WorldWideScience

Sample records for inhibit immune function

  1. Effect of low frequency magnetic fields on melanoma: tumor inhibition and immune modulation

    International Nuclear Information System (INIS)

    Nie, Yunzhong; Du, Leilei; Mou, Yongbin; Xu, Zhenjun; Weng, Leihua; Du, Youwei; Zhu, Yanan; Hou, Yayi; Wang, Tingting

    2013-01-01

    We previously found that the low frequency magnetic fields (LF-MF) inhibited gastric and lung cancer cell growth. We suppose that exposure to LF-MF may modulate immune function so as to inhibit tumor. We here investigated whether LF-MF can inhibit the proliferation and metastasis of melanoma and influence immune function. The effect of MF on the proliferation, cell cycle and ultrastracture of B16-F10 in vitro was detected by cell counting Kit-8 assay, flow cytometry, and transmission electron microscopy. Lung metastasis mice were prepared by injection of 2 × 10 5 B16-F10 melanoma cells into the tail vein in C57BL/6 mice. The mice were then exposed to an LF-MF (0.4 T, 7.5 Hz) for 43 days. Survival rate, tumor markers and the innate and adaptive immune parameters were measured. The growth of B16-F10 cells was inhibited after exposure to the LF-MF. The inhibition was related to induction of cell cycle arrest and decomposition of chromatins. Moreover, the LF-MF prolonged the mouse survival rate and inhibited the proliferation of B16-F10 in melanoma metastasis mice model. Furthermore, the LF-MF modulated the immune response via regulation of immune cells and cytokine production. In addition, the number of Treg cells was decreased in mice with the LF-MF exposure, while the numbers of T cells as well as dendritic cells were significantly increased. LF-MF inhibited the growth and metastasis of melanoma cancer cells and improved immune function of tumor-bearing mice. This suggests that the inhibition may be attributed to modulation of LF-MF on immune function and LF-MF may be a potential therapy for treatment of melanoma

  2. Pomegranate extract and exercise provide additive benefits on improvement of immune function by inhibiting inflammation and oxidative stress in high-fat-diet-induced obesity in rats.

    Science.gov (United States)

    Zhao, Fei; Pang, Wentao; Zhang, Ziyi; Zhao, Jialong; Wang, Xin; Liu, Ye; Wang, Xun; Feng, Zhihui; Zhang, Yong; Sun, Wenyan; Liu, Jiankang

    2016-06-01

    Obesity is reported to be associated with immune dysfunction and a state of low-grade, chronic inflammation. Either pomegranate extract (PomE) or exercise (Ex) has been shown to have antiobesity, anti-inflammatory and antioxidant effects. Nevertheless, no study has addressed the additive benefits of PomE and Ex on the restoration of obesity-induced immune defects. The present work aims to study the effect of PomE and Ex as a combined intervention on immune function and the underlying mechanism involved in inflammation and oxidative stress in rats with high-fat-diet (HFD)-induced obesity. Our results demonstrate that the combination of PomE and Ex showed additive benefits on inhibition of HFD-induced body weight increase and improvement of HFD-induced immune dysfunction, including (a) attenuating the abnormality of histomorphology of the spleen, (b) increasing the ratio of the CD4+:CD8+ T cell subpopulations in splenocytes and peripheral blood mononuclear cells (PBMC), (c) inhibition of apoptosis in splenocytes and PBMC, (d) normalizing peritoneal macrophage phenotypes and (e) restoring immunomodulating factors in serum. We also find that immune dysfunction in HFD-fed rats was associated with increased inflammatory cytokine secretion and oxidative stress biomarkers, and that the combination of PomE and Ex effectively inhibited the inflammatory response and decreased oxidative damage. The effect of PomE and Ex as a combined intervention is greater than the effect of either PomE or Ex alone, showing that PomE and Ex may be additively effective in improving immune function in HFD-fed rats by inhibiting inflammation and decreasing oxidative stress. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Inhibition of CXCL12 signaling attenuates the postischemic immune response and improves functional recovery after stroke

    DEFF Research Database (Denmark)

    Ruscher, Karsten; Kuric, Enida; Liu, Yawei

    2013-01-01

    cell-derived factor-1 (CXCL12). To mimic beneficial effects of EE, we studied the impact of inhibiting CXCL12 action on functional recovery after transient MCAO (tMCAO). Rats treated with the specific CXCL12 receptor antagonist 1-[4-(1,4,8,11-tetrazacyclotetradec-1-ylmethyl)phenyl]methyl]-1......After stroke, brain inflammation in the ischemic hemisphere hampers brain tissue reorganization and functional recovery. Housing rats in an enriched environment (EE) dramatically improves recovery of lost neurologic functions after experimental stroke. We show here that rats housed in EE after......,4,8,11-tetrazacyclo-tetradecan (AMD3100) showed improved recovery compared with saline-treated rats after tMCAO, without a concomitant reduction in infarct size. This was accompanied by a reduction of infiltrating immune cells in the ischemic hemisphere, particularly cluster of differentiation 3-positive (CD3...

  4. Validating the pivotal role of the immune system in low-dose radiation-induced tumor inhibition in Lewis lung cancer-bearing mice.

    Science.gov (United States)

    Zhou, Lei; Zhang, Xiaoying; Li, Hui; Niu, Chao; Yu, Dehai; Yang, Guozi; Liang, Xinyue; Wen, Xue; Li, Min; Cui, Jiuwei

    2018-04-01

    Although low-dose radiation (LDR) possesses the two distinct functions of inducing hormesis and adaptive responses, which result in immune enhancement and tumor inhibition, its clinical applications have not yet been elucidated. The major obstacle that hinders the application of LDR in the clinical setting is that the mechanisms underlying induction of tumor inhibition are unclear, and the risks associated with LDR are still unknown. Thus, to overcome this obstacle and elucidate the mechanisms mediating the antitumor effects of LDR, in this study, we established an in vivo lung cancer model to investigate the participation of the immune system in LDR-induced tumor inhibition and validated the pivotal role of the immune system by impairing immunity with high-dose radiation (HDR) of 1 Gy. Additionally, the LDR-induced adaptive response of the immune system was also observed by sequential HDR treatment in this mouse model. We found that LDR-activated T cells and natural killer cells and increased the cytotoxicity of splenocytes and the infiltration of T cells in the tumor tissues. In contrast, when immune function was impaired by HDR pretreatment, LDR could not induce tumor inhibition. However, when LDR was administered before HDR, the immunity could be protected from impairment, and tumor growth could be inhibited to some extent, indicating the induction of the immune adaptive response by LDR. Therefore, we demonstrated that immune enhancement played a key role in LDR-induced tumor inhibition. These findings emphasized the importance of the immune response in tumor radiotherapy and may help promote the application of LDR as a novel approach in clinical practice. © 2018 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  5. Inhibition of the immune response to experimental fresh osteoarticular allografts

    International Nuclear Information System (INIS)

    Rodrigo, J.J.; Schnaser, A.M.; Reynolds, H.M. Jr.; Biggart, J.M. III; Leathers, M.W.; Chism, S.E.; Thorson, E.; Grotz, T.; Yang, Q.M.

    1989-01-01

    The immune response to osteoarticular allografts is capable of destroying the cartilage--a tissue that has antigens on its cells identical to those on the bone and marrow cells. Osteoarticular allografts of the distal femur were performed in rats using various methods to attempt to temporarily inhibit the antibody response. The temporary systemic immunosuppressant regimens investigated were cyclophosphamide, azathioprine and prednisolone, cyclosporine A, and total lymphoid irradiation. The most successful appeared to be cyclosporine A, but significant side effects were observed. To specifically inhibit the immune response in the allograft antigens without systemically inhibiting the entire immune system, passive enhancement and preadministration of donor blood were tried. Neither was as effective as coating the donor bone with biodegradable cements, a method previously found to be successful. Cyclosporine A was investigated in dogs in a preliminary study of medial compartmental knee allografts and was found to be successful in inhibiting the antibody response and in producing a more successful graft; however, some significant side effects were similarly observed

  6. Human metapneumovirus M2-2 protein inhibits innate immune response in monocyte-derived dendritic cells.

    Directory of Open Access Journals (Sweden)

    Junping Ren

    Full Text Available Human metapneumovirus (hMPV is a leading cause of lower respiratory infection in young children, the elderly and immunocompromised patients. Repeated hMPV infections occur throughout life. However, immune evasion mechanisms of hMPV infection are largely unknown. Recently, our group has demonstrated that hMPV M2-2 protein, an important virulence factor, contributes to immune evasion in airway epithelial cells by targeting the mitochondrial antiviral-signaling protein (MAVS. Whether M2-2 regulates the innate immunity in human dendritic cells (DC, an important family of immune cells controlling antigen presenting, is currently unknown. We found that human DC infected with a virus lacking M2-2 protein expression (rhMPV-ΔM2-2 produced higher levels of cytokines, chemokines and IFNs, compared to cells infected with wild-type virus (rhMPV-WT, suggesting that M2-2 protein inhibits innate immunity in human DC. In parallel, we found that myeloid differentiation primary response gene 88 (MyD88, an essential adaptor for Toll-like receptors (TLRs, plays a critical role in inducing immune response of human DC, as downregulation of MyD88 by siRNA blocked the induction of immune regulatory molecules by hMPV. Since M2-2 is a cytoplasmic protein, we investigated whether M2-2 interferes with MyD88-mediated antiviral signaling. We found that indeed M2-2 protein associated with MyD88 and inhibited MyD88-dependent gene transcription. In this study, we also identified the domains of M2-2 responsible for its immune inhibitory function in human DC. In summary, our results demonstrate that M2-2 contributes to hMPV immune evasion by inhibiting MyD88-dependent cellular responses in human DC.

  7. Tradeoffs between immune function and childhood growth among Amazonian forager-horticulturalists.

    Science.gov (United States)

    Urlacher, Samuel S; Ellison, Peter T; Sugiyama, Lawrence S; Pontzer, Herman; Eick, Geeta; Liebert, Melissa A; Cepon-Robins, Tara J; Gildner, Theresa E; Snodgrass, J Josh

    2018-04-24

    Immune function is an energetically costly physiological activity that potentially diverts calories away from less immediately essential life tasks. Among developing organisms, the allocation of energy toward immune function may lead to tradeoffs with physical growth, particularly in high-pathogen, low-resource environments. The present study tests this hypothesis across diverse timeframes, branches of immunity, and conditions of energy availability among humans. Using a prospective mixed-longitudinal design, we collected anthropometric and blood immune biomarker data from 261 Amazonian forager-horticulturalist Shuar children (age 4-11 y old). This strategy provided baseline measures of participant stature, s.c. body fat, and humoral and cell-mediated immune activity as well as subsample longitudinal measures of linear growth (1 wk, 3 mo, 20 mo) and acute inflammation. Multilevel analyses demonstrate consistent negative effects of immune function on growth, with children experiencing up to 49% growth reduction during periods of mildly elevated immune activity. The direct energetic nature of these relationships is indicated by ( i ) the manifestation of biomarker-specific negative immune effects only when examining growth over timeframes capturing active competition for energetic resources, ( ii ) the exaggerated impact of particularly costly inflammation on growth, and ( iii ) the ability of children with greater levels of body fat (i.e., energy reserves) to completely avoid the growth-inhibiting effects of acute inflammation. These findings provide evidence for immunologically and temporally diverse body fat-dependent tradeoffs between immune function and growth during childhood. We discuss the implications of this work for understanding human developmental energetics and the biological mechanisms regulating variation in human ontogeny, life history, and health.

  8. Tumor-altered dendritic cell function: implications for anti-tumor immunity

    Directory of Open Access Journals (Sweden)

    Kristian Michael Hargadon

    2013-07-01

    Full Text Available Dendritic cells are key regulators of both innate and adaptive immunity, and the array of immunoregulatory functions exhibited by these cells is dictated by their differentiation, maturation, and activation status. Although a major role for these cells in the induction of immunity to pathogens has long been appreciated, data accumulated over the last several years has demonstrated that DC are also critical regulators of anti-tumor immune responses. However, despite the potential for stimulation of robust anti-tumor immunity by DC, tumor-altered DC function has been observed in many cancer patients and tumor-bearing animals and is often associated with tumor immune escape. Such dysfunction has significant implications for both the induction of natural anti-tumor immune responses as well as the efficacy of immunotherapeutic strategies that target endogenous DC in situ or that employ exogenous DC as part of anti-cancer immunization maneuvers. In this review, the major types of tumor-altered DC function will be described, with emphasis on recent insights into the mechanistic bases for the inhibition of DC differentiation from hematopoietic precursors, the altered programming of DC precursors to differentiate into myeloid-derived suppressor cells or tumor-associated macrophages, the suppression of DC maturation and activation, and the induction of immunoregulatory DC by tumors, tumor-derived factors, and tumor-associated cells within the milieu of the tumor microenvironment. The impact of these tumor-altered cells on the quality of the overall anti-tumor immune response will also be discussed. Finally, this review will also highlight questions concerning tumor-altered DC function that remain unanswered, and it will address factors that have limited advances in the study of this phenomenon in order to focus future research efforts in the field on identifying strategies for interfering with tumor-associated DC dysfunction and improving DC-mediated anti

  9. The Ustilago maydis effector Pep1 suppresses plant immunity by inhibition of host peroxidase activity.

    Directory of Open Access Journals (Sweden)

    Christoph Hemetsberger

    Full Text Available The corn smut Ustilago maydis establishes a biotrophic interaction with its host plant maize. This interaction requires efficient suppression of plant immune responses, which is attributed to secreted effector proteins. Previously we identified Pep1 (Protein essential during penetration-1 as a secreted effector with an essential role for U. maydis virulence. pep1 deletion mutants induce strong defense responses leading to an early block in pathogenic development of the fungus. Using cytological and functional assays we show that Pep1 functions as an inhibitor of plant peroxidases. At sites of Δpep1 mutant penetrations, H₂O₂ strongly accumulated in the cell walls, coinciding with a transcriptional induction of the secreted maize peroxidase POX12. Pep1 protein effectively inhibited the peroxidase driven oxidative burst and thereby suppresses the early immune responses of maize. Moreover, Pep1 directly inhibits peroxidases in vitro in a concentration-dependent manner. Using fluorescence complementation assays, we observed a direct interaction of Pep1 and the maize peroxidase POX12 in vivo. Functional relevance of this interaction was demonstrated by partial complementation of the Δpep1 mutant defect by virus induced gene silencing of maize POX12. We conclude that Pep1 acts as a potent suppressor of early plant defenses by inhibition of peroxidase activity. Thus, it represents a novel strategy for establishing a biotrophic interaction.

  10. Vorinostat and hydroxychloroquine improve immunity and inhibit autophagy in metastatic colorectal cancer.

    Science.gov (United States)

    Patel, Sukeshi; Hurez, Vincent; Nawrocki, Steffan T; Goros, Martin; Michalek, Joel; Sarantopoulos, John; Curiel, Tyler; Mahalingam, Devalingam

    2016-09-13

    Hydroxychloroquine (HCQ) enhances the anti-cancer activity of the histone deacetylase inhibitor, vorinostat (VOR), in pre-clinical models and early phase clinical studies of metastatic colorectal cancer (mCRC). Mechanisms could include autophagy inhibition, accumulation of ubiquitinated proteins, and subsequent tumor cell apoptosis. There is growing evidence that autophagy inhibition could lead to improved anti-cancer immunity. To date, effects of autophagy on immunity have not been reported in cancer patients. To address this, we expanded an ongoing clinical study to include patients with advanced, refractory mCRC to evaluate further the clinical efficacy and immune effects of VOR plus HCQ. Refractory mCRC patients received VOR 400 milligrams orally with HCQ 600 milligrams orally daily, in a 3-week cycle. The primary endpoint was median progression-free survival (mPFS). Secondary endpoints include median overall survival (mOS), adverse events (AE), pharmacodynamic of inhibition of autophagy in primary tumors, immune cell analyses, and cytokine levels. Twenty patients were enrolled (19 evaluable for survival) with a mPFS of 2.8 months and mOS of 6.7 months. Treatment-related grade 3-4 AEs occurred in 8 patients (40%), with fatigue, nausea/vomiting, and anemia being the most common. Treatment significantly reduced CD4+CD25hiFoxp3+ regulatory and PD-1+ (exhausted) CD4+ and CD8+ T cells and decreased CD45RO-CD62L+ (naive) T cells, consistent with improved anti-tumor immunity. On-study tumor biopsies showed increases in lysosomal protease cathepsin D and p62 accumulation, consistent with autophagy inhibition. Taken together, VOR plus HCQ is active, safe and well tolerated in refractory CRC patients, resulting in potentially improved anti-tumor immunity and inhibition of autophagy.

  11. Vaccination targeting human HER3 alters the phenotype of infiltrating T cells and responses to immune checkpoint inhibition.

    Science.gov (United States)

    Osada, Takuya; Morse, Michael A; Hobeika, Amy; Diniz, Marcio A; Gwin, William R; Hartman, Zachary; Wei, Junping; Guo, Hongtao; Yang, Xiao-Yi; Liu, Cong-Xiao; Kaneko, Kensuke; Broadwater, Gloria; Lyerly, H Kim

    2017-01-01

    Expression of human epidermal growth factor family member 3 (HER3), a critical heterodimerization partner with EGFR and HER2, promotes more aggressive biology in breast and other epithelial malignancies. As such, inhibiting HER3 could have broad applicability to the treatment of EGFR- and HER2-driven tumors. Although lack of a functional kinase domain limits the use of receptor tyrosine kinase inhibitors, HER3 contains antigenic targets for T cells and antibodies. Using novel human HER3 transgenic mouse models of breast cancer, we demonstrate that immunization with recombinant adenoviral vectors encoding full length human HER3 (Ad-HER3-FL) induces HER3-specific T cells and antibodies, alters the T cell infiltrate in tumors, and influences responses to immune checkpoint inhibitions. Both preventative and therapeutic Ad-HER3-FL immunization delayed tumor growth but were associated with both intratumoral PD-1 expressing CD8 + T cells and regulatory CD4 + T cell infiltrates. Immune checkpoint inhibition with either anti-PD-1 or anti-PD-L1 antibodies increased intratumoral CD8 + T cell infiltration and eliminated tumor following preventive vaccination with Ad-HER3-FL vaccine. The combination of dual PD-1/PD-L1 and CTLA4 blockade slowed the growth of tumor in response to Ad-HER3-FL in the therapeutic model. We conclude that HER3-targeting vaccines activate HER3-specific T cells and induce anti-HER3 specific antibodies, which alters the intratumoral T cell infiltrate and responses to immune checkpoint inhibition.

  12. Effects of BRAF mutations and BRAF inhibition on immune responses to melanoma

    Science.gov (United States)

    Ilieva, Kristina M.; Correa, Isabel; Josephs, Debra H.; Karagiannis, Panagiotis; Egbuniwe, Isioma U.; Cafferkey, Michiala J.; Spicer, James F.; Harries, Mark; Nestle, Frank O.; Lacy, Katie E.; Karagiannis, Sophia N.

    2014-01-01

    Malignant melanoma is associated with poor clinical prognosis; however, novel molecular and immune therapies are now improving patient outcomes. Almost 50% of melanomas harbor targetable activating mutations of BRAF which promote RAS-RAF-MEK-ERK pathway activation and melanoma proliferation. Recent evidence also indicates that melanomas bearing mutant BRAF may also have altered immune responses, suggesting additional avenues for treatment of this patient group. The small molecule inhibitors selective for mutant BRAF induce significant but short-lived clinical responses in a proportion of patients, but also lead to immune stimulatory bystander events, which then subside with the emergence of resistance to inhibition. Simultaneous BRAF and MEK inhibition, and especially combination of BRAF inhibitors with new immunotherapies such as checkpoint blockade antibodies, may further enhance immune activation, or counteract immunosuppressive signals. Pre-clinical evaluation and ongoing clinical trials should provide novel insights into the role of immunity in the therapy of BRAF-mutant melanoma. PMID:25385327

  13. Avelumab: combining immune checkpoint inhibition and antibody-dependent cytotoxicity.

    Science.gov (United States)

    Hamilton, Gerhard; Rath, Barbara

    2017-04-01

    Immune checkpoint inhibition holds great promise for selected tumors. The human monoclonal antibody (mAB) avelumab is directed to programmed death ligand-1 (PD-L1) and is supposed to inhibit the immunosuppressive PD-L1/PD-1 interaction and, furthermore, effect antibody-dependent cytotoxicity (ADCC) lysis of tumor cells. Areas covered: This article presents an overview of the current means to activate the antitumor immune defense by targeting PD-1 or PD-L1 with mABs and their possible role in ADCC-mediated tumor cell elimination. Expert opinion: Avelumab contains a Fc region which can bind cognate receptors on immune effector cells and induce ADCC-mediated tumor cell lysis, in contrast to other mABs directed to PD-1/PD-L1 which lack the ability to trigger ADCC due to belonging to the IgG4 subclass or possessing a mutated Fc region. Preclinical and clinical data indicate that avelumab can be safely administered to cancer patients with a toxicity profile comparable to other mABs and without lysis of PD-L1-positive activated immune cells. This antibody yielded durable responses in a phase II trial in advanced Merkel cell carcinoma patients. Tumor cell lysis by avelumab prevents cells from resorting to alternative checkpoints as shown by targeting PD-1 and the upregulation of TIM-3.

  14. Mycobacterial growth inhibition is associated with trained innate immunity.

    Science.gov (United States)

    Joosten, Simone A; van Meijgaarden, Krista E; Arend, Sandra M; Prins, Corine; Oftung, Fredrik; Korsvold, Gro Ellen; Kik, Sandra V; Arts, Rob Jw; van Crevel, Reinout; Netea, Mihai G; Ottenhoff, Tom Hm

    2018-05-01

    The lack of defined correlates of protection hampers development of vaccines against tuberculosis (TB). In vitro mycobacterial outgrowth assays are thought to better capture the complexity of the human host/Mycobacterium tuberculosis (Mtb) interaction. Here, we used a mycobacterial growth inhibition assay (MGIA) based on peripheral blood mononuclear cells to investigate the capacity to control outgrowth of bacille Calmette-Guérin (BCG). Interestingly, strong control of BCG outgrowth was observed almost exclusively in individuals with recent exposure to Mtb, but not in (long-term) latent TB infection, and only modestly in BCG vaccinees. Mechanistically, control of mycobacterial outgrowth strongly correlated with the presence of a CD14dim monocyte population, but also required the presence of T cells. The nonclassical monocytes produced CXCL10, and CXCR3 receptor blockade inhibited the capacity to control BCG outgrowth. Expression of CXCR3 splice variants was altered in recently Mtb-exposed individuals. Cytokines previously associated with trained immunity were detected in MGIA supernatants, and CXCL9, CXCL10, and CXCL11 represent new markers of trained immunity. These data indicate that CXCR3 ligands are associated with trained immunity and are critical factors in controlling mycobacterial outgrowth. In conclusion, control of mycobacterial outgrowth early after exposure to Mtb is the result of trained immunity mediated by a CXCL10-producing nonclassical CD14dim monocyte subset.

  15. Studies on the protection effects of functional foods for skin immune system from radiation damage

    International Nuclear Information System (INIS)

    Yee, Sung Tae; Shin, Seong Hae; Kim, Do Sun; Heo, Ji Yun; Kang, Hye In

    2007-07-01

    We evaluated the protective effects of pilot products (HemoHIM and HemoTonic) on the UV-induced skin immune damages as the following. · Protective effects of HemoHIM and HemoTonic against UV using contact hypersensitivity model - Protection against depression of contact hypersensitivity by administration and skin application of HemoHIM and HemoTonic - Induction of dendritic cell differentiation and maturation by HemoHIM and HemoTonic treatment - Improvement of antigen-presenting activity of dedritic cells by HemoHIM and HemoTonic treatment · Protective effects of HemoHIM and HemoTonic on skin immune system against UV-irradiation - Protection of antigen-presenting activity of dendritic cells under UV-irradiation - In vivo protection of antigen-presenting activity of Langerhans cells in UV-irradiated mice · Protective effects of HemoHIM on UV-induced apoptosis of dendritic cells - Inhibition of cell membrane change, mitochondrial potential change, SubG1 cell population, nuclear condensation, and DNA fragmentation in UV-irradiated dendritic cells · Anti-allergic effects of HemoHIM and HemoTonic in human adipocyte HMC-1 cells - Inhibition of allergic histamine release from adipocytes - Inhibition of secretion of inflammatory cytokines (IL-6, IL-8, TNF-α, GM-CSF) - Inhibition of c-kit, tryptase, FcεRI mRNA expression From these results, the developed functional food products (HemoHIM, HemoTonic) showed the protection and recovery of the immune functions in the UV-irradiated skin. It is suggested that these products may be used as a new functional food or cosmetic material for the protection of skin damage and the promotion of recovery

  16. Studies on the protection effects of functional foods for skin immune system from radiation damage

    Energy Technology Data Exchange (ETDEWEB)

    Yee, Sung Tae; Shin, Seong Hae; Kim, Do Sun; Heo, Ji Yun; Kang, Hye In [Sunchon National University, Sunchon (Korea, Republic of)

    2007-07-15

    We evaluated the protective effects of pilot products (HemoHIM and HemoTonic) on the UV-induced skin immune damages as the following. centre dot Protective effects of HemoHIM and HemoTonic against UV using contact hypersensitivity model - Protection against depression of contact hypersensitivity by administration and skin application of HemoHIM and HemoTonic - Induction of dendritic cell differentiation and maturation by HemoHIM and HemoTonic treatment - Improvement of antigen-presenting activity of dedritic cells by HemoHIM and HemoTonic treatment centre dot Protective effects of HemoHIM and HemoTonic on skin immune system against UV-irradiation - Protection of antigen-presenting activity of dendritic cells under UV-irradiation - In vivo protection of antigen-presenting activity of Langerhans cells in UV-irradiated mice centre dot Protective effects of HemoHIM on UV-induced apoptosis of dendritic cells - Inhibition of cell membrane change, mitochondrial potential change, SubG1 cell population, nuclear condensation, and DNA fragmentation in UV-irradiated dendritic cells centre dot Anti-allergic effects of HemoHIM and HemoTonic in human adipocyte HMC-1 cells - Inhibition of allergic histamine release from adipocytes - Inhibition of secretion of inflammatory cytokines (IL-6, IL-8, TNF-alpha, GM-CSF) - Inhibition of c-kit, tryptase, FcepsilonRI mRNA expression From these results, the developed functional food products (HemoHIM, HemoTonic) showed the protection and recovery of the immune functions in the UV-irradiated skin. It is suggested that these products may be used as a new functional food or cosmetic material for the protection of skin damage and the promotion of recovery

  17. Molecular and Functional Neuroscience in Immunity.

    Science.gov (United States)

    Pavlov, Valentin A; Chavan, Sangeeta S; Tracey, Kevin J

    2018-04-26

    The nervous system regulates immunity and inflammation. The molecular detection of pathogen fragments, cytokines, and other immune molecules by sensory neurons generates immunoregulatory responses through efferent autonomic neuron signaling. The functional organization of this neural control is based on principles of reflex regulation. Reflexes involving the vagus nerve and other nerves have been therapeutically explored in models of inflammatory and autoimmune conditions, and recently in clinical settings. The brain integrates neuro-immune communication, and brain function is altered in diseases characterized by peripheral immune dysregulation and inflammation. Here we review the anatomical and molecular basis of the neural interface with immunity, focusing on peripheral neural control of immune functions and the role of the brain in the model of the immunological homunculus. Clinical advances stemming from this knowledge within the framework of bioelectronic medicine are also briefly outlined.

  18. Immune function in arctic mammals

    DEFF Research Database (Denmark)

    Desforges, Jean-Pierre; Jasperse, Lindsay; Jensen, Trine Hammer

    2018-01-01

    Natural killer (NK) cells are a vital part of the rapid and non-specific immune defense against invading pathogens and tumor cells. This study evaluated NK cell-like activity by flow cytometry for the first time in three ecologically and culturally important Arctic mammal species: polar bear (Ursus...... the effector:target cell ratio increased. Comparing NK activity between fresh and cryopreserved mouse lymphocytes revealed little to no difference in function, highlighting the applicability of cryopreserving cells in field studies. The evaluation of this important innate immune function in Arctic mammals can...... contribute to future population health assessments, especially as pollution-induced suppression of immune function may increase infectious disease susceptibility....

  19. Modulation of Immune Functions by Foods

    Directory of Open Access Journals (Sweden)

    Shuichi Kaminogawa

    2004-01-01

    Full Text Available Evidence is rapidly accumulating as to the beneficial effects of foods. However, it is not always clear whether the information is based on data evaluated impartially in a scientific fashion. Human research into whether foods modulate immune functions in either intervention studies or randomized controlled trials can be classified into three categories according to the physical state of subjects enrolled for investigation: (i studies examining the effect of foods in healthy individuals; (ii studies analyzing the effect of foods on patients with hypersensitivity; and (iii studies checking the effect of foods on immunocompromized subjects, including patients who had undergone surgical resection of cancer and newborns. The systematization of reported studies has made it reasonable to conclude that foods are able to modulate immune functions manifesting as either innate immunity (phagocytic activity, NK cell activity or acquired immunity (T cell response, antibody production. Moreover, improvement of immune functions by foods can normalize the physical state of allergic patients or cancer patients, and may reduce the risk of diseases in healthy individuals. Therefore, it is valuable to assess the immune-modulating abilities of foods by measuring at least one parameter of either innate or acquired immunity.

  20. TIPE2, a negative regulator of innate and adaptive immunity that maintains immune homeostasis.

    Science.gov (United States)

    Sun, Honghong; Gong, Shunyou; Carmody, Ruaidhri J; Hilliard, Anja; Li, Li; Sun, Jing; Kong, Li; Xu, Lingyun; Hilliard, Brendan; Hu, Shimin; Shen, Hao; Yang, Xiaolu; Chen, Youhai H

    2008-05-02

    Immune homeostasis is essential for the normal functioning of the immune system, and its breakdown leads to fatal inflammatory diseases. We report here the identification of a member of the tumor necrosis factor-alpha-induced protein-8 (TNFAIP8) family, designated TIPE2, that is required for maintaining immune homeostasis. TIPE2 is preferentially expressed in lymphoid tissues, and its deletion in mice leads to multiorgan inflammation, splenomegaly, and premature death. TIPE2-deficient animals are hypersensitive to septic shock, and TIPE2-deficient cells are hyper-responsive to Toll-like receptor (TLR) and T cell receptor (TCR) activation. Importantly, TIPE2 binds to caspase-8 and inhibits activating protein-1 and nuclear factor-kappaB activation while promoting Fas-induced apoptosis. Inhibiting caspase-8 significantly blocks the hyper-responsiveness of TIPE2-deficient cells. These results establish that TIPE2 is an essential negative regulator of TLR and TCR function, and its selective expression in the immune system prevents hyperresponsiveness and maintains immune homeostasis.

  1. Monounsaturated fats and immune function

    Directory of Open Access Journals (Sweden)

    P. Yaqoob

    1998-04-01

    Full Text Available Animal studies suggest that olive oil is capable of modulating functions of cells of the immune system in a manner similar to, albeit weaker than, fish oils. There is some evidence that the effects of olive oil on immune function in animal studies are due to oleic acid rather than to trace elements or antioxidants. Importantly, several studies have demonstrated effects of oleic acid-containing diets on in vivo immune responses. In contrast, consumption of a monounsaturated fatty acid (MUFA-rich diet by humans does not appear to bring about a general suppression of immune cell functions. The effects of this diet in humans are limited to decreasing aspects of adhesion of peripheral blood mononuclear cells, although there are trends towards decreases in natural killer cell activity and proliferation. The lack of a clear effect of MUFA in humans may be attributable to the higher level of monounsaturated fat used in the animal studies, although it is ultimately of importance to examine the effects of intakes which are in no way extreme. The effects of MUFA on adhesion molecules are potentially important, since these molecules appear to have a role in the pathology of a number of diseases involving the immune system. This area clearly deserves further exploration

  2. Unanticipated Mycobacterium tuberculosis complex culture inhibition by immune modulators, immune suppressants, a growth enhancer, and vitamins A and D: clinical implications.

    Science.gov (United States)

    Greenstein, Robert J; Su, Liya; Shahidi, Azra; Brown, William D; Clifford, Anya; Brown, Sheldon T

    2014-09-01

    The development of novel antibiotics to treat multidrug-resistant (MDR) tuberculosis is time-consuming and expensive. Multiple immune modulators, immune suppressants, anti-inflammatories, and growth enhancers, and vitamins A and D, inhibit Mycobacterium avium subspecies paratuberculosis (MAP) in culture. We studied the culture inhibition of Mycobacterium tuberculosis complex by these agents. Biosafety level two M. tuberculosis complex (ATCC 19015 and ATCC 25177) was studied in radiometric Bactec or MGIT culture. Agents evaluated included clofazimine, methotrexate, 6-mercaptopurine, cyclosporine A, rapamycin, tacrolimus, monensin, and vitamins A and D. All the agents mentioned above caused dose-dependent inhibition of the M. tuberculosis complex. There was no inhibition by the anti-inflammatory 5-aminosalicylic acid, which causes bacteriostatic inhibition of MAP. We conclude that, at a minimum, studies with virulent M. tuberculosis are indicated with the agents mentioned above, as well as with the thioamide 5-propothiouricil, which has previously been shown to inhibit the M. tuberculosis complex in culture. Our data additionally emphasize the importance of vitamins A and D in treating mycobacterial diseases. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  3. Season of birth shapes neonatal immune function

    DEFF Research Database (Denmark)

    Thysen, Anna Hammerich; Rasmussen, Morten Arendt; Kreiner-Møller, Eskil

    2016-01-01

    Birth season has been reported to be a risk factor for several immune-mediated diseases. We hypothesized that this association is mediated by differential changes in neonatal immune phenotype and function with birth season. We sought to investigate the influence of season of birth on cord blood...... immune cell subsets and inflammatory mediators in neonatal airways. Cord blood was phenotyped for 26 different immune cell subsets, and at 1 month of age, 20 cytokines and chemokines were quantified in airway mucosal lining fluid. Multivariate partial least squares discriminant analyses were applied...... to determine whether certain immune profiles dominate by birth season, and correlations between individual cord blood immune cells and early airway immune mediators were defined. We found a birth season-related fluctuation in neonatal immune cell subsets and in early-life airway mucosal immune function...

  4. Dipeptidyl peptidase-4 (CD26): knowing the function before inhibiting the enzyme.

    Science.gov (United States)

    Matteucci, E; Giampietro, O

    2009-01-01

    Dipeptidyl peptidase-4 (DPP4) or adenosine deaminase complexing protein 2 (ADCP 2) or T-cell activation antigen CD26 (EC 3.4.14.5.) is a serine exopeptidase belonging to the S9B protein family that cleaves X-proline dipeptides from the N-terminus of polypeptides, such as chemokines, neuropeptides, and peptide hormones. The enzyme is a type II transmembrane glycoprotein, expressed on the surface of many cell types, whose physiological functions are largely unknown. Protein dimerisation should be required for catalytic activity and glycosylation of the enzyme could impact on its physiological functions. The dimeric glycoprotein ADCP has been found linked to adenosine deaminase (ADA) whose relationship with lymphocyte maturation-differentiation is well-established. Since implicated in the regulation of the biological activity of hormones and chemokines, such as glucagon-like peptide-1 and glucose-dependent insulinotropic polypeptide, DPP4 inhibition offers a new potential therapeutic approach for type 2 diabetes mellitus, as monotherapy and adjunct therapy to other oral agents. The clinical use of presently available orally active inhibitors of DPP4, however, has been associated with side effects that have been in part attributed to the inhibition of related serine proteases, such as DPP8 and DPP9. Indeed, it is noteworthy that CD26 has a key role in immune regulation as a T cell activation molecule and in immune-mediated disorder. All-cause infections were increased after sitagliptin treatment. It is noteworthy that the effects of DPP4 inhibition on the immune system have not been extensively investigated. So far, only routine laboratory safety variables have been measured in published randomised controlled trials. The review summarises present knowledge in the field and suggests some potential directions of future research.

  5. Modulation of Host Immunity by Human Respiratory Syncytial Virus Virulence Factors: A Synergic Inhibition of Both Innate and Adaptive Immunity

    Directory of Open Access Journals (Sweden)

    Gisela Canedo-Marroquín

    2017-08-01

    Full Text Available The Human Respiratory Syncytial Virus (hRSV is a major cause of acute lower respiratory tract infections (ARTIs and high rates of hospitalizations in children and in the elderly worldwide. Symptoms of hRSV infection include bronchiolitis and pneumonia. The lung pathology observed during hRSV infection is due in part to an exacerbated host immune response, characterized by immune cell infiltration to the lungs. HRSV is an enveloped virus, a member of the Pneumoviridae family, with a non-segmented genome and negative polarity-single RNA that contains 10 genes encoding for 11 proteins. These include the Fusion protein (F, the Glycoprotein (G, and the Small Hydrophobic (SH protein, which are located on the virus surface. In addition, the Nucleoprotein (N, Phosphoprotein (P large polymerase protein (L part of the RNA-dependent RNA polymerase complex, the M2-1 protein as a transcription elongation factor, the M2-2 protein as a regulator of viral transcription and (M protein all of which locate inside the virion. Apart from the structural proteins, the hRSV genome encodes for the non-structural 1 and 2 proteins (NS1 and NS2. HRSV has developed different strategies to evade the host immunity by means of the function of some of these proteins that work as virulence factors to improve the infection in the lung tissue. Also, hRSV NS-1 and NS-2 proteins have been shown to inhibit the activation of the type I interferon response. Furthermore, the hRSV nucleoprotein has been shown to inhibit the immunological synapsis between the dendritic cells and T cells during infection, resulting in an inefficient T cell activation. Here, we discuss the hRSV virulence factors and the host immunological features raised during infection with this virus.

  6. Activation of Plant Innate Immunity by Extracellular High Mobility Group Box 3 and Its Inhibition by Salicylic Acid.

    Directory of Open Access Journals (Sweden)

    Hyong Woo Choi

    2016-03-01

    Full Text Available Damage-associated molecular pattern molecules (DAMPs signal the presence of tissue damage to induce immune responses in plants and animals. Here, we report that High Mobility Group Box 3 (HMGB3 is a novel plant DAMP. Extracellular HMGB3, through receptor-like kinases BAK1 and BKK1, induced hallmark innate immune responses, including i MAPK activation, ii defense-related gene expression, iii callose deposition, and iv enhanced resistance to Botrytis cinerea. Infection by necrotrophic B. cinerea released HMGB3 into the extracellular space (apoplast. Silencing HMGBs enhanced susceptibility to B. cinerea, while HMGB3 injection into apoplast restored resistance. Like its human counterpart, HMGB3 binds salicylic acid (SA, which results in inhibition of its DAMP activity. An SA-binding site mutant of HMGB3 retained its DAMP activity, which was no longer inhibited by SA, consistent with its reduced SA-binding activity. These results provide cross-kingdom evidence that HMGB proteins function as DAMPs and that SA is their conserved inhibitor.

  7. Nutrition, immune function and health of dairy cattle

    DEFF Research Database (Denmark)

    Ingvartsen, Klaus Lønne; Moyes, Kasey

    2013-01-01

    not seem to be improved. Earlier reviews have covered critical periods such as the transition period in the cow and its influence on health and immune function, the interplay between the endocrine system and the immune system and nutrition and immune function. Knowledge on these topics is crucial for our......) on immune function, and to give perspectives for prevention of diseases in the dairy cow through nutrition. To a large extent, the health problems during the periparturient period relate to cows having difficulty in adapting to the nutrient needs for lactation. This may result in PI, a situation where...... the regulatory mechanisms are insufficient for the animals to function optimally leading to a high risk of a complex of digestive, metabolic and infectious problems. The risk of infectious diseases will be increased if the immune competence is reduced. Nutrition plays a pivotal role in the immune response...

  8. Epicutaneous immunization with type II collagen inhibits both onset and progression of chronic collagen-induced arthritis.

    Directory of Open Access Journals (Sweden)

    Jessica Strid

    Full Text Available Epicutaneous immunization is a potential non-invasive technique for antigen-specific immune-modulation. Topical application of protein antigens to barrier-disrupted skin induces potent antigen-specific immunity with a strong Th2-bias. In this study, we investigate whether the autoimmune inflammatory response of chronic collagen-induced arthritis (CCIA in DBA/1-TCR-beta Tg mice can be modified by epicutaneous immunization. We show that epicutaneous immunization with type II collagen (CII inhibited development and progression of CCIA and, importantly, also ameliorated ongoing disease as indicated by clinical scores of disease severity, paw swelling and joints histology. Treated mice show reduced CII-driven T cell proliferation and IFN-gamma production, as well as significantly lower levels of CII-specific IgG2a serum antibodies. In contrast, CII-driven IL-4 production and IgE antibody levels were increased consistent with skewing of the CII response from Th1 to Th2 in treated mice. IL-4 production in treated mice was inversely correlated with disease severity. Moreover, T cells from treated mice inhibited proliferation and IFN-gamma production by T cells from CCIA mice, suggesting induction of regulatory T cells that actively inhibit effector responses in arthritic mice. The levels of CD4(+CD25(+ T cells were however not increased following epicutaneous CII treatment. Together, these results suggest that epicutaneous immunization may be used as an immune-modulating procedure to actively re-programme pathogenic Th1 responses, and could have potential as a novel specific and simple treatment for chronic autoimmune inflammatory diseases such as rheumatoid arthritis.

  9. Problematic Internet Usage and Immune Function.

    Science.gov (United States)

    Reed, Phil; Vile, Rebecca; Osborne, Lisa A; Romano, Michela; Truzoli, Roberto

    2015-01-01

    Problematic internet use has been associated with a variety of psychological comorbidities, but it relationship with physical illness has not received the same degree of investigation. The current study surveyed 505 participants online, and asked about their levels of problematic internet usage (Internet Addiction Test), depression and anxiety (Hospital Anxiety and Depression Scales), social isolation (UCLA Loneliness Questionnaire), sleep problems (Pittsburgh Sleep Quality Index), and their current health - General Health Questionnaire (GHQ-28), and the Immune Function Questionnaire. The results demonstrated that around 30% of the sample displayed mild or worse levels of internet addiction, as measured by the IAT. Although there were differences in the purposes for which males and females used the internet, there were no differences in terms of levels of problematic usage between genders. The internet problems were strongly related to all of the other psychological variables such as depression, anxiety, social-isolation, and sleep problems. Internet addiction was also associated with reduced self-reported immune function, but not with the measure of general health (GHQ-28). This relationship between problematic internet use and reduced immune function was found to be independent of the impact of the co-morbidities. It is suggested that the negative relationship between level of problematic internet use and immune function may be mediated by levels of stress produced by such internet use, and subsequent sympathetic nervous activity, which related to immune-supressants, such as cortisol.

  10. Problematic Internet Usage and Immune Function.

    Directory of Open Access Journals (Sweden)

    Phil Reed

    Full Text Available Problematic internet use has been associated with a variety of psychological comorbidities, but it relationship with physical illness has not received the same degree of investigation. The current study surveyed 505 participants online, and asked about their levels of problematic internet usage (Internet Addiction Test, depression and anxiety (Hospital Anxiety and Depression Scales, social isolation (UCLA Loneliness Questionnaire, sleep problems (Pittsburgh Sleep Quality Index, and their current health - General Health Questionnaire (GHQ-28, and the Immune Function Questionnaire. The results demonstrated that around 30% of the sample displayed mild or worse levels of internet addiction, as measured by the IAT. Although there were differences in the purposes for which males and females used the internet, there were no differences in terms of levels of problematic usage between genders. The internet problems were strongly related to all of the other psychological variables such as depression, anxiety, social-isolation, and sleep problems. Internet addiction was also associated with reduced self-reported immune function, but not with the measure of general health (GHQ-28. This relationship between problematic internet use and reduced immune function was found to be independent of the impact of the co-morbidities. It is suggested that the negative relationship between level of problematic internet use and immune function may be mediated by levels of stress produced by such internet use, and subsequent sympathetic nervous activity, which related to immune-supressants, such as cortisol.

  11. Problematic Internet Usage and Immune Function

    Science.gov (United States)

    Reed, Phil; Vile, Rebecca; Osborne, Lisa A.; Romano, Michela; Truzoli, Roberto

    2015-01-01

    Problematic internet use has been associated with a variety of psychological comorbidities, but it relationship with physical illness has not received the same degree of investigation. The current study surveyed 505 participants online, and asked about their levels of problematic internet usage (Internet Addiction Test), depression and anxiety (Hospital Anxiety and Depression Scales), social isolation (UCLA Loneliness Questionnaire), sleep problems (Pittsburgh Sleep Quality Index), and their current health – General Health Questionnaire (GHQ-28), and the Immune Function Questionnaire. The results demonstrated that around 30% of the sample displayed mild or worse levels of internet addiction, as measured by the IAT. Although there were differences in the purposes for which males and females used the internet, there were no differences in terms of levels of problematic usage between genders. The internet problems were strongly related to all of the other psychological variables such as depression, anxiety, social-isolation, and sleep problems. Internet addiction was also associated with reduced self-reported immune function, but not with the measure of general health (GHQ-28). This relationship between problematic internet use and reduced immune function was found to be independent of the impact of the co-morbidities. It is suggested that the negative relationship between level of problematic internet use and immune function may be mediated by levels of stress produced by such internet use, and subsequent sympathetic nervous activity, which related to immune-supressants, such as cortisol. PMID:26244339

  12. MUC16 provides immune protection by inhibiting synapse formation between NK and ovarian tumor cells

    Directory of Open Access Journals (Sweden)

    Migneault Martine

    2010-01-01

    Full Text Available Abstract Background Cancer cells utilize a variety of mechanisms to evade immune detection and attack. Effective immune detection largely relies on the formation of an immune synapse which requires close contact between immune cells and their targets. Here, we show that MUC16, a heavily glycosylated 3-5 million Da mucin expressed on the surface of ovarian tumor cells, inhibits the formation of immune synapses between NK cells and ovarian tumor targets. Our results indicate that MUC16-mediated inhibition of immune synapse formation is an effective mechanism employed by ovarian tumors to evade immune recognition. Results Expression of low levels of MUC16 strongly correlated with an increased number of conjugates and activating immune synapses between ovarian tumor cells and primary naïve NK cells. MUC16-knockdown ovarian tumor cells were more susceptible to lysis by primary NK cells than MUC16 expressing controls. This increased lysis was not due to differences in the expression levels of the ligands for the activating receptors DNAM-1 and NKG2D. The NK cell leukemia cell line (NKL, which does not express KIRs but are positive for DNAM-1 and NKG2D, also conjugated and lysed MUC16-knockdown cells more efficiently than MUC16 expressing controls. Tumor cells that survived the NKL challenge expressed higher levels of MUC16 indicating selective lysis of MUC16low targets. The higher csMUC16 levels on the NKL resistant tumor cells correlated with more protection from lysis as compared to target cells that were never exposed to the effectors. Conclusion MUC16, a carrier of the tumor marker CA125, has previously been shown to facilitate ovarian tumor metastasis and inhibits NK cell mediated lysis of tumor targets. Our data now demonstrates that MUC16 expressing ovarian cancer cells are protected from recognition by NK cells. The immune protection provided by MUC16 may lead to selective survival of ovarian cancer cells that are more efficient in

  13. Milk-derived GM3 and GD3 differentially inhibit dendritic cell maturation and effector functionalities

    DEFF Research Database (Denmark)

    Brønnum, H.; Seested, T.; Hellgren, Lars

    2005-01-01

    value of gangliosides in breast milk has yet to be elucidated but when milk is ingested, dietary gangliosides might conceptually affect immune cells, such as dendritic cells (DCs). In this study, we address the in vitro effect of GD(3) and GM(3) on DC effector functionalities. Treatment of bone marrow......Gangliosides are complex glycosphingolipids, which exert immune-modulating effects on various cell types. Ganglioside GD(3) and GM(3) are the predominant gangliosides of human breast milk but during the early phase of lactation, the content of GD(3) decreases while GM(3) increases. The biological...... by GM(3,) and the potency of DCs to activate CD4(+) cells in MLR was unaffected by GM(3). However, both gangliosides suppressed expression of CD40, CD80, CD86 and major histocompatibility complex class II on DCs. Because GD(3) overall inhibits DC functionalities more than GM(3), the immune modulating...

  14. Milk-derived GM(3) and GD(3) differentially inhibit dendritic cell maturation and effector functionalities

    DEFF Research Database (Denmark)

    Bronnum, H.; Seested, T.; Hellgren, Lars

    2005-01-01

    value of gangliosides in breast milk has yet to be elucidated but when milk is ingested, dietary gangliosides might conceptually affect immune cells, such as dendritic cells (DCs). In this study, we address the in vitro effect of GD(3) and GM(3) on DC effector functionalities. Treatment of bone marrow......Gangliosides are complex glycosphingolipids, which exert immune-modulating effects on various cell types. Ganglioside GD(3) and GM(3) are the predominant gangliosides of human breast milk but during the early phase of lactation, the content of GD(3) decreases while GM(3) increases. The biological...... by GM(3,) and the potency of DCs to activate CD4(+) cells in MLR was unaffected by GM(3). However, both gangliosides suppressed expression of CD40, CD80, CD86 and major histocompatibility complex class II on DCs. Because GD(3) overall inhibits DC functionalities more than GM(3), the immune modulating...

  15. Migration inhibition of immune mouse spleen cells by serum from x-irradiated tumor-bearing mice

    International Nuclear Information System (INIS)

    Moroson, H.

    1978-01-01

    Tumor-specific antigens of the chemically induced MC 429 mouse fibrosarcoma were detected in a 3 M KCl extract of tumor by the inhibition of migration of specifically immune spleen cells. Using this assay with serum from tumor-bearing mice no tumor antigen was detected in serum of mice bearing small tumors, unless the tumor was exposed to local x irradiation (3000 R) 1 day prior to collection of serum. It was concluded that local x irradiation of tumor caused increased concentration of tumor antigen in the serum. When the tumor was allowed to grow extremely large, with necrosis, then host serum did cause migration inhibition of both nonimmune and immune spleen cells. This migration-inhibition effect was not associated with tumor antigen, but with a nonspecific serum factor

  16. Suppression of adaptive immunity to heterologous antigens during Plasmodium infection through hemozoin-induced failure of dendritic cell function

    Directory of Open Access Journals (Sweden)

    Phillips R

    2006-04-01

    Full Text Available Abstract Background Dendritic cells (DCs are central to the initiation and regulation of the adaptive immune response during infection. Modulation of DC function may therefore allow evasion of the immune system by pathogens. Significant depression of the host's systemic immune response to both concurrent infections and heterologous vaccines has been observed during malaria infection, but the mechanisms underlying this immune hyporesponsiveness are controversial. Results Here, we demonstrate that the blood stages of malaria infection induce a failure of DC function in vitro and in vivo, causing suboptimal activation of T cells involved in heterologous immune responses. This effect on T-cell activation can be transferred to uninfected recipients by DCs isolated from infected mice. Significantly, T cells activated by these DCs subsequently lack effector function, as demonstrated by a failure to migrate to lymphoid-organ follicles, resulting in an absence of B-cell responses to heterologous antigens. Fractionation studies show that hemozoin, rather than infected erythrocyte (red blood cell membranes, reproduces the effect of intact infected red blood cells on DCs. Furthermore, hemozoin-containing DCs could be identified in T-cell areas of the spleen in vivo. Conclusion Plasmodium infection inhibits the induction of adaptive immunity to heterologous antigens by modulating DC function, providing a potential explanation for epidemiological studies linking endemic malaria with secondary infections and reduced vaccine efficacy.

  17. Ginger extract inhibits LPS induced macrophage activation and function

    Directory of Open Access Journals (Sweden)

    Bruch David

    2008-01-01

    Full Text Available Abstract Background Macrophages play a dual role in host defence. They act as the first line of defence by mounting an inflammatory response to antigen exposure and also act as antigen presenting cells and initiate the adaptive immune response. They are also the primary infiltrating cells at the site of inflammation. Inhibition of macrophage activation is one of the possible approaches towards modulating inflammation. Both conventional and alternative approaches are being studied in this regard. Ginger, an herbal product with broad anti inflammatory actions, is used as an alternative medicine in a number of inflammatory conditions like rheumatic disorders. In the present study we examined the effect of ginger extract on macrophage activation in the presence of LPS stimulation. Methods Murine peritoneal macrophages were stimulated by LPS in presence or absence of ginger extract and production of proinflammatory cytokines and chemokines were observed. We also studied the effect of ginger extract on the LPS induced expression of MHC II, B7.1, B7.2 and CD40 molecules. We also studied the antigen presenting function of ginger extract treated macrophages by primary mixed lymphocyte reaction. Results We observed that ginger extract inhibited IL-12, TNF-α, IL-1β (pro inflammatory cytokines and RANTES, MCP-1 (pro inflammatory chemokines production in LPS stimulated macrophages. Ginger extract also down regulated the expression of B7.1, B7.2 and MHC class II molecules. In addition ginger extract negatively affected the antigen presenting function of macrophages and we observed a significant reduction in T cell proliferation in response to allostimulation, when ginger extract treated macrophages were used as APCs. A significant decrease in IFN-γ and IL-2 production by T cells in response to allostimulation was also observed. Conclusion In conclusion ginger extract inhibits macrophage activation and APC function and indirectly inhibits T cell activation.

  18. Reproduction Alters Hydration State but Does Not Impact the Positive Effects of Dehydration on Innate Immune Function in Children's Pythons (Antaresia childreni).

    Science.gov (United States)

    Brusch, George A; Billy, Gopal; Blattman, Joseph N; DeNardo, Dale F

    Resource availability can impact immune function, with the majority of studies of such influences focusing on the allocation of energy investment into immune versus other physiological functions. When energy is a limited resource, performance trade-offs can result, compromising immunity. Dehydration is also considered a physiological challenge resulting from the limitation of a vital resource, yet previous research has found a positive relationship between dehydration and innate immune performance. However, these studies did not examine the effects of dehydration on immunity when there was another concurrent, substantial physiological challenge. Thus, we examined the impact of reproduction and water deprivation, individually and in combination, on immune performance in Children's pythons (Antaresia childreni). We collected blood samples from free-ranging A. childreni to evaluate osmolality and innate immune function (lysis, agglutination, bacterial growth inhibition) during the austral dry season, when water availability is limited and this species is typically reproducing. To examine how reproduction and water imbalance, both separately and combined, impact immune function, we used a laboratory-based 2 × 2 experiment. Our results demonstrate that A. childreni experience significant dehydration during the dry season and that, overall, osmolality, regardless of the underlying cause (seasonal rainfall, water deprivation, or reproduction), is positively correlated with increased innate immune performance.

  19. A2E Suppresses Regulatory Function of RPE Cells in Th1 Cell Differentiation Via Production of IL-1β and Inhibition of PGE2.

    Science.gov (United States)

    Shi, Qian; Wang, Qiu; Li, Jing; Zhou, Xiaohui; Fan, Huimin; Wang, Fenghua; Liu, Haiyun; Sun, Xiangjun; Sun, Xiaodong

    2015-12-01

    Inflammatory status of RPE cells induced by A2E is essential in the development of AMD. Recent research indicated T-cell immunity was involved in the pathological progression of AMD. This study was designed to investigate how A2E suppresses immunoregulatory function of RPE cells in T-cell immunity in vitro. Mouse RPE cells or human ARPE19 cells were stimulated with A2E, and co-cultured with naïve T cells under Th1, Th2, Th17, and regulatory T cell (Treg) polarization conditions. The intracellular cytokines or transcript factors of the induced T-cells subset were detected with flow cytometer and qRT-PCR. The ROS levels were detected, and the factors and possible pathways involved in the A2E-laden RPE cells were analyzed through neutralization antibody of IL-1β and inhibitors of related pathways. The A2E reduced regulatory function of RPE cells in Treg differentiation. The A2E-laden RPE cells promoted polarization of Th1 cells in vitro, but not Th2 or Th17 differentiation. The A2E induced RPE cells to release inflammatory cytokines and ROS, but PGE2 production was inhibited. Through neutralization of IL-1β or inhibition of COX2-PGE2 pathways, A2E-laden RPE cells expressed reduced effect in inducing Th1 cells. The A2E inhibited regulatory function of RPE cells in suppressing Th1 cell immunity in vitro through production of IL-1β and inhibition of PGE2. Our data indicate that A2E could suppress immunoregulatory function of RPE cells and adaptive immunity might play a role in the immune pathogenesis of AMD.

  20. Mental resilience, perceived immune functioning, and health

    Directory of Open Access Journals (Sweden)

    Van Schrojenstein Lantman M

    2017-03-01

    Full Text Available Marith Van Schrojenstein Lantman,1 Marlou Mackus,1 Leila S Otten,1 Deborah de Kruijff,1 Aurora JAE van de Loo,1,2 Aletta D Kraneveld,1,2 Johan Garssen,1,3 Joris C Verster1,2,4 1Division of Pharmacology, Utrecht University, Utrecht, the Netherlands; 2Institute for Risk Assessment Sciences, Utrecht University, Utrecht, the Netherlands; 3Nutricia Research, Utrecht, the Netherlands; 4Centre for Human Psychopharmacology, Swinburne University, Melbourne, Australia Background: Mental resilience can be seen as a trait that enables an individual to recover from stress and to face the next stressor with optimism. People with resilient traits are considered to have a better mental and physical health. However, there are limited data available assessing the relationship between resilient individuals and their perspective of their health and immune status. Therefore, this study was conducted to examine the relationship between mental resilience, perceived health, and perceived immune status. Methods: A total of 779 participants recruited at Utrecht University completed a questionnaire consisting of demographic characteristics, the brief resilience scale for the assessment of mental resilience, the immune function questionnaire (IFQ, and questions regarding their perceived health and immune status. Results: When correcting for gender, age, height, weight, smoker status, amount of cigarettes smoked per week, alcohol consumption status, amount of drinks consumed per week, drug use, and frequency of past year drug use, mental resilience was significantly correlated with perceived health (r=0.233, p=0.0001, perceived immune functioning (r=0.124, p=0.002, and IFQ score (r=−0.185, p=0.0001. Conclusion: A significant, albeit modest, relationship was found between mental resilience and perceived immune functioning and health. Keywords: mental resilience, immune functioning, health, vitality, quality of life

  1. Measuring the immune system: a comprehensive approach for the analysis of immune functions in humans.

    Science.gov (United States)

    Claus, Maren; Dychus, Nicole; Ebel, Melanie; Damaschke, Jürgen; Maydych, Viktoriya; Wolf, Oliver T; Kleinsorge, Thomas; Watzl, Carsten

    2016-10-01

    The immune system is essential to provide protection from infections and cancer. Disturbances in immune function can therefore directly affect the health of the affected individual. Many extrinsic and intrinsic factors such as exposure to chemicals, stress, nutrition and age have been reported to influence the immune system. These influences can affect various components of the immune system, and we are just beginning to understand the causalities of these changes. To investigate such disturbances, it is therefore essential to analyze the different components of the immune system in a comprehensive fashion. Here, we demonstrate such an approach which provides information about total number of leukocytes, detailed quantitative and qualitative changes in the composition of lymphocyte subsets, cytokine levels in serum and functional properties of T cells, NK cells and monocytes. Using samples from a cohort of 24 healthy volunteers, we demonstrate the feasibility of our approach to detect changes in immune functions.

  2. Early enteral immune nutrition support after radical operation for gastric cancer on promoting the recovery of gastrointestinal function and immune function

    Directory of Open Access Journals (Sweden)

    Zhi-Gang Li

    2016-05-01

    Full Text Available Objective: To analyze the effect of early enteral immune nutrition support after radical operation for gastric cancer on the recovery of gastrointestinal function and immune function. Methods: A total of 106 cases of patients received radical operation for gastric cancer in our hospital were selected as research subjects, and according to different ways of postoperative nutrition intervention, all patients were divided into observation group (n=50 and control group (n=56. Control group received conventional enteral nutrition intervention, observation group received postoperative early enteral immune nutrition support, and then differences in postoperative intestinal mucosa barrier function, gastrointestinal hormone levels, immune function levels and nutrition-related indicator values were compared between two groups. Results: After observation group received enteral immune nutrition intervention, serum DAO, PS and D-lactate levels as well as urine L/M ratio were lower than those of control group; serum GAS, CCK, MTL and SP values of observation group after intervention were higher than those of control group, and GLU, VIP, GIP and SS values were lower than those of control group; CD4, IgG, NK cell, C3, C4, CH50 and S-IgA levels of observation group after intervention were higher than those of control group; serum ALB, PRE, TRF and RBP levels of observation group after intervention were higher than those of control group. Conclusion: Early enteral immune nutrition support after radical operation for gastric cancer is conducive to the recovery of gastrointestinal function and the promotion of immune state, eventually promotes patients’ postoperative overall recovery and has active clinical significance.

  3. Hormone activities and the cell cycle machinery in immunity-triggered growth inhibition.

    Science.gov (United States)

    Reitz, M U; Gifford, M L; Schäfer, P

    2015-04-01

    Biotic stress and diseases caused by pathogen attack pose threats in crop production and significantly reduce crop yields. Enhancing immunity against pathogens is therefore of outstanding importance in crop breeding. However, this must be balanced, as immune activation inhibits plant growth. This immunity-coupled growth trade-off does not support resistance but is postulated to reflect the reallocation of resources to drive immunity. There is, however, increasing evidence that growth-immunity trade-offs are based on the reconfiguration of hormone pathways, shared by growth and immunity signalling. Studies in roots revealed the role of hormones in orchestrating growth across different cell types, with some hormones showing a defined cell type-specific activity. This is apparently highly relevant for the regulation of the cell cycle machinery and might be part of the growth-immunity cross-talk. Since plants are constantly exposed to Immuno-activating microbes under agricultural conditions, the transition from a growth to an immunity operating mode can significantly reduce crop yield and can conflict our efforts to generate next-generation crops with improved yield under climate change conditions. By focusing on roots, we outline the current knowledge of hormone signalling on the cell cycle machinery to explain growth trade-offs induced by immunity. By referring to abiotic stress studies, we further introduce how root cell type-specific hormone activities might contribute to growth under immunity and discuss the feasibility of uncoupling the growth-immunity cross-talk. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  4. Role of Polyamines in Immune Cell Functions

    Directory of Open Access Journals (Sweden)

    Rebecca S. Hesterberg

    2018-03-01

    Full Text Available The immune system is remarkably responsive to a myriad of invading microorganisms and provides continuous surveillance against tissue damage and developing tumor cells. To achieve these diverse functions, multiple soluble and cellular components must react in an orchestrated cascade of events to control the specificity, magnitude and persistence of the immune response. Numerous catabolic and anabolic processes are involved in this process, and prominent roles for l-arginine and l-glutamine catabolism have been described, as these amino acids serve as precursors of nitric oxide, creatine, agmatine, tricarboxylic acid cycle intermediates, nucleotides and other amino acids, as well as for ornithine, which is used to synthesize putrescine and the polyamines spermidine and spermine. Polyamines have several purported roles and high levels of polyamines are manifest in tumor cells as well in autoreactive B- and T-cells in autoimmune diseases. In the tumor microenvironment, l-arginine catabolism by both tumor cells and suppressive myeloid cells is known to dampen cytotoxic T-cell functions suggesting there might be links between polyamines and T-cell suppression. Here, we review studies suggesting roles of polyamines in normal immune cell function and highlight their connections to autoimmunity and anti-tumor immune cell function.

  5. Estimating Herd Immunity to Amphibian Chytridiomycosis in Madagascar Based on the Defensive Function of Amphibian Skin Bacteria

    Directory of Open Access Journals (Sweden)

    Molly C. Bletz

    2017-09-01

    Full Text Available For decades, Amphibians have been globally threatened by the still expanding infectious disease, chytridiomycosis. Madagascar is an amphibian biodiversity hotspot where Batrachochytrium dendrobatidis (Bd has only recently been detected. While no Bd-associated population declines have been reported, the risk of declines is high when invasive virulent lineages become involved. Cutaneous bacteria contribute to host innate immunity by providing defense against pathogens for numerous animals, including amphibians. Little is known, however, about the cutaneous bacterial residents of Malagasy amphibians and the functional capacity they have against Bd. We cultured 3179 skin bacterial isolates from over 90 frog species across Madagascar, identified them via Sanger sequencing of approximately 700 bp of the 16S rRNA gene, and characterized their functional capacity against Bd. A subset of isolates was also tested against multiple Bd genotypes. In addition, we applied the concept of herd immunity to estimate Bd-associated risk for amphibian communities across Madagascar based on bacterial antifungal activity. We found that multiple bacterial isolates (39% of all isolates cultured from the skin of Malagasy frogs were able to inhibit Bd. Mean inhibition was weakly correlated with bacterial phylogeny, and certain taxonomic groups appear to have a high proportion of inhibitory isolates, such as the Enterobacteriaceae, Pseudomonadaceae, and Xanthamonadaceae (84, 80, and 75% respectively. Functional capacity of bacteria against Bd varied among Bd genotypes; however, there were some bacteria that showed broad spectrum inhibition against all tested Bd genotypes, suggesting that these bacteria would be good candidates for probiotic therapies. We estimated Bd-associated risk for sampled amphibian communities based on the concept of herd immunity. Multiple amphibian communities, including those in the amphibian diversity hotspots, Andasibe and Ranomafana, were

  6. Estimating Herd Immunity to Amphibian Chytridiomycosis in Madagascar Based on the Defensive Function of Amphibian Skin Bacteria.

    Science.gov (United States)

    Bletz, Molly C; Myers, Jillian; Woodhams, Douglas C; Rabemananjara, Falitiana C E; Rakotonirina, Angela; Weldon, Che; Edmonds, Devin; Vences, Miguel; Harris, Reid N

    2017-01-01

    For decades, Amphibians have been globally threatened by the still expanding infectious disease, chytridiomycosis. Madagascar is an amphibian biodiversity hotspot where Batrachochytrium dendrobatidis ( Bd ) has only recently been detected. While no Bd -associated population declines have been reported, the risk of declines is high when invasive virulent lineages become involved. Cutaneous bacteria contribute to host innate immunity by providing defense against pathogens for numerous animals, including amphibians. Little is known, however, about the cutaneous bacterial residents of Malagasy amphibians and the functional capacity they have against Bd . We cultured 3179 skin bacterial isolates from over 90 frog species across Madagascar, identified them via Sanger sequencing of approximately 700 bp of the 16S rRNA gene, and characterized their functional capacity against Bd . A subset of isolates was also tested against multiple Bd genotypes. In addition, we applied the concept of herd immunity to estimate Bd -associated risk for amphibian communities across Madagascar based on bacterial antifungal activity. We found that multiple bacterial isolates (39% of all isolates) cultured from the skin of Malagasy frogs were able to inhibit Bd . Mean inhibition was weakly correlated with bacterial phylogeny, and certain taxonomic groups appear to have a high proportion of inhibitory isolates, such as the Enterobacteriaceae, Pseudomonadaceae, and Xanthamonadaceae (84, 80, and 75% respectively). Functional capacity of bacteria against Bd varied among Bd genotypes; however, there were some bacteria that showed broad spectrum inhibition against all tested Bd genotypes, suggesting that these bacteria would be good candidates for probiotic therapies. We estimated Bd -associated risk for sampled amphibian communities based on the concept of herd immunity. Multiple amphibian communities, including those in the amphibian diversity hotspots, Andasibe and Ranomafana, were estimated to be

  7. Plasma polychlorinated biphenyl concentrations and immune function in postmenopausal women

    Energy Technology Data Exchange (ETDEWEB)

    Spector, June T., E-mail: spectj@uw.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way NE, Seattle, WA 98105 (United States); Department of Medicine, School of Medicine, University of Washington, Seattle, WA (United States); De Roos, Anneclaire J., E-mail: ajd335@drexel.edu [Epidemiology Program, Public Health Sciences Division, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue N, P.O. Box 19024, Seattle, WA 98109 (United States); Department of Epidemiology, School of Public Health, University of Washington, Seattle, WA (United States); Ulrich, Cornelia M., E-mail: neli.ulrich@nct-heidelberg.de [Department of Epidemiology, School of Public Health, University of Washington, Seattle, WA (United States); Cancer Prevention Program, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue N, P.O. Box 19024, Seattle, WA 98109 (United States); National Center for Tumor Diseases and German Cancer Research Center, Heidelberg (Germany); Sheppard, Lianne, E-mail: sheppard@uw.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way NE, Seattle, WA 98105 (United States); Department of Biostatistics, School of Public Health, University of Washington, Seattle, WA (United States); Sjoedin, Andreas, E-mail: asjodin@cdc.gov [National Center for Environmental Health, CDC, 4770 Buford Highway NE, Atlanta, GA 30341 (United States); Wener, Mark H., E-mail: wener@u.washington.edu [Department of Medicine, School of Medicine, University of Washington, Seattle, WA (United States); Wood, Brent, E-mail: woodbl@u.washington.edu [Department of Medicine, School of Medicine, University of Washington, Seattle, WA (United States); and others

    2014-05-01

    Background: Polychlorinated biphenyl (PCB) exposure has been associated with non-Hodgkin lymphoma in several studies, and the immune system is a potential mediator. Objectives: We analyzed associations of plasma PCBs with immune function measures. We hypothesized that higher plasma PCB concentrations are associated with lower immune function cross-sectionally, and that increases in PCB concentrations over a one year period are associated with decreases in immune function. Methods: Plasma PCB concentrations and immune function [natural killer (NK) cell cytotoxicity and PHA-induced T-lymphocyte proliferation (PHA-TLP)] were measured at baseline and one year in 109 postmenopausal overweight women participating in an exercise intervention study in the Seattle, Washington (USA) area. Mixed models, with adjustment for body mass index and other potential confounders, were used to estimate associations of PCBs with immune function cross-sectionally and longitudinally. Results: Associations of PCBs with immune function measures differed across groups of PCBs (e.g., medium- and high-chlorinated and dioxin-like [mono-ortho-substituted]) and by the time frame for the comparison (cross-sectional vs. longitudinal). Higher concentrations of medium- and high-chlorinated PCBs were associated with higher PHA-TLP cross-sectionally but not longitudinally. The mean decrease in 0.5 µg/mL PHA-TLP/50.0 pmol/g-lipid increase in dioxin-like PCBs over one year was 51.6 (95% confidence interval 2.7, 100.5; P=0.039). There was no association between plasma PCBs and NK cytotoxicity. Conclusions: These results do not provide strong evidence of impaired cellular immunity from PCB exposure. Larger longitudinal studies with greater variability in PCB exposures are needed to further examine temporal associations of PCBs with immune function. - Highlights: • Plasma PCBs and immune function were measured in 109 women at baseline and one year. • Immune measures included T lymphocyte proliferation

  8. Plasma polychlorinated biphenyl concentrations and immune function in postmenopausal women

    International Nuclear Information System (INIS)

    Spector, June T.; De Roos, Anneclaire J.; Ulrich, Cornelia M.; Sheppard, Lianne; Sjoedin, Andreas; Wener, Mark H.; Wood, Brent

    2014-01-01

    Background: Polychlorinated biphenyl (PCB) exposure has been associated with non-Hodgkin lymphoma in several studies, and the immune system is a potential mediator. Objectives: We analyzed associations of plasma PCBs with immune function measures. We hypothesized that higher plasma PCB concentrations are associated with lower immune function cross-sectionally, and that increases in PCB concentrations over a one year period are associated with decreases in immune function. Methods: Plasma PCB concentrations and immune function [natural killer (NK) cell cytotoxicity and PHA-induced T-lymphocyte proliferation (PHA-TLP)] were measured at baseline and one year in 109 postmenopausal overweight women participating in an exercise intervention study in the Seattle, Washington (USA) area. Mixed models, with adjustment for body mass index and other potential confounders, were used to estimate associations of PCBs with immune function cross-sectionally and longitudinally. Results: Associations of PCBs with immune function measures differed across groups of PCBs (e.g., medium- and high-chlorinated and dioxin-like [mono-ortho-substituted]) and by the time frame for the comparison (cross-sectional vs. longitudinal). Higher concentrations of medium- and high-chlorinated PCBs were associated with higher PHA-TLP cross-sectionally but not longitudinally. The mean decrease in 0.5 µg/mL PHA-TLP/50.0 pmol/g-lipid increase in dioxin-like PCBs over one year was 51.6 (95% confidence interval 2.7, 100.5; P=0.039). There was no association between plasma PCBs and NK cytotoxicity. Conclusions: These results do not provide strong evidence of impaired cellular immunity from PCB exposure. Larger longitudinal studies with greater variability in PCB exposures are needed to further examine temporal associations of PCBs with immune function. - Highlights: • Plasma PCBs and immune function were measured in 109 women at baseline and one year. • Immune measures included T lymphocyte proliferation

  9. Lithocholic acid controls adaptive immune responses by inhibition of Th1 activation through the Vitamin D receptor.

    Science.gov (United States)

    Pols, Thijs W H; Puchner, Teresa; Korkmaz, H Inci; Vos, Mariska; Soeters, Maarten R; de Vries, Carlie J M

    2017-01-01

    Bile acids are established signaling molecules next to their role in the intestinal emulsification and uptake of lipids. We here aimed to identify a potential interaction between bile acids and CD4+ Th cells, which are central in adaptive immune responses. We screened distinct bile acid species for their potency to affect T cell function. Primary human and mouse CD4+ Th cells as well as Jurkat T cells were used to gain insight into the mechanism underlying these effects. We found that unconjugated lithocholic acid (LCA) impedes Th1 activation as measured by i) decreased production of the Th1 cytokines IFNγ and TNFαα, ii) decreased expression of the Th1 genes T-box protein expressed in T cells (T-bet), Stat-1 and Stat4, and iii) decreased STAT1α/β phosphorylation. Importantly, we observed that LCA impairs Th1 activation at physiological relevant concentrations. Profiling of MAPK signaling pathways in Jurkat T cells uncovered an inhibition of ERK-1/2 phosphorylation upon LCA exposure, which could provide an explanation for the impaired Th1 activation. LCA induces these effects via Vitamin D receptor (VDR) signaling since VDR RNA silencing abrogated these effects. These data reveal for the first time that LCA controls adaptive immunity via inhibition of Th1 activation. Many factors influence LCA levels, including bile acid-based drugs and gut microbiota. Our data may suggest that these factors also impact on adaptive immunity via a yet unrecognized LCA-Th cell axis.

