2016-08-01

    This study developed a microfluidic platform for replicating and detecting DNA in real time by integrating a laser and a microfluidic device composed of polydimethylsiloxane. The design of the microchannels consisted of a laser-heating area and a detection area. An infrared laser was used as the heating source for DNA replication, and the laser power was adjusted to heat the solutions directly. In addition, strong biotin-avidin binding was used to capture and detect the replicated products. The biotin on one end was bound to avidin and anchored to the surface of the microchannels, whereas the biotin on the other end was bound to the quantum dots (Qdots). The results showed that the fluorescent intensity of the Qdots bound to the replicated products in the detection area increased with the number of thermal cycles created by the laser. When the number of thermal cycles was ≥10, the fluorescent intensity of the Qdots was directly detectable on the surface of the microchannels. The proposed method is more sensitive than detection methods entailing gel electrophoresis.

  1. Rockfall hazard assessment integrating probabilistic physically based rockfall source detection (Norddal municipality, Norway).

    Science.gov (United States)

    Yugsi Molina, F. X.; Oppikofer, T.; Fischer, L.; Hermanns, R. L.; Taurisano, A.

    2012-04-01

    Traditional techniques to assess rockfall hazard are partially based on probabilistic analysis. Stochastic methods has been used for run-out analysis of rock blocks to estimate the trajectories that a detached block will follow during its fall until it stops due to kinetic energy loss. However, the selection of rockfall source areas is usually defined either by multivariate analysis or by field observations. For either case, a physically based approach is not used for the source area detection. We present an example of rockfall hazard assessment that integrates a probabilistic rockfall run-out analysis with a stochastic assessment of the rockfall source areas using kinematic stability analysis in a GIS environment. The method has been tested for a steep more than 200 m high rock wall, located in the municipality of Norddal (Møre og Romsdal county, Norway), where a large number of people are either exposed to snow avalanches, rockfalls, or debris flows. The area was selected following the recently published hazard mapping plan of Norway. The cliff is formed by medium to coarse-grained quartz-dioritic to granitic gneisses of Proterozoic age. Scree deposits product of recent rockfall activity are found at the bottom of the rock wall. Large blocks can be found several tens of meters away from the cliff in Sylte, the main locality in the Norddal municipality. Structural characterization of the rock wall was done using terrestrial laser scanning (TLS) point clouds in the software Coltop3D (www.terranum.ch), and results were validated with field data. Orientation data sets from the structural characterization were analyzed separately to assess best-fit probability density functions (PDF) for both dip angle and dip direction angle of each discontinuity set. A GIS-based stochastic kinematic analysis was then carried out using the discontinuity set orientations and the friction angle as random variables. An airborne laser scanning digital elevation model (ALS-DEM) with 1 m

  2. Integrative analysis of gene expression and DNA methylation using unsupervised feature extraction for detecting candidate cancer biomarkers.

    Science.gov (United States)

    Moon, Myungjin; Nakai, Kenta

    2018-04-01

    Currently, cancer biomarker discovery is one of the important research topics worldwide. In particular, detecting significant genes related to cancer is an important task for early diagnosis and treatment of cancer. Conventional studies mostly focus on genes that are differentially expressed in different states of cancer; however, noise in gene expression datasets and insufficient information in limited datasets impede precise analysis of novel candidate biomarkers. In this study, we propose an integrative analysis of gene expression and DNA methylation using normalization and unsupervised feature extractions to identify candidate biomarkers of cancer using renal cell carcinoma RNA-seq datasets. Gene expression and DNA methylation datasets are normalized by Box-Cox transformation and integrated into a one-dimensional dataset that retains the major characteristics of the original datasets by unsupervised feature extraction methods, and differentially expressed genes are selected from the integrated dataset. Use of the integrated dataset demonstrated improved performance as compared with conventional approaches that utilize gene expression or DNA methylation datasets alone. Validation based on the literature showed that a considerable number of top-ranked genes from the integrated dataset have known relationships with cancer, implying that novel candidate biomarkers can also be acquired from the proposed analysis method. Furthermore, we expect that the proposed method can be expanded for applications involving various types of multi-omics datasets.

  3. E-core transverse flux machine with integrated fault detection system

    DEFF Research Database (Denmark)

    Rasmussen, Peter Omand; Runólfsson, Gunnar; Thorsdóttir, Thórunn Ágústa

    2011-01-01

    extent also thermal. Since the E-core transverse flux-machine belongs to the family of the SRMs it has unique properties of intervals without current in the windings. By careful investigation of the voltage and current in these intervals a very simple method to detect single and partial turn short...... circuit faults have been developed. For other types of machines the single and partial turn short circuit is very difficult to deal with and requires normally very comprehensive detection and calculation schemes. The developed detection algorithm combined with the E-core transverse flux machine...

  4. Integrated MOSFET-Embedded-Cantilever-Based Biosensor Characteristic for Detection of Anthrax Simulant

    Energy Technology Data Exchange (ETDEWEB)

    Mostafa, Salwa [University of Tennessee, Knoxville (UTK); Lee, Ida [ORNL; Islam, Syed K [University of Tennessee, Knoxville (UTK); Eliza, Sazia A. [University of Tennessee, Knoxville (UTK); Shekhawat, Gajendra [Northwestern University, Evanston; Dravid, Vinayak [Northwestern University, Evanston; Tulip, Fahmida S [ORNL

    2011-01-01

    In this work, MOSFET-embedded cantilevers are configured as microbial sensors for detection of anthrax simulants, Bacillus thuringiensis. Anthrax simulants attached to the chemically treated gold-coated cantilever cause changes in the MOSFET drain current due to the bending of the cantilever which indicates the detection of anthrax simulant. Electrical properties of the anthrax simulant are also responsible for the change in the drain current. The test results suggest a detection range of 10 L of stimulant test solution (a suspension population of 1.3 107 colony-forming units/mL diluted in 40% ethanol and 60% deionized water) with a linear response of 31 A/ L.

  5. Navigation integrity monitoring and obstacle detection for enhanced-vision systems

    Science.gov (United States)

    Korn, Bernd; Doehler, Hans-Ullrich; Hecker, Peter

    2001-08-01

    Typically, Enhanced Vision (EV) systems consist of two main parts, sensor vision and synthetic vision. Synthetic vision usually generates a virtual out-the-window view using databases and accurate navigation data, e. g. provided by differential GPS (DGPS). The reliability of the synthetic vision highly depends on both, the accuracy of the used database and the integrity of the navigation data. But especially in GPS based systems, the integrity of the navigation can't be guaranteed. Furthermore, only objects that are stored in the database can be displayed to the pilot. Consequently, unexpected obstacles are invisible and this might cause severe problems. Therefore, additional information has to be extracted from sensor data to overcome these problems. In particular, the sensor data analysis has to identify obstacles and has to monitor the integrity of databases and navigation. Furthermore, if a lack of integrity arises, navigation data, e.g. the relative position of runway and aircraft, has to be extracted directly from the sensor data. The main contribution of this paper is about the realization of these three sensor data analysis tasks within our EV system, which uses the HiVision 35 GHz MMW radar of EADS, Ulm as the primary EV sensor. For the integrity monitoring, objects extracted from radar images are registered with both database objects and objects (e. g. other aircrafts) transmitted via data link. This results in a classification into known and unknown radar image objects and consequently, in a validation of the integrity of database and navigation. Furthermore, special runway structures are searched for in the radar image where they should appear. The outcome of this runway check contributes to the integrity analysis, too. Concurrent to this investigation a radar image based navigation is performed without using neither precision navigation nor detailed database information to determine the aircraft's position relative to the runway. The performance of our

  6. Fluorescence Detection 400–480 nm Using Microfluidic System Integrated GaP Photodiodes

    Directory of Open Access Journals (Sweden)

    Dion McIntosh

    2011-01-01

    Full Text Available Ciprofloxacin is a commonly used antibiotic and the active ingredient in a veterinary antibiotic. Detecting its presence allows us to understand its absorption process in blood as well as tissue. A portable microfluidic system has been fabricated. It operates at low bias voltage and shows a linear relationship between concentration levels and system response. Detection of concentrations down to 1 ppb of ciprofloxacin in microliters of solution was achieved.

  7. Integrating drivers influencing the detection of plant pests carried in the international cut flower trade.

    Science.gov (United States)

    Areal, F J; Touza, J; MacLeod, A; Dehnen-Schmutz, K; Perrings, C; Palmieri, M G; Spence, N J

    2008-12-01

    This paper analyses the cut flower market as an example of an invasion pathway along which species of non-indigenous plant pests can travel to reach new areas. The paper examines the probability of pest detection by assessing information on pest detection and detection effort associated with the import of cut flowers. We test the link between the probability of plant pest arrivals, as a precursor to potential invasion, and volume of traded flowers using count data regression models. The analysis is applied to the UK import of specific genera of cut flowers from Kenya between 1996 and 2004. There is a link between pest detection and the Genus of cut flower imported. Hence, pest detection efforts should focus on identifying and targeting those imported plants with a high risk of carrying pest species. For most of the plants studied, efforts allocated to inspection have a significant influence on the probability of pest detection. However, by better targeting inspection efforts, it is shown that plant inspection effort could be reduced without increasing the risk of pest entry. Similarly, for most of the plants analysed, an increase in volume traded will not necessarily lead to an increase in the number of pests entering the UK. For some species, such as Carthamus and Veronica, the volume of flowers traded has a significant and positive impact on the likelihood of pest detection. We conclude that analysis at the rank of plant Genus is important both to understand the effectiveness of plant pest detection efforts and consequently to manage the risk of introduction of non-indigenous species.

  8. Virus-Clip: a fast and memory-efficient viral integration site detection tool at single-base resolution with annotation capability.

    Science.gov (United States)

    Ho, Daniel W H; Sze, Karen M F; Ng, Irene O L

    2015-08-28

    Viral integration into the human genome upon infection is an important risk factor for various human malignancies. We developed viral integration site detection tool called Virus-Clip, which makes use of information extracted from soft-clipped sequencing reads to identify exact positions of human and virus breakpoints of integration events. With initial read alignment to virus reference genome and streamlined procedures, Virus-Clip delivers a simple, fast and memory-efficient solution to viral integration site detection. Moreover, it can also automatically annotate the integration events with the corresponding affected human genes. Virus-Clip has been verified using whole-transcriptome sequencing data and its detection was validated to have satisfactory sensitivity and specificity. Marked advancement in performance was detected, compared to existing tools. It is applicable to versatile types of data including whole-genome sequencing, whole-transcriptome sequencing, and targeted sequencing. Virus-Clip is available at http://web.hku.hk/~dwhho/Virus-Clip.zip.

  9. An integrative time-varying frequency detection and channel sounding method for dynamic plasma sheath

    Science.gov (United States)

    Shi, Lei; Yao, Bo; Zhao, Lei; Liu, Xiaotong; Yang, Min; Liu, Yanming

    2018-01-01

    The plasma sheath-surrounded hypersonic vehicle is a dynamic and time-varying medium and it is almost impossible to calculate time-varying physical parameters directly. The in-fight detection of the time-varying degree is important to understand the dynamic nature of the physical parameters and their effect on re-entry communication. In this paper, a constant envelope zero autocorrelation (CAZAC) sequence based on time-varying frequency detection and channel sounding method is proposed to detect the plasma sheath electronic density time-varying property and wireless channel characteristic. The proposed method utilizes the CAZAC sequence, which has excellent autocorrelation and spread gain characteristics, to realize dynamic time-varying detection/channel sounding under low signal-to-noise ratio in the plasma sheath environment. Theoretical simulation under a typical time-varying radio channel shows that the proposed method is capable of detecting time-variation frequency up to 200 kHz and can trace the channel amplitude and phase in the time domain well under -10 dB. Experimental results conducted in the RF modulation discharge plasma device verified the time variation detection ability in practical dynamic plasma sheath. Meanwhile, nonlinear phenomenon of dynamic plasma sheath on communication signal is observed thorough channel sounding result.

  10. Serendipitous discovery of potent human head and neck squamous cell carcinoma anti-cancer molecules: A fortunate failure of a rational molecular design.

    Science.gov (United States)

    Zagni, Chiara; Pistarà, Venerando; Oliveira, Luciana A; Castilho, Rogerio M; Romeo, Giovanni; Chiacchio, Ugo; Rescifina, Antonio

    2017-12-01

    Histone deacetylase inhibitors (HDACis) play an important role as valuable drugs targeted to cancer therapy: several HDACis are currently being tested in clinical trials. Two new potential HDACis 1a and 1d, characterized by the presence of a biphenyl-4-sulfonamide group as a connection unit between the N-{4-[(E)-(2-formylhydrazinylidene)methyl]-3-hydroxyphenyl} and the 2-hydroxy-N-(trifluoroacetyl)benzamide moiety, respectively, as two zinc-binding group (ZBG), have been designed, synthesized and tested for their biological activity. Surprisingly, compounds 1a and 12, this last exclusively obtained in place of 1d, exhibited a very low HDAC inhibitory activity. A serendipitous assay of these two compounds, conducted on three chemoresistant cell lines of head and neck squamous cell carcinoma (HNSCC), showed their antiproliferative activity at low nanomolar concentrations, better than cisplatin. In vitro, biological assays indicated that compounds 1a and 12 are able to increase acetylation of histone H3 and to interfere with the PI3K/Akt/mTOR pathway by inducing the accumulation of PTEN protein. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  11. Quality controls in integrative approaches to detect errors and inconsistencies in biological databases

    Directory of Open Access Journals (Sweden)

    Ghisalberti Giorgio

    2010-12-01

    Full Text Available Numerous biomolecular data are available, but they are scattered in many databases and only some of them are curated by experts. Most available data are computationally derived and include errors and inconsistencies. Effective use of available data in order to derive new knowledge hence requires data integration and quality improvement. Many approaches for data integration have been proposed. Data warehousing seams to be the most adequate when comprehensive analysis of integrated data is required. This makes it the most suitable also to implement comprehensive quality controls on integrated data. We previously developed GFINDer (http://www.bioinformatics.polimi.it/GFINDer/, a web system that supports scientists in effectively using available information. It allows comprehensive statistical analysis and mining of functional and phenotypic annotations of gene lists, such as those identified by high-throughput biomolecular experiments. GFINDer backend is composed of a multi-organism genomic and proteomic data warehouse (GPDW. Within the GPDW, several controlled terminologies and ontologies, which describe gene and gene product related biomolecular processes, functions and phenotypes, are imported and integrated, together with their associations with genes and proteins of several organisms. In order to ease maintaining updated the GPDW and to ensure the best possible quality of data integrated in subsequent updating of the data warehouse, we developed several automatic procedures. Within them, we implemented numerous data quality control techniques to test the integrated data for a variety of possible errors and inconsistencies. Among other features, the implemented controls check data structure and completeness, ontological data consistency, ID format and evolution, unexpected data quantification values, and consistency of data from single and multiple sources. We use the implemented controls to analyze the quality of data available from several

  12. An integrated electrochemical device based on immunochromatographic test strip and enzyme labels for sensitive detection of disease-related biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Zou, Zhexiang; Wang, Jun; Wang, Hua; Li, Yao Q.; Lin, Yuehe

    2012-05-30

    A novel electrochemical biosensing device that integrates an immunochromatographic test strip and a screen-printed electrode (SPE) connected to a portable electrochemical analyzer was presented for rapid, sensitive, and quantitative detection of disease-related biomarker in human blood samples. The principle of the sensor is based on sandwich immunoreactions between a biomarker and a pair of its antibodies on the test strip, followed by highly sensitive square-wave voltammetry (SWV) detection. Horseradish peroxidase (HRP) was used as a signal reporter for electrochemical readout. Hepatitis B surface antigen (HBsAg) was employed as a model protein biomarker to demonstrate the analytical performance of the sensor in this study. Some critical parameters governing the performance of the sensor were investigated in detail. The sensor was further utilized to detect HBsAg in human plasma with an average recovery of 91.3%. In comparison, a colorimetric immunochromatographic test strip assay (ITSA) was also conducted. The result shows that the SWV detection in the electrochemical sensor is much more sensitive for the quantitative determination of HBsAg than the colorimetric detection, indicating that such a sensor is a promising platform for rapid and sensitive point-of-care testing/screening of disease-related biomarkers in a large population

  13. Study of various n-type organic semiconductors on ultraviolet detective and electroluminescent properties of optoelectronic integrated device

    Science.gov (United States)

    Deng, Chaoxu; Shao, Bingyao; Zhao, Dan; Zhou, Dianli; Yu, Junsheng

    2017-11-01

    Organic optoelectronic integrated device (OID) with both ultraviolet (UV) detective and electroluminescent (EL) properties was fabricated by using a thermally activated delayed fluorescence (TADF) semiconductor of (4s, 6s)-2,4,5,6-tetra(9H-carbazol-9-yl)isophthalonitrile (4CzIPN) as an emitter. The effect of five kinds of n-type organic semiconductors (OSCs) on the enhancement of UV detective and EL properties of OID was systematically studied. The result shows that two orders of magnitude in UV detectivity from 109 to 1011 Jones and 3.3 folds of luminance from 2499 to 8233 cd m-2 could be achieved. The result shows that not only the difference of lowest unoccupied molecular orbital (LUMO) between active layer and OSC but also the variety of electron mobility have a significant effect on the UV detective and EL performance through adjusting electron injection/transport. Additionally, the optimized OSC thickness is beneficial to confine the leaking of holes from the active layer to cathode, leading to the decrease of dark current for high detective performance. This work provides a useful method on broadening OSC material selection and device architecture construction for the realization of high performance OID.

  14. Integration of a highly ordered gold nanowires array with glucose oxidase for ultra-sensitive glucose detection

    Energy Technology Data Exchange (ETDEWEB)

    Cui, Jiewu [NanoScience and Sensor Technology Research Group, School of Applied Sciences and Engineering, Monash University, Gippsland Campus, Churchill 3842, VIC Australia (Australia); Laboratory of Functional Nanomaterials and Devices, School of Materials Science and Engineering, Hefei University of Technology, Hefei 230009, Anhui (China); Adeloju, Samuel B., E-mail: sam.adeloju@monash.edu [NanoScience and Sensor Technology Research Group, School of Applied Sciences and Engineering, Monash University, Gippsland Campus, Churchill 3842, VIC Australia (Australia); Wu, Yucheng, E-mail: ycwu@hfut.edu.cn [Laboratory of Functional Nanomaterials and Devices, School of Materials Science and Engineering, Hefei University of Technology, Hefei 230009, Anhui (China)

    2014-01-27

    Graphical abstract: -- Highlights: •Successfully synthesised highly-ordered gold nanowires array with an AAO template. •Fabricated an ultra-sensitive glucose nanobiosensor with the gold nanowires array. •Achieved sensitivity as high as 379.0 μA cm{sup −2} mM{sup −1} and detection limit as low as 50 nM. •Achieved excellent anti-interference with aid of Nafion membrane towards UA and AA. •Enabled successful detection and quantification of glucose in human blood serum. -- Abstract: A highly sensitive amperometric nanobiosensor has been developed by integration of glucose oxidase (GO{sub x}) with a gold nanowires array (AuNWA) by cross-linking with a mixture of glutaraldehyde (GLA) and bovine serum albumin (BSA). An initial investigation of the morphology of the synthesized AuNWA by field emission scanning electron microscopy (FESEM) and field emission transmission electron microscopy (FETEM) revealed that the nanowires array was highly ordered with rough surface, and the electrochemical features of the AuNWA with/without modification were also investigated. The integrated AuNWA–BSA–GLA–GO{sub x} nanobiosensor with Nafion membrane gave a very high sensitivity of 298.2 μA cm{sup −2} mM{sup −1} for amperometric detection of glucose, while also achieving a low detection limit of 0.1 μM, and a wide linear range of 5–6000 μM. Furthermore, the nanobiosensor exhibited excellent anti-interference ability towards uric acid (UA) and ascorbic acid (AA) with the aid of Nafion membrane, and the results obtained for the analysis of human blood serum indicated that the device is capable of glucose detection in real samples.

  15. An integrative 'omics' solution to the detection of recombinant human erythropoietin and blood doping.

    Science.gov (United States)

    Pitsiladis, Yannis P; Durussel, Jérôme; Rabin, Olivier

    2014-05-01

    Administration of recombinant human erythropoietin (rHumanEPO) improves sporting performance and hence is frequently subject to abuse by athletes, although rHumanEPO is prohibited by the WADA. Approaches to detect rHumanEPO doping have improved significantly in recent years but remain imperfect. A new transcriptomic-based longitudinal screening approach is being developed that has the potential to improve the analytical performance of current detection methods. In particular, studies are being funded by WADA to identify a 'molecular signature' of rHumanEPO doping and preliminary results are promising. In the first systematic study to be conducted, the expression of hundreds of genes were found to be altered by rHumanEPO with numerous gene transcripts being differentially expressed after the first injection and further transcripts profoundly upregulated during and subsequently downregulated up to 4 weeks postadministration of the drug; with the same transcriptomic pattern observed in all participants. The identification of a blood 'molecular signature' of rHumanEPO administration is the strongest evidence to date that gene biomarkers have the potential to substantially improve the analytical performance of current antidoping methods such as the Athlete Biological Passport for rHumanEPO detection. Given the early promise of transcriptomics, research using an 'omics'-based approach involving genomics, transcriptomics, proteomics and metabolomics should be intensified in order to achieve improved detection of rHumanEPO and other doping substances and methods difficult to detect such a recombinant human growth hormone and blood transfusions.

  16. Integrating motion-detection cameras and hair snags for wolverine identification

    Science.gov (United States)

    Audrey J. Magoun; Clinton D. Long; Michael K. Schwartz; Kristine L. Pilgrim; Richard E. Lowell; Patrick Valkenburg

    2011-01-01

    We developed an integrated system for photographing a wolverine's (Gulo gulo) ventral pattern while concurrently collecting hair for microsatellite DNA genotyping. Our objectives were to 1) test the system on a wild population of wolverines using an array of camera and hair-snag (C&H) stations in forested habitat where wolverines were known to occur, 2)...

  17. Efficient integration of stiff kinetics with phase change detection for reactive reservoir processes

    DEFF Research Database (Denmark)

    Kristensen, Morten Rode; Gerritsen, Margot G.; Thomsen, Per Grove

    2007-01-01

    We propose the use of implicit one-step Explicit Singly Diagonal Implicit Runge-Kutta (ESDIRK) methods for integration of the stiff kinetics in reactive, compositional and thermal processes that are solved using operator-splitting type approaches. To facilitate the algorithmic development we...

  18. A Novel Ship Detection Method Based on Gradient and Integral Feature for Single-Polarization Synthetic Aperture Radar Imagery

    Directory of Open Access Journals (Sweden)

    Hao Shi

    2018-02-01

    Full Text Available With the rapid development of remote sensing technologies, SAR satellites like China’s Gaofen-3 satellite have more imaging modes and higher resolution. With the availability of high-resolution SAR images, automatic ship target detection has become an important topic in maritime research. In this paper, a novel ship detection method based on gradient and integral features is proposed. This method is mainly composed of three steps. First, in the preprocessing step, a filter is employed to smooth the clutters and the smoothing effect can be adaptive adjusted according to the statistics information of the sub-window. Thus, it can retain details while achieving noise suppression. Second, in the candidate area extraction, a sea-land segmentation method based on gradient enhancement is presented. The integral image method is employed to accelerate computation. Finally, in the ship target identification step, a feature extraction strategy based on Haar-like gradient information and a Radon transform is proposed. This strategy decreases the number of templates found in traditional Haar-like methods. Experiments were performed using Gaofen-3 single-polarization SAR images, and the results showed that the proposed method has high detection accuracy and rapid computational efficiency. In addition, this method has the potential for on-board processing.

  19. Integration of a highly ordered gold nanowires array with glucose oxidase for ultra-sensitive glucose detection.

    Science.gov (United States)

    Cui, Jiewu; Adeloju, Samuel B; Wu, Yucheng

    2014-01-27

    A highly sensitive amperometric nanobiosensor has been developed by integration of glucose oxidase (GO(x)) with a gold nanowires array (AuNWA) by cross-linking with a mixture of glutaraldehyde (GLA) and bovine serum albumin (BSA). An initial investigation of the morphology of the synthesized AuNWA by field emission scanning electron microscopy (FESEM) and field emission transmission electron microscopy (FETEM) revealed that the nanowires array was highly ordered with rough surface, and the electrochemical features of the AuNWA with/without modification were also investigated. The integrated AuNWA-BSA-GLA-GO(x) nanobiosensor with Nafion membrane gave a very high sensitivity of 298.2 μA cm(-2) mM(-1) for amperometric detection of glucose, while also achieving a low detection limit of 0.1 μM, and a wide linear range of 5-6000 μM. Furthermore, the nanobiosensor exhibited excellent anti-interference ability towards uric acid (UA) and ascorbic acid (AA) with the aid of Nafion membrane, and the results obtained for the analysis of human blood serum indicated that the device is capable of glucose detection in real samples. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Detection of vapor-phase organophosphate threats using wearable conformable integrated epidermal and textile wireless biosensor systems.

    Science.gov (United States)

    Mishra, Rupesh K; Martín, Aida; Nakagawa, Tatsuo; Barfidokht, Abbas; Lu, Xialong; Sempionatto, Juliane R; Lyu, Kay Mengjia; Karajic, Aleksandar; Musameh, Mustafa M; Kyratzis, Ilias L; Wang, Joseph

    2018-03-15

    Flexible epidermal tattoo and textile-based electrochemical biosensors have been developed for vapor-phase detection of organophosphorus (OP) nerve agents. These new wearable sensors, based on stretchable organophosphorus hydrolase (OPH) enzyme electrodes, are coupled with a fully integrated conformal flexible electronic interface that offers rapid and selective square-wave voltammetric detection of OP vapor threats and wireless data transmission to a mobile device. The epidermal tattoo and textile sensors display a good reproducibility (with RSD of 2.5% and 4.2%, respectively), along with good discrimination against potential interferences and linearity over the 90-300mg/L range, with a sensitivity of 10.7µA∙cm 3 ∙mg -1 (R 2 = 0.983) and detection limit of 12mg/L in terms of OP air density. Stress-enduring inks, used for printing the electrode transducers, ensure resilience against mechanical deformations associated with textile and skin-based on-body sensing operations. Theoretical simulations are used to estimate the OP air density over the sensor surface. These fully integrated wearable wireless tattoo and textile-based nerve-agent vapor biosensor systems offer considerable promise for rapid warning regarding personal exposure to OP nerve-agent vapors in variety of decentralized security applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Integrating Electrochemical Detection with Centrifugal Microfluidics for Real-Time and Fully Automated Sample Testing

    DEFF Research Database (Denmark)

    Andreasen, Sune Zoëga; Kwasny, Dorota; Amato, Letizia

    2015-01-01

    Here we present a robust, stable and low-noise experimental set-up for performing electrochemical detection on a centrifugal microfluidic platform. By using a low-noise electronic component (electrical slip-ring) it is possible to achieve continuous, on-line monitoring of electrochemical experime......Here we present a robust, stable and low-noise experimental set-up for performing electrochemical detection on a centrifugal microfluidic platform. By using a low-noise electronic component (electrical slip-ring) it is possible to achieve continuous, on-line monitoring of electrochemical...

  2. INTEGRAL/JEM-X detection of 1RXS J194211.9+255552

    DEFF Research Database (Denmark)

    Chenevez, Jérôme; Fiocchi, M.; Bazzano, A.

    2011-01-01

    exposure leading to a detection significance of eight sigmas. The averaged fluxes extracted from the combined JEM-X1 and JEM-X2 mosaics are 10 +/-2 mCrab and 16 +/-5 mCrab, between 3-10 keV and 10-25 keV, respectively. The source is not detected by the IBIS/ISGRI instrument, and we derive a 3-sigma flux...... upper limit of six mCrab in the 18-40 keV energy range. A Swift ToO follow-up has been approved and the data analysis will soon be performed....

  3. Study and characterization of an integrated circuit-deposited hydrogenated amorphous silicon sensor for the detection of particles and radiations

    International Nuclear Information System (INIS)

    Despeisse, M.

    2006-03-01

    Next generation experiments at the European laboratory of particle physics (CERN) require particle detector alternatives to actual silicon detectors. This thesis presents a novel detector technology, which is based on the deposition of a hydrogenated amorphous silicon sensor on top of an integrated circuit. Performance and limitations of this technology have been assessed for the first time in this thesis in the context of particle detectors. Specific integrated circuits have been designed and the detector segmentation, the interface sensor-chip and the sensor leakage current have been studied in details. The signal induced by the track of an ionizing particle in the sensor has been characterized and results on the signal speed, amplitude and on the sensor resistance to radiation are presented. The results are promising regarding the use of this novel technology for radiation detection, though limitations have been shown for particle physics application. (author)

  4. Detectable states, cycle fluxes, and motility scaling of molecular motor kinesin: An integrative kinetic graph theory analysis

    Science.gov (United States)

    Ren, Jie

    2017-12-01

    The process by which a kinesin motor couples its ATPase activity with concerted mechanical hand-over-hand steps is a foremost topic of molecular motor physics. Two major routes toward elucidating kinesin mechanisms are the motility performance characterization of velocity and run length, and single-molecular state detection experiments. However, these two sets of experimental approaches are largely uncoupled to date. Here, we introduce an integrative motility state analysis based on a theorized kinetic graph theory for kinesin, which, on one hand, is validated by a wealth of accumulated motility data, and, on the other hand, allows for rigorous quantification of state occurrences and chemomechanical cycling probabilities. An interesting linear scaling for kinesin motility performance across species is discussed as well. An integrative kinetic graph theory analysis provides a powerful tool to bridge motility and state characterization experiments, so as to forge a unified effort for the elucidation of the working mechanisms of molecular motors.

  5. Integration of biomimicry and nanotechnology for significantly improved detection of circulating tumor cells (CTCs).

    Science.gov (United States)

    Myung, Ja Hye; Park, Sin-Jung; Wang, Andrew Z; Hong, Seungpyo

    2017-12-13

    Circulating tumor cells (CTCs) have received a great deal of scientific and clinical attention as a biomarker for diagnosis and prognosis of many types of cancer. Given their potential significance in clinics, a variety of detection methods, utilizing the recent advances in nanotechnology and microfluidics, have been introduced in an effort of achieving clinically significant detection of CTCs. However, effective detection and isolation of CTCs still remain a tremendous challenge due to their extreme rarity and phenotypic heterogeneity. Among many approaches that are currently under development, this review paper focuses on a unique, promising approach that takes advantages of naturally occurring processes achievable through application of nanotechnology to realize significant improvement in sensitivity and specificity of CTC capture. We provide an overview of successful outcome of this biomimetic CTC capture system in detection of tumor cells from in vitro, in vivo, and clinical pilot studies. We also emphasize the clinical impact of CTCs as biomarkers in cancer diagnosis and predictive prognosis, which provides a cost-effective, minimally invasive method that potentially replaces or supplements existing methods such as imaging technologies and solid tissue biopsy. In addition, their potential prognostic values as treatment guidelines and that ultimately help to realize personalized therapy are discussed. Copyright © 2017. Published by Elsevier B.V.

  6. Integrating LIBS and NIR for detection of heavy metals in perlite ores

    NARCIS (Netherlands)

    Guatame Garcia, L.A.; Buxton, M.W.N.; Pretz, Thomas; Wortruba, Hermann

    Perlite products are used as a filter aid in the food industry. For such applications, the purity of the material is one of the most significant parameters of control. Early detection of heavy metals is therefore of great industrial interest. In this study, a sensor-based approach for chemical and

  7. An Integrated Theory of Attention and Decision Making in Visual Signal Detection

    Science.gov (United States)

    Smith, Philip L.; Ratcliff, Roger

    2009-01-01

    The simplest attentional task, detecting a cued stimulus in an otherwise empty visual field, produces complex patterns of performance. Attentional cues interact with backward masks and with spatial uncertainty, and there is a dissociation in the effects of these variables on accuracy and on response time. A computational theory of performance in…

  8. Integrated hydraulic and organophosphate pesticide injection simulations for enhancing event detection in water distribution systems.

    Science.gov (United States)

    Schwartz, Rafi; Lahav, Ori; Ostfeld, Avi

    2014-10-15

    As a complementary step towards solving the general event detection problem of water distribution systems, injection of the organophosphate pesticides, chlorpyrifos (CP) and parathion (PA), were simulated at various locations within example networks and hydraulic parameters were calculated over 24-h duration. The uniqueness of this study is that the chemical reactions and byproducts of the contaminants' oxidation were also simulated, as well as other indicative water quality parameters such as alkalinity, acidity, pH and the total concentration of free chlorine species. The information on the change in water quality parameters induced by the contaminant injection may facilitate on-line detection of an actual event involving this specific substance and pave the way to development of a generic methodology for detecting events involving introduction of pesticides into water distribution systems. Simulation of the contaminant injection was performed at several nodes within two different networks. For each injection, concentrations of the relevant contaminants' mother and daughter species, free chlorine species and water quality parameters, were simulated at nodes downstream of the injection location. The results indicate that injection of these substances can be detected at certain conditions by a very rapid drop in Cl2, functioning as the indicative parameter, as well as a drop in alkalinity concentration and a small decrease in pH, both functioning as supporting parameters, whose usage may reduce false positive alarms. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Multi-Sensor Integration to Map Odor Distribution for the Detection of Chemical Sources

    Directory of Open Access Journals (Sweden)

    Xiang Gao

    2016-07-01

    Full Text Available This paper addresses the problem of mapping odor distribution derived from a chemical source using multi-sensor integration and reasoning system design. Odor localization is the problem of finding the source of an odor or other volatile chemical. Most localization methods require a mobile vehicle to follow an odor plume along its entire path, which is time consuming and may be especially difficult in a cluttered environment. To solve both of the above challenges, this paper proposes a novel algorithm that combines data from odor and anemometer sensors, and combine sensors’ data at different positions. Initially, a multi-sensor integration method, together with the path of airflow was used to map the pattern of odor particle movement. Then, more sensors are introduced at specific regions to determine the probable location of the odor source. Finally, the results of odor source location simulation and a real experiment are presented.

  10. Time projection chambers with integrated pixels and their application to fast neutron detection and dark matter searches

    Energy Technology Data Exchange (ETDEWEB)

    Seong, I.S., E-mail: issung83@gmail.com; Beamer, K.; Hedges, M.T.; Jaegle, I.; Rosen, M.D.; Ross, S.J.; Thorpe, T.N.; Vahsen, S.E.; Yamaoka, J.

    2013-12-21

    We present our most recent work on the use of integrated silicon pixel electronics to read out gas-filled Time Projection Chambers (TPCs). Such detectors have great promise to measure the direction and energy of neutral particles via nuclear recoils that ionize the gas. We report on ongoing studies and refinement of the first prototype constructed at the University of Hawaii. We present data on the detection of alpha particles and fast neutrons using Ar:CO{sub 2} (70:30) and He:CO{sub 2} (70:30) gas, respectively. We also present plans and sensitivity estimates for a future Dark Matter search based on the technology under study.

  11. Integrated luminometer for the determination of trace metals in seawater using fluorescence, phosphorescence and chemiluminescence detection

    OpenAIRE

    Worsfold, P. J.; Achterberg, E. P.; Bowie, A. R.; Cannizzaro, V.; Charles, S.; Costa, J. M.; Dubois, F.; Pereiro, R.; San Vicente, B.; Sanz-Medel, A.; Vandeloise, R.; Donckt, E. Vander; Wollast, P.; Yunus, S.

    2002-01-01

    The paper describes an integrated luminometer able to perform fluorescence (FL), room temperature phosphorescence (RTP) and chemiluminescence (CL) measurements on seawater samples. The technical details of the instrumentation are presented together with flow injection (FI) manifolds for the determination of cadmium and zinc (by FL), lead (RTP) and cobalt (CL). The analytical figures of merit are given for each mainfold and results are presented for the determination of the four trace metals i...

  12. Fast neutron detection using a new pulse shape discrimination technique: Charge sensitive integration

    International Nuclear Information System (INIS)

    Zucker, M.; Tsoupas, N.; Karwowski, H.; Castaneda, C.; Nimnual, S.; Porter, R.; Ward, T.

    1988-01-01

    A new electronic technique that depends on charge sensitive integration (CSI) has been developed and tested using a CAMAC based pulse shape discrimination system. Neutrons are well separated from γ-ray signals in the 0.1-100 MeV energy range. The new method was compared with the old zero-crossing time-to-amplitude differentiating technique and was found to be comparable in count rate and superior in noise suppression

  13. Integrated Oil spill detection and forecasting using MOON real time data

    OpenAIRE

    De Dominicis, M.; Pinardi, N.; Coppini, G.; Tonani, M.; Guarnieri, A.; Zodiatis, G.; Lardner, R.; Santoleri, R.

    2009-01-01

    MOON (Mediterranean Operational Oceanography Network) is an operational distributed system ready to provide quality controlled and timely marine observations (in situ and satellite) and environmental analyses and predictions for management of oil spill accidents. MOON operational systems are based upon the real time functioning of an integrated system composed of the Real Time Observing system, the regional, sub-regional and coastal forecasting systems and a products dissemination system. All...

  14. DEVELOPMENT OF NOVEL CERAMIC NANOFILM-FIBER INTEGRATED OPTICAL SENSORS FOR RAPID DETECTION OF COAL DERIVED SYNTHESIS GAS

    Energy Technology Data Exchange (ETDEWEB)

    Junhang Dong; Hai Xiao; Xiling Tang; Hongmin Jiang; Kurtis Remmel; Amardeep Kaur

    2012-09-30

    The overall goal of this project is to conduct fundamental studies on advanced ceramic materials and fiber optic devices for developing new types of high temperature (>500{degree}C) fiber optic chemical sensors (FOCS) for monitoring fossil (mainly coal) and biomass derived gases in power plants. The primary technical objective is to investigate and demonstrate the nanocrystalline doped-ceramic thin film enabled FOCS that possess desired stability, sensitivity and selectivity for in-situ, rapid gas detection in the syngas streams from gasification and combustion flue gases. This report summarizes research works of two integrated parts: (1) development of metal oxide solid thin films as sensing materials for detection and measurement of important gas components relevant to the coal- and biomass-derived syngas and combustion gas streams at high temperatures; and (2) development of fiber optic devices that are potentially useful for constructing FOCS in combination with the solid oxide thin films identified in this program.

  15. Integrated remote sensing techniques for the detection of buried archaeological adobe structures: preliminary results in Cahuachi (Peru)

    Science.gov (United States)

    Masini, N.; Rizzo, E.; Lasaponara, R.; Orefici, G.

    2008-11-01

    This paper is focused on the jointly use of satellite Quickbird (QB) images and Ground Probing Radar (GPR) for assessing their capability in the detection of archaeological adobe structures (sun-dried earth material). Such detection is particularly complex. due to the low contrast generally existing between the archaeological features and the background. Two significant test areas were investigated in the Ceremonial Centre of Cahuachi (in the Nasca territory, Southern Peru) dating back to 6th century BC to 4th century AD. Our results showed that both satellite and GPR data provided valuable indications for unearthing precious ancient remains. Our preliminary analyses pointed out that the integrated use of non destructive remote sensing techniques has high potentiality for its important scientific implications and for its significant contributions to cultural resource management.

  16. Intraoperative detection of subtle endometriosis: a novel paradigm for detection and treatment of pelvic pain associated with the loss of peritoneal integrity.

    Science.gov (United States)

    Lessey, Bruce A; Higdon, H Lee; Miller, Sara E; Price, Thomas A

    2012-12-21

    Endometriosis is a common disease affecting 40 to 70% of reproductive-aged women with chronic pelvic pain (CPP) and/or infertility. The purpose of this study was to demonstrate the use of a blue dye (methylene blue) to stain peritoneal surfaces during laparoscopy (L/S) to detect the loss of peritoneal integrity in patients with pelvic pain and suspected endometriosis. Forty women with CPP and 5 women without pain were evaluated in this pilot study. During L/S, concentrated dye was sprayed onto peritoneal surfaces, then aspirated and rinsed with Lactated Ringers solution. Areas of localized dye uptake were evaluated for the presence of visible endometriotic lesions. Areas of intense peritoneal staining were resected and some fixed in 2.5% buffered gluteraldehyde and examined by scanning (SEM) electron microscopy. Blue dye uptake was more common in women with endometriosis and chronic pelvic pain than controls (85% vs. 40%). Resection of the blue stained areas revealed endometriosis by SEM and loss of peritoneal cell-cell contact compared to normal, non-staining peritoneum. Affected peritoneum was associated with visible endometriotic implants in most but not all patients. Subjective pain relief was reported in 80% of subjects. Based on scanning electron microscopy, we conclude that endometrial cells extend well beyond visible implants of endometriosis and appear to disrupt the underlying mesothelium. Subtle lesions of endometriosis could therefore cause pelvic pain by disruption of peritoneal integrity, allowing menstrual or ovulatory blood and associated pain factors access to underlying sensory nerves. Complete resection of affected peritoneum may provide a better long-term treatment for endometriosis and CPP. This simple technique appears to improve detection of subtle or near invisible endometriosis in women with CPP and minimal visual findings at L/S and may serve to elevate diagnostic accuracy for endometriosis at laparoscopy.

  17. 'Integration'

    DEFF Research Database (Denmark)

    Olwig, Karen Fog

    2011-01-01

    , while the countries have adopted disparate policies and ideologies, differences in the actual treatment and attitudes towards immigrants and refugees in everyday life are less clear, due to parallel integration programmes based on strong similarities in the welfare systems and in cultural notions...... of equality in the three societies. Finally, it shows that family relations play a central role in immigrants’ and refugees’ establishment of a new life in the receiving societies, even though the welfare society takes on many of the social and economic functions of the family....

  18. Finite Element Modelling and Analysis of Damage Detection Methodology in Piezo Electric Sensor and Actuator Integrated Sandwich Cantilever Beam

    Science.gov (United States)

    Pradeep, K. R.; Thomas, A. M.; Basker, V. T.