  10. Lloviu virus VP24 and VP35 proteins function as innate immune antagonists in human and bat cells

    International Nuclear Information System (INIS)

    Feagins, Alicia R.; Basler, Christopher F.

    2015-01-01

    Lloviu virus (LLOV) is a new member of the filovirus family that also includes Ebola virus (EBOV) and Marburg virus (MARV). LLOV has not been cultured; however, its genomic RNA sequence indicates the coding capacity to produce homologs of the EBOV and MARV VP24, VP35, and VP40 proteins. EBOV and MARV VP35 proteins inhibit interferon (IFN)-alpha/beta production and EBOV VP35 blocks activation of the antiviral kinase PKR. The EBOV VP24 and MARV VP40 proteins inhibit IFN signaling, albeit by different mechanisms. Here we demonstrate that LLOV VP35 suppresses Sendai virus induced IFN regulatory factor 3 (IRF3) phosphorylation, IFN-α/β production, and PKR phosphorylation. Additionally, LLOV VP24 blocks tyrosine phosphorylated STAT1 binding to karyopherin alpha 5 (KPNA5), STAT1 nuclear accumulation, and IFN-induced gene expression. LLOV VP40 lacks detectable IFN antagonist function. These activities parallel EBOV IFN inhibitory functions. EBOV and LLOV VP35 and VP24 proteins also inhibit IFN responses in bat cells. These data suggest that LLOV infection will block innate immune responses in a manner similar to EBOV. - Highlights: • Lloviu virus (LLOV) is a new member of the filovirus family. • LLOV VP35 blocks IRF3 phosphorylation, IFN-α/β production and PKR phosphorylation. • LLOV VP24 inhibits IFN responses by targeting phospho-STAT1 KPNA interaction. • Infection by LLOV may block innate immune responses in a manner similar to EBOV.

  11. Lloviu virus VP24 and VP35 proteins function as innate immune antagonists in human and bat cells

    Energy Technology Data Exchange (ETDEWEB)

    Feagins, Alicia R.; Basler, Christopher F., E-mail: chris.basler@mssm.edu

    2015-11-15

    Lloviu virus (LLOV) is a new member of the filovirus family that also includes Ebola virus (EBOV) and Marburg virus (MARV). LLOV has not been cultured; however, its genomic RNA sequence indicates the coding capacity to produce homologs of the EBOV and MARV VP24, VP35, and VP40 proteins. EBOV and MARV VP35 proteins inhibit interferon (IFN)-alpha/beta production and EBOV VP35 blocks activation of the antiviral kinase PKR. The EBOV VP24 and MARV VP40 proteins inhibit IFN signaling, albeit by different mechanisms. Here we demonstrate that LLOV VP35 suppresses Sendai virus induced IFN regulatory factor 3 (IRF3) phosphorylation, IFN-α/β production, and PKR phosphorylation. Additionally, LLOV VP24 blocks tyrosine phosphorylated STAT1 binding to karyopherin alpha 5 (KPNA5), STAT1 nuclear accumulation, and IFN-induced gene expression. LLOV VP40 lacks detectable IFN antagonist function. These activities parallel EBOV IFN inhibitory functions. EBOV and LLOV VP35 and VP24 proteins also inhibit IFN responses in bat cells. These data suggest that LLOV infection will block innate immune responses in a manner similar to EBOV. - Highlights: • Lloviu virus (LLOV) is a new member of the filovirus family. • LLOV VP35 blocks IRF3 phosphorylation, IFN-α/β production and PKR phosphorylation. • LLOV VP24 inhibits IFN responses by targeting phospho-STAT1 KPNA interaction. • Infection by LLOV may block innate immune responses in a manner similar to EBOV.

  12. MicroRNAs (MiRs) Precisely Regulate Immune System Development and Function in Immunosenescence Process.

    Science.gov (United States)

    Aalaei-Andabili, Seyed Hossein; Rezaei, Nima

    2016-01-01

    Human aging is a complex process with pivotal changes in gene expression of biological pathways. Immune system dysfunction has been recognized as one of the most important abnormalities induced by senescent names immunosenescence. Emerging evidences suggest miR role in immunosenescence. We aimed to systemically review all relevant reports to clearly state miR effects on immunosenescence process. Sensitive electronic searches carried out. Quality assessment has been performed. Since majority of the included studies were laboratory works, and therefore heterogen, we discussed miR effects on immunological aging process nonstatically. Forty-six articles were found in the initial search. After exclusion of 34 articles, 12 studies enrolled to the final stage. We found that miRs have crucial roles in exact function of immune system. MiRs are involved in the regulation of the aging process in the immune system components and target certain genes, promoting or inhibiting immune system reaction to invasion. Also, miRs control life span of the immune system members by regulation of the genes involved in the apoptosis. Interestingly, we found that immunosenescence is controllable by proper manipulation of the various miRs expression. DNA methylation and histone acetylation have been discovered as novel strategies, altering NF-κB binding ability to the miR promoter sites. Effect of miRs on impairment of immune system function due to the aging is emerging. Although it has been accepted that miRs have determinant roles in the regulation of the immunosenescence; however, most of the reports are concluded from animal/laboratory works, suggesting the necessity of more investigations in human.

  13. Hypoxia Enhances Immunosuppression by Inhibiting CD4+ Effector T Cell Function and Promoting Treg Activity

    Directory of Open Access Journals (Sweden)

    Astrid M. Westendorf

    2017-03-01

    Full Text Available Background/Aims: Hypoxia occurs in many pathological conditions, including inflammation and cancer. Within this context, hypoxia was shown to inhibit but also to promote T cell responses. Due to this controversial function, we aimed to explore whether an insufficient anti-tumour response during colitis-associated colon cancer could be ascribed to a hypoxic microenvironment. Methods: Colitis-associated colon cancer was induced in wildtype mice, and hypoxia as well as T cell immunity were analysed in the colonic tumour tissues. In addition, CD4+ effector T cells and regulatory T cells were cultured under normoxic and hypoxic conditions and examined regarding their phenotype and function. Results: We observed severe hypoxia in the colon of mice suffering from colitis-associated colon cancer that was accompanied by a reduced differentiation of CD4+ effector T cells and an enhanced number and suppressive activity of regulatory T cells. Complementary ex vivo and in vitro studies revealed that T cell stimulation under hypoxic conditions inhibited the differentiation, proliferation and IFN-γ production of TH1 cells and enhanced the suppressive capacity of regulatory T cells. Moreover, we identified an active role for HIF-1α in the modulation of CD4+ T cell functions under hypoxic conditions. Conclusion: Our data indicate that oxygen availability can function as a local modulator of CD4+ T cell responses and thus influences tumour immune surveillance in inflammation-associated colon cancer.

  14. TLR4 plays a crucial role in MSC-induced inhibition of NK cell function

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Ying [No. 307 Hospital of the Chinese People' s Liberation Army, Beijing (China); Liu, Jin; Liu, Yang; Qin, Yaru [Beijing Institute of Radiation Medicine, Beijing (China); Luo, Qun [No. 307 Hospital of the Chinese People' s Liberation Army, Beijing (China); Wang, Quanli, E-mail: 13691110351@163.com [No. 307 Hospital of the Chinese People' s Liberation Army, Beijing (China); Duan, Haifeng, E-mail: duanhf0720@163.com [Beijing Institute of Radiation Medicine, Beijing (China)

    2015-08-21

    Mesenchymal stem cells (MSC) are a kind of stromal cell within the tumor microenvironment. In our research, MSC derived from acute myeloid leukemia patients' bone marrow (AML-MSC) and lung cancer tissues (LC-MSC) as well as normal bone marrow-derived MSC (BM-MSC) cultured in conditioned medium of HeLa cells were found to have higher expressions of Toll-like receptor (TLR4) mRNA compared with BM-MSC. The sorted TLR4-positive MSC (TLR4+ MSC) differed in cytokine (interleukin-6, interleukin-8, and monocyte chemoattractant protein-1) secretion from those of unsorted MSC. MSC was reported to inhibit natural killer (NK) cell proliferation and function. In this research, we confirmed that TLR4+ MSC aggravate this suppression. Furthermore, when TLR4 in the sorted cells were stimulated by LPS or following blocked by antibody, the suppression on NK cell proliferation and cytotoxicity were more intensive or recovered respectively. Compared to unsorted MSC, NKG2D receptor expression on NK cells were also inhibited by TLR4+ MSC. These findings suggest that activation of TLR4 pathway is important for TLR4+ MSC and MSC to obstruct anti-tumor immunity by inhibiting NK cell function, which may provide a potential stroma-targeted tumor therapy. - Highlights: • TLR4+ MSC inhibit NK cell proliferation in vivo and in vitro. • TLR4+ MSC inhibit NKG2D expression on NK cells and NK cell cytotoxicity. • The distinguished cytokine expression of TLR4+ MSC may contribute to the inhibition on NK cell function.

  15. Polysaccharide from Lentinus edodes inhibits the immunosuppressive function of myeloid-derived suppressor cells.

    Directory of Open Access Journals (Sweden)

    Hao Wu

    Full Text Available Reversing the function of immune suppressor cells may improve the efficacy of cancer therapy. Here, we have isolated a novel polysaccharide MPSSS (577.2 Kd from Lentinus edodes and examined its effects on differentiation and function of myeloid-derived suppressor cells (MDSCs. MPSSS is composed of glucose (75.0%, galactose (11.7%, mannose (7.8%, and xylose (0.4%. In vivo, it inhibits the growth of McgR32 tumor cells, which is correlated with a reduced percentage of MDSCs in peripheral blood. In vitro, it induces both morphological and biophysical changes in MDSCs. Importantly, MPSSS up-regulates MHC II and F4/80 expression on MDSCs, and reverses their inhibition effect on CD4(+ T cells in a dose-dependent manner. The mechanism study shows that MPSSS may stimulate MDSCs through a MyD88 dependent NF-κB signaling pathway. Together, we demonstrated for the first time that MPSSS stimulates the differentiation of MDSCs and reverses its immunosuppressive functions, shedding new light on developing novel anti-cancer strategies by targeting MDSCs.

  16. Estradiol-induced vaginal mucus inhibits antigen penetration and CD8(+) T cell priming in response to intravaginal immunization.

    Science.gov (United States)

    Seavey, Matthew M; Mosmann, Tim R

    2009-04-14

    Although vaginal immunization has been explored as a strategy to induce mucosal immunity in the female reproductive tract, this site displays unique immunological features that probably evolved to inhibit anti-paternal T cell responses after insemination to allow successful pregnancy. We previously demonstrated that estradiol, which induces an estrus-like state, prevented CD8(+) T cell priming during intravaginal immunization of mice. We now show that estradiol prevented antigen loading of vaginal antigen presenting cells (APCs) after intravaginal immunization. Histological examination confirmed that estradiol prevented penetration of peptide antigen into the vaginal wall. Removal of the estradiol-induced mucus barrier by mucinase partially restored antigen loading of vaginal APC and CD8(+) T cell proliferation in vivo. The estradiol-induced mucus barrier may thus prevent exposure to antigens delivered intravaginally, supplementing additional estradiol-dependent mechanism(s) that inhibit CD8(+) T cell priming after insemination or vaginal vaccination.

  17. Estradiol-induced vaginal mucus inhibits antigen penetration and CD8+ T cell priming in response to intravaginal immunization

    Science.gov (United States)

    Seavey, Matthew M.; Mosmann, Tim R.

    2010-01-01

    Although vaginal immunization has been explored as a strategy to induce mucosal immunity in the female reproductive tract, this site displays unique immunological features that probably evolved to inhibit anti-paternal T cell responses after insemination to allow successful pregnancy. We previously demonstrated that estradiol, which induces an estrus-like state, prevented CD8+ T cell priming during intravaginal immunization of mice. We now show that estradiol prevented antigen loading of vaginal antigen presenting cells (APC) after intravaginal immunization. Histological examination confirmed that estradiol prevented penetration of peptide antigen into the vaginal wall. Removal of the estradiol-induced mucus barrier by mucinase partially restored antigen loading of vaginal APC and CD8+ T cell proliferation in vivo. The estradiol-induced mucus barrier may thus prevent exposure to antigens delivered intravaginally, supplementing additional estradiol-dependent mechanism(s) that inhibit CD8+ T cell priming after insemination or vaginal vaccination. PMID:19428849

  18. Immune-suppressive activity of punicalagin via inhibition of NFAT activation

    International Nuclear Information System (INIS)

    Lee, Sang-Ik; Kim, Byoung-Soo; Kim, Kyoung-Shin; Lee, Samkeun; Shin, Kwang-Soo; Lim, Jong-Soon

    2008-01-01

    Since T cell activation is central to the development of autoimmune diseases, we screened a natural product library comprising 1400 samples of medicinal herbal extracts, to identify compounds that suppress T cell activity. Punicalagin (PCG) isolated from the fruit of Punica granatum was identified as a potent immune suppressant, based on its inhibitory action on the activation of the nuclear factor of activated T cells (NFAT). PCG downregulated the mRNA and soluble protein expression of interleukin-2 from anti-CD3/anti-CD28-stimulated murine splenic CD4+ T cells and suppressed mixed leukocytes reaction (MLR) without exhibiting cytotoxicity to the cells. In vivo, the PCG treatment inhibited phorbol 12-myristate 13-acetate (PMA)-induced chronic ear edema in mice and decreased CD3+ T cell infiltration of the inflamed tissue. These results suggest that PCG could be a potential candidate for the therapeutics of various immune pathologies

  19. Immune functions of the garment workers.

    Science.gov (United States)

    Sultana, R; Ferdous, K J; Hossain, M; Zahid, M S H; Islam, L N

    2012-10-01

    Occupational exposure to cotton dust, fibers, metal fumes and different chemicals used in the aparrel manufacturing industries cause a wide range of physical and psychological health problems in the garment workers that may also affect their immune function. To assess the immune system function in garment workers. A total of 45 workers of a garment factory, and 41 control subjects, not exposed to the garment working environment were enrolled in this study. In the study subjects, the complement system function was assessed as bactericidal activity on Escherichia coli DH5α cells using the standard plate count method. Serum complement components C3 and C4 were measured by immunoprecipitation, and IgG was measured by immunonephelometry. The bactericidal activity of serum complement in the garment workers (range: 93.5%-99.9%) was significantly (pgarment workers, the mean levels of complement C3, and C4 were 1.75 and 0.26 g/L, respectively that were close to those of the controls. The mean IgG level in the garment workers was 13.5 g/L that was significantly (pgarment factory may affect the immune system.

  20. Differential Gender Effects in the Relationship between Perceived Immune Functioning and Autistic Traits.

    Science.gov (United States)

    Mackus, Marlou; Kruijff, Deborah de; Otten, Leila S; Kraneveld, Aletta D; Garssen, Johan; Verster, Joris C

    2017-04-12

    Altered immune functioning has been demonstrated in individuals with autism spectrum disorder (ASD). The current study explores the relationship between perceived immune functioning and experiencing ASD traits in healthy young adults. N = 410 students from Utrecht University completed a survey on immune functioning and autistic traits. In addition to a 1-item perceived immune functioning rating, the Immune Function Questionnaire (IFQ) was completed to assess perceived immune functioning. The Dutch translation of the Autism-Spectrum Quotient (AQ) was completed to examine variation in autistic traits, including the domains "social insights and behavior", "difficulties with change", "communication", "phantasy and imagination", and "detail orientation". The 1-item perceived immune functioning score did not significantly correlate with the total AQ score. However, a significant negative correlation was found between perceived immune functioning and the AQ subscale "difficulties with change" (r = -0.119, p = 0.019). In women, 1-item perceived immune functioning correlated significantly with the AQ subscales "difficulties with change" (r = -0.149, p = 0.029) and "communication" (r = -0.145, p = 0.032). In men, none of the AQ subscales significantly correlated with 1-item perceived immune functioning. In conclusion, a modest relationship between perceived immune functioning and several autistic traits was found.

  1. Ubiquitin-specific Protease-7 Inhibition Impairs Tip60-dependent Foxp3+ T-regulatory Cell Function and Promotes Antitumor Immunity

    Directory of Open Access Journals (Sweden)

    Liqing Wang

    2016-11-01

    Full Text Available Foxp3+ T-regulatory (Treg cells are known to suppress protective host immune responses to a wide variety of solid tumors, but their therapeutic targeting is largely restricted to their transient depletion or “secondary” modulation, e.g. using anti-CTLA-4 monoclonal antibody. Our ongoing studies of the post-translational modifications that regulate Foxp3 demonstrated that the histone/protein acetyltransferase, Tip60, plays a dominant role in promoting acetylation, dimerization and function in Treg cells. We now show that the ubiquitin-specific protease, Usp7, controls Treg function largely by stabilizing the expression and promoting the multimerization of Tip60 and Foxp3. Genetic or pharmacologic targeting of Usp7 impairs Foxp3+ Treg suppressive functions, while conventional T cell responses remain intact. As a result, pharmacologic inhibitors of Usp7 can limit tumor growth in immunocompetent mice, and promote the efficacy of antitumor vaccines and immune checkpoint therapy with anti-PD1 monoclonal antibody in murine models. Hence, pharmacologic therapy with Usp7 inhibitors may have an important role in future cancer immunotherapy.

  2. Nutrition, immune function and health of dairy cattle.

    Science.gov (United States)

    Ingvartsen, K L; Moyes, K

    2013-03-01

    The large increase in milk yield and the structural changes in the dairy industry have caused major changes in the housing, feeding and management of the dairy cow. However, while large improvements have occurred in production and efficiency, the disease incidence, based on veterinary records, does not seem to be improved. Earlier reviews have covered critical periods such as the transition period in the cow and its influence on health and immune function, the interplay between the endocrine system and the immune system and nutrition and immune function. Knowledge on these topics is crucial for our understanding of disease risk and our effort to develop health and welfare improving strategies, including proactive management for preventing diseases and reducing the severity of diseases. To build onto this the main purpose of this review will therefore be on the effect of physiological imbalance (PI) on immune function, and to give perspectives for prevention of diseases in the dairy cow through nutrition. To a large extent, the health problems during the periparturient period relate to cows having difficulty in adapting to the nutrient needs for lactation. This may result in PI, a situation where the regulatory mechanisms are insufficient for the animals to function optimally leading to a high risk of a complex of digestive, metabolic and infectious problems. The risk of infectious diseases will be increased if the immune competence is reduced. Nutrition plays a pivotal role in the immune response and the effect of nutrition may be directly through nutrients or indirectly by metabolites, for example, in situations with PI. This review discusses the complex relationships between metabolic status and immune function and how these complex interactions increase the risk of disease during early lactation. A special focus will be placed on the major energetic fuels currently known to be used by immune cells (i.e. glucose, non-esterified fatty acids, beta

  3. Targeting CD28, CTLA-4 and PD-L1 costimulation differentially controls immune synapses and function of human regulatory and conventional T-cells.

    Directory of Open Access Journals (Sweden)

    Nahzli Dilek

    Full Text Available CD28, CTLA-4 and PD-L1, the three identified ligands for CD80/86, are pivotal positive and negative costimulatory molecules that, among other functions, control T cell motility and formation of immune synapse between T cells and antigen-presenting cells (APCs. What remains incompletely understood is how CD28 leads to the activation of effector T cells (Teff but inhibition of suppression by regulatory T cells (Tregs, while CTLA-4 and PD-L1 inhibit Teff function but are crucial for the suppressive function of Tregs. Using alloreactive human T cells and blocking antibodies, we show here by live cell dynamic microscopy that CD28, CTLA-4, and PD-L1 differentially control velocity, motility and immune synapse formation in activated Teff versus Tregs. Selectively antagonizing CD28 costimulation increased Treg dwell time with APCs and induced calcium mobilization which translated in increased Treg suppressive activity, in contrast with the dampening effect on Teff responses. The increase in Treg suppressive activity after CD28 blockade was also confirmed with polyclonal Tregs. Whereas CTLA-4 played a critical role in Teff by reversing TCR-induced STOP signals, it failed to affect motility in Tregs but was essential for formation of the Treg immune synapse. Furthermore, we identified a novel role for PD-L1-CD80 interactions in suppressing motility specifically in Tregs. Thus, our findings reveal that the three identified ligands of CD80/86, CD28, CTLA-4 and PD-L1, differentially control immune synapse formation and function of the human Teff and Treg cells analyzed here. Individually targeting CD28, CTLA-4 and PD-L1 might therefore represent a valuable therapeutic strategy to treat immune disorders where effector and regulatory T cell functions need to be differentially targeted.

  4. [Impact of thymic function in age-related immune deterioration].

    Science.gov (United States)

    Ferrando-Martínez, Sara; de la Fuente, Mónica; Guerrero, Juan Miguel; Leal, Manuel; Muñoz-Fernández, M Ángeles

    2013-01-01

    Age-related biological deterioration also includes immune system deterioration and, in consequence, a rise in the incidence and prevalence of infections and cancers, as well as low responses to vaccination strategies. Out of all immune cell subsets, T-lymphocytes seem to be involved in most of the age-related defects. Since T-lymphocytes mature during their passage through the thymus, and the thymus shows an age-related process of atrophy, thymic regression has been proposed as the triggering event of this immune deterioration in elderly people. Historically, it has been accepted that the young thymus sets the T-lymphocyte repertoire during the childhood, whereupon atrophy begins until the elderly thymus is a non-functional evolutionary trace. However, a rising body of knowledge points toward the thymus functioning during adulthood. In the elderly, higher thymic function is associated with a younger immune system, while thymic function failure is associated with all-cause mortality. Therefore, any new strategy focused on the improvement of the elderly quality of life, especially those trying to influence the immune system, should take into account, together with peripheral homeostasis, thymus function as a key element in slowing down age-related decline. Copyright © 2012 SEGG. Published by Elsevier Espana. All rights reserved.

  5. Staphylococcal Immune Evasion Proteins: Structure, Function, and Host Adaptation.

    Science.gov (United States)

    Koymans, Kirsten J; Vrieling, Manouk; Gorham, Ronald D; van Strijp, Jos A G

    2017-01-01

    Staphylococcus aureus is a successful human and animal pathogen. Its pathogenicity is linked to its ability to secrete a large amount of virulence factors. These secreted proteins interfere with many critical components of the immune system, both innate and adaptive, and hamper proper immune functioning. In recent years, numerous studies have been conducted in order to understand the molecular mechanism underlying the interaction of evasion molecules with the host immune system. Structural studies have fundamentally contributed to our understanding of the mechanisms of action of the individual factors. Furthermore, such studies revealed one of the most striking characteristics of the secreted immune evasion molecules: their conserved structure. Despite high-sequence variability, most immune evasion molecules belong to a small number of structural categories. Another remarkable characteristic is that S. aureus carries most of these virulence factors on mobile genetic elements (MGE) or ex-MGE in its accessory genome. Coevolution of pathogen and host has resulted in immune evasion molecules with a highly host-specific function and prevalence. In this review, we explore how these shared structures and genomic locations relate to function and host specificity. This is discussed in the context of therapeutic options for these immune evasion molecules in infectious as well as in inflammatory diseases.

  6. Effect of radiotherapy on immunity function of cancer patients receiving radiotherapy

    International Nuclear Information System (INIS)

    Li Xinli; Zhu Shentao; Xu Jiuhong

    2003-01-01

    Objective: In order to observe the effect of radiotherapy on immunity function of cancer patients receiving radiotherapy. Methods: Cellular immunity is determined by APAAP; Humoral immunity is determined by transmission method. Results: The items of cellular immunity is lower than the control after radiotherapy. These items decrease continually. The difference between before and after radiotherapy has statistic significance. Of all Humoral immunity items, IgA, IgM decreased after radiotherapy and the difference has statistic significance. Conclusions: Radiotherapy can damage patients' immunity function

  7. Siderophore-based immunization strategy to inhibit growth of enteric pathogens.

    Science.gov (United States)

    Sassone-Corsi, Martina; Chairatana, Phoom; Zheng, Tengfei; Perez-Lopez, Araceli; Edwards, Robert A; George, Michael D; Nolan, Elizabeth M; Raffatellu, Manuela

    2016-11-22

    Infections with Gram-negative pathogens pose a serious threat to public health. This scenario is exacerbated by increases in antibiotic resistance and the limited availability of vaccines and therapeutic tools to combat these infections. Here, we report an immunization approach that targets siderophores, which are small molecules exported by enteric Gram-negative pathogens to acquire iron, an essential nutrient, in the host. Because siderophores are nonimmunogenic, we designed and synthesized conjugates of a native siderophore and the immunogenic carrier protein cholera toxin subunit B (CTB). Mice immunized with the CTB-siderophore conjugate developed anti-siderophore antibodies in the gut mucosa, and when mice were infected with the enteric pathogen Salmonella, they exhibited reduced intestinal colonization and reduced systemic dissemination of the pathogen. Moreover, analysis of the gut microbiota revealed that reduction of Salmonella colonization in the inflamed gut was accompanied by expansion of Lactobacillus spp., which are beneficial commensal organisms that thrive in similar locales as Enterobacteriaceae. Collectively, our results demonstrate that anti-siderophore antibodies inhibit Salmonella colonization. Because siderophore-mediated iron acquisition is a virulence trait shared by many bacterial and fungal pathogens, blocking microbial iron acquisition by siderophore-based immunization or other siderophore-targeted approaches may represent a novel strategy to prevent and ameliorate a broad range of infections.

  8. Exercise and the Regulation of Immune Functions.

    Science.gov (United States)

    Simpson, Richard J; Kunz, Hawley; Agha, Nadia; Graff, Rachel

    2015-01-01

    Exercise has a profound effect on the normal functioning of the immune system. It is generally accepted that prolonged periods of intensive exercise training can depress immunity, while regular moderate intensity exercise is beneficial. Single bouts of exercise evoke a striking leukocytosis and a redistribution of effector cells between the blood compartment and the lymphoid and peripheral tissues, a response that is mediated by increased hemodynamics and the release of catecholamines and glucocorticoids following the activation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis. Single bouts of prolonged exercise may impair T-cell, NK-cell, and neutrophil function, alter the Type I and Type II cytokine balance, and blunt immune responses to primary and recall antigens in vivo. Elite athletes frequently report symptoms associated with upper respiratory tract infections (URTI) during periods of heavy training and competition that may be due to alterations in mucosal immunity, particularly reductions in secretory immunoglobulin A. In contrast, single bouts of moderate intensity exercise are "immuno-enhancing" and have been used to effectively increase vaccine responses in "at-risk" patients. Improvements in immunity due to regular exercise of moderate intensity may be due to reductions in inflammation, maintenance of thymic mass, alterations in the composition of "older" and "younger" immune cells, enhanced immunosurveillance, and/or the amelioration of psychological stress. Indeed, exercise is a powerful behavioral intervention that has the potential to improve immune and health outcomes in the elderly, the obese, and patients living with cancer and chronic viral infections such as HIV. © 2015 Elsevier Inc. All rights reserved.

  9. Galectin-9 ameliorates anti-GBM glomerulonephritis by inhibiting Th1 and Th17 immune responses in mice.

    Science.gov (United States)

    Zhang, Qian; Luan, Hong; Wang, Le; He, Fan; Zhou, Huan; Xu, Xiaoli; Li, Xingai; Xu, Qing; Niki, Toshiro; Hirashima, Mitsuomi; Xu, Gang; Lv, Yongman; Yuan, Jin

    2014-04-15

    Antiglomerular basement membrane glomerulonephritis (anti-GBM GN) is a Th1- and Th17-predominant autoimmune disease. Galectin-9 (Gal-9), identified as the ligand of Tim-3, functions in diverse biological processes and leads to the apoptosis of CD4(+)Tim-3(+) T cells. It is still unclear how Gal-9 regulates the functions of Th1 and Th17 cells and prevents renal injury in anti-GBM GN. In this study, Gal-9 was administered to anti-GBM GN mice for 7 days. We found that Gal-9 retarded the increase of Scr, ameliorated renal tubular injury, and reduced the formation of crescents. The infiltration of Th1 and Th17 cells into the spleen and kidneys significantly decreased in Gal-9-treated nephritic mice. The reduced infiltration of Th1 and Th17 cells might be associated with the downregulation of CCL-20, CXCL-9, and CXCL-10 mRNAs in the kidney. In parallel, the blood levels of IFN-γ and IL-17A declined in Gal-9-treated nephritic mice at days 21 and 28. In addition, an enhanced Th2 cell-mediated immune response was observed in the kidneys of nephritic mice after a 7-day injection of Gal-9. In conclusion, the protective role of Gal-9 in anti-GBM GN is associated with the inhibition of Th1 and Th17 cell-mediated immune responses and enhanced Th2 immunity in the kidney.

  10. Vitamin D and neonatal immune function.

    LENUS (Irish Health Repository)

    Clancy, N

    2013-05-01

    Vitamin D deficiency is widespread in the neonatal and paediatric population of northern latitudes, particularly in children of African, Middle Eastern and Asian ethnicity. This is associated with diminished immune function and increases the risk of Th1 autoimmune diseases like type 1 diabetes. Epidermiological studies have also shown a link between vitamin D deficiency in children and a more severe course of illness with lower respiratory tract infection or Respiratory Syncitial Virus (RSV) bronchiolitis. The mechanism by which vitamin D enhances immunity is complex. It acts through the innate immune system by inducing antimicrobial peptides in epithelial cells, neutrophils and macrophages. The role of Vitamin D in neonatal and paediatric immunomodulation requires further study.

  11. The influence of TAP1 and TAP2 gene polymorphisms on TAP function and its inhibition by viral immune evasion proteins.

    Science.gov (United States)

    Praest, P; Luteijn, R D; Brak-Boer, I G J; Lanfermeijer, J; Hoelen, H; Ijgosse, L; Costa, A I; Gorham, R D; Lebbink, R J; Wiertz, E J H J

    2018-06-04

    Herpesviruses encode numerous immune evasion molecules that interfere with the immune system, particularly with certain stages in the MHC class I antigen presentation pathway. In this pathway, the transporter associated with antigen processing (TAP) is a frequent target of viral immune evasion strategies. This ER-resident transporter is composed of the proteins TAP1 and TAP2, and plays a crucial role in the loading of viral peptides onto MHC class I molecules. Several variants of TAP1 and TAP2 occur in the human population, some of which are linked to autoimmune disorders and susceptibility to infections. Here, we assessed the influence of naturally occurring TAP variants on peptide transport and MHC class I expression. In addition, we tested the inhibitory capacity of three viral immune evasion proteins, the TAP inhibitors US6 from human cytomegalovirus, ICP47 from herpes simplex virus type 1 and BNLF2a from Epstein-Barr virus, for a series of TAP1 and TAP2 variants. Our results suggest that these TAP polymorphisms have no or limited effect on peptide transport or MHC class I expression. Furthermore, our study indicates that the herpesvirus-encoded TAP inhibitors target a broad spectrum of TAP variants; inhibition of TAP is not affected by the naturally occurring polymorphisms of TAP tested in this study. Our findings suggest that the long-term coevolution of herpesviruses and their host did not result in selection of inhibitor-resistant TAP variants in the human population. Copyright © 2018. Published by Elsevier Ltd.

  12. PCSK9 at the crossroad of cholesterol metabolism and immune function during infections.

    Science.gov (United States)

    Paciullo, Francesco; Fallarino, Francesca; Bianconi, Vanessa; Mannarino, Massimo R; Sahebkar, Amirhossein; Pirro, Matteo

    2017-09-01

    Sepsis, a complex and dynamic syndrome resulting from microbial invasion and immune system dysregulation, is associated with an increased mortality, reaching up to 35% worldwide. Cholesterol metabolism is often disturbed during sepsis, with low plasma cholesterol levels being associated with poor prognosis. Proprotein convertase subtilisin/kexin type 9 (PCSK9) promotes degradation of the low-density lipoprotein receptor (LDLR), thus regulating intracellular and plasma cholesterol levels. PCSK9 is often upregulated during sepsis and might have a detrimental effect on immune host response and survival. Accordingly, PCSK9 reduces lipopolysaccharide uptake and clearance by human hepatocytes. Moreover, PCSK9 upregulation exacerbates organ dysfunction and tissue inflammation during sepsis, whereas a protective effect of PCSK9 deficiency has been documented in septic patients. Although a possible detrimental impact of PCSK9 on survival has been described, some beneficial effects of PCSK9 on immune response may be hypothesized. First, PCSK9 is associated with increased plasma cholesterol levels, which might be protective during sepsis. Second, PCSK9, by stimulating LDLR degradation and inhibiting reverse cholesterol transport (RCT), might promote preferential cholesterol accumulation in macrophages and other immune cells; these events might improve lipid raft composition and augment toll-like receptor function thus supporting inflammatory response. Hence, a more clear definition of the role of PCSK9 in septic states might provide additional insight in the understanding of the sepsis-associated immune dysregulation and enhance therapeutic outcomes. © 2017 Wiley Periodicals, Inc.

  13. MenTORing Immunity: mTOR Signaling in the Development and Function of Tissue-Resident Immune Cells.

    Science.gov (United States)

    Jones, Russell G; Pearce, Edward J

    2017-05-16

    Tissue-resident immune cells must balance survival in peripheral tissues with the capacity to respond rapidly upon infection or tissue damage, and in turn couple these responses with intrinsic metabolic control and conditions in the tissue microenvironment. The serine/threonine kinase mammalian/mechanistic target of rapamycin (mTOR) is a central integrator of extracellular and intracellular growth signals and cellular metabolism and plays important roles in both innate and adaptive immune responses. This review discusses the function of mTOR signaling in the differentiation and function of tissue-resident immune cells, with focus on the role of mTOR as a metabolic sensor and its impact on metabolic regulation in innate and adaptive immune cells. We also discuss the impact of metabolic constraints in tissues on immune homeostasis and disease, and how manipulating mTOR activity with drugs such as rapamycin can modulate immunity in these contexts. Copyright © 2017. Published by Elsevier Inc.

  14. Maternal immunization increases nestling energy expenditure, immune function, and fledging success in a passerine bird

    Directory of Open Access Journals (Sweden)

    Gary Burness

    2018-04-01

    Full Text Available Female birds transfer maternally derived antibodies (matAb to their nestlings, via the egg yolk. These antibodies are thought to provide passive protection, and allow nestlings to avoid the costs associated with mounting an innate immune response. To test whether there is an energetic benefit to nestlings from receiving matAb, we challenged adult female tree swallows (Tachycineta bicolor prior to clutch initiation with either lipopolysaccharide (LPS or saline (Control. Following hatching, one half of each female's nestlings were immunized on day 8 post-hatch with LPS or saline, and the 4-h post-immunization nestling metabolic rate (MR was measured. There was no difference in either LPS-reactive antibodies or total Ig levels between offspring of immunized and non-immunized mothers on day 6 or 14 post-hatch, possibly reflecting a relatively short half-life of matAbs in altricial birds. Additionally, we found no evidence that nestlings from LPS-immunized mothers could avoid the growth suppression that may result from activation of an inflammatory response. Unexpectedly, we found that control nestlings from LPS mothers had higher resting MR than control nestlings of control mothers. We attribute the increased MR to the costs associated with a general non-specific enhancement of immune function in nestlings from LPS-immunized mothers. Consistent with enhanced immune function, nestlings of immunized mothers had a more robust inflammatory response to phytohaemagglutinin and higher fledging success. Our results suggest that maternal antigen exposure pre-laying can result in increased fitness for both mothers and offspring, depending on food availability.

  15. Vitamin C and Immune Function

    Directory of Open Access Journals (Sweden)

    Anitra C. Carr

    2017-11-01

    Full Text Available Vitamin C is an essential micronutrient for humans, with pleiotropic functions related to its ability to donate electrons. It is a potent antioxidant and a cofactor for a family of biosynthetic and gene regulatory enzymes. Vitamin C contributes to immune defense by supporting various cellular functions of both the innate and adaptive immune system. Vitamin C supports epithelial barrier function against pathogens and promotes the oxidant scavenging activity of the skin, thereby potentially protecting against environmental oxidative stress. Vitamin C accumulates in phagocytic cells, such as neutrophils, and can enhance chemotaxis, phagocytosis, generation of reactive oxygen species, and ultimately microbial killing. It is also needed for apoptosis and clearance of the spent neutrophils from sites of infection by macrophages, thereby decreasing necrosis/NETosis and potential tissue damage. The role of vitamin C in lymphocytes is less clear, but it has been shown to enhance differentiation and proliferation of B- and T-cells, likely due to its gene regulating effects. Vitamin C deficiency results in impaired immunity and higher susceptibility to infections. In turn, infections significantly impact on vitamin C levels due to enhanced inflammation and metabolic requirements. Furthermore, supplementation with vitamin C appears to be able to both prevent and treat respiratory and systemic infections. Prophylactic prevention of infection requires dietary vitamin C intakes that provide at least adequate, if not saturating plasma levels (i.e., 100–200 mg/day, which optimize cell and tissue levels. In contrast, treatment of established infections requires significantly higher (gram doses of the vitamin to compensate for the increased inflammatory response and metabolic demand.

  16. Human erythrocytes inhibit complement-mediated solubilization of immune complexes by human serum

    International Nuclear Information System (INIS)

    Dorval, B.L.

    1987-01-01

    The aim of this study was to develop an autologus human system to evaluate the effects of human erythrocytes on solubilization of immune complex precipitates (IC) by human serum. Incubation of IC with fresh human serum or guinea pig serum resulted in solubilization of IC. When packed erythrocytes were added to human serum or guinea pig serum binding of IC to the erythrocyte occurred and IC solubilization was inhibited significantly (p <.025). Sheep erythrocytes did not bind IC or inhibit IC solubilization. To evaluate the role of human erythrocyte complement receptor (CR1) on these findings, human erythrocytes were treated with trypsin or anti-CR1 antibodies. Both treatments abrogated IC binding to human erythrocytes but did not affect the ability of the human erythrocyte to inhibit IC solubilization. Radioimmunoassay was used to measure C3, C4 and C5 activation in human serum after incubation with IC, human erythrocytes, human erythrocytes plus IC, whole blood or in whole blood plus IC

  17. Splenectomy inhibits non-small cell lung cancer growth by modulating anti-tumor adaptive and innate immune response

    Science.gov (United States)

    Levy, Liran; Mishalian, Inbal; Bayuch, Rachel; Zolotarov, Lida; Michaeli, Janna; Fridlender, Zvi G

    2015-01-01

    It has been shown that inhibitors of the immune system reside in the spleen and inhibit the endogenous antitumor effects of the immune system. We hypothesized that splenectomy would inhibit the growth of relatively large non-small lung cancer (NSCLC) tumors by modulating the systemic inhibition of the immune system, and in particular Myeloid Derived Suppressor Cells (MDSC). The effect of splenectomy was evaluated in several murine lung cancer models. We found that splenectomy reduces tumor growth and the development of lung metastases, but only in advanced tumors. In immune-deficient NOD-SCID mice the effect of splenectomy on tumor growth and metastatic spread disappeared. Splenectomy significantly reduced the presence of MDSC, and especially monocytic-MDSC in the circulation and inside the tumor. Specific reduction of the CCR2+ subset of monocytic MDSC was demonstrated, and the importance of the CCL2-CCR2 axis was further shown by a marked reduction in CCL2 following splenectomy. These changes were followed by changes in the macrophages contents of the tumors to become more antitumorigenic, and by increased activation of CD8+ Cytotoxic T-cells (CTL). By MDSC depletion, and adoptive transfer of MDSCs, we demonstrated that the effect of splenectomy on tumor growth was substantially mediated by MDSC cells. We conclude that the spleen is an important contributor to tumor growth and metastases, and that splenectomy can blunt this effect by depletion of MDSC, changing the amount and characteristics of myeloid cells and enhancing activation of CTL. PMID:26137413

  18. Does Exercise Alter Immune Function and Respiratory Infections?

    Science.gov (United States)

    Nieman, David C.

    2001-01-01

    This paper examines whether physical activity influences immune function as a consequence risk of infection from the common cold and other upper respiratory tract infections (URTI) and whether the immune system responds differently to moderate versus intense physical exertion. Research indicates that people who participate in regular moderate…

  19. GYF-21, an Epoxide 2-(2-Phenethyl-Chromone Derivative, Suppresses Innate and Adaptive Immunity via Inhibiting STAT1/3 and NF-κB Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Ran Guo

    2017-05-01

    Full Text Available Multiple sclerosis is a chronic inflammatory autoimmune disease of the central nervous system characterized by demyelinating plaques and axonal loss. Inhibition on over activation of innate and adaptive immunity provides a rationale strategy for treatment of multiple sclerosis. In the present study, we investigated the inhibitory effects of GYF-21, an epoxide 2-(2-phenethyl-chromone derivative isolated from Chinese agarwood, on innate and adaptive immunity for revealing its potential to treat multiple sclerosis. The results showed that GYF-21 markedly inhibited the activation of microglia, and dendritic cells as well as neutrophils, all of which play important roles in innate immunity. Furthermore, GYF-21 significantly suppressed adaptive immunity via inhibiting the differentiation of naive CD4+ T cells into T helper 1 (Th1 and T helper 17 (Th17 cells, and suppressing the activation, proliferation, and IFN-γ secretion of CD8+ T cells. The mechanism study showed that GYF-21 evidently inhibited the activation of STAT1/3 and NF-κB signaling pathways in microglia. In conclusion, we demonstrated that GYF-21 can significantly inhibit innate and adaptive immunity via suppressing STAT1/3 and NF-κB signaling pathways, and has potential to be developed into therapeutic drug for multiple sclerosis.

  20. Innate immune functions of microglia isolated from human glioma patients

    Directory of Open Access Journals (Sweden)

    Grimm Elizabeth

    2006-03-01

    Full Text Available Abstract Background Innate immunity is considered the first line of host defense and microglia presumably play a critical role in mediating potent innate immune responses to traumatic and infectious challenges in the human brain. Fundamental impairments of the adaptive immune system in glioma patients have been investigated; however, it is unknown whether microglia are capable of innate immunity and subsequent adaptive anti-tumor immune responses within the immunosuppressive tumor micro-environment of human glioma patients. We therefore undertook a novel characterization of the innate immune phenotype and function of freshly isolated human glioma-infiltrating microglia (GIM. Methods GIM were isolated by sequential Percoll purification from patient tumors immediately after surgical resection. Flow cytometry, phagocytosis and tumor cytotoxicity assays were used to analyze the phenotype and function of these cells. Results GIM expressed significant levels of Toll-like receptors (TLRs, however they do not secrete any of the cytokines (IL-1β, IL-6, TNF-α critical in developing effective innate immune responses. Similar to innate macrophage functions, GIM can mediate phagocytosis and non-MHC restricted cytotoxicity. However, they were statistically less able to mediate tumor cytotoxicity compared to microglia isolated from normal brain. In addition, the expression of Fas ligand (FasL was low to absent, indicating that apoptosis of the incoming lymphocyte population may not be a predominant mode of immunosuppression by microglia. Conclusion We show for the first time that despite the immunosuppressive environment of human gliomas, GIM are capable of innate immune responses such as phagocytosis, cytotoxicity and TLR expression but yet are not competent in secreting key cytokines. Further understanding of these innate immune functions could play a critical role in understanding and developing effective immunotherapies to malignant human gliomas.

  1. Inhibition of cathepsin X enzyme influences the immune response of THP-1 cells and dendritic cells infected with Helicobacter pylori

    International Nuclear Information System (INIS)

    Skvarc, Miha; Stubljar, David; Kopitar, Andreja Natasa; Jeverica, Samo; Tepes, Bojan; Kos, Janko; Ihan, Alojz

    2013-01-01

    The immune response to Helicobacter pylori importantly determines the outcome of infection as well as the success of eradication therapy. We demonstrate the role of a cysteine protease cathepsin X in the immune response to H. pylori infection. We analysed how the inhibition of cathepsin X influenced the immune response in experiments when THP-1 cells or dendritic cells isolated from patients were stimulated with 48 strains of H. pylori isolated from gastric biopsy samples of patients which had problems with the eradication of bacteria. The experiments, performed with the help of a flow cytometer, showed that the expression of Toll-like receptors (TLRs), especially TLR-4 molecules, on the membranes of THP-1 cells or dendritic cells was higher when we stimulated cells with H. pylori together with inhibitor of cathepsin X 2F12 compared to THP-1 cells or dendritic cells stimulated with H. pylori only, and also in comparison with negative control samples. We also demonstrated that when we inhibited the action of cathepsin X in THP-1 cells, the concentrations of pro-inflammatory cytokines were lower than when THP-1 cell were stimulated with H. pylori only. We demonstrated that inhibition of cathepsin X influences the internalization of TLR-2 and TLR-4. TLR-2 and TLR-4 redistribution to intra-cytoplasmic compartments is hampered if cathepsin X is blocked. The beginning of a successful immune response against H. pylori in the case of inhibition of cathepsin X is delayed

  2. Involvement of activation of PKR in HBx-siRNA-mediated innate immune effects on HBV inhibition.

    Directory of Open Access Journals (Sweden)

    Qiuju Han

    Full Text Available RNA interference (RNAi of virus-specific genes offers the possibility of developing a new anti-hepatitis B virus (anti-HBV therapy. Recent studies have revealed that siRNAs can induce an innate immune response in vitro and in vivo. Here, HBVx (HBx mRNA expression and HBV replication were significantly inhibited, followed by the enhancement of expression of type I interferons (IFNs, IFN-stimulated genes (ISG15 and ISG56 and proinflammatory cytokines after HepG2.2.15 cells were transfected with chemically synthesized HBx-siRNAs. Transfection with HBx-siRNAs also significantly increased expression of dsRNA-dependent protein kinase R (PKR in HepG2.2.15 cells, followed by activation of downstream signaling events such as eukaryotic initiation factor 2α (eIF2-α. In PKR-over-expressing HepG2.2.15 cells, HBx-siRNAs exerted more potent inhibitory effects on HBV replication and greater production of type I IFNs. By contrast, the inhibitory effect of HBx-siRNAs on HBV replication was attenuated when PKR was inhibited or silenced, demonstrating that HBx-siRNAs greatly promoted PKR activation, leading to the higher production of type I IFN. Therefore, we concluded that PKR is involved in the innate immune effects mediated by HBx-siRNAs and further contributes to HBV inhibition. The bifunctional siRNAs with both gene silencing and innate immune activation properties may represent a new potential strategy for treatment of HBV.

  3. [Effect of Supportan on nutritional status and immune function of late-staged gastric cancer patients undergoing chemotherapy].

    Science.gov (United States)

    Zhong, Hai-jun; Ying, Jie-er; Ma, Sheng-lin

    2006-09-01

    To evaluate the effect of Supportan, an enteral nutrition (EN) specific for tumor patients, on the nutritional status and immune function of late-staged gastric cancer patients undergoing chemotherapy. Sixty-six late-staged gastric cancer patients undergoing chemotherapy were randomly divided into EN group (n=33) and control group (n=33). During chemotherapy, the patients in EN group received Supportan and the patients in the control group received basic diet. On the 14th day before chemotherapy and after chemotherapy, nutritional status and cell immune indicators were evaluated. As for nutrition indicators, there were no significant differences in EN group before and after chemotherapy (P > 0.05). Total protein, hemoglobin, prealbumin and transferrin significantly decreased after chemotherapy compared with those before chemotherapy in the control group (Pnutrition in EN group were superior to that in the control group, however, the differences were not statistically significant. The incidences of nausea, vomiting and marrow inhibition in Supportan group was lower compared with those in the control group, but with no significant difference. Supportan can prevent malnutrition of the late-staged gastric cancer patients undergoing chemotherapy, and improve immune function and alleviate adverse effects of chemotherapy.

  4. Behavioral inhibition in rhesus monkeys (Macaca mulatta is related to the airways response, but not immune measures, commonly associated with asthma.

    Directory of Open Access Journals (Sweden)

    Katie Chun

    Full Text Available Behavioral inhibition reflects a disposition to react warily to novel situations, and has been associated with atopic diseases such as asthma. Retrospective work established the relationship between behavioral inhibition in rhesus monkeys (Macaca mulatta and airway hyperresponsiveness, but not atopy, and the suggestion was made that behavioral inhibition might index components of asthma that are not immune-related. In the present study, we prospectively examined the relationship between behavioral inhibition and airway hyperresponsiveness, and whether hormonal and immune measures often associated with asthma were associated with behavioral inhibition and/or airway hyperresponsiveness. In a sample of 49 yearling rhesus monkeys (mean=1.25 years, n=24 behaviorally inhibited animals, we measured in vitro cytokine levels (IL-4, IL-10, IL-12, IFN-γ in response to stimulation, as well as peripheral blood cell percentages, cortisol levels, and percentage of regulatory T-cells (CD3+CD4+CD25+FOXP3+. Airway reactivity was assessed using an inhaled methacholine challenge. Bronchoalveolar lavage was performed and the proportion of immune cells was determined. Behaviorally inhibited monkeys had airway hyperresponsiveness as indicated by the methacholine challenge (p=0.031, confirming our earlier retrospective result. Airway hyperresponsiveness was also associated with lower lymphocyte percentages in lavage fluid and marginally lower plasma cortisol concentrations. However, none of the tested measures was significantly related to both behavioral inhibition and airway hyperresponsiveness, and so could not mediate their relationship. Airway hyperresponsiveness is common to atopic and non-atopic asthma and behavioral inhibition has been related to altered autonomic activity in other studies. Our results suggest that behavioral inhibition might index an autonomically mediated reactive airway phenotype, and that a variety of stimuli (including inflammation within

  5. Zinc as a Gatekeeper of Immune Function

    Directory of Open Access Journals (Sweden)

    Inga Wessels

    2017-11-01

    Full Text Available After the discovery of zinc deficiency in the 1960s, it soon became clear that zinc is essential for the function of the immune system. Zinc ions are involved in regulating intracellular signaling pathways in innate and adaptive immune cells. Zinc homeostasis is largely controlled via the expression and action of zinc “importers” (ZIP 1–14, zinc “exporters” (ZnT 1–10, and zinc-binding proteins. Anti-inflammatory and anti-oxidant properties of zinc have long been documented, however, underlying mechanisms are still not entirely clear. Here, we report molecular mechanisms underlying the development of a pro-inflammatory phenotype during zinc deficiency. Furthermore, we describe links between altered zinc homeostasis and disease development. Consequently, the benefits of zinc supplementation for a malfunctioning immune system become clear. This article will focus on underlying mechanisms responsible for the regulation of cellular signaling by alterations in zinc homeostasis. Effects of fast zinc flux, intermediate “zinc waves”, and late homeostatic zinc signals will be discriminated. Description of zinc homeostasis-related effects on the activation of key signaling molecules, as well as on epigenetic modifications, are included to emphasize the role of zinc as a gatekeeper of immune function.

  6. Cross-immunity between syngeneic tumors in mice immunized with gamma-irradiated ascites tumors

    International Nuclear Information System (INIS)

    Kudo, Hajime; Waga, Takashi; Sato, Tatsusuke; Ogasawara, Masamichi; Ito, Izumi

    1980-01-01

    C3H/He mice immunized repeatedly with irradiated (13,000 rads 60 Co) MM46 or MM48, both transplantable ascites mammary carcinomas of the same strain, were subcutaneously challenged with the identical or the different tumor. In mice immunized with irradiated MM46, the growth of challenges of not only MM46 but also MM48 was inhibited. On the other hand, in mice immunized with irradiated MM48, the growth of challenges of MM48 was inhibited, but the inhibition of the growth of MM46 was not observed. Cross-immunity, therefore, was shown by immunization with MM46 but not with MM48. These findings were considered to indicate that MM46 expressed cross-immunity against MM48 because of its high resistance to the irradiation, and that MM48 did not show cross-immunity to MM46 because of its low resistance to the irradiation. (author)

  7. Recombinant Marburg viruses containing mutations in the IID region of VP35 prevent inhibition of Host immune responses.

    Science.gov (United States)

    Albariño, César G; Wiggleton Guerrero, Lisa; Spengler, Jessica R; Uebelhoer, Luke S; Chakrabarti, Ayan K; Nichol, Stuart T; Towner, Jonathan S

    2015-02-01

    Previous in vitro studies have demonstrated that Ebola and Marburg virus (EBOV and MARV) VP35 antagonize the host cell immune response. Moreover, specific mutations in the IFN inhibitory domain (IID) of EBOV and MARV VP35 that abrogate their interaction with virus-derived dsRNA, lack the ability to inhibit the host immune response. To investigate the role of MARV VP35 in the context of infectious virus, we used our reverse genetics system to generate two recombinant MARVs carrying specific mutations in the IID region of VP35. Our data show that wild-type and mutant viruses grow to similar titers in interferon deficient cells, but exhibit attenuated growth in interferon-competent cells. Furthermore, in contrast to wild-type virus, both MARV mutants were unable to inhibit expression of various antiviral genes. The MARV VP35 mutants exhibit similar phenotypes to those previously described for EBOV, suggesting the existence of a shared immune-modulatory strategy between filoviruses. Published by Elsevier Inc.

  8. Skin Immunization Obviates Alcohol-Related Immune Dysfunction

    Directory of Open Access Journals (Sweden)

    Rhonda M. Brand

    2015-11-01

    Full Text Available Alcoholics suffer from immune dysfunction that can impede vaccine efficacy. If ethanol (EtOH-induced immune impairment is in part a result of direct exposure of immune cells to EtOH, then reduced levels of exposure could result in less immune dysfunction. As alcohol ingestion results in lower alcohol levels in skin than blood, we hypothesized that the skin immune network may be relatively preserved, enabling skin-targeted immunizations to obviate the immune inhibitory effects of alcohol consumption on conventional vaccines. We employed the two most common chronic EtOH mouse feeding models, the liver-damaging Lieber-DeCarli (LD and liver-sparing Meadows-Cook (MC diets, to examine the roles of EtOH and/or EtOH-induced liver dysfunction on alcohol related immunosuppression. Pair-fed mice were immunized against the model antigen ovalbumin (OVA by DNA immunization or against flu by administering the protein-based influenza vaccine either systemically (IV, IM, directly to liver (hydrodynamic, or cutaneously (biolistic, ID. We measured resulting tissue EtOH levels, liver stress, regulatory T cell (Treg, and myeloid-derived suppressor cell (MDSC populations. We compared immune responsiveness by measuring delayed-type hypersensitivity (DTH, antigen-specific cytotoxic T lymphocyte (CTL, and antibody induction as a function of delivery route and feeding model. We found that, as expected, and independent of the feeding model, EtOH ingestion inhibits DTH, CTL lysis, and antigen-specific total IgG induced by traditional systemic vaccines. On the other hand, skin-targeted vaccines were equally immunogenic in alcohol-exposed and non-exposed subjects, suggesting that cutaneous immunization may result in more efficacious vaccination in alcohol-ingesting subjects.

  9. Position statement. Part one: Immune function and exercise

    DEFF Research Database (Denmark)

    Walsh, Neil P; Gleeson, Michael; Shephard, Roy J

    2011-01-01

    responses and falls in stimulated B cell Ig synthesis. The cause of this apparent depression in acquired immunity appears to be related to elevated circulating stress hormones, and alterations in the pro/anti-inflammatory cytokine balance in response to exercise. The clinical significance of these changes...... and immediately after exercise, proportional to exercise intensity and duration, with numbers of cells (T cells and to a lesser extent B cells) falling below pre-exercise levels during the early stages of recovery, before returning to resting values normally within 24 h. Mobilization of T and B cell subsets...... risk of URTI during heavy training. An important question for exercise immunologists remains: how does one measure immune function in a meaningful way? One approach to assessing immune function that extends beyond blood or salivary measures involves challenging study participants with antigenic stimuli...

  10. Control of Immune Cell Homeostasis and Function by lncRNAs.

    Science.gov (United States)

    Mowel, Walter K; Kotzin, Jonathan J; McCright, Sam J; Neal, Vanessa D; Henao-Mejia, Jorge

    2018-01-01

    The immune system is composed of diverse cell types that coordinate responses to infection and maintain tissue homeostasis. In each of these cells, extracellular cues determine highly specific epigenetic landscapes and transcriptional profiles to promote immunity while maintaining homeostasis. New evidence indicates that long non-coding RNAs (lncRNAs) play crucial roles in epigenetic and transcriptional regulation in mammals. Thus, lncRNAs have emerged as key regulatory molecules of immune cell gene expression programs in response to microbial and tissue-derived cues. We review here how lncRNAs control the function and homeostasis of cell populations during immune responses, emphasizing the diverse molecular mechanisms by which lncRNAs tune highly contextualized transcriptional programs. In addition, we discuss the new challenges faced in interrogating lncRNA mechanisms and function in the immune system. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Antitumor Immunity Is Controlled by Tetraspanin Proteins

    Directory of Open Access Journals (Sweden)

    Fleur Schaper

    2018-05-01

    Full Text Available Antitumor immunity is shaped by the different types of immune cells that are present in the tumor microenvironment (TME. In particular, environmental signals (for instance, soluble factors or cell–cell contact transmitted through the plasma membrane determine whether immune cells are activated or inhibited. Tetraspanin proteins are emerging as central building blocks of the plasma membrane by their capacity to cluster immune receptors, enzymes, and signaling molecules into the tetraspanin web. Whereas some tetraspanins (CD81, CD151, CD9 are widely and broadly expressed, others (CD53, CD37, Tssc6 have an expression pattern restricted to hematopoietic cells. Studies using genetic mouse models have identified important immunological functions of these tetraspanins on different leukocyte subsets, and as such, may be involved in the immune response against tumors. While multiple studies have been performed with regards to deciphering the function of tetraspanins on cancer cells, the effect of tetraspanins on immune cells in the antitumor response remains understudied. In this review, we will focus on tetraspanins expressed by immune cells and discuss their potential role in antitumor immunity. New insights in tetraspanin function in the TME and possible prognostic and therapeutic roles of tetraspanins will be discussed.

  12. Inhibition of Langerhans cell maturation by human papillomavirus type 16: a novel role for the annexin A2 heterotetramer in immune suppression.

    Science.gov (United States)

    Woodham, Andrew W; Raff, Adam B; Raff, Laura M; Da Silva, Diane M; Yan, Lisa; Skeate, Joseph G; Wong, Michael K; Lin, Yvonne G; Kast, W Martin

    2014-05-15

    High-risk human papillomaviruses (HPVs) are sexually transmitted viruses causally associated with several cancers. During its natural life cycle, HPV16, the most common high-risk genotype, infects the epithelial basal cells in a process facilitated through a recently identified receptor, the annexin A2 heterotetramer (A2t). During infection, HPV16 also interacts with Langerhans cells (LC), the APC of the epithelium, inducing immune suppression, which is mediated by the HPV16 L2 minor capsid protein. Despite the importance of these virus-immune cell interactions, the specific mechanisms of HPV16 entry into LC and HPV16-induced immune suppression remain undefined. An N-terminal peptide of HPV16 L2 (aa 108-126) has been shown to specifically interact with A2t. In this study, we show that incubation of human LC with this peptide blocks binding of HPV16. Inhibiting this interaction with an A2t ligand or by small interfering RNA downregulation of A2t significantly decreases HPV16 internalization into LC in an L2-dependent manner. A2t is associated with suppression of LC maturation as demonstrated through attenuated secretion of Th1-associated cytokines and decreased surface expression of MHC class II on LC exposed to A2t. Conversely, small molecule inhibition of A2t prevents HPV16-induced suppression of LC immune function as indicated by significantly increased secretion of inflammatory cytokines and surface expression of CD86 in HPV16 treated LC pre-exposed to A2t inhibitors. These results demonstrate that HPV16 suppresses LC maturation through an interaction with A2t, revealing a novel role for this protein.

  13. The structure of a contact-dependent growth-inhibition (CDI) immunity protein from Neisseria meningitidis MC58

    Energy Technology Data Exchange (ETDEWEB)

    Tan, Kemin; Johnson, Parker M.; Stols, Lucy; Boubion, Bryan; Eschenfeldt, William; Babnigg, Gyorgy; Hayes, Christopher S.; Joachimiak, Andrezj; Goulding, Celia W.

    2015-05-20

    Contact-dependent growth inhibition (CDI) is an important mechanism of intercellular competition between neighboring Gram-negative bacteria. CDI systems encode large surface-exposed CdiA effector proteins that carry a variety of C-terminal toxin domains (CdiA-CTs). All CDI+bacteria also produce CdiI immunity proteins that specifically bind to the cognate CdiA-CT and neutralize its toxin activity to prevent auto-inhibition. Here, the X-ray crystal structure of a CdiI immunity protein fromNeisseria meningitidisMC58 is presented at 1.45 Å resolution. The CdiI protein has structural homology to the Whirly family of RNA-binding proteins, but appears to lack the characteristic nucleic acid-binding motif of this family. Sequence homology suggests that the cognate CdiA-CT is related to the eukaryotic EndoU family of RNA-processing enzymes. A homology model is presented of the CdiA-CT based on the structure of the XendoU nuclease fromXenopus laevis. Molecular-docking simulations predict that the CdiA-CT toxin active site is occluded upon binding to the CdiI immunity protein. Together, these observations suggest that the immunity protein neutralizes toxin activity by preventing access to RNA substrates.

  14. Effect of Paris saponin on antitumor and immune function in U14 ...

    African Journals Online (AJOL)

    bearing mice, and reduced the serum IL-4 level. The Paris saponin can inhibit U14 cell growth and prolong survival time of mice; it is speculated that the Paris saponin may express its anti-tumor activity by improving the body's immune system.

  15. Clinical dosing regimen of selinexor maintains normal immune homeostasis and T cell effector function in mice: implications for combination with immunotherapy

    Science.gov (United States)

    Tyler, Paul M.; Servos, Mariah M.; de Vries, Romy C.; Klebanov, Boris; Kashyap, Trinayan; Sacham, Sharon; Landesman, Yosef; Dougan, Michael; Dougan, Stephanie K.

    2017-01-01

    Selinexor (KPT-330) is a first in class nuclear transport inhibitor currently in clinical trials as an anti-cancer agent. To determine how selinexor might impact anti-tumor immunity, we analyzed immune homeostasis in mice treated with selinexor and found disruptions in T cell development, a progressive loss of CD8 T cells and increases in inflammatory monocytes. Antibody production in response to immunization was mostly normal. Precursor populations in bone marrow and thymus were unaffected by selinexor, suggesting that normal immune homeostasis could recover. We found that a high dose of selinexor given once per week preserved nearly normal immune functioning, whereas a lower dose given 3 times per week did not restore immune homeostasis. Both naïve and effector CD8 T cells cultured in vitro showed impaired activation in the presence of selinexor. These experiments suggest that nuclear exportins are required for T cell development and function. We determined the minimum concentration of selinexor required to block T cell activation, and showed that T cell inhibitory effects of selinexor occur at levels above 100nM, corresponding to the first 24 hours post-oral dosing. In a model of implantable melanoma, selinexor treatment at 10 mg/kg with a 5 day drug holiday led to intratumoral IFNγ+, granzyme B+ cytotoxic CD8 T cells that were comparable to vehicle treated mice. Overall, selinexor treatment leads to transient inhibition of T cell activation but clinically relevant once and twice weekly dosing schedules that incorporate sufficient drug holidays allow for normal CD8 T cell functioning and development of anti-tumor immunity. PMID:28148714

  16. Depression of leukocyte protein synthesis, immune function and growth performance induced by high environmental temperature in broiler chickens

    Science.gov (United States)

    Kamel, Nancy N.; Ahmed, Ayman M. H.; Mehaisen, Gamal M. K.; Mashaly, Magdi M.; Abass, Ahmed O.

    2017-09-01

    In tropical and semitropical regions, raising broiler chickens out of their thermal comfort zone can cause an added economic loss in the poultry industry. The cause for the deleterious effects on immunity and growth performance of broilers under high environmental temperatures is still poorly understood. Therefore, the aim of the current investigation was to evaluate the effect of heat stress on leukocytes protein synthesis and immune function as a possible direct cause of low performance in broiler chickens under such condition. In this study, 300 one-day-old male broiler chicks (Cobb500™) were randomly assigned into 2 groups with 5 replicates of 30 chicks each. From 21 to 42 days of age, one group was exposed to non-stressed condition at 24 °C and 50% relative humidity (control group), while the other group was exposed to heat stress at 35 °C and 50% relative humidity (HS group). At 42 days of age, blood samples were collected from each group to evaluate stress indicators, immune function, and leukocytes protein synthesis. Production performance was also recorded. Noteworthy, protein synthesis in leukocytes was significantly ( P < 0.05) inhibited in HS group by 38% compared to control group. In contrast, the phosphorylation level on threonine 56 site (Thr56) of eukaryotic elongation factor (eEF2), which indicates the suppression of protein translation process through altering the protein elongation phase, was significantly threefold higher in HS group than in control ( P < 0.05). In addition, an increase in stress indicators was markedly ( P < 0.05) presented in the HS birds by twofold increase in heterophil/lymphocyte (H/L) ratio and threefold increase in plasma corticosterone level compared to control. Furthermore, the immune function was significantly ( P < 0.05) suppressed in HS birds than control (0.99 vs. 1.88 mg/mL plasma IgG, 89.2 vs. 148.0 μg/mL plasma IgM, 4.80 vs. 7.20 antibody titer against SRBC, and 1.38 vs. 3.39 stimulation index of lymphocyte

  17. Functional inhibition of UQCRB suppresses angiogenesis in zebrafish

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Yoon Sun; Jung, Hye Jin [Chemical Genomics National Research Laboratory, Department of Biotechnology, Translational Research Center for Protein Function Control, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of); Seok, Seung Hyeok [Department of Microbiology and Immunology, Institute for Experimental Animals, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of); Payumo, Alexander Y.; Chen, James K. [Department of Chemical and Systems Biology, Stanford University School of Medicine, Stanford, CA 94305 (United States); Kwon, Ho Jeong, E-mail: kwonhj@yonsei.ac.kr [Chemical Genomics National Research Laboratory, Department of Biotechnology, Translational Research Center for Protein Function Control, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of)

    2013-04-19

    Highlights: ► This is the first functional characterization of UQCRB in vivo model. ► Angiogenesis is inhibited with UQCRB loss of function in zebrafish. ► UQCRB is introduced as a prognostic marker for mitochondria- and angiogenesis-related diseases. -- Abstract: As a subunit of mitochondrial complex III, UQCRB plays an important role in complex III stability, electron transport, and cellular oxygen sensing. Herein, we report UQCRB function regarding angiogenesis in vivo with the zebrafish (Danio rerio). UQCRB knockdown inhibited angiogenesis in zebrafish leading to the suppression of VEGF expression. Moreover, the UQCRB-targeting small molecule terpestacin also inhibited angiogenesis and VEGF levels in zebrafish, supporting the role of UQCRB in angiogenesis. Collectively, UQCRB loss of function by either genetic and pharmacological means inhibited angiogenesis, indicating that UQCRB plays a key role in this process and can be a prognostic marker of angiogenesis- and mitochondria-related diseases.

  18. Functional inhibition of UQCRB suppresses angiogenesis in zebrafish

    International Nuclear Information System (INIS)

    Cho, Yoon Sun; Jung, Hye Jin; Seok, Seung Hyeok; Payumo, Alexander Y.; Chen, James K.; Kwon, Ho Jeong

    2013-01-01

    Highlights: ► This is the first functional characterization of UQCRB in vivo model. ► Angiogenesis is inhibited with UQCRB loss of function in zebrafish. ► UQCRB is introduced as a prognostic marker for mitochondria- and angiogenesis-related diseases. -- Abstract: As a subunit of mitochondrial complex III, UQCRB plays an important role in complex III stability, electron transport, and cellular oxygen sensing. Herein, we report UQCRB function regarding angiogenesis in vivo with the zebrafish (Danio rerio). UQCRB knockdown inhibited angiogenesis in zebrafish leading to the suppression of VEGF expression. Moreover, the UQCRB-targeting small molecule terpestacin also inhibited angiogenesis and VEGF levels in zebrafish, supporting the role of UQCRB in angiogenesis. Collectively, UQCRB loss of function by either genetic and pharmacological means inhibited angiogenesis, indicating that UQCRB plays a key role in this process and can be a prognostic marker of angiogenesis- and mitochondria-related diseases

  19. Effects of intensified training and taper on immune function

    Directory of Open Access Journals (Sweden)

    Elena Papacosta

    2013-03-01

    Full Text Available Although resting immune function is not very different in athletes compared with non-athletes periods of intensified training (overreaching in already well trained athletes can result in a depression of immunity in the resting state. Illness-prone athletes appear to have an altered cytokine response to antigen stimulation and exercise. Having low levels of salivary IgA secretion also makes athletes more susceptible to upper respiratory tract infections. Overtraining is associated with recurrent infections and immunodepression is common, but immune functions do not seem to be reliable markers of impending overtraining. There are several possible causes of the diminution of immune function associated with periods of heavy training. One mechanism may simply be the cumulative effects of repeated bouts of intense exercise (with or without tissue damage with the consequent elevation of stress hormones, particularly glucocorticoids such as cortisol, causing temporary inhibition of TH-1 cytokines with a relative dampening of the cell-mediated response. When exercise is repeated frequently there may not be sufficient time for the immune system to recover fully. Tapering has been described as a gradual reduction in the training load which allows the recovery of physiological capacities that were impaired by previous intensive training and permits further training-induced adaptations to occur accompanied by competition performance enhancements. The majority of the studies that have examined the recovery of immunoendocrine responses during 1-3 week tapers in trained athletes have mainly reported enhanced performance, often accompanied by increased anabolic activity, reduced physiological stress and restoration of mucosal immunity and immune function.Quando se compara a função imune, em repouso, de atletas e não atletas, não se verificam grandes diferenças. Porém, períodos de treinamento intensificado ("overreaching" em atletas bem treinados podem

  20. Transplantation of β-endorphin neurons into the hypothalamus promotes immune function and restricts the growth and metastasis of mammary carcinoma.

    Science.gov (United States)

    Sarkar, Dipak K; Zhang, Changqing; Murugan, Sengottuvelan; Dokur, Madhavi; Boyadjieva, Nadka I; Ortigüela, Maria; Reuhl, Kenneth R; Mojtehedzadeh, Sepide

    2011-10-01

    Neurobehavioral stress has been shown to promote tumor growth and progression and dampen the immune system. In this study, we investigated whether inhibiting stress hormone production could inhibit the development of mammary carcinoma and metastasis in a rat model of breast carcinogenesis. To enhance β-endorphin (BEP), the endogenous opioid polypeptide that boosts immune activity and decreases stress, we generated BEP neurons by in vitro differentiation from fetal neuronal stem cells and transplanted them into the hypothalami of rats subjected to breast carcinogenesis. BEP-transplanted rats displayed a reduction in mammary tumor incidence, growth, malignancy rate, and metastasis compared with cortical cells-transplanted rats. BEP neuron transplants also reduced inflammation and epithelial to mesenchymal transition in the tumor tissues. In addition, BEP neuron transplants increased peripheral natural killer (NK) cell and macrophage activities, elevated plasma levels of antiinflammatory cytokines, and reduced plasma levels of inflammatory cytokines. Antimetastatic effects along with stimulation of NK cells and macrophages could be reversed by treatment with the opiate antagonist naloxone, the β-receptor agonist metaproterenol, or the nicotine acetylcholine receptor antagonist methyllycaconitine. Together, our findings establish a protective role for BEP against the growth and metastasis of mammary tumor cells by altering autonomic nervous system activities that enhance innate immune function.

  1. The multitasking organ: recent insights into skin immune function.

    Science.gov (United States)

    Di Meglio, Paola; Perera, Gayathri K; Nestle, Frank O

    2011-12-23

    The skin provides the first line defense of the human body against injury and infection. By integrating recent findings in cutaneous immunology with fundamental concepts of skin biology, we portray the skin as a multitasking organ ensuring body homeostasis. Crosstalk between the skin and its microbial environment is also highlighted as influencing the response to injury, infection, and autoimmunity. The importance of the skin immune network is emphasized by the identification of several skin-resident cell subsets, each with its unique functions. Lessons learned from targeted therapy in inflammatory skin conditions, such as psoriasis, provide further insights into skin immune function. Finally, we look at the skin as an interacting network of immune signaling pathways exemplified by the development of a disease interactome for psoriasis. Copyright © 2011 Elsevier Inc. All rights reserved.

  2. IRAK-M regulation and function in host defense and immune homeostasis

    Directory of Open Access Journals (Sweden)

    Leah L.N. Hubbard

    2010-06-01

    Full Text Available Antigen presenting cells (APCs of the innate immune system sense a wide range of pathogens via pattern recognition receptors (PRRs. Engagement of certain PRRs can induce production of pro-inflammatory mediators that facilitate effective clearance of pathogen. Toll-like receptors (TLRs are a well described group of PRRs that belong to the TLR/Interleukin-1 receptor (IL-1R superfamily. However, TLR/IL-1R induction of pro-inflammatory mediators must be regulated to prevent excessive inflammation and tissue damage. One molecule of recent interest that is known to inhibit TLR/IL-1R signaling is interleukin-1 receptor associated kinase (IRAK-M, also known as IRAK-3. IRAK-M is expressed in a number of immune and epithelial cells types, and through its inhibition of pro-inflammatory cytokine production, IRAK-M can regulate immune homeostasis and tolerance in a number of infectious and non-infectious diseases. Furthermore, use of IRAK-M deficient animals has increased our understanding of the importance of IRAK-M in regulating immune responsiveness to a variety of pathogens. Although IRAK-M expression is typically induced through TLR signaling, IRAK-M can also be expressed in response to various endogenous and exogenous soluble factors as well as cell surface and intracellular signaling molecules. This review will focus on clinical scenarios in which expression of IRAK-M is beneficial (as in early sepsis and those situations where IRAK-M expression is harmful to the host (as in cancer and following bone marrow transplant. There is strong rationale for therapeutic targeting of IRAK-M for clinical benefit. However, effective targeting will require a greater understanding of the transcriptional regulation of this gene.

  3. The cytosolic exonuclease TREX1 inhibits the innate immune response to HIV-1

    Science.gov (United States)

    Yan, Nan; Regalado-Magdos, Ashton D.; Stiggelbout, Bart; Lee-Kirsch, Min Ae; Lieberman, Judy

    2010-01-01

    Viral infection triggers innate immune sensors to produce type I interferons (IFN). However, HIV infection of T cells and macrophages does not trip these alarms. How HIV avoids activating nucleic acid sensors is unknown. The cytosolic exonuclease TREX1 suppressed IFN triggered by HIV. In Trex1−/− mouse cells and human CD4+ T cells and macrophages in which TREX1 was inhibited by RNA interference, cytosolic HIV DNA accumulated, and HIV infection induced type I IFN that inhibited HIV replication and spreading. TREX1 bound to cytosolic HIV DNA and digested excess HIV DNA that would otherwise activate IFN expression via a TBK1, STING and IRF3 dependent pathway. HIV-stimulated IFN production in cells deficient in TREX1 did not involve known nucleic acid sensors. PMID:20871604

  4. Inhibition of Langerhans cell maturation by human papillomavirus type 16: a novel role for the annexin A2 heterotetramer in immune suppression1

    Science.gov (United States)

    Woodham, Andrew W.; Raff, Adam B.; Raff, Laura M.; Da Silva, Diane M.; Yan, Lisa; Skeate, Joseph G.; Wong, Michael K.; Lin, Yvonne G.; Kast, W. Martin

    2014-01-01

    High-risk human papillomaviruses (HPV) are sexually transmitted viruses causally associated with several cancers. During its natural life cycle, HPV16, the most common high-risk genotype, infects the epithelial basal cellsin a process facilitated through a recently identified receptor, the annexin A2 heterotetramer (A2t). During infection, HPV16 also interacts with Langerhans cells (LC), the antigen presenting cells of the epithelium, inducing immune suppression, which is mediated by the HPV16 L2 minor capsid protein. Despite the importance of these virus-immune cell interactions, the specific mechanisms of HPV16 entry into LC and HPV16-induced immune suppression remain undefined. An N-terminal peptide of HPV16 L2 (aa 108-126) has been shown to specifically interact with A2t. Here, we show that incubation of human LC with this peptide blocks binding of HPV16. Inhibiting this interaction with an A2t ligand or by siRNA downregulation of A2t, significantly decreases HPV16 internalization into LC in an L2-dependent manner. A2t is associated with suppression of LC maturation as demonstrated through attenuated secretion of Th1-associated cytokines and decreased surface expression of MHC II on LC exposed to A2t. Conversely, small molecule inhibition of A2t prevents HPV16-induced suppression of LC immune function as indicated by significantly increased secretion of inflammatory cytokines and surface expression of CD86 in HPV16 treated LC pre-exposed to A2t inhibitors. These results demonstrate that HPV16 suppresses LC maturation through an interaction with A2t, revealing a novel role for this protein. PMID:24719459

  5. Filoviral Immune Evasion Mechanisms

    Directory of Open Access Journals (Sweden)

    Christopher F. Basler

    2011-09-01

    Full Text Available The Filoviridae family of viruses, which includes the genera Ebolavirus (EBOV and Marburgvirus (MARV, causes severe and often times lethal hemorrhagic fever in humans. Filoviral infections are associated with ineffective innate antiviral responses as a result of virally encoded immune antagonists, which render the host incapable of mounting effective innate or adaptive immune responses. The Type I interferon (IFN response is critical for establishing an antiviral state in the host cell and subsequent activation of the adaptive immune responses. Several filoviral encoded components target Type I IFN responses, and this innate immune suppression is important for viral replication and pathogenesis. For example, EBOV VP35 inhibits the phosphorylation of IRF-3/7 by the TBK-1/IKKε kinases in addition to sequestering viral RNA from detection by RIG-I like receptors. MARV VP40 inhibits STAT1/2 phosphorylation by inhibiting the JAK family kinases. EBOV VP24 inhibits nuclear translocation of activated STAT1 by karyopherin-α. The examples also represent distinct mechanisms utilized by filoviral proteins in order to counter immune responses, which results in limited IFN-α/β production and downstream signaling.

  6. Neutrophil degranulation and immunosuppression in patients with GBM: restoration of cellular immune function by targeting arginase I.

    Science.gov (United States)

    Sippel, Trisha R; White, Jason; Nag, Kamalika; Tsvankin, Vadim; Klaassen, Marci; Kleinschmidt-DeMasters, B K; Waziri, Allen

    2011-11-15

    The source of glioblastoma (GBM)-associated immunosuppression remains multifactorial. We sought to clarify and therapeutically target myeloid cell-derived peripheral immunosuppression in patients with GBM. Direct ex vivo T-cell function, serum Arginase I (ArgI) levels, and circulating myeloid lineage populations were compared between patients with GBM and normal donors or patients with other intracranial tumors. Immunofunctional assays were conducted using bulk and sorted cell populations to explore the potential transfer of myeloid cell-mediated immunosuppression and to identify a potential mechanism for these effects. ArgI-mediated immunosuppression was therapeutically targeted in vitro through pharmacologic inhibition or arginine supplementation. We identified a significantly expanded population of circulating, degranulated neutrophils associated with elevated levels of serum ArgI and decreased T-cell CD3ζ expression within peripheral blood from patients with GBM. Sorted CD11b(+) cells from patients with GBM were found to markedly suppress normal donor T-cell function in coculture, and media harvested from mitogen-stimulated GBM peripheral blood mononuclear cell (PBMC) or GBM-associated mixed lymphoid reactions showed ArgI levels that were significantly higher than controls. Critically, T-cell suppression in both settings could be completely reversed through pharmacologic ArgI inhibition or with arginine supplementation. These data indicate that peripheral cellular immunosuppression in patients with GBM is associated with neutrophil degranulation and elevated levels of circulating ArgI, and that T-cell function can be restored in these individuals by targeting ArgI. These data identify a novel pathway of GBM-mediated suppression of cellular immunity and offer a potential therapeutic window for improving antitumor immunity in affected patients.

  7. Strategies to enhance immune function for marathon runners : what can be done?

    DEFF Research Database (Denmark)

    Åkerström, Thorbjörn; Pedersen, Bente K

    2007-01-01

    immune cells. During this period of immune suppression, by some referred to as an 'open window' in immune function, it has been hypothesised that viruses and bacteria might gain a foothold, which would increase the risk of infections. In light of this, nutritional interventions that can enhance immune...

  8. Systematic identification of anti-interferon function on hepatitis C virus genome reveals p7 as an immune evasion protein.

    Science.gov (United States)

    Qi, Hangfei; Chu, Virginia; Wu, Nicholas C; Chen, Zugen; Truong, Shawna; Brar, Gurpreet; Su, Sheng-Yao; Du, Yushen; Arumugaswami, Vaithilingaraja; Olson, C Anders; Chen, Shu-Hua; Lin, Chung-Yen; Wu, Ting-Ting; Sun, Ren

    2017-02-21

    Hepatitis C virus (HCV) encodes mechanisms to evade the multilayered antiviral actions of the host immune system. Great progress has been made in elucidating the strategies HCV employs to down-regulate interferon (IFN) production, impede IFN signaling transduction, and impair IFN-stimulated gene (ISG) expression. However, there is a limited understanding of the mechanisms governing how viral proteins counteract the antiviral functions of downstream IFN effectors due to the lack of an efficient approach to identify such interactions systematically. To study the mechanisms by which HCV antagonizes the IFN responses, we have developed a high-throughput profiling platform that enables mapping of HCV sequences critical for anti-IFN function at high resolution. Genome-wide profiling performed with a 15-nt insertion mutant library of HCV showed that mutations in the p7 region conferred high levels of IFN sensitivity, which could be alleviated by the expression of WT p7 protein. This finding suggests that p7 protein of HCV has an immune evasion function. By screening a liver-specific ISG library, we identified that IFI6-16 significantly inhibits the replication of p7 mutant viruses without affecting WT virus replication. In contrast, knockout of IFI6-16 reversed the IFN hypersensitivity of p7 mutant virus. In addition, p7 was found to be coimmunoprecipitated with IFI6-16 and to counteract the function of IFI6-16 by depolarizing the mitochondria potential. Our data suggest that p7 is a critical immune evasion protein that suppresses the antiviral IFN function by counteracting the function of IFI6-16.

  9. Trade-off between growth and immune function : a meta-analysis of selection experiments

    NARCIS (Netherlands)

    van der Most, Peter; de Jong, Berber; Parmentier, Henk K.; Verhulst, Simon

    P>1. Evidence suggests that developing and maintaining an effective immune system may be costly and that an organism has to make a trade-off between immune function and other fitness-enhancing traits. To test for a trade-off between growth and immune function we carried out a meta-analysis of data

  10. Immunomodulator, immunosuppression of radiation and immune reconstruction

    International Nuclear Information System (INIS)

    Mao Jianping; Fang Jing; Zhou Ying; Cui Yufang; Jiang Zhujun; Du Li; Ma Qiong

    2010-01-01

    There is a refined and complicated regulatory network between immune cells, and between immune cells and secretory factors. The immune system is kept in a homeostasis and equilibrium by positive activation and negative inhibition. In recent years, the mechanisms of immunosuppression in depth for successful allograft transplantation were studied, and many immunosuppressants and immunosuppressive drugs have been developed for clinical use. Most of them are targeting T cell receptors and three kinds of singnal pathways. The receptors of the immunosuppression were either found highly expressed in immune cells after irradiation. To relieve the suppression by regulating the receptors could help the immune reconstruction out of radiation damage. Many new immunoenhancers have been discovered to improve the immune system function for radiation by Toll-like receptors. The search for new immunoenhancers and agents for relieving immunosuppression is of great importance to immune construction for radiation sickness. (authors)

  11. Clinical Dosing Regimen of Selinexor Maintains Normal Immune Homeostasis and T-cell Effector Function in Mice: Implications for Combination with Immunotherapy.

    Science.gov (United States)

    Tyler, Paul M; Servos, Mariah M; de Vries, Romy C; Klebanov, Boris; Kashyap, Trinayan; Sacham, Sharon; Landesman, Yosef; Dougan, Michael; Dougan, Stephanie K

    2017-03-01

    Selinexor (KPT-330) is a first-in-class nuclear transport inhibitor currently in clinical trials as an anticancer agent. To determine how selinexor might affect antitumor immunity, we analyzed immune homeostasis in mice treated with selinexor and found disruptions in T-cell development, a progressive loss of CD8 T cells, and increases in inflammatory monocytes. Antibody production in response to immunization was mostly normal. Precursor populations in bone marrow and thymus were unaffected by selinexor, suggesting that normal immune homeostasis could recover. We found that a high dose of selinexor given once per week preserved nearly normal immune functioning, whereas a lower dose given 3 times per week did not restore immune homeostasis. Both naïve and effector CD8 T cells cultured in vitro showed impaired activation in the presence of selinexor. These experiments suggest that nuclear exportins are required for T-cell development and function. We determined the minimum concentration of selinexor required to block T-cell activation and showed that T-cell-inhibitory effects of selinexor occur at levels above 100 nmol/L, corresponding to the first 24 hours post-oral dosing. In a model of implantable melanoma, selinexor treatment at 10 mg/kg with a 4-day drug holiday led to intratumoral IFNγ + , granzyme B + cytotoxic CD8 T cells that were comparable with vehicle-treated mice. Overall, selinexor treatment leads to transient inhibition of T-cell activation, but clinically relevant once and twice weekly dosing schedules that incorporate sufficient drug holidays allow for normal CD8 T-cell functioning and development of antitumor immunity. Mol Cancer Ther; 16(3); 428-39. ©2017 AACR See related article by Farren et al., p. 417 . ©2017 American Association for Cancer Research.

  12. Inhibition of NF-κB in Tumor Cells Exacerbates Immune Cell Activation Following Photodynamic Therapy

    Science.gov (United States)

    Broekgaarden, Mans; Kos, Milan; Jurg, Freek A.; van Beek, Adriaan A.; van Gulik, Thomas M.; Heger, Michal

    2015-01-01

    Although photodynamic therapy (PDT) yields very good outcomes in numerous types of superficial solid cancers, some tumors respond suboptimally to PDT. Novel treatment strategies are therefore needed to enhance the efficacy in these therapy-resistant tumors. One of these strategies is to combine PDT with inhibitors of PDT-induced survival pathways. In this respect, the transcription factor nuclear factor κB (NF-κB) has been identified as a potential pharmacological target, albeit inhibition of NF-κB may concurrently dampen the subsequent anti-tumor immune response required for complete tumor eradication and abscopal effects. In contrast to these postulations, this study demonstrated that siRNA knockdown of NF-κB in murine breast carcinoma (EMT-6) cells increased survival signaling in these cells and exacerbated the inflammatory response in murine RAW 264.7 macrophages. These results suggest a pro-death and immunosuppressive role of NF-κB in PDT-treated cells that concurs with a hyperstimulated immune response in innate immune cells. PMID:26307977

  13. Loss of renal function causes premature aging of the immune system.

    Science.gov (United States)

    Betjes, Michiel G H; Meijers, Ruud W J; Litjens, Nicolle H R

    2013-01-01

    Uremia-associated immune deficiency is a well-known complication of loss of renal function and contributes significantly to the overall mortality and morbidity of patients with end-stage renal disease. Chronic inflammation and increased oxidative stress are underlying the uremia-associated immune deficiency. In this review, the differential impact of uremia on the cellular immune system is summarized. Virtually all immune cells studied show a combination of an activated status and loss of function. However, uremia preferentially decreases the number and function of lymphoid cells while myeloid cells show normal and/or elevated cell numbers with increased production of inflammatory cytokines and reactive oxygen species. These particular changes are compatible with immunological aging, which is characterized by loss of thymic function, attrition of telomeres and an expanded memory T cell population. Similar to aging in healthy individuals, the proinflammatory and potential cardiotoxic subsets of CD28(null) T cells and CD16(+) monocytes are increased. Epigenetically changed hematopoietic stem cells may be involved in immunological aging as specific DNA regions become hypermethylated. Proinflammatory T cells and monocytes persist after kidney transplantation, which constitutes a persistent cardiovascular risk factor. Possible therapeutic options to reverse or halt uremia-associated immunological aging are discussed. Premature aging of the immune system is a dominant feature in patients with end-stage renal failure, which corresponds to immunological aging in elderly healthy individuals, which is characterized by preferential loss of cells belonging to the lymphoid cell lineage, inflammation and expansion of proinflammatory immune cells. © 2013 S. Karger AG, Basel.

  14. Sleep and immune function: glial contributions and consequences of aging.

    Science.gov (United States)

    Ingiosi, Ashley M; Opp, Mark R; Krueger, James M

    2013-10-01

    The reciprocal interactions between sleep and immune function are well-studied. Insufficient sleep induces innate immune responses as evidenced by increased expression of pro-inflammatory mediators in the brain and periphery. Conversely, immune challenges upregulate immunomodulator expression, which alters central nervous system-mediated processes and behaviors, including sleep. Recent studies indicate that glial cells, namely microglia and astrocytes, are active contributors to sleep and immune system interactions. Evidence suggests glial regulation of these interactions is mediated, in part, by adenosine and adenosine 5'-triphosphate actions at purinergic type 1 and type 2 receptors. Furthermore, microglia and astrocytes may modulate declines in sleep-wake behavior and immunity observed in aging. Copyright © 2013. Published by Elsevier Ltd.

  15. Strain-specific Plasmodium falciparum growth inhibition among Malian children immunized with a blood-stage malaria vaccine.

    Directory of Open Access Journals (Sweden)

    Matthew B Laurens

    Full Text Available The blood-stage malaria vaccine FMP2.1/AS02A, comprised of recombinant Plasmodium falciparum apical membrane antigen 1 (AMA1 and the adjuvant system AS02A, had strain-specific efficacy against clinical malaria caused by P. falciparum with the vaccine strain 3D7 AMA1 sequence. To evaluate a potential correlate of protection, we measured the ability of participant sera to inhibit growth of 3D7 and FVO strains in vitro using high-throughput growth inhibition assay (GIA testing. Sera from 400 children randomized to receive either malaria vaccine or a control rabies vaccine were assessed at baseline and over two annual malaria transmission seasons after immunization. Baseline GIA against vaccine strain 3D7 and FVO strain was similar in both groups, but more children in the malaria vaccine group than in the control group had 3D7 and FVO GIA activity ≥15% 30 days after the last vaccination (day 90 (49% vs. 16%, p<0.0001; and 71.8% vs. 60.4%, p = 0.02. From baseline to day 90, 3D7 GIA in the vaccine group was 7.4 times the mean increase in the control group (p<0.0001. In AMA1 vaccinees, 3D7 GIA activity subsequently returned to baseline one year after vaccination (day 364 and did not correlate with efficacy in the extended efficacy time period to day 730. In Cox proportional hazards regression models with time-varying covariates, there was a slight suggestion of an association between 3D7 GIA activity and increased risk of clinical malaria between day 90 and day 240. We conclude that vaccination with this AMA1-based malaria vaccine increased inhibition of parasite growth, but this increase was not associated with allele-specific efficacy in the first malaria season. These results provide a framework for testing functional immune correlates of protection against clinical malaria in field trials, and will help to guide similar analyses for next-generation malaria vaccines. Clinical trials registry: This clinical trial was registered on clinicaltrials

  16. Development of Functional Foods and Advanced Technology for Radioprotection

    International Nuclear Information System (INIS)

    Jo, Sung Kee; Byun, Myung Woo; Kim, Jin Kyu

    2003-05-01

    We have previously developed two medicinal herb mixtures that protects immune/hematopoietic system and self-renewal tissues against irradiation and enhances immune/hematopoietic functions. In this study, we have developed two pilot products by adding the effective fractions to the hot water extract of the herb mixtures and investigated their efficacy. In irradiated mice, pilot products protected hematopoietic stem cells, promoted the regeneration and activation of immune cells, normalized the unbalanced immune reaction, and inhibited the growth of cancer cells. Polysaccharide was active fraction and mechanisms were elucidated. The products also protected the stem cells in self-renewal tissues. DNA/membrane damages, apoptotic cell signals, chromosome/DNA alterations, and oxidation of protein/lipid were inhibited by pilot products, and their radical scavenging activities were observed. Five active components were isolated and identified. Pilot products also inhibited the cancer development by 30% in irradiated mice. In clinical investigation, pilot products inhibited the side-effects of cancer therapy including immune/hematopoietic depression. Therefore, the pilot products may be used as functional foods for overcoming of immune/hematopoietic depression and self-renewal tissue damages induced by irradiation, as well as for the immune/hematopoietic enhancement. Also we have screened food materials for inhibition of radiation-induced chronic damage (carcinogenesis), and selected effective 4 materials and elicited two mixture preparations with enhanced activity, and confirmed their inhibitory activities in cancer initiation model systems. To obtain the applicability of radiation technology for the safe sanitation and distribution of functional food materials, we verified the toxicological safety, stability of activity and active components of irradiated medicinal herbs. Also, screening of new radioprotective materials and basic biological research for the enhancement of

  17. Estradiol and Progesterone Strongly Inhibit the Innate Immune Response of Mononuclear Cells in Newborns ▿

    Science.gov (United States)

    Giannoni, Eric; Guignard, Laurence; Knaup Reymond, Marlies; Perreau, Matthieu; Roth-Kleiner, Matthias; Calandra, Thierry; Roger, Thierry

    2011-01-01

    Newborns are particularly susceptible to bacterial infections due to qualitative and quantitative deficiencies of the neonatal innate immune system. However, the mechanisms underlying these deficiencies are poorly understood. Given that fetuses are exposed to high concentrations of estradiol and progesterone during gestation and at time of delivery, we analyzed the effects of these hormones on the response of neonatal innate immune cells to endotoxin, bacterial lipopeptide, and Escherichia coli and group B Streptococcus, the two most common causes of early-onset neonatal sepsis. Here we show that at concentrations present in umbilical cord blood, estradiol and progesterone are as powerful as hydrocortisone for inhibition of cytokine production by cord blood mononuclear cells (CBMCs) and newborn monocytes. Interestingly, CBMCs and newborn monocytes are more sensitive to the effects of estradiol and progesterone than adult peripheral blood mononuclear cells and monocytes. This increased sensitivity is associated with higher expression levels of estrogen and membrane progesterone receptors but is independent of a downregulation of Toll-like receptor 2 (TLR2), TLR4, and myeloid differentiation primary response gene 88 in newborn cells. Estradiol and progesterone mediate their anti-inflammatory activity through inhibition of the NF-κB pathway but not the mitogen-activated protein kinase pathway in CBMCs. Altogether, these results suggest that elevated umbilical cord blood concentrations of estradiol and progesterone acting on mononuclear cells expressing high levels of steroid receptors contribute to impair innate immune responses in newborns. Therefore, intrauterine exposure to estradiol and progesterone may participate in increasing susceptibility to infection during the neonatal period. PMID:21518785

  18. In-Situ Monitoring of Immune Function, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — Monitoring the health and wellness of mission pilots is a critically important function. Space flight has an adverse effect on the human immune response. During...

  19. Tanshinone IIA attenuates neuropathic pain via inhibiting glial activation and immune response.

    Science.gov (United States)

    Cao, Fa-Le; Xu, Min; Wang, Yan; Gong, Ke-Rui; Zhang, Jin-Tao

    2015-01-01

    Neuropathic pain, characterized by spontaneous pain, hyperalgesia and allodynia, is a devastating neurological disease that seriously affects patients' quality of life. We have previously shown that tanshinone IIA (TIIA), an important lipophilic component of Danshen, had significant anti-nociceptive effect in somatic and visceral pain, it is surprisingly noted that few pharmacological studies have been carried out to explore the possible analgesic action of TIIA on neuropathic pain and the underlying mechanisms. Therefore, in the present study, by using spinal nerve ligation (SNL) pain model, the antinociceptive and antihyperalgesic effects of TIIA on neuropathic pain were evaluated by intraperitoneal administration in rats. The results indicated that TIIA dose-dependently inhibited SNL-induced mechanical hyperalgesia. As revealed by OX42 levels, TIIA effectively repressed the activation of spinal microglial activation in SNL-induced neuropathic pain. Meanwhile, TIIA also decreased the expressions of inflammatory cytokines TNF-α and IL-1β in the spinal cord. Furthermore, TIIA inhibited oxidative stress by significantly rescuing the superoxide dismutase (SOD) activity and decreasing the malondialdehyde (MDA). Moreover, TIIA depressed SNL-induced MAPKs activation in spinal cord. Taken together, our study provides evidence that TIIA inhibited SNL-induced neuropathic pain through depressing microglial activation and immune response by the inhibition of mitogen-activated protein kinases (MAPKs) pathways. Our findings suggest that TIIA might be a promising agent in the treatment of neuropathic pain. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Functional comparison of innate immune signaling pathways in primates.

    Directory of Open Access Journals (Sweden)

    Luis B Barreiro

    2010-12-01

    Full Text Available Humans respond differently than other primates to a large number of infections. Differences in susceptibility to infectious agents between humans and other primates are probably due to inter-species differences in immune response to infection. Consistent with that notion, genes involved in immunity-related processes are strongly enriched among recent targets of positive selection in primates, suggesting that immune responses evolve rapidly, yet providing only indirect evidence for possible inter-species functional differences. To directly compare immune responses among primates, we stimulated primary monocytes from humans, chimpanzees, and rhesus macaques with lipopolysaccharide (LPS and studied the ensuing time-course regulatory responses. We find that, while the universal Toll-like receptor response is mostly conserved across primates, the regulatory response associated with viral infections is often lineage-specific, probably reflecting rapid host-virus mutual adaptation cycles. Additionally, human-specific immune responses are enriched for genes involved in apoptosis, as well as for genes associated with cancer and with susceptibility to infectious diseases or immune-related disorders. Finally, we find that chimpanzee-specific immune signaling pathways are enriched for HIV-interacting genes. Put together, our observations lend strong support to the notion that lineage-specific immune responses may help explain known inter-species differences in susceptibility to infectious diseases.

  1. Ex vivo cytosolic delivery of functional macromolecules to immune cells.

    Directory of Open Access Journals (Sweden)

    Armon Sharei

    Full Text Available Intracellular delivery of biomolecules, such as proteins and siRNAs, into primary immune cells, especially resting lymphocytes, is a challenge. Here we describe the design and testing of microfluidic intracellular delivery systems that cause temporary membrane disruption by rapid mechanical deformation of human and mouse immune cells. Dextran, antibody and siRNA delivery performance is measured in multiple immune cell types and the approach's potential to engineer cell function is demonstrated in HIV infection studies.

  2. Immune activation is associated with decreased thymic function in ...

    African Journals Online (AJOL)

    Background: Reduced thymic function causes poor immunological reconstitution in human immunodeficiency virus (HIV)-positive patients on combined antiretroviral therapy (cART). The association between immune activation and thymic function in asymptomatic HIVpositive treatment-naive individuals has thus far not been ...

  3. Diverse novel functions of neutrophils in immunity, inflammation, and beyond.

    Science.gov (United States)

    Mócsai, Attila

    2013-07-01

    Neutrophils have long been considered simple suicide killers at the bottom of the hierarchy of the immune response. That view began to change 10-20 yr ago, when the sophisticated mechanisms behind how neutrophils locate and eliminate pathogens and regulate immunity and inflammation were discovered. The last few years witnessed a new wave of discoveries about additional novel and unexpected functions of these cells. Neutrophils have been proposed to participate in protection against intracellular pathogens such as viruses and mycobacteria. They have been shown to intimately shape the adaptive immune response at various levels, including marginal zone B cells, plasmacytoid dendritic cells and T cell populations, and even to control NK cell homeostasis. Neutrophils have been shown to mediate an alternative pathway of systemic anaphylaxis and to participate in allergic skin reactions. Finally, neutrophils were found to be involved in physiological and pathological processes beyond the immune system, such as diabetes, atherosclerosis, and thrombus formation. Many of those functions appear to be related to their unique ability to release neutrophil extracellular traps even in the absence of pathogens. This review summarizes those novel findings on versatile functions of neutrophils and how they change our view of neutrophil biology in health and disease.

  4. Low Dose Ionizing Radiation Modulates Immune Function

    International Nuclear Information System (INIS)

    Nelson, Gregory A.

    2016-01-01

    In order to examine the effects of low dose ionizing radiation on the immune system we chose to examine an amplified adaptive cellular immunity response. This response is Type IV delayed-type hypersensitivity also called contact hypersensitivity. The agent fluorescein isothiocyanate (FITC) is a low molecular weight, lipophilic, reactive, fluorescent molecule that can be applied to the skin where it (hapten) reacts with proteins (carriers) to become a complete antigen. Exposure to FITC leads to sensitization which is easily measured as a hypersensitivity inflammatory reaction following a subsequent exposure to the ear. Ear swelling, eosinophil infiltration, immunoglobulin E production and cytokine secretion patterns characteristic of a 'Th2 polarized' immune response are the components of the reaction. The reaction requires successful implementation of antigen processing and presentation by antigen presenting Langerhans cells, communication with naïve T lymphocytes in draining lymph nodes, expansion of activated T cell clones, migration of activated T cells to the circulation, and recruitment of memory T cells, macrophages and eosinophils to the site of the secondary challenge. Using this model our approach was to quantify system function rather than relying only on indirect biomarkers of cell. We measured the FITC-induced hypersensitivity reaction over a range of doses from 2 cGy to 2 Gy. Irradiations were performed during key events or prior to key events to deplete critical cell populations. In addition to quantifying the final inflammatory response, we assessed cell populations in peripheral blood and spleen, cytokine signatures, IgE levels and expression of genes associated with key processes in sensitization and elicitation/recall. We hypothesized that ionizing radiation would produce a biphasic effect on immune system function resulting in an enhancement at low doses and a depression at higher doses and suggested that this transition would occur in

  5. Low Dose Ionizing Radiation Modulates Immune Function

    Energy Technology Data Exchange (ETDEWEB)

    Nelson, Gregory A. [Loma Linda Univ., CA (United States)

    2016-01-12

    In order to examine the effects of low dose ionizing radiation on the immune system we chose to examine an amplified adaptive cellular immunity response. This response is Type IV delayed-type hypersensitivity also called contact hypersensitivity. The agent fluorescein isothiocyanate (FITC) is a low molecular weight, lipophilic, reactive, fluorescent molecule that can be applied to the skin where it (hapten) reacts with proteins (carriers) to become a complete antigen. Exposure to FITC leads to sensitization which is easily measured as a hypersensitivity inflammatory reaction following a subsequent exposure to the ear. Ear swelling, eosinophil infiltration, immunoglobulin E production and cytokine secretion patterns characteristic of a “Th2 polarized” immune response are the components of the reaction. The reaction requires successful implementation of antigen processing and presentation by antigen presenting Langerhans cells, communication with naïve T lymphocytes in draining lymph nodes, expansion of activated T cell clones, migration of activated T cells to the circulation, and recruitment of memory T cells, macrophages and eosinophils to the site of the secondary challenge. Using this model our approach was to quantify system function rather than relying only on indirect biomarkers of cell. We measured the FITC-induced hypersensitivity reaction over a range of doses from 2 cGy to 2 Gy. Irradiations were performed during key events or prior to key events to deplete critical cell populations. In addition to quantifying the final inflammatory response, we assessed cell populations in peripheral blood and spleen, cytokine signatures, IgE levels and expression of genes associated with key processes in sensitization and elicitation/recall. We hypothesized that ionizing radiation would produce a biphasic effect on immune system function resulting in an enhancement at low doses and a depression at higher doses and suggested that this transition would occur in the

  6. Influence of Physical Activity and Nutrition on Obesity-Related Immune Function

    Directory of Open Access Journals (Sweden)

    Chun-Jung Huang

    2013-01-01

    Full Text Available Research examining immune function during obesity suggests that excessive adiposity is linked to impaired immune responses leading to pathology. The deleterious effects of obesity on immunity have been associated with the systemic proinflammatory profile generated by the secretory molecules derived from adipose cells. These include inflammatory peptides, such as TNF-α, CRP, and IL-6. Consequently, obesity is now characterized as a state of chronic low-grade systemic inflammation, a condition considerably linked to the development of comorbidity. Given the critical role of adipose tissue in the inflammatory process, especially in obese individuals, it becomes an important clinical objective to identify lifestyle factors that may affect the obesity-immune system relationship. For instance, stress, physical activity, and nutrition have each shown to be a significant lifestyle factor influencing the inflammatory profile associated with the state of obesity. Therefore, the purpose of this review is to comprehensively evaluate the impact of lifestyle factors, in particular psychological stress, physical activity, and nutrition, on obesity-related immune function with specific focus on inflammation.

  7. Immune Checkpoint Function of CD85j in CD8 T Cell Differentiation and Aging

    Directory of Open Access Journals (Sweden)

    Claire E. Gustafson

    2017-06-01

    Full Text Available Aging is associated with an increased susceptibility to infection and a failure to control latent viruses thought to be driven, at least in part, by alterations in CD8 T cell function. The aging T cell repertoire is characterized by an accumulation of effector CD8 T cells, many of which express the negative regulatory receptor CD85j. To define the biological significance of CD85j expression on CD8 T cells and to address the question whether presence of CD85j in older individuals is beneficial or detrimental for immune function, we examined the specific attributes of CD8 T cells expressing CD85j as well as the functional role of CD85j in antigen-specific CD8 T cell responses during immune aging. Here, we show that CD85j is mainly expressed by terminally differentiated effector (TEMRAs CD8 T cells, which increase with age, in cytomegalovirus (CMV infection and in males. CD85j+ CMV-specific cells demonstrate clonal expansion. However, TCR diversity is similar between CD85j+ and CD85j− compartments, suggesting that CD85j does not directly impact the repertoire of antigen-specific cells. Further phenotypic and functional analyses revealed that CD85j identifies a specific subset of CMV-responsive CD8 T cells that coexpress a marker of senescence (CD57 but retain polyfunctional cytokine production and expression of cytotoxic mediators. Blocking CD85j binding enhanced proliferation of CMV-specific CD8 T cells upon antigen stimulation but did not alter polyfunctional cytokine production. Taken together, these data demonstrate that CD85j characterizes a population of “senescent,” but not exhausted antigen-specific effector CD8 T cells and indicates that CD85j is an important checkpoint regulator controlling expansion of virus-specific T cells during aging. Inhibition of CD85j activity may be a mechanism to promote stronger CD8 T cell effector responses during immune aging.

  8. Behavioural conditioning of immune functions: how the central nervous system controls peripheral immune responses by evoking associative learning processes.

    Science.gov (United States)

    Riether, Carsten; Doenlen, Raphaël; Pacheco-López, Gustavo; Niemi, Maj-Britt; Engler, Andrea; Engler, Harald; Schedlowski, Manfred

    2008-01-01

    During the last 30 years of psychoneuroimmunology research the intense bi-directional communication between the central nervous system (CNS) and the immune system has been demonstrated in studies on the interaction between the nervous-endocrine-immune systems. One of the most intriguing examples of such interaction is the capability of the CNS to associate an immune status with specific environmental stimuli. In this review, we systematically summarize experimental evidence demonstrating the behavioural conditioning of peripheral immune functions. In particular, we focus on the mechanisms underlying the behavioural conditioning process and provide a theoretical framework that indicates the potential feasibility of behaviourally conditioned immune changes in clinical situations.

  9. Primary immune system responders to nucleus pulposus cells: evidence for immune response in disc herniation

    Directory of Open Access Journals (Sweden)

    K Murai

    2010-01-01

    Full Text Available Although intervertebral disc herniation and associated sciatica is a common disease, its molecular pathogenesis is not well understood. Immune responses are thought to be involved. This study provides direct evidence that even non-degenerated nucleus pulposus (NP cells elicit immune responses. An in vitro colony forming inhibition assay demonstrated the suppressive effects of autologous spleen cells on NP cells and an in vitro cytotoxicity assay showed the positive cytotoxic effects of natural killer (NK cells and macrophages on NP cells. Non-degenerated rat NP tissues transplanted into wild type rats and immune-deficient mice demonstrated a significantly higher NP cell survival rate in immune-deficient mice. Immunohistochemical staining showed the presence of macrophages and NK cells in the transplanted NP tissues. These results suggest that even non-degenerated autologous NP cells are recognized by macrophages and NK cells, which may have an immunological function in the early phase of disc herniation. These findings contribute to understanding resorption and the inflammatory reaction to disc herniation.

  10. Incubation period and immune function: A comparative field study among coexisting birds

    Science.gov (United States)

    Palacios, M.G.; Martin, T.E.

    2006-01-01

    Developmental periods are integral components of life history strategies that can have important fitness consequences and vary enormously among organisms. However, the selection pressures and mechanisms causing variation in length of developmental periods are poorly understood. Particularly puzzling are prolonged developmental periods, because their selective advantage is unclear. Here we tested the hypotheses that immune function is stronger in species that are attacked at a higher rate by parasites and that prolonged embryonic development allows the development of this stronger immune system. Through a comparative field study among 12 coexisting passerine bird species, we show that species with higher blood parasite prevalence mounted stronger cellular immune responses than species with lower prevalence. These results provide support for the hypothesis that species facing greater selection pressure from parasites invest more in immune function. However, species with longer incubation periods mounted weaker cellular immune responses than species with shorter periods. Therefore, cellular immune responses do not support the hypothesis that longer development time enhances immunocompentence. Future studies should assess other components of the immune system and test alternative causes of variation in incubation periods among bird species. ?? Springer-Verlag 2005.

  11. IL-17 suppresses immune effector functions in human papillomavirus-associated epithelial hyperplasia.

    Science.gov (United States)

    Gosmann, Christina; Mattarollo, Stephen R; Bridge, Jennifer A; Frazer, Ian H; Blumenthal, Antje

    2014-09-01

    Persistent infection with high-risk human papillomaviruses (HPV) causes epithelial hyperplasia that can progress to cancer and is thought to depend on immunosuppressive mechanisms that prevent viral clearance by the host. IL-17 is a cytokine with diverse functions in host defense and in the pathology of autoimmune disorders, chronic inflammatory diseases, and cancer. We analyzed biopsies from patients with HPV-associated cervical intraepithelial neoplasia grade 2/3 and murine skin displaying HPV16 E7 protein-induced epithelial hyperplasia, which closely models hyperplasia in chronic HPV lesions. Expression of IL-17 and IL-23, a major inducer of IL-17, was elevated in both human HPV-infected and murine E7-expressing lesions. Using a skin-grafting model, we demonstrated that IL-17 in HPV16 E7 transgenic skin grafts inhibited effective host immune responses against the graft. IL-17 was produced by CD3(+) T cells, predominantly CD4(+) T cells in human, and CD4(+) and γδ T cells in mouse hyperplastic lesions. IL-23 and IL-1β, but not IL-18, induced IL-17 production in E7 transgenic skin. Together, these findings demonstrate an immunosuppressive role for IL-17 in HPV-associated epithelial hyperplasia and suggest that blocking IL-17 in persistent viral infection may promote antiviral immunity and prevent progression to cancer. Copyright © 2014 by The American Association of Immunologists, Inc.

  12. NEUROTRANSMITTERS AND IMMUNITY: 1. DOPAMINE

    Directory of Open Access Journals (Sweden)

    Lucian Hritcu

    2007-08-01

    Full Text Available Dopamine is one of the principal neurotransmitters in the central nervous system (CNC, and its neuronal pathways are involved in several key functions such as behavior (Hefco et al., 2003a,b, control of movement, endocrine regulation, immune response (Fiserova et al., 2002; Levite et al., 2001, Hritcu et al., 2006a,b,c, and cardiovascular function. Dopamine has at least five G-protein, coupled receptor subtypes, D1-D5, each arising from a different gene (Sibley et al., 1993. Traditionally, these receptors have been classified into D1-like (the D1 and D5 and D2-like (D2, D3 and D4 receptors subtypes, primarily according to their ability to stimulate or inhibit adenylate cyclase, respectively, and to their pharmacological characteristics (Seeman et al., 1993. Receptors for dopamine (particularly of D2 subclass are the primary therapeutic target in a number of neuropathological disorders including schizophrenia, Parkinson’s disease and Huntington’s chorea (Seeman et al., 1987. Neither dopamine by itself, nor dopaminergic agonists by themselves, has been shown to activate T cell function. Nevertheless, lymphocytes are most probably exposed to dopamine since the primary and secondary lymphoid organs of various mammals are markedly innervated, and contain nerve fibers which stain for tyrosine hydroxylase (Weihe et al., 1991, the enzyme responsible for dopamine synthesis. Moreover, cathecolamines and their metabolites are present in single lymphocytes and in extracts of T and B cell clones, and pharmacological inhibition of tyrosine hydroxylase reduces catecholamine levels, suggesting catecholamine synthesis by lymphocytes (Bergquist et al., 1994. The existence of putative dopamine receptors of D2, D3, D4 and D5 subtypes on immune cells has been proposed of several authors, primarily on the basis of dopaminergic ligand binding assays and specific mRNA expression as monitored by reverse transcription-PCR. Several experiments evoked the idea of a

  13. Effect of immune nutritional support on immune function and inflammatory factor in postoperative patients with gastric cancer

    Directory of Open Access Journals (Sweden)

    Hua-Jia Dai

    2016-05-01

    Full Text Available Objective: To investigate the effect of immune nutritional support on immune function and inflammatory factor in postoperative patients with gastric cancer. Methods: A total of 100 patients with gastric cancer were selected and randomly divided into the observation group and the control group with 50 cases in each group. The control group received routine perioperative enteral and parenteral nutrition, on the basis of conventional nutritional support, and the observation group was given enteral nutrition emulsion immune support. Then, the immune function and the inflammatory factor of postoperative day 1 and day 7 were compared between the two groups. Results: (1 With the preoperative data as the basis, the levels of serum IgG, IgA, C3 and C4 decreased at the postoperative day 1 and then increased at the postoperative day 7, while the level of IgM showed an increasing trend and then a decreasing trend in the two groups, and the corresponding figures for the postoperative day 1 and day 7 were statistically different between the two groups. In the observation group, the levels of IgG, IgA, C3 and C4 were higher, while the level of IgM was lower at the postoperative day 1 and day 7 than that in the control group, and the differences were statistically significant; (2 With the preoperative data as the basis, the levels of serum TNF-α, IL-6 and CRP significantly increased at the postoperative day 1 and then decreased at the postoperative day 7 in the two groups, and the corresponding figures for the postoperative day 1 and day 7 in the observation group were lower than those in the control group, and the differences were statistically significant. Conclusion: Immune nutritional support can help to reduce the damage of immune function and the inflammatory response induced by surgery in patients with gastric cancer, which is worthy of clinical application.

  14. A Novel Function for the Streptococcus pneumoniae Aminopeptidase N: Inhibition of T Cell Effector Function through Regulation of TCR Signaling

    Directory of Open Access Journals (Sweden)

    Lance K. Blevins

    2017-11-01

    Full Text Available Streptococcus pneumoniae (Spn causes a variety of disease states including fatal bacterial pneumonia. Our previous finding that introduction of Spn into an animal with ongoing influenza virus infection resulted in a CD8+ T cell population with reduced effector function gave rise to the possibility of direct regulation by pneumococcal components. Here, we show that treatment of effector T cells with lysate derived from Spn resulted in inhibition of IFNγ and tumor necrosis factor α production as well as of cytolytic granule release. Spn aminopeptidase N (PepN was identified as the inhibitory bacterial component and surprisingly, this property was independent of the peptidase activity found in this family of proteins. Inhibitory activity was associated with reduced activation of ZAP-70, ERK1/2, c-Jun N-terminal kinase, and p38, demonstrating the ability of PepN to negatively regulate TCR signaling at multiple points in the cascade. These results reveal a novel immune regulatory function for a bacterial aminopeptidase.

  15. Mesenchymal Stem Cells from Patients with Rheumatoid Arthritis Display Impaired Function in Inhibiting Th17 Cells

    Directory of Open Access Journals (Sweden)

    Yue Sun

    2015-01-01

    Full Text Available Mesenchymal stem cells (MSCs possess multipotent and immunomodulatory properties and are suggested to be involved in the pathogenesis of immune-related diseases. This study explored the function of bone marrow MSCs from rheumatoid arthritis (RA patients, focusing on immunomodulatory effects. RA MSCs showed decreased proliferative activity and aberrant migration capacity. No significant differences were observed in cytokine profiles between RA and control MSCs. The effects of RA MSCs on proliferation of peripheral blood mononuclear cells (PBMCs and distribution of specific CD4+ T cell subtypes (Th17, Treg, and Tfh cells were investigated. RA MSCs appeared to be indistinguishable from controls in suppressing PBMC proliferation, decreasing the proportion of Tfh cells, and inducing the polarization of Treg cells. However, the capacity to inhibit Th17 cell polarization was impaired in RA MSCs, which was related to the low expression of CCL2 in RA MSCs after coculture with CD4+ T cells. These findings indicated that RA MSCs display defects in several important biological activities, especially the capacity to inhibit Th17 cell polarization. These functionally impaired MSCs may contribute to the development of RA disease.

  16. Functional motifs responsible for human metapneumovirus M2-2-mediated innate immune evasion.

    Science.gov (United States)

    Chen, Yu; Deng, Xiaoling; Deng, Junfang; Zhou, Jiehua; Ren, Yuping; Liu, Shengxuan; Prusak, Deborah J; Wood, Thomas G; Bao, Xiaoyong

    2016-12-01

    Human metapneumovirus (hMPV) is a major cause of lower respiratory infection in young children. Repeated infections occur throughout life, but its immune evasion mechanisms are largely unknown. We recently found that hMPV M2-2 protein elicits immune evasion by targeting mitochondrial antiviral-signaling protein (MAVS), an antiviral signaling molecule. However, the molecular mechanisms underlying such inhibition are not known. Our mutagenesis studies revealed that PDZ-binding motifs, 29-DEMI-32 and 39-KEALSDGI-46, located in an immune inhibitory region of M2-2, are responsible for M2-2-mediated immune evasion. We also found both motifs prevent TRAF5 and TRAF6, the MAVS downstream adaptors, to be recruited to MAVS, while the motif 39-KEALSDGI-46 also blocks TRAF3 migrating to MAVS. In parallel, these TRAFs are important in activating transcription factors NF-kB and/or IRF-3 by hMPV. Our findings collectively demonstrate that M2-2 uses its PDZ motifs to launch the hMPV immune evasion through blocking the interaction of MAVS and its downstream TRAFs. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Multivalent dendrimeric compounds containing carbohydrates expressed on immune cells inhibit infection by primary isolates of HIV-1

    International Nuclear Information System (INIS)

    Rosa Borges, Andrew; Wieczorek, Lindsay; Johnson, Benitra; Benesi, Alan J.; Brown, Bruce K.; Kensinger, Richard D.; Krebs, Fred C.; Wigdahl, Brian; Blumenthal, Robert; Puri, Anu; McCutchan, Francine E.; Birx, Deborah L.; Polonis, Victoria R.; Schengrund, Cara-Lynne

    2010-01-01

    Specific glycosphingolipids (GSL), found on the surface of target immune cells, are recognized as alternate cell surface receptors by the human immunodeficiency virus type 1 (HIV-1) external envelope glycoprotein. In this study, the globotriose and 3'-sialyllactose carbohydrate head groups found on two GSL were covalently attached to a dendrimer core to produce two types of unique multivalent carbohydrates (MVC). These MVC inhibited HIV-1 infection of T cell lines and primary peripheral blood mononuclear cells (PBMC) by T cell line-adapted viruses or primary isolates, with IC 50 s ranging from 0.1 to 7.4 μg/ml. Inhibition of Env-mediated membrane fusion by MVC was also observed using a dye-transfer assay. These carbohydrate compounds warrant further investigation as a potential new class of HIV-1 entry inhibitors. The data presented also shed light on the role of carbohydrate moieties in HIV-1 virus-host cell interactions. -- Research Highlights: →Multivalent carbohydrates (MVCs) inhibited infection of PBMCs by HIV-1. →MVCs inhibited infection by T cell line-adapted viruses. →MVCs inhibited infection by primary isolates of HIV-1. →MVCs inhibited Env-mediated membrane fusion.

  18. The importance of vitamins D and K for the bone health and immune function in inflammatory bowel disease.

    Science.gov (United States)

    Iijima, Hideki; Shinzaki, Shinichiro; Takehara, Tetsuo

    2012-11-01

    This review summarizes the recent literature about the roles of vitamins D and K in bone metabolism and immunity-mediated inflammatory processes in inflammatory bowel diseases (IBDs). The levels of vitamins D and K are lower than normal in patients with IBD, especially in Crohn's disease. Although vitamins D and K are important for the maintenance of bone mineral density in non-IBD patients, an association between vitamins D or K and bone metabolism is not apparent in IBD patients. Recent studies showed that vitamins D and K are suggested to have immune-suppressive effects, both in animal models of colitis and human trials. In particular, vitamin D suppresses dendritic and T-cell functions by inhibiting the production of proinflammatory cytokines. Insufficiency of vitamin D is associated with the activated phenotype of IBD. Vitamins D and K potentially contribute to the maintenance of bone health in IBD, but this effect may be diminished by other factors such as steroid use, reduced exposure to sunlight, and inflammatory cytokines. Vitamin D and possibly vitamin K are suggested to be involved in the suppression of immune-mediated inflammation and modulation of disease activity.

  19. Phospholipase C-β in immune cells.

    Science.gov (United States)

    Kawakami, Toshiaki; Xiao, Wenbin

    2013-09-01

    Great progress has recently been made in structural and functional research of phospholipase C (PLC)-β. We now understand how PLC-β isoforms (β1-β4) are activated by GTP-bound Gαq downstream of G protein-coupled receptors. Numerous studies indicate that PLC-βs participate in the differentiation and activation of immune cells that control both the innate and adaptive immune systems. The PLC-β3 isoform also interplays with tyrosine kinase-based signaling pathways, to inhibit Stat5 activation by recruiting the protein-tyrosine phosphatase SHP-1, with which PLC-β3 and Stat5 form a multi-molecular signaling platform, named SPS complex. The SPS complex has important regulatory roles in tumorigenesis and immune cell activation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Effect of long-term fluticasone treatment on immune function in horses with heaves.

    Science.gov (United States)

    Dauvillier, J; Felippe, M J B; Lunn, D P; Lavoie-Lamoureux, A; Leclère, M; Beauchamp, G; Lavoie, J-P

    2011-01-01

    Corticosteroids currently are the most effective pharmacological treatment available to control heaves in horses. Systemically administered corticosteroids have been shown to alter immune response in horses, humans, and other species. Aerosolized administration theoretically minimizes systemic adverse effects, but the effect of inhaled corticosteroids on immune function has not been evaluated in horses. To evaluate the effects of prolonged administration of inhaled fluticasone on the immune system of heaves-affected horses. Heaves-affected horses were treated with inhaled fluticasone (n = 5) for 11 months or received environmental modifications only (n = 5). Prospective analysis. Clinical parameters and CBC, lymphocyte subpopulations and function, and circulating neutrophil gene expression were sequentially measured. Primary and anamnestic immune responses also were evaluated by measuring antigen-specific antibodies in response to vaccination with bovine viral antigen and tetanus toxoid, respectively. No clinical adverse effects were observed and no differences in immune function were detected between treated and untreated horses. The treatment of heaves-affected horses with inhaled fluticasone at therapeutic dosages for 11 months has no significant detectable effect on innate and adaptive (both humoral and cell-mediated) immune parameters studied. These results suggest that prolonged administration of fluticasone would not compromise the systemic immune response to pathogens nor vaccination in adult horses. Copyright © 2011 by the American College of Veterinary Internal Medicine.

  1. Olive oil and immune system functions: potential involvement in immunonutrition

    Directory of Open Access Journals (Sweden)

    Álvarez de Cienfuegos, Gerardo

    2004-03-01

    Full Text Available Olive oil plays a crucial role as a main component of the Mediterranean diet, which has shown important benefits for the human health. According to the current knowledge, the administration of diets containing olive oil exerts some beneficial effects on the immune system functions due likely to the action of oleic acid rather than other substances contained in this fat. In the last few years, epidemiological, clinical and experimental studies have evidenced the potential of certain dietary lipids (containing polyunsaturated or monounsaturated fatty acids as modulators of immune system functions due to their ability to suppress several functions of immune system in both humans and animals. As a result, these fats have been applied in the reduction of symptoms from diseases characterized by an overactivation of the immune system (autoimmune diseases or in the reduction of cancer risk. Here, we review several relevant experimental and clinical data associated with the beneficial effects of olive oil upon the health, the mechanisms of action and the immune function susceptible of being be altered by the administration of dietary lipids and particularly of olive oil. In addition, we will also discuss the detrimental effects on the immune system functions caused by the administration of certain dietary lipids attributed mainly to a reduction of host natural resistance against infectious microorganisms as well as the involvement of olive oil diets in the regulation of immune resistance.El aceite de oliva tiene un papel crucial como componente de la dieta Mediterránea, con importantes beneficios sobre la salud humana. Dietas conteniendo aceite de oliva actúan de manera favorable en las funciones del sistema inmune por la acción sobretodo del ácido oleico. Los estudios epidemiológicos, clínicos y experimentales publicados en los últimos años demuestran que ciertos lípidos de la dieta [ácidos grasos monoinsaturados (MUFA y poliinsaturados (PUFA

  2. Age-dependent changes in innate immune phenotype and function in rhesus macaques (Macaca mulatta

    Directory of Open Access Journals (Sweden)

    Mark Asquith

    2012-06-01

    Full Text Available Aged individuals are more susceptible to infections due to a general decline in immune function broadly referred to as immune senescence. While age-related changes in the adaptive immune system are well documented, aging of the innate immune system remains less well understood, particularly in nonhuman primates. A more robust understanding of age-related changes in innate immune function would provide mechanistic insight into the increased susceptibility of the elderly to infection. Rhesus macaques have proved a critical translational model for aging research, and present a unique opportunity to dissect age-dependent modulation of the innate immune system. We examined age-related changes in: (i innate immune cell frequencies; (ii expression of pattern recognition receptors (PRRs and innate signaling molecules; (iii cytokine responses of monocytes and dendritic cells (DC following stimulation with PRR agonists; and (iv plasma cytokine levels in this model. We found marked changes in both the phenotype and function of innate immune cells. This included an age-associated increased frequency of myeloid DC (mDC. Moreover, we found toll-like receptor (TLR agonists lipopolysaccharide (TLR4, fibroblast stimulating ligand-1 (TLR2/6, and ODN2006 (TLR7/9 induced reduced cytokine responses in aged mDC. Interestingly, with the exception of the monocyte-derived TNFα response to LPS, which increased with age, TNFα, IL-6, and IFNα responses declined with age. We also found that TLR4, TLR5, and innate negative regulator, sterile alpha and TIR motif containing protein (SARM, were all expressed at lower levels in young animals. By contrast, absent in melanoma 2 and retinoic acid-inducible gene I expression was lowest in aged animals. Together, these observations indicate that several parameters of innate immunity are significantly modulated by age and contribute to differential immune function in aged macaques.

  3. Development of Ingredients of the Feed-stuff for Improving Immune system using Centipede grass Extracts

    Energy Technology Data Exchange (ETDEWEB)

    Bai, Hyoungwoo; Chung, Byungyeoup; Lee, Seungsik; Lee, Sungbeom

    2013-09-15

    The purpose of the this project provides new application areas using naturally occurring flavonoids, cenetpedegrass extracts, for improving immune system and used as ingredients for feed-stuff. In order to provide the immune improving effects of centipedegrass, cell and animal experiments were carried out. Research scope includes determine the effect of centipedegrass extracts on immune functions using LPS-induced RAW cells and found that cytokines, IL-6 and IL-10, which were induced by LPS, were reduced by inhibiting phosphorylation of STAT-3, determine the effects of immune stimulating activity of centipedegrass in animals, cenetipedegrass extracts were administrated once a day for 2 weeks. After treated with LPS, immune suppressor, cytokines were down regulated, however, the cytokines in the group pretreated with centipedegrass extracts, were not down regulated as much as non treated group. The overall mechanism of immune stimulating effect of centipedegrass extracts, was that STAT-3 phosphorylation was inhibited by contipedegrass extracts.

  4. Studying the Impact of Spaceflight Environment on Immune Functions Using New Molecular Diagnostics System

    Science.gov (United States)

    Cohen, Luchino

    Immune functions are altered during space flights. Latent virus reactivation, reduction in the number of immune cells, decreased cell activation and increased sensitivity of astronauts to infections following their return on Earth demonstrate that the immune system is less efficient during space flight. The causes of this immune deficiency are not fully understood and this dysfunction during long-term missions could result in the appearance of opportunistic infections or a decrease in the immuno-surveillance mechanisms that eradicate cancer cells. Therefore, the immune functions of astronauts will have to be monitored continuously during long-term missions in space, using miniature and semi-automated diagnostic systems. The objectives of this project are to study the causes of space-related immunodeficiency, to develop countermeasures to maintain an optimal immune function and to improve our capacity to detect infectious diseases during space missions through the monitoring of astronauts' immune system. In order to achieve these objectives, an Immune Function Diagnostic System (IFDS) will be designed to perform a set of immunological assays on board spacecrafts or on planet-bound bases. Through flow cytometric assays and molecular biology analyses, this diagnostic system could improve medical surveillance of astronauts and could be used to test countermeasures aimed at preventing immune deficiency during space missions. The capacity of the instrument to assess cellular fluorescence and to quantify the presence of soluble molecules in biological samples would support advanced molecular studies in space life sciences. Finally, such diagnostic system could also be used on Earth in remote areas or in mobile hospitals following natural disasters to fight against infectious diseases and other pathologies.

  5. Immunization with mutant HPV16 E7 protein inhibits the growth of TC-1 cells in tumor-bearing mice.

    Science.gov (United States)

    Li, Yan-Li; Ma, Zhong-Liang; Zhao, Yue; Zhang, Jing

    2015-04-01

    Two human papillomavirus (HPV) 16 oncogenic proteins, E6 and E7, are co-expressed in the majority of HPV16-induced cervical cancer cells. Thus, the E6 and E7 proteins are good targets for developing therapeutic vaccines for cervical cancer. In the present study, immunization with the mutant non-transforming HPV16 E7 (mE7) protein was demonstrated to inhibit the growth of TC-1 cells in the TC-1 mouse model. The HPV16 mE7 gene was amplified by splicing overlap extension polymerase chain reaction using pET-28a(+)-E7 as a template, and the gene was cloned into pET-28a(+) to form pET-28a(+)-mE7. Compared with the E7 protein, mE7 lacks amino acid residues 94-98, and at residue 24, there is a Cys to Gly substitution. pET-28a(+)-mE7 was then introduced into Escherichia coli Rosetta. The expression of mE7 was induced by isopropyl β-D-1-thiogalactopyranoside. The mE7 protein was purified using Ni-NTA agarose and detected by SDS-PAGE and western blot analysis. In the tumor prevention model, no tumor was detected in the mice vaccinated with the mE7 protein. After 40 days, the tumor-free mice and control mice were challenged with 2×10 5 TC-1 cells. All control mice developed tumors six days later, but mE7 immunized mice were tumor free until 90 days. In the tumor therapy model, the TC-1 cells were initially injected subcutaneously, and the mice were subsequently vaccinated. Vaccination against the mE7 protein may significantly inhibit TC-1 cell growth compared to the control. These results demonstrated that immunization with the HPV16 mE7 protein elicited a long-term protective immunity against TC-1 tumor growth and generated a significant inhibition of TC-1 growth in a TC-1 mouse model.

  6. The Ly49E receptor inhibits the immune control of acute Trypanosoma cruzi infection

    Directory of Open Access Journals (Sweden)

    Jessica Filtjens

    2016-11-01

    Full Text Available The protozoan parasite Trypanosoma cruzi (T. cruzi circulates in the blood upon infection and invades a variety of cells. Parasites intensively multiply during the acute phase of infection and persist lifelong at low levels in tissues and blood during the chronic phase. Natural killer (NK and NKT cells play an important role in the immune control of T. cruzi infection, mainly by releasing the cytokine IFN-γ that activates the microbicidal action of macrophages and other cells and shapes a protective type 1 immune response. The mechanisms by which immune cells are regulated to produce IFN-γ during T. cruzi infection are still incompletely understood. Here, we show that urokinase plasminogen activator (uPA is induced early upon T. cruzi infection, and remains elevated until day 20 post inoculation. We previously demonstrated that the inhibitory receptor Ly49E, which is expressed, among others, on NK and NKT cells, is triggered by uPA. Therefore, we compared wild type (WT to Ly49E knockout (KO mice for their control of experimental T. cruzi infection. Our results show that young, i.e. 4- and 6-week-old, Ly49E KO mice control the infection better than WT mice, indicated by a lower parasite load and less cachexia. The beneficial effect of Ly49E depletion is more obvious in 4-week-old male than in female mice and weakens in 8-week-old mice. In young mice, the lower T. cruzi parasitemia in Ly49E KO mice is paralleled by higher IFN-γ production compared to their WT controls. Our data indicate that Ly49E receptor expression inhibits the immune control of T. cruzi infection. This is the first demonstration that the inhibitory Ly49E receptor can interfere with the immune response to a pathogen in vivo.

  7. [Induction of glutathione and activation of immune functions by low-dose, whole-body irradiation with gamma-rays].

    Science.gov (United States)

    Kojima, Shuji

    2006-10-01

    We first examined the relation between the induction of glutathione and immune functions in mice after low-dose gamma-ray irradiation. Thereafter, inhibition of tumor growth by radiation was confirmed in Ehrlich solid tumor (EST)-bearing mice. The total glutathione level of the splenocytes transiently increased soon after irradiation and reached a maximum at around 4 h postirradiation. Thereafter, the level reverted to the 0 h value by 24 h postirradiation. A significantly high splenocyte proliferative response was also recognized 4 h postirradiation. Natural killer (NK) activity was also increased significantly in a similar manner. The time at which the response reached the maximum coincided well with that of maximum total glutathione levels of the splenocytes in the gamma-ray-irradiated mice. Reduced glutathione exogenously added to splenocytes obtained from normal mice enhanced the proliferative response and NK activity in a dose-dependent manner. The inhibitory effects of radiation on tumor growth was then examined in EST-bearing mice. Repeated low-dose irradiation (0.5 Gy, four times, before and within an early time after inoculation) significantly delayed the tumor growth. Finally, the effect of single low-dose (0.5 Gy), whole-body gamma-ray irradiation on immune balance was examined to elucidate the mechanism underlying the antitumor immunity. The percentage of B cells in blood lymphocytes was selectively decreased after radiation, concomitant with an increase in that of the helper T cell population. The IFN-gamma level in splenocyte culture prepared from EST-bearing mice was significantly increased 48 h after radiation, although the level of IL-4 was unchanged. IL-12 secretion from macrophages was also enhanced by radiation. These results suggest that low-dose gamma-rays induce Th1 polarization and enhance the activities of tumoricidal effector cells, leading to an inhibition of tumor growth.

  8. [Knockdown of indoleamine 2, 3-dioxygenase 2 (IDO2)gene inhibits tumor growth and enhances immune function in mice bearing melanoma].

    Science.gov (United States)

    Liu, Yanling; Liu, Huan; Xiang, Yingqing; Chen, Xiaoyan; Xu, Ping; Min, Weiping

    2017-12-01

    Objective To study the role of indoleamine 2, 3-dioxygenase 2 (IDO2) in anti-tumor therapy and its effect on the immune response when using IDO2 as therapeutic target. Methods B16-BL6 cells were used to construct mouse xenografted melanoma model. IDO2-shRNA that contained IDO2-siRNA or control shRNA (scrambled-shRNA) was injected hydrodynamically via the tail vein to treat melanoma. The tumor size was measured by vernier caliper. Flow cytometry was performed to analyze the percentage of regulatory T cells (Tregs), T cell apoptosis rate in draining lymph nodes and the expressions of co-stimulatory molecules on splenic dendritic cells (DCs) from different treatment groups. The lactate dehydrogenase (LDH) assay was used to determine the CD8 + cytotoxic T lymphocyte (CTL) activity. The serum levels of tumor necrosis factor α (TNF-α) and interferon γ (IFN-γ) were detected by ELISA. Results In the IDO2-shRNA treated group, the tumor formation time was delayed, tumor grew slowly, and excised tumor mass was significantly reduced. IDO2-shRNA treatment also decreased the percentage of Tregs and T cell apoptosis in draining lymph nodes and increased the expressions of co-stimulatory molecules CD80 and CD86 on splenic DCs. The capacity of CD8 + T cells to kill B16-BL6 cells was enhanced and the serum levels of TNF-α and IFN-γ were upregulated. Conclusion Silencing IDO2 can effectively inhibit the growth of melanoma and improve the anti-tumor immune response in vivo.

  9. Inhibition of the cluster of differentiation 14 innate immunity pathway with IAXO-101 improves chronic microelectrode performance

    Science.gov (United States)

    Hermann, John K.; Ravikumar, Madhumitha; Shoffstall, Andrew J.; Ereifej, Evon S.; Kovach, Kyle M.; Chang, Jeremy; Soffer, Arielle; Wong, Chun; Srivastava, Vishnupriya; Smith, Patrick; Protasiewicz, Grace; Jiang, Jingle; Selkirk, Stephen M.; Miller, Robert H.; Sidik, Steven; Ziats, Nicholas P.; Taylor, Dawn M.; Capadona, Jeffrey R.

    2018-04-01

    Objective. Neuroinflammatory mechanisms are hypothesized to contribute to intracortical microelectrode failures. The cluster of differentiation 14 (CD14) molecule is an innate immunity receptor involved in the recognition of pathogens and tissue damage to promote inflammation. The goal of the study was to investigate the effect of CD14 inhibition on intracortical microelectrode recording performance and tissue integration. Approach. Mice implanted with intracortical microelectrodes in the motor cortex underwent electrophysiological characterization for 16 weeks, followed by endpoint histology. Three conditions were examined: (1) wildtype control mice, (2) knockout mice lacking CD14, and (3) wildtype control mice administered a small molecule inhibitor to CD14 called IAXO-101. Main results. The CD14 knockout mice exhibited acute but not chronic improvements in intracortical microelectrode performance without significant differences in endpoint histology. Mice receiving IAXO-101 exhibited significant improvements in recording performance over the entire 16 week duration without significant differences in endpoint histology. Significance. Full removal of CD14 is beneficial at acute time ranges, but limited CD14 signaling is beneficial at chronic time ranges. Innate immunity receptor inhibition strategies have the potential to improve long-term intracortical microelectrode performance.

  10. Imbalanced immune homeostasis in immune thrombocytopenia.

    Science.gov (United States)

    Yazdanbakhsh, Karina

    2016-04-01

    Immune thrombocytopenia (ITP) is an autoimmune bleeding disorder resulting from low platelet counts caused by inadequate production as well as increased destruction by autoimmune mechanisms. As with other autoimmune disorders, chronic ITP is characterized by perturbations of immune homeostasis with hyperactivated effector cells as well as defective regulatory arm of the adaptive immune system, which will be reviewed here. Interestingly, some ITP treatments are associated with restoring the regulatory imbalance, although it remains unclear whether the immune system is redirected to a state of tolerance once treatment is discontinued. Understanding the mechanisms that result in breakdown of immune homeostasis in ITP will help to identify novel pathways for restoring tolerance and inhibiting effector cell responses. This information can then be translated into developing therapies for averting autoimmunity not only in ITP but also many autoimmune disorders. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Trade-offs between sexual advertisement and immune function in the pied flycatcher (Ficedula hypoleuca).

    OpenAIRE

    Kilpimaa, Janne; Alatalo, Rauno V.; Siitari, Heli

    2004-01-01

    Good genes models of sexual selection assume that sexual advertisement is costly and thus the level of advertisement honestly reveals heritable viability. Recently it has been suggested that an important cost of sexual advertisement might be impairment of the functioning of the immune system. In this field experiment we investigated the possible trade-offs between immune function and sexual advertisement by manipulating both mating effort and activity of immune defence in male pied flycatcher...

  12. Arsenic trioxide decreases the amount and inhibits the function of regulatory T cells, which may contribute to its efficacy in the treatment of acute promyelocytic leukemia.

    Science.gov (United States)

    Xu, Wen; Li, Xiaoxia; Quan, Lina; Yao, Jiying; Mu, Guannan; Guo, Jingjie; Wang, Yitong

    2018-03-01

    Arsenic trioxide (ATO) exhibits substantial clinical efficacy in the treatment of acute promyelocytic leukemia (APL). Here, we investigated whether ATO exerts its efficacy by affecting regulatory T (Treg) cells. We determined whether ATO treatment influenced the amount and function of purified Treg cells. We also examined the effect of ATO treatment on Treg cells from APL patients. ATO treatment induced apoptosis in purified Treg cells and dampened the inhibition of effector T (Teff) cells proliferation and the secretion of cytokine by Treg cells. Treg cell levels in the peripheral blood and serum IL-10 levels were dramatically decreased in APL patients after single ATO treatment. In summary, our results show that ATO decreases the amount and inhibits the function of Treg cells, thereby enhancing Teff cell function and overall anti-tumor immunity.

  13. An extracellular subtilase switch for immune priming in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Vicente Ramírez

    Full Text Available In higher eukaryotes, induced resistance associates with acquisition of a priming state of the cells for a more effective activation of innate immunity; however, the nature of the components for mounting this type of immunological memory is not well known. We identified an extracellular subtilase from Arabidopsis, SBT3.3, the overexpression of which enhances innate immune responses while the loss of function compromises them. SBT3.3 expression initiates a durable autoinduction mechanism that promotes chromatin remodeling and activates a salicylic acid(SA-dependent mechanism of priming of defense genes for amplified response. Moreover, SBT3.3 expression-sensitized plants for enhanced expression of the OXI1 kinase gene and activation of MAP kinases following pathogen attack, providing additional clues for the regulation of immune priming by SBT3.3. Conversely, in sbt3.3 mutant plants pathogen-mediated induction of SA-related defense gene expression is drastically reduced and activation of MAP kinases inhibited. Moreover, chromatin remodeling of defense-related genes normally associated with activation of an immune priming response appear inhibited in sbt3.3 plants, further indicating the importance of the extracellular SBT3.3 subtilase in the establishment of immune priming. Our results also point to an epigenetic control in the regulation of plant immunity, since SBT3.3 is up-regulated and priming activated when epigenetic control is impeded. SBT3.3 represents a new regulator of primed immunity.

  14. Immune evasion mechanisms and immune checkpoint inhibition in advanced merkel cell carcinoma.

    Science.gov (United States)

    Schadendorf, Dirk; Nghiem, Paul; Bhatia, Shailender; Hauschild, Axel; Saiag, Philippe; Mahnke, Lisa; Hariharan, Subramanian; Kaufman, Howard L

    2017-01-01

    Merkel cell carcinoma (MCC) is a rare skin cancer caused by Merkel cell polyomavirus (MCPyV) infection and/or ultraviolet radiation-induced somatic mutations. The presence of tumor-infiltrating lymphocytes is evidence that an active immune response to MCPyV and tumor-associated neoantigens occurs in some patients. However, inhibitory immune molecules, including programmed death-1 (PD-1) and programmed death-ligand 1 (PD-L1), within the MCC tumor microenvironment aid in tumor evasion of T-cell-mediated clearance. Unlike chemotherapy, treatment with anti-PD-L1 (avelumab) or anti-PD-1 (pembrolizumab) antibodies leads to durable responses in MCC, in both virus-positive and virus-negative tumors. As many tumors are established through the evasion of infiltrating immune-cell clearance, the lessons learned in MCC may be broadly relevant to many cancers.

  15. Streptavidin-functionalized capillary immune microreactor for highly efficient chemiluminescent immunoassay

    Energy Technology Data Exchange (ETDEWEB)

    Yang Zhanjun [State Key Laboratory of Analytical Chemistry for Life Science, Department of Chemistry, Nanjing University, Nanjing 210093 (China); College of Chemistry and Engineering, Yangzhou University, 88 South University Avenue, Yangzhou 225002 (China); Zong Chen [State Key Laboratory of Analytical Chemistry for Life Science, Department of Chemistry, Nanjing University, Nanjing 210093 (China); Ju Huangxian, E-mail: hxju@nju.edu.cn [State Key Laboratory of Analytical Chemistry for Life Science, Department of Chemistry, Nanjing University, Nanjing 210093 (China); Yan Feng, E-mail: yanfeng2007@sohu.com [Jiangsu Institute of Cancer Prevention and Cure, Nanjing 210009 (China)

    2011-11-07

    Highlights: {yields} A novel capillary immune microreactor was proposed for highly efficient flow-through chemiluminescent immunoassay. {yields} The microreactor was prepared by functionalizing capillary inner wall with streptavidin for capture of biotinylated antibody. {yields} The proposed immunoassay method showed wide dynamic range, good reproducibility, stability and practicality. {yields} The microreactor was low-cost and disposable, and possessed several advantages over the conventional immunoreactors. - Abstract: A streptavidin functionalized capillary immune microreactor was designed for highly efficient flow-through chemiluminescent (CL) immunoassay. The functionalized capillary could be used as both a support for highly efficient immobilization of antibody and a flow cell for flow-through immunoassay. The functionalized inner wall and the capture process were characterized using scanning electron microscopy. Compared to conventional packed tube or thin-layer cell immunoreactor, the proposed microreactor showed remarkable properties such as lower cost, simpler fabrication, better practicality and wider dynamic range for fast CL immunoassay with good reproducibility and stability. Using {alpha}-fetoprotein as model analyte, the highly efficient CL flow-through immunoassay system showed a linear range of 3 orders of magnitude from 0.5 to 200 ng mL{sup -1} and a low detection limit of 0.1 ng mL{sup -1}. The capillary immune microreactor could make up the shortcoming of conventional CL immunoreactors and provided a promising alternative for highly efficient flow-injection immunoassay.

  16. Lead effects on development and function of bone marrow-derived dendritic cells promote Th2 immune responses

    International Nuclear Information System (INIS)

    Gao Donghong; Mondal, Tapan K.; Lawrence, David A.

    2007-01-01

    Although lead (Pb) has significant effects on the development and function of macrophages, B cells, and T cells and has been suggested to promote allergic asthma in mice and humans, Pb modulation of bone marrow (BM)-derived dendritic cells (DCs) and the resultant DC effects on Th1 and Th2 development have not been examined. Accordingly, we cultured BM cells with murine granulocyte macrophage-colony stimulating factor (mGM-CSF) ± PbCl 2 . At day 10, culture supernatant (SN) and non-adherent cells were harvested for analysis. Additionally, day 10 non-adherent BM-DCs were harvested and recultured with mGM-CSF + LPS ± Pb for 2 days. The day 10 Pb exposure significantly inhibited BM-DC generation, based on CD11c expression. Although fewer DCs were generated with Pb, the existing Pb-exposed DCs had significantly greater MHC-II expression than did the non-Pb-exposed DCs. However, these differences diminished upon LPS stimulation. After LPS stimulation, CD80, CD86, CD40, CD54, and MHC-II were all up-regulated on both Pb-DCs and DCs, but Pb-DCs expressed significantly less CD80 than did DCs. The CD86:CD80 ratio suggests a Pb-DC potential for Th2 cell development. After LPS stimulation, IL-6, IL-10, IL-12 (p70), and TNF-α levels significantly increased with both Pb-DCs and DCs, but Pb-DCs produced significantly less cytokines than did DCs, except for IL-10, which further supports Pb-DC preferential skewing toward type-2 immunity. In vitro studies confirm that Pb-DCs have the ability to polarize antigen-specific T cells to Th2 cells. Pb-DCs also enhanced allogeneic and autologous T cell proliferation in vitro, and in vivo studies suggested that Pb-DCs inhibited Th1 effects on humoral and cell-mediated immunity. The Pb effect was mainly on DCs, rather than on T cells, and Pb's modification of DC function appears to be the main cause of Pb's promotion of type-2-related immunity, which may relate to Pb's enhanced activation of the Erk/MAP kinase pathway

  17. Validation of Procedures for Monitoring Crewmember Immune Function

    Science.gov (United States)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarence

    2009-01-01

    There is ample evidence to suggest that space flight leads to immune system dysregulation, however the nature of the phenomenon as it equilibrates over longer flights has not been determined. This dysregulation may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk (if any) for exploration-class space flight is unknown, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. The objective of this Supplemental Medical Objective (SMO) is to determine the status of the immune system, physiological stress and latent viral reactivation (a clinical outcome that can be measured) during both short and long-duration spaceflight. In addition, this study will develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. Pre-mission, in-flight and post-flight blood and saliva samples will be obtained from participating crewmembers. Assays included peripheral immunophenotype, T cell function, cytokine profiles (RNA, intracellular, secreted), viral-specific immunity, latent viral reactivation (EBV, CMV, VZV), and stress hormone measurements. This study is currently ongoing. To date, 10 short duration and 5 long-duration crewmembers have completed the study. Technically, the study is progressing well. In-flight blood samples are being collected, and returned for analysis, including functional assays that require live cells. For all in-flight samples to date, sample viability has been acceptable. Preliminary data (n = 4/7; long/short duration, respectively) indicate that distribution of most peripheral leukocyte subsets is largely unaltered during flight. Exceptions include elevated T cells, reduced B/NK cells, increased memory T cells and increased central memory CD8+ T cells. General T cell function, early blastogenesis response to mitogenic stimulation, is markedly

  18. Diverse novel functions of neutrophils in immunity, inflammation, and beyond

    OpenAIRE

    Mocsai, A.