    2018-03-01

    Structural health monitoring (SHM) is an essential component of futuristic civil, mechanical and aerospace structures. It detects the damages in system or give warning about the degradation of structure by evaluating performance parameters. This is achieved by the integration of sensors and actuators into the structure. Study of damage detection process in piezoelectric sensor and actuator integrated sandwich cantilever beam is carried out in this paper. Possible skin-core debond at the root of the cantilever beam is simulated and compared with undamaged case. The beam is actuated using piezoelectric actuators and performance differences are evaluated using Polyvinylidene fluoride (PVDF) sensors. The methodology utilized is the voltage/strain response of the damaged versus undamaged beam against transient actuation. Finite element model of piezo-beam is simulated in ANSYSTM using 8 noded coupled field element, with nodal degrees of freedoms are translations in the x, y directions and voltage. An aluminium sandwich beam with a length of 800mm, thickness of core 22.86mm and thickness of skin 0.3mm is considered. Skin-core debond is simulated in the model as unmerged nodes. Reduction in the fundamental frequency of the damaged beam is found to be negligible. But the voltage response of the PVDF sensor under transient excitation shows significantly visible change indicating the debond. Piezo electric based damage detection system is an effective tool for the damage detection of aerospace and civil structural system having inaccessible/critical locations and enables online monitoring possibilities as the power requirement is minimal.

  19. FRET based integrated pyrene-AgNPs system for detection of Hg (II) and pyrene dimer: Applications to environmental analysis

    Science.gov (United States)

    Walekar, Laxman S.; Hu, Peidong; Vafaei Molamahmood, Hamed; Long, Mingce

    2018-06-01

    The integrated system of pyrene and cetyltrimethyl ammonium bromide (CTAB) capped silver nanoparticles (AgNPs) with a distance (r) of 2.78 nm has been developed for the detection of Hg (II) and pyrene dimer. The interaction between pyrene and AgNPs results in the fluorescence quenching of pyrene due to the energy transfer, whose mechanism can be attributed to the Forster Resonance Energy Transfer (FRET) supported by experimental observation and theoretical calculations. The developed probe shows a highly selective and sensitive response towards Hg (II) probably due to the amalgam formation, which results in the fluorescence recovery (90%) of pyrene and color change of solution from yellowish brown to colorless. The addition of Hg (II) may increase the distance between pyrene and AgNPs undergoes the 'FRET OFF' process. This system gives a selective response towards Hg (II) over other competing metal ions. Under the optimal condition, the system offers good linearity between 0.1 and 0.6 μg mL-1 with a detection limit of 62 ng mL-1. In addition, the system also provides an effective platform for detection of pyrene in its dimer form even at very low concentrations (10 ng mL-1) on the surface of AgNPs. Therefore, it could be used as effective alternatives for the detection of Hg (II) as well as pyrene simultaneously.

  20. Gold nanostructure-integrated silica-on-silicon waveguide for the detection of antibiotics in milk and milk products

    Science.gov (United States)

    Ozhikandathil, Jayan; Badilescu, Simona; Packirisamy, Muthukumaran

    2012-10-01

    Antibiotics are extensively used in veterinary medicine for the treatment of infectious diseases. The use of antibiotics for the treatment of animals used for food production raised the concern of the public and a rapid screening method became necessary. A novel approach of detection of antibiotics in milk is reported in this work by using an immunoassay format and the Localized Surface Plasmon Resonance property of gold. An antibiotic from the penicillin family that is, ampicillin is used for testing. Gold nanostructures deposited on a glass substrate by a novel convective assembly method were heat-treated to form a nanoisland morphology. The Au nanostructures were functionalized and the corresponding antibody was absorbed from a solution. Solutions with known concentrations of antigen (antibiotics) were subsequently added and the spectral changes were monitored step by step. The Au LSPR band corresponding to the nano-island structure was found to be suitable for the detection of the antibody antigen interaction. The detection of the ampicillin was successfully demonstrated with the gold nano-islands deposited on glass substrate. This process was subsequently adapted for the integration of gold nanostructures on the silica-on-silicon waveguide for the purpose of detecting antibiotics.

  1. Integration of Fault Detection and Isolation with Control Using Neuro-fuzzy Scheme

    Directory of Open Access Journals (Sweden)

    A. Asokan

    2009-10-01

    Full Text Available In this paper an algorithms is developed for fault diagnosis and fault tolerant control strategy for nonlinear systems subjected to an unknown time-varying fault. At first, the design of fault diagnosis scheme is performed using model based fault detection technique. The neuro-fuzzy chi-square scheme is applied for fault detection and isolation. The fault magnitude and time of occurrence of fault is obtained through neuro-fuzzy chi-square scheme. The estimated magnitude of the fault magnitude is normalized and used by the feed-forward control algorithm to make appropriate changes in the manipulated variable to keep the controlled variable near its set value. The feed-forward controller acts along with feed-back controller to control the multivariable system. The performance of the proposed scheme is applied to a three- tank process for various types of fault inputs to show the effectiveness of the proposed approach.

  2. Ultra-thin layer chromatography with integrated silver colloid-based SERS detection.

    Science.gov (United States)

    Wallace, Ryan A; Lavrik, Nickolay V; Sepaniak, Michael J

    2017-01-01

    Simplified lab-on-a-chip techniques are desirable for quick and efficient detection of analytes of interest in the field. The following work involves the use of deterministic pillar arrays on the micro-scale as a platform to separate compounds, and the use of Ag colloid within the arrays as a source of increased signal via surface enhanced Raman spectroscopy (SERS). One problem traditionally seen with SERS surfaces containing Ag colloid is oxidation; however, our platforms are superhydrophobic, reducing the amount of oxidation taking place on the surface of the Ag colloid. This work includes the successful separation and SERS detection of a fluorescent dye compounds (resorufin and sulforhodamine 640), fluorescent anti-tumor drugs (Adriamycin and Daunomycin), and purine and pyrimidine bases (adenine, cytosine, guanine, hypoxanthine, and thymine). © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. An integrated strategy combining DNA walking and NGS to detect GMOs.

    Science.gov (United States)

    Fraiture, Marie-Alice; Herman, Philippe; Papazova, Nina; De Loose, Marc; Deforce, Dieter; Ruttink, Tom; Roosens, Nancy H

    2017-10-01

    Recently, we developed a DNA walking system for the detection and characterization of a broad spectrum of GMOs in routine analysis of food/feed matrices. Here, we present a new version with improved throughput and sensitivity by coupling the DNA walking system to Pacific Bioscience® Next-generation sequencing technology. The performance of the new strategy was thoroughly assessed through several assays. First, we tested its detection and identification capability on grains with high or low GMO content. Second, the potential impacts of food processing were investigated using rice noodle samples. Finally, GMO mixtures and a real-life sample were analyzed to illustrate the applicability of the proposed strategy in routine GMO analysis. In all tested samples, the presence of multiple GMOs was unambiguously proven by the characterization of transgene flanking regions and the combinations of elements that are typical for transgene constructs. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  4. The Impact of Readily Detected- and Underlying Attributes on Social Integration in Cross-Cultural Settings

    OpenAIRE

    Peltokorpi, Vesa

    2003-01-01

    The benefits and drawbacks of homogeneity and heterogeneity have been debated at length. Whereas some researchers assert that heterogeneity is beneficial for groups that are engaged in complex problem solving, the other researchers emphasize the potential costs associated with diversity. The inconsistency is a result of the incomplete measurement of diversity and focus one or two types of diversity. Most research concentrates on the readily detected/visible characteristics, making the assumpt...

  5. Integrating prior knowledge in multiple testing under dependence with applications to detecting differential DNA methylation.

    Science.gov (United States)

    Kuan, Pei Fen; Chiang, Derek Y

    2012-09-01

    DNA methylation has emerged as an important hallmark of epigenetics. Numerous platforms including tiling arrays and next generation sequencing, and experimental protocols are available for profiling DNA methylation. Similar to other tiling array data, DNA methylation data shares the characteristics of inherent correlation structure among nearby probes. However, unlike gene expression or protein DNA binding data, the varying CpG density which gives rise to CpG island, shore and shelf definition provides exogenous information in detecting differential methylation. This article aims to introduce a robust testing and probe ranking procedure based on a nonhomogeneous hidden Markov model that incorporates the above-mentioned features for detecting differential methylation. We revisit the seminal work of Sun and Cai (2009, Journal of the Royal Statistical Society: Series B (Statistical Methodology)71, 393-424) and propose modeling the nonnull using a nonparametric symmetric distribution in two-sided hypothesis testing. We show that this model improves probe ranking and is robust to model misspecification based on extensive simulation studies. We further illustrate that our proposed framework achieves good operating characteristics as compared to commonly used methods in real DNA methylation data that aims to detect differential methylation sites. © 2012, The International Biometric Society.

  6. Design of integrated systems for control and detection of actuator/sensor faults

    DEFF Research Database (Denmark)

    Stoustrup, J.; Grimble, M.J.; Niemann, Hans Henrik

    1997-01-01

    Consider control systems operating under potentially faulty conditions. Discusses the problems of designing a single unit which not only handle the required control but also identified faults occuring in actuators and sensors. In common practice, unites for control and for diagnosis are designed......-integrated design of control and diagnosis unit. Shows how a combined module for control and diagnosis can be designed which is able to follow references and reject disturbances robustly, control the system so that the undertected faults do not have disastrous effect, reduce the number of false alarams and indetify...

  7. Fully integrated monolithic opoelectronic transducer for real.time protein and DNA detection

    DEFF Research Database (Denmark)

    Misiakos, Konstatinos; S. Petrou, Panagiota; E. Kakabakos, Sotirios

    2010-01-01

    The development and testing of a portable bioanalytical device which was capable for real-time monitoring of binding assays was demonstrated. The device was based on arrays of nine optoelectronic transducers monolithically integrated on silicon chips. The optocouplers consisted of nine silicon av...... by exploiting wavelength filtering on photonic crystal engineered waveguides. The proposed miniaturized sensing device with proper packaging and accompanied by a portable instrument can find wide application as a platform for reliable and cost effective point-of-care diagnosis....

  8. Fault detection and isolation in GPS receiver autonomous integrity monitoring based on chaos particle swarm optimization-particle filter algorithm

    Science.gov (United States)

    Wang, Ershen; Jia, Chaoying; Tong, Gang; Qu, Pingping; Lan, Xiaoyu; Pang, Tao

    2018-03-01

    The receiver autonomous integrity monitoring (RAIM) is one of the most important parts in an avionic navigation system. Two problems need to be addressed to improve this system, namely, the degeneracy phenomenon and lack of samples for the standard particle filter (PF). However, the number of samples cannot adequately express the real distribution of the probability density function (i.e., sample impoverishment). This study presents a GPS receiver autonomous integrity monitoring (RAIM) method based on a chaos particle swarm optimization particle filter (CPSO-PF) algorithm with a log likelihood ratio. The chaos sequence generates a set of chaotic variables, which are mapped to the interval of optimization variables to improve particle quality. This chaos perturbation overcomes the potential for the search to become trapped in a local optimum in the particle swarm optimization (PSO) algorithm. Test statistics are configured based on a likelihood ratio, and satellite fault detection is then conducted by checking the consistency between the state estimate of the main PF and those of the auxiliary PFs. Based on GPS data, the experimental results demonstrate that the proposed algorithm can effectively detect and isolate satellite faults under conditions of non-Gaussian measurement noise. Moreover, the performance of the proposed novel method is better than that of RAIM based on the PF or PSO-PF algorithm.

  9. More efficient integrated safeguards by applying a reasonable detection probability for maintaining low presence probability of undetected nuclear proliferating activities

    International Nuclear Information System (INIS)

    Otsuka, Naoto

    2013-01-01

    Highlights: • A theoretical foundation is presented for more efficient Integrated Safeguards (IS). • Probability of undetected nuclear proliferation activities should be maintained low. • For nations under IS, the probability to start proliferation activities is very low. • The fact can decrease the detection probability of IS by dozens of percentage points. • The cost of IS per nation can be cut down by reducing inspection frequencies etc. - Abstract: A theoretical foundation is presented for implementing more efficiently the present International Atomic Energy Agency (IAEA) integrated safeguards (ISs) on the basis of fuzzy evaluation of the probability that the evaluated nation will continue peaceful activities. It is shown that by determining the presence probability of undetected nuclear proliferating activities, nations under IS can be maintained at acceptably low proliferation risk levels even if the detection probability of current IS is decreased by dozens of percentage from the present value. This makes it possible to reduce inspection frequency and the number of collected samples, allowing the IAEA to cut costs per nation. This will contribute to further promotion and application of IS to more nations by the IAEA, and more efficient utilization of IAEA resources from the viewpoint of whole IS framework

  10. Real-Time PCR using a PCR Microchip with Integrated Thermal System and Polymer Waveguides for the Detection of Campylobacter jejuni

    DEFF Research Database (Denmark)

    Wang, Zhenyu; Sekulovic, Andrea; Kutter, Jörg Peter

    2006-01-01

    A novel real-time PCR microchip platform with integrated thermal system and polymer waveguides has been developed. By using the integrated optical system of the real-time PCR chip, cadF – a virulence gene of Campylobacter jejuni, could specifically be detected. Two different DNA binding dyes, SYTOX...

  11. Improved Automated Detection of Diabetic Retinopathy on a Publicly Available Dataset Through Integration of Deep Learning.

    Science.gov (United States)

    Abràmoff, Michael David; Lou, Yiyue; Erginay, Ali; Clarida, Warren; Amelon, Ryan; Folk, James C; Niemeijer, Meindert

    2016-10-01

    To compare performance of a deep-learning enhanced algorithm for automated detection of diabetic retinopathy (DR), to the previously published performance of that algorithm, the Iowa Detection Program (IDP)-without deep learning components-on the same publicly available set of fundus images and previously reported consensus reference standard set, by three US Board certified retinal specialists. We used the previously reported consensus reference standard of referable DR (rDR), defined as International Clinical Classification of Diabetic Retinopathy moderate, severe nonproliferative (NPDR), proliferative DR, and/or macular edema (ME). Neither Messidor-2 images, nor the three retinal specialists setting the Messidor-2 reference standard were used for training IDx-DR version X2.1. Sensitivity, specificity, negative predictive value, area under the curve (AUC), and their confidence intervals (CIs) were calculated. Sensitivity was 96.8% (95% CI: 93.3%-98.8%), specificity was 87.0% (95% CI: 84.2%-89.4%), with 6/874 false negatives, resulting in a negative predictive value of 99.0% (95% CI: 97.8%-99.6%). No cases of severe NPDR, PDR, or ME were missed. The AUC was 0.980 (95% CI: 0.968-0.992). Sensitivity was not statistically different from published IDP sensitivity, which had a CI of 94.4% to 99.3%, but specificity was significantly better than the published IDP specificity CI of 55.7% to 63.0%. A deep-learning enhanced algorithm for the automated detection of DR, achieves significantly better performance than a previously reported, otherwise essentially identical, algorithm that does not employ deep learning. Deep learning enhanced algorithms have the potential to improve the efficiency of DR screening, and thereby to prevent visual loss and blindness from this devastating disease.

  12. Integration of high resolution geophysical methods. Detection of shallow depth bodies of archaeological interest

    Energy Technology Data Exchange (ETDEWEB)

    Cammarano, F.; Piro, S.; Rosso, F.; Versino, L. [Centro Nazionale delle Ricerche, Rome (Italy). Istituto per le Tecnologie Applicate ai Beni Culturali; Mauriello, P. [Neaples, Univ. `Federico II` (Italy). Dip. di Scienze Fisiche

    1998-08-01

    A combined survey using ground penetrating radar, self-potential, geo electrical and magnetic methods has been carried out to detect near-surface tombs in the archaeological test site of the Sabine Necropolis at Colle del Forno, Rome, Italy. A 2D data acquisition mode has been adopted to obtain a 3D image of the investigated volumes. The multi-methodological approach has not only demonstrated the reliability of each method in delineating the spatial behaviour of the governing parameter, but mainly helped to obtain a detailed physical image closely conforming to the target geometry through the whole set of parameters involved

  13. Integration of high resolution geophysical methods. Detection of shallow depth bodies of archaeological interest

    Directory of Open Access Journals (Sweden)

    F. Rosso

    1998-06-01

    Full Text Available A combined survey using ground penetrating radar, self-potential, geoelectrical and magnetic methods has been carried out to detect near-surface tombs in the archaeological test site of the Sabine Necropolis at Colle del Forno, Rome, Italy. A 2D data acquisition mode has been adopted to obtain a 3D image of the investigated volumes. The multi-methodological approach has not only demonstrated the reliability of each method in delineating the spatial behaviour of the governing parameter, but mainly helped to obtain a detailed physical image closely conforming to the target geometry through the whole set of parameters involved.

  14. Calibration model maintenance in melamine resin production: Integrating drift detection, smart sample selection and model adaptation.

    Science.gov (United States)

    Nikzad-Langerodi, Ramin; Lughofer, Edwin; Cernuda, Carlos; Reischer, Thomas; Kantner, Wolfgang; Pawliczek, Marcin; Brandstetter, Markus

    2018-07-12

    The physico-chemical properties of Melamine Formaldehyde (MF) based thermosets are largely influenced by the degree of polymerization (DP) in the underlying resin. On-line supervision of the turbidity point by means of vibrational spectroscopy has recently emerged as a promising technique to monitor the DP of MF resins. However, spectroscopic determination of the DP relies on chemometric models, which are usually sensitive to drifts caused by instrumental and/or sample-associated changes occurring over time. In order to detect the time point when drifts start causing prediction bias, we here explore a universal drift detector based on a faded version of the Page-Hinkley (PH) statistic, which we test in three data streams from an industrial MF resin production process. We employ committee disagreement (CD), computed as the variance of model predictions from an ensemble of partial least squares (PLS) models, as a measure for sample-wise prediction uncertainty and use the PH statistic to detect changes in this quantity. We further explore supervised and unsupervised strategies for (semi-)automatic model adaptation upon detection of a drift. For the former, manual reference measurements are requested whenever statistical thresholds on Hotelling's T 2 and/or Q-Residuals are violated. Models are subsequently re-calibrated using weighted partial least squares in order to increase the influence of newer samples, which increases the flexibility when adapting to new (drifted) states. Unsupervised model adaptation is carried out exploiting the dual antecedent-consequent structure of a recently developed fuzzy systems variant of PLS termed FLEXFIS-PLS. In particular, antecedent parts are updated while maintaining the internal structure of the local linear predictors (i.e. the consequents). We found improved drift detection capability of the CD compared to Hotelling's T 2 and Q-Residuals when used in combination with the proposed PH test. Furthermore, we found that active

  15. NASA UAS Integration into the NAS Project Detect and Avoid Display Evaluations

    Science.gov (United States)

    Shively, Jay

    2016-01-01

    As part of the Air Force - NASA Bi-Annual Research Council Meeting, slides will be presented on phase 1 Detect and Avoid (DAA) display evaluations. A series of iterative human-in-the-loops (HITL) experiments were conducted with different display configurations to objectively measure pilot performance on maintaining well clear. To date, four simulations and two mini-HITLs have been conducted. Data from these experiments have been incorporated into a revised alerting structure and included in the RTCA SC 228 Phase 1 Minimum Operational Performance Standards (MOPS) proposal. Plans for phase 2 are briefly discussed.

  16. An estimation method for echo signal energy of pipe inner surface longitudinal crack detection by 2-D energy coefficients integration

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Shiyuan, E-mail: redaple@bit.edu.cn; Sun, Haoyu, E-mail: redaple@bit.edu.cn; Xu, Chunguang, E-mail: redaple@bit.edu.cn; Cao, Xiandong, E-mail: redaple@bit.edu.cn; Cui, Liming, E-mail: redaple@bit.edu.cn; Xiao, Dingguo, E-mail: redaple@bit.edu.cn [School of Mechanical Engineering, Beijing Institute of Technology, Beijing, China NO.5 Zhongguancun South Street, Haidian District, Beijing 100081 (China)

    2015-03-31

    The echo signal energy is directly affected by the incident sound beam eccentricity or angle for thick-walled pipes inner longitudinal cracks detection. A method for analyzing the relationship between echo signal energy between the values of incident eccentricity is brought forward, which can be used to estimate echo signal energy when testing inside wall longitudinal crack of pipe, using mode-transformed compression wave adaptation of shear wave with water-immersion method, by making a two-dimension integration of “energy coefficient” in both circumferential and axial directions. The calculation model is founded for cylinder sound beam case, in which the refraction and reflection energy coefficients of different rays in the whole sound beam are considered different. The echo signal energy is calculated for a particular cylinder sound beam testing different pipes: a beam with a diameter of 0.5 inch (12.7mm) testing a φ279.4mm pipe and a φ79.4mm one. As a comparison, both the results of two-dimension integration and one-dimension (circumferential direction) integration are listed, and only the former agrees well with experimental results. The estimation method proves to be valid and shows that the usual method of simplifying the sound beam as a single ray for estimating echo signal energy and choosing optimal incident eccentricity is not so appropriate.

  17. Microfluidic-integrated patterned ITO immunosensor for rapid detection of prostate-specific membrane antigen biomarker in prostate cancer.

    Science.gov (United States)

    Seenivasan, Rajesh; Singh, Chandra K; Warrick, Jay W; Ahmad, Nihal; Gunasekaran, Sundaram

    2017-09-15

    An optically transparent patterned indium tin oxide (ITO) three-electrode sensor integrated with a microfluidic channel was designed for label-free immunosensing of prostate-specific membrane antigen (PSMA), a prostate cancer (PCa) biomarker, expressed on prostate tissue and circulating tumor cells but also found in serum. The sensor relies on cysteamine capped gold nanoparticles (N-AuNPs) covalently linked with anti-PSMA antibody (Ab) for target specificity. A polydimethylsiloxane (PDMS) microfluidic channel is used to efficiently and reproducibly introduce sample containing soluble proteins/cells to the sensor. The PSMA is detected and quantified by measuring the change in differential pulse voltammetry signal of a redox probe ([Fe(CN) 6 ] 3- /[Fe(CN) 6 ] 4- ) that is altered upon binding of PSMA with PSMA-Ab immobilized on N-AuNPs/ITO. Detection of PSMA expressing cells and soluble PSMA was tested. The limit of detection (LOD) of the sensor for PSMA-based PCa cells is 6/40µL (i.e., 150 cells/mL) (n=3) with a linear range of 15-400 cells/40µL (i.e., 375-10,000 cells/mL), and for the soluble PSMA is 0.499ng/40µL (i.e., 12.5ng/mL) (n=3) with the linear range of 0.75-250ng/40µL (i.e., 19-6250ng/mL), both with an incubation time of 10min. The results indicate that the sensor has a suitable sensitivity and dynamic range for routine detection of PCa circulating tumor cells and can be adapted to detect other biomarkers/cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Integrated ion imprinted polymers-paper composites for selective and sensitive detection of Cd(II) ions

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Kai [State Key Laboratory of Environment Health - Incubation, Key Laboratory of Environment and Health, Ministry of Education, Key Laboratory of Environment and Health Wuhan, Ministry of Environmental Protection, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, #13 Hangkong Road, Hubei, 430030, Wuhan (China); Chen, Ying [Hubei Center for Disease Control and Prevention, No. 6 ZhuoDao Quan North Road, 430079, Wuhan (China); Zhou, Feng [State Key Laboratory of Environment Health - Incubation, Key Laboratory of Environment and Health, Ministry of Education, Key Laboratory of Environment and Health Wuhan, Ministry of Environmental Protection, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, #13 Hangkong Road, Hubei, 430030, Wuhan (China); Zhao, Xiaoya [Hubei Entry-Exit Inspection and Quarantine Bureau of PRC, No.588 Qingtaidadao Road, Hubei, 430022, Wuhan (China); Liu, Jiafa [Hubei Center for Disease Control and Prevention, No. 6 ZhuoDao Quan North Road, 430079, Wuhan (China); Mei, Surong; Zhou, Yikai [State Key Laboratory of Environment Health - Incubation, Key Laboratory of Environment and Health, Ministry of Education, Key Laboratory of Environment and Health Wuhan, Ministry of Environmental Protection, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, #13 Hangkong Road, Hubei, 430030, Wuhan (China); Jing, Tao, E-mail: jingtao@hust.edu.cn [State Key Laboratory of Environment Health - Incubation, Key Laboratory of Environment and Health, Ministry of Education, Key Laboratory of Environment and Health Wuhan, Ministry of Environmental Protection, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, #13 Hangkong Road, Hubei, 430030, Wuhan (China)

    2017-07-05

    Highlights: • IIPs are first grafted on the low-cost A4 print paper to develop an integrated paper-based device. • As an imprinted composite, the adsorption capacity is 155.2 mg g{sup –1} and the imprinted factor is more than 3.0. • As an analytical method, the limit of detection is 0.4 ng mL{sup –1}. • Based on the water quality standards, it could be used to determine Cd(II) ions in drinking water. - Abstract: Paper-based sensor is a new alternative technology to develop a portable, low-cost, and rapid analysis system in environmental chemistry. In this study, ion imprinted polymers (IIPs) using cadmium ions as the template were directly grafted on the surface of low-cost print paper based on the reversible addition-fragmentation chain transfer polymerization. It can be applied as a recognition element to selectively capture the target ions in the complex samples. The maximum adsorption capacity of IIPs composites was 155.2 mg g{sup –1} and the imprinted factor was more than 3.0. Then, IIPs-paper platform could be also applied as a detection element for highly selective and sensitive detection of Cd(II) ions without complex sample pretreatment and expensive instrument, due to the selective recognition, formation of dithizone-cadmium complexes and light transmission ability. Under the optimized condition, the linear range was changed from 1 to 100 ng mL{sup –1} and the limit of detection was 0.4 ng mL{sup –1}. The results were in good agreement with the classic ICP-MS method. Furthermore, the proposed method can also be developed for detection of other heavy metals by designing of new IIPs.

  19. A miniaturized and integrated gel post platform for multiparameter PCR detection of herpes simplex viruses from raw genital swabs.

    Science.gov (United States)

    Manage, Dammika P; Lauzon, Jana; Atrazhev, Alexey; Morrissey, Yuen C; Edwards, Ann L; Stickel, Alexander J; Crabtree, H John; Pabbaraju, Kanti; Zahariadis, George; Yanow, Stephanie K; Pilarski, Linda M

    2012-05-07

    Herpes simplex virus (HSV) is one of the most prevalent viruses, with acute and recurrent infections in humans. The current gold standard for the diagnosis of HSV is viral culture which takes 2-14 days and has low sensitivity. In contrast, DNA amplification by polymerase chain reaction (PCR) can be performed within 1-2 h. We here describe a multiparameter PCR assay to simultaneously detect HSV-1 and HSV-2 DNA templates, together with integrated positive and negative controls, with product detection by melting curve analysis (MCA), in an array of semi-solid polyacrylamide gel posts. Each gel post is 0.67 μL in volume, and polymerized with all the components required for PCR. Both PCR and MCA can currently be performed in one hour and 20 min. Unprocessed genital swabs collected in universal transport medium were directly added to the reagents before or after polymerization, diffusing from atop the gel posts. The gel post platform detects HSV templates in as little as 2.5 nL of raw sample. In this study, 45 genital swab specimens were tested blindly as a preliminary validation of this platform. The concordance of PCR on gel posts with conventional PCR was 91%. The primer sequestration method introduced here (wherein different primers are placed in different sets of posts) enables the simultaneous detection of multiple pathogens for the same sample, together with positive and negative controls, on a single chip. This platform accepts unprocessed samples and is readily adaptable to detection of multiple different pathogens or biomarkers for point-of-care diagnostics.

  20. UAS Integration in the NAS Project: Flight Test 3 Data Analysis of JADEM-Autoresolver Detect and Avoid System

    Science.gov (United States)

    Gong, Chester; Wu, Minghong G.; Santiago, Confesor

    2016-01-01

    The Unmanned Aircraft Systems Integration in the National Airspace System project, or UAS Integration in the NAS, aims to reduce technical barriers related to safety and operational challenges associated with enabling routine UAS access to the NAS. The UAS Integration in the NAS Project conducted a flight test activity, referred to as Flight Test 3 (FT3), involving several Detect-and-Avoid (DAA) research prototype systems between June 15, 2015 and August 12, 2015 at the Armstrong Flight Research Center (AFRC). This report documents the flight testing and analysis results for the NASA Ames-developed JADEM-Autoresolver DAA system, referred to as 'Autoresolver' herein. Four flight test days (June 17, 18, 22, and July 22) were dedicated to Autoresolver testing. The objectives of this test were as follows: 1. Validate CPA prediction accuracy and detect-and-avoid (DAA, formerly known as self-separation) alerting logic in realistic flight conditions. 2. Validate DAA trajectory model including maneuvers. 3. Evaluate TCAS/DAA interoperability. 4. Inform final Minimum Operating Performance Standards (MOPS). Flight test scenarios were designed to collect data to directly address the objectives 1-3. Objective 4, inform final MOPS, was a general objective applicable to the UAS in the NAS project as a whole, of which flight test is a subset. This report presents analysis results completed in support of the UAS in the NAS project FT3 data review conducted on October 20, 2015. Due to time constraints and, to a lesser extent, TCAS data collection issues, objective 3 was not evaluated in this analysis.

  1. An Integrated Low-Power Lock-In Amplifier and Its Application to Gas Detection

    Directory of Open Access Journals (Sweden)

    Paulina M. Maya-Hernández

    2014-08-01

    Full Text Available This paper presents a new micropower analog lock-in amplifier (LIA suitable for battery-operated applications thanks to its reduced size and power consumption as well as its operation with single-supply voltage. The proposed LIA was designed in a 0.18 µm CMOS process with a single supply voltage of 1.8 V. Experimental results show a variable DC gain ranging from 24.7 to 42 dB, power consumption of 417 µW and integration area of 0.013 mm2. The LIA performance was demonstrated by measuring carbon monoxide concentrations as low as 1 ppm in dry N2. The experimental results show that the response to CO of the sensing system can be considerably improved by means of the proposed LIA.

  2. Development of integrated damage detection system for international America's Cup class yacht structures using a fiber optic distributed sensor

    Science.gov (United States)

    Akiyoshi, Shimada; Naruse, Hiroshi; Uzawa, Kyoshi; Murayama, Hideaki; Kageyama, Kazuro

    2000-06-01

    We constructed a new health monitoring system to detect damage using a fiber optic distributed sensor, namely a Brillouin optical time domain reflectometer (BOTDR), and installed it in International America's Cup Class (IACC) yachts, the Japanese entry in America's Cup 2000. IACC yachts are designed to be as fast as possible, so it is essential that they are lightweight and encounter minimum water resistance. Advanced composite sandwich structures, made with carbon fiber reinforced plastic (CFRP) skins and a honeycomb core, are used to achieve the lightweight structure. Yacht structure designs push the strength of the materials to their limit and so it is important to detect highly stressed or damaged regions that might cause a catastrophic fracture. The BOTDR measures changes in the Brillouin frequency shift caused by distributed strain along one optical fiber. We undertook two experiments: a pulling test and a four point bending test on a composite beam. The former showed that no slippage occurred between the optical fiber glass and its coating. The latter confirmed that a debonding between the skin and the core of 300 mm length could be found with the BOTDR. Next we examined the effectiveness with which this system can assess the structural integrity of IACC yachts. The results show that our system has the potential for use as a damage detection system for smart structures.

  3. Integrated circuit-based electrochemical sensor for spatially resolved detection of redox-active metabolites in biofilms.

    Science.gov (United States)

    Bellin, Daniel L; Sakhtah, Hassan; Rosenstein, Jacob K; Levine, Peter M; Thimot, Jordan; Emmett, Kevin; Dietrich, Lars E P; Shepard, Kenneth L

    2014-01-01

    Despite advances in monitoring spatiotemporal expression patterns of genes and proteins with fluorescent probes, direct detection of metabolites and small molecules remains challenging. A technique for spatially resolved detection of small molecules would benefit the study of redox-active metabolites that are produced by microbial biofilms and can affect their development. Here we present an integrated circuit-based electrochemical sensing platform featuring an array of working electrodes and parallel potentiostat channels. 'Images' over a 3.25 × 0.9 mm(2) area can be captured with a diffusion-limited spatial resolution of 750 μm. We demonstrate that square wave voltammetry can be used to detect, identify and quantify (for concentrations as low as 2.6 μM) four distinct redox-active metabolites called phenazines. We characterize phenazine production in both wild-type and mutant Pseudomonas aeruginosa PA14 colony biofilms, and find correlations with fluorescent reporter imaging of phenazine biosynthetic gene expression.

  4. I-123 iomazenil single photon emission computed tomography for detecting loss of neuronal integrity in patients with traumatic brain injury.

    Science.gov (United States)

    Abiko, Kagari; Ikoma, Katsunori; Shiga, Tohru; Katoh, Chietsugu; Hirata, Kenji; Kuge, Yuji; Kobayashi, Kentaro; Tamaki, Nagara

    2017-12-01

    Traumatic brain injury (TBI) causes brain dysfunction in many patients. Using C-11 flumazenil (FMZ) positron emission tomography (PET), we have detected and reported the loss of neuronal integrity, leading to brain dysfunction in TBI patients. Similarly to FMZ PET, I-123 iomazenil (IMZ) single photon emission computed tomography (SPECT) is widely used to determine the distribution of the benzodiazepine receptor (BZR) in the brain cortex. The purpose of this study is to examine whether IMZ SPECT is as useful as FMZ PET for evaluating the loss of neuronal integrity in TBI patients. The subjects of this study were seven patients who suffered from neurobehavioral disability. They underwent IMZ SPECT and FMZ PET. Nondisplaceable binding potential (BP ND ) was calculated from FMZ PET images. The uptake of IMZ was evaluated on the basis of lesion-to-pons ratio (LPR). The locations of low uptake levels were visually evaluated both in IMZ SPECT and FMZ PET images. We compared FMZ BP ND and (LPR-1) of IMZ SPECT. In the visual assessment, FMZ BP ND decreased in 11 regions. In IMZ SPECT, low uptake levels were observed in eight of the 11 regions. The rate of concordance between FMZ PET and IMZ SPECT was 72.7%. The mean values IMZ (LPR-1) (1.95 ± 1.01) was significantly lower than that of FMZ BP ND (2.95 ± 0.80 mL/mL). There was good correlation between FMZ BP ND and IMZ (LPR-1) (r = 0.80). IMZ SPECT findings were almost the same as FMZ PET findings in TBI patients. The results indicated that IMZ SPECT is useful for evaluating the loss of neuronal integrity. Because IMZ SPECT can be performed in various facilities, IMZ SPECT may become widely adopted for evaluating the loss of neuronal integrity.

  5. An integrated hydrological modeling approach for detection and attribution of climatic and human impacts on coastal water resources

    Science.gov (United States)

    Feng, Dapeng; Zheng, Yi; Mao, Yixin; Zhang, Aijing; Wu, Bin; Li, Jinguo; Tian, Yong; Wu, Xin

    2018-02-01

    Water resources in coastal areas can be profoundly influenced by both climate change and human activities. These climatic and human impacts are usually intertwined and difficult to isolate. This study developed an integrated model-based approach for detection and attribution of climatic and human impacts and applied this approach to the Luanhe Plain, a typical coastal area in northern China. An integrated surface water-groundwater model was developed for the study area using GSFLOW (coupled groundwater and surface-water flow). Model calibration and validation were performed for background years between 1975 and 2000. The variation in water resources between the 1980s and 1990s was then quantitatively attributed to climate variability, groundwater pumping and changes in upstream inflow. Climate scenarios for future years (2075-2100) were also developed by downscaling the projections in CMIP5. Potential water resource responses to climate change, as well as their uncertainty, were then investigated through integrated modeling. The study results demonstrated the feasibility and value of the integrated modeling-based analysis for water resource management in areas with complex surface water-groundwater interaction. Specific findings for the Luanhe Plain included the following: (1) During the historical period, upstream inflow had the most significant impact on river outflow to the sea, followed by climate variability, whereas groundwater pumping was the least influential. (2) The increase in groundwater pumping had a dominant influence on the decline in groundwater change, followed by climate variability. (3) Synergetic and counteractive effects among different impacting factors, while identified, were not significant, which implied that the interaction among different factors was not very strong in this case. (4) It is highly probable that future climate change will accelerate groundwater depletion in the study area, implying that strict regulations for groundwater

  6. RAPS: an innovative active pixel for particle detection integrated in CMOS technology

    International Nuclear Information System (INIS)

    Passeri, Daniele; Placidi, Pisana; Verducci, Leonardo; Ciampolini, Paolo; Matrella, Guido; Marras, Alessandro; Bilei, G.M.

    2004-01-01

    In this paper we discuss some design, implementation and test issues, with respect to the development of the RAPS01 chip in the framework of the Radiation Active Pixel Sensors (RAPS) INFN project. The project aimed at verifying feasibility of smart, high-resolution pixel arrays with a fully standard, submicron CMOS technology for particle detection purposes. Layout optimization of the pixel, including sensitive element and local read and amplification circuits has been carried out. Different basic pixel schemes and read-out options have been proposed and devised. Chip fabrication has been completed and test phase is now under way: to this purpose a suitable test environment has been devised and test strategies have been planned

  7. Integrating Paper Chromatography with Electrochemical Detection for the Trace Analysis of TNT in Soil

    Directory of Open Access Journals (Sweden)

    Patrick Ryan

    2015-07-01

    Full Text Available We report on the development of an electrochemical probe for the trace analysis of 2,4,6-trinitrotoluene (TNT in soil samples. The probe is a combination of graphite electrodes, filter paper, with ethylene glycol and choline chloride as the solvent/electrolyte. Square wave chromatovoltammograms show the probes have a sensitivity for TNT of 0.75 nA/ng and a limit of detection of 100 ng. In addition, by taking advantage of the inherent paper chromatography step, TNT can be separated in both time and cathodic peak potential from 4-amino-dinitrotolene co-spotted on the probe or in soil samples with the presence of methyl parathion as a possible interferent.

  8. A Total Integrated Biochip System for Detection of SNP in Cancer

    DEFF Research Database (Denmark)

    Perch-Nielsen, Ivan R.; Brivio, Monica; Schaeffer, Eva

    2010-01-01

    mutation is a hallmark of many tumors. Importantly, most anticancer agents act by inducing apoptosis and, typically, p53- deficient tumors are more resistant to drug-induced apoptosis than those carrying wild-type p53. It is therefore important to analyze such SNPs and point mutation in cancer diagnosis......Cancer is a leading cause of death worldwide. Resistance of tumor cells to radiation and chemotherapy is the major obstacle in cancer treatment. The serious toxicity that follows the administration of certain drugs can be associated with Single Nucleotide Polymorphisms (SNPs) of genes involved...... in drug metabolism and can ultimately reduce the clinical efficacy of chemotherapy. The KRAS and TP53 genes are altered in many human tumors. K-RAS point mutation appear early in the tumorigenesis pathway and can therefore be used for early cancer detection. The functional inactivation of p53 by point...

  9. Operational NDT simulator, towards human factors integration in simulated probability of detection

    Science.gov (United States)

    Rodat, Damien; Guibert, Frank; Dominguez, Nicolas; Calmon, Pierre

    2017-02-01

    In the aeronautic industry, the performance demonstration of Non-Destructive Testing (NDT) procedures relies on Probability Of Detection (POD) analyses. This statistical approach measures the ability of the procedure to detect a flaw with regard to one of its characteristic dimensions. The inspection chain is evaluated as a whole, including equipment configuration, probe effciency but also operator manipulations. Traditionally, a POD study requires an expensive campaign during which several operators apply the procedure on a large set of representative samples. Recently, new perspectives for the POD estimation have been introduced using NDT simulation to generate data. However, these approaches do not offer straightforward solutions to take the operator into account. The simulation of human factors, including cognitive aspects, often raises questions. To address these diffculties, we propose a concept of operational NDT simulator [1]. This work presents the first steps in the implementation of such simulator for ultrasound phased array inspection of composite parts containing Flat Bottom Holes (FBHs). The final system will look like a classical ultrasound testing equipment with a single exception: the displayed signals will be synthesized. Our hardware (ultrasound acquisition card, 3D position tracker) and software (position analysis, inspection scenario, synchronization, simulations) environments are developed as a bench to test the meta-modeling techniques able to provide fast-simulated realistic ultra-sound signals. The results presented here are obtained by on-the-fly merging of real and simulated signals. They confirm the feasibility of our approach: the replacement of real signals by purely simulated ones has been unnoticed by operators. We believe this simulator is a great prospect for POD evaluation including human factors, and may also find applications for training or procedure set-up.

  10. Final Scientific Report, Integrated Seismic Event Detection and Location by Advanced Array Processing

    Energy Technology Data Exchange (ETDEWEB)

    Kvaerna, T.; Gibbons. S.J.; Ringdal, F; Harris, D.B.

    2007-01-30

    In the field of nuclear explosion monitoring, it has become a priority to detect, locate, and identify seismic events down to increasingly small magnitudes. The consideration of smaller seismic events has implications for a reliable monitoring regime. Firstly, the number of events to be considered increases greatly; an exponential increase in naturally occurring seismicity is compounded by large numbers of seismic signals generated by human activity. Secondly, the signals from smaller events become more difficult to detect above the background noise and estimates of parameters required for locating the events may be subject to greater errors. Thirdly, events are likely to be observed by a far smaller number of seismic stations, and the reliability of event detection and location using a very limited set of observations needs to be quantified. For many key seismic stations, detection lists may be dominated by signals from routine industrial explosions which should be ascribed, automatically and with a high level of confidence, to known sources. This means that expensive analyst time is not spent locating routine events from repeating seismic sources and that events from unknown sources, which could be of concern in an explosion monitoring context, are more easily identified and can be examined with due care. We have obtained extensive lists of confirmed seismic events from mining and other artificial sources which have provided an excellent opportunity to assess the quality of existing fully-automatic event bulletins and to guide the development of new techniques for online seismic processing. Comparing the times and locations of confirmed events from sources in Fennoscandia and NW Russia with the corresponding time and location estimates reported in existing automatic bulletins has revealed substantial mislocation errors which preclude a confident association of detected signals with known industrial sources. The causes of the errors are well understood and are

  11. Final Scientific Report, Integrated Seismic Event Detection and Location by Advanced Array Processing

    International Nuclear Information System (INIS)

    Kvaerna, T.; Gibbons. S.J.; Ringdal, F; Harris, D.B.