    2013-01-01

    Neutrophils have long been considered simple suicide killers at the bottom of the hierarchy of the immune response. That view began to change 10–20 yr ago, when the sophisticated mechanisms behind how neutrophils locate and eliminate pathogens and regulate immunity and inflammation were discovered. The last few years witnessed a new wave of discoveries about additional novel and unexpected functions of these cells. Neutrophils have been proposed to participate in protection against intracellu...

  19. Neurotrophin Receptor p75NTR Regulates Immune Function of Plasmacytoid Dendritic Cells.

    Science.gov (United States)

    Bandoła, Joanna; Richter, Cornelia; Ryser, Martin; Jamal, Arshad; Ashton, Michelle P; von Bonin, Malte; Kuhn, Matthias; Dorschner, Benjamin; Alexopoulou, Dimitra; Navratiel, Katrin; Roeder, Ingo; Dahl, Andreas; Hedrich, Christian M; Bonifacio, Ezio; Brenner, Sebastian; Thieme, Sebastian

    2017-01-01

    Plasmacytoid dendritic cells (pDCs) regulate innate and adaptive immunity. Neurotrophins and their receptors control the function of neuronal tissue. In addition, they have been demonstrated to be part of the immune response but little is known about the effector immune cells involved. We report, for the first time, the expression and immune-regulatory function of the low affinity neurotrophin receptor p75 neurotrophin receptor (p75NTR) by the antigen-presenting pDCs, mediated by toll-like receptor (TLR) 9 activation and differential phosphorylation of interferon regulatory factor 3 and 7. The modulation of p75NTR on pDCs significantly influences disease progression of asthma in an ovalbumin-induced mouse model mediated by the TLR9 signaling pathway. p75NTR activation of pDCs from patients with asthma increased allergen-specific T cell proliferation and cytokine secretion in nerve growth factor concentration-dependent manner. Further, p75NTR activation of pDCs delayed the onset of autoimmune diabetes in RIP-CD80GP mice and aggravated graft-versus-host disease in a xenotransplantation model. Thus, p75NTR signaling on pDCs constitutes a new and critical mechanism connecting neurotrophin signaling and immune response regulation with great therapeutic potential for a variety of immune disorders.

  20. Neurotrophin Receptor p75NTR Regulates Immune Function of Plasmacytoid Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Joanna Bandoła

    2017-08-01

    Full Text Available Plasmacytoid dendritic cells (pDCs regulate innate and adaptive immunity. Neurotrophins and their receptors control the function of neuronal tissue. In addition, they have been demonstrated to be part of the immune response but little is known about the effector immune cells involved. We report, for the first time, the expression and immune-regulatory function of the low affinity neurotrophin receptor p75 neurotrophin receptor (p75NTR by the antigen-presenting pDCs, mediated by toll-like receptor (TLR 9 activation and differential phosphorylation of interferon regulatory factor 3 and 7. The modulation of p75NTR on pDCs significantly influences disease progression of asthma in an ovalbumin-induced mouse model mediated by the TLR9 signaling pathway. p75NTR activation of pDCs from patients with asthma increased allergen-specific T cell proliferation and cytokine secretion in nerve growth factor concentration-dependent manner. Further, p75NTR activation of pDCs delayed the onset of autoimmune diabetes in RIP-CD80GP mice and aggravated graft-versus-host disease in a xenotransplantation model. Thus, p75NTR signaling on pDCs constitutes a new and critical mechanism connecting neurotrophin signaling and immune response regulation with great therapeutic potential for a variety of immune disorders.

  1. The effects of stress hormones on immune function may be vital for the adaptive reconfiguration of the immune system during fight-or-flight behavior.

    Science.gov (United States)

    Adamo, Shelley A

    2014-09-01

    Intense, short-term stress (i.e., robust activation of the fight-or-flight response) typically produces a transient decline in resistance to disease in animals across phyla. Chemical mediators of the stress response (e.g., stress hormones) help induce this decline, suggesting that this transient immunosuppression is an evolved response. However, determining the function of stress hormones on immune function is difficult because of their complexity. Nevertheless, evidence suggests that stress hormones help maintain maximal resistance to disease during the physiological changes needed to optimize the body for intense physical activity. Work on insects demonstrates that stress hormones both shunt resources away from the immune system during fight-or-flight responses as well as reconfigure the immune system. Reconfiguring the immune system minimizes the impact of the loss of these resources and reduces the increased costs of some immune functions due to the physiological changes demanded by the fight-or-flight response. For example, during the stress response of the cricket Gryllus texensis, some molecular resources are shunted away from the immune system and toward lipid transport, resulting in a reduction in resistance to disease. However, insects' immune cells (hemocytes) have receptors for octopamine (the insect stress neurohormone). Octopamine increases many hemocyte functions, such as phagocytosis, and these changes would tend to mitigate the decline in immunity due to the loss of molecular resources. Moreover, because the stress response generates oxidative stress, some immune responses are probably more costly when activated during a stress response (e.g., those that produce reactive molecules). Some of these immune responses are depressed during stress in crickets, while others, whose costs are probably not increased during a stress response, are enhanced. Some effects of stress hormones on immune systems may be better understood as examples of reconfiguration

  2. A Functional Food Mixture “Protector” Reinforces the Protective Immune Parameters against Viral Flu Infection in Mice

    Directory of Open Access Journals (Sweden)

    Kenza A. Mansoor

    2018-06-01

    Full Text Available Background: Viral influenza infection causes serious health issues especially when an outbreak occurs. Although influenza virus vaccines are available and each year manufactures modify the vaccine depending on the expected mutated strain, it is still far from satisfactory, mainly in young children and older adults. Therefore, a product that can support and shape the immune system to protect against viral flu infections is highly essential. Methods: A functional food water-soluble mixture of pomegranate, red grape, dates, olive fruit, figs, and ginger extracts, termed herein “Protector”, was prepared and tested in stimulating/modulating the production of specific cytokines, and hemagglutinin inhibition (HAI antibodies following viral flu vaccination in mice. Results: A single intraperitoneal or multiple oral administration for 1–7 days of “Protector” significantly increased the production of interferon (IFN-γ and interleukin (IL-12 in blood, spleen, and lungs of mice. When “Protector” was orally administered for one week following a single vaccine injection (primary immunization or for two weeks (one week apart following double vaccine injections (secondary immunization, mice significantly produced higher titers of HAI antibodies. This increase in HAI antibodies was associated with Pillow-inducing significant and different changes in vaccine-induced IFN-γ, IL-12, IL-6 and IL-22 following primary and secondary immunizations. Conclusions: “Protector” administration reinforces the protective immune parameters against viral flu infection. Therefore, after performing preclinical toxicology studies and ensuring its safety, “Protector” should be considered a potential product to be tested in clinical trials to conclude its efficacy in reducing the devastating effects of flu infection in humans and its outbreaks.

  3. The function of the Mediator complex in plant immunity.

    Science.gov (United States)

    An, Chuanfu; Mou, Zhonglin

    2013-03-01

    Upon pathogen infection, plants undergo dramatic transcriptome reprogramming to shift from normal growth and development to immune response. During this rapid process, the multiprotein Mediator complex has been recognized as an important player to fine-tune gene-specific and pathway-specific transcriptional reprogramming by acting as an adaptor/coregulator between sequence-specific transcription factor and RNA polymerase II (RNAPII). Here, we review current understanding of the role of five functionally characterized Mediator subunits (MED8, MED15, MED16, MED21 and MED25) in plant immunity. All these Mediator subunits positively regulate resistance against leaf-infecting biotrophic bacteria or necrotrophic fungi. While MED21 appears to regulate defense against fungal pathogens via relaying signals from upstream regulators and chromatin modification to RNAPII, the other four Mediator subunits locate at different positions of the defense network to convey phytohormone signal(s). Fully understanding the role of Mediator in plant immunity needs to characterize more Mediator subunits in both Arabidopsis and other plant species. Identification of interacting proteins of Mediator subunits will further help to reveal their specific regulatory mechanisms in plant immunity.

  4. Maternal immune activation leads to selective functional deficits in offspring parvalbumin interneurons.

    Science.gov (United States)

    Canetta, S; Bolkan, S; Padilla-Coreano, N; Song, L J; Sahn, R; Harrison, N L; Gordon, J A; Brown, A; Kellendonk, C

    2016-07-01

    Abnormalities in prefrontal gamma aminobutyric acid (GABA)ergic transmission, particularly in fast-spiking interneurons that express parvalbumin (PV), are hypothesized to contribute to the pathophysiology of multiple psychiatric disorders, including schizophrenia, bipolar disorder, anxiety disorders and depression. While primarily histological abnormalities have been observed in patients and in animal models of psychiatric disease, evidence for abnormalities in functional neurotransmission at the level of specific interneuron populations has been lacking in animal models and is difficult to establish in human patients. Using an animal model of a psychiatric disease risk factor, prenatal maternal immune activation (MIA), we found reduced functional GABAergic transmission in the medial prefrontal cortex (mPFC) of adult MIA offspring. Decreased transmission was selective for interneurons expressing PV, resulted from a decrease in release probability and was not observed in calretinin-expressing neurons. This deficit in PV function in MIA offspring was associated with increased anxiety-like behavior and impairments in attentional set shifting, but did not affect working memory. Furthermore, cell-type specific optogenetic inhibition of mPFC PV interneurons was sufficient to impair attentional set shifting and enhance anxiety levels. Finally, we found that in vivo mPFC gamma oscillations, which are supported by PV interneuron function, were linearly correlated with the degree of anxiety displayed in adult mice, and that this correlation was disrupted in MIA offspring. These results demonstrate a selective functional vulnerability of PV interneurons to MIA, leading to affective and cognitive symptoms that have high relevance for schizophrenia and other psychiatric disorders.

  5. Single-walled carbon nanotubes disturbed the immune and metabolic regulation function 13-weeks after a single intratracheal instillation

    Energy Technology Data Exchange (ETDEWEB)

    Park, Eun-Jung, E-mail: pejtoxic@hanmail.net [Myunggok Eye Research Institute, Konyang University, Daejeon 302-718 (Korea, Republic of); Hong, Young-Shick [Division of Food and Nutrition, Chonnam National University, Yongbong-Ro, Buk-Gu, Gwangju 500-757 (Korea, Republic of); Lee, Byoung-Seok [Toxicologic Pathology Center, Korea Institute of Toxicology, Daejeon (Korea, Republic of); Yoon, Cheolho [Seoul Center, Korea Basic Science Institute, Seoul 126-16 (Korea, Republic of); Jeong, Uiseok; Kim, Younghun [Department of Chemical Engineering, Kwangwoon University, Seoul 139-701 (Korea, Republic of)

    2016-07-15

    Due to their unique physicochemical properties, the potential health effects of single-walled carbon nanotubes (SWCNTs) have attracted continuous attention together with their extensive application. In this study, we aimed to identify local and systemic health effects following pulmonary persistence of SWCNTs. As expected, SWCNTs remained in the lung for 13 weeks after a single intratracheal instillation (50, 100, and 200 μg/kg). In the lung, the total number of cells and the percentages of lymphocytes and neutrophils significantly increased at 200 μg/kg compared to the control, and the Th1-polarized immune response was induced accompanying enhanced expression of tissue damage-related genes and increased release of chemokines. Additionally, SWCNTs enhanced the expression of antigen presentation-related proteins on the surface of antigen-presenting cells, however, maturation of dendritic cells was inhibited by their persistence. As compared to the control, a significant increase in the percentage of neutrophils and a remarkable decrease of BUN and potassium level were observed in the blood of mice treated with the highest dose. This was accompanied by the down-regulation of the expression of antigen presentation-related proteins on splenocytes. Moreover, protein and glucose metabolism were disturbed with an up-regulation of fatty acid β-oxidation. Taken together, we conclude that SWCNTs may induce adverse health effects by disturbing immune and metabolic regulation functions in the body. Therefore, careful application of SWCNTs is necessary for the enforcement of safety in nano-industries. - Highlights: • We evaluated local and systemic health effects following persistence of SWCNTs. • SWCNTs remained in the lung for 13 weeks after a single intratracheal instillation. • Th1-polarized immune response was induced in the lung. • The expression of antigen presentation-related proteins was altered. • Immune and metabolic regulation function were disturbed.

  6. Thiol dependent NF-κB suppression and inhibition of T-cell mediated adaptive immune responses by a naturally occurring steroidal lactone Withaferin A

    Energy Technology Data Exchange (ETDEWEB)

    Gambhir, Lokesh; Checker, Rahul; Sharma, Deepak; Thoh, M. [Radiation Biology & Health Sciences Division, Bio-science Group, Bhabha Atomic Research Centre, Mumbai (India); Patil, Anand [Advanced Centre for Treatment Research and Education in Cancer, Kharghar, Navi Mumbai (India); Degani, M. [Institute of Chemical Technology, Matunga, Mumbai (India); Gota, Vikram [Advanced Centre for Treatment Research and Education in Cancer, Kharghar, Navi Mumbai (India); Sandur, Santosh K., E-mail: sskumar@barc.gov.in [Radiation Biology & Health Sciences Division, Bio-science Group, Bhabha Atomic Research Centre, Mumbai (India)

    2015-12-01

    Withaferin A (WA), a steroidal lactone isolated from ayurvedic medicinal plant Withania somnifera, was shown to inhibit tumor growth by inducing oxidative stress and suppressing NF-κB pathway. However, its effect on T-cell mediated adaptive immune responses and the underlying mechanism has not been investigated. Since both T-cell responses and NF-κB pathway are known to be redox sensitive, the present study was undertaken to elucidate the effect of WA on adaptive immune responses in vitro and in vivo. WA inhibited mitogen induced T-cell and B-cell proliferation in vitro without inducing any cell death. It inhibited upregulation of T-cell (CD25, CD69, CD71 and CD54) and B-cell (CD80, CD86 and MHC-II) activation markers and secretion of Th1 and Th2 cytokines. WA induced oxidative stress by increasing the basal ROS levels and the immunosuppressive effects of WA were abrogated only by thiol anti-oxidants. The redox modulatory effects of WA in T-cells were attributed to its ability to directly interact with free thiols. WA inhibited NF-κB nuclear translocation in lymphocytes and prevented the direct binding of nuclear NF-κB to its consensus sequence. MALDI-TOF analysis using a synthetic NF-κB-p50 peptide containing Cys-62 residue suggested that WA can modify the cysteine residue of NF-κB. The pharmacokinetic studies for WA were also carried out and in vivo efficacy of WA was studied using mouse model of Graft-versus-host disease. In conclusion, WA is a potent inhibitor of T-cell responses and acts via a novel thiol dependent mechanism and inhibition of NF-κB pathway. - Highlights:: • Withaferin A (WA) inhibited T-cell and B-cell mediated immune responses. • WA increased basal ROS levels in lymphocytes. • WA directly interacted with GSH as studied using spectrophotometry and HPLC. • WA inhibited NF-κB nuclear translocation and binding of nuclear NF-κB to DNA. • WA inhibited induction of the graft-versus-host disease in mice.

  7. Impaired immune function in children and adults with Fanconi anemia.

    Science.gov (United States)

    Myers, Kasiani C; Sauter, Sharon; Zhang, Xue; Bleesing, Jacob J; Davies, Stella M; Wells, Susanne I; Mehta, Parinda A; Kumar, Ashish; Marmer, Daniel; Marsh, Rebecca; Brown, Darron; Butsch Kovacic, Melinda

    2017-11-01

    Fanconi anemia (FA) is a rare genetic disorder characterized by genome instability, bone marrow failure, and cancer predisposition. Previously, small studies have reported heterogeneous immune dysfunction in FA. We performed a detailed immunologic assessment in a large FA cohort who have not undergone bone marrow transplantation or developed malignancies. Comprehensive quantitative and functional immunologic assessment of 29 FA individuals was compared to healthy age-matched controls. Compared to non-FA persons of similar ages, FA individuals showed lower absolute total B cells (P candida (P = 0.019), were diminished in FA. Phytohemagglutinin responses and plasma cytokines were normal. Within FA subjects, adults and older children (≥10 years) exhibited higher CD8 + T cells than younger children (P = 0.004). Documented atypical infections were infrequent, although oral human papilloma virus (HPV) prevalence was higher (31% positive) in FA. Overall, these results demonstrate a high rate of significant humoral and cellular immune dysfunction. Continued longitudinal study of immune function is critical to understand evolution with age, bone marrow failure, and cancer development. © 2017 Wiley Periodicals, Inc.

  8. Jungle Honey Enhances Immune Function and Antitumor Activity

    Directory of Open Access Journals (Sweden)

    Miki Fukuda

    2011-01-01

    Full Text Available Jungle honey (JH is collected from timber and blossom by wild honey bees that live in the tropical forest of Nigeria. JH is used as a traditional medicine for colds, skin inflammation and burn wounds as well as general health care. However, the effects of JH on immune functions are not clearly known. Therefore, we investigated the effects of JH on immune functions and antitumor activity in mice. Female C57BL/6 mice were injected with JH (1 mg/mouse/day, seven times intra-peritoneal. After seven injections, peritoneal cells (PC were obtained. Antitumor activity was assessed by growth of Lewis Lung Carcinoma/2 (LL/2 cells. PC numbers were increased in JH-injected mice compared to control mice. In Dot Plot analysis by FACS, a new cell population appeared in JH-injected mice. The percent of Gr-1 surface antigen and the intensity of Gr-1 antigen expression of PC were increased in JH-injected mice. The new cell population was neutrophils. JH possessed chemotactic activity for neutrophils. Tumor incidence and weight were decreased in JH-injected mice. The ratio of reactive oxygen species (ROS producing cells was increased in JH-injected mice. The effective component in JH was fractionized by gel filtration using HPLC and had an approximate molecular weight (MW of 261. These results suggest that neutrophils induced by JH possess potent antitumor activity mediated by ROS and the effective immune component of JH is substrate of MW 261.

  9. Dextromethorphan Inhibits Activations and Functions in Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Der-Yuan Chen

    2013-01-01

    Full Text Available Dendritic cells (DCs play an important role in connecting innate and adaptive immunity. Thus, DCs have been regarded as a major target for the development of immunomodulators. In this study, we examined the effect of dextromethorphan (DXM, a common cough suppressant with a high safety profile, on the activation and function of DCs. In the presence of DXM, the LPS-induced expression of the costimulatory molecules in murine bone marrow-derived dendritic cells (BMDCs was significantly suppressed. In addition, DXM treatment reduced the production of reactive oxygen species (ROS, proinflammatory cytokines, and chemokines in maturing BMDCs that were activated by LPS. Therefore, DXM abrogated the ability of LPS-stimulated DCs to induce Ag-specific T-cell activation, as determined by their decreased proliferation and IFN-γ secretion in mixed leukocyte cultures. Moreover, the inhibition of LPS-induced MAPK activation and NF-κB translocation may contribute to the suppressive effect of DXM on BMDCs. Remarkably, DXM decreased the LPS-induced surface expression of CD80, CD83, and HLA-DR and the secretion of IL-6 and IL-12 in human monocyte-derived dendritic cells (MDDCs. These findings provide a new insight into the impact of DXM treatment on DCs and suggest that DXM has the potential to be used in treating DC-related acute and chronic diseases.

  10. Cortical organization of inhibition-related functions and modulation by psychopathology.

    Science.gov (United States)

    Warren, Stacie L; Crocker, Laura D; Spielberg, Jeffery M; Engels, Anna S; Banich, Marie T; Sutton, Bradley P; Miller, Gregory A; Heller, Wendy

    2013-01-01

    Individual differences in inhibition-related functions have been implicated as risk factors for a broad range of psychopathology, including anxiety and depression. Delineating neural mechanisms of distinct inhibition-related functions may clarify their role in the development and maintenance of psychopathology. The present study tested the hypothesis that activity in common and distinct brain regions would be associated with an ecologically sensitive, self-report measure of inhibition and a laboratory performance measure of prepotent response inhibition. Results indicated that sub-regions of DLPFC distinguished measures of inhibition, whereas left inferior frontal gyrus and bilateral inferior parietal cortex were associated with both types of inhibition. Additionally, co-occurring anxiety and depression modulated neural activity in select brain regions associated with response inhibition. Results imply that specific combinations of anxiety and depression dimensions are associated with failure to implement top-down attentional control as reflected in inefficient recruitment of posterior DLPFC and increased activation in regions associated with threat (MTG) and worry (BA10). Present findings elucidate possible neural mechanisms of interference that could help explain executive control deficits in psychopathology.

  11. Cortical organization of inhibition-related functions and modulation by psychopathology

    Directory of Open Access Journals (Sweden)

    Stacie L. Warren

    2013-06-01

    Full Text Available Individual differences in inhibition-related functions have been implicated as risk factors for a broad range of psychopathology, including anxiety and depression. Delineating neural mechanisms of distinct inhibition-related functions may clarify their role in the development and maintenance of psychopathology. The present study tested the hypothesis that activity in common and distinct brain regions would be associated with an ecologically sensitive, self-report measure of inhibition and a laboratory performance measure of prepotent response inhibition. Results indicated that sub-regions of DLPFC distinguished measures of inhibition, whereas left inferior frontal gyrus and bilateral inferior parietal cortex were associated with both types of inhibition. Additionally, co-occurring anxiety and depression modulated neural activity in select brain regions associated with response inhibition. Results imply that specific combinations of anxiety and depression dimensions are associated with failure to implement top-down attentional control as reflected in inefficient recruitment of posterior DLPFC and increased activation in regions associated with threat (MTG and worry (BA10. Present findings elucidate possible neural mechanisms of interference that could help explain executive control deficits in psychopathology.

  12. Immuno-regulatory function of indoleamine 2,3 dioxygenase through modulation of innate immune responses.

    Directory of Open Access Journals (Sweden)

    Malihe-Sadat Poormasjedi-Meibod

    Full Text Available Successful long-term treatment of type-1 diabetes mainly relies on replacement of β-cells via islet transplantation. Donor shortage is one of the main obstacles preventing transplantation from becoming the treatment of choice. Although animal organs could be an alternative source for transplantation, common immunosuppressive treatments demonstrate low efficacy in preventing xenorejection. Immunoprotective effects of indoleamine 2,3-dioxygenase (IDO on T-cell mediated allorejection has been extensively studied. Our studies revealed that IDO expression by fibroblasts, induced apoptosis in T-cells while not affecting non-immune cell survival/function. Since macrophages play a pivotal role in xenograft rejection, herein we investigated the effect of IDO-induced tryptophan deficiency/kynurenine accumulation on macrophage function/survival. Moreover, we evaluated the local immunosuppressive effect of IDO on islet-xenograft protection. Our results indicated that IDO expression by bystander fibroblasts significantly reduced the viability of primary macrophages via apoptosis induction. Treatment of peritoneal macrophages by IDO-expressing fibroblast conditioned medium significantly reduced their proinflammatory activity through inhibition of iNOS expression. To determine whether IDO-induced tryptophan starvation or kynurenine accumulation is responsible for macrophage apoptosis and inhibition of their proinflammatory activity, Raw264.7 cell viability and proinflammatory responses were evaluated in tryptophan deficient medium or in the presence of kynurenine. Tryptophan deficiency, but not kynurenine accumulation, reduced Raw264.7 cell viability and suppressed their proinflammatory activity. Next a three-dimensional islet-xenograft was engineered by embedding rat islets within either control or IDO-expressing fibroblast-populated collagen matrix. Islets morphology and immune cell infiltration were then studied in the xenografts transplanted into the C57

  13. A novel monoclonal anti-CD81 antibody produced by genetic immunization efficiently inhibits Hepatitis C virus cell-cell transmission.

    Directory of Open Access Journals (Sweden)

    Isabel Fofana

    Full Text Available Hepatitis C virus (HCV infection is a challenge to prevent and treat because of the rapid development of drug resistance and escape. Viral entry is required for initiation, spread, and maintenance of infection, making it an attractive target for antiviral strategies.Using genetic immunization, we produced four monoclonal antibodies (mAbs against the HCV host entry factor CD81. The effects of antibodies on inhibition of HCV infection and dissemination were analyzed in HCV permissive human liver cell lines.The anti-CD81 mAbs efficiently inhibited infection by HCV of different genotypes as well as a HCV escape variant selected during liver transplantation and re-infecting the liver graft. Kinetic studies indicated that anti-CD81 mAbs target a post-binding step during HCV entry. In addition to inhibiting cell-free HCV infection, one antibody was also able to block neutralizing antibody-resistant HCV cell-cell transmission and viral dissemination without displaying any detectable toxicity.A novel anti-CD81 mAb generated by genetic immunization efficiently blocks HCV spread and dissemination. This antibody will be useful to further unravel the role of virus-host interactions during HCV entry and cell-cell transmission. Furthermore, this antibody may be of interest for the development of antivirals for prevention and treatment of HCV infection.

  14. Blockade of the voltage-gated potassium channel Kv1.3 inhibits immune responses in vivo.

    Science.gov (United States)

    Koo, G C; Blake, J T; Talento, A; Nguyen, M; Lin, S; Sirotina, A; Shah, K; Mulvany, K; Hora, D; Cunningham, P; Wunderler, D L; McManus, O B; Slaughter, R; Bugianesi, R; Felix, J; Garcia, M; Williamson, J; Kaczorowski, G; Sigal, N H; Springer, M S; Feeney, W

    1997-06-01

    The voltage activated K+ channel (Kv1.3) has recently been identified as the molecule that sets the resting membrane potential of peripheral human T lymphoid cells. In vitro studies indicate that blockage of Kv1.3 inhibits T cell activation, suggesting that Kv1.3 may be a target for immunosuppression. However, despite the in vitro evidence, there has been no in vivo demonstration that blockade of Kv1.3 will attenuate an immune response. The difficulty is due to species differences, as the channel does not set the membrane potential in rodent peripheral T cells. In this study, we show that the channel is present on peripheral T cells of miniswine. Using the peptidyl Kv1.3 inhibitor, margatoxin, we demonstrate that Kv1.3 also regulates the resting membrane potential, and that blockade of Kv1.3 inhibits, in vivo, both a delayed-type hypersensitivity reaction and an Ab response to an allogeneic challenge. In addition, prolonged Kv1.3 blockade causes reduced thymic cellularity and inhibits the thymic development of T cell subsets. These results provide in vivo evidence that Kv1.3 is a novel target for immunomodulation.

  15. Interleukin-36 cytokines may overcome microbial immune evasion strategies that inhibit interleukin-1 family signaling.

    Science.gov (United States)

    Jensen, Liselotte E

    2017-08-15

    Pathogens deploy immune evasion strategies to successfully establish infections within their hosts. Naturally, the host responds by acquiring mechanisms to counter these strategies. There is increasing evidence that the three interleukin-36 (IL-36) cytokines, IL-36α, IL-36β and IL-36γ, play important roles in host immunity. With a focus on the skin as a target for microbial and viral invasion, the current knowledge of IL-36 functions is reviewed. Furthermore, the hypothesis that the IL-36s have evolved to counteract virulence factors is presented using viruses as an example. The IL-36s are related to IL-1α, IL-1β, IL-18, and IL-33. Numerous viruses affecting the skin have developed immune evasion strategies that neutralize IL-1α, IL-1β, or IL-18 signaling or combinations of these pathways. Through small differences in activation mechanisms and receptor utilization, it is possible that IL-36 signaling may proceed unhindered in the presence of these viral inhibitors. Thus, one physiological function of the IL-36s may be to counteract microbial immune evasion. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  16. [Effects of electromagnetic radiation on health and immune function of operators].

    Science.gov (United States)

    Li, Yan-zhong; Chen, Shao-hua; Zhao, Ke-fu; Gui, Yun; Fang, Si-xin; Xu, Ying; Ma, Zi-jian

    2013-08-01

    To investigate the effects of electromagnetic radiation on the physiological indices and immune function of operators. The general conditions and electromagnetic radiation awareness rate of 205 operators under electromagnetic radiation were evaluated using a self-designed questionnaire. Physical examination, electrocardiography, and routine urine test were performed in these operators. Peripheral blood was collected from the operators under electromagnetic radiation for blood cell counting and biochemical testing, and their peripheral blood lymphocytes were cultured for determination of chromosomal aberrant frequency and micronucleus frequency. The data from these operators (exposure group) were compared with those of 95 ordinary individuals (control group). The chief complaint of giddiness, tiredness, dizziness, and amnesia showed significant differences between the exposure group and control group (P electromagnetic radiation damage was significantly higher in the exposure group than in the control group. The difference in bradycardia was significant between the two groups (P Electromagnetic radiation may lead to the changes in physiological indices, genetic effects, and immune function and affect the health and immune function in operators. The adverse effects are increased as the working years increase. So it is important to strengthen occupational protection of operators under electromagnetic radiation.

  17. Function of endoplasmic reticulum calcium ATPase in innate immunity-mediated programmed cell death

    Science.gov (United States)

    Zhu, Xiaohong; Caplan, Jeffrey; Mamillapalli, Padmavathi; Czymmek, Kirk; Dinesh-Kumar, Savithramma P

    2010-01-01

    Programmed cell death (PCD) initiated at the pathogen-infected sites during the plant innate immune response is thought to prevent the development of disease. Here, we describe the identification and characterization of an ER-localized type IIB Ca2+-ATPase (NbCA1) that function as a regulator of PCD. Silencing of NbCA1 accelerates viral immune receptor N- and fungal-immune receptor Cf9-mediated PCD, as well as non-host pathogen Pseudomonas syringae pv. tomato DC3000 and the general elicitor cryptogein-induced cell death. The accelerated PCD rescues loss-of-resistance phenotype of Rar1, HSP90-silenced plants, but not SGT1-silenced plants. Using a genetically encoded calcium sensor, we show that downregulation of NbCA1 results in the modulation of intracellular calcium signalling in response to cryptogein elicitor. We further show that NbCAM1 and NbrbohB function as downstream calcium decoders in N-immune receptor-mediated PCD. Our results indicate that ER-Ca2+-ATPase is a component of the calcium efflux pathway that controls PCD during an innate immune response. PMID:20075858

  18. COX-2 inhibition improves immunotherapy and is associated with decreased numbers of myeloid-derived suppressor cells in mesothelioma. Celecoxib influences MDSC function

    International Nuclear Information System (INIS)

    Veltman, Joris D; Lambers, Margaretha EH; Nimwegen, Menno van; Hendriks, Rudi W; Hoogsteden, Henk C; Aerts, Joachim GJV; Hegmans, Joost PJJ

    2010-01-01

    Myeloid-derived suppressor cells (MDSC) are a heterogeneous population of immature cells that accumulates in tumour-bearing hosts. These cells are induced by tumour-derived factors (e.g. prostaglandins) and have a critical role in immune suppression. MDSC suppress T and NK cell function via increased expression of arginase I and production of reactive oxygen species (ROS) and nitric oxide (NO). Immune suppression by MDSC was found to be one of the main factors for immunotherapy insufficiency. Here we investigate if the in vivo immunoregulatory function of MDSC can be reversed by inhibiting prostaglandin synthesis by specific COX-2 inhibition focussing on ROS production by MDSC subtypes. In addition, we determined if dietary celecoxib treatment leads to refinement of immunotherapeutic strategies. MDSC numbers and function were analysed during tumour progression in a murine model for mesothelioma. Mice were inoculated with mesothelioma tumour cells and treated with cyclooxygenase-2 (COX-2) inhibitor celecoxib, either as single agent or in combination with dendritic cell-based immunotherapy. We found that large numbers of infiltrating MDSC co-localise with COX-2 expression in those areas where tumour growth takes place. Celecoxib reduced prostaglandin E2 levels in vitro and in vivo. Treatment of tumour-bearing mice with dietary celecoxib prevented the local and systemic expansion of all MDSC subtypes. The function of MDSC was impaired as was noticed by reduced levels of ROS and NO and reversal of T cell tolerance; resulting in refinement of immunotherapy. We conclude that celecoxib is a powerful tool to improve dendritic cell-based immunotherapy and is associated with a reduction in the numbers and suppressive function of MDSC. These data suggest that immunotherapy approaches benefit from simultaneously blocking cyclooxygenase-2 activity

  19. Chromatin versus pathogens: the function of epigenetics in plant immunity

    Science.gov (United States)

    Ding, Bo; Wang, Guo-Liang

    2015-01-01

    To defend against pathogens, plants have developed a sophisticated innate immunity that includes effector recognition, signal transduction, and rapid defense responses. Recent evidence has demonstrated that plants utilize the epigenetic control of gene expression to fine-tune their defense when challenged by pathogens. In this review, we highlight the current understanding of the molecular mechanisms of histone modifications (i.e., methylation, acetylation, and ubiquitination) and chromatin remodeling that contribute to plant immunity against pathogens. Functions of key histone-modifying and chromatin remodeling enzymes are discussed. PMID:26388882

  20. Uptake of apoptotic leukocytes by synovial lining macrophages inhibits immune complex-mediated arthritis.

    Science.gov (United States)

    van Lent, P L; Licht, R; Dijkman, H; Holthuysen, A E; Berden, J H; van den Berg, W B

    2001-11-01

    Previously we have shown that synovial lining macrophages (SLMs) determine the onset of experimental immune complex-mediated arthritis (ICA). During joint inflammation, many leukocytes undergo apoptosis, and removal of leukocytes by SLMs may regulate resolution of inflammation. In this study we investigated binding and uptake of apoptotic leukocytes by SLMs and its impact on the onset of murine experimental arthritis. We used an in vitro model to evaluate phagocytosis of apoptotic cells on chemotaxis. Phagocytosis of apoptotic thymocytes resulted in a significant decrease (58%) of chemotactic activity for polymorphonuclear neutrophils (PMNs). If apoptotic cells were injected directly into a normal murine knee joint, SLMs resulted in a prominent uptake of cells. After ICA induction, electron micrographs showed that apoptotic leukocytes were evidently present in SLMs on days 1 and 2. Injection of apoptotic leukocytes into the knee joint 1 h before induction of ICA significantly inhibited PMN infiltration into the knee joint at 24 h (61% decrease). This study indicates that uptake of apoptotic leukocytes by SLM reduces chemotactic activity and inhibits the onset of experimental arthritis. These findings indicate an important mechanism in the resolution of joint inflammation.

  1. Exploiting immune cell metabolic machinery for functional HIV cure and the prevention of inflammaging

    OpenAIRE

    Palmer, Clovis S.; Palchaudhuri, Riya; Albargy, Hassan; Abdel-Mohsen, Mohamed; Crowe, Suzanne M.

    2018-01-01

    An emerging paradigm in immunology suggests that metabolic reprogramming and immune cell activation and functions are intricately linked. Viral infections, such as HIV infection, as well as cancer force immune cells to undergo major metabolic challenges. Cells must divert energy resources in order to mount an effective immune response. However, the fact that immune cells adopt specific metabolic programs to provide host defense against intracellular pathogens and how this metabolic shift impa...

  2. A non-canonical function of Ezh2 preserves immune homeostasis.

    Science.gov (United States)

    Vasanthakumar, Ajithkumar; Xu, Dakang; Lun, Aaron Tl; Kueh, Andrew J; van Gisbergen, Klaas Pjm; Iannarella, Nadia; Li, Xiaofang; Yu, Liang; Wang, Die; Williams, Bryan Rg; Lee, Stanley Cw; Majewski, Ian J; Godfrey, Dale I; Smyth, Gordon K; Alexander, Warren S; Herold, Marco J; Kallies, Axel; Nutt, Stephen L; Allan, Rhys S

    2017-04-01

    Enhancer of zeste 2 (Ezh2) mainly methylates lysine 27 of histone-H3 (H3K27me3) as part of the polycomb repressive complex 2 (PRC2) together with Suz12 and Eed. However, Ezh2 can also modify non-histone substrates, although it is unclear whether this mechanism has a role during development. Here, we present evidence for a chromatin-independent role of Ezh2 during T-cell development and immune homeostasis. T-cell-specific depletion of Ezh2 induces a pronounced expansion of natural killer T (NKT) cells, although Ezh2-deficient T cells maintain normal levels of H3K27me3. In contrast, removal of Suz12 or Eed destabilizes canonical PRC2 function and ablates NKT cell development completely. We further show that Ezh2 directly methylates the NKT cell lineage defining transcription factor PLZF, leading to its ubiquitination and subsequent degradation. Sustained PLZF expression in Ezh2-deficient mice is associated with the expansion of a subset of NKT cells that cause immune perturbation. Taken together, we have identified a chromatin-independent function of Ezh2 that impacts on the development of the immune system. © 2017 The Authors.

  3. Passive Immunization with Milk Produced from an Immunized Cow Prevents Oral Recolonization by Streptococcus mutans

    Science.gov (United States)

    Shimazaki, Yoshihiro; Mitoma, Morihide; Oho, Takahiko; Nakano, Yoshio; Yamashita, Yoshihisa; Okano, Kaoru; Nakano, Yutaka; Fukuyama, Masataka; Fujihara, Noboru; Nada, Youichi; Koga, Toshihiko

    2001-01-01

    Cell surface protein antigen (PAc) and water-insoluble glucan-synthesizing enzyme (GTF-I) produced by cariogenic Streptococcus mutans are two major factors implicated in the colonization of the human oral cavity by this bacterium. We examined the effect of bovine milk, produced after immunization with a fusion protein of functional domains of these proteins, on the recolonization of S. mutans. To prepare immune milk, a pregnant Holstein cow was immunized with the fusion protein PAcA-GB, a fusion of the saliva-binding alanine-rich region (PAcA) of PAc and the glucan-binding (GB) domain of GTF-I. After eight adult subjects received cetylpyridinium chloride (CPC) treatment, one subgroup (n = 4) rinsed their mouths with immune milk and a control group (n = 4) rinsed with nonimmune milk. S. mutans levels in saliva and dental plaque decreased after CPC treatment in both groups. Mouth rinsing with immune milk significantly inhibited recolonization of S. mutans in saliva and plaque. On the other hand, the numbers of S. mutans cells in saliva and plaque in the control group increased immediately after the CPC treatment and surpassed the baseline level 42 and 28 days, respectively, after the CPC treatment. The ratios of S. mutans to total streptococci in saliva and plaque in the group that received immune milk were lower than those in the control group. These results suggest that milk produced from immunized cow may be useful for controlling S. mutans in the human oral cavity. PMID:11687453

  4. LNA-modified oligonucleotides mediate specific inhibition of microRNA function

    DEFF Research Database (Denmark)

    Ørom, Ulf Andersson; Kauppinen, Sakari; Lund, Anders H

    2006-01-01

    microRNAs are short, endogenous non-coding RNAs that act as post-transcriptional modulators of gene expression. Important functions for microRNAs have been found in the regulation of development, cellular proliferation and differentiation, while perturbed miRNA expression patterns have been...... observed in many human cancers. Here we present a method for specific inhibition of miRNA function through interaction with LNA-modified antisense oligonucleotides and report the specificity of this application. We show that LNA-modified oligonucleotides can inhibit exogenously introduced miRNAs with high...... specificity using a heterologous reporter assay, and furthermore demonstrate their ability to inhibit an endogenous miRNA in Drosophila melanogaster cells, leading to up-regulation of the cognate target protein. The method shows stoichiometric and reliable inhibition of the targeted miRNA and can thus...

  5. Food supplementation and testosterone interact to influence reproductive behavior and immune function in Sceloporus graciosus.

    Science.gov (United States)

    Ruiz, Mayté; French, Susannah S; Demas, Gregory E; Martins, Emília P

    2010-02-01

    The energetic resources in an organism's environment are essential for executing a wide range of life-history functions, including immunity and reproduction. Most energetic budgets, however, are limited, which can lead to trade-offs among competing functions. Increasing reproductive effort tends to decrease immunity in many cases, and increasing total energy via supplemental feedings can eliminate this effect. Testosterone (T), an important regulator of reproduction, and food availability are thus both potential factors regulating life-history processes, yet they are often tested in isolation of each other. In this study, we considered the effect of both food availability and elevated T on immune function and reproductive behavior in sagebrush lizards, Sceloporus graciosus, to assess how T and energy availability affect these trade-offs. We experimentally manipulated diet (via supplemental feedings) and T (via dermal patches) in males from a natural population. We determined innate immune response by calculating the bacterial killing capability of collected plasma exposed to Escherichia coli ex vivo. We measured reproductive behavior by counting the number of courtship displays produced in a 20-min sampling period. We observed an interactive effect of food availability and T-patch on immune function, with food supplementation increasing immunity in T-patch lizards. Additionally, T increased courtship displays in control food lizards. Lizards with supplemental food had higher circulating T than controls. Collectively, this study shows that the energetic state of the animal plays a critical role in modulating the interactions among T, behavior and immunity in sagebrush lizards and likely other species. Copyright 2009 Elsevier Inc. All rights reserved.

  6. Evasion of antiviral innate immunity by Theiler's virus L* protein through direct inhibition of RNase L.

    Directory of Open Access Journals (Sweden)

    Frédéric Sorgeloos

    Full Text Available Theiler's virus is a neurotropic picornavirus responsible for chronic infections of the central nervous system. The establishment of a persistent infection and the subsequent demyelinating disease triggered by the virus depend on the expression of L*, a viral accessory protein encoded by an alternative open reading frame of the virus. We discovered that L* potently inhibits the interferon-inducible OAS/RNase L pathway. The antagonism of RNase L by L* was particularly prominent in macrophages where baseline oligoadenylate synthetase (OAS and RNase L expression levels are elevated, but was detectable in fibroblasts after IFN pretreatment. L* mutations significantly affected Theiler's virus replication in primary macrophages derived from wild-type but not from RNase L-deficient mice. L* counteracted the OAS/RNase L pathway through direct interaction with the ankyrin domain of RNase L, resulting in the inhibition of this enzyme. Interestingly, RNase L inhibition was species-specific as Theiler's virus L* protein blocked murine RNase L but not human RNase L or RNase L of other mammals or birds. Direct RNase L inhibition by L* and species specificity were confirmed in an in vitro assay performed with purified proteins. These results demonstrate a novel viral mechanism to elude the antiviral OAS/RNase L pathway. By targeting the effector enzyme of this antiviral pathway, L* potently inhibits RNase L, underscoring the importance of this enzyme in innate immunity against Theiler's virus.

  7. Pyruvate Kinase M2 Is Required for the Expression of the Immune Checkpoint PD-L1 in Immune Cells and Tumors

    Directory of Open Access Journals (Sweden)

    Eva M. Palsson-McDermott

    2017-10-01

    Full Text Available Blocking interaction of the immune checkpoint receptor PD-1 with its ligand PD-L1 is associated with good clinical outcomes in a broad variety of malignancies. High levels of PD-L1 promote tumor growth by restraining CD8+ T-cell responses against tumors. Limiting PD-L1 expression and function is therefore critical for allowing the development of antitumor immune responses and effective tumor clearance. Pyruvate kinase isoform M2 (PKM2 is also a key player in regulating cancer as well as immune responses. PKM2 catalyzes the final rate-limiting step of glycolysis. Furthermore, PKM2 as a dimer translocates to the nucleus, where it stimulates hypoxia-inducible factor 1α (Hif-1α transactivation domain function and recruitment of p300 to the hypoxia response elements (HRE of Hif-1α target genes. Here, we provide the first evidence of a role for PKM2 in regulating the expression of PD-L1 on macrophages, dendritic cells (DCs, T cells, and tumor cells. LPS-induced expression of PD-L1 in primary macrophages was inhibited by the PKM2 targeting compound TEPP-46. Furthermore, RNA silencing of PKM2 inhibited LPS-induced PD-L1 expression. This regulation occurs through direct binding of PKM2 and Hif-1α to HRE sites on the PD-L1 promoter. Moreover, TEPP-46 inhibited expression of PD-L1 on macrophages, DCs, and T cells as well as tumor cells in a mouse CT26 cancer model. These findings broaden our understanding of how PKM2 may contribute to tumor progression and may explain the upregulation of PD-L1 in the tumor microenvironment.

  8. Bombyx mori and Aedes aegypti form multi-functional immune complexes that integrate pattern recognition, melanization, coagulants, and hemocyte recruitment.

    Science.gov (United States)

    Phillips, Dennis R; Clark, Kevin D

    2017-01-01

    The innate immune system of insects responds to wounding and pathogens by mobilizing multiple pathways that provide both systemic and localized protection. Key localized responses in hemolymph include melanization, coagulation, and hemocyte encapsulation, which synergistically seal wounds and envelop and destroy pathogens. To be effective, these pathways require a targeted deposition of their components to provide protection without compromising the host. Extensive research has identified a large number of the effectors that comprise these responses, but questions remain regarding their post-translational processing, function, and targeting. Here, we used mass spectrometry to demonstrate the integration of pathogen recognition proteins, coagulants, and melanization components into stable, high-mass, multi-functional Immune Complexes (ICs) in Bombyx mori and Aedes aegypti. Essential proteins common to both include phenoloxidases, apolipophorins, serine protease homologs, and a serine protease that promotes hemocyte recruitment through cytokine activation. Pattern recognition proteins included C-type Lectins in B. mori, while A. aegypti contained a protein homologous to Plasmodium-resistant LRIM1 from Anopheles gambiae. We also found that the B. mori IC is stabilized by extensive transglutaminase-catalyzed cross-linking of multiple components. The melanization inhibitor Egf1.0, from the parasitoid wasp Microplitis demolitor, blocked inclusion of specific components into the IC and also inhibited transglutaminase activity. Our results show how coagulants, melanization components, and hemocytes can be recruited to a wound surface or pathogen, provide insight into the mechanism by which a parasitoid evades this immune response, and suggest that insects as diverse as Lepidoptera and Diptera utilize similar defensive mechanisms.

  9. Development and function of human innate immune cells in a humanized mouse model.

    Science.gov (United States)

    Rongvaux, Anthony; Willinger, Tim; Martinek, Jan; Strowig, Till; Gearty, Sofia V; Teichmann, Lino L; Saito, Yasuyuki; Marches, Florentina; Halene, Stephanie; Palucka, A Karolina; Manz, Markus G; Flavell, Richard A

    2014-04-01

    Mice repopulated with human hematopoietic cells are a powerful tool for the study of human hematopoiesis and immune function in vivo. However, existing humanized mouse models cannot support development of human innate immune cells, including myeloid cells and natural killer (NK) cells. Here we describe two mouse strains called MITRG and MISTRG, in which human versions of four genes encoding cytokines important for innate immune cell development are knocked into their respective mouse loci. The human cytokines support the development and function of monocytes, macrophages and NK cells derived from human fetal liver or adult CD34(+) progenitor cells injected into the mice. Human macrophages infiltrated a human tumor xenograft in MITRG and MISTRG mice in a manner resembling that observed in tumors obtained from human patients. This humanized mouse model may be used to model the human immune system in scenarios of health and pathology, and may enable evaluation of therapeutic candidates in an in vivo setting relevant to human physiology.

  10. The tumor necrosis factor-alpha-induced protein 8 family in immune homeostasis and inflammatory cancer diseases.

    Science.gov (United States)

    Luan, Y Y; Yao, Y M; Sheng, Z Y

    2013-01-01

    Within the immune system homeostasis is maintained by a myriad of mechanisms that include the regulation of immune cell activation and programmed cell death. The breakdown of immune homeostasis may lead to fatal inflammatory diseases. We set out to identify genes of tumor necrosis factor-alpha-induced protein 8 (TNFAIP8) family that has a functional role in the process of immune homeostasis. Tumor necrosis factor-alpha-induced protein 8 (TNFAIP8), which functions as an oncogenic molecule, is also associated with enhanced cell survival and inhibition of apoptosis. Tumor necrosis factor-alpha-induced protein 8-like 2 (TIPE2) governs immune homeostasis in both the innate and adaptive immune system and prevents hyper-responsiveness by negatively regulating signaling via T cell receptors and Toll-like receptors (TLRs). There also exist two highly homologous but uncharacterized proteins, TIPE1 and TIPE3. This review is an attempt to provide a summary of TNFAIP8 family associated with immune homeostasis and inflammatory cancer diseases.

  11. The Novel C24D Synthetic Polypeptide Inhibits Binding of Placenta Immunosuppressive Ferritin to Human T Cells and Elicits Anti–Breast Cancer Immunity In Vitro and In Vivo

    Directory of Open Access Journals (Sweden)

    Inna Solodeev

    2014-09-01

    Full Text Available Immune tolerance mechanisms supporting normal human pregnancy are exploited by breast cancer and other malignancies. We cloned from human placenta and breast cancer cells the novel human immunomodulator named placenta immunosuppressive ferritin (PLIF. PLIF is composed of a ferritin heavy chain–like domain and a novel cytokine-like domain, named C48. Both intact PLIF and C48 inhibit T cell proliferation. Blocking PLIF by specific antibodies in a tolerant breast cancer model in nude mice resulted in tumor cell apoptosis and rejection. This prompted us to study active immune preventive strategies targeting PLIF activity. Currently, we report on the design and synthesis of the novel C24D polypeptide, which inhibits the binding of PLIF to T cells and therefore inhibits the immune suppressive effect of PLIF. The effect of C24D on the generation of anti–breast cancer cytotoxic T lymphocytes (CTLs was studied in vitro in cultures of MCF-7 (HLA-A2+ or T47D (HLA-A2− breast cancer cells incubated with peripheral blood mononuclear cells (PBMCs from healthy blood donors. We found that C24D treatment exclusively induced development of CTLs. On reactivation by their specific target cells, the CTLs secreted interferon-γ and induced target apoptosis. Anti–MCF-7 CTLs were cross-cytotoxic to MDA-MB-231 (HLA-A2+ triple-negative breast cancer but not to T47D. Moreover, C24D treatment in vivo inhibited the growth of MCF-7 tumors engrafted in immune-compromised nude mice transfused with naïve allogeneic human PBMCs. Our results demonstrate that C24D treatment breakdown breast cancer induced tolerance enabling the initiation of effective anti-tumor immune response.

  12. HER2-Targeted Polyinosine/Polycytosine Therapy Inhibits Tumor Growth and Modulates the Tumor Immune Microenvironment.

    Science.gov (United States)

    Zigler, Maya; Shir, Alexei; Joubran, Salim; Sagalov, Anna; Klein, Shoshana; Edinger, Nufar; Lau, Jeffrey; Yu, Shang-Fan; Mizraji, Gabriel; Globerson Levin, Anat; Sliwkowski, Mark X; Levitzki, Alexander

    2016-08-01

    The development of targeted therapies that affect multiple signaling pathways and stimulate antitumor immunity is greatly needed. About 20% of patients with breast cancer overexpress HER2. Small molecules and antibodies targeting HER2 convey some survival benefits; however, patients with advanced disease succumb to the disease under these treatment regimens, possibly because HER2 is not completely necessary for the survival of the targeted cancer cells. In the present study, we show that a polyinosine/polycytosine (pIC) HER2-homing chemical vector induced the demise of HER2-overexpressing breast cancer cells, including trastuzumab-resistant cells. Targeting pIC to the tumor evoked a number of cell-killing mechanisms, as well as strong bystander effects. These bystander mechanisms included type I IFN induction, immune cell recruitment, and activation. The HER2-targeted pIC strongly inhibited the growth of HER2-overexpressing tumors in immunocompetent mice. The data presented here could open additional avenues in the treatment of HER2-positive breast cancer. Cancer Immunol Res; 4(8); 688-97. ©2016 AACR. ©2016 American Association for Cancer Research.

  13. Mercuric ions inhibit mitogen-activated protein kinase dephosphorylation by inducing reactive oxygen species

    International Nuclear Information System (INIS)

    Haase, Hajo; Engelhardt, Gabriela; Hebel, Silke; Rink, Lothar

    2011-01-01

    Mercury intoxication profoundly affects the immune system, in particular, signal transduction of immune cells. However, the mechanism of the interaction of mercury with cellular signaling pathways, such as mitogen activated protein kinases (MAPK), remains elusive. Therefore, the objective of this study is to investigate three potential ways in which Hg 2+ ions could inhibit MAPK dephosphorylation in the human T-cell line Jurkat: (1) by direct binding to phosphatases; (2) by releasing cellular zinc (Zn 2+ ); and (3) by inducing reactive oxygen species (ROS). Hg 2+ causes production of ROS, measured by dihydrorhodamine 123, and triggers ROS-mediated Zn 2+ release, detected with FluoZin-3. Yet, phosphatase-inhibition is not mediated by binding of Zn 2+ or Hg 2+ . Rather, phosphatases are inactivated by at least two forms of thiol oxidation; initial inhibition is reversible with reducing agents such as Tris(2-carboxyethyl)phosphine. Prolonged inhibition leads to non-reversible phosphatase oxidation, presumably oxidizing the cysteine thiol to sulfinic- or sulfonic acid. Notably, phosphatases are a particularly sensitive target for Hg 2+ -induced oxidation, because phosphatase activity is inhibited at concentrations of Hg 2+ that have only minor impact on over all thiol oxidation. This phosphatase inhibition results in augmented, ROS-dependent MAPK phosphorylation. MAPK are important regulators of T-cell function, and MAPK-activation by inhibition of phosphatases seems to be one of the molecular mechanisms by which mercury affects the immune system.

  14. Immune Monitoring in Cancer Vaccine Clinical Trials: Critical Issues of Functional Flow Cytometry-Based Assays

    Directory of Open Access Journals (Sweden)

    Iole Macchia

    2013-01-01

    Full Text Available The development of immune monitoring assays is essential to determine the immune responses against tumor-specific antigens (TSAs and tumor-associated antigens (TAAs and their possible correlation with clinical outcome in cancer patients receiving immunotherapies. Despite the wide range of techniques used, to date these assays have not shown consistent results among clinical trials and failed to define surrogate markers of clinical efficacy to antitumor vaccines. Multiparameter flow cytometry- (FCM- based assays combining different phenotypic and functional markers have been developed in the past decade for informative and longitudinal analysis of polyfunctional T-cells. These technologies were designed to address the complexity and functional heterogeneity of cancer biology and cellular immunity and to define biomarkers predicting clinical response to anticancer treatment. So far, there is still a lack of standardization of some of these immunological tests. The aim of this review is to overview the latest technologies for immune monitoring and to highlight critical steps involved in some of the FCM-based cellular immune assays. In particular, our laboratory is focused on melanoma vaccine research and thus our main goal was the validation of a functional multiparameter test (FMT combining different functional and lineage markers to be applied in clinical trials involving patients with melanoma.

  15. The role of the immune system in kidney disease.

    Science.gov (United States)

    Tecklenborg, J; Clayton, D; Siebert, S; Coley, S M

    2018-05-01

    The immune system and the kidneys are closely linked. In health the kidneys contribute to immune homeostasis, while components of the immune system mediate many acute forms of renal disease and play a central role in progression of chronic kidney disease. A dysregulated immune system can have either direct or indirect renal effects. Direct immune-mediated kidney diseases are usually a consequence of autoantibodies directed against a constituent renal antigen, such as collagen IV in anti-glomerular basement membrane disease. Indirect immune-mediated renal disease often follows systemic autoimmunity with immune complex formation, but can also be due to uncontrolled activation of the complement pathways. Although the range of mechanisms of immune dysregulation leading to renal disease is broad, the pathways leading to injury are similar. Loss of immune homeostasis in renal disease results in perpetual immune cell recruitment and worsening damage to the kidney. Uncoordinated attempts at tissue repair, after immune-mediated disease or non-immune mediated injury, result in fibrosis of structures important for renal function, leading eventually to kidney failure. As renal disease often manifests clinically only when substantial damage has already occurred, new diagnostic methods and indeed treatments must be identified to inhibit further progression and promote appropriate tissue repair. Studying cases in which immune homeostasis is re-established may reveal new treatment possibilities. © 2018 British Society for Immunology.

  16. Constant illumination reduces circulating melatonin and impairs immune function in the cricket Teleogryllus commodus

    Directory of Open Access Journals (Sweden)

    Joanna Durrant

    2015-07-01

    Full Text Available Exposure to constant light has a range of negative effects on behaviour and physiology, including reduced immune function in both vertebrates and invertebrates. It is proposed that the associated suppression of melatonin (a ubiquitous hormone and powerful antioxidant in response to the presence of light at night could be an underlying mechanistic link driving the changes to immune function. Here, we investigated the relationship between constant illumination, melatonin and immune function, using a model invertebrate species, the Australian black field cricket, Teleogryllus commodus. Crickets were reared under either a 12 h light: 12 h dark regimen or a constant 24 h light regimen. Circulating melatonin concentration and immune function (haemocyte concentration, lytic activity and phenoloxidase (PO activity were assessed in individual adult crickets through the analysis of haemolymph. Constant illumination reduced melatonin and had a negative impact on haemocyte concentrations and lytic activity, but its effect on PO activity was less apparent. Our data provide the first evidence, to our knowledge, of a link between exposure to constant illumination and variation in haemocyte concentration in an invertebrate model, while also highlighting the potential complexity of the immune response following exposure to constant illumination. This study provides insight into the possible negative effect of artificial night-time lighting on the physiology of invertebrates, but whether lower and potentially more ecologically relevant levels of light at night produce comparable results, as has been reported in several vertebrate taxa, remains to be tested.

  17. Fluorescence Adherence Inhibition Assay: A Novel Functional Assessment of Blocking Virus Attachment by Vaccine-Induced Antibodies.

    Directory of Open Access Journals (Sweden)

    Atul Asati

    Full Text Available Neutralizing antibodies induced by vaccination or natural infection play a critically important role in protection against the viral diseases. In general, neutralization of the viral infection occurs via two major pathways: pre- and post-attachment modes, the first being the most important for such infections as influenza and polio, the latter being significant for filoviruses. Neutralizing capacity of antibodies is typically evaluated by virus neutralization assays that assess reduction of viral infectivity to the target cells in the presence of functional antibodies. Plaque reduction neutralization test, microneutralization and immunofluorescent assays are often used as gold standard virus neutralization assays. However, these methods are associated with several important prerequisites such as use of live virus requiring safety precautions, tedious evaluation procedure and long assessment time. Hence, there is a need for a robust, inexpensive high throughput functional assay that can be performed rapidly using inactivated virus, without extensive safety precautions. Herein, we report a novel high throughput Fluorescence Adherence Inhibition assay (fADI using inactivated virus labeled with fluorescent secondary antibodies virus and Vero cells or erythrocytes as targets. It requires only few hours to assess pre-attachment neutralizing capacity of donor sera. fADI assay was tested successfully on donors immunized with polio, yellow fever and influenza vaccines. To further simplify and improve the throughput of the assay, we have developed a mathematical approach for calculating the 50% titers from a single sample dilution, without the need to analyze multi-point titration curves. Assessment of pre- and post-vaccination human sera from subjects immunized with IPOL®, YF-VAX® and 2013-2014 Fluzone® vaccines demonstrated high efficiency of the assay. The results correlated very well with microneutralization assay performed independently by the FDA

  18. Clinical evaluation of immune-promoting functions of the developed product (HemoHIM)

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kyoung Soo; Lee, Ill Kyoo; Kwon, Soon Gil [The Catholic University of Korea, Seoul (Korea, Republic of)

    2007-07-15

    We performed a clinical study to evaluate the immune promotion and antioxidant effects of the developed product (HemoHIM) in healthy or subhealthy people. Volunteers with white blood cell numbers between 5000 and 10000/ul were recruited and the subjects were selected by appropriate inclusion and exclusion rules. The subjects were randomly assigned to 3 groups (HemoHIM 6g/day, HemoHIM 12g/day, Placebo). HemoHIM or placebo were adminstered for 2 months and the blood were collected and analyzed at 1 month and 2 month after the intake. The collected blood was analyzed for blood cell number, serum biochemical values (liver and kidney function), immunological activity of blood cells, antioxidant activity of blood plasma, and stress hormone level in the saliva. Finally the data of 88 subjects were analyzed for the immune promoting and antioxidant effects of HemoHIM. In results, no significant changes in blood cell numbers (white blood cell, lymphocyte, red blood cell) were observed in HemoHIM intake groups. However, NK cell activity were increased in HemoHIM intake groups and also IFN-gamma and IL-12, the biomarkers of immune cell functions, were increased in proportion to the dose and intake periode of HemoHIM. The antioxidant biomarker (TAS) was not significantly changed by HemoHIM intake. Besides, the serum biochemical analysis for liver and kidney functions, and the general medical examination showed the HemoHIM showed no side-effects, thus reconfirming its safety in humans. In conclusion, this study showed HemoHIM has a significant effects on the promotion of immune functions, while it has neither side-effects nor toxicity in humans. The results of this study may be utilized for the scientific data to acquire the Health Functional Food Certification of HemoHIM from Korea FDA

  19. Vaccinia Virus Protein C6 Inhibits Type I IFN Signalling in the Nucleus and Binds to the Transactivation Domain of STAT2.

    Directory of Open Access Journals (Sweden)

    Jennifer H Stuart

    2016-12-01

    Full Text Available The type I interferon (IFN response is a crucial innate immune signalling pathway required for defense against viral infection. Accordingly, the great majority of mammalian viruses possess means to inhibit this important host immune response. Here we show that vaccinia virus (VACV strain Western Reserve protein C6, is a dual function protein that inhibits the cellular response to type I IFNs in addition to its published function as an inhibitor of IRF-3 activation, thereby restricting type I IFN production from infected cells. Ectopic expression of C6 inhibits the induction of interferon stimulated genes (ISGs in response to IFNα treatment at both the mRNA and protein level. C6 inhibits the IFNα-induced Janus kinase/signal transducer and activator of transcription (JAK/STAT signalling pathway at a late stage, downstream of STAT1 and STAT2 phosphorylation, nuclear translocation and binding of the interferon stimulated gene factor 3 (ISGF3 complex to the interferon stimulated response element (ISRE. Mechanistically, C6 associates with the transactivation domain of STAT2 and this might explain how C6 inhibits the type I IFN signalling very late in the pathway. During virus infection C6 reduces ISRE-dependent gene expression despite the presence of the viral protein phosphatase VH1 that dephosphorylates STAT1 and STAT2. The ability of a cytoplasmic replicating virus to dampen the immune response within the nucleus, and the ability of viral immunomodulators such as C6 to inhibit multiple stages of the innate immune response by distinct mechanisms, emphasizes the intricacies of host-pathogen interactions and viral immune evasion.

  20. Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity

    Directory of Open Access Journals (Sweden)

    Harmit S. Ranhotra

    2016-07-01

    Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.

  1. Inhibition of human peripheral blood lymphocyte function by protoporphyrin and longwave ultraviolet light

    International Nuclear Information System (INIS)

    Barrett, K.E.; Yen, A.; Montisano, D.; Gigli, I.; Bigby, T.D.

    1994-01-01

    Modulation of immunologic effector cells by exogenous photoactive substances has been advanced as an underlying mechanism for the efficacy of various photochemotherapeutic regimens. It is also possible that endogenous photosensitizers, such as protoporphyrin, could similarly modify the function of immune cell types. The authors examined the effects of protoporphyrin plus longwave UV light on the ability of human PBL to proliferate in response to mitogens. Noncytotoxic dosages of protoporphyrin plus UV light suppressed PHA-stimulated proliferation of both PBMC and enriched T cells. CD8 + cells were more sensitive to this inhibitory effect than CD4 + cells. The inhibitory effect was also observed when proliferation was induced by the combination of a phorbol ester and ionomycin. Inhibition of PBMC proliferation was associated with inhibition of IL-2 secretion but proliferation was not restored with exogenous IL-2. Instead, the effect of protoporphyrin plus UV light may be on IL-2R. Cells treated with protoporphyrin and UV light did not display the increase in CD25 and β-chain of the IL-2R induced by PHA in control cells. In contrast to the effects of protoporphyrin and UV light on IL-2 and IL-2R α-chain protein expression, the accumulation of mRNA for these proteins induced by PHA was unaffected. None of the effects of protoporphyrin plus UV light on lymphocytes were observed in control experiments where cells were treated with either protoporphyrin or UV light alone. They conclude that biologically relevant dosages of protoporphyrin and UV light modify the function of circulating lymphocytes. 26 refs., 8 figs., 1 tab

  2. The role of dehydroepiandrosterone on functional innate immune responses to acute stress.

    Science.gov (United States)

    Prall, Sean P; Larson, Emilee E; Muehlenbein, Michael P

    2017-12-01

    The androgen dehydroepiandrosterone (DHEA) responds to stress activation, exhibits anti-glucocorticoid properties, and modulates immunity in diverse ways, yet little is known of its role in acute stress responses. In this study, the effects of DHEA and its sulfate ester DHEA-S on human male immune function during exposure to an acute stressor is explored. Variation in DHEA, DHEA-S, testosterone, and cortisol, along with bacterial killing assays, was measured in response to a modified Trier Social Stress test in 27 young adult males. Cortisol was positively related to salivary innate immunity but only for participants who also exhibited high DHEA responses. Additionally, DHEA positively and DHEA-S negatively predicted salivary immunity, but the opposite was observed for serum-based innate immunity. The DHEA response to acute stress appears to be an important factor in stress-mediated immunological responses, with differential effects on immunity dependent upon the presence of other hormones, primarily cortisol and DHEA-S. These results suggest that DHEA plays an important role, alongside other hormones, in modulating immunological shifts during acute stress. Copyright © 2017 John Wiley & Sons, Ltd.

  3. Exploiting immune cell metabolic machinery for functional HIV cure and the prevention of inflammaging.

    Science.gov (United States)

    Palmer, Clovis S; Palchaudhuri, Riya; Albargy, Hassan; Abdel-Mohsen, Mohamed; Crowe, Suzanne M

    2018-01-01

    An emerging paradigm in immunology suggests that metabolic reprogramming and immune cell activation and functions are intricately linked. Viral infections, such as HIV infection, as well as cancer force immune cells to undergo major metabolic challenges. Cells must divert energy resources in order to mount an effective immune response. However, the fact that immune cells adopt specific metabolic programs to provide host defense against intracellular pathogens and how this metabolic shift impacts immune cell functions and the natural course of diseases have only recently been appreciated. A clearer insight into how these processes are inter-related will affect our understanding of several fundamental aspects of HIV persistence. Even in patients with long-term use of anti-retroviral therapies, HIV infection persists and continues to cause chronic immune activation and inflammation, ongoing and cumulative damage to multiple organs systems, and a reduction in life expectancy. HIV-associated fundamental changes to the metabolic machinery of the immune system can promote a state of "inflammaging", a chronic, low-grade inflammation with specific immune changes that characterize aging, and can also contribute to the persistence of HIV in its reservoirs. In this commentary, we will bring into focus evolving concepts on how HIV modulates the metabolic machinery of immune cells in order to persist in reservoirs and how metabolic reprogramming facilitates a chronic state of inflammation that underlies the development of age-related comorbidities. We will discuss how immunometabolism is facilitating the changing paradigms in HIV cure research and outline the novel therapeutic opportunities for preventing inflammaging and premature development of age-related conditions in HIV + individuals.

  4. Obligate brood parasites show more functionally effective innate immune responses: an eco-immunological hypothesis

    Science.gov (United States)

    Hahn, D. Caldwell; Summers, Scott G.; Genovese, Kenneth J.; He, Haiqi; Kogut, Michael H.

    2013-01-01

    Immune adaptations of obligate brood parasites attracted interest when three New World cowbird species (Passeriformes, Icteridae, genus Molothrus) proved unusually resistant to West Nile virus. We have used cowbirds as models to investigate the eco-immunological hypothesis that species in parasite-rich environments characteristically have enhanced immunity as a life history adaptation. As part of an ongoing program to understand the cowbird immune system, in this study we measured degranulation and oxidative burst, two fundamental responses of the innate immune system. Innate immunity provides non-specific, fast-acting defenses against a variety of invading pathogens, and we hypothesized that innate immunity experiences particularly strong selection in cowbirds, because their life history strategy exposes them to diverse novel and unpredictable parasites. We compared the relative effectiveness of degranulation and oxidative burst responses in two cowbird species and one related, non-parasitic species. Both innate immune defenses were significantly more functionally efficient in the two parasitic cowbird species than in the non-parasitic red-winged blackbird (Icteridae, Agelaius phoeniceus). Additionally, both immune defenses were more functionally efficient in the brown-headed cowbird (M. ater), an extreme host-generalist brood parasite, than in the bronzed cowbird (M. aeneus), a moderate host-specialist with lower exposure to other species and their parasites. Thus the relative effectiveness of these two innate immune responses corresponds to the diversity of parasites in the niche of each species and to their relative resistance to WNV. This study is the first use of these two specialized assays in a comparative immunology study of wild avian species.

  5. Structural basis for Marburg virus VP35-mediated immune evasion mechanisms

    Energy Technology Data Exchange (ETDEWEB)

    Ramanan, Parameshwaran; Edwards, Megan R.; Shabman, Reed S.; Leung, Daisy W.; Endlich-Frazier, Ariel C.; Borek, Dominika M.; Otwinowski, Zbyszek; Liu, Gai; Huh, Juyoung; Basler, Christopher F.; Amarasinghe, Gaya K. [Sinai; (WU-MED); (UTSMC)

    2013-07-22

    Filoviruses, marburgvirus (MARV) and ebolavirus (EBOV), are causative agents of highly lethal hemorrhagic fever in humans. MARV and EBOV share a common genome organization but show important differences in replication complex formation, cell entry, host tropism, transcriptional regulation, and immune evasion. Multifunctional filoviral viral protein (VP) 35 proteins inhibit innate immune responses. Recent studies suggest double-stranded (ds)RNA sequestration is a potential mechanism that allows EBOV VP35 to antagonize retinoic-acid inducible gene-I (RIG-I) like receptors (RLRs) that are activated by viral pathogen–associated molecular patterns (PAMPs), such as double-strandedness and dsRNA blunt ends. Here, we show that MARV VP35 can inhibit IFN production at multiple steps in the signaling pathways downstream of RLRs. The crystal structure of MARV VP35 IID in complex with 18-bp dsRNA reveals that despite the similar protein fold as EBOV VP35 IID, MARV VP35 IID interacts with the dsRNA backbone and not with blunt ends. Functional studies show that MARV VP35 can inhibit dsRNA-dependent RLR activation and interferon (IFN) regulatory factor 3 (IRF3) phosphorylation by IFN kinases TRAF family member-associated NFkb activator (TANK) binding kinase-1 (TBK-1) and IFN kB kinase e (IKKe) in cell-based studies. We also show that MARV VP35 can only inhibit RIG-I and melanoma differentiation associated gene 5 (MDA5) activation by double strandedness of RNA PAMPs (coating backbone) but is unable to inhibit activation of RLRs by dsRNA blunt ends (end capping). In contrast, EBOV VP35 can inhibit activation by both PAMPs. Insights on differential PAMP recognition and inhibition of IFN induction by a similar filoviral VP35 fold, as shown here, reveal the structural and functional plasticity of a highly conserved virulence factor.

  6. T cell immunity

    OpenAIRE

    Emel Bülbül Başkan

    2013-01-01

    Since birth, our immune system is constantly bombarded with self-antigens and foreign pathogens. To stay healthy, complex immune strategies have evolved in our immune system to maintain self-tolerance and to defend against foreign pathogens. Effector T cells are the key players in steering the immune responses to execute immune functions. While effector T cells were initially identified to be immune promoting, recent studies unraveled negative regulatory functions of effector T cells...

  7. Mesenchymal Stromal Cells Can Regulate the Immune Response in the Tumor Microenvironment

    Directory of Open Access Journals (Sweden)

    Alessandro Poggi

    2016-11-01

    Full Text Available The tumor microenvironment is a good target for therapy in solid tumors and hematological malignancies. Indeed, solid tumor cells’ growth and expansion can influence neighboring cells’ behavior, leading to a modulation of mesenchymal stromal cell (MSC activities and remodeling of extracellular matrix components. This leads to an altered microenvironment, where reparative mechanisms, in the presence of sub-acute inflammation, are not able to reconstitute healthy tissue. Carcinoma cells can undergo epithelial mesenchymal transition (EMT, a key step to generate metastasis; these mesenchymal-like cells display the functional behavior of MSC. Furthermore, MSC can support the survival and growth of leukemic cells within bone marrow participating in the leukemic cell niche. Notably, MSC can inhibit the anti-tumor immune response through either carcinoma-associated fibroblasts or bone marrow stromal cells. Experimental data have indicated their relevance in regulating cytolytic effector lymphocytes of the innate and adaptive arms of the immune system. Herein, we will discuss some of the evidence in hematological malignancies and solid tumors. In particular, we will focus our attention on the means by which it is conceivable to inhibit MSC-mediated immune suppression and trigger anti-tumor innate immunity.

  8. Effects of stress on immune function: the good, the bad, and the beautiful.

    Science.gov (United States)

    Dhabhar, Firdaus S

    2014-05-01

    Although the concept of stress has earned a bad reputation, it is important to recognize that the adaptive purpose of a physiological stress response is to promote survival during fight or flight. While long-term stress is generally harmful, short-term stress can be protective as it prepares the organism to deal with challenges. This review discusses the immune effects of biological stress responses that can be induced by psychological, physiological, or physical (including exercise) stressors. We have proposed that short-term stress is one of the nature's fundamental but under-appreciated survival mechanisms that could be clinically harnessed to enhance immunoprotection. Short-term (i.e., lasting for minutes to hours) stress experienced during immune activation enhances innate/primary and adaptive/secondary immune responses. Mechanisms of immuno-enhancement include changes in dendritic cell, neutrophil, macrophage, and lymphocyte trafficking, maturation, and function as well as local and systemic production of cytokines. In contrast, long-term stress suppresses or dysregulates innate and adaptive immune responses by altering the Type 1-Type 2 cytokine balance, inducing low-grade chronic inflammation, and suppressing numbers, trafficking, and function of immunoprotective cells. Chronic stress may also increase susceptibility to some types of cancer by suppressing Type 1 cytokines and protective T cells and increasing regulatory/suppressor T cell function. Here, we classify immune responses as being protective, pathological, or regulatory, and discuss "good" versus "bad" effects of stress on health. Thus, short-term stress can enhance the acquisition and/or expression of immunoprotective (wound healing, vaccination, anti-infectious agent, anti-tumor) or immuno-pathological (pro-inflammatory, autoimmune) responses. In contrast, chronic stress can suppress protective immune responses and/or exacerbate pathological immune responses. Studies such as the ones discussed

  9. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions.

    Science.gov (United States)

    Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G

    2017-07-25

    We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected

  10. Effects of water extract of Curcuma longa (L.) roots on immunity and telomerase function.

    Science.gov (United States)

    Pan, Min-Hsiung; Wu, Jia-Ching; Ho, Chi-Tang; Badmaev, Vladimir

    2017-05-12

    Background Immunity and Longevity Methods A water extract of Curcuma longa (L.) [vern. Turmeric] roots (TurmericImmune™) standardized for a minimum 20 % of turmeric polysaccharides ukonan A, B, C and D was evaluated for its biological properties in in vitro tissue culture studies. Results The water extract of turmeric (TurP) exhibited induced-nitric oxide (NO) production in RAW264.7 macrophages. These results suggested the immunomodulatory effects of TurP. In addition, the polysaccharides up-regulated function of telomerase reverse transcriptase (TERT) equally to the phenolic compound from turmeric, curcumin. Conclusions The ukonan family of polysaccharides may assist in promoting cellular immune responses, tissue repair and lifespan by enhancing immune response and telomere function.

  11. The effect of elevated reproductive effort onhumoral immune function in collared flycatcher females

    Science.gov (United States)

    Cichoń, Mariusz; Dubiec, Anna; Chadzińska, Magdalena

    2001-02-01

    In order to test whether high reproductive investments impair immune function in naturally breeding collared flycatchers, we performed a brood manipulation experiment and simultaneously induced an immune response by challenging birds with a non-pathogenic antigen - sheep red blood cells (SRBC). Females rearing experimentally enlarged number of nestlings showed significantly lower level of specific anti-SRBC antibodies than control females attending unaltered broods, but only in one of the two study years. The haemoconcentration of leukocytes did not differ between the two groups in both study years. The significant difference in immunological responsiveness between control and enlarged group coincided with differences in survival probability to the next breeding season: females attending enlarged broods showed lower probability of survival than control females, but there was no relationship between the level of immune response and survival probability. Our results indicate that reproduction may indeed trade for resources with immune functions at least in terms of specific antibody production. However, as in the other studies on reproductive costs, these costs seem not always to be pronounced.

  12. The Notch Signaling Pathway Is Balancing Type 1 Innate Lymphoid Cell Immune Functions

    Directory of Open Access Journals (Sweden)

    Thibaut Perchet

    2018-06-01

    Full Text Available The Notch pathway is one of the canonical signaling pathways implicated in the development of various solid tumors. During carcinogenesis, the Notch pathway dysregulation induces tumor expression of Notch receptor ligands participating to escape the immune surveillance. The Notch pathway conditions both the development and the functional regulation of lymphoid subsets. Its importance on T cell subset polarization has been documented contrary to its action on innate lymphoid cells (ILC. We aim to analyze the effect of the Notch pathway on type 1 ILC polarization and functions after disruption of the RBPJk-dependent Notch signaling cascade. Indeed, type 1 ILC comprises conventional NK (cNK cells and type 1 helper innate lymphoid cells (ILC1 that share Notch-related functional characteristics such as the IFNg secretion downstream of T-bet expression. cNK cells have strong antitumor properties. However, data are controversial concerning ILC1 functions during carcinogenesis with models showing antitumoral capacities and others reporting ILC1 inability to control tumor growth. Using various mouse models of Notch signaling pathway depletion, we analyze the effects of its absence on type 1 ILC differentiation and cytotoxic functions. We also provide clues into its role in the maintenance of immune homeostasis in tissues. We show that modulating the Notch pathway is not only acting on tumor-specific T cell activity but also on ILC immune subset functions. Hence, our study uncovers the intrinsic Notch signaling pathway in ILC1/cNK populations and their response in case of abnormal Notch ligand expression. This study help evaluating the possible side effects mediated by immune cells different from T cells, in case of multivalent forms of the Notch receptor ligand delta 1 treatments. In definitive, it should help determining the best novel combination of therapeutic strategies in case of solid tumors.

  13. The Phagocytic Function of Macrophage-Enforcing Innate Immunity and Tissue Homeostasis

    Directory of Open Access Journals (Sweden)

    Daisuke Hirayama

    2017-12-01

    Full Text Available Macrophages are effector cells of the innate immune system that phagocytose bacteria and secrete both pro-inflammatory and antimicrobial mediators. In addition, macrophages play an important role in eliminating diseased and damaged cells through their programmed cell death. Generally, macrophages ingest and degrade dead cells, debris, tumor cells, and foreign materials. They promote homeostasis by responding to internal and external changes within the body, not only as phagocytes, but also through trophic, regulatory, and repair functions. Recent studies demonstrated that macrophages differentiate from hematopoietic stem cell-derived monocytes and embryonic yolk sac macrophages. The latter mainly give rise to tissue macrophages. Macrophages exist in all vertebrate tissues and have dual functions in host protection and tissue injury, which are maintained at a fine balance. Tissue macrophages have heterogeneous phenotypes in different tissue environments. In this review, we focused on the phagocytic function of macrophage-enforcing innate immunity and tissue homeostasis for a better understanding of the role of tissue macrophages in several pathological conditions.

  14. Modulation of immune cell functions by the E3 ligase CBL-b

    Directory of Open Access Journals (Sweden)

    Christina eLutz-Nicoladoni

    2015-03-01

    Full Text Available Maintenance of immunological tolerance is a critical hallmark of the immune system. Several signaling checkpoints necessary to balance activating and inhibitory input to immune cells have been described so far, among which the E3 ligase Cbl-b appears to be a central player. Cbl-b is expressed in all leukocyte subsets and regulates several signaling pathways in T cells, NK cells, B cells and different types of myeloid cells. In most cases Cbl-b negatively regulates activation signals through antigen or pattern recognition receptors and co-stimulatory molecules. In line with this function, cblb-deficient immune cells display lower activation thresholds and cblb knockout mice spontaneously develop autoimmunity and are highly susceptible to experimental autoimmunity. Interestingly, genetic association studies link cblb-polymorphisms with autoimmunity also in humans. Vice versa, the increased activation potential of cblb-deficient cells renders them more potent to fight against malignancies or infections. Accordingly, several reports have shown that cblb knockout mice reject tumors, which mainly depends on cytotoxic T and NK cells. Thus targeting Cbl-b may be an interesting strategy to enhance anti-cancer immunity. In this review we summarize the findings on the molecular function of Cbl-b in different cell types and illustrate the potential of Cbl-b as target for immunomodulatory therapies.

  15. A novel algorithm of artificial immune system for high-dimensional function numerical optimization

    Institute of Scientific and Technical Information of China (English)

    DU Haifeng; GONG Maoguo; JIAO Licheng; LIU Ruochen

    2005-01-01

    Based on the clonal selection theory and immune memory theory, a novel artificial immune system algorithm, immune memory clonal programming algorithm (IMCPA), is put forward. Using the theorem of Markov chain, it is proved that IMCPA is convergent. Compared with some other evolutionary programming algorithms (like Breeder genetic algorithm), IMCPA is shown to be an evolutionary strategy capable of solving complex machine learning tasks, like high-dimensional function optimization, which maintains the diversity of the population and avoids prematurity to some extent, and has a higher convergence speed.

  16. Transient expression of protein tyrosine phosphatases encoded in Cotesia plutellae bracovirus inhibits insect cellular immune responses

    Science.gov (United States)

    Ibrahim, Ahmed M. A.; Kim, Yonggyun

    2008-01-01

    Several immunosuppressive factors are associated with parasitism of an endoparasitoid wasp, Cotesia plutellae, on the diamondback moth, Plutella xylostella. C. plutellae bracovirus (CpBV) encodes a large number of putative protein tyrosine phosphatases (PTPs), which may play a role in inhibiting host cellular immunity. To address this inhibitory hypothesis of CpBV-PTPs, we performed transient expression of individual CpBV-PTPs in hemocytes of the beet armyworm, Spodoptera exigua, and analyzed their cellular immune responses. Two different forms of CpBV-PTPs were chosen and cloned into a eukaryotic expression vector under the control of the p10 promoter of baculovirus: one with the normal cysteine active site (CpBV-PTP1) and the other with a mutated active site (CpBV-PTP5). The hemocytes transfected with CpBV-PTP1 significantly increased in PTP activity compared to control hemocytes, but those with CpBV-PTP5 exhibited a significant decrease in the PTP activity. All transfected hemocytes exhibited a significant reduction in both cell spreading and encapsulation activities compared to control hemocytes. Co-transfection of CpBV-PTP1 together with its double-stranded RNA reduced the messenger RNA (mRNA) level of CpBV-PTP1 and resulted in recovery of both hemocyte behaviors. This is the first report demonstrating that the polydnaviral PTPs can manipulate PTP activity of the hemocytes to interrupt cellular immune responses.

  17. Perillyl alcohol suppresses antigen-induced immune responses in the lung

    International Nuclear Information System (INIS)

    Imamura, Mitsuru; Sasaki, Oh; Okunishi, Katsuhide; Nakagome, Kazuyuki; Harada, Hiroaki; Kawahata, Kimito; Tanaka, Ryoichi; Yamamoto, Kazuhiko; Dohi, Makoto

    2014-01-01

    Highlights: •Perillyl alcohol (POH) is an isoprenoid which inhibits the mevalonate pathway. •We examined whether POH suppresses immune responses with a mouse model of asthma. •POH treatment during sensitization suppressed Ag-induced priming of CD4 + T cells. •POH suppressed airway eosinophila and cytokine production in thoracic lymph nodes. -- Abstract: Perillyl alcohol (POH) is an isoprenoid which inhibits farnesyl transferase and geranylgeranyl transferase, key enzymes that induce conformational and functional changes in small G proteins to conduct signal production for cell proliferation. Thus, it has been tried for the treatment of cancers. However, although it affects the proliferation of immunocytes, its influence on immune responses has been examined in only a few studies. Notably, its effect on antigen-induced immune responses has not been studied. In this study, we examined whether POH suppresses Ag-induced immune responses with a mouse model of allergic airway inflammation. POH treatment of sensitized mice suppressed proliferation and cytokine production in Ag-stimulated spleen cells or CD4 + T cells. Further, sensitized mice received aerosolized OVA to induce allergic airway inflammation, and some mice received POH treatment. POH significantly suppressed indicators of allergic airway inflammation such as airway eosinophilia. Cytokine production in thoracic lymph nodes was also significantly suppressed. These results demonstrate that POH suppresses antigen-induced immune responses in the lung. Considering that it exists naturally, POH could be a novel preventive or therapeutic option for immunologic lung disorders such as asthma with minimal side effects

  18. Functional demonstration of adaptive immunity in zebrafish using DNA vaccination

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja

    Due to the well characterized genome, overall highly synteny with the human genome and its suitability for functional genomics studies, the zebrafish is considered to be an ideal animal model for basic studies of mechanisms of diseases and immunity in vertebrates including humans. While several s...

  19. Azidothymidine Sensitizes Primary Effusion Lymphoma Cells to Kaposi Sarcoma-Associated Herpesvirus-Specific CD4+ T Cell Control and Inhibits vIRF3 Function.

    Directory of Open Access Journals (Sweden)

    Samantha J Williamson

    2016-11-01

    Full Text Available Kaposi sarcoma-associated herpesvirus (KSHV is linked with the development of Kaposi sarcoma and the B lymphocyte disorders primary effusion lymphoma (PEL and multi-centric Castleman disease. T cell immunity limits KSHV infection and disease, however the virus employs multiple mechanisms to inhibit efficient control by these effectors. Thus KSHV-specific CD4+ T cells poorly recognize most PEL cells and even where they can, they are unable to kill them. To make KSHV-infected cells more sensitive to T cell control we treated PEL cells with the thymidine analogue azidothymidine (AZT, which sensitizes PEL lines to Fas-ligand and TRAIL challenge; effector mechanisms which T cells use. PELs co-cultured with KSHV-specific CD4+ T cells in the absence of AZT showed no control of PEL outgrowth. However in the presence of AZT PEL outgrowth was controlled in an MHC-restricted manner. To investigate how AZT sensitizes PELs to immune control we first examined BJAB cells transduced with individual KSHV-latent genes for their ability to resist apoptosis mediated by stimuli delivered through Fas and TRAIL receptors. This showed that in addition to the previously described vFLIP protein, expression of vIRF3 also inhibited apoptosis delivered by these stimuli. Importantly vIRF3 mediated protection from these apoptotic stimuli was inhibited in the presence of AZT as was a second vIRF3 associated phenotype, the downregulation of surface MHC class II. Although both vFLIP and vIRF3 are expressed in PELs, we propose that inhibiting vIRF3 function with AZT may be sufficient to restore T cell control of these tumor cells.

  20. The Influence of histamine H1-receptor on liver functions in immunized rabbits.

    Science.gov (United States)

    Tripathi, Trivendra; Shahid, Mohammad; Khan, Haris M; Khan, Rahat Ali; Siddiqui, Mashiatullah; Mahdi, Abbas Ali

    2011-10-01

    This study was designed to investigate the functional roles of histamine and histamine H1-receptor agonist and antagonist in the development of liver function impairment in immunized rabbits. The study comprised of six groups containing 18 rabbits each. Group III-VI received histamine (100 μg/kg, s.c.), H1R-agonist (HTMT, 10 μg/kg, s.c.), H1R-antagonist (pheniramine, 10 mg/kg, i.m.), and H1R-antagonist (pheniramine, 10 mg/kg, i.m.) plus histamine (100 μg/kg, s.c.), respectively, b.i.d. for 10 days. Group I (negative control) and group II (positive control) received sterile distilled water intramuscularly b.i.d. for 10 days. Groups II-VI were immunized on day 3 with intravenous injection of SRBC (1 × 10(9) cells/ml). Blood samples were collected on pre-immunization day 0, as well as on days 7-, 14-, 21-, 28-, and 58-post-immunization. Biochemical parameters AST, ALT, alkaline phosphatase and bilirubin [total bilirubin (TB), direct bilirubin (DB), and indirect bilirubin (IB)] were determined. On each experimental day, the mean values of serum enzymes and bilirubin in group I and group II showed no significant changes while in group III, IV, V, and VI, these enzymes and bilirubin levels showed significant changes (p pheniramine, and combination of histamine + pheniramine cause hepatic function impairment in terms of altered serum enzymes and bilirubin levels. The present findings suggest that HTMT causes moderate liver function impairment while others show mild impairment.

  1. Phenotypic and functional plasticity of cells of innate immunity: macrophages, mast cells and neutrophils

    DEFF Research Database (Denmark)

    Galli, Stephen J; Borregaard, Niels; Wynn, Thomas A

    2011-01-01

    Hematopoietic cells, including lymphoid and myeloid cells, can develop into phenotypically distinct 'subpopulations' with different functions. However, evidence indicates that some of these subpopulations can manifest substantial plasticity (that is, undergo changes in their phenotype and function......). Here we focus on the occurrence of phenotypically distinct subpopulations in three lineages of myeloid cells with important roles in innate and acquired immunity: macrophages, mast cells and neutrophils. Cytokine signals, epigenetic modifications and other microenvironmental factors can substantially...... and, in some cases, rapidly and reversibly alter the phenotype of these cells and influence their function. This suggests that regulation of the phenotype and function of differentiated hematopoietic cells by microenvironmental factors, including those generated during immune responses, represents...

  2. Phenotypic and functional plasticity of cells of innate immunity: macrophages, mast cells and neutrophils

    DEFF Research Database (Denmark)

    Galli, Stephen J; Borregaard, Niels; Wynn, Thomas A

    2011-01-01

    ). Here we focus on the occurrence of phenotypically distinct subpopulations in three lineages of myeloid cells with important roles in innate and acquired immunity: macrophages, mast cells and neutrophils. Cytokine signals, epigenetic modifications and other microenvironmental factors can substantially......Hematopoietic cells, including lymphoid and myeloid cells, can develop into phenotypically distinct 'subpopulations' with different functions. However, evidence indicates that some of these subpopulations can manifest substantial plasticity (that is, undergo changes in their phenotype and function...... and, in some cases, rapidly and reversibly alter the phenotype of these cells and influence their function. This suggests that regulation of the phenotype and function of differentiated hematopoietic cells by microenvironmental factors, including those generated during immune responses, represents...

  3. The effects of low dose radiation (LDR) on mice of immune function

    International Nuclear Information System (INIS)

    Feng Li; Deng Daping

    2007-01-01

    Objective: To find out the Effects of Low Dose Radiation(LDR) on mice of immune function. Methods: Through flow cytometry to observe and analyse the effects of the leukomonocyte. Through immunohistochemistry to study IL-2, TNF-α. Results: At dose of 100mGy the stimulative effect on CD 4 + cells, CD 8 + cells and NK activity was higher than that at other doses. At dose of 500mGy leukomonocyte activity was lower. At dose of 100mGy, the colorations about IL-2, TNF-α deepen. Conclusion: LDR could stimulate immune function, especially at dose of 100mGy. while at dose of 500mGy, radiation could restrain the leukomonocyte activity. (authors)

  4. Characteristic and functional analysis of toll-like receptors (TLRs in the lophotrocozoan, Crassostrea gigas, reveals ancient origin of TLR-mediated innate immunity.

    Directory of Open Access Journals (Sweden)

    Yang Zhang

    Full Text Available The evolution of TLR-mediated innate immunity is a fundamental question in immunology. Here, we report the characterization and functional analysis of four TLR members in the lophotrochozoans Crassostreagigas (CgTLRs. All CgTLRs bear a conserved domain organization and have a close relationship with TLRs in ancient non-vertebrate chordates. In HEK293 cells, every CgTLR could constitutively activate NF-κB responsive reporter, but none of the PAMPs tested could stimulate CgTLR-activated NF-κB induction. Subcellular localization showed that CgTLR members have similar and dual distribution on late endosomes and plasma membranes. Moreover, CgTLRs and CgMyD88 mRNA show a consistent response to multiple PAMP challenges in oyster hemocytes. As CgTLR-mediated NF-κB activation is dependent on CgMyD88, we designed a blocking peptide for CgTLR signaling that would inhibit CgTLR-CgMyD88 dependent NF-κB activation. This was used to demonstrate that a Vibrio parahaemolyticus infection-induced enhancement of degranulation and increase of cytokines TNF mRNA in hemocytes, could be inhibited by blocking CgTLR signaling. In summary, our study characterized the primitive TLRs in the lophotrocozoan C. gigas and demonstrated a fundamental role of TLR signaling in infection-induced hemocyte activation. This provides further evidence for an ancient origin of TLR-mediated innate immunity.

  5. The interaction between regulatory T cells and NKT cells in the liver: a CD1d bridge links innate and adaptive immunity.

    Science.gov (United States)

    Hua, Jing; Liang, Shuwen; Ma, Xiong; Webb, Tonya J; Potter, James P; Li, Zhiping

    2011-01-01

    Regulatory T cells (Tregs) and natural killer T (NKT) cells are two distinct lymphocyte subsets that independently regulate hepatic adaptive and innate immunity, respectively. In the current study, we examine the interaction between Tregs and NKT cells to understand the mechanisms of cross immune regulation by these cells. The frequency and function of Tregs were evaluated in wild type and NKT cell deficient (CD1dko) mice. In vitro lymphocyte proliferation and apoptosis assays were performed with NKT cells co-cultured with Tregs. The ability of Tregs to inhibit NKT cells in vivo was examined by adoptive transfer of Tregs in a model of NKT cell mediated hepatitis. CD1dko mice have a significant reduction in hepatic Tregs. Although, the Tregs from CD1dko mice remain functional and can suppress conventional T cells, their ability to suppress activation induced NKT cell proliferation and to promote NKT cell apoptosis is greatly diminished. These effects are CD1d dependent and require cell to cell contact. Adoptive transfer of Tregs inhibits NKT cell-mediated liver injury. NKT cells promote Tregs, and Tregs inhibit NKT cells in a CD1d dependent manner requiring cell to cell contact. These cross-talk immune regulations provide a linkage between innate and adaptive immunity.

  6. Hygiene and other early childhood influences on the subsequent function of the immune system.

    Science.gov (United States)

    Rook, Graham A W; Lowry, Christopher A; Raison, Charles L

    2015-08-18

    The immune system influences brain development and function. Hygiene and other early childhood influences impact the subsequent function of the immune system during adulthood, with consequences for vulnerability to neurodevelopmental and psychiatric disorders. Inflammatory events during pregnancy can act directly to cause developmental problems in the central nervous system (CNS) that have been implicated in schizophrenia and autism. The immune system also acts indirectly by "farming" the intestinal microbiota, which then influences brain development and function via the multiple pathways that constitute the gut-brain axis. The gut microbiota also regulates the immune system. Regulation of the immune system is crucial because inflammatory states in pregnancy need to be limited, and throughout life inflammation needs to be terminated completely when not required; for example, persistently raised levels of background inflammation during adulthood (in the presence or absence of a clinically apparent inflammatory stimulus) correlate with an increased risk of depression. A number of factors in the perinatal period, notably immigration from rural low-income to rich developed settings, caesarean delivery, breastfeeding and antibiotic abuse have profound effects on the microbiota and on immunoregulation during early life that persist into adulthood. Many aspects of the modern western environment deprive the infant of the immunoregulatory organisms with which humans co-evolved, while encouraging exposure to non-immunoregulatory organisms, associated with more recently evolved "crowd" infections. Finally, there are complex interactions between perinatal psychosocial stressors, the microbiota, and the immune system that have significant additional effects on both physical and psychiatric wellbeing in subsequent adulthood. This article is part of a Special Issue entitled Neuroimmunology in Health And Disease. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights

  7. Seasonal Redistribution of Immune Function in a Migrant Shorebird : Annual-Cycle Effects Override Adjustments to Thermal Regime

    NARCIS (Netherlands)

    Buehler, Deborah M.; Piersma, Theunis; Matson, Kevin D.; Tieleman, B. Irene; Demas, Greg (associate); Geber, Monica A.

    2008-01-01

    Throughout the annual cycle, demands on competing physiological systems change, and animals must allocate resources to maximize fitness. Immune function is one such system and is important for survival. Yet detailed empirical data tracking immune function over the entire annual cycle are lacking for

  8. Effects of microbial aerosol in poultry house on meat ducks’ immune function

    Directory of Open Access Journals (Sweden)

    Guanliu YU

    2016-08-01

    Full Text Available The aim of this study was to evaluate effects of microbial aerosols on immune function of ducks and shed light on the establishment of microbial aerosol concentration standards for poultry. A total of 1800 1-d-old Cherry Valley ducks were randomly divided into 5 groups (A, B, C, D and E with 360 ducks in each. To obtain objective data, each group had three replications. Concentrations of airborne bacteria, fungi, endotoxin in different groups were created by controlling ventilation and bedding cleaning frequency. Group A was the control group and hygienic conditions deteriorated progressively from group B to E. A 6-stage Andersen impactor was used to detect the aerosol concentration of aerobes, gram-negative bacteria, fungi and AGI-30 microbial air sampler detect the endotoxin, and Composite Gas Detector detect the noxious gas. In order to assess the immune function of meat ducks, immune indicators including H5 AIV antibody titer, IgG, IL-2, T-lymphocyte transformation rate, lysozyme and immune organ indexes were evaluated. Correlation coefficients were also calculated to evaluate the relationships among airborne bacteria, fungi, endotoxin and immune indicators. The results showed that the concentration of airborne aerobe, gram-negative bacteria, fungi, endotoxin have a strong correlation to H5 AIV antibody titer, IgG, IL-2, T-lymphocyte transformation rate, lysozyme and immune organ indexes, respectively. In addition, when the concentration of microbial aerosol reach the level of group D, serum IgG (6 - 8 weeks, lysozyme (4 week were significantly higher than in group A (P < 0.05; serum IL-2 (7 and 8 weeks , T-lymphocyte transformation rate, lysozyme (7 and 8 weeks, spleen index (6 and 8 weeks and bursa index (8 week were significantly lower than in group A(P < 0.05 or P < 0.01. The results indicated that a high level of microbial aerosol adversely affected the immune level of meat ducks. The microbial aerosol values in group D provide a basis

  9. Immune evasion in cancer: Mechanistic basis and therapeutic strategies.

    Science.gov (United States)

    Vinay, Dass S; Ryan, Elizabeth P; Pawelec, Graham; Talib, Wamidh H; Stagg, John; Elkord, Eyad; Lichtor, Terry; Decker, William K; Whelan, Richard L; Kumara, H M C Shantha; Signori, Emanuela; Honoki, Kanya; Georgakilas, Alexandros G; Amin, Amr; Helferich, William G; Boosani, Chandra S; Guha, Gunjan; Ciriolo, Maria Rosa; Chen, Sophie; Mohammed, Sulma I; Azmi, Asfar S; Keith, W Nicol; Bilsland, Alan; Bhakta, Dipita; Halicka, Dorota; Fujii, Hiromasa; Aquilano, Katia; Ashraf, S Salman; Nowsheen, Somaira; Yang, Xujuan; Choi, Beom K; Kwon, Byoung S

    2015-12-01

    Cancer immune evasion is a major stumbling block in designing effective anticancer therapeutic strategies. Although considerable progress has been made in understanding how cancers evade destructive immunity, measures to counteract tumor escape have not kept pace. There are a number of factors that contribute to tumor persistence despite having a normal host immune system. Immune editing is one of the key aspects why tumors evade surveillance causing the tumors to lie dormant in patients for years through "equilibrium" and "senescence" before re-emerging. In addition, tumors exploit several immunological processes such as targeting the regulatory T cell function or their secretions, antigen presentation, modifying the production of immune suppressive mediators, tolerance and immune deviation. Besides these, tumor heterogeneity and metastasis also play a critical role in tumor growth. A number of potential targets like promoting Th1, NK cell, γδ T cell responses, inhibiting Treg functionality, induction of IL-12, use of drugs including phytochemicals have been designed to counter tumor progression with much success. Some natural agents and phytochemicals merit further study. For example, use of certain key polysaccharide components from mushrooms and plants have shown to possess therapeutic impact on tumor-imposed genetic instability, anti-growth signaling, replicative immortality, dysregulated metabolism etc. In this review, we will discuss the advances made toward understanding the basis of cancer immune evasion and summarize the efficacy of various therapeutic measures and targets that have been developed or are being investigated to enhance tumor rejection. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Maternal stress, nutrition and physical activity: Impact on immune function, CNS development and psychopathology.

    Science.gov (United States)

    Marques, Andrea Horvath; Bjørke-Monsen, Anne-Lise; Teixeira, Antônio L; Silverman, Marni N

    2015-08-18

    Evidence suggests that maternal and fetal immune dysfunction may impact fetal brain development and could play a role in neurodevelopmental disorders, although the definitive pathophysiological mechanisms are still not completely understood. Stress, malnutrition and physical inactivity are three maternal behavioral lifestyle factors that can influence immune and central nervous system (CNS) functions in both the mother and fetus, and may therefore, increase risk for neurodevelopmental/psychiatric disorders. First, we will briefly review some aspects of maternal-fetal immune system interactions and development of immune tolerance. Second, we will discuss the bidirectional communication between the immune system and CNS and the pathways by which immune dysfunction could contribute to neurodevelopmental disorders. Third, we will discuss the effects of prenatal stress and malnutrition (over and undernutrition) on perinatal programming of the CNS and immune system, and how this might influence neurodevelopment. Finally, we will discuss the beneficial impact of physical fitness during pregnancy on the maternal-fetal unit and infant and how regular physical activity and exercise can be an effective buffer against stress- and inflammatory-related disorders. Although regular physical activity has been shown to promote neuroplasticity and an anti-inflammatory state in the adult, there is a paucity of studies evaluating its impact on CNS and immune function during pregnancy. Implementing stress reduction, proper nutrition and ample physical activity during pregnancy and the childbearing period may be an efficient strategy to counteract the impact of maternal stress and malnutrition/obesity on the developing fetus. Such behavioral interventions could have an impact on early development of the CNS and immune system and contribute to the prevention of neurodevelopmental and psychiatric disorders. Further research is needed to elucidate this relationship and the underlying

  11. Frank A. Beach award: programming of neuroendocrine function by early-life experience: a critical role for the immune system.

    Science.gov (United States)

    Bilbo, Staci D

    2013-05-01

    Many neuropsychiatric disorders are associated with a strong dysregulation of the immune system, and several have a striking etiology in development as well. Our recent evidence using a rodent model of neonatal Escherichia coli infection has revealed novel insight into the mechanisms underlying cognitive deficits in adulthood, and suggests that the early-life immune history of an individual may be critical to understanding the relative risk of developing later-life mental health disorders in humans. A single neonatal infection programs the function of immune cells within the brain, called microglia, for the life of the rodent such that an adult immune challenge results in exaggerated cytokine production within the brain and associated cognitive deficits. I describe the important role of the immune system, notably microglia, during brain development, and discuss some of the many ways in which immune activation during early brain development can affect the later-life outcomes of neural function, immune function, and cognition. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. Host immune responses to a viral immune modulating protein: immunogenicity of viral interleukin-10 in rhesus cytomegalovirus-infected rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Meghan K Eberhardt

    Full Text Available Considerable evidence has accumulated that multiple viruses, bacteria, and protozoa manipulate interleukin-10 (IL-10-mediated signaling through the IL-10 receptor (IL-10R in ways that could enable establishment of a persistent microbial infection. This suggests that inhibition of pathogen targeting of IL-10/IL-10R signaling could prevent microbial persistence. Human cytomegalovirus (HCMV and rhesus cytomegalovirus (RhCMV express a viral interleukin-10 (cmvIL-10 and rhcmvIL-10, respectively with comparable immune modulating properties in vitro to that of their host's cellular IL-10 (cIL-10. A prior study noted that rhcmvIL-10 alters innate and adaptive immunity to RhCMV in vivo, consistent with a central role for rhcmvIL-10 during acute virus-host interactions. Since cmvIL-10 and rhcmvIL-10 are extremely divergent from the cIL-10 of their respective hosts, vaccine-mediated neutralization of their function could inhibit establishment of viral persistence without inhibition of cIL-10.As a prelude to evaluating cmvIL-10-based vaccines in humans, the rhesus macaque model of HCMV was used to interrogate peripheral and mucosal immune responses to rhcmvIL-10 in RhCMV-infected animals. ELISA were used to detect rhcmvIL-10-binding antibodies in plasma and saliva, and an IL-12-based bioassay was used to quantify plasma antibodies that neutralized rhcmvIL-10 function. rhcmvIL-10 is highly immunogenic during RhCMV infection, stimulating high avidity rhcmvIL-10-binding antibodies in the plasma of all infected animals. Most infected animals also exhibited plasma antibodies that partially neutralized rhcmvIL-10 function but did not cross-neutralize the function of rhesus cIL-10. Notably, minimally detectable rhcmvIL-10-binding antibodies were detected in saliva.This study demonstrates that rhcmvIL-10, as a surrogate for cmvIL-10, is a viable vaccine candidate because (1 it is highly immunogenic during natural RhCMV infection, and (2 neutralizing antibodies to

  13. Functional neural networks underlying response inhibition in adolescents and adults.

    Science.gov (United States)

    Stevens, Michael C; Kiehl, Kent A; Pearlson, Godfrey D; Calhoun, Vince D

    2007-07-19

    This study provides the first description of neural network dynamics associated with response inhibition in healthy adolescents and adults. Functional and effective connectivity analyses of whole brain hemodynamic activity elicited during performance of a Go/No-Go task were used to identify functionally integrated neural networks and characterize their causal interactions. Three response inhibition circuits formed a hierarchical, inter-dependent system wherein thalamic modulation of input to premotor cortex by fronto-striatal regions led to response suppression. Adolescents differed from adults in the degree of network engagement, regional fronto-striatal-thalamic connectivity, and network dynamics. We identify and characterize several age-related differences in the function of neural circuits that are associated with behavioral performance changes across adolescent development.

  14. The cytomegalovirus homolog of interleukin-10 requires phosphatidylinositol 3-kinase activity for inhibition of cytokine synthesis in monocytes.

    Science.gov (United States)

    Spencer, Juliet V

    2007-02-01

    Human cytomegalovirus (CMV) has evolved numerous strategies for evading host immune defenses, including piracy of cellular cytokines. A viral homolog of interleukin-10, designated cmvIL-10, binds to the cellular IL-10 receptor and effects potent immune suppression. The signaling pathways employed by cmvIL-10 were investigated, and the classic IL-10R/JAK1/Stat3 pathway was found to be activated in monocytes. However, inhibition of JAK1 had little effect on cmvIL-10-mediated suppression of tumor necrosis factor alpha (TNF-alpha) production. Inhibition of the phosphatidylinositol 3-kinase/Akt pathway had a more significant impact on TNF-alpha levels but did not completely relieve the immune suppression, demonstrating that cmvIL-10 stimulates multiple signaling pathways to modulate cell function.

  15. Effects of γ-rays on Th1 and Th2 immune function of mice

    International Nuclear Information System (INIS)

    Jin Wei; Cui Yufang; An Xiaoxia; Xu Han; Dong Bo; Liu Xiaolan; Luo Qingliang

    2007-01-01

    Objective: To observe the effects of 6 Gy whole body γ-irradiation on immune function of Th1 and Th2 in mouse, and to investigate the cellular and molecular mechanism of immune system injury induced by irradiation. Methods: Surface marker and intracellular cytokines of lymphocytes were stained with fluorescence-labeled monoclonal antibodies, then the changes of lymphocyte subpopulations, especially the Th1 and Th2 in mouse peripheral blood and spleen were analyzed by flow cytometry. Results: (1) 1 d after 6 Gy y- irradiation, lymphocytic subsets of CD 19 + and CD 8 + in spleen decreased apparently and the percentages of them were only 30% and 41% of control groups respectively (P 19 + and 14 d for CD 8 + respectively, however, up to 21 d post-irradiation they still did not return to control level. (2) Th1 subpopulations in mouse peripheral blood and spleen were significantly reduced at 1 d after irradiation and were only 2.6% and 7.6% of control groups (P 4 + / CD 8 + were significantly increased at 1 d post-irradiation in mouse spleen because of swift reduction of CD 8 + cells. Interestingly, either in peripheral blood or in spleen in irradiated mice, the ratio of Th1/Th2 were evidently raised because of the decrement of Th1 cells, exhibited obviously a phenomenon of predominant immune response of Th2 cells. Conclusions: It is suggested that the depression of mouse immune function induced by 6 Gy γ-irradiation might be caused by changes of CD 4 + /CD 8 + ratio, especially the imbalance of Th1/Th2 function subpopulations. It is shown that the imbalance of Th1/Th2 function subpopulations plays an important role in radiation-induced immune injury, thus providing a better insight into the molecular mechanism and new strategies for prevent and treatment measures of immune injury by irradiation. (authors)

  16. Immune modulation in the blue mussel Mytilus edulis exposed to North Sea produced water

    Energy Technology Data Exchange (ETDEWEB)

    Hannam, M.L., E-mail: marie.hannam@plymouth.ac.u [Ecotoxicology and Stress Biology Research Centre, School of Biological Sciences, University of Plymouth, Drake Circus, Plymouth, Devon, PL4 8AA (United Kingdom); Bamber, S.D.; Sundt, R.C. [IRIS - Biomiljo, Mekjarvik 12, 4070 Randaberg (Norway); Galloway, T.S. [School of Biosciences, University of Exeter, Hatherly Laboratories, Prince of Wales Road, Exeter, EX4 4PS (United Kingdom)

    2009-06-15

    The discharge of oil well produced water (PW) provides a constant source of contaminants to the marine environment including polycyclic aromatic hydrocarbons, alkylated phenols, metals and production chemicals. High concentrations of PW cause adverse effects to exposed biota, including reduced survival, growth and reproduction. Here we explore the effects of PW on immune function in the blue mussel, Mytilus edulis. Mussels were exposed for 21 days to sublethal PW concentrations (0.125-0.5%) and cellular parameters were measured. Cell viability, phagocytosis and cytotoxicity were inhibited after exposure to 0.25% and 0.5% PW, whilst the 0.125% PW treatment produced significant increases in these biomarker responses. This biphasic response was only observed after 7 days exposure; longer exposure periods led to a reduction in immune parameters. Results indicate that PW concentrations close to the discharge point cause modulation to cellular immunity. The implications for longer-term disease resistance are discussed. - Exposure to produced water alters immune function in the sentinel species Mytilus edulis.

  17. Immune modulation in the blue mussel Mytilus edulis exposed to North Sea produced water

    International Nuclear Information System (INIS)

    Hannam, M.L.; Bamber, S.D.; Sundt, R.C.; Galloway, T.S.

    2009-01-01

    The discharge of oil well produced water (PW) provides a constant source of contaminants to the marine environment including polycyclic aromatic hydrocarbons, alkylated phenols, metals and production chemicals. High concentrations of PW cause adverse effects to exposed biota, including reduced survival, growth and reproduction. Here we explore the effects of PW on immune function in the blue mussel, Mytilus edulis. Mussels were exposed for 21 days to sublethal PW concentrations (0.125-0.5%) and cellular parameters were measured. Cell viability, phagocytosis and cytotoxicity were inhibited after exposure to 0.25% and 0.5% PW, whilst the 0.125% PW treatment produced significant increases in these biomarker responses. This biphasic response was only observed after 7 days exposure; longer exposure periods led to a reduction in immune parameters. Results indicate that PW concentrations close to the discharge point cause modulation to cellular immunity. The implications for longer-term disease resistance are discussed. - Exposure to produced water alters immune function in the sentinel species Mytilus edulis.

  18. Activation of cellular immunity and marked inhibition of liver cancer in a mouse model following gene therapy and tumor expression of GM-SCF, IL-21, and Rae-1.

    Science.gov (United States)

    Cheng, Mingrong; Zhi, Kangkang; Gao, Xiaoyan; He, Bing; Li, Yingchun; Han, Jiang; Zhang, Zhiping; Wu, Yan

    2013-12-18

    Cancer is both a systemic and a genetic disease. The pathogenesis of cancer might be related to dampened immunity. Host immunity recognizes nascent malignant cells - a process referred to as immune surveillance. Augmenting immune surveillance and suppressing immune escape are crucial in tumor immunotherapy. A recombinant plasmid capable of co-expressing granulocyte-macrophage colony- stimulating factor (GM-SCF), interleukin-21 (IL-21), and retinoic acid early transcription factor-1 (Rae-1) was constructed, and its effects determined in a mouse model of subcutaneous liver cancer. Serum specimens were assayed for IL-2 and INF-γ by ELISA. Liver cancer specimens were isolated for Rae-1 expression by RT-PCR and Western blot, and splenocytes were analyzed by flow cytometry. The recombinant plasmid inhibited the growth of liver cancer and prolonged survival of tumor-loaded mice. Activation of host immunity might have contributed to this effect by promoting increased numbers and cytotoxicity of natural killer (NK) cells and cytotoxic T lymphocytes (CTL) following expression of GM-SCF, IL-21, and Rae-1. By contrast, the frequency of regulatory T cells was decreased, Consequently, activated CTL and NK cells enhanced their secretion of INF-γ, which promoted cytotoxicity of NK cells and CTL. Moreover, active CTL showed dramatic secretion of IL-2, which stimulates CTL. The recombinant expression plasmid also augmented Rae-1 expression by liver cancer cells. Rae-1 receptor expressing CTL and NK cells removed liver cancer. The recombinant expression plasmid inhibited liver cancer by a mechanism that involved activation of cell-mediated immunity and Rae-1 in liver cancer.

  19. Immune inhibitory receptors in viral infection and cancer

    NARCIS (Netherlands)

    Karnam, G.

    2014-01-01

    We are protected from external and internal dangers by our immune system. Immune responses need to be balanced to prevent uncontrolled inflammation and/or autoimmunity. Cell growth inhibition, apoptosis, and down regulation of receptor signals are all part of the inhibitory tools used by the immune

  20. Effects of zinc-methionine on growth performance, intestinal flora and immune function in pigeon squabs.

    Science.gov (United States)

    Wang, Y; Yi, L; Zhao, M L; Wu, J Q; Wang, M Y; Cheng, X C

    2014-01-01

    1. Different concentrations of zinc-methionine (Zn-Met) were given to pigeon squabs, and the resulting effects on growth, immune functions and intestinal microflora were investigated from hatching to 28 d of age. A total of 180 artificially hatched pigeon squabs were randomly allotted to each of three treatments with three replicates of 20 squabs. The three treatments given were either one ml (2 mg/ml) Zn-Met, one ml (10 mg/ml) Zn-Met or one ml 0.9% NaCl solution. 2. The results showed that Zn-Met improved the growth performance of squabs. The average daily and average weekly weight gain was significantly greater in squabs treated with Zn-Met than in the control group. 3. The group given 2 and 10 mg supplemental Zn-Met had heavier thymus, spleen and bursa of Fabricius than the control group at d 28. 4. Maternal antibody titres against Newcastle disease haemagglutination inhibition and alpha-naphthyl acetate esterase were significantly higher in squabs treated with supplemental 2 and 10 mg Zn-Met compared to the control group at d 14 and d 28. 5. Additionally, the squabs given supplemental 2 mg Zn-Met exhibited significantly higher Bacillaceae, Lactobacillus, Enterococcus and Bifidobacterium populations at d 14 and d 28, but lower Escherichia coli populations at d 28 compared to the control group. On the contrary, Lactobacillus, Enterococcus and Bifidobacterium populations were significantly decreased with 10 mg Zn-Met at d 28. 6. This study indicates that supplementation with Zn-Met has a positive effect on growth performance, immune function and regulation of intestinal flora in pigeons. An inclusion level of 2 mg seems to be better than 10 mg Zn-Met per day per bird.

  1. Phenotypic and Functional Properties of Tumor-Infiltrating Regulatory T Cells

    Directory of Open Access Journals (Sweden)

    Gap Ryol Lee

    2017-01-01

    Full Text Available Regulatory T (Treg cells maintain immune homeostasis by suppressing excessive immune responses. Treg cells induce tolerance against self- and foreign antigens, thus preventing autoimmunity, allergy, graft rejection, and fetus rejection during pregnancy. However, Treg cells also infiltrate into tumors and inhibit antitumor immune responses, thus inhibiting anticancer therapy. Depleting whole Treg cell populations in the body to enhance anticancer treatments will produce deleterious autoimmune diseases. Therefore, understanding the precise nature of tumor-infiltrating Treg cells is essential for effectively targeting Treg cells in tumors. This review summarizes recent results relating to Treg cells in the tumor microenvironment, with particular emphasis on their accumulation, phenotypic, and functional properties, and targeting to enhance the efficacy of anticancer treatment.

  2. Advances in the quantification of mitochondrial function in primary human immune cells through extracellular flux analysis.

    Directory of Open Access Journals (Sweden)

    Dequina Nicholas

    Full Text Available Numerous studies show that mitochondrial energy generation determines the effectiveness of immune responses. Furthermore, changes in mitochondrial function may regulate lymphocyte function in inflammatory diseases like type 2 diabetes. Analysis of lymphocyte mitochondrial function has been facilitated by introduction of 96-well format extracellular flux (XF96 analyzers, but the technology remains imperfect for analysis of human lymphocytes. Limitations in XF technology include the lack of practical protocols for analysis of archived human cells, and inadequate data analysis tools that require manual quality checks. Current analysis tools for XF outcomes are also unable to automatically assess data quality and delete untenable data from the relatively high number of biological replicates needed to power complex human cell studies. The objectives of work presented herein are to test the impact of common cellular manipulations on XF outcomes, and to develop and validate a new automated tool that objectively analyzes a virtually unlimited number of samples to quantitate mitochondrial function in immune cells. We present significant improvements on previous XF analyses of primary human cells that will be absolutely essential to test the prediction that changes in immune cell mitochondrial function and fuel sources support immune dysfunction in chronic inflammatory diseases like type 2 diabetes.

  3. Comparison of the Functional microRNA Expression in Immune Cell Subsets of Neonates and Adults

    Science.gov (United States)

    Yu, Hong-Ren; Hsu, Te-Yao; Huang, Hsin-Chun; Kuo, Ho-Chang; Li, Sung-Chou; Yang, Kuender D.; Hsieh, Kai-Sheng

    2016-01-01

    Diversity of biological molecules in newborn and adult immune cells contributes to differences in cell function and atopic properties. Micro RNAs (miRNAs) are reported to involve in the regulation of immune system. Therefore, determining the miRNA expression profile of leukocyte subpopulations is important for understanding immune system regulation. In order to explore the unique miRNA profiling that contribute to altered immune in neonates, we comprehensively analyzed the functional miRNA signatures of eight leukocyte subsets (polymorphonuclear cells, monocytes, CD4+ T cells, CD8+ T cells, natural killer cells, B cells, plasmacytoid dendritic cells, and myeloid dendritic cells) from both neonatal and adult umbilical cord and peripheral blood samples, respectively. We observed distinct miRNA profiles between adult and neonatal blood leukocyte subsets, including unique miRNA signatures for each cell lineage. Leukocyte miRNA signatures were altered after stimulation. Adult peripheral leukocytes had higher let-7b-5p expression levels compared to neonatal cord leukocytes across multiple subsets, irrespective of stimulation. Transfecting neonatal monocytes with a let-7b-5p mimic resulted in a reduction of LPS-induced interleukin (IL)-6 and TNF-α production, while transfection of a let-7b-5p inhibitor into adult monocytes enhanced IL-6 and TNF-α production. With this functional approach, we provide intact differential miRNA expression profiling of specific immune cell subsets between neonates and adults. These studies serve as a basis to further understand the altered immune response observed in neonates and advance the development of therapeutic strategies. PMID:28066425

  4. Comparison of the functional microRNA expression in immune cell subsets of neonates and adults

    Directory of Open Access Journals (Sweden)

    Hong-Ren Yu

    2016-12-01

    Full Text Available Diversity of biological molecules in newborn and adult immune cells contributes to differences in cell function and atopic properties. Micro RNAs (miRNAs are reported involve in the regulation of immune system. Therefore, determining the miRNA expression profile of leukocyte sub-populations is important for understanding immune system regulation. In order to explore the unique microRNA profiling that contribute to altered immune in neonates, we comprehensively analyzed the functional miRNA signatures of eight leukocyte subsets (polymorphonuclear cells, monocytes, CD4+ T cells, CD8+ T cells, natural killer cells, B cells, plasmacytoid dendritic cells (pDCs, and myeloid dendritic cells (mDCs from both neonatal and adult umbilical cord and peripheral blood samples, respectively. We observed distinct miRNA profiles between adult and neonatal blood leukocyte subsets, including unique miRNA signatures for each cell lineage. Leukocyte miRNA signatures were altered after stimulation. Adult peripheral leukocytes had higher let-7b-5p expression levels compared to neonatal cord leukocytes across multiple subsets, irrespective of stimulation. Transfecting neonatal monocytes with a let-7b-5p mimic resulted in a reduction of LPS-induced IL-6 and TNF-alpha production, while transfection of a let-7b-5p inhibitor into adult monocytes enhanced IL-6 and TNF-alpha production. With this functional approach, we provide intact differential microRNA expression profiling of specific immune cell subsets between neonates and adults. These studies serve as a basis to further understand the altered immune response observed in neonates and advance the development of therapeutic strategies.

  5. Staphylococcus aureus innate immune evasion is lineage-specific: a bioinfomatics study.

    Science.gov (United States)

    McCarthy, Alex J; Lindsay, Jodi A

    2013-10-01

    Staphylococcus aureus is a major human pathogen, and is targeted by the host innate immune system. In response, S. aureus genomes encode dozens of secreted proteins that inhibit complement, chemotaxis and neutrophil activation resulting in successful evasion of innate immune responses. These proteins include immune evasion cluster proteins (IEC; Chp, Sak, Scn), staphylococcal superantigen-like proteins (SSLs), phenol soluble modulins (PSMs) and several leukocidins. Biochemical studies have indicated that genetic variants of these proteins can have unique functions. To ascertain the scale of genetic variation in secreted immune evasion proteins, whole genome sequences of 88 S. aureus isolates, representing 25 clonal complex (CC) lineages, in the public domain were analysed across 43 genes encoding 38 secreted innate immune evasion protein complexes. Twenty-three genes were variable, with between 2 and 15 variants, and the variants had lineage-specific distributions. They include genes encoding Eap, Ecb, Efb, Flipr/Flipr-like, Hla, Hld, Hlg, Sbi, Scin-B/C and 13 SSLs. Most of these protein complexes inhibit complement, chemotaxis and neutrophil activation suggesting that isolates from each S. aureus lineage respond to the innate immune system differently. In contrast, protein complexes that lyse neutrophils (LukSF-PVL, LukMF, LukED and PSMs) were highly conserved, but can be carried on mobile genetic elements (MGEs). MGEs also encode proteins with narrow host-specificities arguing that their acquisition has important roles in host/environmental adaptation. In conclusion, this data suggests that each lineage of S. aureus evades host immune responses differently, and that isolates can adapt to new host environments by acquiring MGEs and the immune evasion protein complexes that they encode. Cocktail therapeutics that targets multiple variant proteins may be the most appropriate strategy for controlling S. aureus infections. Copyright © 2013 Elsevier B.V. All rights

  6. Spillover-mediated feedforward-inhibition functionally segregates interneuron activity

    Science.gov (United States)

    Coddington, Luke T.; Rudolph, Stephanie; Lune, Patrick Vande; Overstreet-Wadiche, Linda; Wadiche, Jacques I.

    2013-01-01

    Summary Neurotransmitter spillover represents a form of neural transmission not restricted to morphologically defined synaptic connections. Communication between climbing fibers (CFs) and molecular layer interneurons (MLIs) in the cerebellum is mediated exclusively by glutamate spillover. Here, we show how CF stimulation functionally segregates MLIs based on their location relative to glutamate release. Excitation of MLIs that reside within the domain of spillover diffusion coordinates inhibition of MLIs outside the diffusion limit. CF excitation of MLIs is dependent on extrasynaptic NMDA receptors that enhance the spatial and temporal spread of CF signaling. Activity mediated by functionally segregated MLIs converges onto neighboring Purkinje cells (PCs) to generate a long-lasting biphasic change in inhibition. These data demonstrate how glutamate release from single CFs modulates excitability of neighboring PCs, thus expanding the influence of CFs on cerebellar cortical activity in a manner not predicted by anatomical connectivity. PMID:23707614

  7. [The liver and the immune system].

    Science.gov (United States)

    Jakab, Lajos

    2015-07-26

    The liver is known to be the metabolic centre of the organism and is under the control of the central nervous system. It has a peculiar tissue structure and its anatomic localisation defines it as part of the immune system having an individual role in the defence of the organism. The determinant of its particular tissue build-up is the sinusoid system. In addition to hepatocytes, one cell row "endothelium", stellate cells close to the external surface, Kupffer cells tightly to its inner surface, as well as dendritic cells and other cell types (T and B lymphocytes, natural killer and natural killer T-cells, mast cells, granulocytes) are present. The multitudes and variety of cells make it possible to carry out the tasks according to the assignment of the organism. The liver is a member of the immune system having immune cells largely in an activated state. Its principal tasks are the assurance of the peripheral immune tolerance of the organism with the help of the haemopoetic cells and transforming growth factor-β. The liver takes part in the determination of the manner of the non-specific immune response of the organism. In addition to acute phase reaction of the organism, the liver has a role in the adaptive/specific immune response. These functions include retardation of the T and B lymphocytes and the defence against harmful pathogens. With the collaboration of transforming growth factor-β, immunoglobulins and their subclasses are inhibited just as the response of the T lymphocytes. The only exception is the undisturbed immunoglobulin A production. Particularly important is the intensive participation of the liver in the acute phase reaction of the organism, which is organised and guided by the coordinated functions of the cortico-hypothalamo-hypophysis-adrenal axis. Beside cellular elements, hormones, adhesion molecules, chemokines and cytokines are also involved in the cooperation with the organs. Acute phase reactants play a central role in these processes

  8. Nanoparticle-based B-cell targeting vaccines: Tailoring of humoral immune responses by functionalization with different TLR-ligands.

    Science.gov (United States)

    Zilker, Claudia; Kozlova, Diana; Sokolova, Viktoriya; Yan, Huimin; Epple, Matthias; Überla, Klaus; Temchura, Vladimir

    2017-01-01

    Induction of an appropriate type of humoral immune response during vaccination is essential for protection against viral and bacterial infections. We recently observed that biodegradable calcium phosphate (CaP) nanoparticles coated with proteins efficiently targeted and activated naïve antigen-specific B-cells in vitro. We now compared different administration routes for CaP-nanoparticles and demonstrated that intramuscular immunization with such CaP-nanoparticles induced stronger immune responses than immunization with monovalent antigen. Additional functionalization of the CaP-nanoparticles with TRL-ligands allowed modulating the IgG subtype response and the level of mucosal IgA antibodies. CpG-containing CaP-nanoparticles were as immunogenic as a virus-like particle vaccine. Functionalization of CaP-nanoparticles with T-helper cell epitopes or CpG also allowed overcoming lack of T-cell help. Thus, our results indicate that CaP-nanoparticle-based B-cell targeting vaccines functionalized with TLR-ligands can serve as a versatile platform for efficient induction and modulation of humoral immune responses in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Multivalent dendrimeric compounds containing carbohydrates expressed on immune cells inhibit infection by primary isolates of HIV-1

    Science.gov (United States)

    Borges, Andrew Rosa; Wieczorek, Lindsay; Johnson, Benitra; Benesi, Alan J.; Brown, Bruce K.; Kensinger, Richard D.; Krebs, Fred C.; Wigdahl, Brian; Blumenthal, Robert; Puri, Anu; McCutchan, Francine E.; Birx, Deborah L.; Polonis, Victoria R.; Schengrund, Cara-Lynne

    2010-01-01

    Specific glycosphingolipids (GSL), found on the surface of target immune cells, are recognized as alternate cell surface receptors by the human immunodeficiency virus type 1 (HIV-1) external envelope glycoprotein. In this study, the globotriose and 3’-sialyllactose carbohydrate head groups found on two GSL were covalently attached to a dendrimer core to produce two types of unique multivalent carbohydrates (MVC). These MVC inhibited HIV-1 infection of T cell lines and primary peripheral blood mononuclear cells (PBMC) by T cell line-adapted viruses or primary isolates, with IC50s ranging from 0.1 – 7.4 µg/ml. Inhibition of Env-mediated membrane fusion by MVC was also observed using a dye-transfer assay. These carbohydrate compounds warrant further investigation as a potential new class of HIV-1 entry inhibitors. The data presented also shed light on the role of carbohydrate moieties in HIV-1 virus-host cell interactions. PMID:20880566

  10. Cow's Milk and Immune Function in the Respiratory Tract: Potential Mechanisms.

    Science.gov (United States)

    Perdijk, Olaf; van Splunter, Marloes; Savelkoul, Huub F J; Brugman, Sylvia; van Neerven, R J Joost

    2018-01-01

    During the last decades, the world has witnessed a dramatic increase in allergy prevalence. Epidemiological evidence shows that growing up on a farm is a protective factor, which is partly explained by the consumption of raw cow's milk. Indeed, recent studies show inverse associations between raw cow's milk consumption in early life and asthma, hay fever, and rhinitis. A similar association of raw cow's milk consumption with respiratory tract infections is recently found. In line with these findings, controlled studies in infants with milk components such as lactoferrin, milk fat globule membrane, and colostrum IgG have shown to reduce respiratory infections. However, for ethical reasons, it is not possible to conduct controlled studies with raw cow's milk in infants, so formal proof is lacking to date. Because viral respiratory tract infections and aeroallergen exposure in children may be causally linked to the development of asthma, it is of interest to investigate whether cow's milk components can modulate human immune function in the respiratory tract and via which mechanisms. Inhaled allergens and viruses trigger local immune responses in the upper airways in both nasal and oral lymphoid tissue. The components present in raw cow's milk are able to promote a local microenvironment in which mucosal immune responses are modified and the epithelial barrier is enforced. In addition, such responses may also be triggered in the gut after exposure to allergens and viruses in the nasal cavity that become available in the GI tract after swallowing. However, these immune cells that come into contact with cow's milk components in the gut must recirculate into the blood and home to the (upper and lower) respiratory tract to regulate immune responses locally. Expression of the tissue homing-associated markers α4β7 and CCR9 or CCR10 on lymphocytes can be influenced by vitamin A and vitamin D3, respectively. Since both vitamins are present in milk, we speculate that raw

  11. Approaches Mediating Oxytocin Regulation of the Immune System.

    Science.gov (United States)

    Li, Tong; Wang, Ping; Wang, Stephani C; Wang, Yu-Feng

    2016-01-01

    The hypothalamic neuroendocrine system is mainly composed of the neural structures regulating hormone secretion from the pituitary gland and has been considered as the higher regulatory center of the immune system. Recently, the hypothalamo-neurohypophysial system (HNS) emerged as an important component of neuroendocrine-immune network, wherein the oxytocin (OT)-secreting system (OSS) plays an essential role. The OSS, consisting of OT neurons in the supraoptic nucleus, paraventricular nucleus, their several accessory nuclei and associated structures, can integrate neural, endocrine, metabolic, and immune information and plays a pivotal role in the development and functions of the immune system. The OSS can promote the development of thymus and bone marrow, perform immune surveillance, strengthen immune defense, and maintain immune homeostasis. Correspondingly, OT can inhibit inflammation, exert antibiotic-like effect, promote wound healing and regeneration, and suppress stress-associated immune disorders. In this process, the OSS can release OT to act on immune system directly by activating OT receptors or through modulating activities of other hypothalamic-pituitary-immune axes and autonomic nervous system indirectly. However, our understandings of the role of the OSS in neuroendocrine regulation of immune system are largely incomplete, particularly its relationship with other hypothalamic-pituitary-immune axes and the vasopressin-secreting system that coexists with the OSS in the HNS. In addition, it remains unclear about the relationship between the OSS and peripherally produced OT in immune regulation, particularly intrathymic OT that is known to elicit central immunological self-tolerance of T-cells to hypophysial hormones. In this work, we provide a brief review of current knowledge of the features of OSS regulation of the immune system and of potential approaches that mediate OSS coordination of the activities of entire neuroendocrine-immune network.

  12. Perillyl alcohol suppresses antigen-induced immune responses in the lung

    Energy Technology Data Exchange (ETDEWEB)

    Imamura, Mitsuru; Sasaki, Oh; Okunishi, Katsuhide; Nakagome, Kazuyuki; Harada, Hiroaki; Kawahata, Kimito; Tanaka, Ryoichi; Yamamoto, Kazuhiko [Department of Allergy and Rheumatology, Graduate School of Medicine, The University of Tokyo, Tokyo (Japan); Dohi, Makoto, E-mail: mdohi-tky@umin.ac.jp [Department of Allergy and Rheumatology, Graduate School of Medicine, The University of Tokyo, Tokyo (Japan); Institute of Respiratory Immunology, Shibuya Clinic for Respiratory Diseases and Allergology, Tokyo (Japan)

    2014-01-03

    Highlights: •Perillyl alcohol (POH) is an isoprenoid which inhibits the mevalonate pathway. •We examined whether POH suppresses immune responses with a mouse model of asthma. •POH treatment during sensitization suppressed Ag-induced priming of CD4{sup +} T cells. •POH suppressed airway eosinophila and cytokine production in thoracic lymph nodes. -- Abstract: Perillyl alcohol (POH) is an isoprenoid which inhibits farnesyl transferase and geranylgeranyl transferase, key enzymes that induce conformational and functional changes in small G proteins to conduct signal production for cell proliferation. Thus, it has been tried for the treatment of cancers. However, although it affects the proliferation of immunocytes, its influence on immune responses has been examined in only a few studies. Notably, its effect on antigen-induced immune responses has not been studied. In this study, we examined whether POH suppresses Ag-induced immune responses with a mouse model of allergic airway inflammation. POH treatment of sensitized mice suppressed proliferation and cytokine production in Ag-stimulated spleen cells or CD4{sup +} T cells. Further, sensitized mice received aerosolized OVA to induce allergic airway inflammation, and some mice received POH treatment. POH significantly suppressed indicators of allergic airway inflammation such as airway eosinophilia. Cytokine production in thoracic lymph nodes was also significantly suppressed. These results demonstrate that POH suppresses antigen-induced immune responses in the lung. Considering that it exists naturally, POH could be a novel preventive or therapeutic option for immunologic lung disorders such as asthma with minimal side effects.

  13. Microbial-immune cross-talk and regulation of the immune system.

    Science.gov (United States)

    Cahenzli, Julia; Balmer, Maria L; McCoy, Kathy D

    2013-01-01

    We are all born germ-free. Following birth we enter into a lifelong relationship with microbes residing on our body's surfaces. The lower intestine is home to the highest microbial density in our body, which is also the highest microbial density known on Earth (up to 10(12) /g of luminal contents). With our indigenous microbial cells outnumbering our human cells by an order of magnitude our body is more microbial than human. Numerous immune adaptations confine these microbes within the mucosa, enabling most of us to live in peaceful homeostasis with our intestinal symbionts. Intestinal epithelial cells not only form a physical barrier between the bacteria-laden lumen and the rest of the body but also function as multi-tasking immune cells that sense the prevailing microbial (apical) and immune (basolateral) milieus, instruct the underlying immune cells, and adapt functionally. In the constant effort to ensure intestinal homeostasis, the immune system becomes educated to respond appropriately and in turn immune status can shape the microbial consortia. Here we review how the dynamic immune-microbial dialogue underlies maturation and regulation of the immune system and discuss recent findings on the impact of diet on both microbial ecology and immune function. © 2012 The Authors. Immunology © 2012 Blackwell Publishing Ltd.

  14. Sibling rivalry: competition between MHC class II family members inhibits immunity.

    Science.gov (United States)

    Denzin, Lisa K; Cresswell, Peter

    2013-01-01

    Peptide loading of major histocompatibility complex (MHC) class II molecules in the endosomes and lysosomes of antigen-presenting cells is catalyzed by human leukocyte antigen-DM (HLA-DM) and modulated by HLA-DO. In a structural study in this issue, Guce et al. show that HLA-DO is an MHC class II mimic and functions as a competitive and essentially irreversible inhibitor of HLA-DM activity, thereby inhibiting MHC class II antigen presentation.

  15. Interactions between Temperament, Stress, and Immune Function in Cattle

    Directory of Open Access Journals (Sweden)

    N. C. Burdick

    2011-01-01

    Full Text Available The detrimental effects caused by stressors encountered by animals during routine handling can pose economic problems for the livestock industry due to increased costs ultimately borne by the producer and the consumer. Stress adversely affects key physiological processes of the reproductive and immune systems. In recent years stress responsiveness has been associated with cattle behavior, specifically temperament. Cattle with more excitable temperaments, as measured by chute score, pen score, and exit velocity (flight speed, exhibit greater basal concentrations of glucocorticoids and catecholamines. Similar to stressed cattle, more temperamental cattle (i.e., cattle exhibiting greater exit velocity or pen and chute scores have poorer growth performance, carcass characteristics, and immune responses. Thus, understanding the interrelationship of stress and temperament can help in the development of selection and management practices that reduce the negative influence of temperament on growth and productivity of cattle. This paper discusses the relationship between stress and temperament and the developing evidence of an effect of temperament on immune function of cattle that have been handled or restrained. Specifically, the paper discusses different methodologies used to measure temperament, including chute score, pen score, and exit velocity, and discusses the reaction of cattle to different stressors including handling and restraint.

  16. PD-1 checkpoint inhibition: Toxicities and management.

    Science.gov (United States)

    Hahn, Andrew W; Gill, David M; Agarwal, Neeraj; Maughan, Benjamin L

    2017-12-01

    With the recent approval of 5 PD-1/PD-L1 inhibitors for a number of malignancies, PD-1 axis inhibition is drastically changing the treatment landscape of immunotherapy in cancer. As PD-1/PD-L1 are involved in peripheral immune tolerance, inhibition of this immune checkpoint has led to novel immune-related adverse events including colitis, hepatitis, pneumonitis, rash, and endocrinopathies among many others. In this seminar, we will analyze the incidence of immune-related adverse events for nivolumab, pembrolizumab, atezolizumab, durvalumab, and avelumab. Then, we will discuss the specific management of the most common immune-mediated adverse events including colitis, hepatitis, pneumonitis, rash, endocrinopathies, nephritis, and neurologic toxicities. Immune-related adverse events are frequently treated with immunosuppressive medication such as steroids and mycofenolate mofetil. There are specific immune-related adverse events which are frequently seen by the treating oncologist from checkpoint inhibitors. It is essential to understand the recommended treatment options to minimize toxicity and mortality from this important class of anti-neoplastic therapies. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. FTY720 ameliorates murine sclerodermatous chronic graft-versus-host disease by promoting expansion of splenic regulatory cells and inhibiting immune cell infiltration into skin.

    Science.gov (United States)

    Huu, Doanh Le; Matsushita, Takashi; Jin, Guihua; Hamaguchi, Yasuhito; Hasegawa, Minoru; Takehara, Kazuhiko; Fujimoto, Manabu

    2013-06-01

    Sphingosine 1-phosphate (S1P) exerts a variety of activities in immune, inflammatory, and vascular systems. S1P plays an important role in systemic sclerosis (SSc) pathogenesis. Regulation of S1P in fibrotic diseases as well as in SSc was recently reported. FTY720, an oral S1P receptor modulator, has been shown to be a useful agent for the prevention of transplant rejection and autoimmune diseases. Murine sclerodermatous chronic graft-versus-host disease (GVHD) is a model for human sclerodermatous chronic GVHD and SSc. We undertook this study to investigate the effects of FTY720 in murine sclerodermatous chronic GVHD. FTY720 was orally administered to allogeneic recipient mice from day 0 to day 20 (short-term, early-treatment group), from day 0 to day 42 (full-term, early-treatment group), or from day 22 to day 42 (delayed-treatment group) after bone marrow transplantation. Delayed administration of FTY720 attenuated, and early administration of FTY720 inhibited, the severity and fibrosis in murine sclerodermatous chronic GVHD. With early treatment, FTY720 induced expansion of splenic myeloid-derived suppressor cells, Treg cells, and Breg cells. Vascular damage in chronic GVHD was inhibited by FTY720 through down-regulating serum levels of S1P and soluble E-selectin. FTY720 inhibited infiltration of immune cells into skin. Moreover, FTY720 diminished the expression of messenger RNA for monocyte chemotactic protein 1, macrophage inflammatory protein 1α, RANTES, tumor necrosis factor α, interferon-γ, interleukin-6 (IL-6), IL-10, IL-17A, and transforming growth factor β1 in the skin. FTY720 suppressed the immune response by promoting the expansion of regulatory cells and reducing vascular damage and infiltration of immune cells into the skin. Taken together, these results have important implications for the potential use of FTY720 in the treatment of sclerodermatous chronic GVHD and SSc in humans. Copyright © 2013 by the American College of Rheumatology.

  18. Effects of rearing temperature on immune functions in sockeye salmon (Oncorhynchus nerka)

    Science.gov (United States)

    Alcorn, S.W.; Murray, A.L.; Pascho, R.J.

    2002-01-01

    To determine if the defences of sockeye salmon (Oncorhynchus nerka) raised in captivity are affected by the rearing temperature or their life-cycle stage, various indices of the humoral and cellular immune functions were measured in fish reared at either 8 or 12??C for their entire life-cycle. Measures of humoral immunity included the commonly used haematological parameters, as well as measurements of complement, and lysozyme activity. Cellular assays quantified the ability of macrophages from the anterior kidney to phagocytise Staphylococcus aureus cells, or the activities of certain bactericidal systems of those cells. The T-dependent antibody response to a recombinant 57 kDa protein of Renibacterium salmoninarum was used to quantify the specific immune response. Fish were sampled during the spring and fall of their second, third and fourth years, corresponding to a period that began just before smolting and ended at sexual maturation. Fish reared at 8??C tended to have a greater percentage of phagocytic kidney macrophages during the first 2 years of sampling than the fish reared at 12??C. During the last half of the study the complement activity of the fish reared at 8??C was greater than that of the 12??C fish. Conversely, a greater proportion of the blood leucocytes were lymphocytes in fish reared at 12??C compared to the fish reared at 8??C. Fish reared at 12??C also produced a greater antibody response than those reared at 8??C. Results suggested that the immune apparatus of sockeye salmon reared at 8??C relied more heavily on the non-specific immune response, while the specific immune response was used to a greater extent when the fish were reared at 12??C. Although a seasonal effect was not detected in any of the indices measured, varying effects were observed in some measurements during sexual maturation of fish in both temperature groups. At that time there were dramatic decreases in complement activity and lymphocyte numbers. This study was unique in

  19. Use of the local lymph node assay in assessment of immune function

    International Nuclear Information System (INIS)

    Berg, Femke A. van den; Baken, Kirsten A.; Vermeulen, Jolanda P.; Gremmer, Eric R.; Steeg, Harry van; Loveren, Henk van

    2005-01-01

    The murine local lymph node assay (LLNA) was originally developed as a predictive test method for the identification of chemicals with sensitizing potential. In this study we demonstrated that an adapted LLNA can also be used as an immune function assay by studying the effects of orally administered immunomodulating compounds on the T-cell-dependent immune response induced by the contact sensitizer 2,4-dinitrochlorobenzene (DNCB). C57Bl/6 mice were treated with the immunotoxic compounds cyclosporin A (CsA), bis(tri-n-butyltin)oxide (TBTO) or benzo[a]pyrene (B[a]P). Subsequently, cell proliferation and interferon-γ (IFN-γ) and interleukin (IL)-4 release were determined in the auricular lymph nodes (LNs) after DNCB application on both ears. Immunosuppression induced by CsA, TBTO and B[a]P was clearly detectable in this application of the LLNA. Cytokine release measurements proved valuable to confirm the results of the cell proliferation assay and to obtain an indication of the effect on Th1/Th2 balance. We believe to have demonstrated the applicability of an adapted LLNA as an immune function assay in the mouse

  20. Use of the local lymph node assay in assessment of immune function.

    Science.gov (United States)

    van den Berg, Femke A; Baken, Kirsten A; Vermeulen, Jolanda P; Gremmer, Eric R; van Steeg, Harry; van Loveren, Henk

    2005-07-01

    The murine local lymph node assay (LLNA) was originally developed as a predictive test method for the identification of chemicals with sensitizing potential. In this study we demonstrated that an adapted LLNA can also be used as an immune function assay by studying the effects of orally administered immunomodulating compounds on the T-cell-dependent immune response induced by the contact sensitizer 2,4-dinitrochlorobenzene (DNCB). C57Bl/6 mice were treated with the immunotoxic compounds cyclosporin A (CsA), bis(tri-n-butyltin)oxide (TBTO) or benzo[a]pyrene, (B[a]P). Subsequently, cell proliferation and interferon-gamma (IFN-gamma) and interleukin (IL)-4 release were determined in the auricular lymph nodes (LNs) after DNCB application on both ears. Immunosuppression induced by CsA, TBTO and B[a]P was clearly detectable in this application of the LLNA. Cytokine release measurements proved valuable to confirm the results of the cell proliferation assay and to obtain an indication of the effect on Th1/Th2 balance. We believe to have demonstrated the applicability of an adapted LLNA as an immune function assay in the mouse.

  1. Comparison the Executive Functions of Inhibition and Problem Solving in Adolescents with and Without Substance Abuse

    Directory of Open Access Journals (Sweden)

    Tahereh masoomi mofrad

    2015-03-01

    Full Text Available Executive functions are self-regulated functions and show the ability to inhibition, self-changing, planning, organization, using the working memory, solving problems and targeting for homework and school activities. This study compares the executive functions of inhibition and problem solving in adolescents with and without substance abuse. In this causal-comparative study, 15 adolescents with substance abuse and 15 normal adolescents were selected which matched each other with the same age, sex and education. The research tools were Wisconsin Card, was used for assessing the inhibition executive functions, and Heppner and Petersen Questionnaires for problem solving. The results showed that there were statistically significant differences between groups between average score of inhibition executive functions and solving problem (except trend– avoid component. There were not statistically significant differences in the average score of inhibition executive functions and solving problem according to age, sex and education. It is concluded that the drug addicts are weaker than those without substance abuse based on the inhibition executive function and problem solving. These findings can be used for the prevention program.

  2. Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

    International Nuclear Information System (INIS)

    Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C.; Ballestas, Mary E.; Elmets, Craig A.; Robbins, David J.; Matalon, Sadis; Deshane, Jessy S.; Afaq, Farrukh; Bickers, David R.; Athar, Mohammad

    2013-01-01

    Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon, 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions

  3. Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C. [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Ballestas, Mary E. [Department of Pediatrics Infectious Disease, Children' s of Alabama, School of Medicine, University of Alabama at Birmingham, AL (United States); Elmets, Craig A. [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Robbins, David J. [Department of Surgery, Molecular Oncology Program, Miller School of Medicine, University of Miami, Miami (United States); Matalon, Sadis [Department of Anesthesiology, University of Alabama at Birmingham, Birmingham, AL (United States); Deshane, Jessy S. [Department of Medicine, Division of Pulmonary, Allergy and Critical Care Medicine, University of Alabama at Birmingham, Birmingham, AL (United States); Afaq, Farrukh [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Bickers, David R. [Department of Dermatology, Columbia University Medical Center, New York (United States); Athar, Mohammad, E-mail: mathar@uab.edu [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States)

    2013-11-01

    Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon, 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions.

  4. Cross-immunity among allogeneic tumors in rats immunized with gamma-irradiated ascites tumors

    International Nuclear Information System (INIS)

    Sato, Tatsusuke; Suga, Michio; Kudo, Hajime; Waga, Takashi; Ogasawara, Masamichi

    1980-01-01

    Non-inbred rats of the Gifu strain were intraperitoneally challenged with Hirosaki sarcoma (Tetraploid type, 10 5 cells) after repeated immunization with gamma-irradiated (13,000 rads 60 Co) allogeneic non-viral tumors of ascites type (Tetraploid or diploid type of Hirosaki sarcoma, Usubuchi sarcoma or AH130). In rats immunized not only with the same tumor as the immunizing tumor but also with a different tumor, the growth of the challenge tumor was markedly inhibited as compared with the control in non-immunized rats. It is considered that these tumors retained common antigen(s) by the resistance to irradiation because of their form of ascites tumor. The marked cross-immunity in rats immunized with AH130 may be explained by the fact that gamma-irradiated AH130 cells were alive longer in the peritoneal cavity than other tumors on account of its high resistance to irradiation. (author)

  5. Poppers: more evidence of suppressed immunity.

    Science.gov (United States)

    James, J S

    1999-08-20

    Evidence from studies in mice shows that exposure to isobutyl nitrite suppresses the immune system. This immune suppression allows for bacterial growth in the lungs and livers of infected mice and can inhibit the ability of mediastinal lymph nodes to respond to antigen-specific stimulation. The mechanism for immune suppression may be a reduction in CD4+ and CD8+ T cell populations in the mediastinal lymph nodes following pulmonary infection with Listeria monocytogenes.