    2007-01-01

    In the field of nuclear explosion monitoring, it has become a priority to detect, locate, and identify seismic events down to increasingly small magnitudes. The consideration of smaller seismic events has implications for a reliable monitoring regime. Firstly, the number of events to be considered increases greatly; an exponential increase in naturally occurring seismicity is compounded by large numbers of seismic signals generated by human activity. Secondly, the signals from smaller events become more difficult to detect above the background noise and estimates of parameters required for locating the events may be subject to greater errors. Thirdly, events are likely to be observed by a far smaller number of seismic stations, and the reliability of event detection and location using a very limited set of observations needs to be quantified. For many key seismic stations, detection lists may be dominated by signals from routine industrial explosions which should be ascribed, automatically and with a high level of confidence, to known sources. This means that expensive analyst time is not spent locating routine events from repeating seismic sources and that events from unknown sources, which could be of concern in an explosion monitoring context, are more easily identified and can be examined with due care. We have obtained extensive lists of confirmed seismic events from mining and other artificial sources which have provided an excellent opportunity to assess the quality of existing fully-automatic event bulletins and to guide the development of new techniques for online seismic processing. Comparing the times and locations of confirmed events from sources in Fennoscandia and NW Russia with the corresponding time and location estimates reported in existing automatic bulletins has revealed substantial mislocation errors which preclude a confident association of detected signals with known industrial sources. The causes of the errors are well understood and are

  12. Methodology and software to detect viral integration site hot-spots

    Science.gov (United States)

    2011-01-01

    Background Modern gene therapy methods have limited control over where a therapeutic viral vector inserts into the host genome. Vector integration can activate local gene expression, which can cause cancer if the vector inserts near an oncogene. Viral integration hot-spots or 'common insertion sites' (CIS) are scrutinized to evaluate and predict patient safety. CIS are typically defined by a minimum density of insertions (such as 2-4 within a 30-100 kb region), which unfortunately depends on the total number of observed VIS. This is problematic for comparing hot-spot distributions across data sets and patients, where the VIS numbers may vary. Results We develop two new methods for defining hot-spots that are relatively independent of data set size. Both methods operate on distributions of VIS across consecutive 1 Mb 'bins' of the genome. The first method 'z-threshold' tallies the number of VIS per bin, converts these counts to z-scores, and applies a threshold to define high density bins. The second method 'BCP' applies a Bayesian change-point model to the z-scores to define hot-spots. The novel hot-spot methods are compared with a conventional CIS method using simulated data sets and data sets from five published human studies, including the X-linked ALD (adrenoleukodystrophy), CGD (chronic granulomatous disease) and SCID-X1 (X-linked severe combined immunodeficiency) trials. The BCP analysis of the human X-linked ALD data for two patients separately (774 and 1627 VIS) and combined (2401 VIS) resulted in 5-6 hot-spots covering 0.17-0.251% of the genome and containing 5.56-7.74% of the total VIS. In comparison, the CIS analysis resulted in 12-110 hot-spots covering 0.018-0.246% of the genome and containing 5.81-22.7% of the VIS, corresponding to a greater number of hot-spots as the data set size increased. Our hot-spot methods enable one to evaluate the extent of VIS clustering, and formally compare data sets in terms of hot-spot overlap. Finally, we show that the

  13. Integrative taxonomy detects cryptic and overlooked fish species in a neotropical river basin.

    Science.gov (United States)

    Gomes, Laís Carvalho; Pessali, Tiago Casarim; Sales, Naiara Guimarães; Pompeu, Paulo Santos; Carvalho, Daniel Cardoso

    2015-10-01

    The great freshwater fish diversity found in the neotropical region makes management and conservation actions challenging. Due to shortage of taxonomists and insufficient infrastructure to deal with such great biodiversity (i.e. taxonomic impediment), proposed remedies to accelerate species identification and descriptions include techniques that combine DNA-based identification and concise morphological description. The building of a DNA barcode reference database correlating meristic and genetic data was developed for 75 % of the Mucuri River basin's freshwater fish. We obtained a total of 141 DNA barcode sequences from 37 species belonging to 30 genera, 19 families, and 5 orders. Genetic distances within species, genera, and families were 0.74, 9.5, and 18.86 %, respectively. All species could be clearly identified by the DNA barcodes. Divergences between meristic morphological characteristics and DNA barcodes revealed two cryptic species among the Cyphocharax gilbert and Astyanax gr. bimaculatus specimens, and helped to identify two overlooked species within the Gymnotus and Astyanax taxa. Therefore, using a simplified model of neotropical biodiversity, we tested the efficiency of an integrative taxonomy approach for species discovery, identification of cryptic diversity, and accelerating biodiversity descriptions.

  14. Development and validation of an integrated DNA walking strategy to detect GMO expressing cry genes.

    Science.gov (United States)

    Fraiture, Marie-Alice; Vandamme, Julie; Herman, Philippe; Roosens, Nancy H C

    2018-06-27

    Recently, an integrated DNA walking strategy has been proposed to prove the presence of GMO via the characterisation of sequences of interest, including their transgene flanking regions and the unnatural associations of elements in their transgenic cassettes. To this end, the p35S, tNOS and t35S pCAMBIA elements have been selected as key targets, allowing the coverage of most of GMO, EU authorized or not. In the present study, a bidirectional DNA walking method anchored on the CryAb/c genes is proposed with the aim to cover additional GMO and additional sequences of interest. The performance of the proposed bidirectional DNA walking method anchored on the CryAb/c genes has been evaluated in a first time for its feasibility using several GM events possessing these CryAb/c genes. Afterwards, its sensitivity has been investigated through low concentrations of targets (as low as 20 HGE). In addition, to illustrate its applicability, the entire workflow has been tested on a sample mimicking food/feed matrices analysed in GMO routine analysis. Given the successful assessment of its performance, the present bidirectional DNA walking method anchored on the CryAb/c genes can easily be implemented in GMO routine analysis by the enforcement laboratories and allows completing the entire DNA walking strategy in targeting an additional transgenic element frequently found in GMO.

  15. Hydrogenated Amorphous Silicon Sensor Deposited on Integrated Circuit for Radiation Detection

    CERN Document Server

    Despeisse, M; Jarron, P; Kaplon, J; Moraes, D; Nardulli, A; Powolny, F; Wyrsch, N

    2008-01-01

    Radiation detectors based on the deposition of a 10 to 30 mum thick hydrogenated amorphous silicon (a-Si:H) sensor directly on top of integrated circuits have been developed. The performance of this detector technology has been assessed for the first time in the context of particle detectors. Three different circuits were designed in a quarter micron CMOS technology for these studies. The so-called TFA (Thin-Film on ASIC) detectors obtained after deposition of a-Si:H sensors on the developed circuits are presented. High internal electric fields (104 to 105 V/cm) can be built in the a-Si:H sensor and overcome the low mobility of electrons and holes in this amorphous material. However, the deposited sensor's leakage current at such fields turns out to be an important parameter which limits the performance of a TFA detector. Its detailed study is presented as well as the detector's pixel segmentation. Signal induction by generated free carrier motion in the a-Si:H sensor has been characterized using a 660 nm pul...

  16. Corrected Integral Shape Averaging Applied to Obstructive Sleep Apnea Detection from the Electrocardiogram

    Directory of Open Access Journals (Sweden)

    C. O'Brien

    2007-01-01

    Full Text Available We present a technique called corrected integral shape averaging (CISA for quantifying shape and shape differences in a set of signals. CISA can be used to account for signal differences which are purely due to affine time warping (jitter and dilation/compression, and hence provide access to intrinsic shape fluctuations. CISA can also be used to define a distance between shapes which has useful mathematical properties; a mean shape signal for a set of signals can be defined, which minimizes the sum of squared shape distances of the set from the mean. The CISA procedure also allows joint estimation of the affine time parameters. Numerical simulations are presented to support the algorithm for obtaining the CISA mean and parameters. Since CISA provides a well-defined shape distance, it can be used in shape clustering applications based on distance measures such as k-means. We present an application in which CISA shape clustering is applied to P-waves extracted from the electrocardiogram of subjects suffering from sleep apnea. The resulting shape clustering distinguishes ECG segments recorded during apnea from those recorded during normal breathing with a sensitivity of 81% and specificity of 84%.

  17. An Integrated GIS-Expert System Framework for Live Hazard Monitoring and Detection

    Directory of Open Access Journals (Sweden)

    Steven M. Rozic

    2008-02-01

    Full Text Available In the context of hazard monitoring, using sensor web technology to monitor anddetect hazardous conditions in near-real-time can result in large amounts of spatial data thatcan be used to drive analysis at an instrumented site. These data can be used for decisionmaking and problem solving, however as with any analysis problem the success ofanalyzing hazard potential is governed by many factors such as: the quality of the sensordata used as input; the meaning that can be derived from those data; the reliability of themodel used to describe the problem; the strength of the analysis methods; and the ability toeffectively communicate the end results of the analysis. For decision makers to make use ofsensor web data these issues must be dealt with to some degree. The work described in thispaper addresses all of these areas by showing how raw sensor data can be automaticallytransformed into a representation which matches a predefined model of the problem context.This model can be understood by analysis software that leverages rule-based logic andinference techniques to reason with, and draw conclusions about, spatial data. These toolsare integrated with a well known Geographic Information System (GIS and existinggeospatial and sensor web infrastructure standards, providing expert users with the toolsneeded to thoroughly explore a problem site and investigate hazards in any domain.

  18. Label-free detection of endocrine disrupting chemicals by integrating a competitive binding assay with a piezoelectric ceramic resonator.

    Science.gov (United States)

    Hu, Liang-sheng; Fong, Chi-Chun; Zou, Lan; Wong, Wing-Leung; Wong, Kwok-Yin; Wu, Rudolf S S; Yang, Mengsu

    2014-03-15

    A piezoelectric biosensor for detection of endocrine disrupting chemicals (EDCs) was developed by incorporating chemical/biochemical recognition elements on the ceramic resonator surface for competitive binding assays. A facile electrodeposition was employed to modify the sensor surface with Au nanoparticles, which increased the surface area and enhanced the binding capacity of the immobilized probes. Thiol-labeled long chain hydrocarbon with bisphenol A (BPA) as head group was synthesized and self-assembled on the Au nanoparticle surface as the sensing probes, which showed a linear response upon the binding of estrogen receptor (ER-α) ranging from 1 to 30 nM. Detection of estrone, 17β-estradiol and BPA was achieved by integrating a competitive binding assay with the piezoelectric sensor. In this detection scheme, different concentrations of EDCs were incubated with 30 nM of ER-α, and the un-bounded ER-α in the solution was captured by the probes immobilized on the ceramic resonator, which resulted in the frequency changes for different EDCs. The biosensor assay exhibited a linear response to EDCs with a low detection limit of 2.4-2.9 nM (S/N=3), and required only a small volume of sample (1.5 µl) with the assay time of 2h. The performance of the biosensor assay was also evaluated for rapid and facile determination of EDCs of environmental relevant concentrations in drinking water and seawater, and the recovery rate was in the range between 94.7% and 109.8%. © 2013 Elsevier B.V. All rights reserved.

  19. Review of CMOS Integrated Circuit Technologies for High-Speed Photo-Detection.

    Science.gov (United States)

    Jeong, Gyu-Seob; Bae, Woorham; Jeong, Deog-Kyoon

    2017-08-25

    The bandwidth requirement of wireline communications has increased exponentially because of the ever-increasing demand for data centers and high-performance computing systems. However, it becomes difficult to satisfy the requirement with legacy electrical links which suffer from frequency-dependent losses due to skin effects, dielectric losses, channel reflections, and crosstalk, resulting in a severe bandwidth limitation. In order to overcome this challenge, it is necessary to introduce optical communication technology, which has been mainly used for long-reach communications, such as long-haul networks and metropolitan area networks, to the medium- and short-reach communication systems. However, there still remain important issues to be resolved to facilitate the adoption of the optical technologies. The most critical challenges are the energy efficiency and the cost competitiveness as compared to the legacy copper-based electrical communications. One possible solution is silicon photonics which has long been investigated by a number of research groups. Despite inherent incompatibility of silicon with the photonic world, silicon photonics is promising and is the only solution that can leverage the mature complementary metal-oxide-semiconductor (CMOS) technologies. Silicon photonics can be utilized in not only wireline communications but also countless sensor applications. This paper introduces a brief review of silicon photonics first and subsequently describes the history, overview, and categorization of the CMOS IC technology for high-speed photo-detection without enumerating the complex circuital expressions and terminologies.

  20. An Ensemble Method with Integration of Feature Selection and Classifier Selection to Detect the Landslides

    Science.gov (United States)

    Zhongqin, G.; Chen, Y.

    2017-12-01

    Abstract Quickly identify the spatial distribution of landslides automatically is essential for the prevention, mitigation and assessment of the landslide hazard. It's still a challenging job owing to the complicated characteristics and vague boundary of the landslide areas on the image. The high resolution remote sensing image has multi-scales, complex spatial distribution and abundant features, the object-oriented image classification methods can make full use of the above information and thus effectively detect the landslides after the hazard happened. In this research we present a new semi-supervised workflow, taking advantages of recent object-oriented image analysis and machine learning algorithms to quick locate the different origins of landslides of some areas on the southwest part of China. Besides a sequence of image segmentation, feature selection, object classification and error test, this workflow ensemble the feature selection and classifier selection. The feature this study utilized were normalized difference vegetation index (NDVI) change, textural feature derived from the gray level co-occurrence matrices (GLCM), spectral feature and etc. The improvement of this study shows this algorithm significantly removes some redundant feature and the classifiers get fully used. All these improvements lead to a higher accuracy on the determination of the shape of landslides on the high resolution remote sensing image, in particular the flexibility aimed at different kinds of landslides.

  1. Virtual overlay metrology for fault detection supported with integrated metrology and machine learning

    Science.gov (United States)

    Lee, Hong-Goo; Schmitt-Weaver, Emil; Kim, Min-Suk; Han, Sang-Jun; Kim, Myoung-Soo; Kwon, Won-Taik; Park, Sung-Ki; Ryan, Kevin; Theeuwes, Thomas; Sun, Kyu-Tae; Lim, Young-Wan; Slotboom, Daan; Kubis, Michael; Staecker, Jens

    2015-03-01

    While semiconductor manufacturing moves toward the 7nm node for logic and 15nm node for memory, an increased emphasis has been placed on reducing the influence known contributors have toward the on product overlay budget. With a machine learning technique known as function approximation, we use a neural network to gain insight to how known contributors, such as those collected with scanner metrology, influence the on product overlay budget. The result is a sufficiently trained function that can approximate overlay for all wafers exposed with the lithography system. As a real world application, inline metrology can be used to measure overlay for a few wafers while using the trained function to approximate overlay vector maps for the entire lot of wafers. With the approximated overlay vector maps for all wafers coming off the track, a process engineer can redirect wafers or lots with overlay signatures outside the standard population to offline metrology for excursion validation. With this added flexibility, engineers will be given more opportunities to catch wafers that need to be reworked, resulting in improved yield. The quality of the derived corrections from measured overlay metrology feedback can be improved using the approximated overlay to trigger, which wafers should or shouldn't be, measured inline. As a development or integration engineer the approximated overlay can be used to gain insight into lots and wafers used for design of experiments (DOE) troubleshooting. In this paper we will present the results of a case study that follows the machine learning function approximation approach to data analysis, with production overlay measured on an inline metrology system at SK hynix.

  2. Emotion detection deficits and changes in personality traits linked to loss of white matter integrity in primary progressive aphasia

    Directory of Open Access Journals (Sweden)

    Namita Multani

    2017-01-01

    Full Text Available Non-cognitive features including personality changes are increasingly recognized in the three PPA variants (semantic-svPPA, non fluent-nfvPPA, and logopenic-lvPPA. However, differences in emotion processing among the PPA variants and its association with white matter tracts are unknown. We compared emotion detection across the three PPA variants and healthy controls (HC, and related them to white matter tract integrity and cortical degeneration. Personality traits in the PPA group were also examined in relation to white matter tracts. Thirty-three patients with svPPA, nfvPPA, lvPPA, and 32 HC underwent neuropsychological assessment, emotion evaluation task (EET, and MRI scan. Patients' study partners were interviewed on the Clinical Dementia Rating Scale (CDR and completed an interpersonal traits assessment, the Interpersonal Adjective Scale (IAS. Diffusion tensor imaging of uncinate fasciculus (UF, superior longitudinal fasciculus (SLF and inferior longitudinal fasciculus (ILF, and voxel-based morphometry to derive gray matter volumes for orbitofrontal cortex (OFC, anterior temporal lobe (ATL regions were performed. In addition, gray matter volumes of white matter tract-associated regions were also calculated: inferior frontal gyrus (IFG, posterior temporal lobe (PTL, inferior parietal lobe (IPL and occipital lobe (OL. ANCOVA was used to compare EET performance. Partial correlation and multivariate linear regression were conducted to examine association between EET and neuroanatomical regions affected in PPA. All three variants of PPA performed significantly worse than HC on EET, and the svPPA group was least accurate at recognizing emotions. Performance on EET was related to the right UF, SLF, and ILF integrity. Regression analysis revealed EET performance primarily relates to the right UF integrity. The IAS subdomain, cold-hearted, was also associated with right UF integrity. Disease-specific emotion recognition and personality changes occur

  3. Detection and location of OP-degrading activity: A model to integrate education and research.

    Science.gov (United States)

    Iyer, Rupa; Smith, Kevin; Kudrle, Bill; Leon, Alex

    2015-06-25

    innovative method for integrating education and research. In addition, the versatility of the ESRM itself provides for easy and rapid adaptation into varying environmental science courses with significant potential for the discovery and isolation of new and unique organisms to be used as part of ongoing research in the laboratory. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Integrated services to support detection, prevention and planning of the agricultural-forest-rural land against fires

    Science.gov (United States)

    Scipioni, A.; Tagliaferri, F.

    2009-04-01

    Objective of the document is to define lines of development and distribution of the services to support detection, prevention and planning of the agricultural-forest-rural land against fire. The services will be a valid support on hand of the Regional and National Administrations involved in the agricultural-forest-rural activities (Ministry of Agricultural and Forestry Policies, National Forest Police, ecc..), through the employment of the SIAN "National Agricultural Informative System", that is the integrated national information system for the entire agriculture, forestry and fisheries Administration. The services proposals would be distributed through the GIS (Geographic Information Systems) of the SIAN: the GIS database is a single nation-wide digital graphic database consisting of: - Ortophotos: Aerial images of approz. 45 km2 each with ground resolution of 50 cm; - Cadastral maps: Land maps; - Thematic layers: Land use and crops identification The GIS services can take full advantage of the benefits of SIAN architectural model designed for best integration and interoperability with other Central and Local P.A. bodies whose main items are: - Integration of information from different sources; - Maintainance of the internal coeherence of any integrated information; - Flexibility with respect to technical or organizational changes The "innovative "services described below could be useful to support the development of institutional tasks of public Agencies and Administrations (es. Regions or Civil Protection agencies) according to than previewed from the D.Lgs. 173/98. Services of support to the management of the phenomenon of wildland fires The activities outlined in below figure, don't have a linear and defined temporal sequence, but a dynamic and time integration. It guarantees not only the integrated use of the various information, but also the value of every product, for level of accuracy, coherence and timeliness of the information. Description of four main

  5. A novel Silicon Photomultiplier with bulk integrated quench resistors: utilization in optical detection and tracking applications for particle physics

    Energy Technology Data Exchange (ETDEWEB)

    Petrovics, Stefan, E-mail: stp@hll.mpg.de [Halbleiterlabor der Max-Planck Gesellschaft, Otto-Hahn-Ring 6, D-81739 Munich (Germany); Andricek, Ladislav [Halbleiterlabor der Max-Planck Gesellschaft, Otto-Hahn-Ring 6, D-81739 Munich (Germany); Diehl, Inge; Hansen, Karsten [DESY, Notkestrasse 85, D-22607 Hamburg (Germany); Jendrysik, Christian [Infineon Technologies AG, Am Campeon 1-12, D-85579 Neubiberg (Germany); Krueger, Katja [DESY, Notkestrasse 85, D-22607 Hamburg (Germany); Lehmann, Raik; Ninkovic, Jelena [Halbleiterlabor der Max-Planck Gesellschaft, Otto-Hahn-Ring 6, D-81739 Munich (Germany); Reckleben, Christian [DESY, Notkestrasse 85, D-22607 Hamburg (Germany); Richter, Rainer; Schaller, Gerhard; Schopper, Florian [Halbleiterlabor der Max-Planck Gesellschaft, Otto-Hahn-Ring 6, D-81739 Munich (Germany); Sefkow, Felix [DESY, Notkestrasse 85, D-22607 Hamburg (Germany)

    2017-02-11

    Silicon Photomultipliers (SiPMs) are a promising candidate for replacing conventional photomultiplier tubes (PMTs) in many applications, thanks to ongoing developments and advances in their technology. Conventional SiPMs are generally an array of avalanche photo diodes, operated in Geiger mode and read out in parallel, thus leading to the necessity of a high ohmic quenching resistor. This resistor enables passive quenching and is usually located on top of the array, limiting the fill factor of the device. In this paper, a novel detector concept with a bulk integrated quenching resistor will be recapped. In addition, due to other advantages of this novel detector design, a new concept, in which these devices will be utilized as tracking detectors for particle physics applications will be introduced, as well as first simulation studies and experimental measurements of this new approach. - Highlights: • A novel SiPM concept with bulk integrated quenching resistor is shown. • First prototypes of these SiPMs as tracking detectors are proposed. • Simulations of the Geiger efficiency suggest feasible operations at low overbias. • First measurements of the electron detection efficiency show promising results. • Measurements are in good agreement with the simulations.

  6. Prospects for detection of intermediate-mass black holes in globular clusters using integrated-light spectroscopy

    Science.gov (United States)

    de Vita, R.; Trenti, M.; Bianchini, P.; Askar, A.; Giersz, M.; van de Ven, G.

    2017-06-01

    The detection of intermediate-mass black holes (IMBHs) in Galactic globular clusters (GCs) has so far been controversial. In order to characterize the effectiveness of integrated-light spectroscopy through integral field units, we analyse realistic mock data generated from state-of-the-art Monte Carlo simulations of GCs with a central IMBH, considering different setups and conditions varying IMBH mass, cluster distance and accuracy in determination of the centre. The mock observations are modelled with isotropic Jeans models to assess the success rate in identifying the IMBH presence, which we find to be primarily dependent on IMBH mass. However, even for an IMBH of considerable mass (3 per cent of the total GC mass), the analysis does not yield conclusive results in one out of five cases, because of shot noise due to bright stars close to the IMBH line of sight. This stochastic variability in the modelling outcome grows with decreasing BH mass, with approximately three failures out of four for IMBHs with 0.1 per cent of total GC mass. Finally, we find that our analysis is generally unable to exclude at 68 per cent confidence an IMBH with mass of 103 M⊙ in snapshots without a central BH. Interestingly, our results are not sensitive to GC distance within 5-20 kpc, nor to misidentification of the GC centre by less than 2 arcsec (<20 per cent of the core radius). These findings highlight the value of ground-based integral field spectroscopy for large GC surveys, where systematic failures can be accounted for, but stress the importance of discrete kinematic measurements that are less affected by stochasticity induced by bright stars.

  7. Instrumentation and signal processing for the detection of heavy water using off axis-integrated cavity output spectroscopy technique

    Science.gov (United States)

    Gupta, A.; Singh, P. J.; Gaikwad, D. Y.; Udupa, D. V.; Topkar, A.; Sahoo, N. K.

    2018-02-01

    An experimental setup is developed for the trace level detection of heavy water (HDO) using the off axis-integrated cavity output spectroscopy technique. The absorption spectrum of water samples is recorded in the spectral range of 7190.7 cm-1-7191.5 cm-1 with the diode laser as the light source. From the recorded water vapor absorption spectrum, the heavy water concentration is determined from the HDO and water line. The effect of cavity gain nonlinearity with per pass absorption is studied. The signal processing and data fitting procedure is devised to obtain linear calibration curves by including nonlinear cavity gain effects into the calculation. Initial calibration of mirror reflectivity is performed by measurements on the natural water sample. The signal processing and data fitting method has been validated by the measurement of the HDO concentration in water samples over a wide range from 20 ppm to 2280 ppm showing a linear calibration curve. The average measurement time is about 30 s. The experimental technique presented in this paper could be applied for the development of a portable instrument for the fast measurement of water isotopic composition in heavy water plants and for the detection of heavy water leak in pressurized heavy water reactors.

  8. Integrating nanohybrid membranes of reduced graphene oxide: chitosan: silica sol gel with fiber optic SPR for caffeine detection

    Science.gov (United States)

    Kant, Ravi; Tabassum, Rana; Gupta, Banshi D.

    2017-05-01

    Caffeine is the most popular psychoactive drug consumed in the world for improving alertness and enhancing wakefulness. However, caffeine consumption beyond limits can result in lot of physiological complications in human beings. In this work, we report a novel detection scheme for caffeine integrating nanohybrid membranes of reduced graphene oxide (rGO) in chitosan modified silica sol gel (rGO: chitosan: silica sol gel) with fiber optic surface plasmon resonance. The chemically synthesized nanohybrid membrane forming the sensing route has been dip coated over silver coated unclad central portion of an optical fiber. The sensor works on the mechanism of modification of dielectric function of sensing layer on exposure to analyte solution which is manifested in terms of red shift in resonance wavelength. The concentration of rGO in polymer network of chitosan and silica sol gel and dipping time of the silver coated probe in the solution of nanohybrid membrane have been optimized to extricate the supreme performance of the sensor. The optimized sensing probe possesses a reasonably good sensitivity and follows an exponentially declining trend within the entire investigating range of caffeine concentration. The sensor boasts of an unparalleled limit of detection value of 1.994 nM and works well in concentration range of 0-500 nM with a response time of 16 s. The impeccable sensor methodology adopted in this work combining fiber optic SPR with nanotechnology furnishes a novel perspective for caffeine determination in commercial foodstuffs and biological fluids.

  9. A lab-on-a-chip system with integrated sample preparation and loop-mediated isothermal amplification for rapid and quantitative detection of Salmonella spp. in food samples

    DEFF Research Database (Denmark)

    Sun, Yi; Than Linh, Quyen; Hung, Tran Quang

    2015-01-01

    was capable to detect Salmonella at concentration of 50 cells per test within 40 min. The simple design, together with high level of integration, isothermal amplification, and quantitative analysis of multiple samples in short time will greatly enhance the practical applicability of the LOC system for rapid...... amplification (LAMP) for rapid and quantitative detection of Salmonella spp. in food samples. The whole diagnostic procedures including DNA isolation, isothermal amplification, and real-time detection were accomplished in a single chamber. Up to eight samples could be handled simultaneously and the system...... and usually take a few hours to days to complete. In response to the demand for rapid on line or at site detection of pathogens, in this study, we describe for the first time an eight-chamber lab-on-a-chip (LOC) system with integrated magnetic beads-based sample preparation and loop-mediated isothermal...

  10. Integrating Radarsat-2, Lidar, and Worldview-3 Imagery to maximize detection of forested inundation extent in the Delmarva Peninsula, USA

    Science.gov (United States)

    Vanderhoof, Melanie; Distler, Hayley; Mendiola, Di Ana; Lang, Megan

    2017-01-01

    Natural variability in surface-water extent and associated characteristics presents a challenge to gathering timely, accurate information, particularly in environments that are dominated by small and/or forested wetlands. This study mapped inundation extent across the Upper Choptank River Watershed on the Delmarva Peninsula, occurring within both Maryland and Delaware. We integrated six quad-polarized Radarsat-2 images, Worldview-3 imagery, and an enhanced topographic wetness index in a random forest model. Output maps were filtered using light detection and ranging (lidar)-derived depressions to maximize the accuracy of forested inundation extent. Overall accuracy within the integrated and filtered model was 94.3%, with 5.5% and 6.0% errors of omission and commission for inundation, respectively. Accuracy of inundation maps obtained using Radarsat-2 alone were likely detrimentally affected by less than ideal angles of incidence and recent precipitation, but were likely improved by targeting the period between snowmelt and leaf-out for imagery collection. Across the six Radarsat-2 dates, filtering inundation outputs by lidar-derived depressions slightly elevated errors of omission for water (+1.0%), but decreased errors of commission (−7.8%), resulting in an average increase of 5.4% in overall accuracy. Depressions were derived from lidar datasets collected under both dry and average wetness conditions. Although antecedent wetness conditions influenced the abundance and total area mapped as depression, the two versions of the depression datasets showed a similar ability to reduce error in the inundation maps. Accurate mapping of surface water is critical to predicting and monitoring the effect of human-induced change and interannual variability on water quantity and quality.

  11. A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection

    OpenAIRE

    Zuo, Peng; Li, XiuJun; Dominguez, Delfina C.; Ye, Bang-Ce

    2013-01-01

    Infectious pathogens often cause serious public health concerns throughout the world. There is an increasing demand for simple, rapid and sensitive approaches for multiplexed pathogen detection. In this paper we have developed a polydimethylsiloxane (PDMS)/paper/glass hybrid microfluidic system integrated with aptamer-functionalized graphene oxide (GO) nano-biosensors for simple, one-step, multiplexed pathogen detection. The paper substrate used in this hybrid microfluidic system facilitated ...

  12. Integration of airborne optical and thermal imagery for archaeological subsurface structures detection: the Arpi case study (Italy)

    Science.gov (United States)

    Bassani, C.; Cavalli, R. M.; Fasulli, L.; Palombo, A.; Pascucci, S.; Santini, F.; Pignatti, S.

    2009-04-01

    archaeological area (southern Italy). We identify, for the selected sites, three main land cover overlying the buried structures: (a) photosynthetic (i.e. green low vegetation), (b) non-photosynthetic vegetation (i.e. yellow, dry low vegetation), and (c) dry bare soil. Afterwards, we analyse the spectral regions showing an inherent potential for the archaeological detection as a function of the land cover characteristics. The classified land cover units have been used in a spectral mixture analysis to assess the land cover fractional abundance surfacing the buried structures (i.e. mark-background system). The classification and unmixing results for the CASI, MIVIS and ATM remote sensing data processing showed a good accordance both in the land cover units and in the subsurface structures identification. The integrated analysis of the unmixing results for the three sensors allowed us to establish that for the land cover characterized by green and dry vegetation (occurrence higher than 75%), the visible and near infrared (VNIR) spectral regions better enhance the buried man-made structures. In particular, if the structures are covered by more than 75% of vegetation the two most promising wavelengths for their detection are the chlorophyll peak at 0.56 m (Visible region) and the red edge region (0.67 to 0.72 m; NIR region). This result confirms that the variation induced by the subsurface structures (e.g., stone walls, tile concentrations, pavements near the surface, road networks) to the natural vegetation growth and/or colour (i.e., for different stress factors) is primarily detectable by the chlorophyll peak and the red edge region applied for the vegetation stress detection. Whereas, if dry soils cover the structures (occurrence higher than 75%), both the VNIR and thermal infrared (TIR) regions are suitable to detect the subsurface structures. This work demonstrates that airborne reflectances and emissivities data, even though at different spatial/spectral resolutions and

  13. Detecting PHG frames in wireless capsule endoscopy video by integrating rough global dominate-color with fine local texture features

    Science.gov (United States)

    Liu, Xiaoqi; Wang, Chengliang; Bai, Jianying; Liao, Guobin

    2018-02-01

    Portal hypertensive gastropathy (PHG) is common in gastrointestinal (GI) diseases, and a severe stage of PHG (S-PHG) is a source of gastrointestinal active bleeding. Generally, the diagnosis of PHG is made visually during endoscopic examination; compared with traditional endoscopy, (wireless capsule endoscopy) WCE with noninvasive and painless is chosen as a prevalent tool for visual observation of PHG. However, accurate measurement of WCE images with PHG is a difficult task due to faint contrast and confusing variations in background gastric mucosal tissue for physicians. Therefore, this paper proposes a comprehensive methodology to automatically detect S-PHG images in WCE video to help physicians accurately diagnose S-PHG. Firstly, a rough dominatecolor-tone extraction approach is proposed for better describing global color distribution information of gastric mucosa. Secondly, a hybrid two-layer texture acquisition model is designed by integrating co-occurrence matrix into local binary pattern to depict complex and unique gastric mucosal microstructure local variation. Finally, features of mucosal color and microstructure texture are merged into linear support vector machine to accomplish this automatic classification task. Experiments were implemented on an annotated data set including 1,050 SPHG and 1,370 normal images collected from 36 real patients of different nationalities, ages and genders. By comparison with three traditional texture extraction methods, our method, combined with experimental results, performs best in detection of S-PHG images in WCE video: the maximum of accuracy, sensitivity and specificity reach 0.90, 0.92 and 0.92 respectively.

  14. Airborne Measurements of CO2 Column Absorption and Range Using a Pulsed Direct-Detection Integrated Path Differential Absorption Lidar

    Science.gov (United States)

    Abshire, James B.; Riris, Haris; Weaver, Clark J.; Mao, Jianping; Allan, Graham R.; Hasselbrack, William E.; Browell, Edward V.

    2013-01-01

    We report on airborne CO2 column absorption measurements made in 2009 with a pulsed direct-detection lidar operating at 1572.33 nm and utilizing the integrated path differential absorption technique. We demonstrated these at different altitudes from an aircraft in July and August in flights over four locations in the central and eastern United States. The results show clear CO2 line shape and absorption signals, which follow the expected changes with aircraft altitude from 3 to 13 km. The lidar measurement statistics were also calculated for each flight as a function of altitude. The optical depth varied nearly linearly with altitude, consistent with calculations based on atmospheric models. The scatter in the optical depth measurements varied with aircraft altitude as expected, and the median measurement precisions for the column varied from 0.9 to 1.2 ppm. The altitude range with the lowest scatter was 810 km, and the majority of measurements for the column within it had precisions between 0.2 and 0.9 ppm.

  15. Automated detection of fluorescent cells in in-resin fluorescence sections for integrated light and electron microscopy.

    Science.gov (United States)

    Delpiano, J; Pizarro, L; Peddie, C J; Jones, M L; Griffin, L D; Collinson, L M

    2018-04-26

    Integrated array tomography combines fluorescence and electron imaging of ultrathin sections in one microscope, and enables accurate high-resolution correlation of fluorescent proteins to cell organelles and membranes. Large numbers of serial sections can be imaged sequentially to produce aligned volumes from both imaging modalities, thus producing enormous amounts of data that must be handled and processed using novel techniques. Here, we present a scheme for automated detection of fluorescent cells within thin resin sections, which could then be used to drive automated electron image acquisition from target regions via 'smart tracking'. The aim of this work is to aid in optimization of the data acquisition process through automation, freeing the operator to work on other tasks and speeding up the process, while reducing data rates by only acquiring images from regions of interest. This new method is shown to be robust against noise and able to deal with regions of low fluorescence. © 2018 The Authors. Journal of Microscopy published by JohnWiley & Sons Ltd on behalf of Royal Microscopical Society.

  16. Integrating Flexible Sensor and Virtual Self-Organizing DC Grid Model With Cloud Computing for Blood Leakage Detection During Hemodialysis.

    Science.gov (United States)

    Huang, Ping-Tzan; Jong, Tai-Lang; Li, Chien-Ming; Chen, Wei-Ling; Lin, Chia-Hung

    2017-08-01

    Blood leakage and blood loss are serious complications during hemodialysis. From the hemodialysis survey reports, these life-threatening events occur to attract nephrology nurses and patients themselves. When the venous needle and blood line are disconnected, it takes only a few minutes for an adult patient to lose over 40% of his / her blood, which is a sufficient amount of blood loss to cause the patient to die. Therefore, we propose integrating a flexible sensor and self-organizing algorithm to design a cloud computing-based warning device for blood leakage detection. The flexible sensor is fabricated via a screen-printing technique using metallic materials on a soft substrate in an array configuration. The self-organizing algorithm constructs a virtual direct current grid-based alarm unit in an embedded system. This warning device is employed to identify blood leakage levels via a wireless network and cloud computing. It has been validated experimentally, and the experimental results suggest specifications for its commercial designs. The proposed model can also be implemented in an embedded system.

  17. 3C 279 IN OUTBURST IN 2015 JUNE: A BROADBAND SED STUDY BASED ON THE INTEGRAL DETECTION

    Energy Technology Data Exchange (ETDEWEB)

    Bottacini, Eugenio [W.W. Hansen Experimental Physics Laboratory and Kavli Institute for Particle Astrophysics and Cosmology, Stanford University (United States); Böttcher, Markus [Centre for Space Research, North-West University, Potchefstroom 2531 (South Africa); Pian, Elena [INAF, Istituto di Astrofisica Spaziale e Fisica Cosmica, via P. Gobetti 101, I-40129 Bologna (Italy); Collmar, Werner, E-mail: eugenio.bottacini@stanford.edu [Max-Planck-Institut für extraterrestrische Physik, Giessenbach, D-85748 Garching (Germany)

    2016-11-20

    Blazars radiate from radio through gamma-ray frequencies and thereby make ideal targets for multifrequency studies. Such studies allow the properties of the emitting jet to be constrained. 3C 279 is among the most notable blazars and therefore subject to extensive multifrequency campaigns. We report the results of a campaign ranging from near-IR to gamma-ray energies that targeted an outburst of 3C 279 in 2015 June. The campaign pivots around the detection in only 50 ks by INTEGRAL , whose IBIS/ISGRI data pin down the high-energy component of the spectral energy distribution (SED) between Swift -XRT data and Fermi -LAT data. The overall SED from near-IR to gamma rays can be well represented by either a leptonic or a lepto-hadronic radiation transfer model. Even though the data are equally well represented by the two models, their inferred parameters challenge the physical conditions in the jet. In fact, the leptonic model requires parameters with a magnetic field far below equipartition with the relativistic particle energy density. In contrast, equipartition may be achieved with the lepto-hadronic model, although this implies an extreme total jet power close to the Eddington luminosity.

  18. Sorbent Film-Coated Passive Samplers for Explosives Vapour Detection Part A: Materials Optimisation and Integration with Analytical Technologies.

    Science.gov (United States)

    McEneff, Gillian L; Murphy, Bronagh; Webb, Tony; Wood, Dan; Irlam, Rachel; Mills, Jim; Green, David; Barron, Leon P

    2018-04-11

    A new thin-film passive sampler is presented as a low resource dependent and discrete continuous monitoring solution for explosives-related vapours. Using 15 mid-high vapour pressure explosives-related compounds as probes, combinations of four thermally stable substrates and six film-based sorbents were evaluated. Meta-aramid and phenylene oxide-based materials showed the best recoveries from small voids (~70%). Analysis was performed using liquid chromatography-high resolution accurate mass spectrometry which also enabled tentative identification of new targets from the acquired data. Preliminary uptake kinetics experiments revealed plateau concentrations on the device were reached between 3-5 days. Compounds used in improvised explosive devices, such as triacetone triperoxide, were detected within 1 hour and were stably retained by the sampler for up to 7 days. Sampler performance was consistent for 22 months after manufacture. Lastly, its direct integration with currently in-service explosives screening equipment including ion mobility spectrometry and thermal desorption mass spectrometry is presented. Following exposure to several open environments and targeted interferences, sampler performance was subsequently assessed and potential interferences identified. High-security building and area monitoring for concealed explosives using such cost-effective and discrete passive samplers can add extra assurance to search routines while minimising any additional burden on personnel or everyday site operation.

  19. Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies

    Science.gov (United States)

    A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

  20. Silicon photonic integrated circuit swept-source optical coherence tomography receiver with dual polarization, dual balanced, in-phase and quadrature detection.

    Science.gov (United States)

    Wang, Zhao; Lee, Hsiang-Chieh; Vermeulen, Diedrik; Chen, Long; Nielsen, Torben; Park, Seo Yeon; Ghaemi, Allan; Swanson, Eric; Doerr, Chris; Fujimoto, James

    2015-07-01

    Optical coherence tomography (OCT) is a widely used three-dimensional (3D) optical imaging method with many biomedical and non-medical applications. Miniaturization, cost reduction, and increased functionality of OCT systems will be critical for future emerging clinical applications. We present a silicon photonic integrated circuit swept-source OCT (SS-OCT) coherent receiver with dual polarization, dual balanced, in-phase and quadrature (IQ) detection. We demonstrate multiple functional capabilities of IQ polarization resolved detection including: complex-conjugate suppressed full-range OCT, polarization diversity detection, and polarization-sensitive OCT. To our knowledge, this is the first demonstration of a silicon photonic integrated receiver for OCT. The integrated coherent receiver provides a miniaturized, low-cost solution for SS-OCT, and is also a key step towards a fully integrated high speed SS-OCT system with good performance and multi-functional capabilities. With further performance improvement and cost reduction, photonic integrated technology promises to greatly increase penetration of OCT systems in existing applications and enable new applications.

  1. Integration of computer-aided diagnosis/detection (CAD) results in a PACS environment using CAD-PACS toolkit and DICOM SR

    International Nuclear Information System (INIS)

    Le, Anh H.T.; Liu, Brent; Huang, H.K.

    2009-01-01

    Picture Archiving and Communication System (PACS) is a mature technology in health care delivery for daily clinical imaging service and data management. Computer-aided detection and diagnosis (CAD) utilizes computer methods to obtain quantitative measurements from medical images and clinical information to assist clinicians to assess a patient's clinical state more objectively. CAD needs image input and related information from PACS to improve its accuracy; and PACS benefits from CAD results online and available at the PACS workstation as a second reader to assist physicians in the decision making process. Currently, these two technologies remain as two separate independent systems with only minimal system integration. This paper describes a universal method to integrate CAD results with PACS in its daily clinical environment. The method is based on Health Level 7 (HL7) and Digital imaging and communications in medicine (DICOM) standards, and Integrating the Healthcare Enterprise (IHE) workflow profiles. In addition, the integration method is Health Insurance Portability and Accountability Act (HIPAA) compliant. The paper presents (1) the clinical value and advantages of integrating CAD results in a PACS environment, (2) DICOM Structured Reporting formats and some important IHE workflow profiles utilized in the system integration, (3) the methodology using the CAD-PACS integration toolkit, and (4) clinical examples with step-by-step workflows of this integration. (orig.)