  6. Let's Tie the Knot: Marriage of Complement and Adaptive Immunity in Pathogen Evasion, for Better or Worse.

    Science.gov (United States)

    Bennett, Kaila M; Rooijakkers, Suzan H M; Gorham, Ronald D

    2017-01-01

    The complement system is typically regarded as an effector arm of innate immunity, leading to recognition and killing of microbial invaders in body fluids. Consequently, pathogens have engaged in an arms race, evolving molecules that can interfere with proper complement responses. However, complement is no longer viewed as an isolated system, and links with other immune mechanisms are continually being discovered. Complement forms an important bridge between innate and adaptive immunity. While its roles in innate immunity are well-documented, its function in adaptive immunity is less characterized. Therefore, it is no surprise that the field of pathogenic complement evasion has focused on blockade of innate effector functions, while potential inhibition of adaptive immune responses (via complement) has been overlooked to a certain extent. In this review, we highlight past and recent developments on the involvement of complement in the adaptive immune response. We discuss the mechanisms by which complement aids in lymphocyte stimulation and regulation, as well as in antigen presentation. In addition, we discuss microbial complement evasion strategies, and highlight specific examples in the context of adaptive immune responses. These emerging ties between complement and adaptive immunity provide a catalyst for future discovery in not only the field of adaptive immune evasion but in elucidating new roles of complement.

  7. The kinase TBK1 functions in dendritic cells to regulate T cell homeostasis, autoimmunity, and antitumor immunity.

    Science.gov (United States)

    Xiao, Yichuan; Zou, Qiang; Xie, Xiaoping; Liu, Ting; Li, Haiyan S; Jie, Zuliang; Jin, Jin; Hu, Hongbo; Manyam, Ganiraju; Zhang, Li; Cheng, Xuhong; Wang, Hui; Marie, Isabelle; Levy, David E; Watowich, Stephanie S; Sun, Shao-Cong

    2017-05-01

    Dendritic cells (DCs) are crucial for mediating immune responses but, when deregulated, also contribute to immunological disorders, such as autoimmunity. The molecular mechanism underlying the function of DCs is incompletely understood. In this study, we have identified TANK-binding kinase 1 (TBK1), a master innate immune kinase, as an important regulator of DC function. DC-specific deletion of Tbk1 causes T cell activation and autoimmune symptoms and also enhances antitumor immunity in animal models of cancer immunotherapy. The TBK1-deficient DCs have up-regulated expression of co-stimulatory molecules and increased T cell-priming activity. We further demonstrate that TBK1 negatively regulates the induction of a subset of genes by type I interferon receptor (IFNAR). Deletion of IFNAR1 could largely prevent aberrant T cell activation and autoimmunity in DC-conditional Tbk1 knockout mice. These findings identify a DC-specific function of TBK1 in the maintenance of immune homeostasis and tolerance. © 2017 Xiao et al.

  8. Tribbles 3 inhibits brown adipocyte differentiation and function by suppressing insulin signaling

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Ha-Won; Choi, Ran Hee; McClellan, Jamie L. [Division of Applied Physiology, Department of Exercise Science, University of South Carolina, Columbia, SC 29208 (United States); Piroli, Gerardo G.; Frizzell, Norma [Department of Pharmacology, Physiology & Neuroscience, University of South Carolina School of Medicine, Columbia, SC 29208 (United States); Tseng, Yu-Hua; Goodyear, Laurie J. [Research Division, Joslin Diabetes Center and Department of Medicine, Harvard Medical School, Boston, MA 02215 (United States); Koh, Ho-Jin, E-mail: kohh@mailbox.sc.edu [Division of Applied Physiology, Department of Exercise Science, University of South Carolina, Columbia, SC 29208 (United States)

    2016-02-19

    Recent studies have demonstrated that adult humans have substantial amounts of functioning brown adipose tissue (BAT). Since BAT has been implicated as an anti-obese and anti-diabetic tissue, it is important to understand the signaling molecules that regulate BAT function. There has been a link between insulin signaling and BAT metabolism as deletion or pharmaceutical inhibition of insulin signaling impairs BAT differentiation and function. Tribbles 3 (TRB3) is a pseudo kinase that has been shown to regulate metabolism and insulin signaling in multiple tissues but the role of TRB3 in BAT has not been studied. In this study, we found that TRB3 expression was present in BAT and overexpression of TRB3 in brown preadipocytes impaired differentiation and decreased expression of BAT markers. Furthermore, TRB3 overexpression resulted in significantly lower oxygen consumption rates for basal and proton leakage, indicating decreased BAT activity. Based on previous studies showing that deletion or pharmaceutical inhibition of insulin signaling impairs BAT differentiation and function, we assessed insulin signaling in brown preadipocytes and BAT in vivo. Overexpression of TRB3 in cells impaired insulin-stimulated IRS1 and Akt phosphorylation, whereas TRB3KO mice displayed improved IRS1 and Akt phosphorylation. Finally, deletion of IRS1 abolished the function of TRB3 to regulate BAT differentiation and metabolism. These data demonstrate that TRB3 inhibits insulin signaling in BAT, resulting in impaired differentiation and function. - Highlights: • TRB3 is expressed in brown adipose tissue and its expression is increased during differentiation. • Overexpression of TRB3 inhibits differentiation and its activity. • Overexpression of TRB3 in brown preadipocytes inhibits insulin signaling. • TRB3KO mice displays improved insulin signaling in brown adipose tissue. • Insulin signaling is required for the effects of TRB3 to regulate brown adipose tissue differentiation and

  9. Tribbles 3 inhibits brown adipocyte differentiation and function by suppressing insulin signaling

    International Nuclear Information System (INIS)

    Jeong, Ha-Won; Choi, Ran Hee; McClellan, Jamie L.; Piroli, Gerardo G.; Frizzell, Norma; Tseng, Yu-Hua; Goodyear, Laurie J.; Koh, Ho-Jin

    2016-01-01

    Recent studies have demonstrated that adult humans have substantial amounts of functioning brown adipose tissue (BAT). Since BAT has been implicated as an anti-obese and anti-diabetic tissue, it is important to understand the signaling molecules that regulate BAT function. There has been a link between insulin signaling and BAT metabolism as deletion or pharmaceutical inhibition of insulin signaling impairs BAT differentiation and function. Tribbles 3 (TRB3) is a pseudo kinase that has been shown to regulate metabolism and insulin signaling in multiple tissues but the role of TRB3 in BAT has not been studied. In this study, we found that TRB3 expression was present in BAT and overexpression of TRB3 in brown preadipocytes impaired differentiation and decreased expression of BAT markers. Furthermore, TRB3 overexpression resulted in significantly lower oxygen consumption rates for basal and proton leakage, indicating decreased BAT activity. Based on previous studies showing that deletion or pharmaceutical inhibition of insulin signaling impairs BAT differentiation and function, we assessed insulin signaling in brown preadipocytes and BAT in vivo. Overexpression of TRB3 in cells impaired insulin-stimulated IRS1 and Akt phosphorylation, whereas TRB3KO mice displayed improved IRS1 and Akt phosphorylation. Finally, deletion of IRS1 abolished the function of TRB3 to regulate BAT differentiation and metabolism. These data demonstrate that TRB3 inhibits insulin signaling in BAT, resulting in impaired differentiation and function. - Highlights: • TRB3 is expressed in brown adipose tissue and its expression is increased during differentiation. • Overexpression of TRB3 inhibits differentiation and its activity. • Overexpression of TRB3 in brown preadipocytes inhibits insulin signaling. • TRB3KO mice displays improved insulin signaling in brown adipose tissue. • Insulin signaling is required for the effects of TRB3 to regulate brown adipose tissue differentiation and

  10. Immunity to transplantable nitrosourea-induced neurogenic tumors. III. Systemic adoptive transfer of immunity

    International Nuclear Information System (INIS)

    Shibuya, N.; Hochgeschwender, U.; Kida, Y.; Hochwald, G.M.; Thorbecke, G.J.; Cravioto, H.

    1984-01-01

    The effect of intravenously injected tumor immune spleen cells on growth of 3 X 10 5 gliosarcoma T 9 cells injected intradermally (ID) or intracerebrally (IC) into sublethally irradiated CDF rats was evaluated. Spleen cells from donor rats with sufficient immunity to reject 5 X 10 5 T 9 cells inhibited the growth of T 9 cells mixed with spleen cells in a ratio of 1:25 and injected ID, but could not act after intravenous transfer. However, donor rats which had rejected increasing T 9 challenge doses up to 1 X 10 7 cells produced immune spleen cells which, upon IV transfer, could inhibit growth of ID T 9 challenge but not of EB-679, an unrelated glioma, in recipient rats. Rejection of IC T 9 challenge was also obtained after IV transfer, in recipients of such ''hyperimmune'' spleen cells, but was less (60% maximum) than that noted after ID T 9 challenge (100% maximum). The removal of B cells from the transferred spleen cells did not affect the results, suggesting that the specific immunity was mediated by T cells. The authors conclude that the special immunological circumstances of tumors growing in the brain renders them less accessible to rejection by systemically transferred immune cells, but it is nevertheless possible to effect a significant incidence of rejection of syngeneic tumor growth in the brain by the intravenous transfer of hyperimmune spleen cells

  11. The sweet side of a long pentraxin: how glycosylation affects PTX3 functions in innate immunity and inflammation

    Directory of Open Access Journals (Sweden)

    Antonio eInforzato

    2013-01-01

    Full Text Available Innate immunity represents the first line of defence against pathogens and plays key roles in activation and orientation of the adaptive immune response. The innate immune system comprises both a cellular and a humoral arm. Components of the humoral arm include soluble pattern recognition molecules (PRMs that recognise pathogen associated molecular patterns (PAMPs and initiate the immune response in coordination with the cellular arm, therefore acting as functional ancestors of antibodies. The long pentraxin PTX3 is a prototypic soluble PRM that is produced at sites of infection and inflammation by both somatic and immune cells. Gene targeting of this evolutionarily conserved protein has revealed a non-redundant role in resistance to selected pathogens. Moreover, PTX3 exerts important functions at the crossroad between innate immunity, inflammation and female fertility. The human PTX3 protein contains a single N-glycosylation site that is fully occupied by complex type oligosaccharides, mainly fucosylated and sialylated biantennary glycans. Glycosylation has been implicated in a number of PTX3 activities, including neutralization of influenza viruses, modulation of the complement system, and attenuation of leukocyte recruitment. Therefore, this post translational modification might act as a fine tuner of PTX3 functions in native immunity and inflammation.Here we review the studies on PTX3, with emphasis on the glycan-dependent mechanisms underlying pathogen recognition and crosstalk with other components of the innate immune system.

  12. Abnormal immune system development and function in schizophrenia helps reconcile diverse findings and suggests new treatment and prevention strategies.

    Science.gov (United States)

    Anders, Sherry; Kinney, Dennis K

    2015-08-18

    Extensive research implicates disturbed immune function and development in the etiology and pathology of schizophrenia. In addition to reviewing evidence for immunological factors in schizophrenia, this paper discusses how an emerging model of atypical immune function and development helps explain a wide variety of well-established - but puzzling - findings about schizophrenia. A number of theorists have presented hypotheses that early immune system programming, disrupted by pre- and perinatal adversity, often combines with abnormal brain development to produce schizophrenia. The present paper focuses on the hypothesis that disruption of early immune system development produces a latent immune vulnerability that manifests more fully after puberty, when changes in immune function and the thymus leave individuals more susceptible to infections and immune dysfunctions that contribute to schizophrenia. Complementing neurodevelopmental models, this hypothesis integrates findings on many contributing factors to schizophrenia, including prenatal adversity, genes, climate, migration, infections, and stress, among others. It helps explain, for example, why (a) schizophrenia onset is typically delayed until years after prenatal adversity, (b) individual risk factors alone often do not lead to schizophrenia, and (c) schizophrenia prevalence rates actually tend to be higher in economically advantaged countries. Here we discuss how the hypothesis explains 10 key findings, and suggests new, potentially highly cost-effective, strategies for treatment and prevention of schizophrenia. Moreover, while most human research linking immune factors to schizophrenia has been correlational, these strategies provide ethical ways to experimentally test in humans theories about immune function and schizophrenia. This article is part of a Special Issue entitled SI: Neuroimmunology in Health And Disease. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Decreased B and T lymphocyte attenuator in Behcet's disease may trigger abnormal Th17 and Th1 immune responses.

    Science.gov (United States)

    Ye, Zi; Deng, Bolin; Wang, Chaokui; Zhang, Dike; Kijlstra, Aize; Yang, Peizeng

    2016-02-04

    Behcet's disease (BD) is a chronic, systemic and recurrent inflammatory disease associated with hyperactive Th17 and Th1 immune responses. Recent studies have shown that B and T lymphocyte attenuator (BTLA) negatively regulates the immune response. In this study, we investigated whether BTLA activation could be exploited to inhibit the development of abnormal immune responses in BD patients. BTLA expression in PBMCs and CD4(+) T cells was significantly decreased in active BD patients. Decreased BTLA level was associated with increased Th17 and Th1 responses. Activation of BTLA inhibited the abnormal Th17 and Th1 responses and IL-22 expression in both patients and controls. Addition of an agonistic anti-BTLA antibody remarkably inhibited DC-induced Th17 and Th1 cell responses, resulted in decreased production of the Th17 and Th1-related cytokines IL-1beta, IL-6, IL-23 and IL-12p70 and reduced CD40 expression in DCs. In conclusion, decreased BTLA expression in ocular BD may lead to inappropriate control of the Th17 and Th1 immune responses and DC functions. Therefore, BTLA may be involved in the development and recurrence of this disease. Agonistic agents of BTLA may represent a potential therapeutic approach for the treatment of BD and other inflammatory diseases mediated by abnormal Th17 and Th1 immune responses.

  14. Advantages of laparoscopic compared to conventional surgery are not related to an innate immune response of peritoneal immune activation: an animal study in rats.

    Science.gov (United States)

    Lingohr, Philipp; Dohmen, Jonas; Matthaei, Hanno; Schwandt, Timo; Stein, Kathy; Hong, Gun-Soo; Steitz, Julia; Longerich, Thomas; Bölke, Edwin; Wehner, Sven; Kalff, Jörg C

    2017-06-01

    Laparoscopic surgery (LS) has proved superior compared to conventional surgery (CS) regarding morbidity, length of hospital stay, rate of wound infection and time until recovery. An improved preservation of the postoperative immune function is assumed to contribute to these benefits though the role of the local peritoneal immune response is still poorly understood. Our study investigates the peritoneal immune response subsequent to abdominal surgery and compares it between laparoscopic and conventional surgery to find an immunological explanation for the clinically proven benefits of LS. Wistar rats (N = 140) underwent laparoscopic cecum resection (LCR; N = 28), conventional cecum resection (CCR; N = 28), laparoscopic sham operation (LSO; N = 28), conventional sham operation (CSO; N = 28), or no surgical treatment (CTRL; N = 28). Postoperatively, peritoneal lavages were performed, leukocytes isolated and analyzed regarding immune function and phagocytosis activity. Immune function was inhibited postoperatively in animals undergoing LCR or CCR compared to CTRL reflected by a lower TNF-α (CTRL 3956.65 pg/ml, LCR 2018.48 pg/ml (p = 0.023), CCR 2793.78 pg/ml (n.s.)) and IL-6 secretion (CTRL 625.84 pg/ml, LCR 142.84 pg/ml (p = 0.009), CCR 169.53 pg/ml (p = 0.01)). Phagocytosis was not affected in rats undergoing any kind of surgery compared to CTRL. Neither cytokine secretion nor phagocytosis activity differed significantly between laparoscopic and conventional surgery. According to our findings the benefits associated with LS compared to CS cannot be explained by differences in the postoperative peritoneal innate immune response. Further studies are needed to elucidate the causes for a more favorable postoperative outcome in patients after LS compared to CS.

  15. Changes of some immune functions in combined radiation-burn injury in rats

    International Nuclear Information System (INIS)

    Yan Yongtang; Ran Xinze; Wei Shuqing

    1991-01-01

    The characteristics of some immune functions in radiation injury (6 Gy), burn injury (15%, III deg) and combined radiation-burn injury (CRBI) were studied in rats. The results showed that the functions of splenocytes and thymocytes in radiation injury group (RIG) were depressed more markedly 24-72 h after injury. The degree of thymocyte depression in burn injury group (BIG) was significantly lower than that in RIG and recovered more easily. The characteristics of the CRBI effects were as follows: (1) The combined depression effect on thymocytes in CRBI as compared with that in RIG was deeper and the recovery was slower. (2) The depression course of splenocytes was similar to that in RIG, but the depression degree in the early stage was significantly more heavy than that in RIG. (3) In the later stage of CRBI the level of recovery of T H cells was significantly lower than that in RIG. (4) Eschar-excision plus skin grafting at 24 h after combined injury was helpful for the recovery of thymocyte and splenocytes function. The results showed that the depression and recovery of immune functions in combined injury were closely related to the wound of burn

  16. Ochratoxin A inhibits the production of tissue factor and plasminogen activator inhibitor-2 by human blood mononuclear cells: Another potential mechanism of immune-suppression

    International Nuclear Information System (INIS)

    Rossiello, Maria R.; Rotunno, Crescenzia; Coluccia, Addolorata; Carratu, Maria R.; Di Santo, Angelomaria; Evangelista, Virgilio; Semeraro, Nicola; Colucci, Mario

    2008-01-01

    The mycotoxin ochratoxin A (OTA), an ubiquitous contaminant of food products endowed with a wide spectrum of toxicity, affects several functions of mononuclear leukocytes. Monocytes/macrophages play a major role in fibrin accumulation associated with immune-inflammatory processes through the production of tissue factor (TF) and plasminogen activator inhibitor 2 (PAI-2). We studied the effect of OTA on TF and PAI-2 production by human blood mononuclear cells (MNC). The cells were incubated for 3 or 18 h at 37 deg. C with non toxic OTA concentrations in the absence and in the presence of lipopolysaccharide (LPS) or other inflammatory agents. TF activity was measured by a one-stage clotting test. Antigen assays were performed by specific ELISAs in cell extracts or conditioned media and specific mRNAs were assessed by RT-PCR. OTA had no direct effect on TF and PAI-2 production by MNC. However, OTA caused a dose-dependent reduction in LPS-induced TF (activity, antigen and mRNA) and PAI-2 (antigen and mRNA) production with > 85% inhibition at 1 μg/ml. Similar results were obtained when monocyte-enriched preparations were used instead of MNC. TF production was also impaired by OTA (1 μg/ml) when MNC were stimulated with phorbol myristate acetate (98% inhibition), IL-1β (83%) or TNF-α (62%). The inhibition of TF and PAI-2 induction might represent a hitherto unrecognized mechanism whereby OTA exerts immunosuppressant activity

  17. Radio (111In) capillary tube leukocyte adherence inhibition assay for the detection of specific tumor-associated immunity

    International Nuclear Information System (INIS)

    Peng, R.; Myers, W.L.

    1984-01-01

    The specific tumor-associated immune response of C3H/HeJ mice was determined at various times after subcutaneous injection with a transplantable mammary adenocarcinoma (H2712) using a radio ( 111 In) leukocyte adherence inhibition (LAI) assay carried out in capillary tubes. Solubilized tumor-associated antigen prepared by a single phase 1-butanol extraction of the specific tumor and other transplantable tumors of different histological origin were used in the evaluation of LAI reactivity. The assay was found to be capable of detecting a significant antitumor response before the subcutaneous tumors became detectable by palpation. The response remained significant until the tumors were greater than 20 mm in diameter

  18. Let’s Tie the Knot: Marriage of Complement and Adaptive Immunity in Pathogen Evasion, for Better or Worse

    Science.gov (United States)

    Bennett, Kaila M.; Rooijakkers, Suzan H. M.; Gorham, Ronald D.

    2017-01-01

    The complement system is typically regarded as an effector arm of innate immunity, leading to recognition and killing of microbial invaders in body fluids. Consequently, pathogens have engaged in an arms race, evolving molecules that can interfere with proper complement responses. However, complement is no longer viewed as an isolated system, and links with other immune mechanisms are continually being discovered. Complement forms an important bridge between innate and adaptive immunity. While its roles in innate immunity are well-documented, its function in adaptive immunity is less characterized. Therefore, it is no surprise that the field of pathogenic complement evasion has focused on blockade of innate effector functions, while potential inhibition of adaptive immune responses (via complement) has been overlooked to a certain extent. In this review, we highlight past and recent developments on the involvement of complement in the adaptive immune response. We discuss the mechanisms by which complement aids in lymphocyte stimulation and regulation, as well as in antigen presentation. In addition, we discuss microbial complement evasion strategies, and highlight specific examples in the context of adaptive immune responses. These emerging ties between complement and adaptive immunity provide a catalyst for future discovery in not only the field of adaptive immune evasion but in elucidating new roles of complement. PMID:28197139

  19. Microglia and Beyond: Innate Immune Cells As Regulators of Brain Development and Behavioral Function

    Directory of Open Access Journals (Sweden)

    Kathryn M. Lenz

    2018-04-01

    Full Text Available Innate immune cells play a well-documented role in the etiology and disease course of many brain-based conditions, including multiple sclerosis, Alzheimer’s disease, traumatic brain and spinal cord injury, and brain cancers. In contrast, it is only recently becoming clear that innate immune cells, primarily brain resident macrophages called microglia, are also key regulators of brain development. This review summarizes the current state of knowledge regarding microglia in brain development, with particular emphasis on how microglia during development are distinct from microglia later in life. We also summarize the effects of early life perturbations on microglia function in the developing brain, the role that biological sex plays in microglia function, and the potential role that microglia may play in developmental brain disorders. Finally, given how new the field of developmental neuroimmunology is, we highlight what has yet to be learned about how innate immune cells shape the development of brain and behavior.

  20. Microglia and Beyond: Innate Immune Cells As Regulators of Brain Development and Behavioral Function.

    Science.gov (United States)

    Lenz, Kathryn M; Nelson, Lars H

    2018-01-01

    Innate immune cells play a well-documented role in the etiology and disease course of many brain-based conditions, including multiple sclerosis, Alzheimer's disease, traumatic brain and spinal cord injury, and brain cancers. In contrast, it is only recently becoming clear that innate immune cells, primarily brain resident macrophages called microglia, are also key regulators of brain development. This review summarizes the current state of knowledge regarding microglia in brain development, with particular emphasis on how microglia during development are distinct from microglia later in life. We also summarize the effects of early life perturbations on microglia function in the developing brain, the role that biological sex plays in microglia function, and the potential role that microglia may play in developmental brain disorders. Finally, given how new the field of developmental neuroimmunology is, we highlight what has yet to be learned about how innate immune cells shape the development of brain and behavior.

  1. Immunization Information System and Informatics to Promote Immunizations: Perspective From Minnesota Immunization Information Connection.

    Science.gov (United States)

    Muscoplat, Miriam Halstead; Rajamani, Sripriya

    2017-01-01

    The vision for management of immunization information is availability of real-time consolidated data and services for all ages, to clinical, public health, and other stakeholders. This is being executed through Immunization Information Systems (IISs), which are population-based and confidential computerized systems present in most US states and territories. Immunization Information Systems offer many functionalities, such as immunization assessment reports, client follow-up, reminder/recall feature, vaccine management tools, state-supplied vaccine ordering, comprehensive immunization history, clinical decision support/vaccine forecasting and recommendations, data processing, and data exchange. This perspective article will present various informatics tools in an IIS, in the context of the Minnesota Immunization Information Connection.

  2. In immune defense: redefining the role of the immune system in chronic disease.

    Science.gov (United States)

    Rubinow, Katya B; Rubinow, David R

    2017-03-01

    The recognition of altered immune system function in many chronic disease states has proven to be a pivotal advance in biomedical research over the past decade. For many metabolic and mood disorders, this altered immune activity has been characterized as inflammation, with the attendant assumption that the immune response is aberrant. However, accumulating evidence challenges this assumption and suggests that the immune system may be mounting adaptive responses to chronic stressors. Further, the inordinate complexity of immune function renders a simplistic, binary model incapable of capturing critical mechanistic insights. In this perspective article, we propose alternative paradigms for understanding the role of the immune system in chronic disease. By invoking allostasis or systems biology rather than inflammation, we can ascribe greater functional significance to immune mediators, gain newfound appreciation of the adaptive facets of altered immune activity, and better avoid the potentially disastrous effects of translating erroneous assumptions into novel therapeutic strategies.

  3. SAMHD1 is down regulated in lung cancer by methylation and inhibits tumor cell proliferation

    International Nuclear Information System (INIS)

    Wang, Jia-lei; Lu, Fan-zhen; Shen, Xiao-Yong; Wu, Yun; Zhao, Li-ting

    2014-01-01

    Highlights: • SAMHD1 expression level is down regulated in lung adenocarcinoma. • The promoter of SAMHD1 is methylated in lung adenocarcinoma. • Over expression of SAMHD1 inhibits the proliferation of lung cancer cells. - Abstract: The function of dNTP hydrolase SAMHD1 as a viral restriction factor to inhibit the replication of several viruses in human immune cells was well established. However, its regulation and function in lung cancer have been elusive. Here, we report that SAMHD1 is down regulated both on protein and mRNA levels in lung adenocarcinoma compared to adjacent normal tissue. We also found that SAMHD1 promoter is highly methylated in lung adenocarcinoma, which may inhibit its gene expression. Furthermore, over expression of the SAMHD1 reduces dNTP level and inhibits the proliferation of lung tumor cells. These results reveal the regulation and function of SAMHD1 in lung cancer, which is important for the proliferation of lung tumor cells

  4. Anterior Chamber-Associated Immune Deviation (ACAID: An Acute Response to Ocular Insult Protects from Future Immune-Mediated Damage?

    Directory of Open Access Journals (Sweden)

    Robert E. Cone

    2009-01-01

    Full Text Available The “immune privilege” that inhibits immune defense mechanisms that could lead to damage to sensitive ocular tissue is based on the expression of immunosuppressive factors on ocular tissue and in ocular fluids. In addition to this environmental protection, the injection of antigen into the anterior chamber or infection in the anterior chamber induces a systemic suppression of potentially damaging cell-mediated and humoral responses to the antigen. Here we discuss evidence that suggests that Anterior Chamber-Associated Immune Deviation (ACAID a is initiated by an ocular response to moderate inflammation that leads to a systemic immunoregulatory response. Injection into the anterior chamber induces a rise in TNF-α and MCP-1 in aqueous humor and an infiltration of circulating F4/80 + monocytes that home to the iris. The induction of ACAID is dependent on this infiltration of circulating monocytes that eventually emigrate to the thymus and spleen where they induce regulatory T cells that inhibit the inductive or effector phases of a cell-mediated immune response. ACAID therefore protects the eye from the collateral damage of an immune response to infection by suppressing a future potentially damaging response to infection.

  5. Impact of MAPK Pathway Activation in BRAFV600 Melanoma on T Cell and Dendritic Cell Function

    Directory of Open Access Journals (Sweden)

    Patrick A. Ott

    2013-10-01

    Full Text Available Constitutive upregulation of the MAPK pathway by a BRAFV600 mutation occurs in about half of melanomas. This leads to increased oncogenic properties such as tumor cell invasion, metastatic potential, and resistance to apoptosis. Blockade of the MAPK pathway with highly specific kinase inhibitors induces unprecedented tumor response rates in patients with advanced BRAFV600 mutant melanoma. Immune checkpoint blockade with monoclonal antibodies targeting cytotoxic T-lymphocyte antigen 4 and programed death-1/PD-L1 has also demonstrated striking anti-tumor activity in patients with advanced melanoma. Tumor responses are likely limited by multiple additional layers of immune suppression in the tumor microenvironment. There is emerging preclinical and clinical evidence suggesting that MAPK inhibition has a beneficial effect on the immunosuppressive tumor microenvironment, providing a strong rationale for combined immunotherapy and MAPK pathway inhibition in melanoma. The T cell response has been the main focus in the studies reported to date. Since dendritic cells (DCs are important in the induction of tumor-specific T cell responses, the impact of MAPK pathway activation in melanoma on DC function is critical for the melanoma directed immune response. BRAFV600E melanoma cells modulate DCs through the MAPK pathway because its blockade in melanoma cells can reverse suppression of DC function. As both MEK/BRAF inhibition and immune checkpoint blockade have recently taken center stage in the treatment of melanoma, a deeper understanding of how MAPK pathway inhibition affects the tumor immune response is needed.

  6. Inhibition of RM-1 prostate carcinoma and eliciting robust immune responses in the mouse model by using VEGF-M2-GnRH3-hinge-MVP vaccine.

    Science.gov (United States)

    Wang, Yiqin; Alahdal, Murad; Ye, Jia; Jing, Liangliang; Liu, Xiaoxin; Chen, Huan; Jin, Liang; Cao, Rongyue

    2018-01-23

    GnRH and VEGF have been investigated as prostate carcinoma enhancers that support tumor spread and progression. Although both have documented roles in prostate carcinoma and many cancer types, the weak immunogenicity of these peptides has remained a major challenge for use in immunotherapy. Here, we describe a novel strategy to inhibit GnRH and VEGF production and assess the effect on the immune responses against these hormones using the RM-1 prostate cancer model. We designed a novel recombinant fusion protein which combined GnRH and VEGF as a vaccine against this tumor. The newly constructed fusion protein hVEGF121-M2-GnRH3-hinge-MVP contains the human vascular endothelial growth factor (hVEGF121) and three copies of GnRH in sequential linear alignment and T helper epitope MVP as an immunogenic vaccine. The effectiveness of the vaccine in eliciting an immune response and attenuating the prostate tumor growth was evaluated. Results showed that administration of a new vaccine effectively elicited humoral and cellular immune responses. We found that, a novel fusion protein, hVEGF121-M2-GnRH3-hinge-MVP, effectively inhibited growth of RM-1 prostate model and effectively promoted immune response. In conclusion, hVEGF121-M2-GnRH3-hinge-MVP is an effective dual mechanism tumor vaccine that limits RM-1 prostate growth. This vaccine may be a promising strategy for the treatment of hormone refractory prostate malignancies.

  7. Dim light at night increases immune function in Nile grass rats, a diurnal rodent.

    Science.gov (United States)

    Fonken, Laura K; Haim, Achikam; Nelson, Randy J

    2012-02-01

    With the widespread adoption of electrical lighting during the 20th century, human and nonhuman animals became exposed to high levels of light at night for the first time in evolutionary history. This divergence from the natural environment may have significant implications for certain ecological niches because of the important influence light exerts on the circadian system. For example, circadian disruption and nighttime light exposure are linked to changes in immune function. The majority of studies investigating the effects of light exposure and circadian disruption on the immune system use nocturnal rodents. In diurnal species, many hormones and immune parameters vary with secretion patterns 180° out of phase to those of nocturnal rodents. Thus, the authors investigated the effects of nighttime light exposure on immunocompetence in diurnal Nile grass rats (Arvicanthis niloticus). Rats were housed in either standard 14-h light (L):10-h dark (D) cycles with L ∼150 lux and D 0 lux or dim light at night (dLAN) cycles of LD 14:10 with L ∼150 lux and D 5 lux for 3 wks, then tested for plasma bactericidal capacity, as well as humoral and cell-mediated immune responses. Rats exposed to dLAN showed increased delayed-type hypersensitivity pinna swelling, which is consistent with enhanced cell-mediated immune function. dLAN rats similarly showed increased antibody production following inoculation with keyhole lymphocyte hemocyanin (KLH) and increased bactericidal capacity. Daytime corticosterone concentrations were elevated in grass rats exposed to nighttime dim light, which may have influenced immunological measures. Overall, these results indicate nighttime light affects immune parameters in a diurnal rodent.

  8. Thiopurines and inhibition of Rac1 in vascular disease

    OpenAIRE

    Marinković, G.

    2015-01-01

    The mechanism of immunosuppressive drug azathioprine is not clear, while azathioprine has been used for 60 years in clinical practice in patients undergoing transplantation surgery or to combat autoimmune disease. Part of the function of azathioprine became evident in specific immune cells, namely T cells, demonstrating that small GTPase Rac1 was inhibited by azathioprine and thereby reduced their inflammatory response. We show that 6-mercaptopurine and thiopurines 6-thio-GDP and 6-thio-GTP, ...

  9. Protein Arginine Methyltransferase 5 Inhibition Upregulates Foxp3+ Regulatory T Cells Frequency and Function during the Ulcerative Colitis

    Directory of Open Access Journals (Sweden)

    Yingxia Zheng

    2017-05-01

    Full Text Available Ulcerative colitis (UC pathogenesis is related to imbalance of immune responses, and the equilibrium between inflammatory T cells and Foxp3+ regulatory T cells (Tregs plays an important role in the intestinal homeostasis. Protein arginine methyltransferases (PRMTs regulate chromatin remodeling and gene expression. Here, we investigated whether inhibition of PRMTs affects colitis pathogenesis in mice and inflammatory bowel disease patients and further explored the underlying mechanisms. In this study, we found that protein arginine N-methyltransferase inhibitor 1 (AMI-1 treatments increased Tregs frequency, function, and reduced colitis incidence. Adoptive transfer of AMI-1-treated Tregs could reduce the colitis incidence. Colitis was associated with increased local PRMT5 expression, which was inhibited by AMI-1 treatment. Additionally, PRMT5 knockdown T cells produced a better response to TGFβ and promoted Tregs differentiation through decreased DNA methyltransferase 1 (DNMT1 expression. PRMT5 also enhanced H3K27me3 and DNMT1 binding to Foxp3 promoter, which restricted Tregs differentiation. Furthermore, PRMT5 knockdown led to decreased Foxp3 promoter methylation during Tregs induction. PRMT5 expression had a negative relationship with Tregs in UC patients, knockdown of PRMT5 expression increased Tregs frequency and decreased TNFα, IL-6, and IL-13 levels. Our study outlines a novel regulation of PRMT5 on Tregs development and function. Strategies to decrease PRMT5 expression might have therapeutic potential to control UC.

  10. Integrated Circuit Immunity

    Science.gov (United States)

    Sketoe, J. G.; Clark, Anthony

    2000-01-01

    This paper presents a DOD E3 program overview on integrated circuit immunity. The topics include: 1) EMI Immunity Testing; 2) Threshold Definition; 3) Bias Tee Function; 4) Bias Tee Calibration Set-Up; 5) EDM Test Figure; 6) EMI Immunity Levels; 7) NAND vs. and Gate Immunity; 8) TTL vs. LS Immunity Levels; 9) TP vs. OC Immunity Levels; 10) 7805 Volt Reg Immunity; and 11) Seventies Chip Set. This paper is presented in viewgraph form.

  11. Vardenafil inhibiting parasympathetic function of tracheal smooth muscle.

    Science.gov (United States)

    Lee, Fei-Peng; Chao, Pin-Zhir; Wang, Hsing-Won

    2018-07-01

    Levitra, a phosphodiesterase-5 (PDE5) inhibitor, is the trade name of vardenafil. Nowadays, it is applied to treatment of erectile dysfunction. PDE5 inhibitors are employed to induce dilatation of the vascular smooth muscle. The effect of Levitra on impotency is well known; however, its effect on the tracheal smooth muscle has rarely been explored. When administered for sexual symptoms via oral intake or inhalation, Levitra might affect the trachea. This study assessed the effects of Levitra on isolated rat tracheal smooth muscle by examining its effect on resting tension of tracheal smooth muscle, contraction caused by 10 -6  M methacholine as a parasympathetic mimetic, and electrically induced tracheal smooth muscle contractions. The results showed that adding methacholine to the incubation medium caused the trachea to contract in a dose-dependent manner. Addition of Levitra at doses of 10 -5  M or above elicited a significant relaxation response to 10 -6  M methacholine-induced contraction. Levitra could inhibit electrical field stimulation-induced spike contraction. It alone had minimal effect on the basal tension of the trachea as the concentration increased. High concentrations of Levitra could inhibit parasympathetic function of the trachea. Levitra when administered via oral intake might reduce asthma attacks in impotent patients because it might inhibit parasympathetic function and reduce methacholine-induced contraction of the tracheal smooth muscle. Copyright © 2018. Published by Elsevier Taiwan LLC.

  12. Modulation of innate immune responses by Yersinia type III secretion system translocators and effectors.

    Science.gov (United States)

    Bliska, James B; Wang, Xiaoying; Viboud, Gloria I; Brodsky, Igor E

    2013-10-01

    The innate immune system of mammals responds to microbial infection through detection of conserved molecular determinants called 'pathogen-associated molecular patterns' (PAMPs). Pathogens use virulence factors to counteract PAMP-directed responses. The innate immune system can in turn recognize signals generated by virulence factors, allowing for a heightened response to dangerous pathogens. Many Gram-negative bacterial pathogens encode type III secretion systems (T3SSs) that translocate effector proteins, subvert PAMP-directed responses and are critical for infection. A plasmid-encoded T3SS in the human-pathogenic Yersinia species translocates seven effectors into infected host cells. Delivery of effectors by the T3SS requires plasma membrane insertion of two translocators, which are thought to form a channel called a translocon. Studies of the Yersinia T3SS have provided key advances in our understanding of how innate immune responses are generated by perturbations in plasma membrane and other signals that result from translocon insertion. Additionally, studies in this system revealed that effectors function to inhibit innateimmune responses resulting from insertion of translocons into plasma membrane. Here, we review these advances with the goal of providing insight into how a T3SS can activate and inhibit innate immune responses, allowing a virulent pathogen to bypass host defences. © 2013 John Wiley & Sons Ltd.

  13. Adiponectin inhibits insulin function in primary trophoblasts by PPARα-mediated ceramide synthesis.

    Science.gov (United States)

    Aye, Irving L M H; Gao, Xiaoli; Weintraub, Susan T; Jansson, Thomas; Powell, Theresa L

    2014-04-01

    Maternal adiponectin (ADN) levels are inversely correlated with birth weight, and ADN infusion in pregnant mice down-regulates placental nutrient transporters and decreases fetal growth. In contrast to the insulin-sensitizing effects in adipose tissue and muscle, ADN inhibits insulin signaling in the placenta. However, the molecular mechanisms involved are unknown. We hypothesized that ADN inhibits insulin signaling and insulin-stimulated amino acid transport in primary human trophoblasts by peroxisome proliferator-activated receptor-α (PPARα)-mediated ceramide synthesis. Primary human term trophoblast cells were treated with ADN and/or insulin. ADN increased the phosphorylation of p38 MAPK and PPARα. ADN inhibited insulin signaling and insulin-stimulated amino acid transport. This effect was dependent on PPARα, because activation of PPARα with an agonist (GW7647) inhibited insulin signaling and function, whereas PPARα-small interfering RNA reversed the effects of ADN on the insulin response. ADN increased ceramide synthase expression and stimulated ceramide production. C2-ceramide inhibited insulin signaling and function, whereas inhibition of ceramide synthase (with Fumonisin B1) reversed the effects of ADN on insulin signaling and amino acid transport. These findings are consistent with the model that maternal ADN limits fetal growth mediated by activation of placental PPARα and ceramide synthesis, which inhibits placental insulin signaling and amino acid transport, resulting in reduced fetal nutrient availability.

  14. The receptor kinase FER is a RALF-regulated scaffold controlling plant immune signaling

    NARCIS (Netherlands)

    Stegmann, Martin; Monaghan, Jacqueline; Smakowska-Luzan, Elwira; Rovenich, Hanna; Lehner, Anita; Holton, Nicholas; Belkhadir, Youssef; Zipfel, Cyril

    2017-01-01

    In plants, perception of invading pathogens involves cell-surface immune receptor kinases. Here, we report that the Arabidopsis SITE-1 PROTEASE (S1P) cleaves endogenous RAPID ALKALINIZATION FACTOR (RALF) propeptides to inhibit plant immunity. This inhibition is mediated by the malectin-like receptor

  15. Immune function genes CD99L2, JARID2 and TPO show association with autism spectrum disorder

    Directory of Open Access Journals (Sweden)

    Ramos Paula S

    2012-06-01

    Full Text Available Abstract Background A growing number of clinical and basic research studies have implicated immunological abnormalities as being associated with and potentially responsible for the cognitive and behavioral deficits seen in autism spectrum disorder (ASD children. Here we test the hypothesis that immune-related gene loci are associated with ASD. Findings We identified 2,012 genes of known immune-function via Ingenuity Pathway Analysis. Family-based tests of association were computed on the 22,904 single nucleotide polymorphisms (SNPs from the 2,012 immune-related genes on 1,510 trios available at the Autism Genetic Resource Exchange (AGRE repository. Several SNPs in immune-related genes remained statistically significantly associated with ASD after adjusting for multiple comparisons. Specifically, we observed significant associations in the CD99 molecule-like 2 region (CD99L2, rs11796490, P = 4.01 × 10-06, OR = 0.68 (0.58-0.80, in the jumonji AT rich interactive domain 2 (JARID2 gene (rs13193457, P = 2.71 × 10-06, OR = 0.61 (0.49-0.75, and in the thyroid peroxidase gene (TPO (rs1514687, P = 5.72 × 10-06, OR = 1.46 (1.24-1.72. Conclusions This study suggests that despite the lack of a general enrichment of SNPs in immune function genes in ASD children, several novel genes with known immune functions are associated with ASD.

  16. Gap junctions in cells of the immune system: structure, regulation and possible functional roles

    Directory of Open Access Journals (Sweden)

    J.C. Sáez

    2000-04-01

    Full Text Available Gap junction channels are sites of cytoplasmic communication between contacting cells. In vertebrates, they consist of protein subunits denoted connexins (Cxs which are encoded by a gene family. According to their Cx composition, gap junction channels show different gating and permeability properties that define which ions and small molecules permeate them. Differences in Cx primary sequences suggest that channels composed of different Cxs are regulated differentially by intracellular pathways under specific physiological conditions. Functional roles of gap junction channels could be defined by the relative importance of permeant substances, resulting in coordination of electrical and/or metabolic cellular responses. Cells of the native and specific immune systems establish transient homo- and heterocellular contacts at various steps of the immune response. Morphological and functional studies reported during the last three decades have revealed that many intercellular contacts between cells in the immune response present gap junctions or "gap junction-like" structures. Partial characterization of the molecular composition of some of these plasma membrane structures and regulatory mechanisms that control them have been published recently. Studies designed to elucidate their physiological roles suggest that they might permit coordination of cellular events which favor the effective and timely response of the immune system.

  17. Comparison of altered expression of histocompatibility antigens with altered immune function in murine spleen cells treated with ultraviolet radiation and/or TPA

    International Nuclear Information System (INIS)

    Pretell, J.O.; Cone, R.E.

    1985-01-01

    Previous studies in our laboratory demonstrated that several treatments that inhibited the ability of cells to stimulate the mixed lymphocyte reaction (MLR) also blocked the shedding of histocompatibility antigens and Ia antigens from murine spleen cells. In the present studies, one of these treatments, ultraviolet radiation (UV), was shown to cause an initial loss in the density of H-2K, IA, and IE antigens prior to the block in shedding observed after culture of these cells. Further analysis revealed that the UV-induced loss of antigens could be prevented by the presence of colchicine during irradiation. Biosynthetic analyses revealed the IA antigen synthesis was also inhibited in the UV-irradiated cells. Examination of the effects of a second agent, 12-0-tetradecanoylphorbol-13-acetate (TPA) on the turnover of histocompatibility antigens revealed that the biosynthesis and shedding of these antigens were accelerated by this agent. However, addition of TPA to UV-irradiated cells did not result in a reversal of the UV-induced block in biosynthesis of IA antigens. Results of immune function assays correlated with the biochemical studies: UV-irradiation inhibited the generation of the MLR, but TPA enhanced this reaction, and addition of TPA to mixed lymphocyte cultures with UV-irradiated stimulators did not reverse the UV-induced inhibition. These results suggest that, although the turnover of histocompatibility antigens may be affected by TPA and UV in an antagonistic fashion, additional factors other than the expression of histocompatibility antigens are operating in the inhibition of stimulation of an MLR by UV radiation or its enhancement by TPA

  18. Prenatal immune challenge in rats: altered responses to dopaminergic and glutamatergic agents, prepulse inhibition of acoustic startle, and reduced route-based learning as a function of maternal body weight gain after prenatal exposure to poly IC.

    Science.gov (United States)

    Vorhees, Charles V; Graham, Devon L; Braun, Amanda A; Schaefer, Tori L; Skelton, Matthew R; Richtand, Neil M; Williams, Michael T

    2012-08-01

    Prenatal maternal immune activation has been used to test the neurodevelopmental hypothesis of schizophrenia. Most of the data are in mouse models; far less is available for rats. We previously showed that maternal weight change in response to the immune activator polyinosinic-polycytidylic acid (Poly IC) in rats differentially affects offspring. Therefore, we treated gravid Harlan Sprague-Dawley rats i.p. on embryonic day 14 with 8 mg/kg of Poly IC or Saline. The Poly IC group was divided into those that lost or gained the least weight, Poly IC (L), versus those that gained the most weight, Poly IC (H), following treatment. The study design controlled for litter size, litter sampling, sex distribution, and test experience. We found no effects of Poly IC on elevated zero maze, open-field activity, object burying, light-dark test, straight channel swimming, Morris water maze spatial acquisition, reversal, or shift navigation or spatial working or reference memory, or conditioned contextual or cued fear or latent inhibition. The Poly IC (H) group showed a significant decrease in the rate of route-based learning when visible cues were unavailable in the Cincinnati water maze and reduced prepulse inhibition of acoustic startle in females, but not males. The Poly IC (L) group exhibited altered responses to acute pharmacological challenges: exaggerated hyperactivity in response to (+)-amphetamine and an attenuated hyperactivity in response to MK-801. This model did not exhibit the cognitive, or latent inhibition deficits reported in Poly IC-treated rats but showed changes in response to drugs acting on neurotransmitter systems implicated in the pathophysiology of schizophrenia (dopaminergic hyperfunction and glutamatergic hypofunction). Copyright © 2012 Wiley Periodicals, Inc.

  19. Hyperthermia, immunity and metastases

    International Nuclear Information System (INIS)

    Lopatin, V.F.

    1983-01-01

    The analysis of literature data concerning local hyperthermia effects shows that temperatures over 41-42 deg C (in the whole tumor volume), causing tumor growth inhibition and cell injury, can change antigenic nature of a malignant tissue. The tumor injured by thermal effect is able probably the full length of time of injured tissue resorption to maintain at a sufficiently high level antitumoral immunity and lay obstacles to emergence of metastases or even cause regression of those tumoral foci which have not been exposed to direct effect of the injuring agent. The facts of tumoral foci regression take place also upon radiation effect which is associated as well with participation of immune mechanisms. In.experiments with animals an essential increase of immunogenic character of malignant cells exposed to ionizing radiation effect has been observed. It follows that radiation injury of tumoral tissue as well as thermal one is able to stimulate antitumoral immunity and reduce the probability of emergence of metastases. But in case of radiotherapy immunosuppression effect of ionizing radiation (at the expense of inhibition of proliferation and death of immunocompetent cells) can essentially overlap immunostimulating effect related to the changes in antigenic character of tumoral cells

  20. Ebola haemorrhagic fever virus: pathogenesis, immune responses, potential prevention.

    Science.gov (United States)

    Marcinkiewicz, Janusz; Bryniarski, Krzysztof; Nazimek, Katarzyna

    2014-01-01

    Ebola zoonotic RNA filovirus represents human most virulent and lethal pathogens, which induces acute hemorrhagic fever and death within few days in a range of 60-90% of symptomatic individuals. Last outbreak in 2014 in West Africa caused panic that Ebola epidemic can be spread to other continents. Number of deaths in late December reached almost 8,000 individuals out of more than 20,000 symptomatic patients. It seems that only a coordinated international response could counteract the further spread of Ebola. Major innate immunity mechanisms against Ebola are associated with the production of interferons, that are inhibited by viral proteins. Activation of host NK cells was recognized as a leading immune function responsible for recovery of infected people. Uncontrolled cell infection by Ebola leads to an impairment of immunity with cytokine storm, coagulopathy, systemic bleeding, multi-organ failure and death. Tested prevention strategies to induce antiviral immunity include: i. recombinant virus formulations (vaccines); ii. cocktail of monoclonal antibodies (serotherapy); iii. alternative RNA-interference-based antiviral methods. Maintaining the highest standards of aseptic and antiseptic precautions is equally important. Present brief review summarizes a current knowledge concerning pathogenesis of Ebola hemorrhagic disease and the virus interaction with the immune system and discusses recent advances in prevention of Ebola infection by vaccination and serotherapy.

  1. Relations between immune and mediator receptors of mouse lymphocytes

    International Nuclear Information System (INIS)

    Ado, A.D.; Alekseeva, T.A.; Kravchenko, S.A.

    1985-01-01

    This paper examines the action of the specific muscarinic antogonist tritium-quinuclidinyl benzilate (tritium-QNB) on immune rosette formation in mice. It is shown that since the specific muscarini antagonist tritium-QNB inhibits immune rosette formation, this process must be regarded as interconnected with muscarinic receptors of lymphocytes. Interaction of immune (antigen-binding) and mediator receptors, however, is an important factor maintaining immune homeostasis at a certain level

  2. Immune functions in crustaceans: lessons from flies

    NARCIS (Netherlands)

    Stet, R.J.M.; Arts, J.A.J.

    2005-01-01

    In recent years insects, notably Drosophila, have emerged as a popular model for studying immune responses to bacterial and fungal pathogens. Due to the availability of the complete genome sequence, genome-wide scans of immune responses have been performed using microarray analyses. These analyses

  3. Immune cells in Chernobyl recovery operation workers exposed over 500 mSv

    International Nuclear Information System (INIS)

    Bazyka, D.; Byelyaeva, N.; Chumak, A.; Golyarnik, N.; Maznichenko, O.; Kovalenko, Ju.

    2004-01-01

    Immune response parameters were studied in Chernobyl radiation emergency workers exposed to radiation over 500 mSv during 1986. Initial response stage to the radiation exposure was characterised by immunological deficiency with T-cell subsets changes. In the reconstitution period inhibition of immune function was associated with lymphocyte subset changes such as decreased CD3 + and CD4 + cell counts and increased number of somatic mutations in TCR-locus. Late period after the acute radiation exposure in Chernobyl radiation emergency workers is characterized by decreased CD8 + suppressor cell function that could lead to poor proliferation control. Subset analysis of CD34 + cells showed in ARS survivors counts significantly higher than in control especially for the most primitive progenitors with CD34 + CD90 + CD45 -/l ow and CD34 + CD45 - CD38 - phenotypes. (author)

  4. Biliary Innate Immunity: Function and Modulation

    Directory of Open Access Journals (Sweden)

    Kenichi Harada

    2010-01-01

    Full Text Available Biliary innate immunity is involved in the pathogenesis of cholangiopathies in patients with primary biliary cirrhosis (PBC and biliary atresia. Biliary epithelial cells possess an innate immune system consisting of the Toll-like receptor (TLR family and recognize pathogen-associated molecular patterns (PAMPs. Tolerance to bacterial PAMPs such as lipopolysaccharides is also important to maintain homeostasis in the biliary tree, but tolerance to double-stranded RNA (dsRNA is not found. In PBC, CD4-positive Th17 cells characterized by the secretion of IL-17 are implicated in the chronic inflammation of bile ducts and the presence of Th17 cells around bile ducts is causally associated with the biliary innate immune responses to PAMPs. Moreover, a negative regulator of intracellular TLR signaling, peroxisome proliferator-activated receptor-γ (PPARγ, is involved in the pathogenesis of cholangitis. Immunosuppression using PPARγ ligands may help to attenuate the bile duct damage in PBC patients. In biliary atresia characterized by a progressive, inflammatory, and sclerosing cholangiopathy, dsRNA viruses are speculated to be an etiological agent and to directly induce enhanced biliary apoptosis via the expression of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL. Moreover, the epithelial-mesenchymal transition (EMT of biliary epithelial cells is also evoked by the biliary innate immune response to dsRNA.

  5. Novel immune-modulator identified by a rapid, functional screen of the parapoxvirus ovis (Orf virus genome

    Directory of Open Access Journals (Sweden)

    McGuire Michael J

    2012-01-01

    Full Text Available Abstract Background The success of new sequencing technologies and informatic methods for identifying genes has made establishing gene product function a critical rate limiting step in progressing the molecular sciences. We present a method to functionally mine genomes for useful activities in vivo, using an unusual property of a member of the poxvirus family to demonstrate this screening approach. Results The genome of Parapoxvirus ovis (Orf virus was sequenced, annotated, and then used to PCR-amplify its open-reading-frames. Employing a cloning-independent protocol, a viral expression-library was rapidly built and arrayed into sub-library pools. These were directly delivered into mice as expressible cassettes and assayed for an immune-modulating activity associated with parapoxvirus infection. The product of the B2L gene, a homolog of vaccinia F13L, was identified as the factor eliciting immune cell accumulation at sites of skin inoculation. Administration of purified B2 protein also elicited immune cell accumulation activity, and additionally was found to serve as an adjuvant for antigen-specific responses. Co-delivery of the B2L gene with an influenza gene-vaccine significantly improved protection in mice. Furthermore, delivery of the B2L expression construct, without antigen, non-specifically reduced tumor growth in murine models of cancer. Conclusion A streamlined, functional approach to genome-wide screening of a biological activity in vivo is presented. Its application to screening in mice for an immune activity elicited by the pathogen genome of Parapoxvirus ovis yielded a novel immunomodulator. In this inverted discovery method, it was possible to identify the adjuvant responsible for a function of interest prior to a mechanistic study of the adjuvant. The non-specific immune activity of this modulator, B2, is similar to that associated with administration of inactivated particles to a host or to a live viral infection. Administration

  6. Gut microbiota, immunity and disease: a complex relationship

    Directory of Open Access Journals (Sweden)

    Michele M Kosiewicz

    2011-09-01

    Full Text Available Our immune system has evolved to recognize and eradicate pathogenic microbes. However, we have a symbiotic relationship with multiple species of bacteria that occupy the gut and comprise the natural commensal flora or microbiota. The microbiota is critically important for the breakdown of nutrients, and also assists in preventing colonization by potentially pathogenic bacteria. In addition, the gut commensal bacteria appears to be critical for the development of an optimally functioning immune system. Various studies have shown that individual species of the microbiota can induce very different types of immune cells (e.g., Th17 cells, Foxp3+ regulatory T cells and responses, suggesting that the composition of the microbiota can have an important influence on the immune response. Although the microbiota resides in the gut, it appears to have a significant impact on the systemic immune response. Indeed, specific gut commensal bacteria have been shown to affect disease development in organs other than the gut, and depending on the species, have been found to have a wide range of effects on diseases from induction and exacerbation to inhibition and protection. In this review, we will focus on the role that the gut microbiota plays in the development and progression of inflammatory/autoimmune disease, and we will also touch upon its role in allergy and cancer.

  7. Development of immune organs and functioning in humans and test animals: Implications for immune intervention studies.

    Science.gov (United States)

    Kuper, C Frieke; van Bilsen, Jolanda; Cnossen, Hilde; Houben, Geert; Garthoff, Jossie; Wolterbeek, Andre

    2016-09-01

    A healthy immune status is mostly determined during early life stages and many immune-related diseases may find their origin in utero and the first years of life. Therefore, immune health optimization may be most effective during early life. This review is an inventory of immune organ maturation events in relation to developmental timeframes in minipig, rat, mouse and human. It is concluded that time windows of immune organ development in rodents can be translated to human, but minipig reflects the human timeframes better; however the lack of prenatal maternal-fetal immune interaction in minipig may cause less responsiveness to prenatal intervention. It is too early to conclude which immune parameters are most appropriate, because there are not enough comparative immune parameters. Filling these gaps will increase the predictability of results observed in experimental animals, and guide future intervention studies by assessing relevant parameters in the right corresponding developmental time frames. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Potential involvement of the immune system in the development of endometriosis

    Directory of Open Access Journals (Sweden)

    Mwenda Jason M

    2003-12-01

    Full Text Available Abstract This article presents an overview of immunological factors and their role in the development of endometriosis, with emphasis on inflammatory cytokines, growth and adhesion factors. Although retrograde menstruation is a common phenomenon among women of reproductive age, not all women who have retrograde menstruation develop endometriosis. The development of endometriosis is hypothesised to be a complex process, which may be facilitated by several factors, including the quantity and quality of endometrial cells in peritoneal fluid (PF, increased inflammatory activity in PF, increased endometrial-peritoneal adhesion and angiogenesis, reduced immune surveillance and clearance of endometrial cells, and increased production of autoantibodies against endometrial cells. Potential biomarkers like cytokines and autoantibodies upregulated during development of endometriosis may be useful in the development of a non-surgical diagnostic tool. Although endometriosis can be treated using hormonal suppression, there is need for non-hormonal drugs, which can inhibit the development of endometriosis and alleviate pain or infertility without inhibition of ovulation. New molecules that modulate immune function in endometriosis should be the targets for future research.

  9. HIV Infection Is Associated with Impaired Striatal Function during Inhibition with Normal Cortical Functioning on Functional MRI

    NARCIS (Netherlands)

    du Plessis, Stéfan; Vink, Matthijs; Joska, John A; Koutsilieri, Eleni; Bagadia, Asif; Stein, Dan J; Emsley, Robin

    2015-01-01

    The aim of the present study was to investigate the effect of HIV infection on cortical and subcortical regions of the frontal-striatal system involved in the inhibition of voluntary movement. Functional MRI (fMRI) studies suggest that human immunodeficiency virus (HIV) infection is associated with

  10. Effect of depression on the immune function and tumor load in patients with advanced gastric cancer

    Directory of Open Access Journals (Sweden)

    Hai-Bo Shi

    2017-06-01

    Full Text Available Objective: To study the correlation between depression and immune function as well as tumor load in patients with advanced gastric cancer. Methods: 98 patients diagnosed with advanced gastric cancer in our hospital between May 2013 and September 2016 were selected and divided into depression group (n=39 with HAMD scores >50 and non-depression group with HAMD scores≤50 (n=39, serum was collected to detect the levels of cytokines interleukin-2 (IL-2, IL-4, IL-10, IL-17, interferon-γ (IFN-γ and transforming growth factor β1 (TGF- β1 as well as tumor markers carcinoembryonic antigen (CEA, carbohydrate antigen 199 (CA199, CA724, TK-1 and sLAG-3, and gastric cancer tissues were collected to determine the expression of cell cycle-related proteins CyclinD1, CDK4 and E2F. Results: Serum IL-2, IFN-γ and IL-17 levels of depression group were significantly lower than those of non-depression group (P<0.05 while IL-4, IL-10, TGF-β1, CEA, CA199, CA724, TK-1 and sLAG-3 levels were significantly higher than those of non-depression group (P<0.05; CyclinD1, CDK4 and E2F protein expression in tumor tissues of depression group were significantly higher than those of non-depression group (P<0.05. Conclusions: Depression can inhibit the anti-tumor immune response in patients with advanced gastric cancer, and then promote cancer cell proliferation and increase tumor load.

  11. Effect of depression on the immune function and tumor load in patients with advanced gastric cancer

    Institute of Scientific and Technical Information of China (English)

    Hai-Bo Shi

    2017-01-01

    Objective:To study the correlation between depression and immune function as well as tumor load in patients with advanced gastric cancer.Methods: 98 patients diagnosed with advanced gastric cancer in our hospital between May 2013 and September 2016 were selected and divided into depression group (n=39) with HAMD scores >50 and non-depression group with HAMD scores≤50 (n=39), serum was collected to detect the levels of cytokines interleukin-2 (IL-2), IL-4, IL-10, IL-17, interferon-γ (IFN-γ) and transforming growth factorβ1 (TGF-β1) as well as tumor markers carcinoembryonic antigen (CEA), carbohydrate antigen 199 (CA199), CA724, TK-1 and sLAG-3, and gastric cancer tissues were collected to determine the expression of cell cycle-related proteins CyclinD1, CDK4 and E2F.Results:Serum IL-2, IFN-γand IL-17 levels of depression group were significantly lower than those of non-depression group (P<0.05) while IL-4, IL-10, TGF-β1, CEA, CA199, CA724, TK-1 and sLAG-3 levels were significantly higher than those of non-depression group (P<0.05);CyclinD1, CDK4 and E2F protein expression in tumor tissues of depression group were significantly higher than those of non-depression group (P<0.05).Conclusions:Depression can inhibit the anti-tumor immune response in patients with advanced gastric cancer, and then promote cancer cell proliferation and increase tumor load.

  12. A Functional Toll-Interacting Protein Variant Is Associated with Bacillus Calmette-Guérin-Specific Immune Responses and Tuberculosis.

    Science.gov (United States)

    Shah, Javeed A; Musvosvi, Munyaradzi; Shey, Muki; Horne, David J; Wells, Richard D; Peterson, Glenna J; Cox, Jeffery S; Daya, Michelle; Hoal, Eileen G; Lin, Lin; Gottardo, Raphael; Hanekom, Willem A; Scriba, Thomas J; Hatherill, Mark; Hawn, Thomas R

    2017-08-15

    The molecular mechanisms that regulate tuberculosis susceptibility and bacillus Calmette-Guérin (BCG)-induced immunity are mostly unknown. However, induction of the adaptive immune response is a critical step in host control of Mycobacterium tuberculosis. Toll-interacting protein (TOLLIP) is a ubiquitin-binding protein that regulates innate immune responses, including Toll-like receptor signaling, which initiate adaptive immunity. TOLLIP variation is associated with susceptibility to tuberculosis, but the mechanism by which it regulates tuberculosis immunity is poorly understood. To identify functional TOLLIP variants and evaluate the role of TOLLIP variation on innate and adaptive immune responses to mycobacteria and susceptibility to tuberculosis. We used human cellular immunology approaches to characterize the role of a functional TOLLIP variant on monocyte mRNA expression and M. tuberculosis-induced monocyte immune functions. We also examined the association of TOLLIP variation with BCG-induced T-cell responses and susceptibility to latent tuberculosis infection. We identified a functional TOLLIP promoter region single-nucleotide polymorphism, rs5743854, which was associated with decreased TOLLIP mRNA expression in infant monocytes. After M. tuberculosis infection, TOLLIP-deficient monocytes demonstrated increased IL-6, increased nitrite, and decreased bacterial replication. The TOLLIP-deficiency G/G genotype was associated with decreased BCG-specific IL-2 + CD4 + T-cell frequency and proliferation. This genotype was also associated with increased susceptibility to latent tuberculosis infection. TOLLIP deficiency is associated with decreased BCG-specific T-cell responses and increased susceptibility to tuberculosis. We hypothesize that the heightened antibacterial monocyte responses after vaccination of TOLLIP-deficient infants are responsible for decreased BCG-specific T-cell responses. Activating TOLLIP may provide a novel adjuvant strategy for BCG

  13. A biocultural perspective on fictive kinship in the Andes: social support and women's immune function in El Alto, Bolivia.

    Science.gov (United States)

    Hicks, Kathryn

    2014-09-01

    This article examines the influence of emotional and instrumental support on women's immune function, a biomarker of stress, in the city of El Alto, Bolivia. It tests the prediction that instrumental support is protective of immune function for women living in this marginal environment. Qualitative and quantitative ethnographic methods were employed to assess perceived emotional and instrumental support and common sources of support; multiple linear regression analysis was used to model the relationship between social support and antibodies to the Epstein-Barr virus. These analyses provided no evidence that instrumental social support is related to women's health, but there is some evidence that emotional support from compadres helps protect immune function. © 2014 by the American Anthropological Association.

  14. Obesity, Cardiovascular Fitness, and Inhibition Function: An Electrophysiological Study

    Directory of Open Access Journals (Sweden)

    Tai-Fen Song

    2016-07-01

    Full Text Available The purpose of the present study was to examine how obesity and cardiovascular fitness are associated with the inhibition aspect of executive function from behavioral and electrophysiological perspectives. One hundred college students, aged 18 to 25 years, were categorized into four groups of equal size on the basis of body mass index and cardiovascular fitness: a normal-weight and high-fitness (NH group, an obese-weight and high-fitness (OH group, a normal-weight and low-fitness (NL group, and an obese-weight and low-fitness (OL group. Behavioral measures of response time and number of errors, as well as event-related potential (ERP measures of P3 and N1, were assessed during the Stroop Task. The results revealed that, in general, the NH group exhibited shorter response times and larger P3 amplitudes relative to the OH, NL, and OL groups, wherein the OL group exhibited the longest response time in the incongruent condition. No group differences in N1 indices were also revealed. These findings suggest that the status of being both normal weight and having high cardiovascular fitness is associated with better behavioral and later stages of electrophysiological indices of inhibition. However, these benefits in inhibition function would be lost in an individual who is obese or has low cardiovascular fitness, reflecting the importance keeping both normal weight and having high cardiovascular fitness.

  15. Immune System Dysfunction in the Elderly.

    Science.gov (United States)

    Fuentes, Eduardo; Fuentes, Manuel; Alarcón, Marcelo; Palomo, Iván

    2017-01-01

    Human aging is characterized by both physical and physiological frailty that profoundly affects the immune system. In this context aging is associated with declines in adaptive and innate immunity established as immunosenescence. Immunosenescence is a new concept that reflects the age-associated restructuring changes of innate and adaptive immune functions. Thus elderly individuals usually present chronic low-level inflammation, higher infection rates and chronic diseases. A study of alterations in the immune system during aging could provide a potentially useful biomarker for the evaluation of immune senescence treatment. The immune system is the result of the interplay between innate and adaptive immunity, yet the impact of aging on this function is unclear. In this article the function of the immune system during aging is explored.

  16. Intestinal epithelial cell-specific RARα depletion results in aberrant epithelial cell homeostasis and underdeveloped immune system.

    Science.gov (United States)

    Jijon, H B; Suarez-Lopez, L; Diaz, O E; Das, S; De Calisto, J; Yaffe, M B; Pittet, M J; Mora, J R; Belkaid, Y; Xavier, R J; Villablanca, E J

    2018-05-01

    Retinoic acid (RA), a dietary vitamin A metabolite, is crucial in maintaining intestinal homeostasis. RA acts on intestinal leukocytes to modulate their lineage commitment and function. Although the role of RA has been characterized in immune cells, whether intestinal epithelial cells (IECs) rely on RA signaling to exert their immune-regulatory function has not been examined. Here we demonstrate that lack of RA receptor α (RARα) signaling in IECs results in deregulated epithelial lineage specification, leading to increased numbers of goblet cells and Paneth cells. Mechanistically, lack of RARα resulted in increased KLF4 + goblet cell precursors in the distal bowel, whereas RA treatment inhibited klf4 expression and goblet cell differentiation in zebrafish. These changes in secretory cells are associated with increased Reg3g, reduced luminal bacterial detection, and an underdeveloped intestinal immune system, as evidenced by an almost complete absence of lymphoid follicles and gut resident mononuclear phagocytes. This underdeveloped intestinal immune system shows a decreased ability to clear infection with Citrobacter rodentium. Collectively, our findings indicate that epithelial cell-intrinsic RARα signaling is critical to the global development of the intestinal immune system.

  17. Effect of liniment levamisole on cellular immune functions of patients with chronic hepatitis B.

    Science.gov (United States)

    Wang, Ke-Xia; Zhang, Li-Hua; Peng, Jiang-Long; Liang, Yong; Wang, Xue-Feng; Zhi, Hui; Wang, Xiang-Xia; Geng, Huan-Xiong

    2005-12-07

    To explore the effects of liniment levamisole on cellular immune functions of patients with chronic hepatitis B. The levels of T lymphocyte subsets and mIL-2R in peripheral blood mononuclear cells (PBMCs) were measured by biotin-streptavidin (BSA) technique in patients with chronic hepatitis B before and after the treatment with liniment levamisole. After one course of treatment with liniment levamisole, the levels of CD3(+), CD4(+), and the ratio of CD4(+)/CD8(+) increased as compared to those before the treatment but the level of CD8(+) decreased. The total expression level of mIL-2R in PBMCs increased before and after the treatment with liniment levamisole. Liniment levamisole may reinforce cellular immune functions of patients with chronic hepatitis B.

  18. Immune system participates in brain regeneration and restoration of reproduction in the earthworm Dendrobaena veneta.

    Science.gov (United States)

    Molnar, Laszlo; Pollak, Edit; Skopek, Zuzanna; Gutt, Ewa; Kruk, Jerzy; Morgan, A John; Plytycz, Barbara

    2015-10-01

    Earthworm decerebration causes temporary inhibition of reproduction which is mediated by certain brain-derived neurohormones; thus, cocoon production is an apposite supravital marker of neurosecretory center functional recovery during brain regeneration. The core aim of the present study was to investigate aspects of the interactions of nervous and immune systems during brain regeneration in adult Dendrobaena veneta (Annelida; Oligochaeta). Surgical brain extirpation was combined, either with (i) maintenance of immune-competent coelomic cells (coelomocytes) achieved by surgery on prilocaine-anesthetized worms or (ii) prior extrusion of fluid-suspended coelomocytes by electrostimulation. Both brain renewal and cocoon output recovery were significantly faster in earthworms with relatively undisturbed coelomocyte counts compared with individuals where coelomocyte counts had been experimentally depleted. These observations provide empirical evidence that coelomocytes and/or coelomocyte-derived factors (e.g. riboflavin) participate in brain regeneration and, by implication, that there is close functional synergy between earthworm neural and immune systems. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Clinical features, predictive correlates, and pathophysiology of immune-related adverse events in immune checkpoint inhibitor treatments in cancer: a short review

    OpenAIRE

    Yoest, Jennifer M

    2017-01-01

    Jennifer M Yoest Department of Pathology, University of Pittsburgh Medical Center, Pittsburgh, PA, USA Abstract: Identification and characterization of T-cell regulatory mechanisms, or checkpoints, have led to a wave of drug development aimed at inhibiting these targets to “remove the brakes” of the immune system. This class of anticancer therapeutics, termed immune checkpoint inhibitors (ICIs), has harnessed the potential of the body’s own immune system to reco...

  20. Impact of enteral nutrition on postoperative immune function and nutritional status.

    Science.gov (United States)

    Wang, F; Hou, M X; Wu, X L; Bao, L D; Dong, P D

    2015-06-10

    We studied the effects of enteral nutrition (EN) support initiated 1 week before surgery on postoperative nutritional status, immune function, and inflammatory response in gastric cancer patients. A total of 200 gastric cancer patients were randomly divided into two groups: EN starting 1 week before surgery (study group) and EN starting early after surgery (control group). The two groups received EN support, following different therapeutic schedules, until the 9th day after operation. In the patients, body weight, skinfold thickness, upper-arm circumference, white blood cell count, albumin, prealbumin, C-reactive protein, peripheral immunoglobulins (IgA, IgG, and IgM), T lymphocyte subsets, interleukin-6, and tumor necrosis factor-α were measured 10 days before and after surgery and on the first day after surgery. There was no statistically significant difference in the results of recovery time of passage of gas by anus, abdominal distension, stomachache, blood glucose, hepatic and renal functions, and electrolytes between the two groups of patients (P > 0. 05). Adverse reactions occurred to both groups at 1 and 2 days after operation. Such conditions was improved after the intravenous drip rate was adjusted. The albumin and prealbumin levels of the patients in both groups decreased at 1 day after operation (P gastric cancer patients can improve their postoperative nutritional status and immune function, can reduce inflammatory response, and is more conducive to the recovery of patients.

  1. NADH oxidase functions as an adhesin in Streptococcus pneumoniae and elicits a protective immune response in mice.

    Directory of Open Access Journals (Sweden)

    Lena Muchnik

    Full Text Available The initial event in disease caused by S. pneumoniae is adhesion of the bacterium to respiratory epithelial cells, mediated by surface expressed molecules including cell-wall proteins. NADH oxidase (NOX, which reduces free oxygen to water in the cytoplasm, was identified in a non-lectin enriched pneumococcal cell-wall fraction. Recombinant NOX (rNOX was screened with sera obtained longitudinally from children and demonstrated age-dependent immunogenicity. NOX ablation in S. pneumoniae significantly reduced bacterial adhesion to A549 epithelial cells in vitro and their virulence in the intranasal or intraperitoneal challenge models in mice, compared to the parental strain. Supplementation of Δnox WU2 with the nox gene restored its virulence. Saturation of A549 target cells with rNOX or neutralization of cell-wall residing NOX using anti-rNOX antiserum decreased adhesion to A549 cells. rNOX-binding phages inhibited bacterial adhesion. Moreover, peptides derived from the human proteins contactin 4, chondroitin 4 sulfotraferase and laminin5, homologous to the insert peptides in the neutralizing phages, inhibited bacterial adhesion to the A549 cells. Furthermore, rNOX immunization of mice elicited a protective immune response to intranasal or intraperitoneal S. pneumoniae challenge, whereas pneumococcal virulence was neutralized by anti-rNOX antiserum prior to intraperitoneal challenge. Our results suggest that in addition to its enzymatic activity, NOX contributes to S. pneumoniae virulence as a putative adhesin and thus peptides derived from its target molecules may be considered for the treatment of pneumococcal infections. Finally, rNOX elicited a protective immune response in both aerobic and anaerobic environments, which renders NOX a candidate for future pneumococcal vaccine.

  2. Cow’s Milk and Immune Function in the Respiratory Tract: Potential Mechanisms

    Directory of Open Access Journals (Sweden)

    Olaf Perdijk

    2018-02-01

    Full Text Available During the last decades, the world has witnessed a dramatic increase in allergy prevalence. Epidemiological evidence shows that growing up on a farm is a protective factor, which is partly explained by the consumption of raw cow’s milk. Indeed, recent studies show inverse associations between raw cow’s milk consumption in early life and asthma, hay fever, and rhinitis. A similar association of raw cow’s milk consumption with respiratory tract infections is recently found. In line with these findings, controlled studies in infants with milk components such as lactoferrin, milk fat globule membrane, and colostrum IgG have shown to reduce respiratory infections. However, for ethical reasons, it is not possible to conduct controlled studies with raw cow’s milk in infants, so formal proof is lacking to date. Because viral respiratory tract infections and aeroallergen exposure in children may be causally linked to the development of asthma, it is of interest to investigate whether cow’s milk components can modulate human immune function in the respiratory tract and via which mechanisms. Inhaled allergens and viruses trigger local immune responses in the upper airways in both nasal and oral lymphoid tissue. The components present in raw cow’s milk are able to promote a local microenvironment in which mucosal immune responses are modified and the epithelial barrier is enforced. In addition, such responses may also be triggered in the gut after exposure to allergens and viruses in the nasal cavity that become available in the GI tract after swallowing. However, these immune cells that come into contact with cow’s milk components in the gut must recirculate into the blood and home to the (upper and lower respiratory tract to regulate immune responses locally. Expression of the tissue homing-associated markers α4β7 and CCR9 or CCR10 on lymphocytes can be influenced by vitamin A and vitamin D3, respectively. Since both vitamins are present

  3. Heat and immunity: an experimental heat wave alters immune functions in three-spined sticklebacks (Gasterosteus aculeatus).

    Science.gov (United States)

    Dittmar, Janine; Janssen, Hannah; Kuske, Andra; Kurtz, Joachim; Scharsack, Jörn P

    2014-07-01

    Global climate change is predicted to lead to increased temperatures and more extreme climatic events. This may influence host-parasite interactions, immunity and therefore the impact of infectious diseases on ecosystems. However, little is known about the effects of rising temperatures on immune defence, in particular in ectothermic animals, where the immune system is directly exposed to external temperature change. Fish are ideal models for studying the effect of temperature on immunity, because they are poikilothermic, but possess a complete vertebrate immune system with both innate and adaptive immunity. We used three-spined sticklebacks ( Gasterosteus aculeatus) originating from a stream and a pond, whereby the latter supposedly were adapted to higher temperature variation. We studied the effect of increasing and decreasing temperatures and a simulated heat wave with subsequent recovery on body condition and immune parameters. We hypothesized that the immune system might be less active at low temperatures, but will be even more suppressed at temperatures towards the upper tolerable temperature range. Contrary to our expectation, we found innate and adaptive immune activity to be highest at a temperature as low as 13 °C. Exposure to a simulated heat wave induced long-lasting immune disorders, in particular in a stickleback population that might be less adapted to temperature variation in its natural environment. The results show that the activity of the immune system of an ectothermic animal species is temperature dependent and suggest that heat waves associated with global warming may immunocompromise host species, thereby potentially facilitating the spread of infectious diseases. © 2014 The Authors. Journal of Animal Ecology © 2014 British Ecological Society.

  4. Complex multicellular functions at a unicellular eukaryote level: Learning, memory, and immunity.

    Science.gov (United States)

    Csaba, György

    2017-06-01

    According to experimental data, eukaryote unicellulars are able to learn, have immunity and memory. Learning is carried out in a very primitive form, and the memory is not neural but an epigenetic one. However, this epigenetic memory, which is well justified by the presence and manifestation of hormonal imprinting, is strong and permanent in the life of cell and also in its progenies. This memory is epigenetically executed by the alteration and fixation of methylation pattern of genes without changes in base sequences. The immunity of unicellulars is based on self/non-self discrimination, which leads to the destruction of non-self invaders and utilization of them as nourishment (by phagocytosis). The tools of learning, memory, and immunity of unicellulars are uniformly found in plasma membrane receptors, which formed under the effect of dynamic receptor pattern generation, suggested by Koch et al., and this is the basis of hormonal imprinting, by which the encounter between a chemical substance and the cell is specifically memorized. The receptors and imprinting are also used in the later steps of evolution up to mammals (including man) in each mentioned functions. This means that learning, memory, and immunity can be deduced to a unicellular eukaryote level.

  5. The role of glycans in immune evasion: the human fetoembryonic defence system hypothesis revisited.

    Science.gov (United States)

    Clark, Gary F

    2014-03-01

    Emerging data suggest that mechanisms to evade the human immune system may be shared by the conceptus, tumour cells, persistent pathogens and viruses. It is therefore timely to revisit the human fetoembryonic defense system (Hu-FEDS) hypothesis that was proposed in two papers in the 1990s. The initial paper suggested that glycoconjugates expressed in the human reproductive system inhibited immune responses directed against gametes and the developing human by employing their carbohydrate sequences as functional groups. These glycoconjugates were proposed to block specific binding interactions and interact with lectins linked to signal transduction pathways that modulated immune cell functions. The second article suggested that aggressive tumour cells and persistent pathogens (HIV, H. pylori, schistosomes) either mimicked or acquired the same carbohydrate functional groups employed in this system to evade immune responses. This subterfuge enabled these pathogens and tumour cells to couple their survival to the human reproductive imperative. The Hu-FEDS model has been repeatedly tested since its inception. Data relevant to this model have also been obtained in other studies. Herein, the Hu-FEDS hypothesis is revisited in the context of these more recent findings. Far more supportive evidence for this model now exists than when it was first proposed, and many of the original predictions have been validated. This type of subterfuge by pathogens and tumour cells likely applies to all sexually reproducing metazoans that must protect their gametes from immune responses. Intervention in these pathological states will likely remain problematic until this system of immune evasion is fully understood and appreciated.

  6. Functional and Transcriptomic Characterization of Peritoneal Immune-Modulation by Addition of Alanyl-Glutamine to Dialysis Fluid.

    Science.gov (United States)

    Herzog, Rebecca; Kuster, Lilian; Becker, Julia; Gluexam, Tobias; Pils, Dietmar; Spittler, Andreas; Bhasin, Manoj K; Alper, Seth L; Vychytil, Andreas; Aufricht, Christoph; Kratochwill, Klaus

    2017-07-24

    Peritonitis remains a major cause of morbidity and mortality during chronic peritoneal dialysis (PD). Glucose-based PD fluids reduce immunological defenses in the peritoneal cavity. Low concentrations of peritoneal extracellular glutamine during PD may contribute to this immune deficit. For these reasons we have developed a clinical assay to measure the function of the immune-competent cells in PD effluent from PD patients. We then applied this assay to test the impact on peritoneal immune-competence of PD fluid supplementation with alanyl-glutamine (AlaGln) in 6 patients in an open-label, randomized, crossover pilot trial (EudraCT 2012-004004-36), and related the functional results to transcriptome changes in PD effluent cells. Ex-vivo stimulation of PD effluent peritoneal cells increased release of interleukin (IL) 6 and tumor necrosis factor (TNF) α. Both IL-6 and TNF-α were lower at 1 h than at 4 h of the peritoneal equilibration test but the reductions in cytokine release were attenuated in AlaGln-supplemented samples. AlaGln-supplemented samples exhibited priming of IL-6-related pathways and downregulation of TNF-α upstream elements. Results from measurement of cytokine release and transcriptome analysis in this pilot clinical study support the conclusion that suppression of PD effluent cell immune function in human subjects by standard PD fluid is attenuated by AlaGln supplementation.

  7. Nutritional components regulate the gut immune system and its association with intestinal immune disease development.

    Science.gov (United States)

    Lamichhane, Aayam; Kiyono, Hiroshi; Kunisawa, Jun

    2013-12-01

    The gut is equipped with a unique immune system for maintaining immunological homeostasis, and its functional immune disruption can result in the development of immune diseases such as food allergy and intestinal inflammation. Accumulating evidence has demonstrated that nutritional components play an important role in the regulation of gut immune responses and also in the development of intestinal immune diseases. In this review, we focus on the immunological functions of lipids, vitamins, and nucleotides in the regulation of the intestinal immune system and as potential targets for the control of intestinal immune diseases. © 2013 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

  8. Comprehensive proteome analysis of lysosomes reveals the diverse function of macrophages in immune responses.

    Science.gov (United States)

    Gao, Yanpan; Chen, Yanyu; Zhan, Shaohua; Zhang, Wenhao; Xiong, Feng; Ge, Wei

    2017-01-31

    Phagocytosis and autophagy in macrophages have been shown to be essential to both innate and adaptive immunity. Lysosomes are the main catabolic subcellular organelles responsible for degradation and recycling of both extracellular and intracellular material, which are the final steps in phagocytosis and autophagy. However, the molecular mechanisms underlying lysosomal functions after infection remain obscure. In this study, we conducted a quantitative proteomics analysis of the changes in constitution and glycosylation of proteins in lysosomes derived from murine RAW 264.7 macrophage cells treated with different types of pathogens comprising examples of bacteria (Listeria monocytogenes, L. m), DNA viruses (herpes simplex virus type-1, HSV-1) and RNA viruses (vesicular stomatitis virus, VSV). In total, 3,704 lysosome-related proteins and 300 potential glycosylation sites on 193 proteins were identified. Comparative analysis showed that the aforementioned pathogens induced distinct alterations in the proteome of the lysosome, which is closely associated with the immune functions of macrophages, such as toll-like receptor activation, inflammation and antigen-presentation. The most significant changes in proteins and fluctuations in glycosylation were also determined. Furthermore, Western blot analysis showed that the changes in expression of these proteins were undetectable at the whole cell level. Thus, our study provides unique insights into the function of lysosomes in macrophage activation and immune responses.

  9. Leptin as immune mediator: Interaction between neuroendocrine and immune system.

    Science.gov (United States)

    Procaccini, Claudio; La Rocca, Claudia; Carbone, Fortunata; De Rosa, Veronica; Galgani, Mario; Matarese, Giuseppe

    2017-01-01

    Leptin is an adipocyte-derived hormone/cytokine that links nutritional status with neuroendocrine and immune functions. Initially described as an anti-obesity hormone, leptin has subsequently been shown to exert pleiotropic effects, being also able to influence haematopoiesis, thermogenesis, reproduction, angiogenesis, and more importantly immune homeostasis. As a cytokine, leptin can affect both innate and adaptive immunity, by inducing a pro-inflammatory response and thus playing a key role in the regulation of the pathogenesis of several autoimmune/inflammatory diseases. In this review, we discuss the most recent advances on the role of leptin as immune-modulator in mammals and we also provide an overview on its main functions in non-mammalian vertebrates. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Exploiting immune cell metabolic machinery for functional HIV cure and the prevention of inflammaging [version 1; referees: 4 approved

    OpenAIRE

    Clovis S. Palmer; Riya Palchaudhuri; Hassan Albargy; Mohamed Abdel-Mohsen; Suzanne M. Crowe

    2018-01-01

    An emerging paradigm in immunology suggests that metabolic reprogramming and immune cell activation and functions are intricately linked. Viral infections, such as HIV infection, as well as cancer force immune cells to undergo major metabolic challenges. Cells must divert energy resources in order to mount an effective immune response. However, the fact that immune cells adopt specific metabolic programs to provide host defense against intracellular pathogens and how this metabolic shift impa...

  11. Immune responses at brain barriers and implications for brain development and neurological function in later life

    Directory of Open Access Journals (Sweden)

    Helen B. Stolp

    2013-08-01

    Full Text Available For a long time the brain has been considered an immune-privileged site due to a muted inflammatory response and the presence of protective brain barriers. It is now recognised that neuroinflammation may play an important role in almost all neurological disorders and that the brain barriers may be contributing through either normal immune signalling, or disruption of their basic physiological mechanisms. The distinction between normal function and dysfunction at the barriers is difficult to dissect, partly due to a lack of understanding of normal barrier function and partly because of physiological changes that occur as part of normal development and ageing. Brain barriers consist of a number of interacting structural and physiological elements including tight junctions between adjacent barrier cells and an array of influx and efflux transporters. Despite these protective mechanisms, the capacity for immune-surveillance of the brain is maintained, and there is evidence of inflammatory signalling at the brain barriers that may be an important part of the body’s response to damage or infection. This signalling system appears to change both with normal ageing, and during disease. Changes may affect diapedesis of immune cells and active molecular transfer, or cause rearrangement of the tight junctions and an increase in passive permeability across barrier interfaces. Here we review the many elements that contribute to brain barrier functions and how they respond to inflammation, particularly during development and aging. The implications of inflammation–induced barrier dysfunction for brain development and subsequent neurological function are also discussed.

  12. Enhancing Immune Checkpoint Inhibitor Therapy in Kidney Cancer

    Science.gov (United States)

    2017-10-01

    AWARD NUMBER: W81XWH-15-1-0141 TITLE: Enhancing Immune Checkpoint Inhibitor therapy in Kidney Cancer PRINCIPAL INVESTIGATOR: Hans-Joerg Hammers...SUBTITLE Enhancing Immune Checkpoint Inhibitor therapy in Kidney Cancer 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH- 15-1-0141 5c. PROGRAM ELEMENT NUMBER...immune checkpoint inhibition in kidney cancer . The work is designed to test different strategies to induce or enhance the abscopal in a kidney cancer

  13. Indices of immune function used by ecologists are mostly unaffected by repeated freeze-thaw cycles and methodological deviations

    NARCIS (Netherlands)

    Hegemann, Arne; Pardal, Sara; Matson, Kevin D.

    2017-01-01

    Background
    Over the past couple of decades, measuring immunological parameters has become widespread in studies of ecology and evolution. A combination of different immunological indices is useful for quantifying different parts of the immune system and comprehensively assessing immune function.

  14. Identification and utility of innate immune system evasion mechanisms of ASFV.

    Science.gov (United States)

    Correia, Sílvia; Ventura, Sónia; Parkhouse, Robert Michael

    2013-04-01

    The interferon (IFN) system is an early innate anti-virus host defense mechanism that takes place shortly after entry of the pathogen and long before the onset of adaptive immunity. Thus, African swine fever virus (ASFV), as an acute and persistent virus in pigs, is predicted to have evolved multiple genes for the manipulation and evasion of interferon. Although, ASFV is known to interfere with signaling pathways controlling the transcription of cytokines, surprisingly no individual virus gene manipulating the induction or impact of IFN has been described. Since an initial bioinformatics search of the ASFV genome failed to identify potential antagonists of the IFN response, our strategy was to functionally screen early expressed, "unassigned" ASFV genes without existing homologies, particularly from MGFs 360 and 530, in luciferase reporter assays for their inhibition of the induction and impact of IFN. Specifically, we used reporter plasmids containing the luciferase gene under the control of: (1) the IFN-β promoter, to screen for inhibition of induction of type I IFN stimulated by the addition of Poly(I:C); (2) the ISRE DNA elements, to screen for the inhibition of the impact of type I IFN; and (3) the GAS DNA elements to screen for the inhibition of the impact of type II IFN. Our initial experiments revealed six ASFV genes inhibiting one or more of the three luciferase assays. From these, we have selected a total of 3 genes for presentation. The ASFV A276R gene from MGF360 inhibited the induction of IFN-β via both the TLR3 and the cytosolic pathways, targeting IRF3, but not IRF7 or NF-κB. The ASFV A528R inhibited the induction of both NF-κB and IRF3 branches of the type I IFN induction signaling pathway and the impact of IFN response via both IFN type I and type II stimulation. The ASFV I329L gene is a functional viral TLR3 homologue inhibiting the induction of IFN at the level of TRIF. Thus, these genes reduce the IFN response by targeting different

  15. Glycogen synthase kinase 3β promotes liver innate immune activation by restraining AMP-activated protein kinase activation.

    Science.gov (United States)

    Zhou, Haoming; Wang, Han; Ni, Ming; Yue, Shi; Xia, Yongxiang; Busuttil, Ronald W; Kupiec-Weglinski, Jerzy W; Lu, Ling; Wang, Xuehao; Zhai, Yuan

    2018-02-13

    Glycogen synthase kinase 3β (Gsk3β [Gsk3b]) is a ubiquitously expressed kinase with distinctive functions in different types of cells. Although its roles in regulating innate immune activation and ischaemia and reperfusion injuries (IRIs) have been well documented, the underlying mechanisms remain ambiguous, in part because of the lack of cell-specific tools in vivo. We created a myeloid-specific Gsk3b knockout (KO) strain to study the function of Gsk3β in macrophages in a murine liver partial warm ischaemia model. Compared with controls, myeloid Gsk3b KO mice were protected from IRI, with diminished proinflammatory but enhanced anti-inflammatory immune responses in livers. In bone marrow-derived macrophages, Gsk3β deficiency resulted in an early reduction of Tnf gene transcription but sustained increase of Il10 gene transcription on Toll-like receptor 4 stimulation in vitro. These effects were associated with enhanced AMP-activated protein kinase (AMPK) activation, which led to an accelerated and higher level of induction of the novel innate immune negative regulator small heterodimer partner (SHP [Nr0b2]). The regulatory function of Gsk3β on AMPK activation and SHP induction was confirmed in wild-type bone marrow-derived macrophages with a Gsk3 inhibitor. Furthermore, we found that this immune regulatory mechanism was independent of Gsk3β Ser9 phosphorylation and the phosphoinositide 3-kinase-Akt signalling pathway. In vivo, myeloid Gsk3β deficiency facilitated SHP upregulation by ischaemia-reperfusion in liver macrophages. Treatment of Gsk3b KO mice with either AMPK inhibitor or SHP small interfering RNA before the onset of liver ischaemia restored liver proinflammatory immune activation and IRI in these otherwise protected hosts. Additionally, pharmacological activation of AMPK protected wild-type mice from liver IRI, with reduced proinflammatory immune activation. Inhibition of the AMPK-SHP pathway by liver ischaemia was demonstrated in tumour resection

  16. Reprogramming Antitumor Immune Responses with microRNAs

    Science.gov (United States)

    2013-10-01

    disease, including cancer etiology (4) and the generation and inhibition of antitumor immune responses (5–9). Biologically active miRNAs bind to MREs...breast, colorectal, lung, pancreatic , and thyroid carcinomas and in liquid tumors including lymphomas and some acute myeloid leukemias (9, 35). The...immunity [9], underscoring the potential of targeting this major microenvironmental compartment. Accumulating evidence suggests that chronic

  17. Immune function surveillance: association with rejection, infection and cardiac allograft vasculopathy.

    Science.gov (United States)

    Heikal, N M; Bader, F M; Martins, T B; Pavlov, I Y; Wilson, A R; Barakat, M; Stehlik, J; Kfoury, A G; Gilbert, E M; Delgado, J C; Hill, H R

    2013-01-01

    Rejection, cardiac allograft vasculopathy (CAV), and infection are significant causes of mortality in heart transplantation recipients. Assessing the immune status of a particular patient remains challenging. Although endomyocardial biopsy (EMB) and angiography are effective for the identification of rejection and CAV, respectively, these are expensive, invasive, and may have numerous complications. The aim of this study was to evaluate the immune function and assess its utility in predicting rejection, CAV, and infection in heart transplantation recipients. We prospectively obtained samples at the time of routine EMB and when clinically indicated for measurement of the ImmuKnow assay (IM), 12 cytokines and soluble CD30 (sCD30). EMB specimens were evaluated for acute cellular rejection, and antibody-mediated rejection (AMR). CAV was diagnosed by the development of angiographic coronary artery disease. Infectious episodes occurring during the next 30 days after testing were identified by the presence of positive bacterial or fungal cultures and/or viremia that prompted treatment with antimicrobials. We collected 162 samples from 56 cardiac transplant recipients. There were 31 infection episodes, 7 AMR, and 4 CAV cases. The average IM value was significantly lower during infection, (P = .04). Soluble CD30 concentrations showed significantly positive correlation with infection episodes, (P = .001). Significant positive correlation was observed between interleukin-5(IL-5) and AMR episodes (P = .008). Tumor necrosis factor-α and IL-8 showed significant positive correlation with CAV (P = .001). Immune function monitoring appears promising in predicting rejection, CAV, and infection in cardiac transplantation recipients. This approach may help in more individualized immunosuppression and it may also minimize unnecessary EMBs and cardiac angiographies. Published by Elsevier Inc.

  18. The effects of cocoa on the immune system

    Directory of Open Access Journals (Sweden)

    Francisco J. Pérez-Cano

    2013-06-01

    Full Text Available Cocoa is a food relatively rich in polyphenols, which makes it a potent antioxidant. Due to its activity as an antioxidant, as well as through other mechanisms, cocoa consumption has been reported to be beneficial for cardiovascular health, brain functions, and cancer prevention. Furthermore, cocoa influences the immune system, in particular the inflammatory innate response and the systemic and intestinal adaptive immune response. Preclinical studies have demonstrated that a cocoa-enriched diet modifies T-cell functions that conduce to a modulation of the synthesis of systemic and gut antibodies. In this regard, it seems that a cocoa diet in rats produces changes in the lymphocyte composition of secondary lymphoid tissues and the cytokines secreted by T cells. These results suggest that it is possible that cocoa could inhibit the function of Th2 cells, and in line with this, the preventive effect of cocoa on IgE synthesis in a rat allergy model has been reported, which opens up new perspectives when considering the beneficial effects of cocoa compounds. On the other hand, cocoa intake modifies the functionality of gut-associated lymphoid tissue by means of modulating IgA secretion and intestinal microbiota. The mechanisms involved in these influences are discussed here. Further research may elucidate the cocoa compounds involved in such an effect and also the possible medical approaches to these repercussions.

  19. The effects of cocoa on the immune system.

    Science.gov (United States)

    Pérez-Cano, Francisco J; Massot-Cladera, Malen; Franch, Angels; Castellote, Cristina; Castell, Margarida

    2013-01-01

    Cocoa is a food relatively rich in polyphenols, which makes it a potent antioxidant. Due to its activity as an antioxidant, as well as through other mechanisms, cocoa consumption has been reported to be beneficial for cardiovascular health, brain functions, and cancer prevention. Furthermore, cocoa influences the immune system, in particular the inflammatory innate response and the systemic and intestinal adaptive immune response. Preclinical studies have demonstrated that a cocoa-enriched diet modifies T cell functions that conduce to a modulation of the synthesis of systemic and gut antibodies. In this regard, it seems that a cocoa diet in rats produces changes in the lymphocyte composition of secondary lymphoid tissues and the cytokines secreted by T cells. These results suggest that it is possible that cocoa could inhibit the function of T helper type 2 cells, and in line with this, the preventive effect of cocoa on IgE synthesis in a rat allergy model has been reported, which opens up new perspectives when considering the beneficial effects of cocoa compounds. On the other hand, cocoa intake modifies the functionality of gut-associated lymphoid tissue by means of modulating IgA secretion and intestinal microbiota. The mechanisms involved in these influences are discussed here. Further research may elucidate the cocoa compounds involved in such an effect and also the possible medical approaches to these repercussions.

  20. A cascade reaction network mimicking the basic functional steps of acquired immune response

    Science.gov (United States)

    Han, Da; Wu, Cuichen; You, Mingxu; Zhang, Tao; Wan, Shuo; Chen, Tao; Qiu, Liping; Zheng, Zheng; Liang, Hao; Tan, Weihong

    2015-01-01

    Biological systems use complex ‘information processing cores’ composed of molecular networks to coordinate their external environment and internal states. An example of this is the acquired, or adaptive, immune system (AIS), which is composed of both humoral and cell-mediated components. Here we report the step-by-step construction of a prototype mimic of the AIS which we call Adaptive Immune Response Simulator (AIRS). DNA and enzymes are used as simple artificial analogues of the components of the AIS to create a system which responds to specific molecular stimuli in vitro. We show that this network of reactions can function in a manner which is superficially similar to the most basic responses of the vertebrate acquired immune system, including reaction sequences that mimic both humoral and cellular responses. As such, AIRS provides guidelines for the design and engineering of artificial reaction networks and molecular devices. PMID:26391084

  1. Carpobrotus edulis methanol extract inhibits the MDR efflux pumps, enhances killing of phagocytosed S. aureus and promotes immune modulation.

    Science.gov (United States)

    Ordway, Diane; Hohmann, Judit; Viveiros, Miguel; Viveiros, Antonio; Molnar, Joseph; Leandro, Clara; Arroz, Maria Jorge; Gracio, Maria Amelia; Amaral, Leonard

    2003-05-01

    Although alkaloids from the family Aizoaceae have anticancer activity, species of this family have received little attention. Because these alkaloids also exhibit properties normally associated with compounds that have activity at the level of the plasma membrane, a methanol extract of Carpobrotus edulis, a common plant found along the Portuguese coast, was studied for properties normally associated with plasma membrane active compounds. The results of this study show that the extract is non-toxic at concentrations that inhibit a verapamil sensitive efflux pump of L5178 mouse T cell lymphoma cell line thereby rendering these multi-drug resistant cells susceptible to anticancer drugs. These non-toxic concentrations also prime THP-1 human monocyte-derived macrophages to kill ingested Staphylococcus aureus and to promote the release of lymphokines associated with cellular immune functions. The extract also induces the proliferation of THP-1 cells within 1 day of exposure to quantities normally associated with phytohaemagglutinin. The potential role of the compound(s) isolated from this plant in cancer biology is intriguing and is currently under investigation. It is supposed that the resistance modifier and immunomodulatory effect of this plant extract can be exploited in the experimental chemotherapy of cancer and bacterial or viral infections. Copyright 2003 John Wiley & Sons, Ltd.

  2. Immune System

    Science.gov (United States)

    A properly functioning immune system is essential to good health. It defends the body against infectious agents and in some cases tumor cells. Individuals with immune deficiencies resulting from genetic defects, diseases (e.g., AIDS, leukemia), or drug therapies are more suscepti...

  3. Immune mechanisms in Ehrlich ascites tumor growth in mice

    International Nuclear Information System (INIS)

    Marusic, M.

    1979-01-01

    Normal mice immunised with irradiated Ehrlich ascites tumor (EAT) cells rejected EAT challenge given 2 weeks later but T-cell-deficient thymectomised lethally irradiated, and bone-marrow-reconstituted (TIR) mice succumbed. However, when TIR mice were injected i.v. with thymus, lymph node, or spleen cells from normalsyngetic donors immediately following i.p. injection of irradiated EAT cells, they rejected the subsequent tumor challenge. This induction of immunity in TIR mice was shown to be T-cell dependent. Spleen cells from EAT- bearing mice given immediately after irradiated tumor cells were also able to promote rejection of EAT challenge in TIR mice. Spleen cells from EAT-immune mice inhibited EAT growth when admixed with tumor cells prior to i.p. injection into normal recipients, but had no effect on progressive tumor growth when given i.v. immediately after i.p. tumor injection. Immune serum inhibited i.p. EAT growth when given either i.p. or i.v. Whereas inhibition of EAT growth by admixed spleen cells was shown to be T-cell independent. The data indicate that T lymphocytes are required only in the induction phase of the immune reponse of mice against EAT, while the efferent phase of the response is accomplished by serum antibodies, perhaps through an interaction with host macrophages. (author)

  4. MECHANISMS OF VITAMIN D ACTION ON THE IMMUNE SYSTEM

    Directory of Open Access Journals (Sweden)

    S. A. Snopov

    2014-01-01

    Full Text Available Besides the well-known effects upon bone metabolism, vitamin D (VD plays important roles in many other processes in the body, including immune regulation. VD action is carried out through its cellular membrane receptor, which is expressed in a variety of human organs and tissues, e.g., most cells of immune system, as well as epithelial cells lining the mucous membranes. The cell-membrane bound VD receptor is transferred to the cytoplasm, to form a functional complex with vitamin A and its receptor. This complex provides either inhibiting, or enhancing effect upon transcription of hundreds genes in the nuclear DNA, including those that regulate cell growth, differentiation, apoptosis, thus preventing malignancy and angiogenesis. The following effects of VD are supposed with respect to immune system: VD inhibits antigen presentation by dendritic cells, supresses Th1-cell differentiation and the production of Th1-cytokines, shifts the balance of Th1/Th2 cell responses towards the Th2 response, exerts inhibitory effect upon Th17 cells, promotes Treg cell development, and increases their activity. In addition, VD boosts production of «endogenous antibiotics» that may provide powerful effects upon Gram-positive and Gram-negative bacteria, fungi and viruses. Therefore, VD seems quite important for prevention of autoimmune and atopic diseases: multiple sclerosis, rheumatoid arthritis, type 1 diabetes, Crohn’s disease, ulcerative colitis, development of asthma in children and chronic obstructive pulmonary disease. VD protects from a wide range of infections, including tuberculosis, leprosy and respiratory infections, and prevents the development of several tumors. Almost half the population of different countries has a VD hypovitaminosis, often hidden and undiagnosed, and this can be a leading cause of weakened immunity and increased morbidity. The diagnostics of VD hypovitaminosis, prevention and treatment of hypovitaminosis should be among the

  5. Cigarette smoke alters the invariant natural killer T cell function and may inhibit anti-tumor responses.

    LENUS (Irish Health Repository)

    Hogan, Andrew E

    2011-09-01

    Invariant natural killer T (iNKT) cells are a minor subset of human T cells which express the invariant T cell receptor Vα24 Jα18 and recognize glycolipids presented on CD1d. Invariant NKT cells are important immune regulators and can initiate anti-tumor responses through early potent cytokine production. Studies show that iNKT cells are defective in certain cancers. Cigarette smoke contains many carcinogens and is implicated directly and indirectly in many cancers. We investigated the effects of cigarette smoke on the circulating iNKT cell number and function. We found that the iNKT cell frequency is significantly reduced in cigarette smoking subjects. Invariant NKT cells exposed to cigarette smoke extract (CSE) showed significant defects in cytokine production and the ability to kill target cells. CSE inhibits the upregulation of CD107 but not CD69 or CD56 on iNKT cells. These findings suggest that CSE has a specific effect on iNKT cell anti-tumor responses, which may contribute to the role of smoking in the development of cancer.

  6. Cell-mediated immunity during syphilis. A review

    Science.gov (United States)

    Pavia, Charles S.; Folds, James D.; Baseman, Joel B.

    1978-01-01

    Evidence is presented which reinforces the complexity of the host-parasite interaction during the course of syphilis. Infection with Treponema pallidum evokes a complicated antibody response and an assortment of cell-mediated immune reactions in the host. It appears that humoral immunity plays a minor role towards the complete elimination of syphilitic infection while the cellular limb of the immune response may be an important host defence mechanism. Information now available indicates that a state of anergy, or immunosuppression, exists in the early stages of human and experimental rabbit syphilis based upon negative skin reactions to T. pallidum antigen(s), the abnormal histological appearance of lymphoid organs, and impaired in vitro lymphocyte reactivity. It is also evident that in the later stages of the disease cellular immunity becomes activated as delayed type skin reactions can normally be elicited in tertiary syphilitics and lymphocyte behaviour in cell culture appears normal. Several mechanisms have been invoked to explain the delay in an effective immune response against syphilitic infection and the duration of the disease: (1) a capsule-like substance on the outer surface of virulant T. pallidum may act as a barrier against treponemicidal antibody; (2) this material and other biological properties of virulent treponemes could enable spirochaetes to escape being engulfed by macrophages and other phagocytic cells; (3) antigenic competition among different treponemal antigens causing partial tolerance; (4) T. pallidum infection may bring about the elaboration of immunosuppressive substances of host or treponemal origin which inhibit the proper function of lymphocytes, macrophages, and other cell types. PMID:350348

  7. Restoration of the immune functions in aged mice by supplementation with a new herbal composition, HemoHIM.

    Science.gov (United States)

    Park, Hae-Ran; Jo, Sung-Kee; Jung, Uhee; Yee, Sung-Tae

    2008-01-01

    The effect of a new herbal composition, HemoHIM, on immune functions was examined in aged mice, in which various immune responses had been impaired. The composition HemoHIM was prepared by adding the ethanol-insoluble fraction to the total water extract of a mixture of three edible herbs, Angelica Radix, Cnidium Rhizoma and Paeonia Radix. Supplementation to the aged mice with HemoHIM restored the proliferative response and cytokine production of splenocytes with a response to ConA. Also, HemoHIM recovered the NK cell activity which had been impaired in the aged mice. Meanwhile aging is known to reduce the Th1-like function, but not the Th2-like function, resulting in a Th1/Th2 imbalance. HemoHIM restored the Th1/Th2 balance in the aged mice through enhanced IFN-gamma and IgG2a production, and conversely a reduced IL-4 and IgG1 production. It was found that one factor for the Th1/Th2 imbalance in the aged mice was a lower production of IL-12p70. However, HemoHIM restored the IL-12p70 production in the aged mice. These results suggested that HemoHIM was effective for the restoration of impaired immune functions of the aged mice and therefore could be a good recommendation for immune restoration in elderly humans. Copyright (c) 2007 John Wiley & Sons, Ltd.

  8. A viral suppressor of RNA silencing inhibits ARGONAUTE 1 function by precluding target RNA binding to pre-assembled RISC.

    Science.gov (United States)

    Kenesi, Erzsébet; Carbonell, Alberto; Lózsa, Rita; Vértessy, Beáta; Lakatos, Lóránt

    2017-07-27

    In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Associations between immune function and air pollution among postmenopausal women living in the Puget Sound airshed

    Science.gov (United States)

    Williams, Lori A.

    Air pollution is associated with adverse health outcomes, and changes in the immune system may be intermediate steps between exposure and a clinically relevant adverse health outcome. We analyzed the associations between three different types of measures of air pollution exposure and five biomarkers of immune function among 115 overweight and obese postmenopausal women whose immunity was assessed as part of a year-long moderate exercise intervention trial. For air pollution metrics, we assessed: (1) residential proximity to major roads (freeways, major arterials and truck routes), (2) fine particulate matter(PM2.5) at the nearest monitor to the residence averaged over three time windows (3-days, 30-days and 60-days), and (3) nitrogen dioxide (NO2) modeled based on land use characteristics. Our immune biomarkers included three measures of inflammation---C-reactive protein, serum amyloid A and interleukin-6---and two measures of cellular immunity---natural killer cell cytotoxicity and T lymphocyte proliferation. We hypothesized that living near a major road, increased exposure to PM2.5 and increased exposure to NO2 would each be independently associated with increased inflammation and decreased immune function. We observed a 21% lower average natural killer cell cytotoxicity among women living within 150 meters of a major arterial road compared to other women. For PM2.5 , we observed changes in 3 of 4 indicators of lymphocyte proliferation stimulated by anti-CD3---an antibody to the T cell receptor associated with increases in 3-day averaged PM2.5. For 30-day averaged PM 2.5 and 60-day averaged PM2.5 we did not observe any statistically significant associations. We observed an increase in lymphocyte proliferation index stimulated by the plant protein phytohemagglutinin (PHA) at 1 of 2 PHA concentrations in association with modeled NO2. For the three inflammatory markers, we observed no notable associations with any of our measures of air pollution. If confirmed, our

  10. In vitro transcription and translation inhibition via DNA functionalized gold nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Conde, J; Baptista, P V [Centro de Investigacao em Genetica Molecular Humana (CIGMH), Departamento de Ciencias da Vida, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); De la Fuente, J M, E-mail: pmvb@fct.unl.pt [Instituto de Nanociencia de Aragon, Universidad de Zaragoza, Pedro Cerbuna 12, 50009 Zaragoza (Spain)

    2010-12-17

    The use of gold nanoparticles (AuNPs) has been gaining momentum as vectors for gene silencing strategies, combining the AuNPs' ease of functionalization with DNA and/or siRNA, high loading capacity and fast uptake by target cells. Here, we used AuNP functionalized with thiolated oligonucleotides to specifically inhibit transcription in vitro, demonstrating the synergetic effect between AuNPs and a specific antisense sequence that blocks the T7 promoter region. Also, AuNPs efficiently protect the antisense oligonucleotide against nuclease degradation, which can thus retain its inhibitory potential. In addition, we demonstrate that AuNPs functionalized with a thiolated oligonucleotide complementary to the ribosome binding site and the start codon, effectively shut down in vitro translation. Together, these two approaches can provide for a simple yet robust experimental set up to test for efficient gene silencing of AuNP-DNA conjugates. What is more, these results show that appropriate functionalization of AuNPs can be used as a dual targeting approach to an enhanced control of gene expression-inhibition of both transcription and translation.

  11. In vitro transcription and translation inhibition via DNA functionalized gold nanoparticles

    International Nuclear Information System (INIS)

    Conde, J; Baptista, P V; De la Fuente, J M

    2010-01-01

    The use of gold nanoparticles (AuNPs) has been gaining momentum as vectors for gene silencing strategies, combining the AuNPs' ease of functionalization with DNA and/or siRNA, high loading capacity and fast uptake by target cells. Here, we used AuNP functionalized with thiolated oligonucleotides to specifically inhibit transcription in vitro, demonstrating the synergetic effect between AuNPs and a specific antisense sequence that blocks the T7 promoter region. Also, AuNPs efficiently protect the antisense oligonucleotide against nuclease degradation, which can thus retain its inhibitory potential. In addition, we demonstrate that AuNPs functionalized with a thiolated oligonucleotide complementary to the ribosome binding site and the start codon, effectively shut down in vitro translation. Together, these two approaches can provide for a simple yet robust experimental set up to test for efficient gene silencing of AuNP-DNA conjugates. What is more, these results show that appropriate functionalization of AuNPs can be used as a dual targeting approach to an enhanced control of gene expression-inhibition of both transcription and translation.

  12. Selective inhibition of influenza virus protein synthesis by inhibitors of DNA function

    International Nuclear Information System (INIS)

    Minor, P.D.; Dimmock, N.J.

    1977-01-01

    Various known inhibitors of cellular DNA function were shown to inhibit cellular RNA synthesis and influenza (fowl plague) virus multiplication. The drugs were investigated for their effect upon the synthesis of influenza virus proteins. According to this effect they could be classified with previously studied compounds as follows: Group I (ethidium bromide, proflavine, and N-nitroquinoline-N-oxide) inhibited both viral and cellular protein synthesis; Group II (nogalomycin, daunomycin and α-amanitin) inhibited viral but not cellular protein synthesis, and all viral proteins were inhibited coordinately; Group III (mithramycin, echinomycin, and actinomycin D) inhibited all viral but not cellular protein synthesis at high concentrations, but at a lower critical concentration inhibited the synthesis of viral haemagglutinin, neuraminidase, and M protein preferentially; Group IV(uv irradiation and camptothecin) inhibited the synthesis of viral haemagglutinin, neuraminidase, and M protein, but not other viral proteins, even at high doses. The mode of action of these inhibitors is discussed in relation to the mechanism of the nuclear events upon which influenza virus multiplication is dependent

  13. Reaction of the immune system to low-level RF/MW exposures

    International Nuclear Information System (INIS)

    Szmigielski, Stanislaw

    2013-01-01

    Radiofrequency (RF) and microwave (MW) radiation have been used in the modern world for many years. The rapidly increasing use of cellular phones in recent years has seen increased interest in relation to the possible health effects of exposure to RF/MW radiation. In 2011 a group of international experts organized by the IARC (International Agency for Research on Cancer in Lyon) concluded that RF/MW radiations should be listed as a possible carcinogen (group 2B) for humans. The incomplete knowledge of RF/MW-related cancer risks has initiated searches for biological indicators sensitive enough to measure the “weak biological influence” of RF/MWs. One of the main candidates is the immune system, which is able to react in a measurable way to discrete environmental stimuli. In this review, the impacts of weak RF/MW fields, including cell phone radiation, on various immune functions, both in vitro and in vivo, are discussed. The bulk of available evidence clearly indicates that various shifts in the number and/or activity of immunocompetent cells are possible, however the results are inconsistent. For example, a number of lymphocyte functions have been found to be enhanced and weakened within single experiments based on exposure to similar intensities of MW radiation. Certain premises exist which indicate that, in general, short-term exposure to weak MW radiation may temporarily stimulate certain humoral or cellular immune functions, while prolonged irradiation inhibits the same functions

  14. Reaction of the immune system to low-level RF/MW exposures

    Energy Technology Data Exchange (ETDEWEB)

    Szmigielski, Stanislaw, E-mail: szmigielski@wihe.waw.pl

    2013-06-01

    Radiofrequency (RF) and microwave (MW) radiation have been used in the modern world for many years. The rapidly increasing use of cellular phones in recent years has seen increased interest in relation to the possible health effects of exposure to RF/MW radiation. In 2011 a group of international experts organized by the IARC (International Agency for Research on Cancer in Lyon) concluded that RF/MW radiations should be listed as a possible carcinogen (group 2B) for humans. The incomplete knowledge of RF/MW-related cancer risks has initiated searches for biological indicators sensitive enough to measure the “weak biological influence” of RF/MWs. One of the main candidates is the immune system, which is able to react in a measurable way to discrete environmental stimuli. In this review, the impacts of weak RF/MW fields, including cell phone radiation, on various immune functions, both in vitro and in vivo, are discussed. The bulk of available evidence clearly indicates that various shifts in the number and/or activity of immunocompetent cells are possible, however the results are inconsistent. For example, a number of lymphocyte functions have been found to be enhanced and weakened within single experiments based on exposure to similar intensities of MW radiation. Certain premises exist which indicate that, in general, short-term exposure to weak MW radiation may temporarily stimulate certain humoral or cellular immune functions, while prolonged irradiation inhibits the same functions.

  15. Toxicity of cadmium in Japanese quail: Evaluation of body weight, hepatic and renal function, and cellular immune response

    International Nuclear Information System (INIS)

    Sant'Ana, M.G.; Moraes, R.; Bernardi, M.M.

    2005-01-01

    Cadmium (Cd) is an environmental pollutant that is able to alter the immune function. Previous studies have shown that, in mammals, chronic exposure to Cd decreases the release of macrophagic cytokines such as IL1 and TNα and decreases phagocytosis activity. On the other hand contradictory results showed an increase in the humoral response. The cellular response could be decreased by exposure to Cd. These alterations were observed in mammals. The present study aimed to investigate some of the toxic effects of Cd exposure in birds. In particular, the main objective of this work was to elucidate the effects of exposure to this pollutant on the cellular immune function of the Japanese quail as a model for the study of toxicity in animals exposed in nature. The animals were exposed to the metal (100 ppm, per os) during development, i.e., from 1 to 28 days old. Body weight, biochemical parameters, and cellular immune response were measured during and at the end of treatment. The results showed that the exposure to Cd for 28 days significantly reduced the body weight and induced hepatic toxicity. The kidney function and cellular immune response were not affected by the Cd exposure

  16. PDE5 inhibition alleviates functional muscle ischemia in boys with Duchenne muscular dystrophy.

    Science.gov (United States)

    Nelson, Michael D; Rader, Florian; Tang, Xiu; Tavyev, Jane; Nelson, Stanley F; Miceli, M Carrie; Elashoff, Robert M; Sweeney, H Lee; Victor, Ronald G

    2014-06-10

    To determine whether phosphodiesterase type 5 (PDE5) inhibition can alleviate exercise-induced skeletal muscle ischemia in boys with Duchenne muscular dystrophy (DMD). In 10 boys with DMD and 10 healthy age-matched male controls, we assessed exercise-induced attenuation of reflex sympathetic vasoconstriction, i.e., functional sympatholysis, a protective mechanism that matches oxygen delivery to metabolic demand. Reflex vasoconstriction was induced by simulated orthostatic stress, measured as the decrease in forearm muscle oxygenation with near-infrared spectroscopy, and performed when the forearm muscles were rested or lightly exercised with rhythmic handgrip exercise. Then, the patients underwent an open-label, dose-escalation, crossover trial with single oral doses of tadalafil or sildenafil. The major new findings are 2-fold: first, sympatholysis is impaired in boys with DMD-producing functional muscle ischemia-despite contemporary background therapy with corticosteroids alone or in combination with cardioprotective medication. Second, PDE5 inhibition with standard clinical doses of either tadalafil or sildenafil alleviates this ischemia in a dose-dependent manner. Furthermore, PDE5 inhibition also normalizes the exercise-induced increase in skeletal muscle blood flow (measured by Doppler ultrasound), which is markedly blunted in boys with DMD. These data provide in-human proof of concept for PDE5 inhibition as a putative new therapeutic strategy for DMD. This study provides Class IV evidence that in patients with DMD, PDE5 inhibition restores functional sympatholysis. © 2014 American Academy of Neurology.

  17. Functional aspects of the adaptive immune system in arthritis

    NARCIS (Netherlands)

    Jansen, D.T.S.L.

    2017-01-01

    The adaptive immune system is the part of the immune system that is highly specific and generates memory resulting in a fast and specific immune response upon a second infection with the same pathogen. However, when this response is specific for a part of the body itself instead of a pathogen,

  18. IL-35, a hallmark of immune-regulation in cancer progression, chronic infections and inflammatory diseases.

    Science.gov (United States)

    Teymouri, Manouchehr; Pirro, Matteo; Fallarino, Francesca; Gargaro, Marco; Sahebkar, Amirhosein

    2018-03-25

    Cytokine members of the IL-12 family have attracted enormous attention in the last few years, with IL-35 being the one of the most attractive-suppressive cytokine. IL-35 is an important mediator of regulatory T cell function. Regulatory T cells play key roles in restoring immune homeostasis after facing challenges such as infection by specific pathogens. Moreover, a crucial role for regulatory T cell populations has been demonstrated in several physiological processes, including establishment of fetal-maternal tolerance, maintenance of self-tolerance and prevention of autoimmune diseases. However, a deleterious involvement of immune regulatory T cells has been documented in specific inhibition of immune responses against tumor cells, promotion of chronic infections and establishment of chronic inflammatory disorders. In this review, we attempt to shed light on the concept of immune-homoeostasis on the aforementioned issues, taking IL-35 as the hallmark of regulatory responses. The dilemma between immune-mediated cancer treatment and inflammation is discussed. Histopathological indications of chronic vs. acute infections are elaborated. Moreover, the evidence that IL-35 requires additional immune-regulatory cytokines, such as IL-10 and TGF-β, to induce effective and maximal anti-inflammatory effects suggest that immune-regulation requires multi-factorial analysis of many immune playmakers rather than a specific immune target. © 2018 UICC.

  19. Radioimmunotoxicological effect of enriched uranium on central and peripheral immune cells and the protective action of IL-1 and IL-2

    International Nuclear Information System (INIS)

    Zhu Shoupeng; Lai Guanhua; Wang Liuyi

    1993-01-01

    With accumulation of enriched uranium 235 U-UO 2 F 2 in organism, it was found that enriched uranium had injurious effect on the immune function of central and peripheral immune cells. After intravenous injection of enriched uranium the spontaneous 3 H-TdR incorporation in thymocytes and bone marrow cells decreased. Though the sensitivity of immune cells to 235 U-UO 2 F 2 was different, the thymocytes were destroyed more markedly. Also the proliferation ability of T and B lymphocytes were both inhibited by enriched uranium 235 U. As compared with them, spleen B lymphocytes were inhibited more markedly than T lymphocytes. At the same time spleen lymphocytes IL-1 production and IL 2 consumption were diminished. It should be noted that the inhibition of spleen B lymphocytes proliferation by enriched uranium 235 U-UO 2 F 2 was partially restored by exogenous IL-1 or IL-2. The recovery rate of protective action at the very most was 67.1 +- 11.2% with exogenous IL-1 and 50.2 +- 8.0% with IL-2. Moreover, both exogenous IL-1 and IL-2 had synergetic effect, and the recovery rate was elevated to 83.1 +-12.3%

  20. Cytokine regulation of immune tolerance

    OpenAIRE

    Wu, Jie; Xie, Aini; Chen, Wenhao

    2014-01-01

    The immune system provides defenses against invading pathogens while maintaining immune tolerance to self-antigens. This immune homeostasis is harmonized by the direct interactions between immune cells and the cytokine environment in which immune cells develop and function. Herein, we discuss three non-redundant paradigms by which cytokines maintain or break immune tolerance. We firstly describe how anti-inflammatory cytokines exert direct inhibitory effects on immune cells to enforce immune ...

  1. Cell-Intrinsic Glycogen Metabolism Supports Early Glycolytic Reprogramming Required for Dendritic Cell Immune Responses.

    Science.gov (United States)

    Thwe, Phyu M; Pelgrom, Leonard; Cooper, Rachel; Beauchamp, Saritha; Reisz, Julie A; D'Alessandro, Angelo; Everts, Bart; Amiel, Eyal

    2017-09-05

    Dendritic cell (DC) activation by Toll-like receptor (TLR) agonists causes rapid glycolytic reprogramming that is required to meet the metabolic demands of their immune activation. Recent efforts in the field have identified an important role for extracellular glucose sourcing to support DC activation. However, the contributions of intracellular glucose stores to these processes have not been well characterized. We demonstrate that DCs possess intracellular glycogen stores and that cell-intrinsic glycogen metabolism supports the early effector functions of TLR-activated DCs. Inhibition of glycogenolysis significantly attenuates TLR-mediated DC maturation and impairs their ability to initiate lymphocyte activation. We further report that DCs exhibit functional compartmentalization of glucose- and glycogen-derived carbons, where these substrates preferentially contribute to distinct metabolic pathways. This work provides novel insights into nutrient homeostasis in DCs, demonstrating that differential utilization of glycogen and glucose metabolism regulates their optimal immune function. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Sulfatide-activated type II NKT cells prevent allergic airway inflammation by inhibiting type I NKT cell function in a mouse model of asthma.

    Science.gov (United States)

    Zhang, Guqin; Nie, Hanxiang; Yang, Jiong; Ding, Xuhong; Huang, Yi; Yu, Hongying; Li, Ruyou; Yuan, Zhuqing; Hu, Suping

    2011-12-01

    Asthma is a common chronic inflammatory disease involving many different cell types. Recently, type I natural killer T (NKT) cells have been demonstrated to play a crucial role in the development of asthma. However, the roles of type II NKT cells in asthma have not been investigated before. Interestingly, type I and type II NKT cells have been shown to have opposing roles in antitumor immunity, antiparasite immunity, and autoimmunity. We hypothesized that sulfatide-activated type II NKT cells could prevent allergic airway inflammation by inhibiting type I NKT cell function in asthma. Strikingly, in our mouse model, activation of type II NKT cells by sulfatide administration and adoptive transfer of sulfatide-activated type II NKT cells result in reduced-inflammation cell infiltration in the lung and bronchoalveolar lavage fluid, decreased levels of IL-4 and IL-5 in the BALF; and decreased serum levels of ovalbumin-specific IgE and IgG1. Furthermore, it is found that the activation of sulfatide-reactive type II NKT cells leads to the functional inactivation of type I NKT cells, including the proliferation and cytokine secretion. Our data reveal that type II NKT cells activated by glycolipids, such as sulfatide, may serve as a novel approach to treat allergic diseases and other disorders characterized by inappropriate type I NKT cell activation.

  3. Inactivated Influenza Vaccine That Provides Rapid, Innate-Immune-System-Mediated Protection and Subsequent Long-Term Adaptive Immunity.

    Science.gov (United States)

    Chua, Brendon Y; Wong, Chinn Yi; Mifsud, Edin J; Edenborough, Kathryn M; Sekiya, Toshiki; Tan, Amabel C L; Mercuri, Francesca; Rockman, Steve; Chen, Weisan; Turner, Stephen J; Doherty, Peter C; Kelso, Anne; Brown, Lorena E; Jackson, David C

    2015-10-27

    The continual threat to global health posed by influenza has led to increased efforts to improve the effectiveness of influenza vaccines for use in epidemics and pandemics. We show in this study that formulation of a low dose of inactivated detergent-split influenza vaccine with a Toll-like receptor 2 (TLR2) agonist-based lipopeptide adjuvant (R4Pam2Cys) provides (i) immediate, antigen-independent immunity mediated by the innate immune system and (ii) significant enhancement of antigen-dependent immunity which exhibits an increased breadth of effector function. Intranasal administration of mice with vaccine formulated with R4Pam2Cys but not vaccine alone provides protection against both homologous and serologically distinct (heterologous) viral strains within a day of administration. Vaccination in the presence of R4Pam2Cys subsequently also induces high levels of systemic IgM, IgG1, and IgG2b antibodies and pulmonary IgA antibodies that inhibit hemagglutination (HA) and neuraminidase (NA) activities of homologous but not heterologous virus. Improved primary virus nucleoprotein (NP)-specific CD8(+) T cell responses are also induced by the use of R4Pam2Cys and are associated with robust recall responses to provide heterologous protection. These protective effects are demonstrated in wild-type and antibody-deficient animals but not in those depleted of CD8(+) T cells. Using a contact-dependent virus transmission model, we also found that heterologous virus transmission from vaccinated mice to naive mice is significantly reduced. These results demonstrate the potential of adding a TLR2 agonist to an existing seasonal influenza vaccine to improve its utility by inducing immediate short-term nonspecific antiviral protection and also antigen-specific responses to provide homologous and heterologous immunity. The innate and adaptive immune systems differ in mechanisms, specificities, and times at which they take effect. The innate immune system responds within hours of

  4. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  5. Arabidopsis MKS1 is involved in basal immunity and requires an intact N-terminal domain for proper function

    DEFF Research Database (Denmark)

    Petersen, Klaus; Qiu, Jin-Long; Lütje, Juri

    2010-01-01

    Innate immune signaling pathways in animals and plants are regulated by mitogen-activated protein kinase (MAPK) cascades. MAP kinase 4 (MPK4) functions downstream of innate immune receptors via a nuclear substrate MKS1 to regulate the activity of the WRKY33 transcription factor, which in turn...

  6. Effects of Afternoon Nap Deprivation on Adult Habitual Nappers’ Inhibition Functions

    Directory of Open Access Journals (Sweden)

    Qingwei Chen

    2018-01-01

    Full Text Available Multiple studies have established the effects of afternoon naps on cognition. However, relatively few studies have investigated the domain of executive functions. Moreover, the effects of napping on inhibition are far from conclusive. The present study employed adult habitual nappers to investigate the effects of afternoon nap deprivation on response-based inhibition assessed by a Go/No-go task and stimulus-based inhibition assessed by a Flanker task and on alertness assessed by a psychomotor vigilance test (PVT and the Karolinska Sleepiness Scale (KSS. The results showed that afternoon nap deprivation significantly decreased participants’ accuracy and reaction speed for the Go/No-go task but not for the Flanker task. In addition, participants’ alertness was significantly impaired after nap deprivation in terms of increased subjective sleepiness and worse PVT performance. Task-specific effects of napping on inhibition were demonstrated. The implications of the results are discussed.

  7. Changes in proHB-EGF expression after functional activation of the immune system cells

    Directory of Open Access Journals (Sweden)

    T. O. Chudina

    2017-12-01

    Full Text Available The level of proHB-EGF expression on J774, Raji, KG-1 cells derived from different types of human and mouse immune system cells under the standard in vitro culture conditions and during functional activation of these cells was investigated. Changes in the proHB-EGF expression on the cell surface were found to depend on the density of cell population, the content of fetal bovine serum in the culture medium, the effect of mitogenic factors – bacterial lipopolysaccharide, an inactive full-size form of diphtheria toxin (CRM197 and recombinant soluble HB-EGF – rsHB-EGF. The results obtained are important for the understanding of the functional role of proHB-EGF receptor on the surface of macrophage-like cells and B lymphocytes and indicate the involvement of this receptor in immune response regulation in an organism.

  8. Response inhibition is modulated by functional cerebral asymmetries for facial expression perception

    Directory of Open Access Journals (Sweden)

    Sebastian eOcklenburg

    2013-11-01

    Full Text Available The efficacy of executive functions is critically modulated by information processing in earlier cognitive stages. For example, initial processing of verbal stimuli in the language-dominant left-hemisphere leads to more efficient response inhibition than initial processing of verbal stimuli in the non-dominant right hemisphere. However, it is unclear whether this organizational principle is specific for the language system, or a general principle that also applies to other types of lateralized cognition. To answer this question, we investigated the neurophysiological correlates of early attentional processes, facial expression perception and response inhibition during tachistoscopic presentation of facial ‘Go’ and ‘Nogo’ stimuli in the left and the right visual field. Participants committed fewer false alarms after Nogo-stimulus presentation in the left compared to the right visual field. This right-hemispheric asymmetry on the behavioral level was also reflected in the neurophysiological correlates of face perception, specifically in a right-sided asymmetry in the N170 amplitude. Moreover, the right-hemispheric dominance for facial expression processing also affected event-related potentials typically related to response inhibition, namely the Nogo-N2 and Nogo-P3. These findings show that an effect of hemispheric asymmetries in early information processing on the efficacy of higher cognitive functions is not limited to left-hemispheric language functions, but can be generalized to predominantly right-hemispheric functions.

  9. Immune response is required for the control of in vivo translocation and chronic toxicity of graphene oxide

    Science.gov (United States)

    Wu, Qiuli; Zhao, Yunli; Fang, Jianpeng; Wang, Dayong

    2014-05-01

    Graphene oxide (GO) shows great promise as a nanomaterial for medical applications; however, the mechanism for its long-term adverse effects is still largely unclear. Here, we show that chronic GO exposure not only caused damage on the function of both primary and secondary targeted organs but also induced severe accumulation of pathogenic microbial food (OP50) in the intestine of Caenorhabditis elegans, a non-mammalian alternative toxicity assay system. GO accumulated in the intestine could be largely co-localized with OP50 and induced decreased immune response of animals. In contrast, feeding with UV-treated OP50 suppressed GO toxicity and accumulation in the intestine and maintained the relatively normal immune response of animals. The severe accumulation of OP50 in the intestine might be partially due to the damage by GO on the development and function of AVL and DVB neurons controlling defecation behavior. Reduction of chronic GO toxicity by PEG surface modification largely resulted from the inhibition of OP50 accumulation in the intestine and the maintenance of normal immune response. Our results highlight the key role of innate immunity in regulating in vivo chronic GO toxicity, which will be helpful for our understanding of the interactions between nanomaterials and biological systems during the long-term development of animals.Graphene oxide (GO) shows great promise as a nanomaterial for medical applications; however, the mechanism for its long-term adverse effects is still largely unclear. Here, we show that chronic GO exposure not only caused damage on the function of both primary and secondary targeted organs but also induced severe accumulation of pathogenic microbial food (OP50) in the intestine of Caenorhabditis elegans, a non-mammalian alternative toxicity assay system. GO accumulated in the intestine could be largely co-localized with OP50 and induced decreased immune response of animals. In contrast, feeding with UV-treated OP50 suppressed GO

  10. Wnt signaling inhibits CTL memory programming.

    Science.gov (United States)

    Xiao, Zhengguo; Sun, Zhifeng; Smyth, Kendra; Li, Lei

    2013-12-01

    Induction of functional CTLs is one of the major goals for vaccine development and cancer therapy. Inflammatory cytokines are critical for memory CTL generation. Wnt signaling is important for CTL priming and memory formation, but its role in cytokine-driven memory CTL programming is unclear. We found that wnt signaling inhibited IL-12-driven CTL activation and memory programming. This impaired memory CTL programming was attributed to up-regulation of eomes and down-regulation of T-bet. Wnt signaling suppressed the mTOR pathway during CTL activation, which was different to its effects on other cell types. Interestingly, the impaired memory CTL programming by wnt was partially rescued by mTOR inhibitor rapamycin. In conclusion, we found that crosstalk between wnt and the IL-12 signaling inhibits T-bet and mTOR pathways and impairs memory programming which can be recovered in part by rapamycin. In addition, direct inhibition of wnt signaling during CTL activation does not affect CTL memory programming. Therefore, wnt signaling may serve as a new tool for CTL manipulation in autoimmune diseases and immune therapy for certain cancers. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Understanding how commensal obligate anaerobic bacteria regulate immune functions in the large intestine.

    Science.gov (United States)

    Maier, Eva; Anderson, Rachel C; Roy, Nicole C

    2014-12-24

    The human gastrointestinal tract is colonised by trillions of commensal bacteria, most of which are obligate anaerobes residing in the large intestine. Appropriate bacterial colonisation is generally known to be critical for human health. In particular, the development and function of the immune system depends on microbial colonisation, and a regulated cross-talk between commensal bacteria, intestinal epithelial cells and immune cells is required to maintain mucosal immune homeostasis. This homeostasis is disturbed in various inflammatory disorders, such as inflammatory bowel diseases. Several in vitro and in vivo studies indicate a role for Faecalibacterium prausnitzii, Bacteroides thetaiotaomicron, Bacteroides fragilis, Akkermansia muciniphila and segmented filamentous bacteria in maintaining intestinal immune homeostasis. These obligate anaerobes are abundant in the healthy intestine but reduced in several inflammatory diseases, suggesting an association with protective effects on human health. However, knowledge of the mechanisms underlying the effects of obligate anaerobic intestinal bacteria remains limited, in part due to the difficulty of co-culturing obligate anaerobes together with oxygen-requiring human epithelial cells. By using novel dual-environment co-culture models, it will be possible to investigate the effects of the unstudied majority of intestinal microorganisms on the human epithelia. This knowledge will provide opportunities for improving human health and reducing the risk of inflammatory diseases.

  12. Understanding How Commensal Obligate Anaerobic Bacteria Regulate Immune Functions in the Large Intestine

    Science.gov (United States)

    Maier, Eva; Anderson, Rachel C.; Roy, Nicole C.

    2014-01-01

    The human gastrointestinal tract is colonised by trillions of commensal bacteria, most of which are obligate anaerobes residing in the large intestine. Appropriate bacterial colonisation is generally known to be critical for human health. In particular, the development and function of the immune system depends on microbial colonisation, and a regulated cross-talk between commensal bacteria, intestinal epithelial cells and immune cells is required to maintain mucosal immune homeostasis. This homeostasis is disturbed in various inflammatory disorders, such as inflammatory bowel diseases. Several in vitro and in vivo studies indicate a role for Faecalibacterium prausnitzii, Bacteroides thetaiotaomicron, Bacteroides fragilis, Akkermansia muciniphila and segmented filamentous bacteria in maintaining intestinal immune homeostasis. These obligate anaerobes are abundant in the healthy intestine but reduced in several inflammatory diseases, suggesting an association with protective effects on human health. However, knowledge of the mechanisms underlying the effects of obligate anaerobic intestinal bacteria remains limited, in part due to the difficulty of co-culturing obligate anaerobes together with oxygen-requiring human epithelial cells. By using novel dual-environment co-culture models, it will be possible to investigate the effects of the unstudied majority of intestinal microorganisms on the human epithelia. This knowledge will provide opportunities for improving human health and reducing the risk of inflammatory diseases. PMID:25545102

  13. Incorporation of Immune Checkpoint Blockade into Chimeric Antigen Receptor T Cells (CAR-Ts): Combination or Built-In CAR-T.

    Science.gov (United States)

    Yoon, Dok Hyun; Osborn, Mark J; Tolar, Jakub; Kim, Chong Jai

    2018-01-24

    Chimeric antigen receptor (CAR) T cell therapy represents the first U.S. Food and Drug Administration approved gene therapy and these engineered cells function with unprecedented efficacy in the treatment of refractory CD19 positive hematologic malignancies. CAR translation to solid tumors is also being actively investigated; however, efficacy to date has been variable due to tumor-evolved mechanisms that inhibit local immune cell activity. To bolster the potency of CAR-T cells, modulation of the immunosuppressive tumor microenvironment with immune-checkpoint blockade is a promising strategy. The impact of this approach on hematological malignancies is in its infancy, and in this review we discuss CAR-T cells and their synergy with immune-checkpoint blockade.

  14. Incorporation of Immune Checkpoint Blockade into Chimeric Antigen Receptor T Cells (CAR-Ts: Combination or Built-In CAR-T

    Directory of Open Access Journals (Sweden)

    Dok Hyun Yoon

    2018-01-01

    Full Text Available Chimeric antigen receptor (CAR T cell therapy represents the first U.S. Food and Drug Administration approved gene therapy and these engineered cells function with unprecedented efficacy in the treatment of refractory CD19 positive hematologic malignancies. CAR translation to solid tumors is also being actively investigated; however, efficacy to date has been variable due to tumor-evolved mechanisms that inhibit local immune cell activity. To bolster the potency of CAR-T cells, modulation of the immunosuppressive tumor microenvironment with immune-checkpoint blockade is a promising strategy. The impact of this approach on hematological malignancies is in its infancy, and in this review we discuss CAR-T cells and their synergy with immune-checkpoint blockade.

  15. Yeast functional genomic screens lead to identification of a role for a bacterial effector in innate immunity regulation.

    Directory of Open Access Journals (Sweden)

    Roger W Kramer

    2007-02-01

    Full Text Available Numerous bacterial pathogens manipulate host cell processes to promote infection and ultimately cause disease through the action of proteins that they directly inject into host cells. Identification of the targets and molecular mechanisms of action used by these bacterial effector proteins is critical to understanding pathogenesis. We have developed a systems biological approach using the yeast Saccharomyces cerevisiae that can expedite the identification of cellular processes targeted by bacterial effector proteins. We systematically screened the viable yeast haploid deletion strain collection for mutants hypersensitive to expression of the Shigella type III effector OspF. Statistical data mining of the results identified several cellular processes, including cell wall biogenesis, which when impaired by a deletion caused yeast to be hypersensitive to OspF expression. Microarray experiments revealed that OspF expression resulted in reversed regulation of genes regulated by the yeast cell wall integrity pathway. The yeast cell wall integrity pathway is a highly conserved mitogen-activated protein kinase (MAPK signaling pathway, normally activated in response to cell wall perturbations. Together these results led us to hypothesize and subsequently demonstrate that OspF inhibited both yeast and mammalian MAPK signaling cascades. Furthermore, inhibition of MAPK signaling by OspF is associated with attenuation of the host innate immune response to Shigella infection in a mouse model. These studies demonstrate how yeast systems biology can facilitate functional characterization of pathogenic bacterial effector proteins.

  16. Role of levamisole immunotherapy as an adjuvant to radiotherapy in oral cancer - Immune responses

    International Nuclear Information System (INIS)

    Balaram, P.; Remani, P.; Padmanabhan, T.K.

    1988-01-01

    Investigations were carried out to assess the effect of levamisole immunotherapy as an adjuvant to radiotherapy, on the immune response of patients with squamous cell carcinoma of the oral cavity. Parameters assessed were leukocyte migration inhibition, response to PPD and oral cancer extract (OCA), lymphocyte transformation to PHA, circulating antibodies to OCA and circulating immune complexes (CIC). Comparisons were made between groups receiving levamisole, those receiving placebo and normal controls. The results of a thirty-month follow-up are presented. Radiotherapy resulted in a depression of cell-mediated functions, reduction in antibody titre also showed a gradual increase with time of follow-up. Levamisole, however, appeared to reduce the levels of CIC. (author). 2 figs., 1 tab., 38 refs

  17. Antiviral immunity in fish – functional analysis using DNA vaccination as a tool

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja

    2013-01-01

    fingerlings. Vaccination of fish at an early stage appears advantageous, since larger fish require higher doses of vaccine to be protected. Even in fish with an average size of 0.5 g at the time of vaccination, good protection can be obtained. Interestingly, immunity is established already a few days after...... and cellular components both play a role in the long lasting protection. The similarity of the functional immune response profile to that induced by a natural virus infection is striking and is most likely one of the major reasons for the efficacy of the rhabdovirus DNA vaccines. Although other elements like...... protein gene suggest that the structural requirements for antigenicity are different from the requirements for immunogenicity....

  18. Neural circuitry and immunity

    Science.gov (United States)

    Pavlov, Valentin A.; Tracey, Kevin J.

    2015-01-01

    Research during the last decade has significantly advanced our understanding of the molecular mechanisms at the interface between the nervous system and the immune system. Insight into bidirectional neuroimmune communication has characterized the nervous system as an important partner of the immune system in the regulation of inflammation. Neuronal pathways, including the vagus nerve-based inflammatory reflex are physiological regulators of immune function and inflammation. In parallel, neuronal function is altered in conditions characterized by immune dysregulation and inflammation. Here, we review these regulatory mechanisms and describe the neural circuitry modulating immunity. Understanding these mechanisms reveals possibilities to use targeted neuromodulation as a therapeutic approach for inflammatory and autoimmune disorders. These findings and current clinical exploration of neuromodulation in the treatment of inflammatory diseases defines the emerging field of Bioelectronic Medicine. PMID:26512000

  19. Pretransplant Immune- and Apoptosis-Related Gene Expression Is Associated with Kidney Allograft Function

    Directory of Open Access Journals (Sweden)

    Dorota Kamińska

    2016-01-01

    Full Text Available Renal transplant candidates present immune dysregulation, caused by chronic uremia. The aim of the study was to investigate whether pretransplant peripheral blood gene expression of immune factors affects clinical outcome of renal allograft recipients. Methods. In a prospective study, we analyzed pretransplant peripheral blood gene expression in87 renal transplant candidates with real-time PCR on custom-designed low density arrays (TaqMan. Results. Immediate posttransplant graft function (14-day GFR was influenced negatively by TGFB1 (P=0.039 and positively by IL-2 gene expression (P=0.040. Pretransplant blood mRNA expression of apoptosis-related genes (CASP3, FAS, and IL-18 and Th1-derived cytokine gene IFNG correlated positively with short- (6-month GFR CASP3: P=0.027, FAS: P=0.021, and IFNG: P=0.029 and long-term graft function (24-month GFR CASP3: P=0.003, FAS: P=0.033, IL-18: P=0.044, and IFNG: P=0.04. Conclusion. Lowered pretransplant Th1-derived cytokine and apoptosis-related gene expressions were a hallmark of subsequent worse kidney function but not of acute rejection rate. The pretransplant IFNG and CASP3 and FAS and IL-18 genes’ expression in the recipients’ peripheral blood is the possible candidate for novel biomarker of short- and long-term allograft function.

  20. Shingles Immunity and Health Functioning in the Elderly: Tai Chi Chih as a Behavioral Treatment

    Directory of Open Access Journals (Sweden)

    Michael Irwin

    2004-01-01

    Full Text Available Both the incidence and severity of herpes zoster (HZ or shingles increase markedly with increasing age in association with a decline in varicella zoster virus (VZV-specific immunity. Considerable evidence shows that behavioral stressors, prevalent in older adults, correlate with impairments of cellular immunity. Moreover, the presence of depressive symptoms in older adults is associated with declines in VZV-responder cell frequency (VZV-RCF, an immunological marker of shingles risk. In this review, we discuss recent findings that administration of a relaxation response-based intervention, tai chi chih (TCC, results in improvements in health functioning and immunity to VZV in older adults as compared with a control group. TCC is a slow moving meditation consisting of 20 separate standardized movements which can be readily used in elderly and medically compromised individuals. TCC offers standardized training and practice schedules, lending an important advantage over prior relaxation response-based therapies. Focus on older adults at increased risk for HZ and assay of VZV-specific immunity have implications for understanding the impact of behavioral factors and a behavioral intervention on a clinically relevant end-point and on the response of the immune system to infectious pathogens.

  1. Natural material adsorbed onto a polymer to enhance immune function

    Directory of Open Access Journals (Sweden)

    Reinaque AP

    2012-08-01

    Full Text Available Ana Paula Barcelos Reinaque,1 Eduardo Luzía França,2 Edson Fredulin Scherer,3 Mayra Aparecida Côrtes,1 Francisco José Dutra Souto,4 Adenilda Cristina Honorio-França51Post Graduate Program in Material Science, 2Institute of Biological and Health Science, Federal University of Mato Grosso, Barra do Garças, 3Post Graduate Program in Material Science, Institute of Biological and Health Science, Federal University of Mato Grosso, Pontal do Araguaia, 4Faculty of Medical Sciences, Federal University of Mato Grosso, Cuiabá, 5Institute of Biological and Health Science, Federal University of Mato Grosso, Pontal do Araguaia, MT, BrazilBackground: In this study, we produced poly(ethylene glycol (PEG microspheres of different sizes and adsorbing a medicinal plant mixture, and verified their effect in vitro on the viability, superoxide production, and bactericidal activity of phagocytes in the blood.Methods: The medicinal plant mixture was adsorbed onto PEG microspheres and its effects were evaluated by flow cytometry and fluorescence microscopy.Results: Adsorption of the herbal mixture onto the PEG microspheres was achieved and the particles were internalized by phagocytes. PEG microspheres bearing the adsorbed herbal mixture stimulated superoxide release, and activated scavenging and microbicidal activity in phagocytes. No differences in functional activity were observed when the phagocytes were not incubated with PEG microspheres bearing the adsorbed herbal mixture.Conclusion: This system may be useful for the delivery of a variety of medicinal plants and can confer additional protection against infection. The data reported here suggest that a polymer adsorbed with a natural product is a treatment alternative for enhancing immune function.Keywords: natural product, polymer, adsorption, immune function, phagocytes

  2. Adoptive regulatory T-cell therapy preserves systemic immune homeostasis after cerebral ischemia.

    Science.gov (United States)

    Li, Peiying; Mao, Leilei; Zhou, Guoqing; Leak, Rehana K; Sun, Bao-Liang; Chen, Jun; Hu, Xiaoming

    2013-12-01

    Cerebral ischemia has been shown to result in peripheral inflammatory responses followed by long-lasting immunosuppression. Our recent study demonstrated that intravenous delivery of regulatory T cells (Tregs) markedly protected against transient cerebral ischemia by suppressing neutrophil-derived matrix metallopeptidase 9 production in the periphery. However, the effect of Tregs on systemic inflammatory responses and immune status has not been fully characterized. Cerebral ischemia was induced by middle cerebral artery occlusion for 60 minutes in mice or 120 minutes in rats. Tregs were isolated from donor animals by CD4 and CD25 double selection and transferred intravenously to ischemic recipients at 2 hours after middle cerebral artery occlusion. Animals were euthanized on different days after reperfusion. The effects of Tregs on systemic inflammation and immune status were evaluated using flow cytometry, ELISAs, and immunohistochemistry. Systemic administration of purified Tregs raises functional Tregs in the blood and peripheral organs, including spleen and lymph nodes. These exogenous Tregs remain in the blood and peripheral organs for ≥12 days. Functionally, Treg adoptive transfer markedly inhibits middle cerebral artery occlusion-induced elevation of inflammatory cytokines (interleukin-6 and tumor necrosis factor α) in the blood. Furthermore, Treg treatment corrects long-term lymphopenia and improves cellular immune functions after ischemic brain injury. As a result, Treg-treated animals exhibit decreased bacterial loads in the blood during recovery from cerebral ischemic attack. Treg treatment did not exacerbate poststroke immunosuppression. On the contrary, Treg-treated animals displayed improved immune status after focal cerebral ischemia.

  3. Thermal sensitivity of immune function: evidence against a generalist-specialist trade-off among endothermic and ectothermic vertebrates

    Science.gov (United States)

    Butler, Michael W.; Stahlschmidt, Zachary R.; Ardia, Daniel R.; Davies, Scott; Davis, Jon; Guillette, Louis J.; Johnson, Nicholas; McCormick, Stephen D.; McGraw, Kevin J.; DeNardo, Dale F.