  2. Additional value of integrated PET-CT in the detection and characterization of lung metastases: correlation with CT alone and PET alone

    International Nuclear Information System (INIS)

    Wever, W. de; Meylaerts, L.; Verschakelen, J.A.; Ceuninck, L. de; Stroobants, S.

    2007-01-01

    The purpose was evaluating retrospectively the additional value of integrated positron emission tomography (PET) and computed tomography (CT) in the detection of pulmonary metastases in comparison with CT and PET alone. Fifty-six lung nodules, divided into three groups according their size, detected in 24 consecutive patients with a known primary tumor were retrospectively evaluated with integrated PET-CT, CT and PET. The nature of these nodules was determined by either histopathology or a follow-up of at least 6 months. The CT and PET images of the integrated PET-CT were evaluated separately by a radiologist and a nuclear medicine physician, the integrated PET-CT images were evaluated by a chest radiologist and nuclear medicine physician in consensus. The investigators were asked to search lung nodules and to determine whether these nodules were metastases or not. Sensitivity and accuracy for CT, PET and integrated PET-CT for characterization of all pulmonary nodules were, respectively: 100%, 90%, 100% and 57%, 55%, 55%. There was no significant difference in the characterization of pulmonary nodules between integrated PET-CT and CT alone (P=1.000) and PET alone (P=0.1306). An accurate evaluation is only possible for lesions larger than 1 cm. (orig.)

  3. Integration of a Graphite/PMMA CompositeElectrode into a Poly(methyl methacrylate) (PMMA) Substrate for Electrochemical Detection in Microchips

    Science.gov (United States)

    Regel, Anne; Lunte, Susan

    2013-01-01

    Traditional fabrication methods for polymer microchips, the bonding of two substrates together to form the microchip, can make the integration of carbon electrodes difficult. We have developed a simple and inexpensive method to integrate graphite/PMMA composite electrodes (GPCEs) into a PMMA substrate. These substrates can be bonded to other PMMA layers using a solvent-assisted thermal bonding method. The optimal composition of the GPCEs for electrochemical detection was determined using cyclic voltammetry with dopamine as a test analyte. Using the optimized GPCEs in an all-PMMA flow cell with flow injection analysis, it was possible to detect 50 nM dopamine under the best conditions. These electrodes were also evaluated for the detection of dopamine and catechol following separation by microchip electrophoresis (ME). PMID:23670816

  4. The Integration of Remote-Sensing Detection Techniques into the Operational Decision-Making of Marine Oil Spills

    Science.gov (United States)

    Garron, J.; Trainor, S.

    2017-12-01

    Remotely-sensed data collected from satellites, airplanes and unmanned aerial systems can be used in marine oil spills to identify the overall footprint, estimate fate and transport, and to identify resources at risk. Mandates for the use of best available technology exists for addressing marine oil spills under the jurisdiction of the USCG (33 CFR 155.1050), though clear pathways to familiarization of these technologies during a marine oil spill, or more importantly, between marine oil spills, does not. Similarly, remote-sensing scientists continue to experiment with highly tuned oil detection, fate and transport techniques that can benefit decision-making during a marine oil spill response, but the process of translating these prototypical tools to operational information remains undefined, leading most researchers to describe the "potential" of these new tools in an operational setting rather than their actual use, and decision-makers relying on traditional field observational methods. Arctic marine oil spills are no different in their mandates and the remote-sensing research undertaken, but are unique via the dark, cold, remote, infrastructure-free environment in which they can occur. These conditions increase the reliance of decision-makers in an Arctic oil spill on remotely-sensed data and tools for their manipulation. In the absence of another large-scale oil spill in the US, and limited literature on the subject, this study was undertaken to understand how remotely-sensed data and tools are being used in the Incident Command System of a marine oil spill now, with an emphasis on Arctic implementation. Interviews, oil spill scenario/drill observations and marine oil spill after action reports were collected and analyzed to determine the current state of remote-sensing data use for decision-making during a marine oil spill, and to define a set of recommendations for the process of integrating new remote-sensing tools and information in future oil spill

  5. Detection of adenoviruses in shellfish by means of conventional-PCR, nested-PCR, and integrated cell culture PCR (ICC/PCR).

    Science.gov (United States)

    Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M

    2005-01-01

    We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.

  6. Pilot Integration of HIV Screening and Healthcare Settings with Multi- Component Social Network and Partner Testing for HIV Detection.

    Science.gov (United States)

    Rentz, Michael F; Ruffner, Andrew H; Ancona, Rachel M; Hart, Kimberly W; Kues, John R; Barczak, Christopher M; Lindsell, Christopher J; Fichtenbaum, Carl J; Lyons, Michael S

    2017-11-23

    Healthcare settings screen broadly for HIV. Public health settings use social network and partner testing ("Transmission Network Targeting (TNT)") to select high-risk individuals based on their contacts. HIV screening and TNT systems are not integrated, and healthcare settings have not implemented TNT. The study aimed to evaluate pilot implementation of multi-component, multi-venue TNT in conjunction with HIV screening by a healthcare setting. Our urban, academic health center implemented a TNT program in collaboration with the local health department for five months during 2011. High-risk or HIV positive patients of the infectious diseases clinic and emergency department HIV screening program were recruited to access social and partner networks via compensated peer-referral, testing of companions present with them, and partner notification services. Contacts became the next-generation index cases in a snowball recruitment strategy. The pilot TNT program yielded 485 HIV tests for 482 individuals through eight generations of recruitment with five (1.0%; 95% CI = 0.4%, 2.3%) new diagnoses. Of these, 246 (51.0%; 95% CI = 46.6%, 55.5%) reported that they had not been tested for HIV within the last 12 months and 383 (79.5%; 95% CI = 75.7%, 82.9%) had not been tested by the existing ED screening program within the last five years. TNT complements population screening by more directly targeting high-risk individuals and by expanding the population receiving testing. Information from existing healthcare services could be used to seed TNT programs, or TNT could be implemented within healthcare settings. Research evaluating multi-component, multi-venue HIV detection is necessary to maximize complementary approaches while minimizing redundancy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  7. Photonics-on-a-chip: recent advances in integrated waveguides as enabling detection elements for real-world, lab-on-a-chip biosensing applications.

    Science.gov (United States)

    Washburn, Adam L; Bailey, Ryan C

    2011-01-21

    By leveraging advances in semiconductor microfabrication technologies, chip-integrated optical biosensors are poised to make an impact as scalable and multiplexable bioanalytical measurement tools for lab-on-a-chip applications. In particular, waveguide-based optical sensing technology appears to be exceptionally amenable to chip integration and miniaturization, and, as a result, the recent literature is replete with examples of chip-integrated waveguide sensing platforms developed to address a wide range of contemporary analytical challenges. As an overview of the most recent advances within this dynamic field, this review highlights work from the last 2-3 years in the areas of grating-coupled, interferometric, photonic crystal, and microresonator waveguide sensors. With a focus towards device integration, particular emphasis is placed on demonstrations of biosensing using these technologies within microfluidically controlled environments. In addition, examples of multiplexed detection and sensing within complex matrices--important features for real-world applicability--are given special attention.

  8. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

    Science.gov (United States)

    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

    2012-04-27

    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

  9. Remote Sensing of Mars: Detection of Impact Craters on the Mars Global Surveyor DTM by Integrating Edge- and Region-Based Algorithms

    Science.gov (United States)

    Athanassas, C. D.; Vaiopoulos, A.; Kolokoussis, P.; Argialas, D.

    2018-03-01

    This study integrates two different computer vision approaches, namely the circular Hough transform (CHT) and the determinant of Hessian (DoH), to detect automatically the largest number possible of craters of any size on the digital terrain model (DTM) generated by the Mars Global Surveyor mission. Specifically, application of the standard version of CHT to the DTM captured a great number of craters with diameter smaller than 50 km only, failing to capture larger craters. On the other hand, DoH was successful in detecting craters that were undetected by CHT, but its performance was deterred by the irregularity of the topographic surface encompassed: strongly undulated and inclined (trended) topographies hindered crater detection. When run on a de-trended DTM (and keeping the topology unaltered) DoH scored higher. Current results, although not optimal, encourage combined use of CHT and DoH for routine crater detection undertakings.

  10. Enteroviruses in blood of patients with type 1 diabetes detected by integrated cell culture and reverse transcription quantitative real-time PCR.

    Science.gov (United States)

    Alidjinou, Enagnon Kazali; Sane, Famara; Lefevre, Christine; Baras, Agathe; Moumna, Ilham; Engelmann, Ilka; Vantyghem, Marie-Christine; Hober, Didier

    2017-11-01

    Enteroviruses (EV) have been associated with type 1 diabetes (T1D), but EV RNA detection has been reported in only a small proportion of T1D patients. We studied whether integrated cell culture and reverse transcription real-time PCR could improve EV detection in blood samples from patients with T1D. Blood was collected from 13 patients with T1D. The presence of EV RNA in blood was investigated by using real-time RT-PCR. In addition, plasma and white blood cells (WBC) were inoculated to BGM and Vero cell line cultures. Culture supernatants and cells collected on day 7 and day 14 were tested for EV RNA by real-time RT-PCR. Enterovirus identification was performed through sequencing of the VP4/VP2 region. Enterovirus RNA was detected in blood by using real-time RT-PCR in only one out of 13 patients. The detection of EV RNA in cultures inoculated with clinical samples (plasma and/or WBC) gave positive results in five other patients. The viral loads were low, ranging from 45 to 4420 copies/ng of total RNA. One isolate was successfully identified as coxsackievirus B1. Integrated cell culture and reverse transcription real-time PCR can improve the detection rate of EV in blood samples of patients with T1D and can be useful to investigate further the relationship between EV and the disease.

  11. A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection.

    Science.gov (United States)

    Zuo, Peng; Li, XiuJun; Dominguez, Delfina C; Ye, Bang-Ce

    2013-10-07

    Infectious pathogens often cause serious public health concerns throughout the world. There is an increasing demand for simple, rapid and sensitive approaches for multiplexed pathogen detection. In this paper we have developed a polydimethylsiloxane (PDMS)/paper/glass hybrid microfluidic system integrated with aptamer-functionalized graphene oxide (GO) nano-biosensors for simple, one-step, multiplexed pathogen detection. The paper substrate used in this hybrid microfluidic system facilitated the integration of aptamer biosensors on the microfluidic biochip, and avoided complicated surface treatment and aptamer probe immobilization in a PDMS or glass-only microfluidic system. Lactobacillus acidophilus was used as a bacterium model to develop the microfluidic platform with a detection limit of 11.0 cfu mL(-1). We have also successfully extended this method to the simultaneous detection of two infectious pathogens - Staphylococcus aureus and Salmonella enterica. This method is simple and fast. The one-step 'turn on' pathogen assay in a ready-to-use microfluidic device only takes ~10 min to complete on the biochip. Furthermore, this microfluidic device has great potential in rapid detection of a wide variety of different other bacterial and viral pathogens.

  12. Tuberculosis detection and the challenges of integrated care in rural China: A cross-sectional standardized patient study.

    Science.gov (United States)

    Sylvia, Sean; Xue, Hao; Zhou, Chengchao; Shi, Yaojiang; Yi, Hongmei; Zhou, Huan; Rozelle, Scott; Pai, Madhukar; Das, Jishnu

    2017-10-01

    Despite recent reductions in prevalence, China still faces a substantial tuberculosis (TB) burden, with future progress dependent on the ability of rural providers to appropriately detect and refer TB patients for further care. This study (a) provides a baseline assessment of the ability of rural providers to correctly manage presumptive TB cases; (b) measures the gap between provider knowledge and practice and; (c) evaluates how ongoing reforms of China's health system-characterized by a movement toward "integrated care" and promotion of initial contact with grassroots providers-will affect the care of TB patients. Unannounced standardized patients (SPs) presenting with classic pulmonary TB symptoms were deployed in 3 provinces of China in July 2015. The SPs successfully completed 274 interactions across all 3 tiers of China's rural health system, interacting with providers in 46 village clinics, 207 township health centers, and 21 county hospitals. Interactions between providers and standardized patients were assessed against international and national standards of TB care. Using a lenient definition of correct management as at least a referral, chest X-ray or sputum test, 41% (111 of 274) SPs were correctly managed. Although there were no cases of empirical anti-TB treatment, antibiotics unrelated to the treatment of TB were prescribed in 168 of 274 interactions or 61.3% (95% CI: 55%-67%). Correct management proportions significantly higher at county hospitals compared to township health centers (OR 0.06, 95% CI: 0.01-0.25, p system, where patients can choose to bypass any level of care, simulations suggest that a system of managed referral with gatekeeping at the level of village clinics would reduce proportions of correct management from 41% to 16%, while gatekeeping at the level of the township hospital would retain correct management close to current levels at 37%. The main limitations of the study are 2-fold. First, we evaluate the management of a one

  13. Spectral states evolution of 4U 1728-34 observed by INTEGRAL and RXTE: non-thermal component detection

    NARCIS (Netherlands)

    Tarana, A.; Belloni, T.; Bazzano, A.; Mendez, M.; Ubertini, P.

    We report results of a one-year monitoring of the low-mass X-ray binary (LMXB) source (atoll type) 4U 1728-34 with INTEGRAL and RXTE. Three time intervals were covered by INTEGRAL, during which the source showed strong spectral evolution. We studied the broad-band X-ray spectra in detail by fitting

  14. Non-destructive vacuum decay method for pre-filled syringe closure integrity testing compared with dye ingress testing and high-voltage leak detection.

    Science.gov (United States)

    Simonetti, Andrea; Amari, Filippo

    2015-01-01

    In reaction to the limitations of the traditional sterility test methods, in 2008, the U.S. Food and Drug Administration issued the guidance "Container and Closure System Integrity Testing in Lieu of Sterility Testing as a Component of the Stability Protocol for Sterile Products" encouraging sterile drug manufacturers to use properly validated physical methods, apart from conventional microbial challenge testing, to confirm container closure integrity as part of the stability protocol. The case study presented in this article investigated the capability of four container closure integrity testing methods to detect simulated defects of different sizes and types on glass syringes, prefilled both with drug product intended for parenteral administration and sterile water. The drug product was a flu vaccine (Agrippal, Novartis Vaccines, Siena, Italy). Vacuum decay, pharmacopoeial dye ingress test, Novartis specific dye ingress test, and high-voltage leak detection were, in succession, the methods involved in the comparative studies. The case study execution was preceded by the preparation of two independent sets of reference prefilled syringes, classified, respectively, as examples of conforming to closure integrity requirements (negative controls) and as defective (positive controls). Positive controls were, in turn, split in six groups, three of with holes laser-drilled through the prefilled syringe glass barrel, while the other three with capillary tubes embedded in the prefilled syringe plunger. These reference populations were then investigated by means of validated equipment used for container closure integrity testing of prefilled syringe commercial production; data were collected and analyzed to determine the detection rate and the percentage of false results. Results showed that the vacuum decay method had the highest performance in terms of detection sensitivity and also ensured the best reliability and repeatability of measurements. An innovative technical

  15. DEVELOPMENT OF AN INTEGRATED CELL CULTURE/RT-PCR METHOD FOR THE DETECTION OF ENTEROVIRUS IN WATER

    Science.gov (United States)

    Virus contamination in environmental samples is believed to be underestimated due to the limitations in the methods available for detection. A major detection method is based upon the formation of cytopathic effect (CPE) in cell culture. The main limitations to this method are ...

  16. Point-of-care detection and real-time monitoring of intravenously delivered drugs via tubing with an integrated SERS sensor.

    Science.gov (United States)

    Wu, Hsin-Yu; Cunningham, Brian T

    2014-05-21

    We demonstrate an approach for detection, identification, and kinetic monitoring of drugs flowing within tubing, through the use of a plasmonic nanodome array (PNA) surface. The PNA structures are fabricated using a low-cost nanoreplica molding process upon a flexible plastic substrate that is subsequently integrated with a flow cell that connects in series with ordinary intravenous (IV) drug delivery tubing. To investigate the potential clinical applications for point-of-care detection and real-time monitoring, we perform SERS detection of ten pharmaceutical compounds (hydrocodone, levorphanol, morphine, oxycodone, methadone, phenobarbital, dopamine, diltiazem, promethazine, and mitoxantrone). We demonstrate dose-dependent SERS signal magnitude, resulting in detection limits (ng ml(-1)) well below typical administered dosages (mg ml(-1)). Further, we show that the detected drugs are not permanently attached to the PNA surface, and thus our approach is capable of performing continuous monitoring of drug delivery as materials flow through IV tubing that is connected in series with the sensor. Finally, we demonstrate the potential co-detection of multiple drugs when they are mixed together, and show excellent reproducibility and stability of SERS measurements for periods extending at least five days. The capabilities reported here demonstrate the potential to use PNA SERS surfaces for enhancing the safety of IV drug delivery.

  17. Deconstruction of spatial integrity in visual stimulus detected by modulation of synchronized activity in cat visual cortex.

    Science.gov (United States)

    Zhou, Zhiyi; Bernard, Melanie R; Bonds, A B

    2008-04-02

    Spatiotemporal relationships among contour segments can influence synchronization of neural responses in the primary visual cortex. We performed a systematic study to dissociate the impact of spatial and temporal factors in the signaling of contour integration via synchrony. In addition, we characterized the temporal evolution of this process to clarify potential underlying mechanisms. With a 10 x 10 microelectrode array, we recorded the simultaneous activity of multiple cells in the cat primary visual cortex while stimulating with drifting sine-wave gratings. We preserved temporal integrity and systematically degraded spatial integrity of the sine-wave gratings by adding spatial noise. Neural synchronization was analyzed in the time and frequency domains by conducting cross-correlation and coherence analyses. The general association between neural spike trains depends strongly on spatial integrity, with coherence in the gamma band (35-70 Hz) showing greater sensitivity to the change of spatial structure than other frequency bands. Analysis of the temporal dynamics of synchronization in both time and frequency domains suggests that spike timing synchronization is triggered nearly instantaneously by coherent structure in the stimuli, whereas frequency-specific oscillatory components develop more slowly, presumably through network interactions. Our results suggest that, whereas temporal integrity is required for the generation of synchrony, spatial integrity is critical in triggering subsequent gamma band synchronization.

  18. Forecast-based Integrated Flood Detection System for Emergency Response and Disaster Risk Reduction (Flood-FINDER)

    Science.gov (United States)

    Arcorace, Mauro; Silvestro, Francesco; Rudari, Roberto; Boni, Giorgio; Dell'Oro, Luca; Bjorgo, Einar

    2016-04-01

    Most flood prone areas in the globe are mainly located in developing countries where making communities more flood resilient is a priority. Despite different flood forecasting initiatives are now available from academia and research centers, what is often missing is the connection between the timely hazard detection and the community response to warnings. In order to bridge the gap between science and decision makers, UN agencies play a key role on the dissemination of information in the field and on capacity-building to local governments. In this context, having a reliable global early warning system in the UN would concretely improve existing in house capacities for Humanitarian Response and the Disaster Risk Reduction. For those reasons, UNITAR-UNOSAT has developed together with USGS and CIMA Foundation a Global Flood EWS called "Flood-FINDER". The Flood-FINDER system is a modelling chain which includes meteorological, hydrological and hydraulic models that are accurately linked to enable the production of warnings and forecast inundation scenarios up to three weeks in advance. The system is forced with global satellite derived precipitation products and Numerical Weather Prediction outputs. The modelling chain is based on the "Continuum" hydrological model and risk assessments produced for GAR2015. In combination with existing hydraulically reconditioned SRTM data and 1D hydraulic models, flood scenarios are derived at multiple scales and resolutions. Climate and flood data are shared through a Web GIS integrated platform. First validation of the modelling chain has been conducted through a flood hindcasting test case, over the Chao Phraya river basin in Thailand, using multi temporal satellite-based analysis derived for the exceptional flood event of 2011. In terms of humanitarian relief operations, the EO-based services of flood mapping in rush mode generally suffer from delays caused by the time required for their activation, programming, acquisitions and

  19. Tuberculosis detection and the challenges of integrated care in rural China: A cross-sectional standardized patient study.

    Directory of Open Access Journals (Sweden)

    Sean Sylvia

    2017-10-01

    Full Text Available Despite recent reductions in prevalence, China still faces a substantial tuberculosis (TB burden, with future progress dependent on the ability of rural providers to appropriately detect and refer TB patients for further care. This study (a provides a baseline assessment of the ability of rural providers to correctly manage presumptive TB cases; (b measures the gap between provider knowledge and practice and; (c evaluates how ongoing reforms of China's health system-characterized by a movement toward "integrated care" and promotion of initial contact with grassroots providers-will affect the care of TB patients.Unannounced standardized patients (SPs presenting with classic pulmonary TB symptoms were deployed in 3 provinces of China in July 2015. The SPs successfully completed 274 interactions across all 3 tiers of China's rural health system, interacting with providers in 46 village clinics, 207 township health centers, and 21 county hospitals. Interactions between providers and standardized patients were assessed against international and national standards of TB care. Using a lenient definition of correct management as at least a referral, chest X-ray or sputum test, 41% (111 of 274 SPs were correctly managed. Although there were no cases of empirical anti-TB treatment, antibiotics unrelated to the treatment of TB were prescribed in 168 of 274 interactions or 61.3% (95% CI: 55%-67%. Correct management proportions significantly higher at county hospitals compared to township health centers (OR 0.06, 95% CI: 0.01-0.25, p < 0.001 and village clinics (OR 0.02, 95% CI: 0.0-0.17, p < 0.001. Correct management in tests of knowledge administered to the same 274 physicians for the same case was 45 percentage points (95% CI: 37%-53% higher with 24 percentage points (95% CI: -33% to -15% fewer antibiotic prescriptions. Relative to the current system, where patients can choose to bypass any level of care, simulations suggest that a system of managed

  20. First detection of global dawn-dusk ionospheric current intensities using Ampere's integral law on Orsted orbits

    DEFF Research Database (Denmark)

    Stauning, P.; Primdahl, Fritz

    2000-01-01

    -to-dusk ionospheric current is found to be proportional to the gee-effective solar wind electric field and is around 1 million ampere for a typical solar wind electric field of 2 mV/m. Dividing the Ampere integral into semi-orbit parts has enabled us to show that the hemispherical total current intensities depend......The magnetic measurements by the Orsted satellite in noon-midnight orbits have enabled the derivation of the global dawn-dusk oriented ionospheric currents from an Ampere's law closed loop line integral of the geomagnetic vector field along the satellite track. The globally integrated dawn...... on the respective polar cap conductivities, which relate to the daily and seasonally varying solar illumination. The more illuminated hemisphere conveys up to three times more current from dawn to dusk than does the less illuminated....

  1. Detection of monohydroxylated polycyclic aromatic hydrocarbons in urine and particulate matter using LC separations coupled with integrated SPE and fluorescence detection or coupled with high-resolution time-of-flight mass spectrometry.

    Science.gov (United States)

    Lintelmann, Jutta; Wu, Xiao; Kuhn, Evelyn; Ritter, Sebastian; Schmidt, Claudia; Zimmermann, Ralf

    2018-05-01

    A high-performance liquid chromatographic (HPLC) method with integrated solid-phase extraction for the determination of 1-hydroxypyrene and 1-, 2-, 3-, 4- and 9-hydroxyphenanthrene in urine was developed and validated. After enzymatic treatment and centrifugation of 500 μL urine, 100 μL of the sample was directly injected into the HPLC system. Integrated solid-phase extraction was performed on a selective, copper phthalocyanine modified packing material. Subsequent chromatographic separation was achieved on a pentafluorophenyl core-shell column using a methanol gradient. For quantification, time-programmed fluorescence detection was used. Matrix-dependent recoveries were between 94.8 and 102.4%, repeatability and reproducibility ranged from 2.2 to 17.9% and detection limits lay between 2.6 and 13.6 ng/L urine. A set of 16 samples from normally exposed adults was analyzed using this HPLC-fluorescence detection method. Results were comparable with those reported in other studies. The chromatographic separation of the method was transferred to an ultra-high-performance liquid chromatography pentafluorophenyl core-shell column and coupled to a high-resolution time-of-flight mass spectrometer (HR-TOF-MS). The resulting method was used to demonstrate the applicability of LC-HR-TOF-MS for simultaneous target and suspect screening of monohydroxylated polycyclic aromatic hydrocarbons in extracts of urine and particulate matter. Copyright © 2018 John Wiley & Sons, Ltd.

  2. Rapid molecular detection of invasive species in ballast and harbor water by integrating environmental DNA and light transmission spectroscopy.

    Science.gov (United States)

    Egan, Scott P; Grey, Erin; Olds, Brett; Feder, Jeffery L; Ruggiero, Steven T; Tanner, Carol E; Lodge, David M

    2015-04-07

    Invasive species introduced via the ballast water of commercial ships cause enormous environmental and economic damage worldwide. Accurate monitoring for these often microscopic and morphologically indistinguishable species is challenging but critical for mitigating damages. We apply eDNA sampling, which involves the filtering and subsequent DNA extraction of microscopic bits of tissue suspended in water, to ballast and harbor water sampled during a commercial ship's 1400 km voyage through the North American Great Lakes. Using a lab-based gel electrophoresis assay and a rapid, field-ready light transmission spectroscopy (LTS) assay, we test for the presence of two invasive species: quagga (Dreissena bugensis) and zebra (D. polymorpha) mussels. Furthermore, we spiked a set of uninfested ballast and harbor samples with zebra mussel tissue to further test each assay's detection capabilities. In unmanipulated samples, zebra mussel was not detected, while quagga mussel was detected in all samples at a rate of 85% for the gel assay and 100% for the LTS assay. In the spiked experimental samples, both assays detected zebra mussel in 94% of spiked samples and 0% of negative controls. Overall, these results demonstrate that eDNA sampling is effective for monitoring ballast-mediated invasions and that LTS has the potential for rapid, field-based detection.

  3. Strategy for signaling molecule detection by using an integrated microfluidic device coupled with mass spectrometry to study cell-to-cell communication.

    Science.gov (United States)

    Mao, Sifeng; Zhang, Jie; Li, Haifang; Lin, Jin-Ming

    2013-01-15

    Cell-to-cell communication is a very important physiological behavior in life entity, and most of human behaviors are related to it. Although cell-to-cell communications are attracting much attention and financial support, rare methods have been successfully developed for in vitro cell-to-cell communication study. In this work, we developed a novel method for cell-to-cell communication study on an integrated microdevice, and signaling molecule and metabolites were online-detected by an electrospray ionization-quadrupole-time-of-flight-mass spectrometer (ESI-Q-TOF-MS) after on-chip solid-phase extraction. Moreover, we presented a "Surface Tension Plug" on a microchip to control cell-to-cell communication. The microdevice consists of three functional sections: cell coculture channel, targets pretreatment, and targets detection sections. To verify the feasibility of cell-to-cell communications on the integrated microdevice, we studied the communication between the 293 and the L-02 cells. Epinephrine and glucose were successfully detected using an ESI-Q-TOF-MS with short analysis time (communication study.

  4. Nondestructive Analysis of Tumor-Associated Membrane Protein Integrating Imaging and Amplified Detection in situ Based on Dual-Labeled DNAzyme.

    Science.gov (United States)

    Chen, Xiaoxia; Zhao, Jing; Chen, Tianshu; Gao, Tao; Zhu, Xiaoli; Li, Genxi

    2018-01-01

    Comprehensive analysis of the expression level and location of tumor-associated membrane proteins (TMPs) is of vital importance for the profiling of tumor cells. Currently, two kinds of independent techniques, i.e. ex situ detection and in situ imaging, are usually required for the quantification and localization of TMPs respectively, resulting in some inevitable problems. Methods: Herein, based on a well-designed and fluorophore-labeled DNAzyme, we develop an integrated and facile method, in which imaging and quantification of TMPs in situ are achieved simultaneously in a single system. The labeled DNAzyme not only produces localized fluorescence for the visualization of TMPs but also catalyzes the cleavage of a substrate to produce quantitative fluorescent signals that can be collected from solution for the sensitive detection of TMPs. Results: Results from the DNAzyme-based in situ imaging and quantification of TMPs match well with traditional immunofluorescence and western blotting. In addition to the advantage of two-in-one, the DNAzyme-based method is highly sensitivity, allowing the detection of TMPs in only 100 cells. Moreover, the method is nondestructive. Cells after analysis could retain their physiological activity and could be cultured for other applications. Conclusion: The integrated system provides solid results for both imaging and quantification of TMPs, making it a competitive method over some traditional techniques for the analysis of TMPs, which offers potential application as a toolbox in the future.

  5. Integrating qualitative and quantitative characterization of traditional Chinese medicine injection by high-performance liquid chromatography with diode array detection and tandem mass spectrometry.

    Science.gov (United States)

    Xie, Yuan-yuan; Xiao, Xue; Luo, Juan-min; Fu, Chan; Wang, Qiao-wei; Wang, Yi-ming; Liang, Qiong-lin; Luo, Guo-an

    2014-06-01

    The present study aims to describe and exemplify an integrated strategy of the combination of qualitative and quantitative characterization of a multicomponent mixture for the quality control of traditional Chinese medicine injections with the example of Danhong injection (DHI). The standardized chemical profile of DHI has been established based on liquid chromatography with diode array detection. High-performance liquid chromatography coupled with time-of-flight mass spectrometry and high-performance liquid chromatography with electrospray multistage tandem ion-trap mass spectrometry have been developed to identify the major constituents in DHI. The structures of 26 compounds including nucleotides, phenolic acids, and flavonoid glycosides were identified or tentatively characterized. Meanwhile, the simultaneous determination of seven marker constituents, including uridine, adenosine, danshensu, protocatechuic aldehyde, p-coumaric acid, rosmarinic acid, and salvianolic acid B, in DHI was performed by multiwavelength detection based on high-performance liquid chromatography with diode array detection. The integrated qualitative and quantitative characterization strategy provided an effective and reliable pattern for the comprehensive and systematic characterization of the complex traditional Chinese medicine system. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Detection of anatomical changes in lung cancer patients with 2D time-integrated, 2D time-resolved and 3D time-integrated portal dosimetry: a simulation study

    Science.gov (United States)

    Wolfs, Cecile J. A.; Brás, Mariana G.; Schyns, Lotte E. J. R.; Nijsten, Sebastiaan M. J. J. G.; van Elmpt, Wouter; Scheib, Stefan G.; Baltes, Christof; Podesta, Mark; Verhaegen, Frank

    2017-08-01

    The aim of this work is to assess the performance of 2D time-integrated (2D-TI), 2D time-resolved (2D-TR) and 3D time-integrated (3D-TI) portal dosimetry in detecting dose discrepancies between the planned and (simulated) delivered dose caused by simulated changes in the anatomy of lung cancer patients. For six lung cancer patients, tumor shift, tumor regression and pleural effusion are simulated by modifying their CT images. Based on the modified CT images, time-integrated (TI) and time-resolved (TR) portal dose images (PDIs) are simulated and 3D-TI doses are calculated. The modified and original PDIs and 3D doses are compared by a gamma analysis with various gamma criteria. Furthermore, the difference in the D 95% (ΔD 95%) of the GTV is calculated and used as a gold standard. The correlation between the gamma fail rate and the ΔD 95% is investigated, as well the sensitivity and specificity of all combinations of portal dosimetry method, gamma criteria and gamma fail rate threshold. On the individual patient level, there is a correlation between the gamma fail rate and the ΔD 95%, which cannot be found at the group level. The sensitivity and specificity analysis showed that there is not one combination of portal dosimetry method, gamma criteria and gamma fail rate threshold that can detect all simulated anatomical changes. This work shows that it will be more beneficial to relate portal dosimetry and DVH analysis on the patient level, rather than trying to quantify a relationship for a group of patients. With regards to optimizing sensitivity and specificity, different combinations of portal dosimetry method, gamma criteria and gamma fail rate should be used to optimally detect certain types of anatomical changes.

  7. Detection of anatomical changes in lung cancer patients with 2D time-integrated, 2D time-resolved and 3D time-integrated portal dosimetry: a simulation study.

    Science.gov (United States)

    Wolfs, Cecile J A; Brás, Mariana G; Schyns, Lotte E J R; Nijsten, Sebastiaan M J J G; van Elmpt, Wouter; Scheib, Stefan G; Baltes, Christof; Podesta, Mark; Verhaegen, Frank

    2017-07-12

    The aim of this work is to assess the performance of 2D time-integrated (2D-TI), 2D time-resolved (2D-TR) and 3D time-integrated (3D-TI) portal dosimetry in detecting dose discrepancies between the planned and (simulated) delivered dose caused by simulated changes in the anatomy of lung cancer patients. For six lung cancer patients, tumor shift, tumor regression and pleural effusion are simulated by modifying their CT images. Based on the modified CT images, time-integrated (TI) and time-resolved (TR) portal dose images (PDIs) are simulated and 3D-TI doses are calculated. The modified and original PDIs and 3D doses are compared by a gamma analysis with various gamma criteria. Furthermore, the difference in the D 95% (ΔD 95% ) of the GTV is calculated and used as a gold standard. The correlation between the gamma fail rate and the ΔD 95% is investigated, as well the sensitivity and specificity of all combinations of portal dosimetry method, gamma criteria and gamma fail rate threshold. On the individual patient level, there is a correlation between the gamma fail rate and the ΔD 95% , which cannot be found at the group level. The sensitivity and specificity analysis showed that there is not one combination of portal dosimetry method, gamma criteria and gamma fail rate threshold that can detect all simulated anatomical changes. This work shows that it will be more beneficial to relate portal dosimetry and DVH analysis on the patient level, rather than trying to quantify a relationship for a group of patients. With regards to optimizing sensitivity and specificity, different combinations of portal dosimetry method, gamma criteria and gamma fail rate should be used to optimally detect certain types of anatomical changes.

  8. Mobile Measurement of Methane and Ethane for the Detection and Attribution of Natural Gas Pipeline Leaks Using Off-Axis Integrated Output Spectroscopy

    Science.gov (United States)

    Leen, J. B.; Spillane, S.; Gardner, A.; Hansen, P. C.; Gupta, M.; Baer, D. S.

    2015-12-01

    Natural gas leaks pose a risk to public safety both because of potential explosions as well as from the greenhouse gas potential of fugitive methane. The rapid and cost effective detection of leaks in natural gas distribution is critical to providing a system that is safe for the public and the environment. Detection of methane from a mobile platform (vehicles, aircraft, etc.) is an accepted method of identifying leaks. A robust approach to differentiating pipeline gas (thermogenic) from other biogenic sources is the detection of ethane along with methane. Ethane is present in nearly all thermogenic gas but not in biogenic sources and its presence can be used to positively identify a gas sample. We present a mobile system for the simultaneous measurement of methane and ethane that is capable of detecting pipeline leaks and differentiating pipeline gas from other biogenic sources such as landfills, swamps, sewers, and enteric fermentation. The mobile system consists of a high precision GPS, sonic anemometer, and methane/ethane analyzer based on off-axis integrated cavity output spectroscopy (OA-ICOS). In order to minimize the system cost and facilitate the wide use of mobile leak detection, the analyzer operates in the near-infrared portion of the spectrum where lasers and optics are significantly less costly than in the mid-infrared. The analyzer is capable of detecting methane with a precision of detecting ethane with a precision of detection of leaks at speeds up to 50 mph. The sonic anemometer, GPS and analyzer inlet are mounted to a generic roof rack for attachment to available fleet vehicles. The system can detect leaks having a downwind concentration of as little as 10 ppb of methane above ambient, while leaks 500 ppb above ambient can be identified as thermogenic with greater than 99% certainty (for gas with 6% ethane). Finally, analysis of wind data provides an estimate of leak direction and distance. The system presented provides a robust, cost effective

  9. A novel fluorescent biosensor for Adenosine Triphosphate detection based on the polydopamine nanospheres integrating with enzymatic recycling amplification.

    Science.gov (United States)

    Ji, Xiaoting; Yi, Bingqing; Xu, Yujuan; Zhao, Yanan; Zhong, Hua; Ding, Caifeng

    2017-07-01

    Based on the protective performance of polydopamine nanospheres (PDANSs) for DNA against nuclease digestion and the specific recognition characteristic of aptamer, we have developed an enzymatic recycling signal amplification method for highly sensitive and selective detection of adenosine triphosphate (ATP). Fluorescence measurements were carried out to verify the DNA polymerase and exonuclease III (Exo III) assisted target recycling process and fluorescence signal amplification. In the absence of the ATP, initially, the signal DNA-PDANSs complex was in the "off" state due to the efficient fluorescence quenching of 6-carboxyfluorescein (FAM) adjacent to the surface of PDANSs. Due to the binding of the aptamer by ATP, it trigger DNA polymerase and Exo III assisted target recycling process by the product of release, the complex would change into the "on" state as a result of the dissociation of the FAM from the surface of PDANSs, thus providing greatly enhanced fluorescence emission intensity. The method allows quantitative detection of ATP in the range of 20-600nM with a detection limit of 8.32nM. This biosensor requires no complex operations, and is a new high efficiency method for ATP detection. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Simultaneous detection of multiple DNA targets by integrating dual-color graphene quantum dot nanoprobes and carbon nanotubes.

    Science.gov (United States)

    Qian, Zhaosheng; Shan, Xiaoyue; Chai, Lujing; Chen, Jianrong; Feng, Hui

    2014-12-01

    Simultaneous detection of multiple DNA targets was achieved based on a biocompatible graphene quantum dots (GQDs) and carbon nanotubes (CNTs) platform through spontaneous assembly between dual-color GQD-based probes and CNTs and subsequently self-recognition between DNA probes and targets. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Detection of concrete dam leakage using an integrated geophysical technique based on flow-field fitting method

    Science.gov (United States)

    Dai, Qianwei; Lin, Fangpeng; Wang, Xiaoping; Feng, Deshan; Bayless, Richard C.

    2017-05-01

    An integrated geophysical investigation was performed at S dam located at Dadu basin in China to assess the condition of the dam curtain. The key methodology of the integrated technique used was flow-field fitting method, which allowed identification of the hydraulic connections between the dam foundation and surface water sources (upstream and downstream), and location of the anomalous leakage outlets in the dam foundation. Limitations of the flow-field fitting method were complemented with resistivity logging to identify the internal erosion which had not yet developed into seepage pathways. The results of the flow-field fitting method and resistivity logging were consistent when compared with data provided by seismic tomography, borehole television, water injection test, and rock quality designation.

  12. IMS2 – An integrated medical software system for early lung cancer detection using ion mobility spectrometry data of human breath

    Directory of Open Access Journals (Sweden)

    Baumbach Jan

    2007-12-01

    Full Text Available IMS2 is an Integrated Medical Software system for the analysis of Ion Mobility Spectrometry (IMS data. It assists medical staff with the following IMS data processing steps: acquisition, visualization, classification, and annotation. IMS2 provides data analysis and interpretation features on the one hand, and also helps to improve the classification by increasing the number of the pre-classified datasets on the other hand. It is designed to facilitate early detection of lung cancer, one of the most common cancer types with one million deaths each year around the world.

  13. Integrated Path Detection of Co2 and CH4 Using a Waveform Driven Electro-Optic Single Sideband Laser Source

    Directory of Open Access Journals (Sweden)

    Wagner Gerd

    2016-01-01

    Full Text Available Integrated path concentrations of ambient levels of carbon dioxide and methane have been measured during nighttime periods at NIST, Boulder (CO, USA, using a ground-based, eyesafe laser system. In this contribution, we describe the transmitter and receiver system, demonstrate measurements of CO2 and CH4 in comparison with an in situ point sensor measurement using a commercial cavity ring-down instrument, and demonstrate a speckle noise reduction method.

  14. Integration of Distributed Services and Hybrid Models Based on Process Choreography to Predict and Detect Type 2 Diabetes.

    Science.gov (United States)

    Martinez-Millana, Antonio; Bayo-Monton, Jose-Luis; Argente-Pla, María; Fernandez-Llatas, Carlos; Merino-Torres, Juan Francisco; Traver-Salcedo, Vicente

    2017-12-29

    Life expectancy is increasing and, so, the years that patients have to live with chronic diseases and co-morbidities. Type 2 diabetes is one of the most prevalent chronic diseases, specifically linked to being overweight and ages over sixty. Recent studies have demonstrated the effectiveness of new strategies to delay and even prevent the onset of type 2 diabetes by a combination of active and healthy lifestyle on cohorts of mid to high risk subjects. Prospective research has been driven on large groups of the population to build risk scores that aim to obtain a rule for the classification of patients according to the odds for developing the disease. Currently, there are more than two hundred models and risk scores for doing this, but a few have been properly evaluated in external groups and integrated into a clinical application for decision support. In this paper, we present a novel system architecture based on service choreography and hybrid modeling, which enables a distributed integration of clinical databases, statistical and mathematical engines and web interfaces to be deployed in a clinical setting. The system was assessed during an eight-week continuous period with eight endocrinologists of a hospital who evaluated up to 8080 patients with seven different type 2 diabetes risk models implemented in two mathematical engines. Throughput was assessed as a matter of technical key performance indicators, confirming the reliability and efficiency of the proposed architecture to integrate hybrid artificial intelligence tools into daily clinical routine to identify high risk subjects.

  15. High-Throughput Analysis With 96-Capillary Array Electrophoresis and Integrated Sample Preparation for DNA Sequencing Based on Laser Induced Fluorescence Detection

    Energy Technology Data Exchange (ETDEWEB)

    Xue, Gang [Iowa State Univ., Ames, IA (United States)

    2001-01-01

    The purpose of this research was to improve the fluorescence detection for the multiplexed capillary array electrophoresis, extend its use beyond the genomic analysis, and to develop an integrated micro-sample preparation system for high-throughput DNA sequencing. The authors first demonstrated multiplexed capillary zone electrophoresis (CZE) and micellar electrokinetic chromatography (MEKC) separations in a 96-capillary array system with laser-induced fluorescence detection. Migration times of four kinds of fluoresceins and six polyaromatic hydrocarbons (PAHs) are normalized to one of the capillaries using two internal standards. The relative standard deviations (RSD) after normalization are 0.6-1.4% for the fluoresceins and 0.1-1.5% for the PAHs. Quantitative calibration of the separations based on peak areas is also performed, again with substantial improvement over the raw data. This opens up the possibility of performing massively parallel separations for high-throughput chemical analysis for process monitoring, combinatorial synthesis, and clinical diagnosis. The authors further improved the fluorescence detection by step laser scanning. A computer-controlled galvanometer scanner is adapted for scanning a focused laser beam across a 96-capillary array for laser-induced fluorescence detection. The signal at a single photomultiplier tube is temporally sorted to distinguish among the capillaries. The limit of detection for fluorescein is 3 x 10-11 M (S/N = 3) for 5-mW of total laser power scanned at 4 Hz. The observed cross-talk among capillaries is 0.2%. Advantages include the efficient utilization of light due to the high duty-cycle of step scan, good detection performance due to the reduction of stray light, ruggedness due to the small mass of the galvanometer mirror, low cost due to the simplicity of components, and flexibility due to the independent paths for excitation and emission.

  16. Nanogram per milliliter-level immunologic detection of alpha-fetoprotein with integrated rotating-resonance microcantilevers for early-stage diagnosis of heptocellular carcinoma.

    Science.gov (United States)

    Liu, Yongjing; Li, Xinxin; Zhang, Zhixiang; Zuo, Guomin; Cheng, Zhenxing; Yu, Haitao

    2009-02-01

    Nanogram per milliliter-level ultra-low concentration detection of alpha-fetoprotein (AFP), which is an important marker for heptocellular carcinoma, is in favor of early-stage prognosis and disease diagnosis. On-the-spot rapid detection of such antigens as AFP highly requires innovative micro/nano techniques. To meet this requirement, an advanced resonant microcantilever is developed and used for screening the tumor marker at nanogram per milliliter level. The sensing principle of the resonant microcantilever is measuring frequency-shift versus specific-adsorbed mass. With both electromagnetic resonance-exciting and piezoresistive readout elements on-chip integrated, the microcantilever sensor is operated in a rotating resonance mode to improve sensitivity and resolution to specific mass adsorption. Prior to detection of AFP with previously immobilized anti-AFP antibody, the antigen-antibody specific-binding is confirmed with an enzyme linked immunosorbent assay experiment. By implementing the specific reaction in liquid and reading out the sensor signal in lab air environment, the micromechanical sensor has achieved the sensitive scale between 2 and 20 ng/ml. To effectively depress cross-talk signal and improve resolution, the insensitive regions of the cantilever surface are pre-modified with 2-[methoxy (polyethyleneoxy) propyl] trimethoxysilane for nonspecific bio-adsorption minimization. Finally, a better AFP detecting limit than 2 ng/mL is experimentally achieved. The label-free resonant microcantilever sensor is promising in low-cost or even disposable early-stage prognosis and diagnosis of tumors.

  17. Integrated FDG-PET/CT for detection, therapy monitoring and follow-up of granulocytic sarcoma. Initial results

    Energy Technology Data Exchange (ETDEWEB)

    Aschoff, Philip; Werner, M.K.; Lichy, M.; Pfannenberg, C. [Dept. of Diagnostic and Interventional Radiology, Univ. Hospital, Eberhard-Karls-Univ. Tuebingen (Germany); Haentschel, M.; Vogel, W. [Dept. of Internal Medicine, Univ. Hospital, Eberhard-Karls-Univ. Tuebingen (Germany); Oeksuez, M. [Dept. of Nuclear Medicine, Univ. Hospital, Eberhard-Karls-Univ. Tuebingen (Germany)

    2009-07-01

    Granulocytic sarcomas (GS) are rare extramedullary manifestations of myeloid or lymphoblastic leukaemia. Laboratory examinations are of limited use for diagnosis of extramedullary disease. Radiological imaging based on morphology is challenging. To date, the possible role of FDG-PET/CT as a method for combined metabolic and morphologic imaging is unclear. We present a series of 10 patients to evaluate the potential role of FDG-PET/CT in the management of GS. Patients, materials, methods: a retrospective evaluation of 18 FDG-PET/CT exams in 10 patients with histologically proven GS was performed. All scans included a contrast enhanced CT. The FDG uptake of GS was analyzed and the sensitivity of lesion detection was compared to PET and CT alone. The changes in FDG uptake after therapy were compared to morphological changes detected by CT and follow-up/clinical outcome. Results: 52 untreated or recurrent GS lesions were detected by FDG-PET/CT and all showed an increased FDG uptake with a mean SUVmax and SUVavg of 5.1 and 3.4, respectively. GS was multifocal in 8/10 patients. Combined PET/CT avoided 5 false positive findings compared to PET alone and 13 false negative findings and 1 false positive compared to CT alone. Changes in FDG uptake after therapy correlated with clinical outcome and were more reliable than CT assessment alone. PET/CT identified recurrent GS in 3 patients. Conclusion: viable GS are FDG-avid. Using this metabolic information and morphologic CT criteria, combined FDG-PET/CT was more accurate in lesion detection than FDG-PET or CT alone. Changes in FDG uptake after therapy might be a useful additional parameter for therapy monitoring. Therefore, FDG-PET/CU appears to be a promising diagnostic and monitoring tool in the management of patients with GS. (orig.)

  18. INTEGRAL detects Swift J1910.2-0546 (= MAXI J1910-057) in the hard X-rays

    DEFF Research Database (Denmark)

    Bodaghee, A.; Bozzo, E.; Tomsick, J. A.

    2012-01-01

    .2-0546 is detected up to ~200 keV. Fitting this spectrum (9.1 ks of effective exposure time) with a power-law model yields a photon index of 1.8+/-0.3 (at 90% confidence) for a reduced chi^2/d.o.f.=1.0/9; adding an exponential cutoff does not improve the fit. The observed 20--100-keV flux is 1.5e-9 ergs/cm^2/s...

  19. INTEGRAL detects the recurrent transients XTE J1709-267 and XTE J1739-285 in outburst

    DEFF Research Database (Denmark)

    Sanchez-Fernandez, C.; Chenevez, Jérôme; Pavan, L.

    2012-01-01

    in the 20-40 keV band. We estimate a rough flux of ~8 mCrab (5 sigma) for an effective ISGRI exposure time of 21 ks. A preliminary spectral fit to the JEM-X data is consistent with an absorbed disk blackbody model of temperature ~2.2 keV. The onset of this outburst was also detected by MAXI http://maxi.riken.jp/top/index.php...

  20. Integrating occurrence and detectability patterns based on interview data: a case study for threatened mammals in Equatorial Guinea

    Science.gov (United States)

    Martínez-Martí, Chele; Jiménez-Franco, María V.; Royle, J. Andrew; Palazón, José A.; Calvo, José F.

    2016-01-01

    Occurrence models that account for imperfect detection of species are increasingly used for estimating geographical range, for determining species-landscape relations and to prioritize conservation actions worldwide. In 2010, we conducted a large-scale survey in Río Muni, the mainland territory of Equatorial Guinea, which aimed to estimate the probabilities of occurrence and detection of threatened mammals based on environmental covariates, and to identify priority areas for conservation. Interviews with hunters were designed to record presence/absence data of seven species (golden cat, leopard, forest elephant, forest buffalo, western gorilla, chimpanzee and mandrill) in 225 sites throughout the region. We fitted single season occupancy models and recently developed models which also include false positive errors (i.e. species detected in places where it actually does not occur), which should provide more accurate estimates for most species, which are susceptible to mis-identification. Golden cat and leopard had the lowest occurrence rates in the region, whereas primates had the highest rates. All species, except gorilla, were affected negatively by human settlements. The southern half of Río Muni showed the highest occurrence of the species studied, and conservation strategies for ensuring the persistence of threatened mammals should be focused on this area.

  1. Micromachined silicon cantilevers with integrated high-frequency magnetoimpedance sensors for simultaneous strain and magnetic field detection

    Science.gov (United States)

    Buettel, G.; Joppich, J.; Hartmann, U.

    2017-12-01

    Giant magnetoimpedance (GMI) measurements in the high-frequency regime utilizing a coplanar waveguide with an integrated Permalloy multilayer and micromachined on a silicon cantilever are reported. The fabrication process is described in detail. The aspect ratio of the magnetic multilayer in the magnetoresistive and magnetostrictive device was varied. Tensile strain and compressive strain were applied. Vector network analyzer measurements in the range from the skin effect to ferromagnetic resonance confirm the technological potential of GMI-based micro-electro-mechanical devices for strain and magnetic field sensing applications. The strain-impedance gauge factor was quantified by finite element strain calculations and reaches a maximum value of almost 200.

  2. Implementation of an integrating sphere for the enhancement of noninvasive glucose detection using quantum cascade laser spectroscopy

    Science.gov (United States)

    Werth, Alexandra; Liakat, Sabbir; Dong, Anqi; Woods, Callie M.; Gmachl, Claire F.

    2018-05-01

    An integrating sphere is used to enhance the collection of backscattered light in a noninvasive glucose sensor based on quantum cascade laser spectroscopy. The sphere enhances signal stability by roughly an order of magnitude, allowing us to use a thermoelectrically (TE) cooled detector while maintaining comparable glucose prediction accuracy levels. Using a smaller TE-cooled detector reduces form factor, creating a mobile sensor. Principal component analysis has predicted principal components of spectra taken from human subjects that closely match the absorption peaks of glucose. These principal components are used as regressors in a linear regression algorithm to make glucose concentration predictions, over 75% of which are clinically accurate.

  3. Gravitational field-flow fractionation integrated with chemiluminescence detection for a self-standing point-of-care compact device in bioanalysis.

    Science.gov (United States)

    Casolari, S; Roda, B; Mirasoli, M; Zangheri, M; Patrono, D; Reschiglian, P; Roda, A

    2013-01-07

    A "Point-Of-Care-Testing" (POCT) system relies on portable and simply operated self-standing analytical devices. To fulfill diagnostic requirements, the POCT system should provide highly sensitive simultaneous detection of several biomarkers of the pathology of interest (multiplexing) in a short assay time. One of the main unsolved issues in POCT device development is the integration of pre-analytical sample preparation procedures in the miniaturized device. In this work, an integrated POCT system based on gravitational field-flow fractionation (GrFFF) and chemiluminescence (CL) detection is presented for the on-line sample pre-analytical treatment and/or clean-up and analysis of biological fluids. As a proof of principle for the new GrFFF-CL POCT system, the automatic on-line analysis of plasma alkaline phosphatase activity, a biomarker of obstructive liver diseases and bone disorders, starting from whole blood samples was developed. The GrFFF-CL POCT system was able to give quantitative results on blood samples from control and patients with low sample volume (0.5 μL) and reagent consumption, short analysis time (10 minutes), high reproducibility and with a linear range of 50-1400 IU L(-1). The system can be easily applied to on-line prepare plasma from whole blood for other clinical biomarkers and for other assay formats, based on immunoassay or DNA hybridization.

  4. Ascorbic acid surface modified TiO₂-thin layers as a fully integrated analysis system for visual simultaneous detection of organophosphorus pesticides.

    Science.gov (United States)

    Li, Shunxing; Liang, Wenjie; Zheng, Fengying; Lin, Xiaofeng; Cai, Jiabai

    2014-11-06

    TiO₂ photocatalysis and colorimetric detection are coupled with thin layer chromatography (TLC) for the first time to develop a fully integrated analysis system. Titania@polystyrene hybrid microspheres were surface modified with ascorbic acid, denoted AA-TiO₂@PS, and used as the stationary phase for TLC. Because the affinity between AA-TiO₂@PS and organophosphorus pesticides (OPs) was different for different species of OPs (including chlopyrifos, malathion, parathion, parathion-methyl, and methamidophos), OPs could be separated simultaneously by the mobile phase in 12.0 min with different Rf values. After surface modification, the UV-vis wavelength response range of AA-TiO₂@PS was expanded to 650 nm. Under visible-light irradiation, all of the OPs could be photodegraded to PO₄(3-) in 25.0 min. Based on the chromogenic reaction between PO₄(3-) and chromogenic agents (ammonium molybdate and ascorbic acid), OPs were quantified from color intensity images using a scanner in conjunction with image processing software. So, AA-TiO₂@PS was respectively used as the stationary phase of TLC for efficient separation of OPs, as a photocatalyst for species transformation of phosphorus, and as a colorimetric probe for on-field simultaneous visual detection of OPs in natural water. Linear calibration curves for each OP ranged from 19.3 nmol P L(-1) to 2.30 μmol P L(-1). This integrated analysis system was simple, inexpensive, easy to operate, and sensitive.

  5. A novel photoelectrochemical immunosensor by integration of nanobody and TiO₂ nanotubes for sensitive detection of serum cystatin C.

    Science.gov (United States)

    Mi, Li; Wang, Pingyan; Yan, Junrong; Qian, Jing; Lu, Jusheng; Yu, Jiachao; Wang, Yuzhen; Liu, Hong; Zhu, Min; Wan, Yakun; Liu, Songqin

    2016-01-01

    Cystatin C (CysC) is a sensitive marker for the estimation of the glomerular filtration rate and the clinical diagnosis of different diseases. In this paper, CysC-specific nanobodies (Nbs) were isolated from a phage display nanobody library. A simple and sensitive photoelectrochemical immunosensor based on TiO2 nanotube arrays (TNAs) was proposed for the sensitive detection of CysC. The TiO2 nanotube arrays deposited by electrochemical anodization displayed a high and stable photocurrent response under irradiation. After coupling CysC-specific nanobody to TNA (Nb/TNA), the proposed immunosensor for CysC can be utilized for tracking the photocurrent change of Nb/TNA caused by immunoreactions between CysC and the immobilized CysC-specific Nb. This allowed for the determination of CysC with a calibration range from 0.72 pM to 7.19 nM. The variation of the photocurrent was in a linear relationship with the logarithm of the CysC concentration in the range of 0.72 pM-3.6 nM. The immunosensor had a correlation coefficient of 0.97 and a detection limit of 0.14 pM at a signal-to-noise ratio of 3. The proposed immunosensor showed satisfactory intra- and inter-assay accuracy, high selectivity and good stability. As a result, this proposed strategy would offer a novel and simple approach for the detection of immunoreactions, provide new insights in popularizing the diagnosis of CysC, and extend the application of TiO2 nanotubes. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Material Property Estimation for Direct Detection of DNAPL using Integrated Ground-Penetrating Radar Velocity, Imaging and Attribute Analysis

    Energy Technology Data Exchange (ETDEWEB)

    John H. Bradford; Stephen Holbrook; Scott B. Smithson

    2004-12-09

    The focus of this project is direct detection of DNAPL's specifically chlorinated solvents, via material property estimation from multi-fold surface ground-penetrating radar (GPR) data. We combine state-of-the-art GPR processing methodology with quantitative attribute analysis and material property estimation to determine the location and extent of residual and/or pooled DNAPL in both the vadose and saturated zones. An important byproduct of our research is state-of-the-art imaging which allows us to pinpoint attribute anomalies, characterize stratigraphy, identify fracture zones, and locate buried objects.

  7. A high-throughput method to detect RNA profiling by integration of RT-MLPA with next generation sequencing technology.

    Science.gov (United States)

    Wang, Jing; Yang, Xue; Chen, Haofeng; Wang, Xuewei; Wang, Xiangyu; Fang, Yi; Jia, Zhenyu; Gao, Jidong

    2017-07-11

    RNA in formalin-fixed and paraffin-embedded (FFPE) tissues provides large amount of information indicating disease stages, histological tumor types and grades, as well as clinical outcomes. However, Detection of RNA expression levels in formalin-fixed and paraffin-embedded samples is extremely difficult due to poor RNA quality. Here we developed a high-throughput method, Reverse Transcription-Multiple Ligation-dependent Probe Sequencing (RT-MLPSeq), to determine expression levels of multiple transcripts in FFPE samples. By combining Reverse Transcription-Multiple Ligation-dependent Amplification method and next generation sequencing technology, RT-MLPSeq overcomes the limit of probe length in multiplex ligation-dependent probe amplification assay and thus could detect expression levels of transcripts without quantitative limitations. We proved that different RT-MLPSeq probes targeting on the same transcripts have highly consistent results and the starting RNA/cDNA input could be as little as 1 ng. RT-MLPSeq also presented consistent relative RNA levels of selected 13 genes with reverse transcription quantitative PCR. Finally, we demonstrated the application of the new RT-MLPSeq method by measuring the mRNA expression levels of 21 genes which can be used for accurate calculation of the breast cancer recurrence score - an index that has been widely used for managing breast cancer patients.

  8. Sleep apnea detection by a cardiac resynchronization device integrated thoracic impedance sensor: A validation study against the gold standard polysomnography.

    Science.gov (United States)

    Barbieri, Fabian; Dichtl, Wolfgang; Heidbreder, Anna; Brandauer, Elisabeth; Stefani, Ambra; Adukauskaite, Agne; Senoner, Thomas; Schgör, Wilfried; Hintringer, Florian; Högl, Birgit

    2018-01-01

    Sleep disordered breathing is a common but often undiagnosed comorbidity in heart failure patients. Cardiac implantable electronic devices used for cardiac resynchronization therapy (CRT) may detect sleep apnea by use of a transthoracic impedance sensor. Validation of the AP scan® algorithm (Boston Scientific®) was performed by using the diagnostic gold standard polysomnography (PSG). Forty-one patients with impaired left ventricular ejection fraction, frequent right ventricular pacing due to atrioventricular block and heart failure symptoms despite optimal medical therapy underwent upgrading to biventricular pacing. Within one month after left ventricular lead implantation, sleep apnea was assessed by single-night PSG and AP scan® measurements. AP scan® measurements were valid in only 21 of 41 (51.2%) patients in the index night of the PSG. The PSG determined apnea-hypopnea index did not correlate statistically significant with the AP scan® measurements (r = 0.41, 95% confidence interval -0.05-0.72, p = 0.07). The degree of overestimation is displayed by using the Bland-Altman method: mean difference -12.4, standard deviation ± 15.8, 95% confidence interval -43.3-18.6. In heart failure patients receiving CRT upgrading, the AP scan® algorithm may need further improvement before it can be recommended for sleep apnea detection.

  9. Detection of impact damage on thermal protection systems using thin-film piezoelectric sensors for integrated structural health monitoring

    Science.gov (United States)

    Na, Jeong K.; Kuhr, Samuel J.; Jata, Kumar V.

    2008-03-01

    Thermal Protection Systems (TPS) can be subjected to impact damage during flight and/or during ground maintenance and/or repair. AFRL/RXLP is developing a reliable and robust on-board sensing/monitoring capability for next generation thermal protection systems to detect and assess impact damage. This study was focused on two classes of metallic thermal protection tiles to determine threshold for impact damage and develop sensing capability of the impacts. Sensors made of PVDF piezoelectric film were employed and tested to evaluate the detectability of impact signals and assess the onset or threshold of impact damage. Testing was performed over a range of impact energy levels, where the sensors were adhered to the back of the specimens. The PVDF signal levels were analyzed and compared to assess damage, where digital microscopy, visual inspection, and white light interferometry were used for damage verification. Based on the impact test results, an assessment of the impact damage thresholds for each type of metallic TPS system was made.

  10. DETECTION OF THE NITRATE POLLUTION SOURCES IN SHALLOW AQUIFER, USING INTEGRATION OF RS&GIS WITH STABLE ISOTOPES TECHNOLOGIES

    Directory of Open Access Journals (Sweden)

    N. B. I. Shakak

    2018-04-01

    Full Text Available Geographical information system (GIS and remote sensing technique is a tool which is used for acquiring data from space, storing, analyzing and displaying spatial data, also can use for investigating source of environmental pollution which is affect health. Sudan landsat mosaic image which acquired in 2013 was used in this study to develop land use and land cover maps for tow selected study area, Khartoum urban area, and Bara locality in North kordofan state western Sudan. The main objective to assess the source of Nitrate pollution in shallow aquifer. ERDAS software was used to create land cover-land use maps for the study areas. For Khartoum town we used land sat mosaic image which acquire in 2013, and used supervised classification which more closely controlled than unsupervised. In this process, we select pixel that represent patterns you recognized or can identify with help from knowledge of the data, the classes desired, and the algorithm to be used is required. In this paper we integrated the (GIS&RS, and stable isotopes methods for fingerprinting Nitrate sources in shallow boreholes. The global positioning system (GPS, used in the field to identify the shallow boreholes location in a three dimensional coordinate (Latitude, longitude, and altitude, Water samples were collected from 19 shallow boreholes in the study areas according to the standard sampling method send to laboratory to measure stable nitrogen (δ15Nnitrate, and Nitrate-oxygen (δ18Onitrate isotopes. Analysis were conducted by using isotope ratio mass spectrometry (IRMS. We can conclude that, special distribution and integration of GIs & RS help to identify the source of nitrate pollution.

  11. Detection of the Nitrate Pollution Sources in Shallow Aquifer, Using Integration of RS&GIS with Stable Isotopes Technologies

    Science.gov (United States)

    Shakak, N. B. I.

    2018-04-01

    Geographical information system (GIS) and remote sensing technique is a tool which is used for acquiring data from space, storing, analyzing and displaying spatial data, also can use for investigating source of environmental pollution which is affect health. Sudan landsat mosaic image which acquired in 2013 was used in this study to develop land use and land cover maps for tow selected study area, Khartoum urban area, and Bara locality in North kordofan state western Sudan. The main objective to assess the source of Nitrate pollution in shallow aquifer. ERDAS software was used to create land cover-land use maps for the study areas. For Khartoum town we used land sat mosaic image which acquire in 2013, and used supervised classification which more closely controlled than unsupervised. In this process, we select pixel that represent patterns you recognized or can identify with help from knowledge of the data, the classes desired, and the algorithm to be used is required. In this paper we integrated the (GIS&RS), and stable isotopes methods for fingerprinting Nitrate sources in shallow boreholes. The global positioning system (GPS), used in the field to identify the shallow boreholes location in a three dimensional coordinate (Latitude, longitude, and altitude), Water samples were collected from 19 shallow boreholes in the study areas according to the standard sampling method send to laboratory to measure stable nitrogen (δ15Nnitrate), and Nitrate-oxygen (δ18Onitrate) isotopes. Analysis were conducted by using isotope ratio mass spectrometry (IRMS). We can conclude that, special distribution and integration of GIs & RS help to identify the source of nitrate pollution.

  12. Determination of biogenic amines in chocolate by ion chromatographic separation and pulsed integrated amperometric detection with implemented wave-form at Au disposable electrode.

    Science.gov (United States)

    Pastore, Paolo; Favaro, Gabriella; Badocco, Denis; Tapparo, Andrea; Cavalli, Silvano; Saccani, Giovanna

    2005-12-09

    A rapid and selective cation exchange chromatographic method coupled to integrated pulsed amperometric detection (PAD) has been developed to quantify biogenic amines in chocolate. The method is based on gradient elution of aqueous methanesulfonic acid with post column addition of strong base to obtain suitable conditions for amperometric detection. A potential waveform able to keep long time performance of the Au disposable electrode was set up. Total analysis time is less than 20min. Concentration levels of dopamine, serotonin, tyramine, histamine and 2-phenylethylamine were measured, after extraction with perchloric acid from 2g samples previously defatted twice with petroleum ether. The method was used to determine the analytes in chocolate real matrices and their quantification was made with standard addition method. Only dopamine, histamine and serotonin were found in the analysed real samples. Repeatabilities of their signals, computed on their amounts in the real samples, were 5% for all of them. Repeatabilities of tyramine and phenethylamine were relative to standard additions to real samples (close to 1mg/l in the extract) and were 7 and 3%, respectively. Detection limits were computed with the 3s of the baseline noise combined with the calibration plot regression parameters. They were satisfactorily low for all amines: 3mg/kg for dopamine, 2mg/kg for tyramine, 1mg/kg for histamine, 2mg/kg for serotonin, 3mg/kg for 2-phenylethylamine.

  13. INTEGRAL/JEM-X detection of a type-I X-ray burst from MAXI J1421-613

    DEFF Research Database (Denmark)

    Bozzo, E.; Bazzano, A.; Kuulkers, Erik

    2014-01-01

    . The onset of the burst occurred on 2014 January 10 at 19:05 UTC, and the total event as observed by JEM-X lasted for about 20 s (3-25 keV). The average spectrum of the burst could be roughly described by using a black-body model with temperature kT~1 keV. The corresponding flux was 1.7E-9 erg/cm^2/s...... (translating into a luminosity of 1.3E37 erg/s at 8 kpc; 3-10 keV). We estimated a persistent flux outside the burst of 7E-10 erg/cm^2/s (3-25 keV). This detection reveals that MAXI J1421-613 is a newly discovered X-ray bursting transient source, thus hosting an accreting neutron star....

  14. Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

    International Nuclear Information System (INIS)

    Althuwaynee, Omar F; Pradhan, Biswajeet; Ahmad, Noordin

    2014-01-01

    This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies

  15. Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

    Science.gov (United States)

    Althuwaynee, Omar F.; Pradhan, Biswajeet; Ahmad, Noordin

    2014-06-01

    This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies.

  16. Advancing satellite-based solar power forecasting through integration of infrared channels for automatic detection of coastal marine inversion layer

    Energy Technology Data Exchange (ETDEWEB)

    Kostylev, Vladimir; Kostylev, Andrey; Carter, Chris; Mahoney, Chad; Pavlovski, Alexandre; Daye, Tony [Green Power Labs Inc., Dartmouth, NS (Canada); Cormier, Dallas Eugene; Fotland, Lena [San Diego Gas and Electric Co., San Diego, CA (United States)

    2012-07-01

    The marine atmospheric boundary layer is a layer or cool, moist maritime air with the thickness of a few thousand feet immediately below a temperature inversion. In coastal areas as moist air rises from the ocean surface, it becomes trapped and is often compressed into fog above which a layer of stratus clouds often forms. This phenomenon is common for satellite-based solar radiation monitoring and forecasting. Hour ahead satellite-based solar radiation forecasts are commonly using visible spectrum satellite images, from which it is difficult to automatically differentiate low stratus clouds and fog from high altitude clouds. This provides a challenge for cloud motion tyracking and cloud cover forecasting. San Diego Gas and Electric {sup registered} (SDG and E {sup registered}) Marine Layer Project was undertaken to obtain information for integration with PV forecasts, and to develop a detailed understanding of long-term benefits from forecasting Marine Layer (ML) events and their effects on PV production. In order to establish climatological ML patterns, spatial extent and distribution of marine layer, we analyzed visible and IR spectrum satellite images (GOES WEST) archive for the period of eleven years (2000 - 2010). Historical boundaries of marine layers impact were established based on the cross-classification of visible spectrum (VIS) and infrared (IR) images. This approach is successfully used by us and elsewhere for evaluating cloud albedo in common satellite-based techniques for solar radiation monitoring and forecasting. The approach allows differentiation of cloud cover and helps distinguish low laying fog which is the main consequence of marine layer formation. ML occurrence probability and maximum extent inland was established for each hour and day of the analyzed period and seasonal/patterns were described. SDG and E service area is the most affected region by ML events with highest extent and probability of ML occurrence. Influence of ML was the

  17. Integrated PC-based system for detecting and parameter monitoring at the Dubna Gas Filled Recoil Separator

    International Nuclear Information System (INIS)

    Tsyganov, Yu.S.; Polyakov, A.N.; Sukhov, A.M.

    2012-01-01

    New detection system of the Dubna Gas Filled Recoil Separator (DGFRS) was put into operation in May 2012. It includes 32-strip position sensitive PIPS detector manufactured by CANBERRA NV, 24-strip back side PIPS detector, 8-strip V ETO P IPS detector, time-of-flight low pressure (∼1.7 Torr) pentane-filled gaseous detector, CAMAC fast ADC's with 5 μs dead time per three signals (energy, top position, bottom position), modified CC012 crate controller and PC-based C ++ Builder code for spectrometry data acquisition. New parameter monitoring system (project) is reported too together with the brief review of the present system. It is planned to put into operation with this system during 2013-2014. Examples of applications in the long-term experiments aimed at the synthesis of superheavy elements in 48 Ca induced complete fusion nuclear reactions are also presented. Namely with the DGFRS facility 45 new isotopes of superheavy nuclei were synthesized since 2001

  18. Lab-on-capillary: a rapid, simple and quantitative genetic analysis platform integrating nucleic acid extraction, amplification and detection.

    Science.gov (United States)

    Fu, Yu; Zhou, Xiaoming; Xing, Da

    2017-12-05

    In this work, we describe for the first time a genetic diagnosis platform employing a polydiallyldimethylammonium chloride (PDDA)-modified capillary and a liquid-based thermalization system for rapid, simple and quantitative DNA analysis with minimal user interaction. Positively charged PDDA is modified on the inner surface of the silicon dioxide capillary by using an electrostatic self-assembly approach that allows the negatively charged DNA to be separated from the lysate in less than 20 seconds. The capillary loaded with the PCR mix is incorporated in the thermalization system, which can achieve on-site real-time PCR. This system is based on the circulation of pre-heated liquids in the chamber, allowing for high-speed thermalization of the capillary and fast amplification. Multiple targets can be simultaneously analysed with multiplex spatial melting. Starting with live Escherichia coli (E. coli) cells in milk, as a realistic sample, the current method can achieve DNA extraction, amplification, and detection within 40 min.

  19. Wireless Low-Power Integrated Basal-Body-Temperature Detection Systems Using Teeth Antennas in the MedRadio Band.

    Science.gov (United States)

    Yang, Chin-Lung; Zheng, Gou-Tsun

    2015-11-20

    This study proposes using wireless low power thermal sensors for basal-body-temperature detection using frequency modulated telemetry devices. A long-term monitoring sensor requires low-power circuits including a sampling circuit and oscillator. Moreover, temperature compensated technologies are necessary because the modulated frequency might have additional frequency deviations caused by the varying temperature. The temperature compensated oscillator is composed of a ring oscillator and a controlled-steering current source with temperature compensation, so the output frequency of the oscillator does not drift with temperature variations. The chip is fabricated in a standard Taiwan Semiconductor Manufacturing Company (TSMC) 0.18-μm complementary metal oxide semiconductor (CMOS) process, and the chip area is 0.9 mm². The power consumption of the sampling amplifier is 128 µW. The power consumption of the voltage controlled oscillator (VCO) core is less than 40 µW, and the output is -3.04 dBm with a buffer stage. The output voltage of the bandgap reference circuit is 1 V. For temperature measurements, the maximum error is 0.18 °C with a standard deviation of ±0.061 °C, which is superior to the required specification of 0.1 °C.

  20. Wireless Low-Power Integrated Basal-Body-Temperature Detection Systems Using Teeth Antennas in the MedRadio Band

    Directory of Open Access Journals (Sweden)

    Chin-Lung Yang

    2015-11-01

    Full Text Available This study proposes using wireless low power thermal sensors for basal-body-temperature detection using frequency modulated telemetry devices. A long-term monitoring sensor requires low-power circuits including a sampling circuit and oscillator. Moreover, temperature compensated technologies are necessary because the modulated frequency might have additional frequency deviations caused by the varying temperature. The temperature compensated oscillator is composed of a ring oscillator and a controlled-steering current source with temperature compensation, so the output frequency of the oscillator does not drift with temperature variations. The chip is fabricated in a standard Taiwan Semiconductor Manufacturing Company (TSMC 0.18-μm complementary metal oxide semiconductor (CMOS process, and the chip area is 0.9 mm2. The power consumption of the sampling amplifier is 128 µW. The power consumption of the voltage controlled oscillator (VCO core is less than 40 µW, and the output is −3.04 dBm with a buffer stage. The output voltage of the bandgap reference circuit is 1 V. For temperature measurements, the maximum error is 0.18 °C with a standard deviation of ±0.061 °C, which is superior to the required specification of 0.1 °C.

  1. Integration of Breast Cancer Secretomes with Clinical Data Elucidates Potential Serum Markers for Disease Detection, Diagnosis, and Prognosis.

    Science.gov (United States)

    Ziegler, Yvonne S; Moresco, James J; Yates, John R; Nardulli, Ann M

    2016-01-01

    Cancer cells secrete factors that influence adjacent cell behavior and can lead to enhanced proliferation and metastasis. To better understand the role of these factors in oncogenesis and disease progression, estrogen and progesterone receptor positive MCF-7 cells, triple negative breast cancer MDA-MB-231, DT22, and DT28 cells, and MCF-10A non-transformed mammary epithelial cells were grown in 3D cultures. A special emphasis was placed on triple negative breast cancer since these tumors are highly aggressive and no targeted treatments are currently available. The breast cancer cells secreted factors of variable potency that stimulated proliferation of the relatively quiescent MCF-10A cells. The conditioned medium from each cell line was subjected to mass spectrometry analysis and a variety of secreted proteins were identified including glycolytic enzymes, proteases, protease inhibitors, extracellular matrix proteins, and insulin-like growth factor binding proteins. An investigation of the secretome from each cell line yielded clues about strategies used for breast cancer proliferation and metastasis. Some of the proteins we identified may be useful in the development of a serum-based test for breast cancer detection, diagnosis, prognosis, and monitoring.

  2. The discovery of putative urine markers for the specific detection of prostate tumor by integrative mining of public genomic profiles.

    Directory of Open Access Journals (Sweden)

    Min Chen

    Full Text Available Urine has emerged as an attractive biofluid for the noninvasive detection of prostate cancer (PCa. There is a strong imperative to discover candidate urinary markers for the clinical diagnosis and prognosis of PCa. The rising flood of various omics profiles presents immense opportunities for the identification of prospective biomarkers. Here we present a simple and efficient strategy to derive candidate urine markers for prostate tumor by mining cancer genomic profiles from public databases. Prostate, bladder and kidney are three major tissues from which cellular matters could be released into urine. To identify urinary markers specific for PCa, upregulated entities that might be shed in exosomes of bladder cancer and kidney cancer are first excluded. Through the ontology-based filtering and further assessment, a reduced list of 19 entities encoding urinary proteins was derived as putative PCa markers. Among them, we have found 10 entities closely associated with the process of tumor cell growth and development by pathway enrichment analysis. Further, using the 10 entities as seeds, we have constructed a protein-protein interaction (PPI subnetwork and suggested a few urine markers as preferred prognostic markers to monitor the invasion and progression of PCa. Our approach is amenable to discover and prioritize potential markers present in a variety of body fluids for a spectrum of human diseases.

  3. Ascorbic acid surface modified TiO2-thin layers as a fully integrated analysis system for visual simultaneous detection of organophosphorus pesticides

    Science.gov (United States)

    Li, Shunxing; Liang, Wenjie; Zheng, Fengying; Lin, Xiaofeng; Cai, Jiabai

    2014-11-01

    TiO2 photocatalysis and colorimetric detection are coupled with thin layer chromatography (TLC) for the first time to develop a fully integrated analysis system. Titania@polystyrene hybrid microspheres were surface modified with ascorbic acid, denoted AA-TiO2@PS, and used as the stationary phase for TLC. Because the affinity between AA-TiO2@PS and organophosphorus pesticides (OPs) was different for different species of OPs (including chlopyrifos, malathion, parathion, parathion-methyl, and methamidophos), OPs could be separated simultaneously by the mobile phase in 12.0 min with different Rf values. After surface modification, the UV-vis wavelength response range of AA-TiO2@PS was expanded to 650 nm. Under visible-light irradiation, all of the OPs could be photodegraded to PO43- in 25.0 min. Based on the chromogenic reaction between PO43- and chromogenic agents (ammonium molybdate and ascorbic acid), OPs were quantified from color intensity images using a scanner in conjunction with image processing software. So, AA-TiO2@PS was respectively used as the stationary phase of TLC for efficient separation of OPs, as a photocatalyst for species transformation of phosphorus, and as a colorimetric probe for on-field simultaneous visual detection of OPs in natural water. Linear calibration curves for each OP ranged from 19.3 nmol P L-1 to 2.30 μmol P L-1. This integrated analysis system was simple, inexpensive, easy to operate, and sensitive.TiO2 photocatalysis and colorimetric detection are coupled with thin layer chromatography (TLC) for the first time to develop a fully integrated analysis system. Titania@polystyrene hybrid microspheres were surface modified with ascorbic acid, denoted AA-TiO2@PS, and used as the stationary phase for TLC. Because the affinity between AA-TiO2@PS and organophosphorus pesticides (OPs) was different for different species of OPs (including chlopyrifos, malathion, parathion, parathion-methyl, and methamidophos), OPs could be separated

  4. Encapsulation of Fluidic Tubing and Microelectrodes in Microfluidic Devices: Integrating Off-Chip Process and Coupling Conventional Capillary Electrophoresis with Electrochemical Detection.

    Science.gov (United States)

    Becirovic, Vedada; Doonan, Steven R; Martin, R Scott

    2013-08-21

    In this paper, an approach to fabricate epoxy or polystyrene microdevices with encapsulated tubing and electrodes is described. Key features of this approach include a fixed alignment between the fluidic tubing and electrodes, the ability to polish the device when desired, and the low dead volume nature of the fluidic interconnects. It is shown that a variety of tubing can be encapsulated with this approach, including fused silica capillary, polyetheretherketone (PEEK), and perfluoroalkoxy (PFA), with the resulting tubing/microchip interface not leading to significant band broadening or plug dilution. The applicability of the devices with embedded tubing is demonstrated by integrating several off-chip analytical methods to the microchip. This includes droplet transfer, droplet desegmentation, and microchip-based flow injection analysis. Off-chip generated droplets can be transferred to the microchip with minimal coalescence, while flow injection studies showed improved peak shape and sensitivity when compared to the use of fluidic interconnects with an appreciable dead volume. Importantly, it is shown that this low dead volume approach can be extended to also enable the integration of conventional capillary electrophoresis (CE) with electrochemical detection. This is accomplished by embedding fused silica capillary along with palladium (for grounding the electrophoresis voltage) and platinum (for detection) electrodes. With this approach, up to 128,000 theoretical plates for dopamine was possible. In all cases, the tubing and electrodes are housed in a rigid base; this results in extremely robust devices that will be of interest to researchers wanting to develop microchips for use by non-experts.

  5. Detection of premature browning in ground beef with an integrated optical-fibre based sensor using reflection spectroscopy and fibre Bragg grating technology

    International Nuclear Information System (INIS)

    O'Farrell, M; Sheridan, C; Lewis, E

    2007-01-01

    This paper reports on an optical fibre based sensor system to detect the occurrence of premature browning in ground beef. Premature browning (PMB) occurs when, at a temperature below the pasteurisation temperature of 71 deg. C, there are no traces of pink meat left in the patty. PMB is more frequent if poorer quality beef or beef that has been stored under imperfect conditions. The experimental work pertaining to this paper involved cooking fresh meat and meat that has been stored in a freezer for, 1 week, 1 month and 3 months and recording the reflected spectra and temperature at the core of the product, during the cooking process, in order to develop a classifier based on the spectral response and using a Self-Organising Map (SOM) to classify the patties into one of four categories, based on their colour. Further tests were also carried out on developing an all-optical fibre sensor for measuring both the temperature and colour in a single integrated probe. The integrated probe contains two different sensor concepts, one to monitor temperature, based on Fibre Bragg Grating (FBG) technology and a second for meat quality, based on reflection spectroscopy in the visible wavelength range

  6. Integrated hierarchical geo-environmental survey strategy applied to the detection and investigation of an illegal landfill: A case study in the Campania Region (Southern Italy).

    Science.gov (United States)

    Di Fiore, Vincenzo; Cavuoto, Giuseppe; Punzo, Michele; Tarallo, Daniela; Casazza, Marco; Guarriello, Silvio Marco; Lega, Massimiliano

    2017-10-01

    This paper describes an approach to detect and investigate the main characteristics of a solid waste landfill through the integration of geological, geographical and geophysical methods. In particular, a multi-temporal analysis of the landfill morphological evolution was carried out using aerial and satellite photos, since there were no geological and geophysical data referring to the study area. Subsequently, a surface geophysical prospection was performed through geoelectric and geomagnetic methods. In particular, the combination of electrical resistivity, induced polarization and magnetic measurements removed some of the uncertainties, generally associated with a separate utilization of these techniques. This approach was successfully tested to support the Prosecutor Office of Salerno (S Italy) during a specific investigation about an illegal landfill. All the collected field data supported the reconstruction of the site-specific history, while the real quarry geometry and site geology were defined. Key elements of novelty of this method are the combination and the integration of different methodological approaches, as the parallel and combined use of satellite, aerial and in-situ collected data, that were validated in a real investigation and that revealed the effectiveness of this strategy. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. A smartphone colorimetric reader integrated with an ambient light sensor and a 3D printed attachment for on-site detection of zearalenone.

    Science.gov (United States)

    Chen, Yuan; Fu, Qiangqiang; Li, Dagang; Xie, Jun; Ke, Dongxu; Song, Qifang; Tang, Yong; Wang, Hong

    2017-11-01

    Smartphone biosensors could be cost-effective, portable instruments to be used for the readout of liquid colorimetric assays. However, current reported smartphone colorimetric readers have relied on photos of liquid assays captured using a camera, and then analyzed using software programs. This approach results in a relatively low accuracy and low generality. In this work, we reported a novel smartphone colorimetric reader that has been integrated with an ambient light sensor and a 3D printed attachment for the readout of liquid colorimetric assays. The portable and low-cost ($0.15) reader utilized a simplified electronic and light path design. Furthermore, our reported smartphone colorimetric reader can be compatible with different smartphones. As a proof of principle, the utility of this device was demonstrated using it in conjunction with an enzyme-linked immunosorbent assay to detect zearalenone. Results were consistent with those obtained using a professional microplate reader. The developed smartphone colorimetric reader was capable of providing scalable, cost-effective, and accurate results for liquid colorimetric assays that related to clinical diagnoses, environment pollution, and food testing. Graphical abstract A novel smartphone colorimetric reader that has been integrated with an ambient light sensor and a 3D printed attachment for the readout of liquid colorimetric assays.

  8. Planar integrated optical waveguide used as a transducer to yield chemical information: detection of the activity of proteolytic enzymes e.g. serine-proteases

    Science.gov (United States)

    Zhylyak, Gleb; Ramoz-Perez, Victor; Linnhoff, Michael; Hug, Thomas; Citterio, Daniel; Spichiger-Keller, Ursula E.

    2005-03-01

    The paper shows the very first results of a feasibility study where the activity of proteolytic enzymes towards dye-labelled artificial substrates immobilized on the surface of planar optical Ta2O5 waveguide was investigated. Within this project, a chromophore label was developed, synthesized and attached to the carboxy-terminus of specific tripeptides. The goal was to develop a highly sensitive optical assay in order to monitor the activity of serine-proteases by cleavage of the amide bond between peptide and chromophore. On the one hand, a strategy was developed to immobilize the labeled tripeptide unto integrated planar waveguides. On the other hand, an instrument, the so-called "chip-reader" was developed to detect the biological process on the surface of the integrated planar optical waveguide. Surface characteristics were analyzed by XPS, TOF-SIMS and contact angle measurements. A comparison between the effectivity of ATR-photometry on chip using TE0 mode and photometry in transmission mode is discussed.

  9. An integrated analysis of micro- and macro-habitat features as a tool to detect weather-driven constraints: A case study with cavity nesters.

    Directory of Open Access Journals (Sweden)

    D Campobello

    Full Text Available The effects of climate change on animal populations may be shaped by habitat characteristics at both micro- and macro-habitat level, however, empirical studies integrating these two scales of observation are lacking. As analyses of the effects of climate change commonly rely on data from a much larger scale than the microhabitat level organisms are affected at, this mismatch risks hampering progress in developing understanding of the details of the ecological and evolutionary responses of organisms and, ultimately, effective actions to preserve their populations. Cavity nesters, often with a conservation status of concern, are an ideal model because the cavity is a microenvironment potentially different from the macroenvironment but nonetheless inevitably interacting with it. The lesser kestrel (Falco naumanni is a cavity nester which was until recently classified by as Vulnerable species. Since 2004, for nine years, we collected detailed biotic and abiotic data at both micro- and macro-scales of observation in a kestrel population breeding in the Gela Plain (Italy, a Mediterranean area where high temperatures may reach lethal values for the nest content. We show that macroclimatic features needed to be integrated with both abiotic and biotic factors recorded at a microscale before reliably predicting nest temperatures. Among the nest types used by lesser kestrels, we detected a preferential occupation of the cooler nest types, roof tiles, by early breeders whereas, paradoxically, late breeders nesting with hotter temperatures occupied the overheated nest holes. Not consistent with such a suggested nest selection, the coolest nest type did not host a higher reproductive success than the overheated nests. We discussed our findings in the light of cavity temperatures and nest types deployed within conservation actions assessed by integrating selected factors at different observation scales.

  10. An integrated analysis of micro- and macro-habitat features as a tool to detect weather-driven constraints: A case study with cavity nesters.

    Science.gov (United States)

    Campobello, D; Lindström, J; Di Maggio, R; Sarà, M

    2017-01-01

    The effects of climate change on animal populations may be shaped by habitat characteristics at both micro- and macro-habitat level, however, empirical studies integrating these two scales of observation are lacking. As analyses of the effects of climate change commonly rely on data from a much larger scale than the microhabitat level organisms are affected at, this mismatch risks hampering progress in developing understanding of the details of the ecological and evolutionary responses of organisms and, ultimately, effective actions to preserve their populations. Cavity nesters, often with a conservation status of concern, are an ideal model because the cavity is a microenvironment potentially different from the macroenvironment but nonetheless inevitably interacting with it. The lesser kestrel (Falco naumanni) is a cavity nester which was until recently classified by as Vulnerable species. Since 2004, for nine years, we collected detailed biotic and abiotic data at both micro- and macro-scales of observation in a kestrel population breeding in the Gela Plain (Italy), a Mediterranean area where high temperatures may reach lethal values for the nest content. We show that macroclimatic features needed to be integrated with both abiotic and biotic factors recorded at a microscale before reliably predicting nest temperatures. Among the nest types used by lesser kestrels, we detected a preferential occupation of the cooler nest types, roof tiles, by early breeders whereas, paradoxically, late breeders nesting with hotter temperatures occupied the overheated nest holes. Not consistent with such a suggested nest selection, the coolest nest type did not host a higher reproductive success than the overheated nests. We discussed our findings in the light of cavity temperatures and nest types deployed within conservation actions assessed by integrating selected factors at different observation scales.

  11. Amperometric detection of glucose in fruit juices with polypyrrole-based biosensor with an integrated permselective layer for exclusion of interferences.

    Science.gov (United States)

    Ayenimo, Joseph G; Adeloju, Samuel B

    2017-08-15

    A novel polypyrrole (PPy)-based bilayer amperometric glucose biosensor integrated with a permselective layer has been developed for detection of glucose in the presence of interferences. It comprises of a PPy-GOx film grown, in the absence of electrolyte, as an inner layer, and a permselective PPy-Cl film as an outer layer. The PPy-GOx/PPy-Cl bilayer biosensor was effective in rejecting 98% of ascorbic acid and 100% of glycine, glutamic acid and uric acid. With an outer layer thickness of 6.6nm, the bilayer biosensor gave nearly identical glucose response to that of a single layer PPy-GOx biosensor. The biosensor also exhibited good reproducibility (1.9% rsd, n=10), high stability (more than 2months), wide linear range (0.5-24mM), low K m (8.4mM), high I max (77.2μAcm -2 ), low detection limit (26.9μM) and good sensitivity (3.5μAcm -2 mM -1 ). The bilayer biosensor was successfully employed for glucose determination in various fruit juices. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Fully integrated graphene electronic biosensor for label-free detection of lead (II) ion based on G-quadruplex structure-switching.

    Science.gov (United States)

    Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu

    2017-03-15

    This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Forensic Drug Identification, Confirmation, and Quantification Using Fully Integrated Gas Chromatography with Fourier Transform Infrared and Mass Spectrometric Detection (GC-FT-IR-MS).

    Science.gov (United States)

    Lanzarotta, Adam; Lorenz, Lisa; Voelker, Sarah; Falconer, Travis M; Batson, JaCinta S

    2018-05-01

    This manuscript is a continuation of a recent study that described the use of fully integrated gas chromatography with direct deposition Fourier transform infrared detection and mass spectrometric detection (GC-FT-IR-MS) to identify and confirm the presence of sibutramine and AB-FUBINACA. The purpose of the current study was to employ the GC-FT-IR portion of the same instrument to quantify these compounds, thereby demonstrating the ability to identify, confirm, and quantify drug substances using a single GC-FT-IR-MS unit. The performance of the instrument was evaluated by comparing quantitative analytical figures of merit to those measured using an established, widely employed method for quantifying drug substances, high performance liquid chromatography with ultraviolet detection (HPLC-UV). The results demonstrated that GC-FT-IR was outperformed by HPLC-UV with regard to sensitivity, precision, and linear dynamic range (LDR). However, sibutramine and AB-FUBINACA concentrations measured using GC-FT-IR were not significantly different at the 95% confidence interval compared to those measured using HPLC-UV, which demonstrates promise for using GC-FT-IR as a semi-quantitative tool at the very least. The most significant advantage of GC-FT-IR compared to HPLC-UV is selectivity; a higher level of confidence regarding the identity of the analyte being quantified is achieved using GC-FT-IR. Additional advantages of using a single GC-FT-IR-MS instrument for identification, confirmation, and quantification are efficiency, increased sample throughput, decreased consumption of laboratory resources (solvents, chemicals, consumables, etc.), and thus cost.

  14. Study and characterization of an integrated circuit-deposited hydrogenated amorphous silicon sensor for the detection of particles and radiations; Etude et caracterisation d'un capteur en silicium amorphe hydrogene depose sur circuit integre pour la detection de particules et de rayonnements

    Energy Technology Data Exchange (ETDEWEB)

    Despeisse, M

    2006-03-15

    Next generation experiments at the European laboratory of particle physics (CERN) require particle detector alternatives to actual silicon detectors. This thesis presents a novel detector technology, which is based on the deposition of a hydrogenated amorphous silicon sensor on top of an integrated circuit. Performance and limitations of this technology have been assessed for the first time in this thesis in the context of particle detectors. Specific integrated circuits have been designed and the detector segmentation, the interface sensor-chip and the sensor leakage current have been studied in details. The signal induced by the track of an ionizing particle in the sensor has been characterized and results on the signal speed, amplitude and on the sensor resistance to radiation are presented. The results are promising regarding the use of this novel technology for radiation detection, though limitations have been shown for particle physics application. (author)

  15. Remote detection device and detection method therefor

    International Nuclear Information System (INIS)

    Kogure, Sumio; Yoshida, Yoji; Matsuo, Takashiro; Takehara, Hidetoshi; Kojima, Shinsaku.

    1997-01-01

    The present invention provides a non-destructive detection device for collectively, efficiently and effectively conducting maintenance and detection for confirming the integrity of a nuclear reactor by way of a shielding member for shielding radiation rays generated from an objective portion to be detected. Namely, devices for direct visual detection using an under water TV camera as a sensor, an eddy current detection using a coil as a sensor and each magnetic powder flow detection are integrated and applied collectively. Specifically, the visual detection by using the TV camera and the eddy current flaw detection are adopted together. The flaw detection with magnetic powder is applied as a means for confirming the results of the two kinds of detections by other method. With such procedures, detection techniques using respective specific theories are combined thereby enabling to enhance the accuracy for the evaluation of the detection. (I.S.)

  16. Improving tuberculosis case detection in underdeveloped multi-ethnic regions with high disease burden: a case study of integrated control program in China.

    Science.gov (United States)

    Li, Jun; Liu, Xiao-Qiu; Jiang, Shi-Wen; Li, Xue; Yu, Fei; Wang, Yan; Peng, Yong; Gu, Xiao-Ming; Sun, Yan-Ni; Zhang, Hui; Wang, Li-Xia

    2017-11-29

    In the underdeveloped multi-ethnic regions of China, high tuberculosis (TB) burden and regional inequity in access to healthcare service increase the challenge of achieving the End TB goals. Among all the provinces, the highest TB burden is reported in Xinjiang, where ethnic minorities and older people have suffered most. However, current case-finding strategy is inadequate given the complex social determinants and suboptimal case detection rates. Thus, we developed an integrated TB control program to improve case detection and conducted a pilot in Xinjiang from 2014 to 2015. In this case study, we summarized the activities and key findings. We also shared the experiences and challenges of implementing interventions and provided recommendations to inform the TB control program in the future. The pilot interventions were implemented in one selected town in Yining based on local TB control programs. By applying tailor-made educational materials, outreach TB educational activities were conducted in diverse ways. In 22 Masjids, the trained imams promoted TB education to the Muslims, covering 20,440 person-times in 88 delivered preaching sessions. In seven schools, 1944 students were educated by the teachers and contributed to educating 6929 family members. In the village communities, 13,073 residents participated in household education and screening. Among them, 12,292 people aged under 65 years were investigated for suspicious pulmonary TB symptoms, where six TB patients were diagnosed out of 89 TB suspects; 781 older people were mobilized for screening directly by chest X-ray, where 10 patients were diagnosed out of 692 participants. Supportive healthcare system, multi-sectoral cooperation and multi-channel financing mechanism were the successful experiences of implementation. The interventions were proved to be more effective than the previous performance: the number of TB suspects consulting doctors and patients detected increased by 50% and 26%, respectively

  17. INTEGRAL detection of the on-going outbursts from 1RXS J180408.9-342058 and GRO J1750-27

    DEFF Research Database (Denmark)

    Boissay, R.; Chenevez, J.; Wilms, J.

    2015-01-01

    index of 1.4+/-0.2 and a cut-off energy of 58+/-9 keV. The estimated fluxes from the spectral analysis were 2.1E-9 erg/cm^2/s in the 3-20 keV energy band and 2.2E-9 erg/cm^2/s in the 20-100 keV energy band. No type-I X-ray bursts were found in the JEM-X data by scanning the 3-10 keV lightcurve.......4E-10 erg/cm^2/s in the 20-60 keV energy band. The 3-10 keV flux estimated from the JEM-X mosaic is of roughly 7E-10 erg/cm^2/s. We also report on the continued detection of the outburst from IGR J17451-3022 (ATel #6451, ATel #7028). JEM-X confirms the detection of the source at 3.7 sigma for 20 ks...... effective exposure with a flux of 5.2 +/-1.6 mCrab between 3-10 keV (corresponding to roughly 7.3E-11 erg/cm^2/s). This is slightly below the flux (6.5 mCrab) the source had the last time INTEGRAL saw it at the end of October 2014. The source is still undetected above 10 keV at a 5-sigma upper limit of 2 m...

  18. Serendipitous offline learning in a neuromorphic robot

    CSIR Research Space (South Africa)

    Stewart, TC

    2016-02-01

    Full Text Available ) by turning right if it is present at an intersection, and otherwise turning left. In general, this system can learn arbitrary relations between sensory input and motor behavior....

  19. Story of Superconductivity: A Serendipitous Discovery

    Indian Academy of Sciences (India)

    , offered a glimmerof hope to make this dream possible. It was a discoverytotally unexpected at that time, and we owe this discovery tothe painstaking andmethodical investigations of Onnes – firstto produce very low temperatures, and then ...

  20. Serendipitous Offline Learning in a Neuromorphic Robot

    Directory of Open Access Journals (Sweden)

    Terrence C Stewart

    2016-02-01

    Full Text Available We demonstrate a hybrid neuromorphic learning paradigm that learns complex sensorimotor mappings based on a small set of hard-coded reflex behaviours. A mobile robot is first controlled by a basic set of reflexive hand-designed behaviours. All sensor data is provided via a spike-based silicon retina camera (eDVS, and all control is implemented via spiking neurons simulated on neuromorphic hardware (SpiNNaker. Given this control system, the robot is capable of simple obstacle avoidance and random exploration. To train the robot to perform more complex tasks, we observe the robot and find instances where he robot accidentally performs the desired action. Data recorded from the robot during these times is then used to update the neural control system, increasing the likelihood of the robot performing that task in the future, given a similar sensor state. As an example application of this general-purpose method of training, we demonstrate the robot learning to respond to novel sensory stimuli (a mirror by turning right if it is present at an intersection, and otherwise turning left. In general, this system can learn arbitrary relations between sensory input and motor behaviour.

  1. Serendipitous SEU hardening of resistive load SRAMs

    International Nuclear Information System (INIS)

    Koga, R.; Kirshman, J.F.; Pinkerton, S.D.; Hansel, S.J.; Crawford, K.B.; Crain, W.R.

    1996-01-01

    High and low resistive load versions of Micron Technology's MT5C1008C (128K x 8) and MT5C2561C (256K x 1) SRAMs were tested for SEU vulnerability. Contrary to computer simulation results, SEU susceptibility decreased with increasing resistive load. A substantially larger number of multiple-bit errors were observed for the low resistive load SRAMs, which also exhibited a 1 → 0 to 0 → 1 bit error ratio close to unity; in contrast, the high resistive load devices displayed a pronounced error bit polarity effect. Two distinct upset mechanisms are proposed to account for these observations

  2. Pipeline integrity management

    Energy Technology Data Exchange (ETDEWEB)

    Guyt, J.; Macara, C.

    1997-12-31

    This paper focuses on some of the issues necessary for pipeline operators to consider when addressing the challenge of managing the integrity of their systems. Topics are: Definition; business justification; creation and safeguarding of technical integrity; control and deviation from technical integrity; pipelines; pipeline failure assessment; pipeline integrity assessment; leak detection; emergency response. 6 figs., 3 tabs.

  3. Radiation damages during synchrotron X-ray micro-analyses of Prussian blue and zinc white historic paintings: detection, mitigation and integration

    Energy Technology Data Exchange (ETDEWEB)

    Gervais, Claire [Bern University of the Arts, Bern (Switzerland); Thoury, Mathieu [IPANEMA, USR 3461 CNRS/MCC, Synchrotron SOLEIL, Gif-sur-Yvette (France); Reguer, Solenn; Gueriau, Pierre [Synchrotron SOLEIL, Gif-sur-Yvette (France); Mass, Jennifer [Winterthur Museum and Country Estate, Conservation Department, Winterthur, DE (United States)

    2015-11-15

    High-flux synchrotron techniques allow microspectroscopic analyses of artworks that were not feasible even a few years ago, allowing for a more detailed characterization of their constituent materials and a better understanding of their chemistry. However, interaction between high-flux photons and matter at the sub-microscale can generate damages which are not visually detectable. We show here different methodologies allowing to evidence the damages induced by microscopic X-ray absorption near-edge structure spectroscopy analysis (μXANES) at the Fe and Zn K-edges of a painting dating from the turn of the twentieth century containing Prussian blue and zinc white. No significant degradation of the pigments was noticed, in agreement with the excellent condition of the painting. However, synchrotron radiation damages occurred at several levels, from chemical changes of the binder, modification of crystal defects in zinc oxide, to Prussian blue photoreduction. They could be identified by using both the μXANES signal during analysis and with photoluminescence imaging in the deep ultraviolet and visible ranges after analysis. We show that recording accurately damaged areas is a key step to prevent misinterpretation of results during future re-examination of the sample. We conclude by proposing good practices that could help in integrating radiation damage avoidance into the analytical pathway. (orig.)

  4. A multi-feature integration method for fatigue crack detection and crack length estimation in riveted lap joints using Lamb waves

    Science.gov (United States)

    He, Jingjing; Guan, Xuefei; Peng, Tishun; Liu, Yongming; Saxena, Abhinav; Celaya, Jose; Goebel, Kai

    2013-10-01

    This paper presents an experimental study of damage detection and quantification in riveted lap joints. Embedded lead zirconate titanate piezoelectric (PZT) ceramic wafer-type sensors are employed to perform in situ non-destructive evaluation (NDE) during fatigue cyclical loading. PZT wafers are used to monitor the wave reflection from the boundaries of the fatigue crack at the edge of bolt joints. The group velocity of the guided wave is calculated to select a proper time window in which the received signal contains the damage information. It is found that the fatigue crack lengths are correlated with three main features of the signal, i.e., correlation coefficient, amplitude change, and phase change. It was also observed that a single feature cannot be used to quantify the damage among different specimens since a considerable variability was observed in the response from different specimens. A multi-feature integration method based on a second-order multivariate regression analysis is proposed for the prediction of fatigue crack lengths using sensor measurements. The model parameters are obtained using training datasets from five specimens. The effectiveness of the proposed methodology is demonstrated using several lap joint specimens from different manufactures and under different loading conditions.

  5. A multi-feature integration method for fatigue crack detection and crack length estimation in riveted lap joints using Lamb waves

    International Nuclear Information System (INIS)

    He, Jingjing; Guan, Xuefei; Peng, Tishun; Liu, Yongming; Saxena, Abhinav; Celaya, Jose; Goebel, Kai

    2013-01-01

    This paper presents an experimental study of damage detection and quantification in riveted lap joints. Embedded lead zirconate titanate piezoelectric (PZT) ceramic wafer-type sensors are employed to perform in situ non-destructive evaluation (NDE) during fatigue cyclical loading. PZT wafers are used to monitor the wave reflection from the boundaries of the fatigue crack at the edge of bolt joints. The group velocity of the guided wave is calculated to select a proper time window in which the received signal contains the damage information. It is found that the fatigue crack lengths are correlated with three main features of the signal, i.e., correlation coefficient, amplitude change, and phase change. It was also observed that a single feature cannot be used to quantify the damage among different specimens since a considerable variability was observed in the response from different specimens. A multi-feature integration method based on a second-order multivariate regression analysis is proposed for the prediction of fatigue crack lengths using sensor measurements. The model parameters are obtained using training datasets from five specimens. The effectiveness of the proposed methodology is demonstrated using several lap joint specimens from different manufactures and under different loading conditions. (paper)

  6. Sensor Fusion of Position- and Micro-Sensors (MEMS) integrated in a Wireless Sensor Network for movement detection in landslide areas

    Science.gov (United States)

    Arnhardt, Christian; Fernández-Steeger, Tomas; Azzam, Rafig

    2010-05-01

    Monitoring systems in landslide areas are important elements of effective Early Warning structures. Data acquisition and retrieval allows the detection of movement processes and thus is essential to generate warnings in time. Apart from the precise measurement, the reliability of data is fundamental, because outliers can trigger false alarms and leads to the loss of acceptance of such systems. For the monitoring of mass movements and their risk it is important to know, if there is movement, how fast it is and how trustworthy is the information. The joint project "Sensorbased landslide early warning system" (SLEWS) deals with these questions, and tries to improve data quality and to reduce false alarm rates, due to the combination of sensor date (sensor fusion). The project concentrates on the development of a prototypic Alarm- and Early Warning system (EWS) for different types of landslides by using various low-cost sensors, integrated in a wireless sensor network (WSN). The network consists of numerous connection points (nodes) that transfer data directly or over other nodes (Multi-Hop) in real-time to a data collection point (gateway). From there all the data packages are transmitted to a spatial data infrastructure (SDI) for further processing, analyzing and visualizing with respect to end-user specifications. The ad-hoc characteristic of the network allows the autonomous crosslinking of the nodes according to existing connections and communication strength. Due to the independent finding of new or more stable connections (self healing) a breakdown of the whole system is avoided. The bidirectional data stream enables the receiving of data from the network but also allows the transfer of commands and pointed requests into the WSN. For the detection of surface deformations in landslide areas small low-cost Micro-Electro-Mechanical-Systems (MEMS) and positionsensors from the automobile industries, different industrial applications and from other measurement

  7. A Policy Analysis on the Proactive Prevention of Chronic Disease: Learnings from the Initial Implementation of Integrated Measurement for Early Detection (MIDO

    Directory of Open Access Journals (Sweden)

    Roberto Tapia-Conyer

    2017-06-01

    Full Text Available Mexico, like many low- and middle-income countries (LMICs, faces an epidemic of chronic non-communicable diseases (NCDs, specifically diabetes, hypertension, obesity, and lipid disorders. Many people with these NCDs may not be aware that they have a disease, pointing to the need for broader screening programs. The traditional prevention policy in Mexico was based on screening with a paper-based risk factor questionnaire. However, this was used to screen patients already seeking healthcare services at facilities, and screening goals were set as a function of the number of questionnaires applied, not number of individuals screened. Due to this, Fundación Carlos Slim developed Medición Integrada para la Detección Oportuna (MIDOTM, or Integrated Measurement for Early Detection, an NCD screening and proactive prevention policy. This document is a policy analysis based on early learnings from the initial implementation of MIDO in eight primary healthcare centers in two central Mexican states. MIDO was found to expand screening programs beyond clinic walls, systematize community screening strategies, emphasize the detection of pre-disease phases, incorporate lifestyle counseling, and propose screening goals based on population targets. In collaboration with the Mexican Ministry of Health, MIDO has successfully screened over 500 000 individuals—about 40% of whom would not have been screened under previous policies. Of these more than 500 000 screened individuals, 13.4% had pre-diabetes (fasting glucose between 100 and 125 mg/dL, and 5.8% had undiagnosed diabetes (defined as fasting glucose above 126 mg/dL or random glucose above 200 mg/dL. However, there is still room for improvement in linking positive results from screening with disease confirmation and with patient incorporation into disease management. The experience of implementing MIDO in Mexico suggests that primary and secondary prevention programs in other parts of the world should

  8. Infrared detection and photon energy up-conversion in graphene layer infrared photodetectors integrated with LEDs based on van der Waals heterostructures: Concept, device model, and characteristics

    Science.gov (United States)

    Ryzhii, V.; Otsuji, T.; Ryzhii, M.; Karasik, V. E.; Shur, M. S.

    2017-09-01

    We propose the concept of the infrared detection and photon energy up-conversion in the devices using the integration of the graphene layer infrared detectors (GLIPs) and the light emitting diodes (LEDs) based on van der Waals (vdW) heterostructures. Using the developed device model of the GLIP-LEDs, we calculate their characteristics. The GLIP-LED devices can operate as the detectors of far- and mid infrared radiation (FIR and MIR) with an electrical output or with near-infrared radiation (NIR) or visible radiation (VIR) output. In the latter case, GLIP-LED devices function as the photon energy up-converters of FIR and MIR to NIR or VIR. The operation of GLIP-LED devices is associated with the injection of the electron photocurrent produced due to the interband absorption of the FIR/MIR photons in the GLIP part into the LED emitting NIR/VIR photons. We calculate the GLIP-LED responsivity and up-conversion efficiency as functions the structure parameters and the energies of the incident FIR/MIR photons and the output NIR/VIR photons. The advantages of the GLs in the vdW heterostructures (relatively high photoexcitation rate from and low capture efficiency into GLs) combined with the reabsorption of a fraction of the NIR/FIR photon flux in the GLIP (which can enable an effective photonic feedback) result in the elevated GLIP-LED device responsivity and up-conversion efficiency. The positive optical feedback from the LED section of the device lead to increasing current injection enabling the appearance of the S-type current-voltage characteristic with a greatly enhanced responsivity near the switching point and current filamentation.

  9. Integrated Disease Investigations and Surveillance planning: a systems approach to strengthening national surveillance and detection of events of public health importance in support of the International Health Regulations

    Directory of Open Access Journals (Sweden)

    Kennedy Sarah

    2010-12-01

    Full Text Available Abstract The international community continues to define common strategic themes of actions to improve global partnership and international collaborations in order to protect our populations. The International Health Regulations (IHR[2005] offer one of these strategic themes whereby World Health Organization (WHO Member States and global partners engaged in biosecurity, biosurveillance and public health can define commonalities and leverage their respective missions and resources to optimize interventions. The U.S. Defense Threat Reduction Agency’s Cooperative Biologica Engagement Program (CBEP works with partner countries across clinical, veterinary, epidemiological, and laboratory communities to enhance national disease surveillance, detection, diagnostic, and reporting capabilities. CBEP, like many other capacity building programs, has wrestled with ways to improve partner country buy-in and ownership and to develop sustainable solutions that impact integrated disease surveillance outcomes. Designing successful implementation strategies represents a complex and challenging exercise and requires robust and transparent collaboration at the country level. To address this challenge, the Laboratory Systems Development Branch of the U.S. Centers for Disease Control and Prevention (CDC and CBEP have partnered to create a set of tools that brings together key leadership of the surveillance system into a deliberate system design process. This process takes into account strengths and limitations of the existing system, how the components inter-connect and relate to one another, and how they can be systematically refined within the local context. The planning tools encourage cross-disciplinary thinking, critical evaluation and analysis of existing capabilities, and discussions across organizational and departmental lines toward a shared course of action and purpose. The underlying concepts and methodology of these tools are presented here.

  10. Portable modular detection system

    Science.gov (United States)

    Brennan, James S [Rodeo, CA; Singh, Anup [Danville, CA; Throckmorton, Daniel J [Tracy, CA; Stamps, James F [Livermore, CA

    2009-10-13

    Disclosed herein are portable and modular detection devices and systems for detecting electromagnetic radiation, such as fluorescence, from an analyte which comprises at least one optical element removably attached to at least one alignment rail. Also disclosed are modular detection devices and systems having an integrated lock-in amplifier and spatial filter and assay methods using the portable and modular detection devices.

  11. Detection of single-nucleotide polymorphisms using an ON-OFF switching of regenerated biosensor based on a locked nucleic acid-integrated and toehold-mediated strand displacement reaction.

    Science.gov (United States)

    Gao, Zhong Feng; Ling, Yu; Lu, Lu; Chen, Ning Yu; Luo, Hong Qun; Li, Nian Bing

    2014-03-04

    Although various strategies have been reported for single-nucleotide polymorphisms (SNPs) detection, development of a time-saving, specific, and regenerated electrochemical sensing platform still remains a realistic goal. In this study, an ON-OFF switching of a regenerated biosensor based on a locked nucleic acid (LNA)-integrated and toehold-mediated strand displacement reaction technique is constructed for detection of SNPs. The LNA-integrated and methylene blue-labeled capture probe with an external toehold is designed to switch on the sensing system. The mutant-type DNA probe completes complementary with the capture probe to trigger the strand displacement reaction, which switches off the sensing system. However, when the single-base mismatched wild-type DNA probe is presented, the strand displacement reaction cannot be achieved; therefore, the sensing system still keeps the ON state. This DNA sensor is stable over five reuses. We further testify that the LNA-integrated sequence has better recognition ability for SNPs detection compared to the DNA-integrated sequence. Moreover, this DNA senor exhibits a remarkable discrimination capability of SNPs among abundant wild-type targets and 6000-fold (m/m) excess of genomic DNA. In addition, it is selective enough in complex and contaminant-ridden samples, such as human urine, soil, saliva, and beer. Overall, these results demonstrate that this reliable DNA sensor is easy to be fabricated, simple to operate, and stable enough to be readily regenerated.

  12. Clinical application of RT-nested PCR integrated with RFLP in Hantavirus detection and genotyping: a prospective study in Shandong Province, PR China.

    Science.gov (United States)

    Liu, Yun-Xi; Zhao, Zhong-Tang; Cao, Wu-Chun; Xu, Xiao-Qun; Suo, Ji-Jiang; Xing, Yu-Bin; Jia, Ning; Du, Ming-Mei; Liu, Bo-Wei; Yao, Yuan

    2013-01-01

    The aim of the present study was to evaluate the clinical usefulness of applying RT-nested PCR along with RFLP as a method for diagnosis and genotypic differentiation of Hantavirus in the acute-stage sera of HFRS patients as compared to the ELISA technique. A prospective study of patients with suspected HFRS patients was carried out. Sera were collected for serological evaluation by ELISA and RT-nested PCR testing. Primers were selected from the published sequence of the S segment of HTNV strain 76-118 and SEOV strain SR-11, which made it possible to obtain an amplicon of 403 bp by RT-nested PCR. The genotypic differentiations of the RT-nested PCR amplicons were carried out by RFLP. Sequence analyses of the amplicons were used to confirm the accuracy of the results obtained by RFLP. Of the 48 acute-stage sera from suspected HFRS patients, 35 were ELISA-positive while 41 were positive by RT-nested PCR. With Hind III and Hinf I, RFLP profiles of the RT-nested PCR amplicons of the 41 positive sera exhibited two patterns. 33 had RFLP profiles similar to the reference strain R22, and thus belonged to the SEOV type. The other 8 samples which were collected during October-December had RFLP profiles similar to the reference strain 76-118, and thus belonged to the HTNV type. Sequence phylogenetic analysis of RT-nested PCR amplicons revealed sdp1, sdp2 YXL-2008, and sdp3 as close relatives of HTNV strain 76-118, while sdp22 and sdp37 as close relatives of SEOV strain Z37 and strain R22 located in two separate clusters in the phylogenetic tree. These results were identical to those acquired by RFLP. RT-nested PCR integrated with RFLP was a rapid, simple, accurate method for detecting and differentiating the genotypes of Hantavirus in the acute-stage sera of suspected HFRS patients. In Shandong province, the main genotypes of Hantavirus belonged to the SEOV types, while the HTNV types were observed during the autumn-winter season.

  13. DISCOVERY OF A WOLF-RAYET STAR THROUGH DETECTION OF ITS PHOTOMETRIC VARIABILITY

    Energy Technology Data Exchange (ETDEWEB)

    Littlefield, Colin [Law School, University of Notre Dame, Notre Dame, IN 46556 (United States); Garnavich, Peter; McClelland, Colin; Rettig, Terrence [Physics Department, University of Notre Dame, Notre Dame, IN 46556 (United States); Marion, G. H. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Vinko, Jozsef [Department of Optics, University of Szeged (Hungary); Wheeler, J. Craig [Astronomy Department, University of Texas, Austin, TX 78712 (United States)

    2012-06-15

    We report the serendipitous discovery of a heavily reddened Wolf-Rayet star that we name WR 142b. While photometrically monitoring a cataclysmic variable, we detected weak variability in a nearby field star. Low-resolution spectroscopy revealed a strong emission line at 7100 A, suggesting an unusual object and prompting further study. A spectrum taken with the Hobby-Eberly Telescope confirms strong He II emission and an N IV 7112 A line consistent with a nitrogen-rich Wolf-Rayet star of spectral class WN6. Analysis of the He II line strengths reveals no detectable hydrogen in WR 142b. A blue-sensitive spectrum obtained with the Large Binocular Telescope shows no evidence for a hot companion star. The continuum shape and emission line ratios imply a reddening of E(B - V) = 2.2-2.6 mag. We estimate that the distance to WR 142b is 1.4 {+-} 0.3 kpc.

  14. A multi-feature integration method for fatigue crack detection and crack length estimation in riveted lap joints using Lamb waves

    Data.gov (United States)

    National Aeronautics and Space Administration — This paper presents an experimental study of damage detection and quantification in riveted lap joints. Embedded lead zirconate titanate piezoelectric (PZT) ceramic...

  15. Integration of agglutination assay for protein detection in microfluidic disc using Blu-ray optical pickup unit and optical fluid scanning

    DEFF Research Database (Denmark)

    Uddin, Rokon; Burger, Robert; Donolato, Marco

    2015-01-01

    We present a novel strategy for thrombin detection by combining a magnetic bead based agglutination assay and low-cost microfluidic disc. The detection method is based on an optomagnetic readout system implemented using a Blu-ray optical pickup unit (OPU) as main optoelectronic component. The ass...

  16. Integrated interpretation of 3D seismic data to enhance the detection of the gold-bearing reef: Mponeng Gold mine, Witwatersrand Basin (South Africa)

    CSIR Research Space (South Africa)

    Manzi, M

    2015-07-01

    Full Text Available The authors present an integrated approach to the seismic interpretation of one of the world's deepest gold ore body (Carbon Leader Reef) using three-dimensional seismic data, ultrasonic velocity measurements at elevated stresses, and modified...

  17. Integral or integrated marketing

    Directory of Open Access Journals (Sweden)

    Davčik Nebojša

    2006-01-01

    Full Text Available Marketing theorists and experts try to develop business efficient organization and to get marketing performance at higher, business integrated level since its earliest beginnings. The core issue in this paperwork is the dialectic and practical approach dilemma should we develop integrated or integral marketing approach in the organization. The presented company cases as well as dialectic and functional explanations of this dilemma clearly shows that integrated marketing is narrower approach than integral marketing if we take as focal point new, unique and completed entity. In the integration the essence is in getting different parts together, which do not have to make necessary the new entity. The key elements in the definition of the integral marketing are necessity and holistic, e.g. necessity to develop new, holistic entity.

  18. The use of a new PMOS monolithic integrated circuit for the electronic equipment of a large multiwire proportional chamber (MWPC) detection system

    International Nuclear Information System (INIS)

    Bareyre, P.; Borgeaud, P.; Poinsignon, J.; Billion, B.

    1975-01-01

    A new monolithic 8-channel PMOS integrated circuit has been developed for an experiment to be carried out on the CERN 300 GeV accelerator. The circuit, read-out electronics and tests performed on 12 large MWPCs (total of 48 000 channels) are described and the results are presented. (Auth.)

  19. Applicability of integrated cell culture quantitative PCR (ICC-qPCR) for the detection of infectious adenovirus type 2 in UV disinfection studies

    Science.gov (United States)

    Human adenovirus is relatively resistant to UV radiation and has been used as a conservative testing microbe for evaluations of UV disinfection systems as components of water treatment processes. In this study, we attempted to validate the applicability of integrated cell culture...

  20. An automated three-dimensional detection and segmentation method for touching cells by integrating concave points clustering and random walker algorithm.

    Directory of Open Access Journals (Sweden)

    Yong He

    Full Text Available Characterizing cytoarchitecture is crucial for understanding brain functions and neural diseases. In neuroanatomy, it is an important task to accurately extract cell populations' centroids and contours. Recent advances have permitted imaging at single cell resolution for an entire mouse brain using the Nissl staining method. However, it is difficult to precisely segment numerous cells, especially those cells touching each other. As presented herein, we have developed an automated three-dimensional detection and segmentation method applied to the Nissl staining data, with the following two key steps: 1 concave points clustering to determine the seed points of touching cells; and 2 random walker segmentation to obtain cell contours. Also, we have evaluated the performance of our proposed method with several mouse brain datasets, which were captured with the micro-optical sectioning tomography imaging system, and the datasets include closely touching cells. Comparing with traditional detection and segmentation methods, our approach shows promising detection accuracy and high robustness.

  1. Probability of Detection (POD) Analysis for the Advanced Retirement for Cause (RFC)/Engine Structural Integrity Program (ENSIP) Nondestructive Evaluation (NDE) System-Volume 3: Material Correlation Study

    National Research Council Canada - National Science Library

    Berens, Alan

    2000-01-01

    .... Volume 1 presents a description of changes made to the probability of detection (POD) analysis program of Mil-STD-1823 and the statistical evaluation of modifications that were made to version 3 of the Eddy Current Inspection System (ECIS v3...

  2. Integrating early detection with DNA barcoding: species identification of a non-native monitor lizard (Squamata: Varanidae) carcass in Mississippi, U.S.A.

    Science.gov (United States)

    Reed, Robert N.; Hopken, Matthew W.; Steen, David A.; Falk, Bryan G.; Piaggio, Antoinette J.

    2016-01-01

    Early detection of invasive species is critical to increasing the probability of successful management. At the primary stage of an invasion, invasive species are easier to control as the population is likely represented by just a few individuals. Detection of these first few individuals can be challenging, particularly if they are cryptic or otherwise characterized by low detectability. The engagement of members of the public may be critical to early detection as there are far more citizen s on the landscape than trained biologists. However, it can be difficult to assess the credibility of public reporting, especially when a diagnostic digital image or a physical specimen in good condition are lacking. DNA barcoding can be used for verification when morphological identification of a specimen is not possible or uncertain (i.e., degraded or partial specimen). DNA barcoding relies on obtaining a DNA sequence from a relatively small fragment of mitochondrial DNA and comparing it to a database of sequences containing a variety of expertly identified species. He rein we report the successful identification of a degraded specimen of a non-native, potentially invasive reptile species (Varanus niloticus) via DNA barcoding, after discovery and reporting by a member of the public.

  3. Theoretical and experimental work on steam generator integrity and reliability with particular reference to leak development and detection. United Kingdom status report. October 1983

    International Nuclear Information System (INIS)

    Smedley, J.A.; Edge, D.M.

    1984-01-01

    This paper reviews the experimental and theoretical work in the UK on the characteristics of sodium-water reactions and describes work on the development of leak detection systems. A review of the operating experience with the PFR steam generators and the protection philosophy used on PFR is also given and the design studies for the Commercial Demonstration Fast Reactor (CDFR) are described

  4. A novel photoelectrochemical immunosensor by integration of nanobody and ZnO nanorods for sensitive detection of nucleoside diphosphatase kinase-A

    International Nuclear Information System (INIS)

    Liu, Anran; Yin, Kaifei; Mi, Li; Ma, Mengyao; Liu, Yuanjian; Li, Ying; Wei, Wei; Zhang, Yuanjian; Liu, Songqin

    2017-01-01

    Nucleoside diphosphatase kinase A (NDPK-A) is a metastasis-suppressor protein and a biomarker that act on a wide range cancer cells to inhibit the potential metastasis. Herein, we present a simple photoelectrochemical immunosensor based on ZnO nanorod arrays for the sensitive detection of NDPK-A. The ZnO nanorod arrays cosensitized with CdS nanoparticles and Mn 2+ displayed a high and stable photocurrent response under irradiation. After anti-NPDK-A nanobodies were immobilized to the ZnO nanorod arrays, the proposed immunosensor can be utilized for detecting NPDK-A by monitoring the changes in the photocurrent signals of the electrode resulting from immunoreaction. Accordingly, the well-designed immunosensor exhibited a low limit of detection (LOD) of 0.3 pg mL −1 and a wide linear range from 0.5 pg mL −1 to 10 μg mL −1 . The R 2 of the regression curve is 0.99782. Meanwhile, the good stability, reproducibility and specificity of the resulting photoelectrochemical biosensor are demonstrated. In addition, the presented work would offer a novel and simple approach for the detection of immunoreactions and provide new insights in popularizing the diagnosis of NPDK-A. - Highlights: • A photoelectrochemical immunosensor based on ZnO NAs and NBs was fabricated. • Cosensitized structure of ZnO NAs, CdS and Mn improved the photocurrent response. • An excellent sensitivity and selectivity of NDPK-A detection was obtained.

  5. A novel photoelectrochemical immunosensor by integration of nanobody and ZnO nanorods for sensitive detection of nucleoside diphosphatase kinase-A

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Anran, E-mail: liuar@seu.edu.cn; Yin, Kaifei; Mi, Li; Ma, Mengyao; Liu, Yuanjian; Li, Ying; Wei, Wei; Zhang, Yuanjian; Liu, Songqin

    2017-06-22

    Nucleoside diphosphatase kinase A (NDPK-A) is a metastasis-suppressor protein and a biomarker that act on a wide range cancer cells to inhibit the potential metastasis. Herein, we present a simple photoelectrochemical immunosensor based on ZnO nanorod arrays for the sensitive detection of NDPK-A. The ZnO nanorod arrays cosensitized with CdS nanoparticles and Mn{sup 2+} displayed a high and stable photocurrent response under irradiation. After anti-NPDK-A nanobodies were immobilized to the ZnO nanorod arrays, the proposed immunosensor can be utilized for detecting NPDK-A by monitoring the changes in the photocurrent signals of the electrode resulting from immunoreaction. Accordingly, the well-designed immunosensor exhibited a low limit of detection (LOD) of 0.3 pg mL{sup −1} and a wide linear range from 0.5 pg mL{sup −1} to 10 μg mL{sup −1}. The R{sup 2} of the regression curve is 0.99782. Meanwhile, the good stability, reproducibility and specificity of the resulting photoelectrochemical biosensor are demonstrated. In addition, the presented work would offer a novel and simple approach for the detection of immunoreactions and provide new insights in popularizing the diagnosis of NPDK-A. - Highlights: • A photoelectrochemical immunosensor based on ZnO NAs and NBs was fabricated. • Cosensitized structure of ZnO NAs, CdS and Mn improved the photocurrent response. • An excellent sensitivity and selectivity of NDPK-A detection was obtained.

  6. Managing for Organizational Integrity.

    Science.gov (United States)

    Paine, Lynn Sharp

    1994-01-01

    Compliance-based ethics programs focus on prevention, detection, and punishment. Companies should adopt an integrity-based approach to ethics management that combines a concern for the law with an emphasis on managerial responsibility for ethical behavior. (JOW)

  7. Integral-preserving integrators

    International Nuclear Information System (INIS)

    McLaren, D I; Quispel, G R W

    2004-01-01

    Ordinary differential equations having a first integral may be solved numerically using one of several methods, with the integral preserved to machine accuracy. One such method is the discrete gradient method. It is shown here that the order of the method can be bootstrapped repeatedly to higher orders of accuracy. The method is illustrated using the Henon-Heiles system. (letter to the editor)

  8. INTEGRAL Galactic Plane Scans detect enhanced activity from the HMXBs IGR J19294+1816 and 4U 1909+07

    DEFF Research Database (Denmark)

    Drave, S. P.; Sguera, V.; Fiocchi, M.

    2013-01-01

    exposures of ~7.9 and ~2.9 ks respectively but neither were detected, with 6sigma flux upper limits of 6 mCrab and 8 mCrab in the 3-10 keV band respectively. 4U 1909+07 is a wind-fed SgXRB pulsar whose past variability is consistent with the enhanced flux detected in these observations. IGR J19294......+1816 is a likely BeXRB pulsar that displays recurrent outbursts, of an approximate duration of 2 months (Bozzo et al. 2011, A&A, 531, A65), modulated on the 117.2 day orbital period (Corbet and Krimm 2009, ATel #2008) along with additional fast flaring behaviour, more typical of Supergiant Fast X-ray Transients...

  9. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  10. Integrated site-specific quantification of faecal bacteria and detection of DNA markers in faecal contamination source tracking as a microbial risk tracking tool in urban Lake ecosystems

    Science.gov (United States)

    Donde, Oscar Omondi; Tian, Cuicui; Xiao, Bangding

    2017-11-01

    The presence of feacal-derived pathogens in water is responsible for several infectious diseases and deaths worldwide. As a solution, sources of fecal pollution in waters must be accurately assessed, properly determined and strictly controlled. However, the exercise has remained challenging due to the existing overlapping characteristics by different members of faecal coliform bacteria and the inadequacy of information pertaining to the contribution of seasonality and weather condition on tracking the possible sources of pollution. There are continued efforts to improve the Faecal Contamination Source Tracking (FCST) techniques such as Microbial Source Tracking (MST). This study aimed to make contribution to MST by evaluating the efficacy of combining site specific quantification of faecal contamination indicator bacteria and detection of DNA markers while accounting for seasonality and weather conditions' effects in tracking the major sources of faecal contamination in a freshwater system (Donghu Lake, China). The results showed that the use of cyd gene in addition to lacZ and uidA genes differentiates E. coli from other closely related faecal bacteria. The use of selective media increases the pollution source tracking accuracy. BSA addition boosts PCR detection and increases FCST efficiency. Seasonality and weather variability also influence the detection limit for DNA markers.

  11. Detection of Ca2+-dependent acid phosphatase activity identifies neuronal integrity in damaged rat central nervous system after application of bacterial melanin

    Directory of Open Access Journals (Sweden)

    Tigran R Petrosyan

    2016-01-01

    Full Text Available The study aims to confirm the neuroregenerative effects of bacterial melanin (BM on central nervous system injury using a special staining method based on the detection of Ca2+-dependent acid phosphatase activity. Twenty-four rats were randomly assigned to undergo either unilateral destruction of sensorimotor cortex (group I; n = 12 or unilateral rubrospinal tract transection at the cervical level (C3–4 (group II; n = 12. In each group, six rats were randomly selected after surgery to undergo intramuscular injection of BM solution (BM subgroup and the remaining six rats were intramuscularly injected with saline (saline subgroup. Neurological testing confirmed that BM accelerated the recovery of motor function in rats from both BM and saline subgroups. Two months after surgery, Ca2+-dependent acid phosphatase activity detection in combination with Chilingarian's calcium adenoside triphosphate method revealed that BM stimulated the sprouting of fibers and dilated the capillaries in the brain and spinal cord. These results suggest that BM can promote the recovery of motor function of rats with central nervous system injury; and detection of Ca2+-dependent acid phosphatase activity is a fast and easy method used to study the regeneration-promoting effects of BM on the injured central nervous system.

  12. Genetic control of functional traits related to photosynthesis and water use efficiency in Pinus pinaster Ait. drought response: integration of genome annotation, allele association and QTL detection for candidate gene identification.

    Science.gov (United States)

    de Miguel, Marina; Cabezas, José-Antonio; de María, Nuria; Sánchez-Gómez, David; Guevara, María-Ángeles; Vélez, María-Dolores; Sáez-Laguna, Enrique; Díaz, Luis-Manuel; Mancha, Jose-Antonio; Barbero, María-Carmen; Collada, Carmen; Díaz-Sala, Carmen; Aranda, Ismael; Cervera, María-Teresa

    2014-06-12

    Understanding molecular mechanisms that control photosynthesis and water use efficiency in response to drought is crucial for plant species from dry areas. This study aimed to identify QTL for these traits in a Mediterranean conifer and tested their stability under drought. High density linkage maps for Pinus pinaster were used in the detection of QTL for photosynthesis and water use efficiency at three water irrigation regimes. A total of 28 significant and 27 suggestive QTL were found. QTL detected for photochemical traits accounted for the higher percentage of phenotypic variance. Functional annotation of genes within the QTL suggested 58 candidate genes for the analyzed traits. Allele association analysis in selected candidate genes showed three SNPs located in a MYB transcription factor that were significantly associated with efficiency of energy capture by open PSII reaction centers and specific leaf area. The integration of QTL mapping of functional traits, genome annotation and allele association yielded several candidate genes involved with molecular control of photosynthesis and water use efficiency in response to drought in a conifer species. The results obtained highlight the importance of maintaining the integrity of the photochemical machinery in P. pinaster drought response.

  13. A 40 GHz fully integrated circuit with a vector network analyzer and a coplanar-line-based detection area for circulating tumor cell analysis using 65 nm CMOS technology

    Science.gov (United States)

    Nakanishi, Taiki; Matsunaga, Maya; Kobayashi, Atsuki; Nakazato, Kazuo; Niitsu, Kiichi

    2018-03-01

    A 40-GHz fully integrated CMOS-based circuit for circulating tumor cells (CTC) analysis, consisting of an on-chip vector network analyzer (VNA) and a highly sensitive coplanar-line-based detection area is presented in this paper. In this work, we introduce a fully integrated architecture that eliminates unwanted parasitic effects. The proposed analyzer was designed using 65 nm CMOS technology, and SPICE and MWS simulations were used to validate its operation. The simulation confirmed that the proposed circuit can measure S-parameter shifts resulting from the addition of various types of tumor cells to the detection area, the data of which are provided in a previous study: the |S 21| values for HepG2, A549, and HEC-1-A cells are -0.683, -0.580, and -0.623 dB, respectively. Additionally, the measurement demonstrated an S-parameters reduction of -25.7% when a silicone resin was put on the circuit. Hence, the proposed system is expected to contribute to cancer diagnosis.

  14. A novel photoelectrochemical immunosensor by integration of nanobody and TiO2 nanotubes for sensitive detection of serum cystatin C

    International Nuclear Information System (INIS)

    Mi, Li; Wang, Pingyan; Yan, Junrong; Qian, Jing; Lu, Jusheng; Yu, Jiachao; Wang, Yuzhen; Liu, Hong; Zhu, Min; Wan, Yakun; Liu, Songqin

    2016-01-01

    Cystatin C (CysC) is a sensitive marker for the estimation of the glomerular filtration rate and the clinical diagnosis of different diseases. In this paper, CysC-specific nanobodies (Nbs) were isolated from a phage display nanobody library. A simple and sensitive photoelectrochemical immunosensor based on TiO 2 nanotube arrays (TNAs) was proposed for the sensitive detection of CysC. The TiO 2 nanotube arrays deposited by electrochemical anodization displayed a high and stable photocurrent response under irradiation. After coupling CysC-specific nanobody to TNA (Nb/TNA), the proposed immunosensor for CysC can be utilized for tracking the photocurrent change of Nb/TNA caused by immunoreactions between CysC and the immobilized CysC-specific Nb. This allowed for the determination of CysC with a calibration range from 0.72 pM to 7.19 nM. The variation of the photocurrent was in a linear relationship with the logarithm of the CysC concentration in the range of 0.72 pM–3.6 nM. The immunosensor had a correlation coefficient of 0.97 and a detection limit of 0.14 pM at a signal-to-noise ratio of 3. The proposed immunosensor showed satisfactory intra- and inter-assay accuracy, high selectivity and good stability. As a result, this proposed strategy would offer a novel and simple approach for the detection of immunoreactions, provide new insights in popularizing the diagnosis of CysC, and extend the application of TiO 2 nanotubes. - Highlights: • CysC-specific nanobody to CysC is isolated from phage display nanobody library. • A photoelectrochemical immunosensor for CysC develops by Nb modified TNA. • An excellent sensitivity and good selectivity of CysC sensing was obtained.

  15. A novel photoelectrochemical immunosensor by integration of nanobody and TiO{sub 2} nanotubes for sensitive detection of serum cystatin C

    Energy Technology Data Exchange (ETDEWEB)

    Mi, Li [School of Chemistry and Chemical Engineering, Southeast University, Nanjing 211189 (China); Wang, Pingyan; Yan, Junrong [Institute of Materia Medica, Chinese Academy of Sciences, Shanghai 201203 (China); Qian, Jing; Lu, Jusheng; Yu, Jiachao [School of Chemistry and Chemical Engineering, Southeast University, Nanjing 211189 (China); Wang, Yuzhen; Liu, Hong [Plexera LLC, WA 98072 (United States); Zhu, Min [Institute of Materia Medica, Chinese Academy of Sciences, Shanghai 201203 (China); Wan, Yakun, E-mail: ywansystemsbiology@gmail.com [Institute of Materia Medica, Chinese Academy of Sciences, Shanghai 201203 (China); Jiangsu Nanobody Engineering and Research Center, Nantong 226010 (China); Liu, Songqin, E-mail: liusq@seu.edu.cn [School of Chemistry and Chemical Engineering, Southeast University, Nanjing 211189 (China)

    2016-01-01

    Cystatin C (CysC) is a sensitive marker for the estimation of the glomerular filtration rate and the clinical diagnosis of different diseases. In this paper, CysC-specific nanobodies (Nbs) were isolated from a phage display nanobody library. A simple and sensitive photoelectrochemical immunosensor based on TiO{sub 2} nanotube arrays (TNAs) was proposed for the sensitive detection of CysC. The TiO{sub 2} nanotube arrays deposited by electrochemical anodization displayed a high and stable photocurrent response under irradiation. After coupling CysC-specific nanobody to TNA (Nb/TNA), the proposed immunosensor for CysC can be utilized for tracking the photocurrent change of Nb/TNA caused by immunoreactions between CysC and the immobilized CysC-specific Nb. This allowed for the determination of CysC with a calibration range from 0.72 pM to 7.19 nM. The variation of the photocurrent was in a linear relationship with the logarithm of the CysC concentration in the range of 0.72 pM–3.6 nM. The immunosensor had a correlation coefficient of 0.97 and a detection limit of 0.14 pM at a signal-to-noise ratio of 3. The proposed immunosensor showed satisfactory intra- and inter-assay accuracy, high selectivity and good stability. As a result, this proposed strategy would offer a novel and simple approach for the detection of immunoreactions, provide new insights in popularizing the diagnosis of CysC, and extend the application of TiO{sub 2} nanotubes. - Highlights: • CysC-specific nanobody to CysC is isolated from phage display nanobody library. • A photoelectrochemical immunosensor for CysC develops by Nb modified TNA. • An excellent sensitivity and good selectivity of CysC sensing was obtained.

  16. Evaluation of epidemic intelligence systems integrated in the early alerting and reporting project for the detection of A/H5N1 influenza events.

    Directory of Open Access Journals (Sweden)

    Philippe Barboza

    Full Text Available The objective of Web-based expert epidemic intelligence systems is to detect health threats. The Global Health Security Initiative (GHSI Early Alerting and Reporting (EAR project was launched to assess the feasibility and opportunity for pooling epidemic intelligence data from seven expert systems. EAR participants completed a qualitative survey to document epidemic intelligence strategies and to assess perceptions regarding the systems performance. Timeliness and sensitivity were rated highly illustrating the value of the systems for epidemic intelligence. Weaknesses identified included representativeness, completeness and flexibility. These findings were corroborated by the quantitative analysis performed on signals potentially related to influenza A/H5N1 events occurring in March 2010. For the six systems for which this information was available, the detection rate ranged from 31% to 38%, and increased to 72% when considering the virtual combined system. The effective positive predictive values ranged from 3% to 24% and F1-scores ranged from 6% to 27%. System sensitivity ranged from 38% to 72%. An average difference of 23% was observed between the sensitivities calculated for human cases and epizootics, underlining the difficulties in developing an efficient algorithm for a single pathology. However, the sensitivity increased to 93% when the virtual combined system was considered, clearly illustrating complementarities between individual systems. The average delay between the detection of A/H5N1 events by the systems and their official reporting by WHO or OIE was 10.2 days (95% CI: 6.7-13.8. This work illustrates the diversity in implemented epidemic intelligence activities, differences in system's designs, and the potential added values and opportunities for synergy between systems, between users and between systems and users.

  17. Evaluation of Epidemic Intelligence Systems Integrated in the Early Alerting and Reporting Project for the Detection of A/H5N1 Influenza Events

    Science.gov (United States)

    Barboza, Philippe; Vaillant, Laetitia; Mawudeku, Abla; Nelson, Noele P.; Hartley, David M.; Madoff, Lawrence C.; Linge, Jens P.; Collier, Nigel; Brownstein, John S.; Yangarber, Roman; Astagneau, Pascal; on behalf of the Early Alerting, Reporting Project of the Global Health Security Initiative

    2013-01-01

    The objective of Web-based expert epidemic intelligence systems is to detect health threats. The Global Health Security Initiative (GHSI) Early Alerting and Reporting (EAR) project was launched to assess the feasibility and opportunity for pooling epidemic intelligence data from seven expert systems. EAR participants completed a qualitative survey to document epidemic intelligence strategies and to assess perceptions regarding the systems performance. Timeliness and sensitivity were rated highly illustrating the value of the systems for epidemic intelligence. Weaknesses identified included representativeness, completeness and flexibility. These findings were corroborated by the quantitative analysis performed on signals potentially related to influenza A/H5N1 events occurring in March 2010. For the six systems for which this information was available, the detection rate ranged from 31% to 38%, and increased to 72% when considering the virtual combined system. The effective positive predictive values ranged from 3% to 24% and F1-scores ranged from 6% to 27%. System sensitivity ranged from 38% to 72%. An average difference of 23% was observed between the sensitivities calculated for human cases and epizootics, underlining the difficulties in developing an efficient algorithm for a single pathology. However, the sensitivity increased to 93% when the virtual combined system was considered, clearly illustrating complementarities between individual systems. The average delay between the detection of A/H5N1 events by the systems and their official reporting by WHO or OIE was 10.2 days (95% CI: 6.7–13.8). This work illustrates the diversity in implemented epidemic intelligence activities, differences in system's designs, and the potential added values and opportunities for synergy between systems, between users and between systems and users. PMID:23472077

  18. Pulse-Driven Capacitive Lead Ion Detection with Reduced Graphene Oxide Field-Effect Transistor Integrated with an Analyzing Device for Rapid Water Quality Monitoring.

    Science.gov (United States)

    Maity, Arnab; Sui, Xiaoyu; Tarman, Chad R; Pu, Haihui; Chang, Jingbo; Zhou, Guihua; Ren, Ren; Mao, Shun; Chen, Junhong

    2017-11-22

    Rapid and real-time detection of heavy metals in water with a portable microsystem is a growing demand in the field of environmental monitoring, food safety, and future cyber-physical infrastructure. Here, we report a novel ultrasensitive pulse-driven capacitance-based lead ion sensor using self-assembled graphene oxide (GO) monolayer deposition strategy to recognize the heavy metal ions in water. The overall field-effect transistor (FET) structure consists of a thermally reduced graphene oxide (rGO) channel with a thin layer of Al 2 O 3 passivation as a top gate combined with sputtered gold nanoparticles that link with the glutathione (GSH) probe to attract Pb 2+ ions in water. Using a preprogrammed microcontroller, chemo-capacitance based detection of lead ions has been demonstrated with this FET sensor. With a rapid response (∼1-2 s) and negligible signal drift, a limit of detection (LOD) water stabilization followed by lead ion testing and calculation is much shorter than common FET resistance/current measurements (∼minutes) and other conventional methods, such as optical and inductively coupled plasma methods (∼hours). An approximate linear operational range (5-20 ppb) around 15 ppb (the maximum contaminant limit by US Environmental Protection Agency (EPA) for lead in drinking water) makes it especially suitable for drinking water quality monitoring. The validity of the pulse method is confirmed by quantifying Pb 2+ in various real water samples such as tap, lake, and river water with an accuracy ∼75%. This capacitance measurement strategy is promising and can be readily extended to various FET-based sensor devices for other targets.

  19. Evaluation of epidemic intelligence systems integrated in the early alerting and reporting project for the detection of A/H5N1 influenza events.

    Science.gov (United States)

    Barboza, Philippe; Vaillant, Laetitia; Mawudeku, Abla; Nelson, Noele P; Hartley, David M; Madoff, Lawrence C; Linge, Jens P; Collier, Nigel; Brownstein, John S; Yangarber, Roman; Astagneau, Pascal

    2013-01-01

    The objective of Web-based expert epidemic intelligence systems is to detect health threats. The Global Health Security Initiative (GHSI) Early Alerting and Reporting (EAR) project was launched to assess the feasibility and opportunity for pooling epidemic intelligence data from seven expert systems. EAR participants completed a qualitative survey to document epidemic intelligence strategies and to assess perceptions regarding the systems performance. Timeliness and sensitivity were rated highly illustrating the value of the systems for epidemic intelligence. Weaknesses identified included representativeness, completeness and flexibility. These findings were corroborated by the quantitative analysis performed on signals potentially related to influenza A/H5N1 events occurring in March 2010. For the six systems for which this information was available, the detection rate ranged from 31% to 38%, and increased to 72% when considering the virtual combined system. The effective positive predictive values ranged from 3% to 24% and F1-scores ranged from 6% to 27%. System sensitivity ranged from 38% to 72%. An average difference of 23% was observed between the sensitivities calculated for human cases and epizootics, underlining the difficulties in developing an efficient algorithm for a single pathology. However, the sensitivity increased to 93% when the virtual combined system was considered, clearly illustrating complementarities between individual systems. The average delay between the detection of A/H5N1 events by the systems and their official reporting by WHO or OIE was 10.2 days (95% CI: 6.7-13.8). This work illustrates the diversity in implemented epidemic intelligence activities, differences in system's designs, and the potential added values and opportunities for synergy between systems, between users and between systems and users.

  20. An integrated tool to study MHC region: accurate SNV detection and HLA genes typing in human MHC region using targeted high-throughput sequencing.

    Directory of Open Access Journals (Sweden)

    Hongzhi Cao

    Full Text Available The major histocompatibility complex (MHC is one of the most variable and gene-dense regions of the human genome. Most studies of the MHC, and associated regions, focus on minor variants and HLA typing, many of which have been demonstrated to be associated with human disease susceptibility and metabolic pathways. However, the detection of variants in the MHC region, and diagnostic HLA typing, still lacks a coherent, standardized, cost effective and high coverage protocol of clinical quality and reliability. In this paper, we presented such a method for the accurate detection of minor variants and HLA types in the human MHC region, using high-throughput, high-coverage sequencing of target regions. A probe set was designed to template upon the 8 annotated human MHC haplotypes, and to encompass the 5 megabases (Mb of the extended MHC region. We deployed our probes upon three, genetically diverse human samples for probe set evaluation, and sequencing data show that ∼97% of the MHC region, and over 99% of the genes in MHC region, are covered with sufficient depth and good evenness. 98% of genotypes called by this capture sequencing prove consistent with established HapMap genotypes. We have concurrently developed a one-step pipeline for calling any HLA type referenced in the IMGT/HLA database from this target capture sequencing data, which shows over 96% typing accuracy when deployed at 4 digital resolution. This cost-effective and highly accurate approach for variant detection and HLA typing in the MHC region may lend further insight into immune-mediated diseases studies, and may find clinical utility in transplantation medicine research. This one-step pipeline is released for general evaluation and use by the scientific community.

  1. Development and evaluation of a real-time fluorogenic loop-mediated isothermal amplification assay integrated on a microfluidic disc chip (on-chip LAMP) for rapid and simultaneous detection of ten pathogenic bacteria in aquatic animals.

    Science.gov (United States)

    Zhou, Qian-Jin; Wang, Lei; Chen, Jiong; Wang, Rui-Na; Shi, Yu-Hong; Li, Chang-Hong; Zhang, De-Min; Yan, Xiao-Jun; Zhang, Yan-Jun

    2014-09-01

    Rapid, low-cost, and user-friendly strategies are urgently needed for early disease diagnosis and timely treatment, particularly for on-site screening of pathogens in aquaculture. In this study, we successfully developed a real-time fluorogenic loop-mediated isothermal amplification assay integrated on a microfluidic disc chip (on-chip LAMP), which was capable of simultaneously detecting 10 pathogenic bacteria in aquatic animals, i.e., Nocardia seriolae, Pseudomonas putida, Streptococcus iniae, Vibrio alginolyticus, Vibrio anguillarum, Vibrio fluvialis, Vibrio harveyi, Vibrio parahaemolyticus, Vibrio rotiferianus, and Vibrio vulnificus. The assay provided a nearly-automated approach, with only a single pipetting step per chip for sample dispensing. This technique could achieve limits of detection (LOD) ranging from 0.40 to 6.42pg per 1.414μL reaction in less than 30 min. The robust reproducibility was demonstrated by a little variation among duplications for each bacterium with the coefficient of variation (CV) for time to positive (Tp) value less than 0.10. The clinical sensitivity and specificity of this on-chip LAMP assay in detecting field samples were 96.2% and 93.8% by comparison with conventional microbiological methods. Compared with other well-known techniques, on-chip LAMP assay provides low sample and reagent consumption, ease-of-use, accelerated analysis, multiple bacteria and on-site detection, and high reproducibility, indicating that such a technique would be applicable for on-site detection and routine monitoring of multiple pathogens in aquaculture. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Assessment of image quality and low-contrast detectability in abdominal CT of obese patients: comparison of a novel integrated circuit with a conventional discrete circuit detector at different tube voltages.

    Science.gov (United States)

    Euler, A; Heye, T; Kekelidze, M; Bongartz, G; Szucs-Farkas, Z; Sommer, C; Schmidt, B; Schindera, Sebastian T

    2015-03-01

    To compare image quality and low-contrast detectability of an integrated circuit (IC) detector in abdominal CT of obese patients with conventional detector technology at low tube voltages. A liver phantom with 45 lesions was placed in a water container to mimic an obese patient and examined on two different CT systems at 80, 100 and 120 kVp. The systems were equipped with either the IC or conventional detector. Image noise was measured, and the contrast-to-noise-ratio (CNR) was calculated. Low-contrast detectability was assessed independently by three radiologists. Radiation dose was estimated by the volume CT dose index (CTDIvol). The image noise was significantly lower, and the CNR was significantly higher with the IC detector at 80, 100 and 120 kVp, respectively (P = 0.023). The IC detector resulted in an increased lesion detection rate at 80 kVp (38.1 % vs. 17.2 %) and 100 kVp (57.0 % vs. 41.0 %). There was no difference in the detection rate between the IC detector at 100 kVp and the conventional detector at 120 kVp (57.0 % vs. 62.2 %). The CTDIvol at 80, 100 and 120 kVp measured 4.5-5.2, 7.3-7.9 and 9.8-10.2 mGy, respectively. The IC detector at 100 kVp resulted in similar low-contrast detectability compared to the conventional detector with a 120-kVp protocol at a radiation dose reduction of 37 %.

  3. Assessment of image quality and low-contrast detectability in abdominal CT of obese patients: comparison of a novel integrated circuit with a conventional discrete circuit detector at different tube voltages

    Energy Technology Data Exchange (ETDEWEB)

    Euler, A.; Heye, T.; Kekelidze, M.; Bongartz, G.; Schindera, Sebastian T. [University of Basel Hospital, Clinic of Radiology and Nuclear Medicine, Basel (Switzerland); Szucs-Farkas, Z. [Hospital Centre of Biel, Institute of Radiology, Biel (Switzerland); Sommer, C. [University Hospital, Department of Diagnostic and Interventional Radiology, Heidelberg (Germany); Schmidt, B. [Siemens Healthcare Sector, Forchheim (Germany)

    2014-10-15

    To compare image quality and low-contrast detectability of an integrated circuit (IC) detector in abdominal CT of obese patients with conventional detector technology at low tube voltages. A liver phantom with 45 lesions was placed in a water container to mimic an obese patient and examined on two different CT systems at 80, 100 and 120 kVp. The systems were equipped with either the IC or conventional detector. Image noise was measured, and the contrast-to-noise-ratio (CNR) was calculated. Low-contrast detectability was assessed independently by three radiologists. Radiation dose was estimated by the volume CT dose index (CTDI{sub vol}). The image noise was significantly lower, and the CNR was significantly higher with the IC detector at 80, 100 and 120 kVp, respectively (P = 0.023). The IC detector resulted in an increased lesion detection rate at 80 kVp (38.1 % vs. 17.2 %) and 100 kVp (57.0 % vs. 41.0 %). There was no difference in the detection rate between the IC detector at 100 kVp and the conventional detector at 120 kVp (57.0 % vs. 62.2 %). The CTDI{sub vol} at 80, 100 and 120 kVp measured 4.5-5.2, 7.3-7.9 and 9.8-10.2 mGy, respectively. The IC detector at 100 kVp resulted in similar low-contrast detectability compared to the conventional detector with a 120-kVp protocol at a radiation dose reduction of 37 %. (orig.)

  4. Neutron detection with integrated sub-2 nm Pt nanoparticles and 10B enriched dielectrics—A direct conversion device

    Directory of Open Access Journals (Sweden)

    Haisheng Zheng

    2016-07-01

    Full Text Available We report a direct conversion solid-state neutron detection device fabricated by combining the large neutron capture cross-section of 10B with the charge trapping attributes of sub-2 nm Pt nanoparticles (Pt NPs in MOSCAP structures. The 10B embedded polystyrene based neutron conversion layer also serves as the dielectric layer. Neutron sensing is achieved through carrier generation within the active 10B based dielectric layer and subsequent transfer to the embedded Pt NP layers, resulting in a significant change of the device's flat-band voltage upon ex-situ characterization. Both single and dual Pt NP layer embedded architectures, with varying electron addition energies, were tested within this study. While dual-layer Pt NPs embedded direct conversion devices with higher electron addition energy are shown to successfully capture charges generated through energetic reaction product upon neutron capture, the single Pt NP layer embedded device structure with lower electron addition energy displays signs of charge loss attributable to direct tunneling in the ex-situ capacitance–voltage measurement. Although only ex-situ detector operation is demonstrated within the realms of this study, sensitive in-situ neutron detectors and ultra-stable ex-situ dosimeters may be achievable utilizing a similar structure by fine-tuning the Pt NP size and the number of Pt NP layers in the device. Keywords: Neutron detection, Sub-2 nm Pt nanoparticles, 10B enriched dielectrics, Direct conversion, MOSCAP, Coulomb blockade

  5. A knowledge-based operator advisor system for integration of fault detection, control, and diagnosis to enhance the safe and reliable operation of nuclear power plants

    International Nuclear Information System (INIS)

    Bhatnagar, R.

    1989-01-01

    A Knowledged-Based Operator Advisor System has been developed for enhancing the complex task of maintaining safe and reliable operation of nuclear power plants. The operator's activities have been organized into the four tasks of data interpretation for abstracting high level information from sensor data, plant state monitoring for identification of faults, plan execution for controlling the faults, and diagnosis for determination of root causes of faults. The Operator Advisor System is capable of identifying the abnormal functioning of the plant in terms of: (1) deviations from normality, (2) pre-enumerated abnormal events, and (3) safety threats. The classification of abnormal functioning into the three categories of deviations from normality, abnormal events, and safety threats allows the detection of faults at three levels of: (1) developing faults, (2) developed faults, and (3) safety threatening faults. After the identification of abnormal functioning the system will identify the procedures to be executed to mitigate the consequences of abnormal functioning and will help the operator by displaying the procedure steps and monitoring the success of actions taken. The system also is capable of diagnosing the root causes of abnormal functioning. The identification, and diagnosis of root causes of abnormal functioning are done in parallel to the task of procedure execution, allowing the detection of more critical safety threats while executing procedures to control abnormal events

  6. Site-Specific Growth and in Situ Integration of Different Nanowire Material Networks on a Single Chip: Toward a Nanowire-Based Electronic Nose for Gas Detection.

    Science.gov (United States)

    Hrachowina, Lukas; Domènech-Gil, Guillem; Pardo, Antonio; Seifner, Michael S; Gràcia, Isabel; Cané, Carles; Romano-Rodríguez, Albert; Barth, Sven

    2018-03-23

    A new method for the site-selective synthesis of nanowires has been developed to enable material growth with defined morphology and, at the same time, different composition on the same chip surface. The chemical vapor deposition approach for the growth of these nanowire-based resistive devices using micromembranes can be easily modified and represents a simple, adjustable fabrication process for the direct integration of nanowire meshes in multifunctional devices. This proof-of-concept study includes the deposition of SnO 2 , WO 3 , and Ge nanowires on the same chip. The individual resistors exhibit adequate gas sensing responses toward changing gas concentrations of CO, NO 2 , and humidity diluted in synthetic air. The data have been processed by principal component analysis with cluster responses that can be easily separated, and thus, the devices described herein are in principle suitable for environmental monitoring.

  7. Semiconductor radiation detection systems

    CERN Document Server

    2010-01-01

    Covers research in semiconductor detector and integrated circuit design in the context of medical imaging using ionizing radiation. This book explores other applications of semiconductor radiation detection systems in security applications such as luggage scanning, dirty bomb detection and border control.

  8. Integrated Landsat Image Analysis and Hydrologic Modeling to Detect Impacts of 25-Year Land-Cover Change on Surface Runoff in a Philippine Watershed

    Directory of Open Access Journals (Sweden)

    Enrico Paringit

    2011-05-01

    Full Text Available Landsat MSS and ETM+ images were analyzed to detect 25-year land-cover change (1976–2001 in the critical Taguibo Watershed in Mindanao Island, Southern Philippines. This watershed has experienced historical modifications of its land-cover due to the presence of logging industries in the 1950s, and continuous deforestation due to illegal logging and slash-and-burn agriculture in the present time. To estimate the impacts of land-cover change on watershed runoff, land-cover information derived from the Landsat images was utilized to parameterize a GIS-based hydrologic model. The model was then calibrated with field-measured discharge data and used to simulate the responses of the watershed in its year 2001 and year 1976 land-cover conditions. The availability of land-cover information on the most recent state of the watershed from the Landsat ETM+ image made it possible to locate areas for rehabilitation such as barren and logged-over areas. We then created a “rehabilitated” land-cover condition map of the watershed (re-forestation of logged-over areas and agro-forestation of barren areas and used it to parameterize the model and predict the runoff responses of the watershed. Model results showed that changes in land-cover from 1976 to 2001 were directly related to the significant increase in surface runoff. Runoff predictions showed that a full rehabilitation of the watershed, especially in barren and logged-over areas, will be likely to reduce the generation of a huge volume of runoff during rainfall events. The results of this study have demonstrated the usefulness of multi-temporal Landsat images in detecting land-cover change, in identifying areas for rehabilitation, and in evaluating rehabilitation strategies for management of tropical watersheds through its use in hydrologic modeling.

  9. Post-therapy surveillance of patients with uterine cancers: value of integrated FDG PET/CT in the detection of recurrence

    International Nuclear Information System (INIS)

    Sironi, Sandro; Picchio, Maria; Bettinardi, Valentino; Landoni, Claudio; Galimberti, Stefania; Signorelli, Mauro; Perego, Patrizia; Mangioni, Costantino; Messa, Cristina; Fazio, Ferruccio

    2007-01-01

    The purpose of this study was to prospectively determine the diagnostic accuracy of PET/CT in the detection of recurrence in patients with treated uterine cancers. Twenty-five women, ranging in age from 37 to 79 years (mean 58.9 years), who underwent primary surgical treatment for either a cervical or an endometrial cancer met the inclusion criterion of the study, which was suspicion of recurrence based on results of routine follow-up procedures. PET/CT was performed after administration of 18 F-fluorodeoxyglucose (FDG); two readers interpreted the images in consensus. Histopathological findings or correlation with results of subsequent clinical and imaging follow-up examinations served as the reference standard. Diagnostic accuracy of PET/CT was reported in terms of the proportion of correctly classified patients and lesion sites. Tumour recurrence was found at histopathological analysis or follow-up examinations after PET/CT in 14 (56%) of the 25 patients. Patient-based sensitivity, specificity, positive predictive value, negative predictive value and accuracy of PET/CT for detection of tumour recurrence were 92.9%, 100.0%, 100.0%, 91.7% and 96.0%, respectively. Lesion site-based sensitivity, specificity, positive predictive value, negative predictive value and accuracy of PET/CT were 94.7%, 99.5%, 94.7%, 99.5% and 99.0%, respectively. This preliminary study shows that PET/CT may be an accurate method for the evaluation of recurrence in patients who have been treated for uterine cancers and are undergoing follow-up. (orig.)

  10. Key Challenges and Opportunities Associated with the Use of In Vitro Models to Detect Human DILI: Integrated Risk Assessment and Mitigation Plans

    Directory of Open Access Journals (Sweden)

    Franck A. Atienzar

    2016-01-01

    Full Text Available Drug-induced liver injury (DILI is a major cause of late-stage clinical drug attrition, market withdrawal, black-box warnings, and acute liver failure. Consequently, it has been an area of focus for toxicologists and clinicians for several decades. In spite of considerable efforts, limited improvements in DILI prediction have been made and efforts to improve existing preclinical models or develop new test systems remain a high priority. While prediction of intrinsic DILI has improved, identifying compounds with a risk for idiosyncratic DILI (iDILI remains extremely challenging because of the lack of a clear mechanistic understanding and the multifactorial pathogenesis of idiosyncratic drug reactions. Well-defined clinical diagnostic criteria and risk factors are also missing. This paper summarizes key data interpretation challenges, practical considerations, model limitations, and the need for an integrated risk assessment. As demonstrated through selected initiatives to address other types of toxicities, opportunities exist however for improvement, especially through better concerted efforts at harmonization of current, emerging and novel in vitro systems or through the establishment of strategies for implementation of preclinical DILI models across the pharmaceutical industry. Perspectives on the incorporation of newer technologies and the value of precompetitive consortia to identify useful practices are also discussed.

  11. Detection of irradiated foods by the thermoluminescence. Relationships between the temperature ranges of integrating TL glow curves and TL glow ratios

    International Nuclear Information System (INIS)

    Sekiguchi, Masayuki; Yamazaki, Masao; Goto, Michiko; Todoriki, Setsuko; Hagiwara, Shoji

    2007-01-01

    Our study demonstrated that the effects of the several temperature ranges for integrating TL glow intensity on the TL glow ratios by using spice-set purchased at a Turkish air port. The spice set had no labeling of irradiation feeds, but nine of 12 spices were judged as irradiated food in this study. Those temperature ranges were defined by evaluating the glow curves of irradiated TLD-100 chip (167-230degC), TLD-100 disc (177-238degC) and Dolomite element (145-258degC). Those are relatively stable and the difference of typical glow peak temperatures of TLD-100 disc in two institutes was less than 2%. On the other hand, those of TLD-100 tip was shift to higher temperature side at about 4degC because of declining of thermal conductance. The temperature ranges defined by TLD-100 were showed that discriminate more clearly between irradiated and nonirradiated spices compared with the full temperature range of TL measurement (70-400degC). With the exception of low glow intensity, background measurement for estimating net glow intensity was not necessary because TL glow ratio was hardly influenced whether the background measured or not. (author)

  12. Detection of Acute Myocardial Infarction in a Pig Model Using the SAN-Atrial-AVN-His (SAAH) Electrocardiogram (ECG), Model PHS-A10, an Automated and Integrated Signals Recognition System.

    Science.gov (United States)

    Zhao, Wenjiao; Lu, Guihua; Liu, Li; Sun, Zhishan; Wu, Mingxin; Yi, Wenyan; Chen, Haiyan; Li, Yanhui; Tang, Lilong; Zeng, Jianping

    2018-03-04

    BACKGROUND The aim of this study was to compare the use of the standard 12-lead electrocardiogram (ECG) with the SAN-Atrial-AVN-His (SAAH) ECG (Model PHS-A10), a new automated and integrated signals recognition system that detects micro-waveforms within the P, QRS, and T-wave, in a pig model of acute myocardial infarction (MI). MATERIAL AND METHODS Six medium-sized domestic Chinese pigs underwent general anesthesia, and an angioplasty balloon was placed and dilated for 120 minutes in the first diagonal coronary artery arising from the left anterior descending (LAD) coronary artery. A standard ECG and a SAAH ECG (Model PHS-A10) were used to evaluate: 1) the number of wavelets in ST-T segment in lead V5; 2) the duration of the repolarization initial (Ri), or duration of the wavelets starting from the J-point to the endpoint of the wavelets in the ST interval; 3) the duration of the repolarization terminal (Rt), of the wavelets, starting from the endpoint of the wavelets in the ST interval to the cross-point of the T-wave and baseline; 4) the ratio Ri: Rt. RESULTS Following coronary artery occlusion, duration of Ri and Ri/Rt increased, and Rt decreased, which was detected by the SAAH ECG (Model PHS-A10) within 12 seconds, compared with standard ECG that detected ST segment depression at 24 seconds following coronary artery occlusion. CONCLUSIONS The findings from this preliminary study in a pig model of acute MI support the need for clinical studies to evaluate the SAAH ECG (Model PHS-A10) for the early detection of acute MI.

  13. An integrated scheme for the simultaneous determination of biogenic amines, precursor amino acids, and related metabolites by liquid chromatography with electrochemical detection.

    Science.gov (United States)

    Oka, K; Kojima, K; Togari, A; Nagatsu, T; Kiss, B

    1984-06-08

    A new method using high-performance liquid chromatography with electrochemical detection (HPLC-ED) for the simultaneous determination of monoamines, their precursor amino acids, and related major metabolites in small samples of brain tissue weighing from 0.5 to 50 mg is described. The method is based on the preliminary isolation of monoamines (dopamine, norepinephrine, epinephrine, and serotonin), their precursor amino acids (tyrosine, 3,4-dihydroxyphenylalanine, tryptophan and 5-hydroxytryptophan), and their major metabolites (3-methoxytyramine, normetanephrine, 3,4-dihydroxyphenylacetic acid, homovanillic acid, vanillylmandelic acid, 3-methoxy-4-hydroxyphenylethyleneglycol, and 5-hydroxyindoleacetic acid) by chromatography on small columns of Amberlite CG-50 and Dowex 50W, and by ethyl acetate extraction. All the compounds in the four isolated fractions were measured by HPLC-ED on a reversed-phase column under four different conditions. The sensitivity was from 0.1 to 40 pmol, depending on the substances analysed. This newly established method was applied to the study of the effects of an aromatic L-amino acid decarboxylase inhibitor (NSD-1015) and a monoamine oxidase inhibitor (pargyline) on the levels of monoamines, their precursor amino acids and their major metabolites in brain regions of mice.

  14. Fast and sensitive medical diagnostic protocol based on integrating circular current lines for magnetic washing and optical detection of fluorescent magnetic nanobeads

    Directory of Open Access Journals (Sweden)

    Jaiyam Sharma

    2016-07-01

    Full Text Available Magnetic nanoparticles (MNPs are increasingly being used as ‘magnetic labels’ in medical diagnostics. Practical applications of MNPs necessitate reducing their non-specific interactions with sensor surfaces that result in noise in measurements. Here we describe the design and implementation of a sensing platform that incorporates circular shaped current lines that reduce non-specific binding by enabling the “magnetic washing” of loosely attached MNPs attached to the senor surface. Generating magnetic fields by passing electrical currents through the circular shaped current lines enabled the capture and collection of fluorescent MNPs that was more efficient and effective than straight current lines reported to-date. The use of fluorescent MNPs allows their optical detection rather than with widely used magnetoresistive sensors. As a result our approach is not affected by magnetic noise due to the flow of currents. Our design is expected to improve the speed, accuracy, and sensitivity of MNPs based medical diagnostics. Keywords: Biosensors, Magnetic beads, Fluorescent magnetic nanoparticles, Lab on chip, Point of care testing

  15. Investigation of Gasochromic Rhodium Complexes Towards Their Reactivity to CO and Integration into an Optical Gas Sensor for Fire Gas Detection

    Directory of Open Access Journals (Sweden)

    Carolin Pannek

    2018-06-01

    Full Text Available The detection of the toxic gas carbon monoxide (CO in the low ppm range is required in different applications. We present a study of the reactivity of different gasochromic rhodium complexes towards the toxic gas carbon monoxide (CO. Therefore, variations of binuclear rhodium complexes with different ligands were prepared. They were characterized by FTIR spectroscopy, 1H NMR spectroscopy, and differential scanning calorimetry. All complexes are spectroscopically distinguishable and temperature stable up to at least 187 °C. The gasochromic behavior of all different compounds was tested. Therefore, the compounds were dissolved in toluene and exposed to 100 ppm CO for 10 min to investigate their gas sensitivity and reaction velocity. The changes in the transmission spectra were recorded by UV/vis spectroscopy. Furthermore, a significant influence of the solvent to the color dyes’ gasochromic reaction and behavior was observed. After characterization, one complex was transferred as sensing element into an optical gas sensor. Two different measurement principles (reflection- and waveguide-based were built up and tested towards their capability as gasochromic CO sensors. Finally, different gas-dependent measurements were carried out.

  16. An integrated automatic system to evaluate U and Th dynamic lixiviation from solid matrices, and to extract/pre-concentrate leached analytes previous ICP-MS detection.

    Science.gov (United States)

    Ceballos, Melisa Rodas; García-Tenorio, Rafael; Estela, José Manuel; Cerdà, Víctor; Ferrer, Laura

    2017-12-01

    Leached fractions of U and Th from different environmental solid matrices were evaluated by an automatic system enabling the on-line lixiviation and extraction/pre-concentration of these two elements previous ICP-MS detection. UTEVA resin was used as selective extraction material. Ten leached fraction, using artificial rainwater (pH 5.4) as leaching agent, and a residual fraction were analyzed for each sample, allowing the study of behavior of U and Th in dynamic lixiviation conditions. Multivariate techniques have been employed for the efficient optimization of the independent variables that affect the lixiviation process. The system reached LODs of 0.1 and 0.7ngkg -1 of U and Th, respectively. The method was satisfactorily validated for three solid matrices, by the analysis of a soil reference material (IAEA-375), a certified sediment reference material (BCR- 320R) and a phosphogypsum reference material (MatControl CSN-CIEMAT 2008). Besides, environmental samples were analyzed, showing a similar behavior, i.e. the content of radionuclides decreases with the successive extractions. In all cases, the accumulative leached fraction of U and Th for different solid matrices studied (soil, sediment and phosphogypsum) were extremely low, up to 0.05% and 0.005% of U and Th, respectively. However, a great variability was observed in terms of mass concentration released, e.g. between 44 and 13,967ngUkg -1 . Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Dual modal ultra-bright nanodots with aggregation-induced emission and gadolinium-chelation for vascular integrity and leakage detection.

    Science.gov (United States)

    Feng, Guangxue; Li, Jackson Liang Yao; Claser, Carla; Balachander, Akhila; Tan, Yingrou; Goh, Chi Ching; Kwok, Immanuel Weng Han; Rénia, Laurent; Tang, Ben Zhong; Ng, Lai Guan; Liu, Bin

    2018-01-01

    The study of blood brain barrier (BBB) functions is important for neurological disorder research. However, the lack of suitable tools and methods has hampered the progress of this field. Herein, we present a hybrid nanodot strategy, termed AIE-Gd dots, comprising of a fluorogen with aggregation-induced emission (AIE) characteristics as the core to provide bright and stable fluorescence for optical imaging, and gadolinium (Gd) for accurate quantification of vascular leakage via inductively-coupled plasma mass spectrometry (ICP-MS). In this report, we demonstrate that AIE-Gd dots enable direct visualization of brain vascular networks under resting condition, and that they form localized punctate aggregates and accumulate in the brain tissue during experimental cerebral malaria, indicative of hemorrhage and BBB malfunction. With its superior detection sensitivity and multimodality, we hereby propose that AIE-Gd dots can serve as a better alternative to Evans blue for visualization and quantification of changes in brain barrier functions. Copyright © 2017. Published by Elsevier Ltd.

  18. A multi-reader in vitro study using porcine kidneys to determine the impact of integrated circuit detectors and iterative reconstruction on the detection accuracy, size measurement, and radiation dose for small (<4 mm) renal stones.

    Science.gov (United States)

    Wells, Michael L; Froemming, Adam T; Kawashima, Akira; Vrtiska, Terri J; Kim, Bohyun; Hartman, Robert P; Holmes, David R; Carter, Rickey E; Bartley, Adam C; Leng, Shuai; McCollough, Cynthia H; Fletcher, Joel G

    2017-08-01

    Background Detection of small renal calculi has benefitted from recent advances in computed tomography (CT) scanner design. Information regarding observer performance when using state-of-the-art CT scanners for this application is needed. Purpose To assess observer performance and the impact of radiation dose for detection and size measurement of <4 mm renal stones using CT with integrated circuit detectors and iterative reconstruction. Material and Methods Twenty-nine <4 mm calcium oxalate stones were randomly placed in 20 porcine kidneys in an anthropomorphic phantom. Four radiologists used a workstation to record each calculus detection and size. JAFROC Figure of Merit (FOM), sensitivity, false positive detections, and calculus size were calculated. Results Mean calculus size was 2.2 ± 0.7 mm. The CTDI vol values corresponding to the automatic exposure control settings of 160, 80, 40, 25, and 10 Quality Reference mAs (QRM) were 15.2, 7.9, 4.2, 2.7, and 1.3 mGy, respectively. JAFROC FOM was ≥ 0.97 at ≥ 80 QRM, ≥ 0.89 at ≥ 25 QRM, and was inferior to routine dose (160 QRM) at 10 QRM (0.72, P < 0.05). Per-calculus sensitivity remained ≥ 85% for every reader at ≥ 25 QRM. Mean total false positive detections per reader were ≤ 3 at ≥ 80 QRM, but increased substantially for two readers ( ≥ 12) at ≤ 40 QRM. Measured calculus size significantly decreased at ≤ 25 QRM ( P ≤ 0.01). Conclusion Using low dose renal CT with iterative reconstruction and ≥ 25 QRM results in high sensitivity, but false positive detections increase for some readers at very low dose levels (≤ 40 QRM). At very low doses with iterative reconstruction, measured calculus size will artifactually decrease.

  19. Unmanned Aircraft Systems Detect and Avoid System: End-to-End Verification and Validation Simulation Study of Minimum Operations Performance Standards for Integrating Unmanned Aircraft into the National Airspace System

    Science.gov (United States)

    Ghatas, Rania W.; Jack, Devin P.; Tsakpinis, Dimitrios; Sturdy, James L.; Vincent, Michael J.; Hoffler, Keith D.; Myer, Robert R.; DeHaven, Anna M.

    2017-01-01

    As Unmanned Aircraft Systems (UAS) make their way to mainstream aviation operations within the National Airspace System (NAS), research efforts are underway to develop a safe and effective environment for their integration into the NAS. Detect and Avoid (DAA) systems are required to account for the lack of "eyes in the sky" due to having no human on-board the aircraft. The technique, results, and lessons learned from a detailed End-to-End Verification and Validation (E2-V2) simulation study of a DAA system representative of RTCA SC-228's proposed Phase I DAA Minimum Operational Performance Standards (MOPS), based on specific test vectors and encounter cases, will be presented in this paper.

  20. Notes on the design of experiments and beam diagnostics with synchrotron light detected by a gated photomultiplier for the Fermilab superconducting electron linac and for the Integrable Optics Test Accelerator (IOTA)

    Energy Technology Data Exchange (ETDEWEB)

    Stancari, Giulio [Fermi National Accelerator Lab. (FNAL), Batavia, IL (United States); Romanov, Aleksandr [Fermi National Accelerator Lab. (FNAL), Batavia, IL (United States); Ruan, Jinhao [Fermi National Accelerator Lab. (FNAL), Batavia, IL (United States); Santucci, James [Fermi National Accelerator Lab. (FNAL), Batavia, IL (United States); Thurman-Keup, Randy [Fermi National Accelerator Lab. (FNAL), Batavia, IL (United States); Valishev, Alexander [Fermi National Accelerator Lab. (FNAL), Batavia, IL (United States)

    2017-11-08

    We outline the design of beam experiments for the electron linac at the Fermilab Accelerator Science and Technology (FAST) facility and for the Integrable Optics Test Accelerator (IOTA), based on synchrotron light emitted by the electrons in bend dipoles, detected with gated microchannel-plate photomultipliers (MCP-PMTs). The system can be used both for beam diagnostics (e.g., beam intensity with full dynamic range, turn-by-turn beam vibrations, etc.) and for scientific experiments, such as the direct observation of the time structure of the radiation emitted by single electrons in a storage ring. The similarity between photon pulses and spectrum at the downstream end of the electron linac and in the IOTA ring allows one to test the apparatus during commissioning of the linac.

  1. A Biosensor-CMOS Platform and Integrated Readout Circuit in 0.18-μm CMOS Technology for Cancer Biomarker Detection

    Directory of Open Access Journals (Sweden)

    Abdulaziz Alhoshany

    2017-08-01

    Full Text Available This paper presents a biosensor-CMOS platform for measuring the capacitive coupling of biorecognition elements. The biosensor is designed, fabricated, and tested for the detection and quantification of a protein that reveals the presence of early-stage cancer. For the first time, the spermidine/spermine N1 acetyltransferase (SSAT enzyme has been screened and quantified on the surface of a capacitive sensor. The sensor surface is treated to immobilize antibodies, and the baseline capacitance of the biosensor is reduced by connecting an array of capacitors in series for fixed exposure area to the analyte. A large sensing area with small baseline capacitance is implemented to achieve a high sensitivity to SSAT enzyme concentrations. The sensed capacitance value is digitized by using a 12-bit highly digital successive-approximation capacitance-to-digital converter that is implemented in a 0.18 μm CMOS technology. The readout circuit operates in the near-subthreshold regime and provides power and area efficient operation. The capacitance range is 16.137 pF with a 4.5 fF absolute resolution, which adequately covers the concentrations of 10 mg/L, 5 mg/L, 2.5 mg/L, and 1.25 mg/L of the SSAT enzyme. The concentrations were selected as a pilot study, and the platform was shown to demonstrate high sensitivity for SSAT enzymes on the surface of the capacitive sensor. The tested prototype demonstrated 42.5 μS of measurement time and a total power consumption of 2.1 μW.

  2. A Biosensor-CMOS Platform and Integrated Readout Circuit in 0.18-μm CMOS Technology for Cancer Biomarker Detection.

    Science.gov (United States)

    Alhoshany, Abdulaziz; Sivashankar, Shilpa; Mashraei, Yousof; Omran, Hesham; Salama, Khaled N

    2017-08-23

    This paper presents a biosensor-CMOS platform for measuring the capacitive coupling of biorecognition elements. The biosensor is designed, fabricated, and tested for the detection and quantification of a protein that reveals the presence of early-stage cancer. For the first time, the spermidine/spermine N1 acetyltransferase (SSAT) enzyme has been screened and quantified on the surface of a capacitive sensor. The sensor surface is treated to immobilize antibodies, and the baseline capacitance of the biosensor is reduced by connecting an array of capacitors in series for fixed exposure area to the analyte. A large sensing area with small baseline capacitance is implemented to achieve a high sensitivity to SSAT enzyme concentrations. The sensed capacitance value is digitized by using a 12-bit highly digital successive-approximation capacitance-to-digital converter that is implemented in a 0.18 μm CMOS technology. The readout circuit operates in the near-subthreshold regime and provides power and area efficient operation. The capacitance range is 16.137 pF with a 4.5 fF absolute resolution, which adequately covers the concentrations of 10 mg/L, 5 mg/L, 2.5 mg/L, and 1.25 mg/L of the SSAT enzyme. The concentrations were selected as a pilot study, and the platform was shown to demonstrate high sensitivity for SSAT enzymes on the surface of the capacitive sensor. The tested prototype demonstrated 42.5 μS of measurement time and a total power consumption of 2.1 μW.

  3. A Biosensor-CMOS Platform and Integrated Readout Circuit in 0.18-μm CMOS Technology for Cancer Biomarker Detection

    KAUST Repository

    Alhoshany, Abdulaziz

    2017-08-23

    This paper presents a biosensor-CMOS platform for measuring the capacitive coupling of biorecognition elements. The biosensor is designed, fabricated, and tested for the detection and quantification of a protein that reveals the presence of early-stage cancer. For the first time, the spermidine/spermine N1 acetyltransferase (SSAT) enzyme has been screened and quantified on the surface of a capacitive sensor. The sensor surface is treated to immobilize antibodies, and the baseline capacitance of the biosensor is reduced by connecting an array of capacitors in series for fixed exposure area to the analyte. A large sensing area with small baseline capacitance is implemented to achieve a high sensitivity to SSAT enzyme concentrations. The sensed capacitance value is digitized by using a 12-bit highly digital successive-approximation capacitance-to-digital converter that is implemented in a 0.18 μm CMOS technology. The readout circuit operates in the near-subthreshold regime and provides power and area efficient operation. The capacitance range is 16.137 pF with a 4.5 fF absolute resolution, which adequately covers the concentrations of 10 mg/L, 5 mg/L, 2.5 mg/L, and 1.25 mg/L of the SSAT enzyme. The concentrations were selected as a pilot study, and the platform was shown to demonstrate high sensitivity for SSAT enzymes on the surface of the capacitive sensor. The tested prototype demonstrated 42.5 μS of measurement time and a total power consumption of 2.1 μW.

  4. A Biosensor-CMOS Platform and Integrated Readout Circuit in 0.18-μm CMOS Technology for Cancer Biomarker Detection

    KAUST Repository

    Alhoshany, Abdulaziz; Sivashankar, Shilpa; Mashraei, Yousof; Omran, Hesham; Salama, Khaled N.

    2017-01-01

    This paper presents a biosensor-CMOS platform for measuring the capacitive coupling of biorecognition elements. The biosensor is designed, fabricated, and tested for the detection and quantification of a protein that reveals the presence of early-stage cancer. For the first time, the spermidine/spermine N1 acetyltransferase (SSAT) enzyme has been screened and quantified on the surface of a capacitive sensor. The sensor surface is treated to immobilize antibodies, and the baseline capacitance of the biosensor is reduced by connecting an array of capacitors in series for fixed exposure area to the analyte. A large sensing area with small baseline capacitance is implemented to achieve a high sensitivity to SSAT enzyme concentrations. The sensed capacitance value is digitized by using a 12-bit highly digital successive-approximation capacitance-to-digital converter that is implemented in a 0.18 μm CMOS technology. The readout circuit operates in the near-subthreshold regime and provides power and area efficient operation. The capacitance range is 16.137 pF with a 4.5 fF absolute resolution, which adequately covers the concentrations of 10 mg/L, 5 mg/L, 2.5 mg/L, and 1.25 mg/L of the SSAT enzyme. The concentrations were selected as a pilot study, and the platform was shown to demonstrate high sensitivity for SSAT enzymes on the surface of the capacitive sensor. The tested prototype demonstrated 42.5 μS of measurement time and a total power consumption of 2.1 μW.

  5. Integrated security system definition

    International Nuclear Information System (INIS)

    Campbell, G.K.; Hall, J.R. II

    1985-01-01

    The objectives of an integrated security system are to detect intruders and unauthorized activities with a high degree of reliability and the to deter and delay them until effective response/engagement can be accomplished. Definition of an effective integrated security system requires proper application of a system engineering methodology. This paper summarizes a methodology and describes its application to the problem of integrated security system definition. This process includes requirements identification and analysis, allocation of identified system requirements to the subsystem level and provides a basis for identification of synergistic subsystem elements and for synthesis into an integrated system. The paper discusses how this is accomplished, emphasizing at each step how system integration and subsystem synergism is considered. The paper concludes with the product of the process: implementation of an integrated security system

  6. Human-Centered Design Study: Enhancing the Usability of a Mobile Phone App in an Integrated Falls Risk Detection System for Use by Older Adult Users.

    Science.gov (United States)

    Harte, Richard; Quinlan, Leo R; Glynn, Liam; Rodríguez-Molinero, Alejandro; Baker, Paul Ma; Scharf, Thomas; ÓLaighin, Gearóid

    2017-05-30

    Design processes such as human-centered design (HCD), which involve the end user throughout the product development and testing process, can be crucial in ensuring that the product meets the needs and capabilities of the user, particularly in terms of safety and user experience. The structured and iterative nature of HCD can often conflict with the necessary rapid product development life-cycles associated with the competitive connected health industry. The aim of this study was to apply a structured HCD methodology to the development of a smartphone app that was to be used within a connected health fall risk detection system. Our methodology utilizes so called discount usability engineering techniques to minimize the burden on resources during development and maintain a rapid pace of development. This study will provide prospective designers a detailed description of the application of a HCD methodology. A 3-phase methodology was applied. In the first phase, a descriptive "use case" was developed by the system designers and analyzed by both expert stakeholders and end users. The use case described the use of the app and how various actors would interact with it and in what context. A working app prototype and a user manual were then developed based on this feedback and were subjected to a rigorous usability inspection. Further changes were made both to the interface and support documentation. The now advanced prototype was exposed to user testing by end users where further design recommendations were made. With combined expert and end-user analysis of a comprehensive use case having originally identified 21 problems with the system interface, we have only seen and observed 3 of these problems in user testing, implying that 18 problems were eliminated between phase 1 and 3. Satisfactory ratings were obtained during validation testing by both experts and end users, and final testing by users shows the system requires low mental, physical, and temporal demands

  7. Advanced detection strategies for ultrasound contrast agents

    NARCIS (Netherlands)

    J.M.G. Borsboom (Jerome)

    2005-01-01

    markdownabstract__Abstract__ Ultrasound contrast agent was discovered serendipitously by Gramiak and Shah in I968 when they injected indocyanine green dye into the heart and observed increased echogenicity of the blood containing the dye. Small cavitation bubbles that were formed upon

  8. Intrusion detection sensors

    International Nuclear Information System (INIS)

    Williams, J.D.

    1978-07-01

    Intrusion detection sensors are an integral part of most physical security systems. Under the sponsorship of the U.S. Department of Energy, Office of Safeguards and Security, Sandia Laboratories has conducted a survey of available intrusion detection sensors and has tested a number of different sensors. An overview of these sensors is provided. This overview includes (1) the operating principles of each type of sensor, (2) unique sensor characteristics, (3) desired sensor improvements which must be considered in planning an intrusion detection system, and (4) the site characteristics which affect the performance of both exterior and interior sensors. Techniques which have been developed to evaluate various intrusion detection sensors are also discussed

  9. First Earth-Based Detection of a Superbolide on Jupiter

    Science.gov (United States)

    Hueso, R.; Wesley, A.; Go, C.; Perez-Hoyos, S.; Wong, M. H.; Fletcher, L. N.; Sanchez-Lavega, A.; Boslough, M. B.; DePater, I.; Orton, G. S.; hide

    2010-01-01

    Cosmic collisions can planets cause detectable optical flashes that range from terrestrial shooting stars to bright fireballs. On 2010 June 3 a bolide in Jupiter's atmosphere was simultaneously observed from the Earth by two amateur astronomers observing Jupiter in red and blue wavelengths, The bolide appeared as a flash of 2 s duration in video recording data of the planet. The analysis of the light carve of the observations results in an estimated energy of the impact of (0.9-4,0) x 10(exp 15) J which corresponds to a colliding body of 8-13 m diameter assuming a mean density of 2 g/cu cm. Images acquired a few days later by the Hubble Space Telescope and other large ground-based facilities did not show any signature of aerosol debris, temperature, or chemical composition anomaly, confirming that the body was small and destroyed in Jupiter's upper atmosphere. Several collisions of this size may happen on Jupiter on a yearly basis. A systematic study of the impact rate and size of these bolides can enable an empirical determination. of the flux of meteoroids in Jupiter with implications for the populations of small bodies in the outer solar system and may allow a better quantification of the threat of impacting bodies to Earth. The serendipitous recording of this optical flash opens a new window in the observation of Jupiter with small telescopes.

  10. FIRST EARTH-BASED DETECTION OF A SUPERBOLIDE ON JUPITER

    International Nuclear Information System (INIS)

    Hueso, R.; Perez-Hoyos, S.; Sanchez-Lavega, A.; Wesley, A.; Go, C.; Wong, M. H.; De Pater, I.; Fletcher, L. N.; Boslough, M. B. E.; Orton, G. S.; Yanamandra-Fisher, P. A.; Simon-Miller, A. A.; Djorgovski, S. G.; Edwards, M. L.; Hammel, H. B.; Clarke, J. T.; Noll, K. S.

    2010-01-01

    Cosmic collisions on planets cause detectable optical flashes that range from terrestrial shooting stars to bright fireballs. On 2010 June 3 a bolide in Jupiter's atmosphere was simultaneously observed from the Earth by two amateur astronomers observing Jupiter in red and blue wavelengths. The bolide appeared as a flash of 2 s duration in video recording data of the planet. The analysis of the light curve of the observations results in an estimated energy of the impact of (0.9-4.0) x 10 15 J which corresponds to a colliding body of 8-13 m diameter assuming a mean density of 2 g cm -3 . Images acquired a few days later by the Hubble Space Telescope and other large ground-based facilities did not show any signature of aerosol debris, temperature, or chemical composition anomaly, confirming that the body was small and destroyed in Jupiter's upper atmosphere. Several collisions of this size may happen on Jupiter on a yearly basis. A systematic study of the impact rate and size of these bolides can enable an empirical determination of the flux of meteoroids in Jupiter with implications for the populations of small bodies in the outer solar system and may allow a better quantification of the threat of impacting bodies to Earth. The serendipitous recording of this optical flash opens a new window in the observation of Jupiter with small telescopes.

  11. Integrated economics

    International Nuclear Information System (INIS)

    Bratton, T.J.

    1992-01-01

    This article offers ideas for evaluating integrated solid waste management systems through the use of a conceptual cost overview. The topics of the article include the integrated solid waste management system; making assumptions about community characteristics, waste generation rates, waste collection responsibility, integrated system components, sizing and economic life of system facilities, system implementation schedule, facility ownership, and system administration; integrated system costs; integrated system revenues; system financing; cost projections; and making decisions

  12. Process-integrated online monitoring of safety-relevant aluminum airbag pressure vessel components for a combined defect detection and material property determination by using contactless NDT (EMUS and EC)

    International Nuclear Information System (INIS)

    Becker, R.; Dobmann, G.; Salzburger, H.-J.

    1999-01-01

    Airbag pressure vessels for the north-American market mainly are made by forging and by the use of steel alloys. In Europe aluminum alloys are common and the manufacturing process is extrusion of circular blanks - made from cold rolled plates - in a form applying a 100 t press at room temperature. Then by heat treatment the strength/hardness of the material is properly adjusted and after that the pressure vessel parts have to be continuously inspected with an inspection and handling cycle time of 3 s. Inspection of the axis-symmetric parts is asked for surface breaking extrusion defects as well as for surface parallel delaminations in the bulk volume. Furthermore, the material strength is a quality characteristic that has to be nondestructively registered and documented. The inspection is performed by eddy current probes and an EMAT, of which the eddy current impedance measurements are used for surface breaking extrusion defect detection and sizing (single frequency technique with digital locus curve filtering) and strength characterization (3-frequency technique with digital filtering for signal-to-noise enhancement). The bulk delaminations are detected by an EMAT-resonance technique using a spiral eddy current coil and permanent magnets for the EMA-energy transformation. The inspections are performed by singling the parts on a conveying belt, rotating two of them parallel on turntables scanning with the transducers in specially selected circular scan paths. The performance of the system is characterized by a number of 6000 parts per shift in the two time-parallel inspection lines with 3 shifts in 24 hours. The registered quality characteristics are documented by laser writing onto the surface of each part. The emphasis of the contribution is on the presentation and discussion of the safety and economical benefits by process-integrated NDT. (author)

  13. An integrated framework for software vulnerability detection ...

    Indian Academy of Sciences (India)

    Manoj Kumar

    2017-07-15

    Jul 15, 2017 ... concern and intelligent framework and provides more secured ... In the present scenario, the software systems are being .... human. In human body, the autonomic nervous system ..... such as artificial neural networks, genetic algorithm, grey ..... [8] Bansiya J 1997 A hierarchical model for quality assessment.

  14. Semantic Observation Integration

    Directory of Open Access Journals (Sweden)

    Werner Kuhn

    2012-09-01

    Full Text Available Although the integration of sensor-based information into analysis and decision making has been a research topic for many years, semantic interoperability has not yet been reached. The advent of user-generated content for the geospatial domain, Volunteered Geographic Information (VGI, makes it even more difficult to establish semantic integration. This paper proposes a novel approach to integrating conventional sensor information and VGI, which is exploited in the context of detecting forest fires. In contrast to common logic-based semantic descriptions, we present a formal system using algebraic specifications to unambiguously describe the processing steps from natural phenomena to value-added information. A generic ontology of observations is extended and profiled for forest fire detection in order to illustrate how the sensing process, and transformations between heterogeneous sensing systems, can be represented as mathematical functions and grouped into abstract data types. We discuss the required ontological commitments and a possible generalization.

  15. Gauge Integral

    Directory of Open Access Journals (Sweden)

    Coghetto Roland

    2017-10-01

    Full Text Available Some authors have formalized the integral in the Mizar Mathematical Library (MML. The first article in a series on the Darboux/Riemann integral was written by Noboru Endou and Artur Korniłowicz: [6]. The Lebesgue integral was formalized a little later [13] and recently the integral of Riemann-Stieltjes was introduced in the MML by Keiko Narita, Kazuhisa Nakasho and Yasunari Shidama [12].

  16. VECTOR INTEGRATION

    NARCIS (Netherlands)

    Thomas, E. G. F.

    2012-01-01

    This paper deals with the theory of integration of scalar functions with respect to a measure with values in a, not necessarily locally convex, topological vector space. It focuses on the extension of such integrals from bounded measurable functions to the class of integrable functions, proving

  17. Cross-sensor comparisons between Landsat 5 TM and IRS-P6 AWiFS and disturbance detection using integrated Landsat and AWiFS time-series images

    Science.gov (United States)

    Chen, Xuexia; Vogelmann, James E.; Chander, Gyanesh; Ji, Lei; Tolk, Brian; Huang, Chengquan; Rollins, Matthew

    2013-01-01

    Routine acquisition of Landsat 5 Thematic Mapper (TM) data was discontinued recently and Landsat 7 Enhanced Thematic Mapper Plus (ETM+) has an ongoing problem with the scan line corrector (SLC), thereby creating spatial gaps when covering images obtained during the process. Since temporal and spatial discontinuities of Landsat data are now imminent, it is therefore important to investigate other potential satellite data that can be used to replace Landsat data. We thus cross-compared two near-simultaneous images obtained from Landsat 5 TM and the Indian Remote Sensing (IRS)-P6 Advanced Wide Field Sensor (AWiFS), both captured on 29 May 2007 over Los Angeles, CA. TM and AWiFS reflectances were compared for the green, red, near-infrared (NIR), and shortwave infrared (SWIR) bands, as well as the normalized difference vegetation index (NDVI) based on manually selected polygons in homogeneous areas. All R2 values of linear regressions were found to be higher than 0.99. The temporally invariant cluster (TIC) method was used to calculate the NDVI correlation between the TM and AWiFS images. The NDVI regression line derived from selected polygons passed through several invariant cluster centres of the TIC density maps and demonstrated that both the scene-dependent polygon regression method and TIC method can generate accurate radiometric normalization. A scene-independent normalization method was also used to normalize the AWiFS data. Image agreement assessment demonstrated that the scene-dependent normalization using homogeneous polygons provided slightly higher accuracy values than those obtained by the scene-independent method. Finally, the non-normalized and relatively normalized ‘Landsat-like’ AWiFS 2007 images were integrated into 1984 to 2010 Landsat time-series stacks (LTSS) for disturbance detection using the Vegetation Change Tracker (VCT) model. Both scene-dependent and scene-independent normalized AWiFS data sets could generate disturbance maps similar to

  18. Serendipitous Discovery of Factor VII Deficiency and the Ensuing Dilemma.

    Science.gov (United States)

    Umakanthan, Jayadev M; Dhakal, Prajwal; Gundabolu, Krishna; Koepsell, Scott A; Baljevic, Muhamed

    2018-03-01

    Congenital factor VII deficiency is a challenging disorder to manage, as it is associated with varied genotypes that do not clinically correlate with a bleeding phenotype. Individuals with severe factor VII deficiency (FVII: c 5%) may experience severe hemorrhages. In modern medicine, due to extensive routine pre-operative laboratory testing, clinically asymptomatic patients without any bleeding history might be incidentally discovered, raising clinical dilemmas. Careful consideration of bleeding versus thrombosis risk has to be made in such cases, especially in the elderly. Clinical history of no prior bleeding complications may be a reassuring factor. Minimal required replacement dosing of recombinant activated factor VII can be given peri-operatively in such situations, with close monitoring.

  19. A Serendipitous Formation of a Cysteine-bridged Disaccharide

    African Journals Online (AJOL)

    NICO

    O-acetyl-b-D-glucopyranosylisothiouronium salt and the iodide or tosyl derivatives of L-serine,3 the desulfurization of disulfide- linked glycosyl cysteine derivatives,4 Lewis acid-catalyzed glycosylation,5,6 and solid phase glycosylation.7. Glycosylation of amino acids has previously relied on the use of amino acids protected ...

  20. Serendipitous discovery of Wolbachia genomes in multiple Drosophila species.

    Science.gov (United States)

    Salzberg, Steven L; Dunning Hotopp, Julie C; Delcher, Arthur L; Pop, Mihai; Smith, Douglas R; Eisen, Michael B; Nelson, William C

    2005-01-01

    The Trace Archive is a repository for the raw, unanalyzed data generated by large-scale genome sequencing projects. The existence of this data offers scientists the possibility of discovering additional genomic sequences beyond those originally sequenced. In particular, if the source DNA for a sequencing project came from a species that was colonized by another organism, then the project may yield substantial amounts of genomic DNA, including near-complete genomes, from the symbiotic or parasitic organism. By searching the publicly available repository of DNA sequencing trace data, we discovered three new species of the bacterial endosymbiont Wolbachia pipientis in three different species of fruit fly: Drosophila ananassae, D. simulans, and D. mojavensis. We extracted all sequences with partial matches to a previously sequenced Wolbachia strain and assembled those sequences using customized software. For one of the three new species, the data recovered were sufficient to produce an assembly that covers more than 95% of the genome; for a second species the data produce the equivalent of a 'light shotgun' sampling of the genome, covering an estimated 75-80% of the genome; and for the third species the data cover approximately 6-7% of the genome. The results of this study reveal an unexpected benefit of depositing raw data in a central genome sequence repository: new species can be discovered within this data. The differences between these three new Wolbachia genomes and the previously sequenced strain revealed numerous rearrangements and insertions within each lineage and hundreds of novel genes. The three new genomes, with annotation, have been deposited in GenBank.

  1. Interorganisational Integration

    DEFF Research Database (Denmark)

    Lyngsø, Anne Marie; Godtfredsen, Nina Skavlan; Frølich, Anne

    2016-01-01

    INTRODUCTION: Despite many initiatives to improve coordination of patient pathways and intersectoral cooperation, Danish health care is still fragmented, lacking intra- and interorganisational integration. This study explores barriers to and facilitators of interorganisational integration...... at a university hospital in the Capital Region of Denmark. RESULTS AND DISCUSSION: Our results can be grouped into five influencing areas for interorganisational integration: communication/information transfer, committed leadership, patient engagement, the role and competencies of the general practitioner...... and organisational culture. Proposed solutions to barriers in each area hold the potential to improve care integration as experienced by individuals responsible for supporting and facilitating it. Barriers and facilitators to integrating care relate to clinical, professional, functional and normative integration...

  2. Vertical integration

    International Nuclear Information System (INIS)

    Antill, N.

    1999-01-01

    This paper focuses on the trend in international energy companies towards vertical integration in the gas chain from wellhead to power generation, horizontal integration in refining and marketing businesses, and the search for larger projects with lower upstream costs. The shape of the petroleum industry in the next millennium, the creation of super-major oil companies, and the relationship between size and risk are discussed. The dynamics of vertical integration, present events and future developments are considered. (UK)

  3. Integral equations

    CERN Document Server

    Moiseiwitsch, B L

    2005-01-01

    Two distinct but related approaches hold the solutions to many mathematical problems--the forms of expression known as differential and integral equations. The method employed by the integral equation approach specifically includes the boundary conditions, which confers a valuable advantage. In addition, the integral equation approach leads naturally to the solution of the problem--under suitable conditions--in the form of an infinite series.Geared toward upper-level undergraduate students, this text focuses chiefly upon linear integral equations. It begins with a straightforward account, acco

  4. VizieR Online Data Catalog: ROSAT detected quasars. I. (Brinkmann+ 1997)

    Science.gov (United States)

    Brinkmann, W.; Yuan, W.

    1996-09-01

    We have compiled a sample of all quasars with measured radio emission from the Veron-Cetty - Veron catalogue (1993, VV93 ) detected by ROSAT in the ALL-SKY SURVEY (RASS, Voges 1992), as targets of pointed observations, or as serendipitous sources from pointed observations as publicly available from the ROSAT point source catalogue (ROSAT-SRC, Voges et al. 1995). The total number of ROSAT detected radio quasars from the above three sources is 654 objects. 69 of the objects are classified as radio-quiet using the defining line at a radio-loudness of 1.0, and 10 objects have no classification. The 5GHz data are from the 87GB radio survey, the NED database, or from the Veron-Cetty - Veron catalogue. The power law indices and their errors are estimated from the two hardness ratios given by the SASS assuming Galactic absorption. The X-ray flux densities in the ROSAT band (0.1-2.4keV) are calculated from the count rates using the energy to counts conversion factor for power law spectra and Galactic absorption. For the photon index we use the value obtained for a individual source if the estimated 1 sigma error is smaller than 0.5, otherwise we use the mean value 2.14. (1 data file).

  5. DISCOVERY OF A WOLF-RAYET STAR THROUGH DETECTION OF ITS PHOTOMETRIC VARIABILITY

    International Nuclear Information System (INIS)

    Littlefield, Colin; Garnavich, Peter; McClelland, Colin; Rettig, Terrence; Marion, G. H.; Vinkó, József; Wheeler, J. Craig

    2012-01-01

    We report the serendipitous discovery of a heavily reddened Wolf-Rayet star that we name WR 142b. While photometrically monitoring a cataclysmic variable, we detected weak variability in a nearby field star. Low-resolution spectroscopy revealed a strong emission line at 7100 Å, suggesting an unusual object and prompting further study. A spectrum taken with the Hobby-Eberly Telescope confirms strong He II emission and an N IV 7112 Å line consistent with a nitrogen-rich Wolf-Rayet star of spectral class WN6. Analysis of the He II line strengths reveals no detectable hydrogen in WR 142b. A blue-sensitive spectrum obtained with the Large Binocular Telescope shows no evidence for a hot companion star. The continuum shape and emission line ratios imply a reddening of E(B – V) = 2.2-2.6 mag. We estimate that the distance to WR 142b is 1.4 ± 0.3 kpc.

  6. Integrated Design

    DEFF Research Database (Denmark)

    Lenau, Torben Anker

    1999-01-01

    A homepage on the internet with course material, lecture plan, student exercises, etc. Continuesly updated during the course Integrated Design (80402, 80403)......A homepage on the internet with course material, lecture plan, student exercises, etc. Continuesly updated during the course Integrated Design (80402, 80403)...

  7. Traffic Light Detection

    DEFF Research Database (Denmark)

    Philipsen, Mark Philip; Jensen, Morten Bornø; Møgelmose, Andreas

    2015-01-01

    Traffic light recognition (TLR) is an integral part of any intelligent vehicle, which must function in the existing infrastructure. Pedestrian and sign detection have recently seen great improvements due to the introduction of learning based detectors using integral channel features. A similar push...... database is collected based on footage from US roads. The database consists of both test and training data, totaling 46,418 frames and 112,971 annotated traffic lights, captured in continuous sequences under a varying light and weather conditions. The learning based detector achieves an AUC of 0.4 and 0...

  8. Organising integration

    DEFF Research Database (Denmark)

    Axelsson, Runo

    2013-01-01

    Background: In Sweden, as in many other countries, there has been a succession of trends in the organisation of health care and other welfare services. These trends have had different implications for the integration of services in the health and welfare system. Aims: One aim is to discuss...... the implications of different organisational trends for the integration of health and welfare services. Another aim is to introduce a Swedish model of financial coordination as a flexible way to organise integration. Organisational trends: In the 1960’s there was an expansion of health and welfare services leading...... an increasing lack of integration in the health and welfare system. In the 2000’s, there has been a re-centralisation through mergers of hospitals, regions and state agencies. It has become clear, however, that mergers do not promote integration but rather increase the bureaucratisation of the system. Model...

  9. The integration of immigrants

    OpenAIRE

    Bauböck, Rainer

    1995-01-01

    from the Table of Contents: Migration and integration - Basic concepts and definitions; Immigration and Integration policies; The legal framework for integration; Dimension of social integration; Cultural integration; Conclusions;

  10. Integrative psychotherapy.

    Science.gov (United States)

    Kozarić-Kovacić, Dragica

    2008-09-01

    The main purposes of the article are to present the history of integration in psychotherapy, the reasons of the development integrative approaches, and the approaches to integration in psychotherapy. Three approaches to integration in psychotherapy exist: theoretical integration, theoretical eclecticism, and common factors in different psychotherapeutic trends. In integrative psychotherapy, the basic epistemology, theory, and clinical practice are based on the phenomenology, field theory, holism, dialogue, and co-creation of dialogue in the therapeutic relationship. The main criticism is that integrative psychotherapy suffers from confusion and many unresolved controversies. It is difficult to theoretically and methodologically define the clinically applied model that is based on such a different epistemological and theoretical presumptions. Integrative psychotherapy is a synthesis of humanistic psychotherapy, object relations theory, and psychoanalytical self psychology. It focuses on the dynamics and potentials of human relationships, with a goal of changing the relations and understanding internal and external resistances. The process of integrative psychotherapy is primarily focused on the developmental-relational model and co-creation of psychotherapeutic relationship as a single interactive event, which is not unilateral, but rather a joint endeavor by both the therapist and the patient/client. The need for a relationship is an important human need and represents a process of attunement that occurs as a response to the need for a relationship, a unique interpersonal contact between two people. If this need is not met, it manifests with the different feelings and various defenses. To meet this need, we need to have another person with whom we can establish a sensitive, attuned relationship. Thus, the therapist becomes this person who tries to supplement what the person did not receive. Neuroscience can be a source of integration through different therapies. We

  11. Integration of Chandrasekhar's integral equation

    International Nuclear Information System (INIS)

    Tanaka, Tasuku

    2003-01-01

    We solve Chandrasekhar's integration equation for radiative transfer in the plane-parallel atmosphere by iterative integration. The primary thrust in radiative transfer has been to solve the forward problem, i.e., to evaluate the radiance, given the optical thickness and the scattering phase function. In the area of satellite remote sensing, our problem is the inverse problem: to retrieve the surface reflectance and the optical thickness of the atmosphere from the radiance measured by satellites. In order to retrieve the optical thickness and the surface reflectance from the radiance at the top-of-the atmosphere (TOA), we should express the radiance at TOA 'explicitly' in the optical thickness and the surface reflectance. Chandrasekhar formalized radiative transfer in the plane-parallel atmosphere in a simultaneous integral equation, and he obtained the second approximation. Since then no higher approximation has been reported. In this paper, we obtain the third approximation of the scattering function. We integrate functions derived from the second approximation in the integral interval from 1 to ∞ of the inverse of the cos of zenith angles. We can obtain the indefinite integral rather easily in the form of a series expansion. However, the integrals at the upper limit, ∞, are not yet known to us. We can assess the converged values of those series expansions at ∞ through calculus. For integration, we choose coupling pairs to avoid unnecessary terms in the outcome of integral and discover that the simultaneous integral equation can be deduced to the mere integral equation. Through algebraic calculation, we obtain the third approximation as a polynomial of the third degree in the atmospheric optical thickness

  12. Electronic detecting equipment in the Camac standard

    International Nuclear Information System (INIS)

    Basiladze, S.G.

    1981-01-01

    Basic tends of development of electron detecting equipment of modern facilities for experiments in nuclear physics are considered. Special attention is paid to developments of specialized hybrid integrated circuits, specialized processors for selection of events, usage of integrated circuits of memories in detecting units as well as to prospects of developing nuclear electronics standards [ru

  13. Integrated services

    International Nuclear Information System (INIS)

    Chafcouloff, S.; Michel, G.; Trice, M.; Clark, G.; Cosad, C.; Forbes, K.

    1995-01-01

    Integrated services is the name given to several services grouped together under a single contract. Four key factors determine the success of integrated services projects: teamwork, common objectives, technology, and shared benefits. For oil companies, integration means smoother, more efficient operations by bringing service companies on board as part of the team. For the service industry, it means a radical change in the way business is conducted, taking on more responsibility in return for greater incentives. This article reviews the need for change and the approach Schlumberger has adopted to meet this challenge. 20 figs., 20 refs

  14. Integrated services

    Energy Technology Data Exchange (ETDEWEB)

    Chafcouloff, S.; Michel, G.; Trice, M. [Schlumberger Integrated Project Management Group, Montrouge (France); Clark, G. [Schlumberger Testing Services, Aberdeen (United Kingdom); Cosad, C.; Forbes, K. [Schlumberger Integrated Project Management Group, Aberdeen (United Kingdom)

    1995-12-31

    Integrated services is the name given to several services grouped together under a single contract. Four key factors determine the success of integrated services projects: teamwork, common objectives, technology, and shared benefits. For oil companies, integration means smoother, more efficient operations by bringing service companies on board as part of the team. For the service industry, it means a radical change in the way business is conducted, taking on more responsibility in return for greater incentives. This article reviews the need for change and the approach Schlumberger has adopted to meet this challenge. 20 figs., 20 refs

  15. Shunt detection and measurement

    International Nuclear Information System (INIS)

    Grossman, W.

    1986-01-01

    Detection, localization, and quantification of intracardiac shunts are an integral part of the hemodynamic evaluation of patients with congenital heart disease. In most cases, an intracardiac shunt is suspected on the basis of the clinical evaluation of the patient prior to catheterization. However, there are several circumstances in which data obtained at catheterization should alert the cardiologist to look for a shunt that previously had not been suspected

  16. INTEGRATED EDUCATION

    Directory of Open Access Journals (Sweden)

    Lioara-Bianca BUBOIU

    2015-04-01

    Full Text Available Accepting and valuing people with disabilities is a key aspect of social policies promoted worldwide. The implementation of these policies aim normalize the lives of people with disabilities through full integration in the society to which they belong. Removing discrimination and social barriers eq