    2013-01-01

    Animal body temperature (Tbody) varies over daily and annual cycles, affecting multiple aspects of biological performance in both endothermic and ectothermic animals. Yet a comprehensive comparison of thermal performance among animals varying in Tbody (mean and variance) and heat production is lacking. Thus, we examined the thermal sensitivity of immune function (a crucial fitness determinant) in Vertebrata, a group encompassing species of varying thermal biology. Specifically, we investigated temperature-related variation in two innate immune performance metrics, hemagglutination and hemolysis, for 13 species across all seven major vertebrate clades. Agglutination and lysis were temperature dependent and were more strongly related to the thermal biology of species (e.g., mean Tbody) than to the phylogenetic relatedness of species, although these relationships were complex and frequently surprising (e.g., heterotherms did not exhibit broader thermal performance curves than homeotherms). Agglutination and lysis performance were positively correlated within species, except in taxa that produce squalamine, a steroidal antibiotic that does not lyse red blood cells. Interestingly, we found the antithesis of a generalist-specialist trade-off: species with broader temperature ranges of immune performance also had higher peak performance levels. In sum, we have uncovered thermal sensitivity of immune performance in both endotherms and ectotherms, highlighting the role that temperature and life history play in immune function across Vertebrata.

  4. Regulatory immune cells and functions in autoimmunity and transplantation immunology.

    Science.gov (United States)

    Papp, Gabor; Boros, Peter; Nakken, Britt; Szodoray, Peter; Zeher, Margit

    2017-05-01

    In physiological circumstances, various tolerogenic mechanisms support the protection of self-structures during immune responses. However, quantitative and/or qualitative changes in regulatory immune cells and mediators can evoke auto-reactive immune responses, and upon susceptible genetic background, along with the presence of other concomitant etiological factors, autoimmune disease may develop. In transplant immunology, tolerogenic mechanisms are also critical, since the balance between of alloantigen-reactive effector cells and the regulatory immune cells will ultimately determine whether a graft is accepted or rejected. Better understanding of the immunological tolerance and the potential modulations of immune regulatory processes are crucial for developing effective therapies in autoimmune diseases as well as in organ transplantation. In this review, we focus on the novel insights regarding the impaired immune regulation and other relevant factors contributing to the development of auto-reactive and graft-reactive immune responses in autoimmune diseases and transplant rejection, respectively. We also address some promising approaches for modification of immune-regulatory processes and tolerogenic mechanisms in autoimmunity and solid organ transplantation, which may be beneficial in future therapeutic strategies. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Anti-tumour immune effect of oral administration of Lactobacillus plantarum to CT26 tumour-bearing mice.

    Science.gov (United States)

    Hu, Jingtao; Wang, Chunfeng; Ye, Liping; Yang, Wentao; Huang, Haibin; Meng, Fei; Shi, Shaohua; Ding, Zhuang

    2015-06-01

    Colorectal cancer (CRC) is one of the most prevalent forms of cancer that shows a high mortality and increasing incidence. There are numerous successful treatment options for CRC, including surgery, chemotherapy, radiotherapy and immunotherapy; however, their side effects and limitations are considerable. Probiotics may be an effective strategy for preventing and inhibiting tumour growth through stimulation of host innate and adaptive immunity. We investigated and compared potential anti-tumour immune responses induced by two isolated Lactobacillus strains, Lactobacillus plantarum A and Lactobacillus rhamnosus b, by pre-inoculating mice with lactobacilli for 14 days. Subsequently, subcutaneous and orthotopic intestinal tumours were generated in the pre-inoculated mice using CT26 murine adenocarcinoma cells and were assessed for response against the tumour. Our results indicated that oral administration with L. plantarum inhibited CT26 cell growth in BALB/c mice and prolonged the survival time of tumour-bearing mice compared with mice administered L. rhamnosus. L. plantarum produced protective immunity against the challenge with CT26 cells by increasing the effector functions of CD8+ and natural killer (NK) cell infiltration into tumour tissue, up-regulation of IFN-gamma (but not IL-4 or IL-17) production, and promotion of Th1-type CD4+ T differentiation. Consequently, our results suggest that L. plantarum can enhance the anti-tumour immune response and delay tumour formation.

  6. Exercise protects from cancer through regulation of immune function and inflammation

    DEFF Research Database (Denmark)

    Hojman, Pernille

    2017-01-01

    Exercise training has been extensively studied in cancer settings as part of prevention or rehabilitation strategies, yet emerging evidence suggests that exercise training can also directly affect tumor-specific outcomes. The underlying mechanisms for this exercise-dependent cancer protection are...... regulation of immune and inflammatory functions, and exercise may be pursued as anticancer treatment through incorporation into standard oncological therapy to the benefit of the cancer patients.......Exercise training has been extensively studied in cancer settings as part of prevention or rehabilitation strategies, yet emerging evidence suggests that exercise training can also directly affect tumor-specific outcomes. The underlying mechanisms for this exercise-dependent cancer protection...... are just starting to be elucidated. To this end, evasion of immune surveillance and tumor-associated inflammation are established as hallmarks of cancer, and exercise may target cancer incidence and progression through regulation of these mechanisms. Here, I review the role of exercise in protection from...

  7. Regulatory T Cells in Post-stroke Immune Homeostasis.

    Science.gov (United States)

    Liesz, Arthur; Kleinschnitz, Christoph

    2016-08-01

    The secondary neuroinflammatory response has come into focus of experimental stroke research. Immunological mechanisms after acute stroke are being investigated in the hope to identify novel and druggable pathways that contribute to secondary infarct growth after stroke. Among a variety of neuroimmunological events after acute brain ischemia, including microglial activation, brain leukocyte invasion, and secretion of pro-inflammatory factors, lymphocytes have been identified as the key leukocyte subpopulation driving the neuroinflammatory response and contributing to stroke outcome. Several studies have shown that pro-inflammatory lymphocyte subpopulations worsen stroke outcome and that inhibiting their invasion to the injured brain is neuroprotective. In contrast to the effector functions of pro-inflammatory lymphocytes, regulatory T cells (Treg) are critically involved in maintaining immune homeostasis and have been characterized as disease-limiting protective cells in several inflammatory conditions, particularly in primary inflammatory diseases of the central nervous system (CNS). However, due to the complex function of regulatory cells in immune homeostasis and disease, divergent findings have been described for the role of Treg in stroke models. Emerging evidence suggests that this discrepancy arises from potentially differing functions of Treg depending on the predominant site of action within the neurovascular unit and the surrounding inflammatory milieu. This article will provide a comprehensive review of current findings on Treg in brain ischemia models and discuss potential reasons for the observed discrepancies.

  8. Poly-functional and long-lasting anticancer immune response elicited by a safe attenuated Pseudomonas aeruginosa vector for antigens delivery

    Directory of Open Access Journals (Sweden)

    Xavier Chauchet

    2016-01-01

    Full Text Available Live-attenuated bacterial vectors for antigens delivery have aroused growing interest in the field of cancer immunotherapy. Their potency to stimulate innate immunity and to promote intracellular antigen delivery into antigen-presenting cells could be exploited to elicit a strong and specific cellular immune response against tumor cells. We previously described genetically-modified and attenuated Pseudomonas aeruginosa vectors able to deliver in vivo protein antigens into antigen-presenting cells, through Type 3 secretion system of the bacteria. Using this approach, we managed to protect immunized mice against aggressive B16 melanoma development in both a prophylactic and therapeutic setting. In this study, we further investigated the antigen-specific CD8+ T cell response, in terms of phenotypic and functional aspects, obtained after immunizations with a killed but metabolically active P. aeruginosa attenuated vector. We demonstrated that P. aeruginosa vaccine induces a highly functional pool of antigen-specific CD8+ T cell able to infiltrate the tumor. Furthermore, multiple immunizations allowed the development of a long-lasting immune response, represented by a pool of predominantly effector memory cells which protected mice against late tumor challenge. Overall, killed but metabolically active P. aeruginosa vector is a safe and promising approach for active and specific antitumor immunotherapy.

  9. INDOLEAMINE 2,3-DIOXYGENASE (IDO AND IMMUNE TOLERANCE

    Directory of Open Access Journals (Sweden)

    Coma-del-Corral MJ

    2013-09-01

    Full Text Available SUMMARY: Indoleamine 2,3-dioxygenase (IDO is an intracellular and extrahepatic enzyme predominantly found in many cells, especially macrophages. Tryptophan degradation generates kynurenine, and this pathway of tryptophan metabolism is an effective mechanism for modulating the immune response. The IDO facilitates immune tolerance and is one of the main actors involved in the inhibition of cell proliferation, including activated T cells. IDO induces production of reactive oxygen species (ROS and nitric oxide (NO radicals. Several pathways involved in the regulation of immune response are regulated by redox mechanisms. Reactive oxygen and nitrogen species (ROS-RNS and other redox active molecules play key roles in immunity.

  10. Visible light induced changes in the immune response through an eye-brain mechanism (photoneuroimmunology).

    Science.gov (United States)

    Roberts, J E

    1995-07-01

    The immune system is susceptible to a variety of stresses. Recent work in neuroimmunology has begun to define how mood alteration, stress, the seasons, and daily rhythms can have a profound effect on immune response through hormonal modifications. Central to these factors may be light through an eye-brain hormonal modulation. In adult primates, only visible light (400-700 nm) is received by the retina. This photic energy is then transduced and delivered to the visual cortex and by an alternative pathway to the suprachiasmatic nucleus (SCN). The SCN is a part of the hypothalamic region in the brain believed to direct circadian rhythm. Visible light exposure also modulates the pituitary and pineal gland which leads to neuroendocrine changes. Melatonin, norepinephrine and acetylcholine decrease with light activation, while cortisol, serotonin, gaba and dopamine levels increase. The synthesis of vasoactive intestinal polypeptide (VIP), gastrin releasing peptide (GRP) and neuropeptide Y (NPY) in rat SCN has been shown to be modified by light. These induced neuroendocrine changes can lead to alterations in mood and circadian rhythm. All of these neuroendocrine changes can lead to immune modulation. An alternative pathway for immune modulation by light is through the skin. Visible light (400-700 nm) can penetrate epidermal and dermal layers of the skin and may directly interact with circulating lymphocytes to modulate immune function. However, even in the presence of phototoxic agents such as eosin and rose bengal, visible light did not produce suppression of contact hypersensitivity with suppresser cells. In contrast to visible light, in vivo exposure to UV-B (280-320 nm) and UV-A (320-400 nm) radiation can only alter normal human immune function by a skin mediated response. Each UV subgroup (B, A) induces an immunosuppressive response but by differing mechanisms involving the regulation of differing interleukins and growth factors. Some effects observed in humans are

  11. Exploiting immune cell metabolic machinery for functional HIV cure and the prevention of inflammaging [version 1; referees: 4 approved

    Directory of Open Access Journals (Sweden)

    Clovis S. Palmer

    2018-01-01

    Full Text Available An emerging paradigm in immunology suggests that metabolic reprogramming and immune cell activation and functions are intricately linked. Viral infections, such as HIV infection, as well as cancer force immune cells to undergo major metabolic challenges. Cells must divert energy resources in order to mount an effective immune response. However, the fact that immune cells adopt specific metabolic programs to provide host defense against intracellular pathogens and how this metabolic shift impacts immune cell functions and the natural course of diseases have only recently been appreciated. A clearer insight into how these processes are inter-related will affect our understanding of several fundamental aspects of HIV persistence. Even in patients with long-term use of anti-retroviral therapies, HIV infection persists and continues to cause chronic immune activation and inflammation, ongoing and cumulative damage to multiple organs systems, and a reduction in life expectancy. HIV-associated fundamental changes to the metabolic machinery of the immune system can promote a state of “inflammaging”, a chronic, low-grade inflammation with specific immune changes that characterize aging, and can also contribute to the persistence of HIV in its reservoirs. In this commentary, we will bring into focus evolving concepts on how HIV modulates the metabolic machinery of immune cells in order to persist in reservoirs and how metabolic reprogramming facilitates a chronic state of inflammation that underlies the development of age-related comorbidities. We will discuss how immunometabolism is facilitating the changing paradigms in HIV cure research and outline the novel therapeutic opportunities for preventing inflammaging and premature development of age-related conditions in HIV+ individuals.

  12. Structural and functional analyses of DNA-sensing and immune activation by human cGAS.

    Science.gov (United States)

    Kato, Kazuki; Ishii, Ryohei; Goto, Eiji; Ishitani, Ryuichiro; Tokunaga, Fuminori; Nureki, Osamu

    2013-01-01

    The detection of cytosolic DNA, derived from pathogens or host cells, by cytosolic receptors is essential for appropriate host immune responses. Cyclic GMP-AMP synthase (cGAS) is a newly identified cytosolic DNA receptor that produces cyclic GMP-AMP, which activates stimulator of interferon genes (STING), resulting in TBK1-IRF3 pathway activation followed by the production of type I interferons. Here we report the crystal structure of human cGAS. The structure revealed that a cluster of lysine and arginine residues forms the positively charged DNA binding surface of human cGAS, which is important for the STING-dependent immune activation. A structural comparison with other previously determined cGASs and our functional analyses suggested that a conserved zinc finger motif and a leucine residue on the DNA binding surface are crucial for the DNA-specific immune response of human cGAS, consistent with previous work. These structural features properly orient the DNA binding to cGAS, which is critical for DNA-induced cGAS activation and STING-dependent immune activation. Furthermore, we showed that the cGAS-induced activation of STING also involves the activation of the NF-κB and IRF3 pathways. Our results indicated that cGAS is a DNA sensor that efficiently activates the host immune system by inducing two distinct pathways.

  13. Structural and functional analyses of DNA-sensing and immune activation by human cGAS.

    Directory of Open Access Journals (Sweden)

    Kazuki Kato

    Full Text Available The detection of cytosolic DNA, derived from pathogens or host cells, by cytosolic receptors is essential for appropriate host immune responses. Cyclic GMP-AMP synthase (cGAS is a newly identified cytosolic DNA receptor that produces cyclic GMP-AMP, which activates stimulator of interferon genes (STING, resulting in TBK1-IRF3 pathway activation followed by the production of type I interferons. Here we report the crystal structure of human cGAS. The structure revealed that a cluster of lysine and arginine residues forms the positively charged DNA binding surface of human cGAS, which is important for the STING-dependent immune activation. A structural comparison with other previously determined cGASs and our functional analyses suggested that a conserved zinc finger motif and a leucine residue on the DNA binding surface are crucial for the DNA-specific immune response of human cGAS, consistent with previous work. These structural features properly orient the DNA binding to cGAS, which is critical for DNA-induced cGAS activation and STING-dependent immune activation. Furthermore, we showed that the cGAS-induced activation of STING also involves the activation of the NF-κB and IRF3 pathways. Our results indicated that cGAS is a DNA sensor that efficiently activates the host immune system by inducing two distinct pathways.

  14. BRAF inhibition improves tumor recognition by the immune system

    DEFF Research Database (Denmark)

    Donia, Marco; Fagone, Paolo; Nicoletti, Ferdinando

    2012-01-01

    to be poorly efficient. By characterizing the immunological interactions between T cells and cancer cells in clinical material as well as the influence of the FDA-approved BRAF inhibitor vemurafenib on the immune system, we aimed at unraveling new strategies to expand the efficacy of adoptive T-cell transfer...

  15. Differential Effects of Naja naja atra Venom on Immune Activity

    Directory of Open Access Journals (Sweden)

    Jian-Qun Kou

    2014-01-01

    Full Text Available Previous studies reported that Naja naja atra venom (NNAV inhibited inflammation and adjuvant arthritis. Here we investigated the role of NNAV in regulation of immune responses in mice. Oral administration of NNAV to normal mice showed significant increase in natural killer cell activity, B lymphocyte proliferation stimulated by lipopolysaccharides, and antibody production in response to sheep red blood cells. Meanwhile, NNAV markedly decreased T lymphocyte proliferation stimulated by concanavalin A, arrested the cell cycle at G0/G1 phase, and suppressed CD4 and CD8 T cell divisions. Furthermore, NNAV inhibited the dinitrofluorobenzene-induced delayed-type hypersensitivity reaction. This modulation of immune responses may be partly attributed to the selective increase in Th1 and Th2 cytokines (IFN-γ, IL-4 secretion and inhibition of Th17 cytokine (IL-17 production. In dexamethasone-induced immunosuppressed mice, NNAV restored the concentration of serum IgG and IgM, while decreasing the percentage of CD4 and CD8 T-cell subsets. These results indicate that NNAV enhances the innate and humoral immune responses while inhibiting CD4 Th17 and CD8 T cell actions, suggesting that NNAV could be a potential therapeutic agent for autoimmune diseases.

  16. The twilight of immunity: emerging concepts in aging of the immune system.

    Science.gov (United States)

    Nikolich-Žugich, Janko

    2018-01-01

    Immunosenescence is a series of age-related changes that affect the immune system and, with time, lead to increased vulnerability to infectious diseases. This Review addresses recent developments in the understanding of age-related changes that affect key components of immunity, including the effect of aging on cells of the (mostly adaptive) immune system, on soluble molecules that guide the maintenance and function of the immune system and on lymphoid organs that coordinate both the maintenance of lymphocytes and the initiation of immune responses. I further address the effect of the metagenome and exposome as key modifiers of immune-system aging and discuss a conceptual framework in which age-related changes in immunity might also affect the basic rules by which the immune system operates.

  17. Adaptive immunity to leukemia is inhibited by cross-reactive induced regulatory T cells

    OpenAIRE

    Manlove, Luke S.; Berquam-Vrieze, Katherine E.; Pauken, Kristen E.; Williams, Richard T.; Jenkins, Marc K.; Farrar, Michael A.

    2015-01-01

    BCR-ABL+ acute lymphoblastic leukemia patients have transient responses to current therapies. However, the fusion of BCR to ABL generates a potential leukemia-specific antigen that could be a target for immunotherapy. We demonstrate that the immune system can limit BCR-ABL+ leukemia progression although ultimately this immune response fails. To address how BCR-ABL+ leukemia escapes immune surveillance, we developed a peptide: MHC-II tetramer that labels endogenous BCR-ABL-specific CD4+ T cell...

  18. The Role of TAM Family Receptors in Immune Cell Function: Implications for Cancer Therapy.

    Science.gov (United States)

    Paolino, Magdalena; Penninger, Josef M

    2016-10-21

    The TAM receptor protein tyrosine kinases-Tyro3, Axl, and Mer-are essential regulators of immune homeostasis. Guided by their cognate ligands Growth arrest-specific gene 6 (Gas6) and Protein S (Pros1), these receptors ensure the resolution of inflammation by dampening the activation of innate cells as well as by restoring tissue function through promotion of tissue repair and clearance of apoptotic cells. Their central role as negative immune regulators is highlighted by the fact that deregulation of TAM signaling has been linked to the pathogenesis of autoimmune, inflammatory, and infectious diseases. Importantly, TAM receptors have also been associated with cancer development and progression. In a cancer setting, TAM receptors have a dual regulatory role, controlling the initiation and progression of tumor development and, at the same time, the associated anti-tumor responses of diverse immune cells. Thus, modulation of TAM receptors has emerged as a potential novel strategy for cancer treatment. In this review, we discuss our current understanding of how TAM receptors control immunity, with a particular focus on the regulation of anti-tumor responses and its implications for cancer immunotherapy.

  19. Coelomocytes: Biology and Possible Immune Functions in Invertebrates with Special Remarks on Nematodes

    Directory of Open Access Journals (Sweden)

    Qudsia Tahseen

    2009-01-01

    Full Text Available All metazoans are exposed to a wide range of microbes and have evolved complex immune defenses used to repel infectious agents. Coelomocytes play a key role in the defense reactions of most invertebrates. They are involved in important immune functions, such as phagocytosis, encapsulation, graft rejection, and inflammation, as well as the synthesis and secretion of several humoral factors especially in annelids and echinoderms. Coelomocytes in nematodes are variable in shapes from round, ovoid, cuboidal, and spindle-shaped to stellate or branched cells that are found usually at fixed positions in the pseudocoelom. Their number usually varies from 2 to 6. The model nematode, C. elegans lacks an adaptive immune system and the coelomocytes are capable of endocytosis, but their involvement in phagocytosis of bacteria seems unlikely. The aim of this review is to evaluate current knowledge on coelomocytes of invertebrates with special reference to nematodes. The morphology and structure of these coelomocytes are discussed along with their origin. Their relative positions and diversity in different nematode groups have also been discussed and illustrated.

  20. Trichinella spiralis Calreticulin Binds Human Complement C1q As an Immune Evasion Strategy.

    Science.gov (United States)

    Zhao, Limei; Shao, Shuai; Chen, Yi; Sun, Ximeng; Sun, Ran; Huang, Jingjing; Zhan, Bin; Zhu, Xinping

    2017-01-01

    As a multicellular parasitic nematode, Trichinella spiralis regulates host immune responses by producing a variety of immunomodulatory molecules to escape from host immune attack, but the mechanisms underlying the immune evasion are not well understood. Here, we identified that T. spiralis calreticulin ( Ts -CRT), a Ca 2+ -binding protein, facilitated T. spiralis immune evasion by interacting with the first component of human classical complement pathway, C1q. In the present study, Ts -CRT was found to be expressed on the surface of different developmental stages of T. spiralis as well as in the secreted products of adult and muscle larval worms. Functional analysis identified that Ts -CRT was able to bind to human C1q, resulting in the inhibition of C1q-initiated complement classical activation pathway reflected by reduced C4/C3 generation and C1q-dependent lysis of antibody-sensitized sheep erythrocytes. Moreover, recombinant Ts -CRT (r Ts -CRT) binding to C1q suppressed C1q-induced THP-1-derived macrophages chemotaxis and reduced monocyte-macrophages release of reactive oxygen intermediates (ROIs). Blocking Ts -CRT on the surface of newborn larvae (NBL) of T. spiralis with anti- Ts -CRT antibody increased the C1q-mediated adherence of monocyte-macrophages to larvae and impaired larval infectivity. All of these results suggest that T. spiralis -expressed Ts -CRT plays crucial roles in T. spiralis immune evasion and survival in host mostly by directly binding to host complement C1q, which not only reduces C1q-mediated activation of classical complement pathway but also inhibits the C1q-induced non-complement activation of macrophages.

  1. Melatonin: Buffering the Immune System

    Directory of Open Access Journals (Sweden)

    Juan M. Guerrero

    2013-04-01

    Full Text Available Melatonin modulates a wide range of physiological functions with pleiotropic effects on the immune system. Despite the large number of reports implicating melatonin as an immunomodulatory compound, it still remains unclear how melatonin regulates immunity. While some authors argue that melatonin is an immunostimulant, many studies have also described anti-inflammatory properties. The data reviewed in this paper support the idea of melatonin as an immune buffer, acting as a stimulant under basal or immunosuppressive conditions or as an anti-inflammatory compound in the presence of exacerbated immune responses, such as acute inflammation. The clinical relevance of the multiple functions of melatonin under different immune conditions, such as infection, autoimmunity, vaccination and immunosenescence, is also reviewed.

  2. Melatonin: Buffering the Immune System

    Science.gov (United States)

    Carrillo-Vico, Antonio; Lardone, Patricia J.; Álvarez-Sánchez, Nuria; Rodríguez-Rodríguez, Ana; Guerrero, Juan M.

    2013-01-01

    Melatonin modulates a wide range of physiological functions with pleiotropic effects on the immune system. Despite the large number of reports implicating melatonin as an immunomodulatory compound, it still remains unclear how melatonin regulates immunity. While some authors argue that melatonin is an immunostimulant, many studies have also described anti-inflammatory properties. The data reviewed in this paper support the idea of melatonin as an immune buffer, acting as a stimulant under basal or immunosuppressive conditions or as an anti-inflammatory compound in the presence of exacerbated immune responses, such as acute inflammation. The clinical relevance of the multiple functions of melatonin under different immune conditions, such as infection, autoimmunity, vaccination and immunosenescence, is also reviewed. PMID:23609496

  3. Response Inhibition Function of Obsessive-Compulsive Patients with Obsessive-Compulsive Personality Disorder

    Directory of Open Access Journals (Sweden)

    Hui Lei

    2017-06-01

    Full Text Available Objective: To explore the effect of comorbid obsessive-compulsive personality disorder (OCPD on response inhibition functions in patients with obsessive-compulsive disorder (OCD. Methods: Forty-five obsessive-compulsive patients with obsessive-compulsive personality disorder (OCD + OCPD, 42 obsessive-compulsive patients without obsessive-compulsive personality disorder (OCD - OCPD and 54 healthy volunteers were selected for the stop-signal task. Results: Obsessive-compulsive patients with obsessive-compulsive personality disorder had a higher score of depression and anxiety and more severe obsessive-compulsive symptoms than that of obsessive-compulsive patients without obsessive-compulsive personality disorder. The two groups of obsessive-compulsive patients of had a greater stop-signal reaction time (SSRT during the inhibition process than the healthy volunteers of the control group (OCD + OCPD: 221.45 ± 31.78; OCD - OCPD: 218.36 ± 31.78; Controls: 199.29 ± 22.80; p < 0.05. However, no significant difference was found between the two groups of obsessive-compulsive patients. Conclusion: The findings show that the comorbid obsessive-compulsive personality disorder has no effect on response inhibition function of obsessive-compulsive patients.

  4. Growth versus immunity--a redirection of the cell cycle?

    Science.gov (United States)

    Eichmann, Ruth; Schäfer, Patrick

    2015-08-01

    Diseases caused by plant pathogens significantly reduce growth and yield in agricultural crop production. Raising immunity in crops is therefore a major aim in breeding programs. However, efforts to enhance immunity are challenged by the occurrence of growth inhibition triggered by immunity that can be as detrimental as diseases. In this review, we will propose molecular models to explain the inhibitory growth-immunity crosstalk. We will briefly discuss why the resource reallocation model might not represent the driving force for the observed growth-immunity trade-offs. We suggest a model in which immunity redirects and initiates hormone signalling activities that can impair plant growth by antagonising cell cycle regulation and meristem activities. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. Functions of innate immune cells and commensal bacteria in gut homeostasis.

    Science.gov (United States)

    Kayama, Hisako; Takeda, Kiyoshi

    2016-02-01

    The intestinal immune system remains unresponsive to beneficial microbes and dietary antigens while activating pro-inflammatory responses against pathogens for host defence. In intestinal mucosa, abnormal activation of innate immunity, which directs adaptive immune responses, causes the onset and/or progression of inflammatory bowel diseases. Thus, innate immunity is finely regulated in the gut. Multiple innate immune cell subsets have been identified in both murine and human intestinal lamina propria. Some innate immune cells play a key role in the maintenance of gut homeostasis by preventing inappropriate adaptive immune responses while others are associated with the pathogenesis of intestinal inflammation through development of Th1 and Th17 cells. In addition, intestinal microbiota and their metabolites contribute to the regulation of innate/adaptive immune responses. Accordingly, perturbation of microbiota composition can trigger intestinal inflammation by driving inappropriate immune responses. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  6. Human antibodies fix complement to inhibit Plasmodium falciparum invasion of erythrocytes and are associated with protection against malaria.

    Science.gov (United States)

    Boyle, Michelle J; Reiling, Linda; Feng, Gaoqian; Langer, Christine; Osier, Faith H; Aspeling-Jones, Harvey; Cheng, Yik Sheng; Stubbs, Janine; Tetteh, Kevin K A; Conway, David J; McCarthy, James S; Muller, Ivo; Marsh, Kevin; Anders, Robin F; Beeson, James G

    2015-03-17

    Antibodies play major roles in immunity to malaria; however, a limited understanding of mechanisms mediating protection is a major barrier to vaccine development. We have demonstrated that acquired human anti-malarial antibodies promote complement deposition on the merozoite to mediate inhibition of erythrocyte invasion through C1q fixation and activation of the classical complement pathway. Antibody-mediated complement-dependent (Ab-C') inhibition was the predominant invasion-inhibitory activity of human antibodies; most antibodies were non-inhibitory without complement. Inhibitory activity was mediated predominately via C1q fixation, and merozoite surface proteins 1 and 2 were identified as major targets. Complement fixation by antibodies was very strongly associated with protection from both clinical malaria and high-density parasitemia in a prospective longitudinal study of children. Ab-C' inhibitory activity could be induced by human immunization with a candidate merozoite surface-protein vaccine. Our findings demonstrate that human anti-malarial antibodies have evolved to function by fixing complement for potent invasion-inhibitory activity and protective immunity. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Maintenance of systemic immune functions prevents accelerated presbycusis.

    Science.gov (United States)

    Iwai, Hiroshi; Baba, Susumu; Omae, Mariko; Lee, Shinryu; Yamashita, Toshio; Ikehara, Susumu

    2008-05-07

    There is no effective therapy for progressive hearing loss such as presbycusis, the causes of which remain poorly understood because of the difficulty of separating genetic and environmental contributions. In the present study, we show that the age-related dysfunctions of the systemic immune system in an animal model of accelerated presbycusis (SAMP1, senescence-accelerated mouse P1) can be corrected by allogeneic bone marrow transplantation (BMT). We also demonstrate that this presbycusis can be prevented; BMT protects the recipients from age-related hearing impairment and the degeneration of spiral ganglion cells (SGCs) as well as the dysfunctions of T lymphocytes, which have a close relation to immune senescence. No donor cells are infiltrated to the spiral ganglia, confirming that this experimental system using BMT is connected to the systemic immune system and does not contribute to transdifferentiation or fusion by donor hematopoietic stem cells (HSCs), or to the direct maintenance of ganglion cells by locally infiltrated donor immunocompetent cells. Therefore, another procedure which attempts to prevent the age-related dysfunctions of the recipient immune system is the inoculation of syngeneic splenocytes from young donors. These mice show no development of hearing loss, compared with the recipient mice with inoculation of saline or splenocytes from old donors. Our studies on the relationship between age-related systemic immune dysfunctions and neurodegeneration mechanisms open up new avenues of treatment for presbycusis, for which there is no effective therapy.

  8. Viral Inhibition of PRR-Mediated Innate Immune Response: Learning from KSHV Evasion Strategies.

    Science.gov (United States)

    Lee, Hye-Ra; Choi, Un Yung; Hwang, Sung-Woo; Kim, Stephanie; Jung, Jae U

    2016-11-30

    The innate immune system has evolved to detect and destroy invading pathogens before they can establish systemic infection. To successfully eradicate pathogens, including viruses, host innate immunity is activated through diverse pattern recognition receptors (PRRs) which detect conserved viral signatures and trigger the production of type I interferon (IFN) and pro-inflammatory cytokines to mediate viral clearance. Viral persistence requires that viruses co-opt cellular pathways and activities for their benefit. In particular, due to the potent antiviral activities of IFN and cytokines, viruses have developed various strategies to meticulously modulate intracellular innate immune sensing mechanisms to facilitate efficient viral replication and persistence. In this review, we highlight recent advances in the study of viral immune evasion strategies with a specific focus on how Kaposi's sarcoma-associated herpesvirus (KSHV) effectively targets host PRR signaling pathways.

  9. Functionalized iron oxide nanoparticles for controlling the movement of immune cells

    Science.gov (United States)

    White, Ethan E.; Pai, Alex; Weng, Yiming; Suresh, Anil K.; van Haute, Desiree; Pailevanian, Torkom; Alizadeh, Darya; Hajimiri, Ali; Badie, Behnam; Berlin, Jacob M.

    2015-04-01

    Immunotherapy is currently being investigated for the treatment of many diseases, including cancer. The ability to control the location of immune cells during or following activation would represent a powerful new technique for this field. Targeted magnetic delivery is emerging as a technique for controlling cell movement and localization. Here we show that this technique can be extended to microglia, the primary phagocytic immune cells in the central nervous system. The magnetized microglia were generated by loading the cells with iron oxide nanoparticles functionalized with CpG oligonucleotides, serving as a proof of principle that nanoparticles can be used to both deliver an immunostimulatory cargo to cells and to control the movement of the cells. The nanoparticle-oligonucleotide conjugates are efficiently internalized, non-toxic, and immunostimulatory. We demonstrate that the in vitro migration of the adherent, loaded microglia can be controlled by an external magnetic field and that magnetically-induced migration is non-cytotoxic. In order to capture video of this magnetically-induced migration of loaded cells, a novel 3D-printed ``cell box'' was designed to facilitate our imaging application. Analysis of cell movement velocities clearly demonstrate increased cell velocities toward the magnet. These studies represent the initial step towards our final goal of using nanoparticles to both activate immune cells and to control their trafficking within the diseased brain.Immunotherapy is currently being investigated for the treatment of many diseases, including cancer. The ability to control the location of immune cells during or following activation would represent a powerful new technique for this field. Targeted magnetic delivery is emerging as a technique for controlling cell movement and localization. Here we show that this technique can be extended to microglia, the primary phagocytic immune cells in the central nervous system. The magnetized microglia were

  10. Innate immunity and effector and regulatory mechanisms involved in allergic contact dermatitis.

    Science.gov (United States)

    Silvestre, Marilene Chaves; Sato, Maria Notomi; Reis, Vitor Manoel Silva Dos

    2018-03-01

    Skin's innate immunity is the initial activator of immune response mechanisms, influencing the development of adaptive immunity. Some contact allergens are detected by Toll-like receptors (TLRs) and inflammasome NLR3. Keratinocytes participate in innate immunity and, in addition to functioning as an anatomical barrier, secrete cytokines, such as TNF, IL-1β, and IL-18, contributing to the development of Allergic Contact Dermatitis. Dendritic cells recognize and process antigenic peptides into T cells. Neutrophils cause pro-inflammatory reactions, mast cells induce migration/maturation of skin DCs, the natural killer cells have natural cytotoxic capacity, the γδ T cells favor contact with hapten during the sensitization phase, and the innate lymphoid cells act in the early stages by secreting cytokines, as well as act in inflammation and tissue homeostasis. The antigen-specific inflammation is mediated by T cells, and each subtype of T cells (Th1/Tc1, Th2/Tc2, and Th17/Tc17) activates resident skin cells, thus contributing to inflammation. Skin's regulatory T cells have a strong ability to inhibit the proliferation of hapten-specific T cells, acting at the end of the Allergic Contact Dermatitis response and in the control of systemic immune responses. In this review, we report how cutaneous innate immunity is the first line of defense and focus its role in the activation of the adaptive immune response, with effector response induction and its regulation.

  11. Innate immunity and effector and regulatory mechanisms involved in allergic contact dermatitis*

    Science.gov (United States)

    Silvestre, Marilene Chaves; Sato, Maria Notomi; dos Reis, Vitor Manoel Silva

    2018-01-01

    Skin's innate immunity is the initial activator of immune response mechanisms, influencing the development of adaptive immunity. Some contact allergens are detected by Toll-like receptors (TLRs) and inflammasome NLR3. Keratinocytes participate in innate immunity and, in addition to functioning as an anatomical barrier, secrete cytokines, such as TNF, IL-1β, and IL-18, contributing to the development of Allergic Contact Dermatitis. Dendritic cells recognize and process antigenic peptides into T cells. Neutrophils cause pro-inflammatory reactions, mast cells induce migration/maturation of skin DCs, the natural killer cells have natural cytotoxic capacity, the γδ T cells favor contact with hapten during the sensitization phase, and the innate lymphoid cells act in the early stages by secreting cytokines, as well as act in inflammation and tissue homeostasis. The antigen-specific inflammation is mediated by T cells, and each subtype of T cells (Th1/Tc1, Th2/Tc2, and Th17/Tc17) activates resident skin cells, thus contributing to inflammation. Skin's regulatory T cells have a strong ability to inhibit the proliferation of hapten-specific T cells, acting at the end of the Allergic Contact Dermatitis response and in the control of systemic immune responses. In this review, we report how cutaneous innate immunity is the first line of defense and focus its role in the activation of the adaptive immune response, with effector response induction and its regulation. PMID:29723367

  12. Innate and Adaptive Immunity to Mucorales.

    Science.gov (United States)

    Ghuman, Harlene; Voelz, Kerstin

    2017-09-05

    Mucormycosis is an invasive fungal infection characterised by rapid filamentous growth, which leads to angioinvasion, thrombosis, and tissue necrosis. The high mortality rates (50-100%) associated with mucormycosis are reflective of not only the aggressive nature of the infection and the poor therapeutics currently employed, but also the failure of the human immune system to successfully clear the infection. Immune effector interaction with Mucorales is influenced by the developmental stage of the mucormycete spore. In a healthy immune environment, resting spores are resistant to phagocytic killing. Contrarily, swollen spores and hyphae are susceptible to damage and degradation by macrophages and neutrophils. Under the effects of immune suppression, the recruitment and efficacy of macrophage and neutrophil activity against mucormycetes is considerably reduced. Following penetration of the endothelial lining, Mucorales encounter platelets. Platelets adhere to both mucormycete spores and hyphae, and exhibit germination suppression and hyphal damage capacity in vitro. Dendritic cells are activated in response to Mucorales hyphae only, and induce adaptive immunity. It is crucial to further knowledge regarding our immune system's failure to eradicate resting spores under intact immunity and inhibit fungal growth under immunocompromised conditions, in order to understand mucormycosis pathogenicity and enhance therapeutic strategies for mucormycosis.

  13. Effects of psycho-behavioral interventions on immune functioning in cancer patients: a systematic review.

    Science.gov (United States)

    Tong, Guixian; Geng, Qingqing; Cheng, Jing; Chai, Jing; Xia, Yi; Feng, Rui; Zhang, Lu; Wang, Debin

    2014-01-01

    This study aimed at summarizing evidence about effects of psycho-behavioral interventions (PBIs) on immune responses among cancer patients and analyzing quality of published studies so as to inform future researches. Literature retrieval utilized both highly inclusive algorithms searching randomized controlled studies published in English and Chinese and manual searching of eligible studies from references of relevant review papers. Two researchers examined the articles selected separately and extracted the information using a pre-designed form for soliciting data about the trials (e.g., sample size, disease status, intervention, immune responses) and quality ratings of the studies. Both narrative descriptions and meta-analysis (via Review manager 5) were used synthesizing the effects of PBIs on immune responses among cancer patients and state of art of the researches in this area. Seventy-six RCTs met inclusion criteria. PBIs implemented were divided into three major categories including psychological state adjustment, physical activity and dietary modification. Immune indicators measured included CD4+ cells, CD8+ cells, CD4/CDC8+ ratio, CD3+ cells, NK cell activity, etc. Effects of PBIs on immune responses documented in individual papers were mixed and pooled analysis of CD4+ cells, CD4+/CD8+ ratio, CD3+ cells, NKCA, IgG, IgM and IL-2 showed modest effects. However, there were huge discrepancies in intervention effects between studies published in English and Chinese and the results should be interpreted with caution. Besides, most studies suffer from some quality flaws concerning blinding, randomization procedures, compliance, attrition and intention-to-treat analyses, etc. Although there are considerable evidences of PBI effects on some immune indicators, the effect sizes are modest and it is still premature to conclude whether PBIs have effects on immune functions among cancer patients. There is a clear need for much more rigorous efforts in this area

  14. Electrostatics-mediated α-chymotrypsin inhibition by functionalized single-walled carbon nanotubes.

    Science.gov (United States)

    Zhao, Daohui; Zhou, Jian

    2017-01-04

    The α-chymotrypsin (α-ChT) enzyme is extensively used for studying nanomaterial-induced enzymatic activity inhibition. A recent experimental study reported that carboxylized carbon nanotubes (CNTs) played an important role in regulating the α-ChT activity. In this study, parallel tempering Monte Carlo and molecular dynamics simulations were combined to elucidate the interactions between α-ChT and CNTs in relation to the CNT functional group density. The simulation results indicate that the adsorption and the driving force of α-ChT on different CNTs are contingent on the carboxyl density. Meanwhile, minor secondary structural changes are observed in adsorption processes. It is revealed that α-ChT interacts with pristine CNTs through hydrophobic forces and exhibits a non-competitive characteristic with the active site facing towards the solution; while it binds to carboxylized CNTs with the active pocket through a dominant electrostatic association, which causes enzymatic activity inhibition in a competitive-like mode. These findings are in line with experimental results, and well interpret the activity inhibition of α-ChT at the molecular level. Moreover, this study would shed light on the detailed mechanism of specific recognition and regulation of α-ChT by other functionalized nanomaterials.

  15. Endothelial-specific inhibition of NF-κB enhances functional haematopoiesis.

    Science.gov (United States)

    Poulos, Michael G; Ramalingam, Pradeep; Gutkin, Michael C; Kleppe, Maria; Ginsberg, Michael; Crowley, Michael J P; Elemento, Olivier; Levine, Ross L; Rafii, Shahin; Kitajewski, Jan; Greenblatt, Matthew B; Shim, Jae-Hyuck; Butler, Jason M

    2016-12-21

    Haematopoietic stem cells (HSCs) reside in distinct niches within the bone marrow (BM) microenvironment, comprised of endothelial cells (ECs) and tightly associated perivascular constituents that regulate haematopoiesis through the expression of paracrine factors. Here we report that the canonical NF-κB pathway in the BM vascular niche is a critical signalling axis that regulates HSC function at steady state and following myelosuppressive insult, in which inhibition of EC NF-κB promotes improved HSC function and pan-haematopoietic recovery. Mice expressing an endothelial-specific dominant negative IκBα cassette under the Tie2 promoter display a marked increase in HSC activity and self-renewal, while promoting the accelerated recovery of haematopoiesis following myelosuppression, in part through protection of the BM microenvironment following radiation and chemotherapeutic-induced insult. Moreover, transplantation of NF-κB-inhibited BM ECs enhanced haematopoietic recovery and protected mice from pancytopenia-induced death. These findings pave the way for development of niche-specific cellular approaches for the treatment of haematological disorders requiring myelosuppressive regimens.

  16. Endothelial-specific inhibition of NF-κB enhances functional haematopoiesis

    Science.gov (United States)

    Poulos, Michael G.; Ramalingam, Pradeep; Gutkin, Michael C.; Kleppe, Maria; Ginsberg, Michael; Crowley, Michael J. P.; Elemento, Olivier; Levine, Ross L.; Rafii, Shahin; Kitajewski, Jan; Greenblatt, Matthew B.; Shim, Jae-Hyuck; Butler, Jason M.

    2016-01-01

    Haematopoietic stem cells (HSCs) reside in distinct niches within the bone marrow (BM) microenvironment, comprised of endothelial cells (ECs) and tightly associated perivascular constituents that regulate haematopoiesis through the expression of paracrine factors. Here we report that the canonical NF-κB pathway in the BM vascular niche is a critical signalling axis that regulates HSC function at steady state and following myelosuppressive insult, in which inhibition of EC NF-κB promotes improved HSC function and pan-haematopoietic recovery. Mice expressing an endothelial-specific dominant negative IκBα cassette under the Tie2 promoter display a marked increase in HSC activity and self-renewal, while promoting the accelerated recovery of haematopoiesis following myelosuppression, in part through protection of the BM microenvironment following radiation and chemotherapeutic-induced insult. Moreover, transplantation of NF-κB-inhibited BM ECs enhanced haematopoietic recovery and protected mice from pancytopenia-induced death. These findings pave the way for development of niche-specific cellular approaches for the treatment of haematological disorders requiring myelosuppressive regimens. PMID:28000664

  17. Behavioral and Neural Correlates of Executive Function: Interplay between Inhibition and Updating Processes.

    Science.gov (United States)

    Kim, Na Young; Wittenberg, Ellen; Nam, Chang S

    2017-01-01

    This study investigated the interaction between two executive function processes, inhibition and updating, through analyses of behavioral, neurophysiological, and effective connectivity metrics. Although, many studies have focused on behavioral effects of executive function processes individually, few studies have examined the dynamic causal interactions between these two functions. A total of twenty participants from a local university performed a dual task combing flanker and n-back experimental paradigms, and completed the Operation Span Task designed to measure working memory capacity. We found that both behavioral (accuracy and reaction time) and neurophysiological (P300 amplitude and alpha band power) metrics on the inhibition task (i.e., flanker task) were influenced by the updating load (n-back level) and modulated by working memory capacity. Using independent component analysis, source localization (DIPFIT), and Granger Causality analysis of the EEG time-series data, the present study demonstrated that manipulation of cognitive demand in a dual executive function task influenced the causal neural network. We compared connectivity across three updating loads (n-back levels) and found that experimental manipulation of working memory load enhanced causal connectivity of a large-scale neurocognitive network. This network contains the prefrontal and parietal cortices, which are associated with inhibition and updating executive function processes. This study has potential applications in human performance modeling and assessment of mental workload, such as the design of training materials and interfaces for those performing complex multitasking under stress.

  18. Behavioral and Neural Correlates of Executive Function: Interplay between Inhibition and Updating Processes

    Directory of Open Access Journals (Sweden)

    Na Young Kim

    2017-06-01

    Full Text Available This study investigated the interaction between two executive function processes, inhibition and updating, through analyses of behavioral, neurophysiological, and effective connectivity metrics. Although, many studies have focused on behavioral effects of executive function processes individually, few studies have examined the dynamic causal interactions between these two functions. A total of twenty participants from a local university performed a dual task combing flanker and n-back experimental paradigms, and completed the Operation Span Task designed to measure working memory capacity. We found that both behavioral (accuracy and reaction time and neurophysiological (P300 amplitude and alpha band power metrics on the inhibition task (i.e., flanker task were influenced by the updating load (n-back level and modulated by working memory capacity. Using independent component analysis, source localization (DIPFIT, and Granger Causality analysis of the EEG time-series data, the present study demonstrated that manipulation of cognitive demand in a dual executive function task influenced the causal neural network. We compared connectivity across three updating loads (n-back levels and found that experimental manipulation of working memory load enhanced causal connectivity of a large-scale neurocognitive network. This network contains the prefrontal and parietal cortices, which are associated with inhibition and updating executive function processes. This study has potential applications in human performance modeling and assessment of mental workload, such as the design of training materials and interfaces for those performing complex multitasking under stress.

  19. Functions of Calcium-Dependent Protein Kinases in Plant Innate Immunity

    Directory of Open Access Journals (Sweden)

    Xiquan Gao

    2014-03-01

    Full Text Available An increase of cytosolic Ca2+ is generated by diverse physiological stimuli and stresses, including pathogen attack. Plants have evolved two branches of the immune system to defend against pathogen infections. The primary innate immune response is triggered by the detection of evolutionarily conserved pathogen-associated molecular pattern (PAMP, which is called PAMP-triggered immunity (PTI. The second branch of plant innate immunity is triggered by the recognition of specific pathogen effector proteins and known as effector-triggered immunity (ETI. Calcium (Ca2+ signaling is essential in both plant PTI and ETI responses. Calcium-dependent protein kinases (CDPKs have emerged as important Ca2+ sensor proteins in transducing differential Ca2+ signatures, triggered by PAMPs or effectors and activating complex downstream responses. CDPKs directly transmit calcium signals by calcium binding to the elongation factor (EF-hand domain at the C-terminus and substrate phosphorylation by the catalytic kinase domain at the N-terminus. Emerging evidence suggests that specific and overlapping CDPKs phosphorylate distinct substrates in PTI and ETI to regulate diverse plant immune responses, including production of reactive oxygen species, transcriptional reprogramming of immune genes, and the hypersensitive response.

  20. Functions of Calcium-Dependent Protein Kinases in Plant Innate Immunity

    Science.gov (United States)

    Gao, Xiquan; Cox, Kevin L.; He, Ping

    2014-01-01

    An increase of cytosolic Ca2+ is generated by diverse physiological stimuli and stresses, including pathogen attack. Plants have evolved two branches of the immune system to defend against pathogen infections. The primary innate immune response is triggered by the detection of evolutionarily conserved pathogen-associated molecular pattern (PAMP), which is called PAMP-triggered immunity (PTI). The second branch of plant innate immunity is triggered by the recognition of specific pathogen effector proteins and known as effector-triggered immunity (ETI). Calcium (Ca2+) signaling is essential in both plant PTI and ETI responses. Calcium-dependent protein kinases (CDPKs) have emerged as important Ca2+ sensor proteins in transducing differential Ca2+ signatures, triggered by PAMPs or effectors and activating complex downstream responses. CDPKs directly transmit calcium signals by calcium binding to the elongation factor (EF)-hand domain at the C-terminus and substrate phosphorylation by the catalytic kinase domain at the N-terminus. Emerging evidence suggests that specific and overlapping CDPKs phosphorylate distinct substrates in PTI and ETI to regulate diverse plant immune responses, including production of reactive oxygen species, transcriptional reprogramming of immune genes, and the hypersensitive response. PMID:27135498

  1. Functional similarities between pigeon 'milk' and mammalian milk: induction of immune gene expression and modification of the microbiota.

    Directory of Open Access Journals (Sweden)

    Meagan J Gillespie

    Full Text Available Pigeon 'milk' and mammalian milk have functional similarities in terms of nutritional benefit and delivery of immunoglobulins to the young. Mammalian milk has been clearly shown to aid in the development of the immune system and microbiota of the young, but similar effects have not yet been attributed to pigeon 'milk'. Therefore, using a chicken model, we investigated the effect of pigeon 'milk' on immune gene expression in the Gut Associated Lymphoid Tissue (GALT and on the composition of the caecal microbiota. Chickens fed pigeon 'milk' had a faster rate of growth and a better feed conversion ratio than control chickens. There was significantly enhanced expression of immune-related gene pathways and interferon-stimulated genes in the GALT of pigeon 'milk'-fed chickens. These pathways include the innate immune response, regulation of cytokine production and regulation of B cell activation and proliferation. The caecal microbiota of pigeon 'milk'-fed chickens was significantly more diverse than control chickens, and appears to be affected by prebiotics in pigeon 'milk', as well as being directly seeded by bacteria present in pigeon 'milk'. Our results demonstrate that pigeon 'milk' has further modes of action which make it functionally similar to mammalian milk. We hypothesise that pigeon 'lactation' and mammalian lactation evolved independently but resulted in similarly functional products.

  2. Heat shock protein 10 (Hsp10) in immune-related diseases: one coin, two sides

    Science.gov (United States)

    Jia, Haibo; Halilou, Amadou I.; Hu, Liang; Cai, Wenqian; Liu, Jing; Huang, Bo

    2011-01-01

    Heat shock protein 10 (Hsp10) in eukaryotes, originally identified as a mitochondrial chaperone, now is also known to be present in cytosol, cell surface, extracellular space and peripheral blood. Functionally besides participating in mitochondrial protein folding in association with Hsp60, Hsp10 appears to be related to pregnancy, cancer and autoimmune inhibition. Hsp10 can be released to peripheral blood at very early time point of pregnancy and given another name called early pregnancy factor (EPF), which seems to play a critical role in developing a pregnant niche. In malignant disorders, Hsp10 is usually abnormally expressed in the cytosol of malignant cells and further released to extracellular space, resulting in tumor-promoting effect from various aspects. Furthermore, distinct from other heat shock protein members, whose soluble form is recognized as danger signal by immune cells and triggers immune responses, Hsp10 after release, however, is designed to be an inhibitory signal by limiting immune response. This review discusses how Hsp10 participates in various physiological and pathological processes from basic protein molecule folding to pregnancy, cancer and autoimmune diseases, and emphasizes how important the location is for the function exertion of a molecule. PMID:21969171

  3. Cesarean section and disease associated with immune function

    DEFF Research Database (Denmark)

    Kristensen, Kim; Henriksen, Lonny

    2016-01-01

    colitis and celiac disease, whereas children delivered by elective CS had an increased risk of lower respiratory tract infection and juvenile idiopathic arthritis. The effect of elective CS was higher than the effect of acute CS on the risk of asthma. CONCLUSION: Children delivered by CS are at increased......BACKGROUND: Earlier studies have shown that delivery by cesarean section (CS) is associated with an increased risk of disease associated with immune function in the offspring, but these studies have generally not discriminated between the effect of acute and elective CS. OBJECTIVE: We sought...... to further explore these associations using discrimination between the effects of acute versus elective CS. METHODS: We performed a population- and national register-based cohort study including all children born in Denmark from January 1997 through December 2012. Hazard ratios for diseases associated...

  4. The Immune System: Basis of so much Health and Disease: 3. Adaptive Immunity.

    Science.gov (United States)

    Scully, Crispian; Georgakopoulou, Eleni A; Hassona, Yazan

    2017-04-01

    The immune system is the body’s primary defence mechanism against infections, and disturbances in the system can cause disease if the system fails in defence functions (in immunocompromised people), or if the activity is detrimental to the host (as in auto-immune and auto-inflammatory states). A healthy immune system is also essential to normal health of dental and oral tissues. This series presents the basics for the understanding of the immune system; this article covers adaptive immunity. Clinical relevance: Dental clinicians need a basic understanding of the immune system as it underlies health and disease.

  5. Changes in mitochondrial function by lipid peroxidation and their inhibition by biscoclaurin alkaloid

    International Nuclear Information System (INIS)

    Aono, K.; Shiraishi, N.; Arita, T.; Inouye, B.; Nakazawa, T.; Utsumi, K.

    1981-01-01

    During in vitro investigation of changes in mitochondrial function accompanying lipid peroxidation, it was found that cepharanthine, a biscoclaurin alkaloid, protects against such change. Results obtained were as follows: (1) Fe2+ induces lipid peroxidation of isolated mitochondria, resulting in diminished oxidative phosphorylation. (2) This diminishment largely depends on deterioration of ion compartmentation of the membrane and an increase in latent ATPase activity. (3) The Fe2+-induced deterioration in ion compartmentation is inhibited by cepharanthine. (4) Cepharanthine inhibits the mitochondrial lipid peroxidation induced by Fe2+. (5) Cepharanthine inhibits the lipid peroxidation of soybean lecithin liposomes by 60Co-irradiation

  6. Tumor necrosis factor (TNF) receptor shedding controls thresholds of innate immune activation that balance opposing TNF functions in infectious and inflammatory diseases

    DEFF Research Database (Denmark)

    Xanthoulea, Sofia; Pasparakis, Manolis; Kousteni, Stavroula

    2004-01-01

    Tumor necrosis factor (TNF) is a potent cytokine exerting critical functions in the activation and regulation of immune and inflammatory responses. Due to its pleiotropic activities, the amplitude and duration of TNF function must be tightly regulated. One of the mechanisms that may have evolved...... to modulate TNF function is the proteolytic cleavage of its cell surface receptors. In humans, mutations affecting shedding of the p55TNF receptor (R) have been linked with the development of the TNFR-associated periodic syndromes, disorders characterized by recurrent fever attacks and localized inflammation....... Here we show that knock-in mice expressing a mutated nonsheddable p55TNFR develop Toll-like receptor-dependent innate immune hyperreactivity, which renders their immune system more efficient at controlling intracellular bacterial infections. Notably, gain of function for antibacterial host defenses...

  7. Transfer of adoptive immunity to tuberculosis in mice

    International Nuclear Information System (INIS)

    Lefford, M.J.

    1975-01-01

    A system is described for studying adoptive immunity to tuberculosis in syngeneic mice. Donor mice were immunized with 10 4 BCG intravenously, and lymphoid cells were harvested 28 days later. Adoptive immunity was measured in recipient mice in terms of the inhibition of growth of BCG in the liver and spleen following intravenous injection. Adoptive immunity was expressed optimally when recipients were sublethally irradiated (500 R), challenged with 10 4 to 10 5 viable organisms, and given sensitized lymphoid cells intravenously. Adoptive immunity was not manifest until 14 days after challenge and was effective against Mycobacterium tuberculosis H37Rv as well as BCG. Immunity could be conferred by spleen, lymph node, peritoneal exudate, and resident peritoneal (washout) cells. The lymphoid cells conferring immunity were shown to be thymus-dependent lymphocytes by virtue of their nonadherence to glass wool and sensitivity to anti-theta serum plus complement. The sensitized cells were relatively susceptible to both in vitro and in vivo x irradiation

  8. High dose of plasmid IL-15 inhibits immune responses in an influenza non-human primates immunogenicity model

    International Nuclear Information System (INIS)

    Yin Jiangmei; Dai Anlan; Laddy, Dominick J.; Yan Jian; Arango, Tatiana; Khan, Amir S.; Lewis, Mark G.; Andersen, Hanne; Kutzler, Michele A.; Draghia-Akli, Ruxandra; Weiner, David B.; Boyer, Jean D.

    2009-01-01

    Interleukin (IL)-15, is a cytokine that is important for the maintenance of long-lasting, high-avidity T cell response to invading pathogens and has, therefore, been used in vaccine and therapeutic platforms as an adjuvant. In addition to pure protein delivery, plasmids encoding the IL-15 gene have been utilized. However, it is critical to determine the appropriate dose to maximize the adjuvanting effects. We immunized rhesus macaques with different doses of IL-15 expressing plasmid in an influenza non-human primate immunogenicity model. We found that co-immunization of rhesus macaques with a Flu DNA-based vaccine and low doses of plasmid encoding macaque IL-15 enhanced the production of IFN-γ (0.5 mg) and the proliferation of CD4 + and CD8 + T cells, as well as T CM levels in proliferating CD8 + T cells (0.25 mg). Whereas, high doses of IL-15 (4 mg) decrease the production of IFN-γ and the proliferation of CD4 + and CD8 + T cells and T CM levels in the proliferating CD4 + and CD8 + T cells. In addition, the data of hemagglutination inhibition (HI) antibody titer suggest that although not significantly different, there appears to be a slight increase in antibodies at lower doses of IL-15. Importantly, however, the higher doses of IL-15 decrease the antibody levels significantly. This study demonstrates the importance of optimizing DNA-based cytokine adjuvants.

  9. The emerging role of immune checkpoint based approaches in AML and MDS.

    Science.gov (United States)

    Boddu, Prajwal; Kantarjian, Hagop; Garcia-Manero, Guillermo; Allison, James; Sharma, Padmanee; Daver, Naval

    2018-04-01

    The development of immune checkpoint inhibitors represents a major breakthrough in the field of cancer therapeutics. Pursuant to their success in melanoma and numerous solid tumor malignancies, these agents are being investigated in hematological malignancies including acute myelogenous leukemia (AML) and myelodysplastic syndromes (MDS). Although AML/MDS have traditionally been considered to be less immunogenic than solid tumor malignancies, recent pre-clinical models suggest a therapeutic role for immune checkpoint inhibition in these diseases. CTLA-4 inhibition may be especially effective in treating late post-allogeneic stem cell transplant relapse of AML in patients with limited or no graft versus host disease. Immune checkpoint inhibition, specifically PD-1 inhibition, demonstrated limited single agent efficacy in patients with relapsed AML and with MDS post-hypomethylating therapy. Rationally designed combinations of PD-1 inhibitors with standard anti-leukemic therapy are needed. Hypomethylating agents such as azacitidine, up-regulate PD-1, PD-L1, and PD-L2 in patients with AML/MDS and up-regulation of these genes was associated with the emergence of resistance. The combination of azacitidine and PD-1/PD-L1 inhibition may be a potential mechanism to prevent or overcome resistance to 5-azacitidine. A number of such combinations are being evaluated in clinical trials with early encouraging results. Immune checkpoint inhibition is also an attractive option to improve relapse-free survival or eliminate minimal residual disease post induction and consolidation by enhancing T-cell surveillance in patients with high-risk AML. The ongoing clinical trials with checkpoint inhibitors in AML/MDS will improve our understanding of the immunobiology of these diseases and guide us to the most appropriate application of these agents in the therapy of AML/MDS.

  10. Cost of reproduction in a long-lived bird: incubation effort reduces immune function and future reproduction.

    Science.gov (United States)

    Hanssen, Sveinn Are; Hasselquist, Dennis; Folstad, Ivar; Erikstad, Kjell Einar

    2005-05-22

    Life-history theory predicts that increased current reproductive effort should lead to a fitness cost. This cost of reproduction may be observed as reduced survival or future reproduction, and may be caused by temporal suppression of immune function in stressed or hard-working individuals. In birds, consideration of the costs of incubating eggs has largely been neglected in favour of the costs of brood rearing. We manipulated incubation demand in two breeding seasons (2000 and 2001) in female common eiders (Somateria mollissima) by creating clutches of three and six eggs (natural range 3-6 eggs). The common eider is a long-lived sea-duck where females do not eat during the incubation period. Mass loss increased and immune function (lymphocyte levels and specific antibody response to the non-pathogenic antigens diphtheria and tetanus toxoid) was reduced in females incubating large clutches. The increased incubation effort among females assigned to large incubation demand did not lead to adverse effects on current reproduction or return rate in the next breeding season. However, large incubation demand resulted in long-term fitness costs through reduced fecundity the year after manipulation. Our data show that in eiders, a long-lived species, the cost of high incubation demand is paid in the currency of reduced future fecundity, possibly mediated by reduced immune function.

  11. Participation of hypothalamic CB1 receptors in reproductive axis disruption during immune challenge.

    Science.gov (United States)

    Surkin, P N; Di Rosso, M E; Correa, F; Elverdin, J C; Genaro, A M; De Laurentiis, A; Fernández-Solari, J

    2017-08-01

    Immune challenge inhibits reproductive function and endocannabinoids (eCB) modulate sexual hormones. However, no studies have been performed to assess whether the eCB system mediates the inhibition of hormones that control reproduction as a result of immune system activation during systemic infections. For that reason, we evaluated the participation of the hypothalamic cannabinoid receptor CB1 on the hypothalamic-pituitary-gonadal (HPG) axis activity in rats submitted to immune challenge. Male adult rats were treated i.c.v. administration with a CB1 antagonist/inverse agonist (AM251) (500 ng/5 μL), followed by an i.p. injection of lipopolysaccharide (LPS) (5 mg/kg) 15 minutes later. Plasmatic, hypothalamic and adenohypophyseal pro-inflammatory cytokines, hormones and neuropeptides were assessed 90 or 180 minutes post-LPS. The plasma concentration of tumour necrosis factor α and adenohypophyseal mRNA expression of Tnfα and Il1β increased 90 and 180 minutes post i.p. administration of LPS. However, cytokine mRNA expression in the hypothalamus increased only 180 minutes post-LPS, suggesting an inflammatory delay in this organ. CB1 receptor blockade with AM251 increased LPS inflammatory effects, particularly in the hypothalamus. LPS also inhibited the HPG axis by decreasing gonadotrophin-releasing hormone hypothalamic content and plasma levels of luteinising hormone and testosterone. These disruptor effects were accompanied by decreased hypothalamic Kiss1 mRNA expression and prostaglandin E2 content, as well as by increased gonadotrophin-inhibitory hormone (Rfrp3) mRNA expression. All these disruptive effects were prevented by the presence of AM251. In summary, our results suggest that, in male rats, eCB mediate immune challenge-inhibitory effects on reproductive axis at least partially via hypothalamic CB1 activation. In addition, this receptor also participates in homeostasis recovery by modulating the inflammatory process taking place after LPS

  12. Effects of ration level on immune functions in chinook salmon (Oncorhynchus tshawytscha)

    Science.gov (United States)

    Alcorn, S.W.; Pascho, R.J.; Murray, A.L.; Shearer, K.D.

    2003-01-01

    The relationship between nutritional status and disease resistance in cultured salmonids can be affected by dietary manipulations. Careful attention to feeding levels may be important to avoid imbalances in nutrient levels that could ultimately impair a fish's ability to resist infectious microorganisms. In the current study, fish in three feed-level groups were fed an experimental diet either to satiation, 64% of satiation or 40% of satiation. A fourth group of fish were fed a commercial diet at the 64% of satiation level and served as controls. To evaluate certain indices of disease resistance in the test and control fish, a panel of assays was employed to measure humoral and cellular immune functions 30, 39 and 54 weeks after starting the dietary treatments. The panel included measures of blood hematocrit and leucocrit levels, plasma protein concentration and serum lysozyme and complement activity. Cellular analyses included differential blood leucocyte counts, NBT reduction and phagocytosis by pronephros macrophages and myeloperoxidase activity of pronephros neutrophils. No differences were observed in those indices between fish tested from the control-diet group (commercial diet fed at the 64% rate) and fish tested from the 64% feed-level group, except that fish fed the commercial diet had a greater concentration of plasma protein. Leucocrit values and plasma protein concentrations tended to increase among the experimental feed groups as the ration increased from 40% to satiation. More importantly, phagocytic activity by anterior kidney leucocytes was found to be inversely proportional to the feed level. Whereas the results of this study provide evidence that the salmonid immune system may be fairly robust with regard to available metabolic energy, the significant changes observed in phagocytic cell activity suggest that some cellular immune functions may be affected by the feed level.

  13. Relationship between ways of nutritional support and immune function in patients with malignant obstructive jaundice after PTCD

    Directory of Open Access Journals (Sweden)

    YANG Shenghua

    2014-11-01

    Full Text Available ObjectiveTo investigate the clinical effect of different nutritional therapies on the immune function of patients with malignant obstructive jaundice after percutaneous transhepatic cholangiodrainage (PTCD. MethodsA total of 50 patients with malignant obstructive jaundice who were admitted to our hospital from January 2009 to March 2013 were randomly divided into two groups according to the admission order. The patients in group A (n=25 received enteral nutritional support after PTCD, and those in group B (n=25 received total parenteral nutritional support after PTCD. Intra-group and inter-group comparisons were made in terms of jaundice clearance, nutritional indices, and body’s immune function on preoperative day 1 and postoperative day 7; comparison between the two groups was made by t test. ResultsAmong the 50 patients who underwent PTCD, 39 (78% had good drainage, while 11 (22% did not reach the expectation, of which, 5 (10% were in group A and 6 (12% in group B. In both groups, the nutritional indices on postoperative day 7 were significantly higher than those on preoperative day 1(P<0.05, but no significant difference in these indices was observed between group A and group B on postoperative day 7 (P>0.05. The immune function of patients in both groups was significantly improved following PTCD and nutritional support (P<0.05, but there was no significant difference between the two groups (P>0.05. Although the same scheme of nutritional support was used, there were 11 patients who did not achieve the expected jaundice clearance after PTCD and had limited improvement in immune function compared with those who had complete jaundice clearance (all P<0.05. ConclusionJaundice clearance is closely related to PTCD in patients with malignant obstructive jaundice, but not markedly associated with the ways of nutritional support.

  14. Induction of antitumor immunity through xenoplacental immunization

    Directory of Open Access Journals (Sweden)

    Agadjanyan Michael G

    2006-05-01

    Full Text Available Abstract Historically cancer vaccines have yielded suboptimal clinical results. We have developed a novel strategy for eliciting antitumor immunity based upon homology between neoplastic tissue and the developing placenta. Placenta formation shares several key processes with neoplasia, namely: angiogenesis, activation of matrix metalloproteases, and active suppression of immune function. Immune responses against xenoantigens are well known to break self-tolerance. Utilizing xenogeneic placental protein extracts as a vaccine, we have successfully induced anti-tumor immunity against B16 melanoma in C57/BL6 mice, whereas control xenogeneic extracts and B16 tumor extracts where ineffective, or actually promoted tumor growth, respectively. Furthermore, dendritic cells were able to prime tumor immunity when pulsed with the placental xenoantigens. While vaccination-induced tumor regression was abolished in mice depleted of CD4 T cells, both CD4 and CD8 cells were needed to adoptively transfer immunity to naïve mice. Supporting the role of CD8 cells in controlling tumor growth are findings that only freshly isolated CD8 cells from immunized mice were capable of inducing tumor cell caspases-3 activation ex vivo. These data suggest feasibility of using xenogeneic placental preparations as a multivalent vaccine potently targeting not just tumor antigens, but processes that are essential for tumor maintenance of malignant potential.

  15. Immune system handling time may alter the outcome of competition between pathogens and the immune system.

    Science.gov (United States)

    Greenspoon, Philip B; Banton, Sydney; Mideo, Nicole

    2018-06-14

    Predators may be limited in their ability to kill prey (i.e., have type II or III functional responses), an insight that has had far-reaching consequences in the ecological literature. With few exceptions, however, this possibility has not been extended to the behaviour of immune cells, which kill pathogens much as predators kill their prey. Rather, models of the within-host environment have tended to tacitly assume that immune cells have an unlimited ability to target and kill pathogens (i.e., a type I functional response). Here we explore the effects of changing this assumption on infection outcomes (i.e., pathogen loads). We incorporate immune cell handling time into an ecological model of the within-host environment that considers both the predatory nature of the pathogen-immune cell interaction as well as competition between immune cells and pathogens for host resources. Unless pathogens can preempt immune cells for host resources, adding an immune cell handling time increases equilibrium pathogen load. We find that the shape of the relationship between energy intake and pathogen load can change: with a type I functional response, pathogen load is maximised at intermediate inputs, while for a type II or III functional response, pathogen load is solely increasing. With a type II functional response, pathogen load can fluctuate rather than settling to an equilibrium, a phenomenon unobserved with type I or III functional responses. Our work adds to a growing literature highlighting the role of resource availability in host-parasite interactions. Implications of our results for adaptive anorexia are discussed. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Inhibition of WISE preserves renal allograft function.

    Science.gov (United States)

    Qian, Xueming; Yuan, Xiaodong; Vonderfecht, Steven; Ge, Xupeng; Lee, Jae; Jurisch, Anke; Zhang, Li; You, Andrew; Fitzpatrick, Vincent D; Williams, Alexia; Valente, Eliane G; Pretorius, Jim; Stevens, Jennitte L; Tipton, Barbara; Winters, Aaron G; Graham, Kevin; Harriss, Lindsey; Baker, Daniel M; Damore, Michael; Salimi-Moosavi, Hossein; Gao, Yongming; Elkhal, Abdallah; Paszty, Chris; Simonet, W Scott; Richards, William G; Tullius, Stefan G

    2013-01-01

    Wnt-modulator in surface ectoderm (WISE) is a secreted modulator of Wnt signaling expressed in the adult kidney. Activation of Wnt signaling has been observed in renal transplants developing interstitial fibrosis and tubular atrophy; however, whether WISE contributes to chronic changes is not well understood. Here, we found moderate to high expression of WISE mRNA in a rat model of renal transplantation and in kidneys from normal rats. Treatment with a neutralizing antibody against WISE improved proteinuria and graft function, which correlated with higher levels of β-catenin protein in kidney allografts. In addition, treatment with the anti-WISE antibody reduced infiltration of CD68(+) macrophages and CD8(+) T cells, attenuated glomerular and interstitial injury, and decreased biomarkers of renal injury. This treatment reduced expression of genes involved in immune responses and in fibrogenic pathways. In summary, WISE contributes to renal dysfunction by promoting tubular atrophy and interstitial fibrosis.

  17. T Lymphocyte Inhibition by Tumor-Infiltrating Dendritic Cells Involves Ectonucleotidase CD39 but Not Arginase-1

    Directory of Open Access Journals (Sweden)

    Malika Trad

    2015-01-01

    Full Text Available T lymphocytes activated by dendritic cells (DC which present tumor antigens play a key role in the antitumor immune response. However, in patients suffering from active cancer, DC are not efficient at initiating and supporting immune responses as they participate to T lymphocyte inhibition. DC in the tumor environment are functionally defective and exhibit a characteristic of immature phenotype, different to that of DC present in nonpathological conditions. The mechanistic bases underlying DC dysfunction in cancer responsible for the modulation of T-cell responses and tumor immune escape are still being investigated. Using two different mouse tumor models, we showed that tumor-infiltrating DC (TIDC are constitutively immunosuppressive, exhibit a semimature phenotype, and impair responder T lymphocyte proliferation and activation by a mechanism involving CD39 ectoenzyme.

  18. Effect of Kanglaite combined with chemotherapy on myelosuppression, immune function and tumor markers levels in patients with breast cancer

    Directory of Open Access Journals (Sweden)

    Qi Pan

    2017-09-01

    Full Text Available Objective: To investigate the effect of Kanglaite combined with chemotherapy on myelosuppression, immune function and tumor markers levels in patients with breast cancer. Methods: A total of 90 breast cancer patients in our hospital were randomly divided into control group (45 cases and observation group (45 cases. The two groups received CAF chemotherapy, and the observation group was additionally given Kanglaite injection (200 mL/d for 2 weeks continuously. Both groups had chemotherapy for 6 courses. The effect on myelosuppression, immune function and tumor markers levels was detected and compared before and after treatment in two groups. Results: After treatment, myelosuppression was found in both groups, and the levels of leukocyte, hemoglobin and platelet decreased significantly compared with before treatment (P0.05, and the levels of immune function indexes (CD3+, CD4+, CD4+/ CD8+ of the observation group were significantly higher than those in the control group (P<0.05) . After treatment, the levels of two tumor markers (CEA, CA15-3 decreased significantly than before treatment in both groups (P<0.05, and the decrease amplitude in the observation group was higher than that in the control group (P<0.05. Conclusions: Kanglaite combined with chemotherapy has evident therapeutic effect on breast cancer. It can alleviate the myelosuppression caused by chemotherapy, improve immune function, and reduce the concentration of tumor markers in patients with breast cancer.

  19. Adaptive Immunity to Leukemia Is Inhibited by Cross-Reactive Induced Regulatory T Cells.

    Science.gov (United States)

    Manlove, Luke S; Berquam-Vrieze, Katherine E; Pauken, Kristen E; Williams, Richard T; Jenkins, Marc K; Farrar, Michael A

    2015-10-15

    BCR-ABL(+) acute lymphoblastic leukemia patients have transient responses to current therapies. However, the fusion of BCR to ABL generates a potential leukemia-specific Ag that could be a target for immunotherapy. We demonstrate that the immune system can limit BCR-ABL(+) leukemia progression although ultimately this immune response fails. To address how BCR-ABL(+) leukemia escapes immune surveillance, we developed a peptide: MHC class II tetramer that labels endogenous BCR-ABL-specific CD4(+) T cells. Naive mice harbored a small population of BCR-ABL-specific T cells that proliferated modestly upon immunization. The small number of naive BCR-ABL-specific T cells was due to negative selection in the thymus, which depleted BCR-ABL-specific T cells. Consistent with this observation, we saw that BCR-ABL-specific T cells were cross-reactive with an endogenous peptide derived from ABL. Despite this cross-reactivity, the remaining population of BCR-ABL reactive T cells proliferated upon immunization with the BCR-ABL fusion peptide and adjuvant. In response to BCR-ABL(+) leukemia, BCR-ABL-specific T cells proliferated and converted into regulatory T (Treg) cells, a process that was dependent on cross-reactivity with self-antigen, TGF-β1, and MHC class II Ag presentation by leukemic cells. Treg cells were critical for leukemia progression in C57BL/6 mice, as transient Treg cell ablation led to extended survival of leukemic mice. Thus, BCR-ABL(+) leukemia actively suppresses antileukemia immune responses by converting cross-reactive leukemia-specific T cells into Treg cells. Copyright © 2015 by The American Association of Immunologists, Inc.

  20. Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection.

    Science.gov (United States)

    Zhang, Jie; Liu, Huan; Wei, Bin

    Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibit