
Sample records for inducible brassica napus

  1. Different myrosinase and idioblast distribution in Arabidopsis and Brassica napus

    DEFF Research Database (Denmark)

    Andreasson, Erik; Jørgensen, Lise Bolt; Höglund, Anna-Stina


    Arabidopsis, Brassica napus, Myrosinase, Myrosinase Binding Protein, Glucosinolates, Myrosin Cell, Immunocytochemistry......Arabidopsis, Brassica napus, Myrosinase, Myrosinase Binding Protein, Glucosinolates, Myrosin Cell, Immunocytochemistry...

  2. Isolation of an ascorbate peroxidase in Brassica napus and analysis ...

    African Journals Online (AJOL)



    Apr 5, 2010 ... domain; APX, ascorbate peroxidase; Bn-APX, Brassica napus ascorbate ... Brassica napus, which is widely grown as the oilseed crop of rape or canola, .... grew on the SD-Leu-Trp-His-Ade medium and were verified by PCR.

  3. Mechanism of Salt-Induced Self-Compatibility Dissected by Comparative Proteomic Analysis in Brassica napus L. (United States)

    Yang, Yong; Liu, Zhiquan; Zhang, Tong; Zhou, Guilong; Duan, Zhiqiang; Li, Bing; Dou, Shengwei; Liang, Xiaomei; Tu, Jinxing; Shen, Jinxiong; Yi, Bin; Fu, Tingdong; Dai, Cheng; Ma, Chaozhi


    Self-incompatibility (SI) in plants genetically prevents self-fertilization to promote outcrossing and genetic diversity. Its hybrids in Brassica have been widely cultivated due to the propagation of SI lines by spraying a salt solution. We demonstrated that suppression of Brassica napus SI from edible salt solution treatment was ascribed to sodium chloride and independent of S haplotypes, but it did not obviously change the expression of SI - related genes. Using the isobaric tags for relative and absolute quantitation (iTRAQ) technique, we identified 885 differentially accumulated proteins (DAPs) in Brassica napus stigmas of un-pollinated (UP), pollinated with compatible pollen (PC), pollinated with incompatible pollen (PI), and pollinated with incompatible pollen after edible salt solution treatment (NA). Of the 307 DAPs in NA/UP, 134 were unique and 94 were shared only with PC/UP. In PC and NA, some salt stress protein species, such as glyoxalase I , were induced, and these protein species were likely to participate in the self-compatibility (SC) pathway. Most of the identified protein species were related to metabolic pathways, biosynthesis of secondary metabolites, ribosome, and so on. A systematic analysis implied that salt treatment-overcoming SI in B. napus was likely conferred by at least five different physiological mechanisms: (i) the use of Ca 2+ as signal molecule; (ii) loosening of the cell wall to allow pollen tube penetration; (iii) synthesis of compatibility factor protein species for pollen tube growth; (iv) depolymerization of microtubule networks to facilitate pollen tube movement; and (v) inhibition of protein degradation pathways to restrain the SI response.

  4. Phenotyping of Brassica napus for high oil content (United States)

    Multi-trait and multi-growth stage phenotyping may improve our ability to assess the dynamic changes in the B. napus phenome under spatiotemporal field conditions. A minimum set of phenotypic traits that can integrate ontogeny and architecture of Brassica napus L. is required for breeding and select...

  5. Cytological and morphological analysis of hybrids between Brassicoraphanus, and Brassica napus for introgression of clubroot resistant trait into Brassica napus L. (United States)

    Zhan, Zongxiang; Nwafor, Chinedu Charles; Hou, Zhaoke; Gong, Jianfang; Zhu, Bin; Jiang, Yingfen; Zhou, Yongming; Wu, Jiangsheng; Piao, Zhongyun; Tong, Yue; Liu, Chao; Zhang, Chunyu


    Interspecific hybridization is a powerful tool for improvement of crop species, it has the potential to broaden the genetic base and create new plant forms for breeding programs. Synthetic allopolyploid is a widely-used model for the study of genetic recombination and fixed heterosis in Brassica. In Brassica napus breeding, identification and introgression of new sources of clubroot resistance trait from wild or related species into it by hybridization is a long-term crop management strategy for clubroot disease. Radish (Raphanus sativus L.) is a close relative of the Brassica and most radish accessions are immune to the clubroot disease. A synthesized allotetraploid Brassicoraphanus (RRCC, 2n = 36) between R. sativus cv. HQ-04 (2n = 18, RR) and Brassica oleracea var. alboglabra (L.H Bailey) (2n = 18, CC) proved resistant of multiple clubroot disease pathogen P. brassicae. To predict the possibility to transfer the clubroot resistance trait from the RR subgenome of allotetraploid Brassicoraphanus (RRCC, 2n = 36) into Brassica napus (AACC, 2n = 38), we analyzed the frequency of chromosome pairings in the F1 hybrids produced from a cross between B. napus cv. HS5 and the allotetraploid, characterize the genomic composition of some backcrossed progeny (BC1) using GISH, BAC-FISH and AFLP techniques. The level of intergenomic pairing between A and R genomes in the F1 hybrid was high, allosyndetic bivalents formed in 73.53% PMCs indicative of significant level of homeologous recombination between two genomes and high probability of incorporating chromosomal segments/genes from R-genome into A/C-genomes. The BC1 plants inherited variant extra R chromosomes or fragments from allotetraploid as revealed by GISH and AFLP analysis. 13.51% BC2 individuals were resistant to clubroot disease, and several resistance lines had high pollen fertility, Overall, the genetic material presented in this work represents a potential new genetic resource for practical use in breeding B. napus

  6. Involvement of phospholipases C and D in early response to SAR and ISR inducers in Brassica napus plants

    Czech Academy of Sciences Publication Activity Database

    Profotová, Bronislava; Burketová, Lenka; Novotná, Z.; Martinec, Jan; Valentová, O.


    Roč. 44, 2-3 (2006), s. 143-151 ISSN 0981-9428 R&D Projects: GA ČR GA522/03/0353 Institutional research plan: CEZ:AV0Z50380511 Keywords : Brassica napus * Induced resistance * Phospholipase C and D Subject RIV: CE - Biochemistry Impact factor: 1.847, year: 2006

  7. Phosphate-assisted phytoremediation of arsenic by Brassica napus and Brassica juncea: Morphological and physiological response. (United States)

    Niazi, Nabeel Khan; Bibi, Irshad; Fatimah, Ayesha; Shahid, Muhammad; Javed, Muhammad Tariq; Wang, Hailong; Ok, Yong Sik; Bashir, Safdar; Murtaza, Behzad; Saqib, Zulfiqar Ahmad; Shakoor, Muhammad Bilal


    In this study, we examined the potential role of phosphate (P; 0, 50, 100 mg kg -1 ) on growth, gas exchange attributes, and photosynthetic pigments of Brassica napus and Brassica juncea under arsenic (As) stress (0, 25, 50, 75 mg kg -1 ) in a pot experiment. Results revealed that phosphate supplementation (P100) to As-stressed plants significantly increased shoot As concentration, dry biomass yield, and As uptake, in addition to the improved morphological and gas exchange attributes and photosynthetic pigments over P0. However, phosphate-assisted increase in As uptake was substantially (up to two times) greater for B. napus, notably due to higher shoot As concentration and dry biomass yield, compared to B. juncea at the P100 level. While phosphate addition in soil (P100) led to enhanced shoot As concentration in B. juncea, it reduced shoot dry biomass, primarily after 50 and 75 mg kg -1 As treatments. The translocation factor and bioconcentration factor values of B. napus were higher than B. juncea for all As levels in the presence of phosphate. This study demonstrates that phosphate supplementation has a potential to improve As phytoextraction efficiency, predominantly for B. napus, by minimizing As-induced damage to plant growth, as well as by improving the physiological and photosynthetic attributes.

  8. Cloning and characterization of a pathogen-induced chitinase in Brassica napus

    DEFF Research Database (Denmark)

    Rasmussen, U.; Bojsen, K.; Collinge, D.B.


    A chitinase cDNA clone from rapeseed (Brassica napus L. ssp. oleifera) was isolated. The cDNA clone, ChB4, represents a previously purified and characterized basic chitinase isozyme. The longest open reading frame in ChB4 encodes a polypeptide of 268 amino acids. This polypeptide consists of a 24...

  9. Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus

    Directory of Open Access Journals (Sweden)

    Ting Xiang Neik


    Full Text Available Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae, Blackleg (Leptosphaeria maculans and L. biglobosa, Sclerotinia Stem Rot (Sclerotinia sclerotiorum, and Downy Mildew (Hyaloperonospora parasitica. We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus.

  10. Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus (United States)

    Neik, Ting Xiang; Barbetti, Martin J.; Batley, Jacqueline


    Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R) genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae), Blackleg (Leptosphaeria maculans and L. biglobosa), Sclerotinia Stem Rot (Sclerotinia sclerotiorum), and Downy Mildew (Hyaloperonospora parasitica). We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus. PMID:29163558

  11. Inheritance of oilseed rape (Brassica napus) RAPD markers in a backcross progeny with Brassica campestris

    DEFF Research Database (Denmark)

    Mikkelsen, T.R.; Jensen, J.; Bagger Jørgensen, Rikke


    Different cultivars/transgenic lines of oilseed rape (Brassica napus) were crossed (as females) with different cultivars/populations of Brassica campestris. All cross combinations produced seed, with an average seed set per pollination of 9.8. Backcrossing of selected interspecific hybrids (as...... females) to B. campestris resulted in a much lower seed set, average 0.7 seed per pollination. In the single backcross progeny where a large enough population (92 plants) was obtained for analysis, 33 B. napus specific RAPD markers were investigated to determine the extent of transfer of oilseed rape...

  12. NAPUS 2000 Rapeseed (Brassica napus breeding for improved human nutrition

    Directory of Open Access Journals (Sweden)

    Friedt Wolfgang


    Full Text Available Following a competition announcement of the Federal Ministry of Research and Education (BMBF a project dealing with the improvement of the nutritional value of oilseed rape (Brassica napus for food applications and human nutrition was worked out and started in autumn 1999. A number of partners (Figure 2 are carrying out a complex project reaching from the discovery, characterisation, isolation and transfer of genes of interest up to breeding of well performing varieties combined with important agronomic traits. Economic studies and processing trials as well as nutritional investigations of the new qualities are undertaken. B. napus seed quality aspects with respect to seed coat colour, oil composition, lecithin and protein fractions and antioxidants like tocopherols and resveratrol will be improved.

  13. Cloning and expression study of BnaLCR78 in Brassica napus

    International Nuclear Information System (INIS)

    Zhuang, L.; Ze, L. Y.; Cheng, W. Y.


    BnaLCR78 genes of three types of rape were cloned in rape (Brassica napus), and encoded protein structure was analyzed, the Results showed that the protein had a conserved coding domain which was analogues among LCR family of Arabidopsis. The expression patterns of genes of three types of rape in varying tissues and in specific same tissues were analyzed using quantitative method. The Results showed that their expression patterns differ from that of former research in Brassica napus, which may result from the difference of sampling time. We speculated that the gene might be involved in transpiration and transportation and distribution of nutrient, oil content in seed. (author)

  14. Citric acid improves lead (pb) phytoextraction in brassica napus L. by mitigating pb-induced morphological and biochemical damages. (United States)

    Shakoor, Muhammad Bilal; Ali, Shafaqat; Hameed, Amjad; Farid, Mujahid; Hussain, Sabir; Yasmeen, Tahira; Najeeb, Ullah; Bharwana, Saima Aslam; Abbasi, Ghulam Hasan


    Phytoextraction is an environmentally friendly and a cost-effective strategy for remediation of heavy metal contaminated soils. However, lower bioavailability of some of the metals in polluted environments e.g. lead (Pb) is a major constraint of phytoextraction process that could be overcome by applying organic chelators. We conducted a glasshouse experiment to evaluate the role of citric acid (CA) in enhancing Pb phytoextraction. Brassica napus L. seedlings were grown in hydroponic media and exposed to various treatments of Pb (50 and 100 μM) as alone or in combination with CA (2.5mM) for six weeks. Pb-induced damage in B. napus toxicity was evident from elevated levels of malondialdehyde (MDA) and H2O2 that significantly inhibited plant growth, biomass accumulation, leaf chlorophyll contents and gas exchange parameters. Alternatively, CA application to Pb-stressed B. napus plants arrested lipid membrane damage by limiting MDA and H2O2 production and by improving antioxidant enzyme activities. In addition, CA significantly increased the Pb accumulation in B. napus plants. The study concludes that CA has a potential to improve Pb phytoextraction without damaging plant growth. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Immunopurification and characterization of a rape ( Brassica napus L.)

    African Journals Online (AJOL)

    Lipase or triacylglycerol acylhydrolase (E.C. was purified to homogeneity from rapeseed-germinated cotyledons (Brassica napus L.). The purification scheme involved homogenization, centrifugation, ultracentrifugation and affinity chromatography using polyclonal antibodies raised against porcine pancreatic lipase.

  16. Functional analysis and tissue-differential expression of four FAD2 genes in amphidiploid Brassica napus derived from Brassica rapa and Brassica oleracea. (United States)

    Lee, Kyeong-Ryeol; In Sohn, Soo; Jung, Jin Hee; Kim, Sun Hee; Roh, Kyung Hee; Kim, Jong-Bum; Suh, Mi Chung; Kim, Hyun Uk


    Fatty acid desaturase 2 (FAD2), which resides in the endoplasmic reticulum (ER), plays a crucial role in producing linoleic acid (18:2) through catalyzing the desaturation of oleic acid (18:1) by double bond formation at the delta 12 position. FAD2 catalyzes the first step needed for the production of polyunsaturated fatty acids found in the glycerolipids of cell membranes and the triacylglycerols in seeds. In this study, four FAD2 genes from amphidiploid Brassica napus genome were isolated by PCR amplification, with their enzymatic functions predicted by sequence analysis of the cDNAs. Fatty acid analysis of budding yeast transformed with each of the FAD2 genes showed that whereas BnFAD2-1, BnFAD2-2, and BnFAD2-4 are functional enzymes, and BnFAD2-3 is nonfunctional. The four FAD2 genes of B. napus originated from synthetic hybridization of its diploid progenitors Brassica rapa and Brassica oleracea, each of which has two FAD2 genes identical to those of B. napus. The BnFAD2-3 gene of B. napus, a nonfunctional pseudogene mutated by multiple nucleotide deletions and insertions, was inherited from B. rapa. All BnFAD2 isozymes except BnFAD2-3 localized to the ER. Nonfunctional BnFAD2-3 localized to the nucleus and chloroplasts. Four BnFAD2 genes can be classified on the basis of their expression patterns. © 2013.

  17. Induction and purification of chitinase in Brassica napus L. ssp. oleifera infected with Phoma lingam

    DEFF Research Database (Denmark)

    Rasmussen, U.; Giese, H.; Dalgaard Mikkelsen, J.


    A pathogen-induced chitinase (EC was isolated from cotyledons of oilseed rape (Brassica napus cv. Bienvenu) 8 d after inoculation with Phoma lingam. The purified chitinase has a molecular weight of 30 kDa, and an isoelectric point of approx. 9.1. A partial amino-acid sequence obtained a...

  18. Factors affecting the density of Brassica napus seeds

    NARCIS (Netherlands)

    Young, L.; Jalink, H.; Denkert, R.; Reaney, M.


    Brassica napus seed is composed of low density oil (0.92 and higher density solids (1.3-1.45 Seed buoyant density may potentially be used to determine seed oil content and to separate seeds with different oil contents, however, we have found that seeds with the lowest buoyant

  19. Chromosomal aberration induced by gamma rays in winter rape (Brassica napus L.)

    International Nuclear Information System (INIS)

    Luczkiewicz, T.; Rogalska, S.M.


    Winter rape seeds (Brassica napus L. cv. Jet Neuf) were irradiated twice with gamma rays. In γ 1-2 generation (dose 50.0 kR) plants with reduced fertility were selected. Offspring of these plants, in the following generations, were segregated into fertile plants, partly fertile and sterile plants. Analysis of meiosis in PCM revealed presence of a great number of cells (in prophase 1. and metaphase 1.) with crosses, rings and chains of multivalents. It is a proof of vast heterozygous translocation. (author)

  20. Molecular phylogenetic implications in Brassica napus based on ...

    Indian Academy of Sciences (India)

    Brassica napus L. (canola, rapeseed) is one of the most important oil crops in many countries (Abdelmigid 2012;. Fayyaz et al. 2014), and thought to have originated from a cross where the maternal donor was closely related to two diploid species, B. oleracea (CC, 2n = 18) and B. rapa (AA, 2n = 20). Here, molecular ...

  1. Citric acid assisted phytoremediation of copper by Brassica napus L. (United States)

    Zaheer, Ihsan Elahi; Ali, Shafaqat; Rizwan, Muhammad; Farid, Mujahid; Shakoor, Muhammad Bilal; Gill, Rafaqa Ali; Najeeb, Ullah; Iqbal, Naeem; Ahmad, Rehan


    Use of organic acids for promoting heavy metals phytoextraction is gaining worldwide attention. The present study investigated the influence of citric acid (CA) in enhancing copper (Cu) uptake by Brassica napus L. seedlings. 6 Weeks old B. napus seedlings were exposed to different levels of copper (Cu, 0, 50 and 100µM) alone or with CA (2.5mM) in a nutrient medium for 40 days. Exposure to elevated Cu levels (50 and 100µM) significantly reduced the growth, biomass production, chlorophyll content, gas exchange attributes and soluble proteins of B. napus seedlings. In addition, Cu toxicity increased the production of hydrogen peroxide (H2O2), malondialdehyde (MDA) and electrolyte leakage (EL) in leaf and root tissues of B. napus. Activities of antioxidant enzymes such as guaiacol peroxidase (POD), superoxide dismutase (SOD), catalases (CAT), ascorbate peroxidase (APX) in root and shoot tissues of B. napus were increased in response to lower Cu concentration (50µM) but increased under higher Cu concentration (100µM). Addition of CA into nutrient medium significantly alleviated Cu toxicity effects on B. napus seedlings by improving photosynthetic capacity and ultimately plant growth. Increased activities of antioxidant enzymes in CA-treated plants seems to play a role in capturing of stress-induced reactive oxygen species as was evident from lower level of H2O2, MDA and EL in CA-treated plants. Increasing Cu concentration in the nutrient medium significantly increased Cu concentration in in B. napus tissues. Cu uptake was further increased by CA application. These results suggested that CA might be a useful strategy for increasing phytoextraction of Cu from contaminated soils. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. High-throughput multiplex cpDNA resequencing clarifies the genetic diversity and genetic relationships among Brassica napus, Brassica rapa and Brassica oleracea. (United States)

    Qiao, Jiangwei; Cai, Mengxian; Yan, Guixin; Wang, Nian; Li, Feng; Chen, Binyun; Gao, Guizhen; Xu, Kun; Li, Jun; Wu, Xiaoming


    Brassica napus (rapeseed) is a recent allotetraploid plant and the second most important oilseed crop worldwide. The origin of B. napus and the genetic relationships with its diploid ancestor species remain largely unresolved. Here, chloroplast DNA (cpDNA) from 488 B. napus accessions of global origin, 139 B. rapa accessions and 49 B. oleracea accessions were populationally resequenced using Illumina Solexa sequencing technologies. The intraspecific cpDNA variants and their allelic frequencies were called genomewide and further validated via EcoTILLING analyses of the rpo region. The cpDNA of the current global B. napus population comprises more than 400 variants (SNPs and short InDels) and maintains one predominant haplotype (Bncp1). Whole-genome resequencing of the cpDNA of Bncp1 haplotype eliminated its direct inheritance from any accession of the B. rapa or B. oleracea species. The distribution of the polymorphism information content (PIC) values for each variant demonstrated that B. napus has much lower cpDNA diversity than B. rapa; however, a vast majority of the wild and cultivated B. oleracea specimens appeared to share one same distinct cpDNA haplotype, in contrast to its wild C-genome relatives. This finding suggests that the cpDNA of the three Brassica species is well differentiated. The predominant B. napus cpDNA haplotype may have originated from uninvestigated relatives or from interactions between cpDNA mutations and natural/artificial selection during speciation and evolution. These exhaustive data on variation in cpDNA would provide fundamental data for research on cpDNA and chloroplasts. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  3. Cadmium uptake potential of Brassica napus cocropped with Brassica parachinensis and Zea mays

    Energy Technology Data Exchange (ETDEWEB)

    Selvam, Ammaiyappan [Sino-Forest Applied Research Centre for Pearl River Delta Environment, Department of Biology, Hong Kong Baptist University, Hong Kong, (Hong Kong); Wong, Jonathan Woon-Chung, E-mail: [Sino-Forest Applied Research Centre for Pearl River Delta Environment, Department of Biology, Hong Kong Baptist University, Hong Kong (Hong Kong)


    Cadmium uptake potential of Brassica napus cocropped with B. parachinensis or Zea mays plants in split pot (allow the solutes to pass but prevent the interaction of roots between compartments) experiments was evaluated. Plants were grown in split pots filled with soil spiked at 0, 3, 6, 12, 25 and 50 mg Cd/kg soil. Biomass and Cd uptake were detemined after 6 weeks, and rhizospheric soil solutions, extracted using soil probes, were analyzed for pH and water soluble Cd at weekly intervals. Cadmium treatments affected the biomass. Cadmium concentration in the shoots of B. napus was higher when cocropped with B. parachinensis and significantly higher with Z. mays; however, the biomass was negatively affected implying the higher nutrient apportionment to the crop plants than B. napus. Concentration of Cd in B. napus was higher in shoots than in roots as revealed by shoot/root Cd quotient and was always >1; the quotient for B. parachinensis was {approx}1 and that of Z. mays was <1, indicating the potential of Brassicaceae members to translocate the Cd to aboveground tissue. Results indicate the feasibility of cocropping method to clean the Cd contaminated soils.

  4. Cadmium uptake potential of Brassica napus cocropped with Brassica parachinensis and Zea mays

    International Nuclear Information System (INIS)

    Selvam, Ammaiyappan; Wong, Jonathan Woon-Chung


    Cadmium uptake potential of Brassica napus cocropped with B. parachinensis or Zea mays plants in split pot (allow the solutes to pass but prevent the interaction of roots between compartments) experiments was evaluated. Plants were grown in split pots filled with soil spiked at 0, 3, 6, 12, 25 and 50 mg Cd/kg soil. Biomass and Cd uptake were detemined after 6 weeks, and rhizospheric soil solutions, extracted using soil probes, were analyzed for pH and water soluble Cd at weekly intervals. Cadmium treatments affected the biomass. Cadmium concentration in the shoots of B. napus was higher when cocropped with B. parachinensis and significantly higher with Z. mays; however, the biomass was negatively affected implying the higher nutrient apportionment to the crop plants than B. napus. Concentration of Cd in B. napus was higher in shoots than in roots as revealed by shoot/root Cd quotient and was always >1; the quotient for B. parachinensis was ∼1 and that of Z. mays was <1, indicating the potential of Brassicaceae members to translocate the Cd to aboveground tissue. Results indicate the feasibility of cocropping method to clean the Cd contaminated soils.

  5. Effects of plant densities on yield, yield components and some morphological characters of two cultivators of oilseed rape (Brassica napus L.)

    DEFF Research Database (Denmark)

    Al-Barzinjy, M.; Stölen, O.; Christiansen, Jørgen Lindskrog


    Effects of Plant Densities on Yield, Yield Components and some Morphological Characters of two Cultivators of Oilseed Rape (Brassica napus L.)......Effects of Plant Densities on Yield, Yield Components and some Morphological Characters of two Cultivators of Oilseed Rape (Brassica napus L.)...

  6. Molecular regulation and genetic improvement of seed oil content in Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Wei HUA,Jing LIU,Hanzhong WANG


    Full Text Available As an important oil crop and a potential bioenergy crop, Brassica napus L. is becoming a model plant for basic research on seed lipid biosynthesis as well as seed oil content, which has always been the key breeding objective. In this review, we present current progress in understanding of the regulation of oil content in B. napus, including genetics, biosynthesis pathway, transcriptional regulation, maternal effects and QTL analysis. Furthermore, the history of breeding for high oil content in B. napus is summarized and the progress in breeding ultra-high oil content lines is described. Finally, prospects for breeding high oil content B. napus cultivars are outlined.

  7. Phytoextraction with Brassica napus L.: A tool for sustainable management of heavy metal contaminated soils.

    NARCIS (Netherlands)

    Grispen, V.M.J.; Nelissen, H.J.M.; Verkleij, J.A.C.


    Phytoextraction is a promising tool to extract metals from contaminated soils and Brassica napus L. seems to be a possible candidate species for this purpose. To select accessions with the ability to accumulate cadmium, hydroponically grown 21 day old seedlings of 77 B. napus L. accessions were

  8. Integration of linkage maps for the Amphidiploid Brassica napus and comparative mapping with Arabidopsis and Brassica rapa

    Directory of Open Access Journals (Sweden)

    Delourme Régine


    Full Text Available Abstract Background The large number of genetic linkage maps representing Brassica chromosomes constitute a potential platform for studying crop traits and genome evolution within Brassicaceae. However, the alignment of existing maps remains a major challenge. The integration of these genetic maps will enhance genetic resolution, and provide a means to navigate between sequence-tagged loci, and with contiguous genome sequences as these become available. Results We report the first genome-wide integration of Brassica maps based on an automated pipeline which involved collation of genome-wide genotype data for sequence-tagged markers scored on three extensively used amphidiploid Brassica napus (2n = 38 populations. Representative markers were selected from consolidated maps for each population, and skeleton bin maps were generated. The skeleton maps for the three populations were then combined to generate an integrated map for each LG, comparing two different approaches, one encapsulated in JoinMap and the other in MergeMap. The BnaWAIT_01_2010a integrated genetic map was generated using JoinMap, and includes 5,162 genetic markers mapped onto 2,196 loci, with a total genetic length of 1,792 cM. The map density of one locus every 0.82 cM, corresponding to 515 Kbp, increases by at least three-fold the locus and marker density within the original maps. Within the B. napus integrated map we identified 103 conserved collinearity blocks relative to Arabidopsis, including five previously unreported blocks. The BnaWAIT_01_2010a map was used to investigate the integrity and conservation of order proposed for genome sequence scaffolds generated from the constituent A genome of Brassica rapa. Conclusions Our results provide a comprehensive genetic integration of the B. napus genome from a range of sources, which we anticipate will provide valuable information for rapeseed and Canola research.

  9. Preliminary study of Tl and Cd uptake in the heavy metal accumulating Brassica napus using the Debrecen proton microprobe

    International Nuclear Information System (INIS)

    Kertesz, Zs.; Haag-Kerwer, A.; Povh, B.


    The high biomass producing crop plants, Brassica juncea L. and Brassica napus are very promising plant species for phytoremediation. The aim of further research is to help a better understanding of the transport mechanism within roots and roots to shoots of heavy metals, and to find out their distribution and translocation among different cell types in the root of these species. The distribution and concentration of major and trace elements was determined along the roots of Cd and Tl treated as well as control plants of Brassica napus on the ATOMKI proton microprobe. (R.P.)

  10. Impact of biogenic terpene emissions from Brassica napus on tropospheric ozone over Saxony (Germany): numerical investigation. (United States)

    Renner, Eberhard; Münzenberg, Annette


    The role of biogenic emissions in tropospheric ozone production is currently under discussion and major aspects are not well understood yet. This study aims towards the estimation of the influence of biogenic emissions on tropospheric ozone concentrations over Saxony in general and of biogenic emissions from brassica napus in special. MODELLING TOOLS: The studies are performed by utilizing a coupled numerical modelling system consisting of the meteorological model METRAS and the chemistry transport model MUSCAT. For the chemical part, the Euro-RADM algorithm is used. EMISSIONS: Anthropogenic and biogenic emissions are taken into account. The anthropogenic emissions are introduced by an emission inventory. Biogenic emissions, VOC and NO, are calculated within the chemical transport model MUSCAT at each time step and in each grid cell depending on land use type and on the temperature. The emissions of hydrocarbons from forest areas as well as biogenic NO especially from agricultural grounds are considered. Also terpene emissions from brassica napus fields are estimated. SIMULATION SETUP AND METEOROLOGICAL CONDITIONS: The simulations were performed over an area with an extension of 160 x 140 km2 which covers the main parts of Saxony and neighboring areas of Brandenburg, Sachsen-Anhalt and Thuringia. Summer smog with high ozone concentrations can be expected during high pressure conditions on hot summer days. Typical meteorological conditions for such cases were introduced in an conceptual way. It is estimated that biogenic emissions change tropospheric ozone concentrations in a noticeable way (up to 15% to 20%) and, therefore, should not be neglected in studies about tropospheric ozone. Emissions from brassica napus do have a moderate potential to enhance tropospheric ozone concentrations, but emissions are still under consideration and, therefore, results vary to a high degree. Summing up, the effect of brassica napus terpene emissions on ozone concentrations is

  11. Genome-Wide Identification and Expression Analysis of WRKY Transcription Factors under Multiple Stresses in Brassica napus. (United States)

    He, Yajun; Mao, Shaoshuai; Gao, Yulong; Zhu, Liying; Wu, Daoming; Cui, Yixin; Li, Jiana; Qian, Wei


    WRKY transcription factors play important roles in responses to environmental stress stimuli. Using a genome-wide domain analysis, we identified 287 WRKY genes with 343 WRKY domains in the sequenced genome of Brassica napus, 139 in the A sub-genome and 148 in the C sub-genome. These genes were classified into eight groups based on phylogenetic analysis. In the 343 WRKY domains, a total of 26 members showed divergence in the WRKY domain, and 21 belonged to group I. This finding suggested that WRKY genes in group I are more active and variable compared with genes in other groups. Using genome-wide identification and analysis of the WRKY gene family in Brassica napus, we observed genome duplication, chromosomal/segmental duplications and tandem duplication. All of these duplications contributed to the expansion of the WRKY gene family. The duplicate segments that were detected indicated that genome duplication events occurred in the two diploid progenitors B. rapa and B. olearecea before they combined to form B. napus. Analysis of the public microarray database and EST database for B. napus indicated that 74 WRKY genes were induced or preferentially expressed under stress conditions. According to the public QTL data, we identified 77 WRKY genes in 31 QTL regions related to various stress tolerance. We further evaluated the expression of 26 BnaWRKY genes under multiple stresses by qRT-PCR. Most of the genes were induced by low temperature, salinity and drought stress, indicating that the WRKYs play important roles in B. napus stress responses. Further, three BnaWRKY genes were strongly responsive to the three multiple stresses simultaneously, which suggests that these 3 WRKY may have multi-functional roles in stress tolerance and can potentially be used in breeding new rapeseed cultivars. We also found six tandem repeat pairs exhibiting similar expression profiles under the various stress conditions, and three pairs were mapped in the stress related QTL regions

  12. Genome-Wide Identification and Expression Analysis of WRKY Transcription Factors under Multiple Stresses in Brassica napus.

    Directory of Open Access Journals (Sweden)

    Yajun He

    Full Text Available WRKY transcription factors play important roles in responses to environmental stress stimuli. Using a genome-wide domain analysis, we identified 287 WRKY genes with 343 WRKY domains in the sequenced genome of Brassica napus, 139 in the A sub-genome and 148 in the C sub-genome. These genes were classified into eight groups based on phylogenetic analysis. In the 343 WRKY domains, a total of 26 members showed divergence in the WRKY domain, and 21 belonged to group I. This finding suggested that WRKY genes in group I are more active and variable compared with genes in other groups. Using genome-wide identification and analysis of the WRKY gene family in Brassica napus, we observed genome duplication, chromosomal/segmental duplications and tandem duplication. All of these duplications contributed to the expansion of the WRKY gene family. The duplicate segments that were detected indicated that genome duplication events occurred in the two diploid progenitors B. rapa and B. olearecea before they combined to form B. napus. Analysis of the public microarray database and EST database for B. napus indicated that 74 WRKY genes were induced or preferentially expressed under stress conditions. According to the public QTL data, we identified 77 WRKY genes in 31 QTL regions related to various stress tolerance. We further evaluated the expression of 26 BnaWRKY genes under multiple stresses by qRT-PCR. Most of the genes were induced by low temperature, salinity and drought stress, indicating that the WRKYs play important roles in B. napus stress responses. Further, three BnaWRKY genes were strongly responsive to the three multiple stresses simultaneously, which suggests that these 3 WRKY may have multi-functional roles in stress tolerance and can potentially be used in breeding new rapeseed cultivars. We also found six tandem repeat pairs exhibiting similar expression profiles under the various stress conditions, and three pairs were mapped in the stress related

  13. Multiple Evolutionary Events Involved in Maintaining Homologs of Resistance to Powdery Mildew 8 in Brassica napus. (United States)

    Li, Qin; Li, Jing; Sun, Jin-Long; Ma, Xian-Feng; Wang, Ting-Ting; Berkey, Robert; Yang, Hui; Niu, Ying-Ze; Fan, Jing; Li, Yan; Xiao, Shunyuan; Wang, Wen-Ming


    The Resistance to Powdery Mildew 8 (RPW8) locus confers broad-spectrum resistance to powdery mildew in Arabidopsis thaliana. There are four Homologous to RPW8s (BrHRs) in Brassica rapa and three in Brassica oleracea (BoHRs). Brassica napus (Bn) is derived from diploidization of a hybrid between B. rapa and B. oleracea, thus should have seven homologs of RPW8 (BnHRs). It is unclear whether these genes are still maintained or lost in B. napus after diploidization and how they might have been evolved. Here, we reported the identification and sequence polymorphisms of BnHRs from a set of B. napus accessions. Our data indicated that while the BoHR copy from B. oleracea is highly conserved, the BrHR copy from B. rapa is relatively variable in the B. napus genome owing to multiple evolutionary events, such as gene loss, point mutation, insertion, deletion, and intragenic recombination. Given the overall high sequence homology of BnHR genes, it is not surprising that both intragenic recombination between two orthologs and two paralogs were detected in B. napus, which may explain the loss of BoHR genes in some B. napus accessions. When ectopically expressed in Arabidopsis, a C-terminally truncated version of BnHRa and BnHRb, as well as the full length BnHRd fused with YFP at their C-termini could trigger cell death in the absence of pathogens and enhanced resistance to powdery mildew disease. Moreover, subcellular localization analysis showed that both BnHRa-YFP and BnHRb-YFP were mainly localized to the extra-haustorial membrane encasing the haustorium of powdery mildew. Taken together, our data suggest that the duplicated BnHR genes might have been subjected to differential selection and at least some may play a role in defense and could serve as resistance resource in engineering disease-resistant plants.

  14. Agronomic performance of rape seed (brassica napus L.) mutant lines under drought conditions

    International Nuclear Information System (INIS)

    Shah, S.A.; Ali, I.; Shah, S.J.A.; Rehman, K.; Rashid, A.


    Oil seed forms of Brassica napus are not well adapted to drought and the warner environments of Pakistan. Induced mutations were, therefore, utilized for improving drought tolerance efficiency of two napus cultivars. Induction of genetic variability, selection of desirable mutants and stabilization of mutants in acceptable agronomic background were carried out during 1988-1991. Fourteen promising mutants each of cv. Pak-cheen and Tower were evaluated for different agronomic characters in separate yield trials, under extremely drought conditions. The results demonstrated that yield potential of some mutants was very high and 9 mutants of cv. Pak-cheen and 8 mutants of cv. Tower significantly (P<0.05) out yield the local commercial cultivar. Eleven mutants in both the trials matured significantly earlier than the check. Nevertheless, more extensive testing of the drought tolerant lines under diversified environs of the country will help confirm these findings. (author)

  15. miR395 is involved in detoxification of cadmium in Brassica napus

    International Nuclear Information System (INIS)

    Zhang, Liu Wei; Song, Jian Bo; Shu, Xia Xia; Zhang, Yun; Yang, Zhi Min


    Highlights: ► Involvement of miR395 in sulfate uptake and assimilation in B. napus. ► miR395 regulation of Cd accumulation and distribution in B. napus. ► Depression of Cd-induced oxidative stress by miR395. -- Abstract: The toxic metal cadmium (Cd) constitutes one of the major inorganic contaminants in environments. microRNAs (miRNAs) are a class of endogenous non-coding small RNAs. miR395 is conserved and regulates sulfate assimilation and distribution in higher plants, but whether it is involved in detoxification of Cd in plants has not been described. In this study, transgenic rapeseed (Brassica napus) over-expressing miR395 was identified under Cd stress. miR395-over-expressing plants showed a lower degree of Cd-induced oxidative stress than wild type. By contrast, chlorophyll, glutathione and non-protein thiols contents were higher in the transformants than wild type. Determination of growth response showed that 35S::MIR395 plants accumulated higher levels of biomass and sulfur than wild type under Cd exposure. miR395 transgenic plants had higher levels of Cd in plants, particularly at the high supply of Cd in the medium, but they tended to repress Cd translocation from roots to shoots. Simultaneously, expression of metal-tolerance genes such as BnPCS1, BnHO1 and Sultr1;1 was up-regulated under Cd stress, and the expression of the genes was more pronounced in 35S::MIR395 plants than in wild type. These results suggest that miR395 would be involved in detoxification of Cd in B. napus

  16. miR395 is involved in detoxification of cadmium in Brassica napus

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Liu Wei; Song, Jian Bo; Shu, Xia Xia; Zhang, Yun [Department of Biochemistry and Molecular Biology, College of Life Science, Nanjing Agricultural University, Nanjing 210095 (China); Yang, Zhi Min, E-mail: [Department of Biochemistry and Molecular Biology, College of Life Science, Nanjing Agricultural University, Nanjing 210095 (China)


    Highlights: ► Involvement of miR395 in sulfate uptake and assimilation in B. napus. ► miR395 regulation of Cd accumulation and distribution in B. napus. ► Depression of Cd-induced oxidative stress by miR395. -- Abstract: The toxic metal cadmium (Cd) constitutes one of the major inorganic contaminants in environments. microRNAs (miRNAs) are a class of endogenous non-coding small RNAs. miR395 is conserved and regulates sulfate assimilation and distribution in higher plants, but whether it is involved in detoxification of Cd in plants has not been described. In this study, transgenic rapeseed (Brassica napus) over-expressing miR395 was identified under Cd stress. miR395-over-expressing plants showed a lower degree of Cd-induced oxidative stress than wild type. By contrast, chlorophyll, glutathione and non-protein thiols contents were higher in the transformants than wild type. Determination of growth response showed that 35S::MIR395 plants accumulated higher levels of biomass and sulfur than wild type under Cd exposure. miR395 transgenic plants had higher levels of Cd in plants, particularly at the high supply of Cd in the medium, but they tended to repress Cd translocation from roots to shoots. Simultaneously, expression of metal-tolerance genes such as BnPCS1, BnHO1 and Sultr1;1 was up-regulated under Cd stress, and the expression of the genes was more pronounced in 35S::MIR395 plants than in wild type. These results suggest that miR395 would be involved in detoxification of Cd in B. napus.

  17. Alteration of gene expression during the induction of freezing tolerance in Brassica napus suspension cultures

    International Nuclear Information System (INIS)

    Johnson-Flanagan, A.M.; Singh, J.


    Brassica napus suspension-cultured cells can be hardened to a lethal temperature for 50% of the sample of -20 0 C in eight days at room temperature with abscisic acid. During the induction of freezing tolerance, changes were observed in the electrophoretic pattern of [ 35 S]methionine labeled polypeptides. In hardening cells, a 20 kilodalton polypeptide was induced on day 2 and its level increased during hardening. The induction of freezing tolerance with nonmaximal hardening regimens also resulted in increases in the 20 kilodalton polypeptide. The 20 kilodalton polypeptide was associated with a membrane fraction enriched in endoplasmic reticulum and was resolved as a single spot by two-dimensional electrophoresis. In vitro translation of mRNA indicate alteration of gene expression during abscisic acid induction of freezing tolerance. The new mRNA encodes a 20 kilodalton polypeptide associated with increased freezing tolerance induced by either abscisic acid or high sucrose. A 20 kilodalton polypeptide was also translated by mRNA isolated from cold-hardened B. napus plants

  18. Analysis of morphology, DNA and isozyme of leaf mutation in Brassica napus L

    International Nuclear Information System (INIS)

    Luo Zhen; Hu Dongwei; Li Xiaobai


    This paper aims to study the rule of irradiating effects, provide the effective way of analyzing mutant, and discuss the production application of mutant. By irradiating the 040B of Brassica napus L with . 0Co γ- ray, an obvious leaf mutation (ML) with large leaf area was found. The ML which has been inherited stably after three generations was compared with wide-type (CK) on the morphologic, DNA and isozymic levels. Results showed that S 4 and S17 from RAPD were two molecular markers which can express good polymorphism and have close relationships with leaf mutation sites. And in the analysis of EST and POD between ML and CK, the polymorphisms also proved that many discrepancies exist between ML and CK on the protein level. In addition, the research results in question can be applied to the breeding and genetic research of Brassica napus L

  19. Genomes and transcriptomes of partners in plant-fungal-interactions between canola (Brassica napus and two Leptosphaeria species.

    Directory of Open Access Journals (Sweden)

    Rohan G T Lowe

    Full Text Available Leptosphaeria maculans 'brassicae' is a damaging fungal pathogen of canola (Brassica napus, causing lesions on cotyledons and leaves, and cankers on the lower stem. A related species, L. biglobosa 'canadensis', colonises cotyledons but causes few stem cankers. We describe the complement of genes encoding carbohydrate-active enzymes (CAZys and peptidases of these fungi, as well as of four related plant pathogens. We also report dual-organism RNA-seq transcriptomes of these two Leptosphaeria species and B. napus during disease. During the first seven days of infection L. biglobosa 'canadensis', a necrotroph, expressed more cell wall degrading genes than L. maculans 'brassicae', a hemi-biotroph. L. maculans 'brassicae' expressed many genes in the Carbohydrate Binding Module class of CAZy, particularly CBM50 genes, with potential roles in the evasion of basal innate immunity in the host plant. At this time, three avirulence genes were amongst the top 20 most highly upregulated L. maculans 'brassicae' genes in planta. The two fungi had a similar number of peptidase genes, and trypsin was transcribed at high levels by both fungi early in infection. L. biglobosa 'canadensis' infection activated the jasmonic acid and salicylic acid defence pathways in B. napus, consistent with defence against necrotrophs. L. maculans 'brassicae' triggered a high level of expression of isochorismate synthase 1, a reporter for salicylic acid signalling. L. biglobosa 'canadensis' infection triggered coordinated shutdown of photosynthesis genes, and a concomitant increase in transcription of cell wall remodelling genes of the host plant. Expression of particular classes of CAZy genes and the triggering of host defence and particular metabolic pathways are consistent with the necrotrophic lifestyle of L. biglobosa 'canadensis', and the hemibiotrophic life style of L. maculans 'brassicae'.

  20. Screening of a Brassica napus bacterial artificial chromosome library using highly parallel single nucleotide polymorphism assays (United States)


    Background Efficient screening of bacterial artificial chromosome (BAC) libraries with polymerase chain reaction (PCR)-based markers is feasible provided that a multidimensional pooling strategy is implemented. Single nucleotide polymorphisms (SNPs) can be screened in multiplexed format, therefore this marker type lends itself particularly well for medium- to high-throughput applications. Combining the power of multiplex-PCR assays with a multidimensional pooling system may prove to be especially challenging in a polyploid genome. In polyploid genomes two classes of SNPs need to be distinguished, polymorphisms between accessions (intragenomic SNPs) and those differentiating between homoeologous genomes (intergenomic SNPs). We have assessed whether the highly parallel Illumina GoldenGate® Genotyping Assay is suitable for the screening of a BAC library of the polyploid Brassica napus genome. Results A multidimensional screening platform was developed for a Brassica napus BAC library which is composed of almost 83,000 clones. Intragenomic and intergenomic SNPs were included in Illumina’s GoldenGate® Genotyping Assay and both SNP classes were used successfully for screening of the multidimensional BAC pools of the Brassica napus library. An optimized scoring method is proposed which is especially valuable for SNP calling of intergenomic SNPs. Validation of the genotyping results by independent methods revealed a success of approximately 80% for the multiplex PCR-based screening regardless of whether intra- or intergenomic SNPs were evaluated. Conclusions Illumina’s GoldenGate® Genotyping Assay can be efficiently used for screening of multidimensional Brassica napus BAC pools. SNP calling was specifically tailored for the evaluation of BAC pool screening data. The developed scoring method can be implemented independently of plant reference samples. It is demonstrated that intergenomic SNPs represent a powerful tool for BAC library screening of a polyploid genome

  1. NMR metabolomics of ripened and developing oilseed rape (Brassica napus) and turnip rape (Brassica rapa). (United States)

    Kortesniemi, Maaria; Vuorinen, Anssi L; Sinkkonen, Jari; Yang, Baoru; Rajala, Ari; Kallio, Heikki


    The oilseeds of the commercially important oilseed rape (Brassica napus) and turnip rape (Brassica rapa) were investigated with (1)H NMR metabolomics. The compositions of ripened (cultivated in field trials) and developing seeds (cultivated in controlled conditions) were compared in multivariate models using principal component analysis (PCA), partial least squares discriminant analysis (PLS-DA), and orthogonal partial least squares discriminant analysis (OPLS-DA). Differences in the major lipids and the minor metabolites between the two species were found. A higher content of polyunsaturated fatty acids and sucrose were observed in turnip rape, while the overall oil content and sinapine levels were higher in oilseed rape. The genotype traits were negligible compared to the effect of the growing site and concomitant conditions on the oilseed metabolome. This study demonstrates the applicability of NMR-based analysis in determining the species, geographical origin, developmental stage, and quality of oilseed Brassicas. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Separation and identification of candidate protein elicitors from the cultivation medium of Leptosphaeria maculans inducing resistance in Brassica napus

    Czech Academy of Sciences Publication Activity Database

    Nováková, Miroslava; Kim, P.D.; Šašek, Vladimír; Burketová, Lenka; Jindřichová, Barbora; Šantrůček, J.; Valentová, O.


    Roč. 32, č. 4 (2016), s. 918-928 ISSN 8756-7938 R&D Projects: GA ČR GA522/08/1581; GA MZe QH81201; GA MŠk LD14093 Institutional support: RVO:61389030 Keywords : elicitor * Brassica napus * Leptosphaeria maculans Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection Impact factor: 1.986, year: 2016

  3. Origins of the amphiploid species Brassica napus L. investigated by chloroplast and nuclear molecular markers

    Directory of Open Access Journals (Sweden)

    Allender Charlotte J


    Full Text Available Abstract Background The amphiploid species Brassica napus (oilseed rape, Canola is a globally important oil crop yielding food, biofuels and industrial compounds such as lubricants and surfactants. Identification of the likely ancestors of each of the two genomes (designated A and C found in B. napus would facilitate incorporation of novel alleles from the wider Brassica genepool in oilseed rape crop genetic improvement programmes. Knowledge of the closest extant relatives of the genotypes involved in the initial formation of B. napus would also allow further investigation of the genetic factors required for the formation of a stable amphiploid and permit the more efficient creation of fully fertile re-synthesised B. napus. We have used a combination of chloroplast and nuclear genetic markers to investigate the closest extant relatives of the original maternal progenitors of B. napus. This was based on a comprehensive sampling of the relevant genepools, including 83 accessions of A genome B. rapa L. (both wild and cultivated types, 94 accessions of B. napus and 181 accessions of C genome wild and cultivated B. oleracea L. and related species. Results Three chloroplast haplotypes occurred in B. napus. The most prevalent haplotype (found in 79% of accessions was not present within the C genome accessions but was found at low frequencies in B. rapa. Chloroplast haplotypes characteristic of B. napus were found in a small number of wild and weedy B. rapa populations, and also in two accessions of cultivated B. rapa 'brocoletto'. Whilst introgression of the B. napus chloroplast type in the wild and weedy B. rapa populations has been proposed by other studies, the presence of this haplotype within the two brocoletto accessions is unexplained. Conclusions The distribution of chloroplast haplotypes eliminate any of the C genome species as being the maternal ancestor of the majority of the B. napus accessions. The presence of multiple chloroplast

  4. Phytoextraction with Brassica napus L.: A tool for sustainable management of heavy metal contaminated soils

    International Nuclear Information System (INIS)

    Grispen, Veerle M.J.; Nelissen, Hans J.M.; Verkleij, Jos A.C.


    Phytoextraction is a promising tool to extract metals from contaminated soils and Brassica napus L. seems to be a possible candidate species for this purpose. To select accessions with the ability to accumulate cadmium, hydroponically grown 21 day old seedlings of 77 B. napus L. accessions were exposed to 0.2 μM CdSO 4 for an additional 10 days. The effects of Cd on several parameters were quantified i.e.; shoot Cd concentration ([Cd] shoot ), total amount of Cd in shoots (Total Cd) and the shoot to root Cd concentration ratio (S/R ratio). Though generally natural variation was low for [Cd] shoot , Total Cd and S/R ratio, a number of accessions could be selected. Our results indicated that Total Cd and S/R ratio are independent parameters for Cd accumulation and translocation. The selected varieties were then tested in field experiments on two locations nearby metal smelters. The two locations differed in extractable soil Cd, Zn, Ca concentration and pH levels. On both locations B. napus L. accessions showed significant differences in [Cd] shoot and Total Cd. Furthermore we found significant correlations between Cd and Zn accumulation in shoots. There were site-specific effects with respect to Cd accumulation in the B. napus L. accessions, however, two accessions seem to perform equally well on both sites. The results of the field experiment suggest that certain B. napus L. accessions are suitable for phytoextraction of moderately heavy metal contaminated soils. - A screening for natural variation in Cd accumulated by 77 Brassica napus L. yielded candidate phytoextraction accessions for agricultural practice

  5. Phytoextraction with Brassica napus L.: A tool for sustainable management of heavy metal contaminated soils

    Energy Technology Data Exchange (ETDEWEB)

    Grispen, Veerle M.J. [Department of Ecology and Physiology of Plants, Vrije Universiteit, De Boelelaan 1085, NL-1081 HV Amsterdam (Netherlands); Nelissen, Hans J.M. [Department of Ecology and Physiology of Plants, Vrije Universiteit, De Boelelaan 1085, NL-1081 HV Amsterdam (Netherlands); Verkleij, Jos A.C. [Department of Ecology and Physiology of Plants, Vrije Universiteit, De Boelelaan 1085, NL-1081 HV Amsterdam (Netherlands)]. E-mail:


    Phytoextraction is a promising tool to extract metals from contaminated soils and Brassica napus L. seems to be a possible candidate species for this purpose. To select accessions with the ability to accumulate cadmium, hydroponically grown 21 day old seedlings of 77 B. napus L. accessions were exposed to 0.2 {mu}M CdSO{sub 4} for an additional 10 days. The effects of Cd on several parameters were quantified i.e.; shoot Cd concentration ([Cd]{sub shoot}), total amount of Cd in shoots (Total Cd) and the shoot to root Cd concentration ratio (S/R ratio). Though generally natural variation was low for [Cd]{sub shoot}, Total Cd and S/R ratio, a number of accessions could be selected. Our results indicated that Total Cd and S/R ratio are independent parameters for Cd accumulation and translocation. The selected varieties were then tested in field experiments on two locations nearby metal smelters. The two locations differed in extractable soil Cd, Zn, Ca concentration and pH levels. On both locations B. napus L. accessions showed significant differences in [Cd]{sub shoot} and Total Cd. Furthermore we found significant correlations between Cd and Zn accumulation in shoots. There were site-specific effects with respect to Cd accumulation in the B. napus L. accessions, however, two accessions seem to perform equally well on both sites. The results of the field experiment suggest that certain B. napus L. accessions are suitable for phytoextraction of moderately heavy metal contaminated soils. - A screening for natural variation in Cd accumulated by 77 Brassica napus L. yielded candidate phytoextraction accessions for agricultural practice.

  6. Studies on the use of gamma irradiation and tissue culture in improving brassica napus

    International Nuclear Information System (INIS)

    Khedr, E.K.A.


    The objectives of this study were to:1- Studying the effect of different doses of gamma rays on some growth and yield component traits of three Brassica napus cultivars (Serow6, Serow4 and Pactol) during four consecutive generations aiming to create new genotypes characterized with high yielding traits. 2- Studying the effect of different doses of gamma rays on in vitro biotechnology technique (tissue culture) used in improving Brassica napus. Seeds of three Brassica napus cultivars were irradiated with different gamma ray doses then sown for four consecutive seasons. Data were collected and recorded to clarify the effect gamma irradiation on some yield component traits which were days to flowering , plant height, number of main branches per plant, number of secondary branches per plant, number of pods per plant, number of seeds per pod, weight of 1000-seed, weight of grain yield/plant and oil content of seeds). Results showed that high doses of gamma radiation had enhanced all of the studied traits for each of the three tested cultivars (except the plant height trait for Serow6 and Pactol cultivars). Seven new mutant lines were selected for their superiority in one or more of the studied yield component traits. Regarding the effect of gamma rays on tissue culture techniques, the applied gamma radiation doses did not affect the percentage of seed germination of the three studied cultivars, whereas the percentage of callus induction decreased by increasing the dose of gamma rays for each of the three cultivars and in both types of explants (hypocotyl and cotyledons) used in this experiment.

  7. Progressive introgression between ¤Brassica napus¤ (oilseed rape) and ¤B-rapa¤

    DEFF Research Database (Denmark)

    Hansen, L.B.; Siegismund, H.R.; Bagger Jørgensen, Rikke


    We have earlier shown extensive introgression between oilseed rape (Brassica napus) and B. rapa in a weedy population using AFLP markers specific for the nuclear genomes. In order to describe the progress of this introgression, we examined 117 offspring from 12 maternal plants from the introgress...

  8. Synthetic Brassica napus L.: Development and Studies on Morphological Characters, Yield Attributes, and Yield

    Directory of Open Access Journals (Sweden)

    M. A. Malek


    Full Text Available Brassica napus was synthesized by hybridization between its diploid progenitor species B. rapa and B. oleracea followed by chromosome doubling. Cross with B. rapa as a female parent was only successful. Among three colchicine treatments (0.10, 0.15, and 0.20%, 0.15% gave the highest success (86% of chromosome doubling in the hybrids (AC; 2=19. Synthetic B. napus (AACC, 2=38 was identified with bigger petals, fertile pollens and seed setting. Synthetic B. napus had increased growth over parents and exhibited wider ranges with higher coefficients of variations than parents for morphological and yield contributing characters, and yield per plant. Siliqua length as well as beak length in synthetic B. napus was longer than those of the parents. Number of seeds per siliqua, 1000-seed weight and seed yield per plant in synthetic B. napus were higher than those of the parents. Although flowering time in synthetic B. napus was earlier than both parents, however the days to maturity was little higher over early maturing B. rapa parent. The synthesized B. napus has great potential to produce higher seed yield. Further screening and evaluation is needed for selection of desirable genotypes having improved yield contributing characters and higher seed yield.

  9. Effects of Salinity on Yield and Component Characters in Canola (Brassica napus L. Cultivars

    Directory of Open Access Journals (Sweden)

    Ahmad BYBORDI


    Full Text Available Cultivars �Okapi�, �SLM046�, �Elite�, �Fornax� and �Licord� Brassica napus were tested for yield and component characters under different levels of salinity. The variations due to salinity levels, cultivars and cultivarxsalinity (interaction were significant for different characters. The variable degrees of increase and decrease of regression coefficient estimate mates (curve estimation showed the performance as influenced by different salinity levels. The performance of Brassica napus variety in plant height and days to first flowering was the best for �SLM046�, �Okapi� �SLM046� and �Okapi� cultivars. �SLM046� showed the best performance in days to maturity, followed by �Licord� and �Elite�. �Okapi� performed better than others regarding the increased number of seeds per plant and seed yield per plant, followed by �Fornax�. Considering all characters, the most tolerance ability was found in �SLM046� and �Okapi�, against different levels of salinity.

  10. Proteomic dissection of seed germination and seedling establishment in Brassica napus

    Directory of Open Access Journals (Sweden)

    Jianwei Gu


    Full Text Available The success of seed germination and the establishment of a normal seedling are key determinants of plant species propagation. At present, only few studies have focused on the genetic control of the seed germination by proteomic approach in Brassica napus. In the present study, the protein expression pattern of seed germination was investigated using differential fluorescence two-dimensional gel electrophoresis (2-D DIGE in B. napus. One hundred thirteen differentially expressed proteins (DEPs, which were mainly involved in storage proteins (23.4%, energy metabolism (18.9%, protein metabolism (16.2%, defense/disease (12.6%, seed maturation (11.7%, carbohydrate metabolism (4.5%, lipid metabolism (4.5%, amino acids metabolism (3.6%, cell growth/division (3.6%, and some unclear proteins (2.7% were observed by proteomic analysis. Seventeen genes corresponding to 11 DEPs were identified within or near the associated linkage disequilibrium regions related to seed germination and vigor quantitative traits reported in B. napus in previous studies. The expression pattern of proteins showed the heterotrophic metabolism could be activated in the process of seed germination and the onset of defense system might start during seed germination. These findings will help us more in-depth understanding of the mobilization of seed storage reserves and regulation mechanisms of germination process in B. napus.

  11. LMI1-like genes involved in leaf margin development of Brassica napus. (United States)

    Ni, Xiyuan; Liu, Han; Huang, Jixiang; Zhao, Jianyi


    In rapeseed (Brassica napus L.), leaf margins are variable and can be entire, serrate, or lobed. In our previous study, the lobed-leaf gene (LOBED-LEAF 1, BnLL1) was mapped to a 32.1 kb section of B. napus A10. Two LMI1-like genes, BnaA10g26320D and BnaA10g26330D, were considered the potential genes that controlled the lobed-leaf trait in rapeseed. In the present study, these two genes and another homologous gene (BnaC04g00850D) were transformed into Arabidopsis thaliana (L.) Heynh. plants to identify their functions. All three LMI1-like genes of B. napus produced serrate leaf margins. The expression analysis indicated that the expression level of BnaA10g26320D determined the difference between lobed- and entire-leaved lines in rapeseed. Therefore, it is likely that BnaA10g26320D corresponds to BnLL1.

  12. Occurrence of metaxenia and false hybrids in Brassica juncea L. cv. Kikarashina × B. napus (United States)

    Tsuda, Mai; Konagaya, Ken-ichi; Okuzaki, Ayako; Kaneko, Yukio; Tabei, Yutaka


    Imported genetically modified (GM) canola (Brassica napus) is approved by Japanese law. Some GM canola varieties have been found around importation sites, and there is public concern that these may have any harmful effects on related species such as reduction of wild relatives. Because B. juncea is distributed throughout Japan and is known to be high crossability with B. napus, it is assumed to be a recipient of B. napus. However, there are few reports for introgression of cross-combination in B. juncea × B. napus. To assess crossability, we artificially pollinated B. juncea with B. napus. After harvesting a large number of progeny seeds, we observed false hybrids and metaxenia of seed coats. Seed coat color was classified into four categories and false hybrids were confirmed by morphological characteristics and random amplified polymorphic DNA (RAPD) markers. Furthermore, the occurrence of false hybrids was affected by varietal differences in B. napus, whereas that of metaxenia was related to hybridity. Therefore, we suggest that metaxenia can be used as a marker for hybrid identification in B. juncea L. cv. Kikarashina × B. napus. Our results suggest that hybrid productivity in B. juncea × B. napus should not be evaluated by only seed productivity, crossability ought to be assessed the detection of true hybrids. PMID:23136472

  13. Agronomic and seed quality traits dissected by genome-wide association mapping in Brassica napus

    Directory of Open Access Journals (Sweden)

    Niklas eKörber


    Full Text Available In Brassica napus breeding, traits related to commercial success are of highest importance for plant breeders. However, such traits can only be assessed in an advanced developmental stage. % as well as require high experimental effort due to their quantitative inheritance and the importance of genotype*environment interaction. Molecular markers genetically linked to such traits have the potential to accelerate the breeding process of B. napus by marker-assisted selection. Therefore, the objectives of this study were to identify (i genome regions associated with the examined agronomic and seed quality traits, (ii the interrelationship of population structure and the detected associations, and (iii candidate genes for the revealed associations. The diversity set used in this study consisted of 405 Brassica napus inbred lines which were genotyped using a 6K single nucleotide polymorphism (SNP array and phenotyped for agronomic and seed quality traits in field trials. In a genome-wide association study, we detected a total of 112 associations between SNPs and the seed quality traits as well as 46 SNP-trait associations for the agronomic traits with a P-value 100 and a sequence identity of > 70 % to A. thaliana or B. rapa could be found for the agronomic SNP-trait associations and 187 hits of potential candidate genes for the seed quality SNP-trait associations.

  14. Molecular mapping of QTL alleles of Brassica oleracea affecting days to flowering and photosensitivity in spring Brassica napus. (United States)

    Rahman, Habibur; Bennett, Rick A; Kebede, Berisso


    Earliness of flowering and maturity are important traits in spring Brassica napus canola-whether grown under long- or short-day condition. By use of a spring B. napus mapping population carrying the genome content of B. oleracea and testing this population under 10 to 18 h photoperiod and 18 to 20 0C (day) temperature conditions, we identified a major QTL on the chromosome C1 affecting flowering time without being influenced by photoperiod and temperature, and a major QTL on C9 affecting flowering time under a short photoperiod (10 h); in both cases, the QTL alleles reducing the number of days to flowering in B. napus were introgressed from the late flowering species B. oleracea. Additive effect of the C1 QTL allele at 14 to18 h photoperiod was 1.1 to 2.9 days; however, the same QTL allele exerted an additive effect of 6.2 days at 10 h photoperiod. Additive effect of the C9 QTL at 10 h photoperiod was 2.8 days. These two QTL also showed significant interaction in the control of flowering only under a short-day (10 h photoperiod) condition with an effect of 2.3 days. A few additional QTL were also detected on the chromosomes C2 and C8; however, none of these QTL could be detected under all photoperiod and temperature conditions. BLASTn search identified several putative flowering time genes on the chromosomes C1 and C9 and located the physical position of the QTL markers in the Brassica genome; however, only a few of these genes were found within the QTL region. Thus, the molecular markers and the genomic regions identified in this research could potentially be used in breeding for the development of early flowering photoinsensitive B. napus canola cultivars, as well as for identification of candidate genes involved in flowering time variation and photosensitivity.

  15. Genome-Wide Association Mapping of Seed Coat Color in Brassica napus. (United States)

    Wang, Jia; Xian, Xiaohua; Xu, Xinfu; Qu, Cunmin; Lu, Kun; Li, Jiana; Liu, Liezhao


    Seed coat color is an extremely important breeding characteristic of Brassica napus. To elucidate the factors affecting the genetic architecture of seed coat color, a genome-wide association study (GWAS) of seed coat color was conducted with a diversity panel comprising 520 B. napus cultivars and inbred lines. In total, 22 single-nucleotide polymorphisms (SNPs) distributed on 7 chromosomes were found to be associated with seed coat color. The most significant SNPs were found in 2014 near Bn-scaff_15763_1-p233999, only 43.42 kb away from BnaC06g17050D, which is orthologous to Arabidopsis thaliana TRANSPARENT TESTA 12 (TT12), an important gene involved in the transportation of proanthocyanidin precursors into the vacuole. Two of eight repeatedly detected SNPs can be identified and digested by restriction enzymes. Candidate gene mining revealed that the relevant regions of significant SNP loci on the A09 and C08 chromosomes are highly homologous. Moreover, a comparison of the GWAS results to those of previous quantitative trait locus (QTL) studies showed that 11 SNPs were located in the confidence intervals of the QTLs identified in previous studies based on linkage analyses or association mapping. Our results provide insights into the genetic basis of seed coat color in B. napus, and the beneficial allele, SNP information, and candidate genes should be useful for selecting yellow seeds in B. napus breeding.

  16. Purification and protein composition of oil bodies from Brassica napus seeds

    Directory of Open Access Journals (Sweden)

    Jolivet Pascale


    Full Text Available Seed oil bodies are intracellular particles to store lipids as food reserves in oleaginous plants. Description of oil body-associated proteins of Arabidopsis thaliana has been recently reported whereas only few data are available in the case of rapeseed. Oil bodies have been prepared from two double-low varieties of Brassica napus seeds, a standard variety (Explus and an oleic variety (Cabriolet. Oil bodies have been purified using floatation technique in the successive presence of high salt concentration, detergent or urea in order to remove non-specifically trapped proteins. The integrity of the oil bodies has been verified and their size estimated. Their protein and fatty acid contents have been determined. The proteins composing these organelles were extracted, separated by denaturing gel electrophoresis, digested by trypsin and their peptides were subsequently analyzed by liquid chromatography-tandem mass spectrometry. Protein identification was performed using Arabidopsis thaliana protein sequence database and a collection of Expressed Sequence Tag (EST of Brassica napus generated from the framework of the French plant genomics programme “Genoplante”. This led to the identification of a limited number of proteins: eight oleosins showing a high similarity each other and representing up to 75% of oil body proteins, a 11 β hydroxysteroid dehydrogenase-like protein highly homologous to the same protein from A. thaliana, and only few contaminating proteins associated with myrosinase activity.

  17. Differences between winter oilseed rape (Brassica napus L.) cultivars in nitrogen starvation-induced leaf senescence are governed by leaf-inherent rather than root-derived signals

    Czech Academy of Sciences Publication Activity Database

    Koeslin-Findeklee, F.; Becker, M. A.; van der Graaff, E.; Roitsch, Thomas; Horst, W. J.


    Roč. 66, č. 13 (2015), s. 3669-3681 ISSN 0022-0957 Institutional support: RVO:67179843 Keywords : Brassica napus * cytokinins * genotypic differences * leaf senescence * nitrogen efficiency * nitrogen starvation * reciprocal grafting * stay-green Subject RIV: EH - Ecology, Behaviour Impact factor: 5.677, year: 2015

  18. Amplification of the active site of BnLIP3 gene of Brassica napus L ...

    African Journals Online (AJOL)

    Lipases are useful enzymes that are responsible for the hydrolysis of triacylglycerides and play an important role in plant growth. In this study, we report a rapid molecular method to amplify a partial sequence of the lipase class 3 family designated BnLIP3 gene of Brassica napus L. in order to follow its expression and ...

  19. The microbe-secreted isopeptide poly-γ-glutamic acid induces stress tolerance in Brassica napus L. seedlings by activating crosstalk between H2O2 and Ca2+ (United States)

    Lei, Peng; Pang, Xiao; Feng, Xiaohai; Li, Sha; Chi, Bo; Wang, Rui; Xu, Zongqi; Xu, Hong


    Poly-γ-glutamic acid (γ-PGA) is a microbe-secreted isopeptide that has been shown to promote growth and enhance stress tolerance in crops. However, its site of action and downstream signaling pathways are still unknown. In this study, we investigated γ-PGA-induced tolerance to salt and cold stresses in Brassica napus L. seedlings. Fluorescent labeling of γ-PGA was used to locate the site of its activity in root protoplasts. The relationship between γ-PGA-induced stress tolerance and two signal molecules, H2O2 and Ca2+, as well as the γ-PGA-elicited signaling pathway at the whole plant level, were explored. Fluorescent labeling showed that γ-PGA did not enter the cytoplasm but instead attached to the surface of root protoplasm. Here, it triggered a burst of H2O2 in roots by enhancing the transcription of RbohD and RbohF, and the elicited H2O2 further activated an influx of Ca2+ into root cells. Ca2+ signaling was transmitted via the stem from roots to leaves, where it elicited a fresh burst of H2O2, thus promoting plant growth and enhancing stress tolerance. On the basis of these observation, we propose that γ-PGA mediates stress tolerance in Brassica napus seedlings by activating an H2O2 burst and subsequent crosstalk between H2O2 and Ca2+ signaling. PMID:28198821

  20. Gene expression profiling via LongSAGE in a non-model plant species: a case study in seeds of Brassica napus

    Directory of Open Access Journals (Sweden)

    Friedt Wolfgang


    Full Text Available Abstract Background Serial analysis of gene expression (LongSAGE was applied for gene expression profiling in seeds of oilseed rape (Brassica napus ssp. napus. The usefulness of this technique for detailed expression profiling in a non-model organism was demonstrated for the highly complex, neither fully sequenced nor annotated genome of B. napus by applying a tag-to-gene matching strategy based on Brassica ESTs and the annotated proteome of the closely related model crucifer A. thaliana. Results Transcripts from 3,094 genes were detected at two time-points of seed development, 23 days and 35 days after pollination (DAP. Differential expression showed a shift from gene expression involved in diverse developmental processes including cell proliferation and seed coat formation at 23 DAP to more focussed metabolic processes including storage protein accumulation and lipid deposition at 35 DAP. The most abundant transcripts at 23 DAP were coding for diverse protease inhibitor proteins and proteases, including cysteine proteases involved in seed coat formation and a number of lipid transfer proteins involved in embryo pattern formation. At 35 DAP, transcripts encoding napin, cruciferin and oleosin storage proteins were most abundant. Over both time-points, 18.6% of the detected genes were matched by Brassica ESTs identified by LongSAGE tags in antisense orientation. This suggests a strong involvement of antisense transcript expression in regulatory processes during B. napus seed development. Conclusion This study underlines the potential of transcript tagging approaches for gene expression profiling in Brassica crop species via EST matching to annotated A. thaliana genes. Limits of tag detection for low-abundance transcripts can today be overcome by ultra-high throughput sequencing approaches, so that tag-based gene expression profiling may soon become the method of choice for global expression profiling in non-model species.

  1. In vitro distribution and characterization of membrane-associated PLD and PI-PLC in Brassica napus

    Czech Academy of Sciences Publication Activity Database

    Novotná, Z.; Martinec, Jan; Profotová, Bronislava; Žďárová, Štěpánka; Kader, J. K.; Valentová, O.


    Roč. 54, č. 383 (2003), s. 691-698 ISSN 0022-0957 R&D Projects: GA ČR GA522/00/1332; GA MŠk LN00A081 Institutional research plan: CEZ:AV0Z5038910 Keywords : Brassica napus * phospholipases * plasma membrane Subject RIV: CE - Biochemistry Impact factor: 3.180, year: 2003

  2. DNA Methylation Alterations at 5'-CCGG Sites in the Interspecific and Intraspecific Hybridizations Derived from Brassica rapa and B. napus.

    Directory of Open Access Journals (Sweden)

    Wanshan Xiong

    Full Text Available DNA methylation is an important regulatory mechanism for gene expression that involved in the biological processes of development and differentiation in plants. To investigate the association of DNA methylation with heterosis in Brassica, a set of intraspecific hybrids in Brassica rapa and B. napus and interspecific hybrids between B. rapa and B. napus, together with parental lines, were used to monitor alterations in cytosine methylation at 5'-CCGG sites in seedlings and buds by methylation-sensitive amplification polymorphism analysis. The methylation status of approximately a quarter of the methylation sites changed between seedlings and buds. These alterations were related closely to the genomic structure and heterozygous status among accessions. The methylation status in the majority of DNA methylation sites detected in hybrids was the same as that in at least one of the parental lines in both seedlings and buds. However, the association between patterns of cytosine methylation and heterosis varied among different traits and between tissues in hybrids of Brassica, although a few methylation loci were associated with heterosis. Our data suggest that changes in DNA methylation at 5'-CCGG sites are not associated simply with heterosis in the interspecific and intraspecific hybridizations derived from B. rapa and B. napus.

  3. Expression of the C3-C 4 intermediate character in somatic hybrids between Brassica napus and the C3-C 4 species Moricandia arvensis. (United States)

    O'Neill, C M; Murata, T; Morgan, C L; Mathias, R J


    The wild crucifer Moricandia arvensis is a potential source of alien genes for the genetic improvement of related Brassica crops. In particular M. arvensis has a C3-C4 intermediate photosynthetic mechanism which results in enhanced recapture of photorespired CO2 and may increase plant water-use efficiency. In order to transfer this trait into Brassica napus, somatic hybridisations were made between leaf mesophyll protoplasts from cultured M. arvensis shoot tips and hypocotyl protoplasts from three Brassica napus cultivars, 'Ariana', 'Cobra' and 'Westar'. A total of 23 plants were recovered from fusion experiments and established in the greenhouse. A wide range of chromosome numbers were observed among the regenerated plants, including some apparent mixoploids. Thirteen of the regenerated plants were identified as nuclear hybrids between B. napus and M. arvensis on the basis of isozyme analysis. The phenotypes of these hybrids were typically rather B. napus-like, but much variability was observed, including variation in flower colour, leaf shape and colour, leaf waxiness, fertility and plant vigour. CO2 compensation point measurements on the regenerated plants demonstrated that 3 of the hybrids express the M. arvensis C3-C4 intermediate character at the physiological level. Semi-thin sections through leaf tissues of these 3 plants revealed the presence of a Kranz-like leaf anatomy characteristic of M. arvensis but not found in B. napus. This is the first report of the expression of this potentially important agronomic trait, transferred from Moricandia, in M. arvensis x B. napus hybrids.

  4. Impacts of adding different components of wood vinegar on rape (Brassica napus L.) seed germiantion (United States)

    Shan, Xue; Liu, Xia; Zhang, Qian


    In recent years, wood vinegar has been widely used in the agricultural production. It can be used as the soil amendment, antibacterial agent and organic fertilizer. This study investigated the effect of wood vinegar on rape (Brassica napus L.) seed germination. The results in this study showed that 1% (v/v) wood vinegar had the greatest inhibition effect on the seed germination of rape (Brassica napus L.). The wood vinegar (WV) and the distilled wood vinegar at 98 - 130 °C (D2) significantly inhibited seed germination by 100%, compared to the control treatment. However, the distilled wood vinegar (D1) had significantly increased the shoot length and root length by 58.4% and 31.7%, respectively. These positive effects could be attributed to the improved soil fertility, increased nutrient supply, and further stimulated plant growth. Overall, the D1 could be a promising soil amendment to promote plants growth and enhance crop yields. Effect of adding different components of distilled wood vinegar on the seed germination of rape

  5. A high-density SNP map for accurate mapping of seed fibre QTL in Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Liezhao Liu

    Full Text Available A high density genetic linkage map for the complex allotetraploid crop species Brassica napus (oilseed rape was constructed in a late-generation recombinant inbred line (RIL population, using genome-wide single nucleotide polymorphism (SNP markers assayed by the Brassica 60 K Infinium BeadChip Array. The linkage map contains 9164 SNP markers covering 1832.9 cM. 1232 bins account for 7648 of the markers. A subset of 2795 SNP markers, with an average distance of 0.66 cM between adjacent markers, was applied for QTL mapping of seed colour and the cell wall fiber components acid detergent lignin (ADL, cellulose and hemicellulose. After phenotypic analyses across four different environments a total of 11 QTL were detected for seed colour and fiber traits. The high-density map considerably improved QTL resolution compared to the previous low-density maps. A previously identified major QTL with very high effects on seed colour and ADL was pinpointed to a narrow genome interval on chromosome A09, while a minor QTL explaining 8.1% to 14.1% of variation for ADL was detected on chromosome C05. Five and three QTL accounting for 4.7% to 21.9% and 7.3% to 16.9% of the phenotypic variation for cellulose and hemicellulose, respectively, were also detected. To our knowledge this is the first description of QTL for seed cellulose and hemicellulose in B. napus, representing interesting new targets for improving oil content. The high density SNP genetic map enables navigation from interesting B. napus QTL to Brassica genome sequences, giving useful new information for understanding the genetics of key seed quality traits in rapeseed.

  6. Construction of an integrated genetic linkage map for the A genome of Brassica napus using SSR markers derived from sequenced BACs in B. rapa

    Directory of Open Access Journals (Sweden)

    King Graham J


    Full Text Available Abstract Background The Multinational Brassica rapa Genome Sequencing Project (BrGSP has developed valuable genomic resources, including BAC libraries, BAC-end sequences, genetic and physical maps, and seed BAC sequences for Brassica rapa. An integrated linkage map between the amphidiploid B. napus and diploid B. rapa will facilitate the rapid transfer of these valuable resources from B. rapa to B. napus (Oilseed rape, Canola. Results In this study, we identified over 23,000 simple sequence repeats (SSRs from 536 sequenced BACs. 890 SSR markers (designated as BrGMS were developed and used for the construction of an integrated linkage map for the A genome in B. rapa and B. napus. Two hundred and nineteen BrGMS markers were integrated to an existing B. napus linkage map (BnaNZDH. Among these mapped BrGMS markers, 168 were only distributed on the A genome linkage groups (LGs, 18 distrubuted both on the A and C genome LGs, and 33 only distributed on the C genome LGs. Most of the A genome LGs in B. napus were collinear with the homoeologous LGs in B. rapa, although minor inversions or rearrangements occurred on A2 and A9. The mapping of these BAC-specific SSR markers enabled assignment of 161 sequenced B. rapa BACs, as well as the associated BAC contigs to the A genome LGs of B. napus. Conclusion The genetic mapping of SSR markers derived from sequenced BACs in B. rapa enabled direct links to be established between the B. napus linkage map and a B. rapa physical map, and thus the assignment of B. rapa BACs and the associated BAC contigs to the B. napus linkage map. This integrated genetic linkage map will facilitate exploitation of the B. rapa annotated genomic resources for gene tagging and map-based cloning in B. napus, and for comparative analysis of the A genome within Brassica species.

  7. Identification and characterization of microRNAs in oilseed rape (Brassica napus) responsive to infection with the pathogenic fungus Verticillium longisporum using Brassica AA (Brassica rapa) and CC (Brassica oleracea) as reference genomes. (United States)

    Shen, Dan; Suhrkamp, Ina; Wang, Yu; Liu, Shenyi; Menkhaus, Jan; Verreet, Joseph-Alexander; Fan, Longjiang; Cai, Daguang


    Verticillium longisporum, a soil-borne pathogenic fungus, causes vascular disease in oilseed rape (Brassica napus). We proposed that plant microRNAs (miRNAs) are involved in the plant-V. longisporum interaction. To identify oilseed rape miRNAs, we deep-sequenced two small RNA libraries made from V. longisporum infected/noninfected roots and employed Brassica rapa and Brassica oleracea genomes as references for miRNA prediction and characterization. We identified 893 B. napus miRNAs representing 360 conserved and 533 novel miRNAs, and mapped 429 and 464 miRNAs to the AA and CC genomes, respectively. Microsynteny analysis with the conserved miRNAs and their flanking protein coding sequences revealed 137 AA-CC genome syntenic miRNA pairs and 61 AA and 42 CC genome-unique miRNAs. Sixty-two miRNAs were responsive to the V. longisporum infection. We present data for specific interactions and simultaneously reciprocal changes in the expression levels of the miRNAs and their targets in the infected roots. We demonstrate that miRNAs are involved in the plant-fungus interaction and that miRNA168-Argonaute 1 (AGO1) expression modulation might act as a key regulatory module in a compatible plant-V. longisporum interaction. Our results suggest that V. longisporum may have evolved a virulence mechanism by interference with plant miRNAs to reprogram plant gene expression and achieve infection. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  8. Genetic differentiation among sexually compatible relatives of Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Pipan Barbara


    Full Text Available Analysis of gene flow between Brassica napus L. and its sexually compatible relatives that could be found in the wild in Slovenia was performed by microsatellite analysis using fifteen selected primer pairs. Genotypes included in the study were obtained from the field survey of sexually compatible relatives of B. napus in natural habitats around Slovenia and from reference collections. Two different wild species of all the presented sexually compatible relatives of B. napus were found in Slovenia, B. rapa and Sinapis arvensis. The reference genotypes included varieties and wild forms from internal collections as marketable seeds or from gene banks. Reference genotypes were represented by the following species and subspecies: B. napus ssp. napobrassica, B. napus ssp. napus, B. nigra, B. oleracea, B. rapa ssp. oleifera, Diplotaxis muralis; D. tenuifolia, Raphanus raphanistrum, R. sativus, R. sativus var. oleiformis, Rapistrum rugosum, S. alba and S. arvensis. Estimation of gene flow described by average number of migrants was 0.72 followed by 0.20 migrants. Due to the observed gene migrations, genetic drift and selection, Hardy-Weinberg equilibrium was not met. The mean number of alleles over all loci was 16.9, the average polymorphic information content was 0.43. We found four highly divergent and polymorphic loci (Na12-C08, Na10-A08, Ni3-G04b and BRMS-050 at statistically significant level (p<0.05 of gene flow detected. Over all gene diversity intra-individual among populations (0.55 was lower than inter-individual among population (0.77. The results of genetic linkages based standard genetic distance and unweighted pair group method with arithmetic mean clustering method, generally divided the genotypes in three divergent groups. Similar results were obtained by principal coordinate analysis where three main groups were constructed according to three factors. A real number of genetic clusters demonstrated a clear separation between populations

  9. Genome-Wide Identification of MicroRNAs in Response to Cadmium Stress in Oilseed Rape (Brassica napus L. Using High-Throughput Sequencing

    Directory of Open Access Journals (Sweden)

    Hongju Jian


    Full Text Available MicroRNAs (miRNAs have important roles in regulating stress-response genes in plants. However, identification of miRNAs and the corresponding target genes that are induced in response to cadmium (Cd stress in Brassica napus remains limited. In the current study, we sequenced three small-RNA libraries from B. napus after 0 days, 1 days, and 3 days of Cd treatment. In total, 44 known miRNAs (belonging to 27 families and 103 novel miRNAs were identified. A comprehensive analysis of miRNA expression profiles found 39 differentially expressed miRNAs between control and Cd-treated plants; 13 differentially expressed miRNAs were confirmed by qRT-PCR. Characterization of the corresponding target genes indicated functions in processes including transcription factor regulation, biotic stress response, ion homeostasis, and secondary metabolism. Furthermore, we propose a hypothetical model of the Cd-response mechanism in B. napus. Combined with qRT-PCR confirmation, our data suggested that miRNAs were involved in the regulations of TFs, biotic stress defense, ion homeostasis and secondary metabolism synthesis to respond Cd stress in B. napus.

  10. Glyphostate-drift but not herbivory alters the rate of transgene flow from single and stacked trait transgenic canola (Brassica napus L.) to non-transgenic B. napus and B. rapa (United States)

    While transgenic plants can offer agricultural benefits, the escape of transgenes out of crop fields is a major environmental concern. Escape of transgenic herbicide resistance has occurred between transgenic Brassica napus (canola) and weedy species in numerous locations. In t...

  11. GISH and AFLP analyses of novel Brassica napus lines derived from one hybrid between B. napus and Orychophragmus violaceus. (United States)

    Ma, Ni; Li, Zai-Yun; Cartagena, J A; Fukui, K


    New Brassica napus inbred lines with different petal colors and with canola quality and increased levels of oleic (approximately 70%, 10% higher than that of B. napus parent) and linoleic (28%) acids have been developed in the progenies of one B. napus cv. Oro x Orychophragmus violaceus F5 hybrid plant (2n = 31). Their genetic constituents were analyzed by using the methods of genomic in situ hybridization (GISH) and amplified fragments length polymorphism (AFLP). No intact chromosomes of O. violaceus origin were detected by GISH in their somatic cells of ovaries and root tips (2n = 38) and pollen mother cells (PMCs) with normal chromosome pairing (19 bivalents) and segregation (19:19), though signals of variable sizes and intensities were located mainly at terminal and centromeric parts of some mitotic chromosomes and meiotic bivalents at diakinesis or chromosomes in anaphase I groups and one large patch of chromatin was intensively labeled and separated spatially in some telophase I nuclei and metaphase II PMCs. AFLP analysis revealed that substantial genomic changes have occurred in these lines and O. violaceus-specific bands, deleted bands in 'Oro' and novel bands for two parents were detected. The possible mechanisms for these results were discussed.

  12. Chelate-assisted phytoextraction: effect of EDTA and EDDS on copper uptake by Brassica napus L.

    Directory of Open Access Journals (Sweden)



    Full Text Available Chelate-assisted phytoextraction is proposed as an effective approach for the removal of heavy metals from contaminated soil through the use of high biomass plants. The aim of the present study was to compare the efficiency of the two chelators: EDTA and biodegradable EDDS in enhancing Cu uptake and translocation by Brassica napus L. grown on moderately contaminated soil and treated with increasing concentrations of EDTA or EDDS. Increasing amounts of EDDS caused serious growth suppression of B. napus and an increase in shoot metal concentrations. Growth suppression limited the actual amount of phytoextracted Cu at high concentrations of EDDS. The maximum amount of extracted Cu was achieved by the application of 8.0 and 4.0+4.0 mmol kg-1 EDDS. The shoot Cu concentrations after EDTA application were much lower than with EDDS at the same doses. According to these experiments, EDTA does not appear to be an efficient amendment if Cu phytoextraction with B. napus is considered but EDDS is.

  13. Biochemical and histopathological profiling of Wistar rat treated with Brassica napus as a supplementary feed

    Directory of Open Access Journals (Sweden)

    Kazi Md. Mahmudul Hasan


    Full Text Available Metabolic changes together with cardiovascular and hepatic factors are related to the development of diseases like myocardial lipidosis, heart disease, and profound toxicity. The aim of this animal study is to determine the effects of high erucic acid containing rapeseed oil (Brassica napus L. varieties on liver, kidney and heart muscles in Wistar rats. Male Wistar rats were divided into three groups where each group containing four rats. Group A was considered as control diet group, while Group B rapeseed wild oil group and Group C rapeseed hybrid oil group were considered as experimental diet groups. The levels of aspartate aminotransferase (AST, alanine aminotransferase (ALT,alkaline phosphatase(ALP, creatine kinase-MB (CK-MB and creatinine of two experimental groups were significantly elevated while compared to the control groups (p  0.05. Noticeable tissue injury observed in this study is a sign of the relative toxicity of erucic acid containing rapeseed oil to mammalian species. The use of Brassica napus as a supplementary feed ingredient should be, therefore, thoroughly considered Keywords: Rapeseed oil, Rattus norvegicus, Serum enzymes, Erucic acid, Tissue profiling

  14. Genome-Wide Identification and Structural Analysis of bZIP Transcription Factor Genes in Brassica napus. (United States)

    Zhou, Yan; Xu, Daixiang; Jia, Ledong; Huang, Xiaohu; Ma, Guoqiang; Wang, Shuxian; Zhu, Meichen; Zhang, Aoxiang; Guan, Mingwei; Lu, Kun; Xu, Xinfu; Wang, Rui; Li, Jiana; Qu, Cunmin


    The basic region/leucine zipper motif (bZIP) transcription factor family is one of the largest families of transcriptional regulators in plants. bZIP genes have been systematically characterized in some plants, but not in rapeseed ( Brassica napus ). In this study, we identified 247 BnbZIP genes in the rapeseed genome, which we classified into 10 subfamilies based on phylogenetic analysis of their deduced protein sequences. The BnbZIP genes were grouped into functional clades with Arabidopsis genes with similar putative functions, indicating functional conservation. Genome mapping analysis revealed that the BnbZIPs are distributed unevenly across all 19 chromosomes, and that some of these genes arose through whole-genome duplication and dispersed duplication events. All expression profiles of 247 bZIP genes were extracted from RNA-sequencing data obtained from 17 different B . napus ZS11 tissues with 42 various developmental stages. These genes exhibited different expression patterns in various tissues, revealing that these genes are differentially regulated. Our results provide a valuable foundation for functional dissection of the different BnbZIP homologs in B . napus and its parental lines and for molecular breeding studies of bZIP genes in B . napus .

  15. Genetic Diversity in Commercial Rapeseed (Brassica napus L.) Varieties from Turkey as Revealed by RAPD


    Özlem ÖZBEK; Betül Uçar GIDIK


    In cultivated commercial crop species, genetic diversity tends to decrease because of the extensive breeding processes. Therefore, germplasm of commercial crop species, such as Brassica napus L. should be evaluated and the genotypes, which have higher genetic diversity index, should be addressed as potential parental cross materials in breeding programs. In this study, the genetic diversity was analysed by using randomly amplified polymorphic DNA analysis (RAPD) technique in nine Turkish com...

  16. The Vascular Pathogen Verticillium longisporum Does Not Affect Water Relations and Plant Responses to Drought Stress of Its Host, Brassica napus. (United States)

    Lopisso, Daniel Teshome; Knüfer, Jessica; Koopmann, Birger; von Tiedemann, Andreas


    Verticillium longisporum is a host-specific vascular pathogen of oilseed rape (Brassica napus L.) that causes economic crop losses by impairing plant growth and inducing premature senescence. This study investigates whether plant damage through Verticillium stem striping is due to impaired plant water relations, whether V. longisporum affects responses of a susceptible B. napus variety to drought stress, and whether drought stress, in turn, affects plant responses to V. longisporum. Two-factorial experiments on a susceptible cultivar of B. napus infected or noninfected with V. longisporum and exposed to three watering levels (30, 60, and 100% field capacity) revealed that drought stress and V. longisporum impaired plant growth by entirely different mechanisms. Although both stresses similarly affected plant growth parameters (plant height, hypocotyl diameter, and shoot and root dry matter), infection of B. napus with V. longisporum did not affect any drought-related physiological or molecular genetic plant parameters, including transpiration rate, stomatal conductance, photosynthesis rate, water use efficiency, relative leaf water content, leaf proline content, or the expression of drought-responsive genes. Thus, this study provides comprehensive physiological and molecular genetic evidence explaining the lack of wilt symptoms in B. napus infected with V. longisporum. Likewise, drought tolerance of B. napus was unaffected by V. longisporum, as was the level of disease by drought conditions, thus excluding a concerted action of both stresses in the field. Although it is evident that drought and vascular infection with V. longisporum impair plant growth by different mechanisms, it remains to be determined by which other factors V. longisporum causes crop loss.

  17. Homoeologous exchange is a major cause of gene presence/absence variation in the amphidiploid Brassica napus. (United States)

    Hurgobin, Bhavna; Golicz, Agnieszka A; Bayer, Philipp E; Chan, Chon-Kit Kenneth; Tirnaz, Soodeh; Dolatabadian, Aria; Schiessl, Sarah V; Samans, Birgit; Montenegro, Juan D; Parkin, Isobel A P; Pires, J Chris; Chalhoub, Boulos; King, Graham J; Snowdon, Rod; Batley, Jacqueline; Edwards, David


    Homoeologous exchanges (HEs) have been shown to generate novel gene combinations and phenotypes in a range of polyploid species. Gene presence/absence variation (PAV) is also a major contributor to genetic diversity. In this study, we show that there is an association between these two events, particularly in recent Brassica napus synthetic accessions, and that these represent a novel source of genetic diversity, which can be captured for the improvement of this important crop species. By assembling the pangenome of B. napus, we show that 38% of the genes display PAV behaviour, with some of these variable genes predicted to be involved in important agronomic traits including flowering time, disease resistance, acyl lipid metabolism and glucosinolate metabolism. This study is a first and provides a detailed characterization of the association between HEs and PAVs in B. napus at the pangenome level. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. Production of intertribal somatic hybrids between Brassica napus L. and Lesquerella fendleri (Gray) Wats

    International Nuclear Information System (INIS)

    Skarzhinskaya, M.; Landgren, M.; Glimelius, K.


    Intertribal Brassica napus (+) Lesquerella fendleri hybrids have been produced by polyethylene glycol-induced fusions of B. napus hypocotyl and L. fendleri mesophyll protoplasts. Two series of experiments were performed. In the first, symmetric fusion experiments, protoplasts from the two materials were fused without any pretreatments. In the second, asymmetric fusion experiments, X-ray irradiation at doses of 180 and 200 Gy were used to limit the transfer of the L. fendleri genome to the hybrids. X-ray irradiation of L. fendleri mesophyll protoplasts did not suppress the proliferation rate and callus formation of the fusion products but did significantly decrease growth and differentiation of non-fused L. fendleri protoplasts. In total, 128 regenerated plants were identified as intertribal somatic hybrids on the basis of morphological criteria. Nuclear DNA analysis performed on 80 plants, using species specific sequences, demonstrated that 33 plants from the symmetric fusions and 43 plants from the asymmetric fusions were hybrids. Chloroplast and mitochondrial DNA analysis revealed a biased segregation that favoured B. napus organelles in the hybrids from the symmetric fusion experiments. The bias was even stronger in the hybrids from the asymmetric fusion experiments where no hybrids with L. fendleri organelles were found. X-ray irradiation of L. fendleri protoplasts increased the possibility of obtaining mature somatic hybrid plants with improved fertility. Five plants from the symmetric and 24 plants from the asymmetric fusion experiments were established in the greenhouse. From the symmetric fusions 2 plants could be fertilised and set seeds after cross-pollination with B. napus. From the asymmetric fusions 9 plants could be selfed as well as fertilised when backcrossed with B. napus. Chromosome analysis was performed on all of the plants but 1 that were transferred to the greenhouse. Three plants from the symmetric fusions contained 50 chromosomes, which

  19. Physiological and proteomic analyses on artificially aged Brassica napus seed

    Directory of Open Access Journals (Sweden)

    Pingfang eYang


    Full Text Available Plant seeds lose their viability when they are exposed to long term storage or controlled deterioration treatments, by a process known as seed ageing. Based on previous studies, artificially ageing treatments have been developed to accelerate the process of seed ageing in order to understand its underlying mechanisms. In this study, we used Brassica napus seeds to investigate the mechanisms of ageing initiation. B. napus seeds were exposed to artificially ageing treatment (40 oC and 90% relative humidity and their physio-biochemical characteristics were analyzed. Although the treatment delayed germination, it did not increase the concentration of cellular reactive oxygen species (ROS. Comparative proteomic analysis was conducted among the control and treated seeds at different stages of germination. The proteins responded to the treatment were mainly involved in metabolism, protein modification and destination, stress response, development and miscellaneous enzymes. Except for peroxiredoxin, no changes were observed in the accumulation of other antioxidant enzymes in the artificially aged seeds. Increased content of ABA was observed in the artificially treated seeds which might be involved in the inhibition of germination. Taken together, our results highlight the involvement of ABA in the initiation of seed ageing in addition to the ROS which was previously reported to mediate the seed ageing process.

  20. Proteomic and comparative genomic analysis reveals adaptability of Brassica napus to phosphorus-deficient stress. (United States)

    Chen, Shuisen; Ding, Guangda; Wang, Zhenhua; Cai, Hongmei; Xu, Fangsen


    Given low solubility and immobility in many soils of the world, phosphorus (P) may be the most widely studied macronutrient for plants. In an attempt to gain an insight into the adaptability of Brassica napus to P deficiency, proteome alterations of roots and leaves in two B. napus contrasting genotypes, P-efficient 'Eyou Changjia' and P-inefficient 'B104-2', under long-term low P stress and short-term P-free starvation conditions were investigated, and proteomic combined with comparative genomic analyses were conducted to interpret the interrelation of differential abundance protein species (DAPs) responding to P deficiency with quantitative trait loci (QTLs) for P deficiency tolerance. P-efficient 'Eyou Changjia' had higher dry weight and P content, and showed high tolerance to low P stress compared with P-inefficient 'B104-2'. A total of 146 DAPs were successfully identified by MALDI TOF/TOF MS, which were categorized into several groups including defense and stress response, carbohydrate and energy metabolism, signaling and regulation, amino acid and fatty acid metabolism, protein process, biogenesis and cellular component, and function unknown. 94 of 146 DAPs were mapped to a linkage map constructed by a B. napus population derived from a cross between the two genotypes, and 72 DAPs were located in the confidence intervals of QTLs for P efficiency related traits. We conclude that the identification of these DAPs and the co-location of DAPs with QTLs in the B. napus linkage genetic map provide us novel information in understanding the adaptability of B. napus to P deficiency, and helpful to isolate P-efficient genes in B. napus. Low P seriously limits the production and quality of B. napus. Proteomics and genetic linkage map were widely used to study the adaptive strategies of B. napus response to P deficiency, proteomic combined with comparative genetic analysis to investigate the correlations between DAPs and QTLs are scarce. Thus, we herein investigated

  1. Consequences of gene flow between oilseed rape (Brassica napus) and its relatives. (United States)

    Liu, Yongbo; Wei, Wei; Ma, Keping; Li, Junsheng; Liang, Yuyong; Darmency, Henri


    Numerous studies have focused on the probability of occurrence of gene flow between transgenic crops and their wild relatives and the likelihood of transgene escape, which should be assessed before the commercial release of transgenic crops. This review paper focuses on this issue for oilseed rape, Brassica napus L., a species that produces huge numbers of pollen grains and seeds. We analyze separately the distinct steps of gene flow: (1) pollen and seeds as vectors of gene flow; (2) spontaneous hybridization; (3) hybrid behavior, fitness cost due to hybridization and mechanisms of introgression; (4) and fitness benefit due to transgenes (e.g. herbicide resistance and Bt toxin). Some physical, biological and molecular means of transgene containment are also described. Although hybrids and first generation progeny are difficult to identify in fields and non-crop habitats, the literature shows that transgenes could readily introgress into Brassica rapa, Brassica juncea and Brassica oleracea, while introgression is expected to be rare with Brassica nigra, Hirschfeldia incana and Raphanus raphanistrum. The hybrids grow well but produce less seed than their wild parent. The difference declines with increasing generations. However, there is large uncertainty about the evolution of chromosome numbers and recombination, and many parameters of life history traits of hybrids and progeny are not determined with satisfactory confidence to build generic models capable to really cover the wide diversity of situations. We show that more studies are needed to strengthen and organize biological knowledge, which is a necessary prerequisite for model simulations to assess the practical and evolutionary outputs of introgression, and to provide guidelines for gene flow management. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  2. Genome-wide analysis and expression profiling of the GRF gene family in oilseed rape (Brassica napus L.). (United States)

    Ma, Jin-Qi; Jian, Hong-Ju; Yang, Bo; Lu, Kun; Zhang, Ao-Xiang; Liu, Pu; Li, Jia-Na


    Growth regulating-factors (GRFs) are plant-specific transcription factors that help regulate plant growth and development. Genome-wide identification and evolutionary analyses of GRF gene families have been performed in Arabidopsis thaliana, Zea mays, Oryza sativa, and Brassica rapa, but a comprehensive analysis of the GRF gene family in oilseed rape (Brassica napus) has not yet been reported. In the current study, we identified 35 members of the BnGRF family in B. napus. We analyzed the chromosomal distribution, phylogenetic relationships (Bayesian Inference and Neighbor Joining method), gene structures, and motifs of the BnGRF family members, as well as the cis-acting regulatory elements in their promoters. We also analyzed the expression patterns of 15 randomly selected BnGRF genes in various tissues and in plant varieties with different harvest indices and gibberellic acid (GA) responses. The expression levels of BnGRFs under GA treatment suggested the presence of possible negative feedback regulation. The evolutionary patterns and expression profiles of BnGRFs uncovered in this study increase our understanding of the important roles played by these genes in oilseed rape. Copyright © 2017. Published by Elsevier B.V.

  3. Induction of microspore embryogenesis in Brassica napus L. by gamma irradiation and ethanol stress

    Energy Technology Data Exchange (ETDEWEB)

    Pechan, P. M. [Max Planck Institute für Zuchtungsforschung, Köln (Germany); Keller, W. A.


    Summary Gamma irradiation and ethanol stress treatments redirected pollen development to an embryo formation pathway in Brassica napus. Less than 0.01% of microspores developed into embryos at 25°C compared to approximately 2% at 32°C. However, subsequent to gamma irradiation and ethanol treatments up to 1% and 0.7% of microspores formed embryos at 25°C, respectively. Gamma irradiation also enhanced embryogenesis at 32°C. The possible importance of these findings is discussed in relation to microspore embryogenesis.

  4. Induction of microspore embryogenesis in Brassica napus L. by gamma irradiation and ethanol stress

    International Nuclear Information System (INIS)

    Pechan, P.M.; Keller, W.A.


    Summary Gamma irradiation and ethanol stress treatments redirected pollen development to an embryo formation pathway in Brassica napus. Less than 0.01% of microspores developed into embryos at 25°C compared to approximately 2% at 32°C. However, subsequent to gamma irradiation and ethanol treatments up to 1% and 0.7% of microspores formed embryos at 25°C, respectively. Gamma irradiation also enhanced embryogenesis at 32°C. The possible importance of these findings is discussed in relation to microspore embryogenesis

  5. Effect of different sulfur levels from various sources on brassica napus growth and soil sulfur fractions

    International Nuclear Information System (INIS)

    Khalid, R.; Khan, K.S.; Islam, M.; Yousaf, M.; Shabbir, G.


    A two year field study was conducted at two different locations in northern rain fed Punjab, Pakistan to assess the effect of different rates of sulfur application from various sources on soil sulfur fractions and growth of Brassica napus. The treatments included three sulfur sources i. e., single super phosphate, ammonium sulfate and gypsum each applied at five different rates (0, 10, 20, 30 and 40 kg S ha/sup -1/ ). Sulfur application had a significant positive effect on the growth and yield parameters of Brassica napus. Among the sulfur sources ammonium sulfate resulted in maximum increase in plant growth and yield parameters, followed by single super phosphate. Sulfur content and uptake by crop plants was significantly higher with ammonium sulfate application as compared to other two sulfur sources. Sulfur application also exerted a significant positive effect on different S fractions in the soils. On an average, 18.0% of the applied sulfur got incorporated into CaCl/sub 2/ extractable sulfur fraction, while 15.6% and 35.5% entered into adsorbed and organic sulfur fractions in the soils, respectively. The value cost ratio increased significantly by sulfur application up to 30 kg ha/sup -1/. Among sulfur sources, ammonium sulfate performed best giving the highest net return. (author)

  6. Scale up of 2,4-dichlorophenol removal from aqueous solutions using Brassica napus hairy roots

    Energy Technology Data Exchange (ETDEWEB)

    Angelini, Vanina A. [Departamento de Biologia Molecular, FCEFQN, Universidad Nacional de Rio Cuarto, 5800 Rio Cuarto, Cordoba (Argentina); Orejas, Joaquin [Facultad de Ingenieria, Universidad Nacional de Rio Cuarto, 5800 Rio Cuarto, Cordoba (Argentina); Medina, Maria I. [Departamento de Biologia Molecular, FCEFQN, Universidad Nacional de Rio Cuarto, 5800 Rio Cuarto, Cordoba (Argentina); Agostini, Elizabeth, E-mail: [Departamento de Biologia Molecular, FCEFQN, Universidad Nacional de Rio Cuarto, 5800 Rio Cuarto, Cordoba (Argentina)


    Research highlights: {yields}B. napus hairy roots were effectively used for a large scale removal of 2,4-DCP. {yields} High removal efficiencies were obtained (98%) in a short time (30 min). {yields} Roots were re-used for six consecutive cycles with high efficiency. {yields} Post removal solutions showed no toxicity. {yields} This method could be used for continuous and safe treatment of phenolic effluents. - Abstract: Chlorophenols are harmful pollutants, frequently found in the effluents of several industries. For this reason, many environmental friendly technologies are being explored for their removal from industrial wastewaters. The aim of the present work was to study the scale up of 2,4-dichlorophenol (2,4-DCP) removal from synthetic wastewater, using Brassica napus hairy roots and H{sub 2}O{sub 2} in a discontinuous stirred tank reactor. We have analyzed some operational conditions, because the scale up of such process was poorly studied. High removal efficiencies were obtained (98%) in a short time (30 min). When roots were re-used for six consecutive cycles, 2,4-DCP removal efficiency decreased from 98 to 86%, in the last cycle. After the removal process, the solutions obtained from the reactor were assessed for their toxicity using an acute test with Lactuca sativa L. seeds. Results suggested that the treated solution was less toxic than the parent solution, because neither inhibition of lettuce germination nor effects in root and hypocotyl lengths were observed. Therefore, we provide evidence that Brassica napus hairy roots could be effectively used to detoxify solutions containing 2,4-DCP and they have considerable potential for a large scale removal of this pollutant. Thus, this study could help to design a method for continuous and safe treatment of effluents containing chlorophenols.

  7. Scale up of 2,4-dichlorophenol removal from aqueous solutions using Brassica napus hairy roots

    International Nuclear Information System (INIS)

    Angelini, Vanina A.; Orejas, Joaquin; Medina, Maria I.; Agostini, Elizabeth


    Research highlights: →B. napus hairy roots were effectively used for a large scale removal of 2,4-DCP. → High removal efficiencies were obtained (98%) in a short time (30 min). → Roots were re-used for six consecutive cycles with high efficiency. → Post removal solutions showed no toxicity. → This method could be used for continuous and safe treatment of phenolic effluents. - Abstract: Chlorophenols are harmful pollutants, frequently found in the effluents of several industries. For this reason, many environmental friendly technologies are being explored for their removal from industrial wastewaters. The aim of the present work was to study the scale up of 2,4-dichlorophenol (2,4-DCP) removal from synthetic wastewater, using Brassica napus hairy roots and H 2 O 2 in a discontinuous stirred tank reactor. We have analyzed some operational conditions, because the scale up of such process was poorly studied. High removal efficiencies were obtained (98%) in a short time (30 min). When roots were re-used for six consecutive cycles, 2,4-DCP removal efficiency decreased from 98 to 86%, in the last cycle. After the removal process, the solutions obtained from the reactor were assessed for their toxicity using an acute test with Lactuca sativa L. seeds. Results suggested that the treated solution was less toxic than the parent solution, because neither inhibition of lettuce germination nor effects in root and hypocotyl lengths were observed. Therefore, we provide evidence that Brassica napus hairy roots could be effectively used to detoxify solutions containing 2,4-DCP and they have considerable potential for a large scale removal of this pollutant. Thus, this study could help to design a method for continuous and safe treatment of effluents containing chlorophenols.

  8. Data for iTRAQ-based quantitative proteomics analysis of Brassica napus leaves in response to chlorophyll deficiency

    Directory of Open Access Journals (Sweden)

    Pu Chu


    Full Text Available The essential pigment chlorophyll (Chl plays important roles in light harvesting and energy transfer during photosynthesis. Here we present the data from a comparative proteomic analysis of chlorophyll-deficient Brassica napus mutant cde1 and its corresponding wild-type using the iTRAQ approach (Pu Chu et al., 2014 [1]. The distribution of length and number of peptides, mass and sequence coverage of proteins identified was calculated, and the repeatability of the replicates was analyzed. A total of 443 differentially expressed proteins were identified in B. napus leaves, including 228 down-accumulated proteins mainly involved in photosynthesis, porphyrin and chlorophyll metabolism, biosynthesis of secondary metabolites, carbon fixation and 215 up-accumulated proteins that enriched in the spliceosome, mRNA surveillance and RNA degradation.

  9. Tissue-specific distribution of secondary metabolites in rapeseed (Brassica napus L..

    Directory of Open Access Journals (Sweden)

    Jingjing Fang

    Full Text Available Four different parts, hypocotyl and radicle (HR, inner cotyledon (IC, outer cotyledon (OC, seed coat and endosperm (SE, were sampled from mature rapeseed (Brassica napus L. by laser microdissection. Subsequently, major secondary metabolites, glucosinolates and sinapine, as well as three minor ones, a cyclic spermidine conjugate and two flavonoids, representing different compound categories, were qualified and quantified in dissected samples by high-performance liquid chromatography with diode array detection and mass spectrometry. No qualitative and quantitative difference of glucosinolates and sinapine was detected in embryo tissues (HR, IC and OC. On the other hand, the three minor compounds were observed to be distributed unevenly in different rapeseed tissues. The hypothetic biological functions of the distribution patterns of different secondary metabolites in rapeseed are discussed.

  10. Comparative Analysis of the Brassica napus Root and Leaf Transcript Profiling in Response to Drought Stress

    Directory of Open Access Journals (Sweden)

    Chunqing Liu


    Full Text Available Drought stress is one of the major abiotic factors affecting Brassica napus (B. napus productivity. In order to identify genes of potential importance to drought stress and obtain a deeper understanding of the molecular mechanisms regarding the responses of B. napus to dehydration stress, we performed large-scale transcriptome sequencing of B. napus plants under dehydration stress using the Illumina sequencing technology. In this work, a relatively drought tolerant B. napus line, Q2, identified in our previous study, was used. Four cDNA libraries constructed from mRNAs of control and dehydration-treated root and leaf were sequenced by Illumina technology. A total of 6018 and 5377 differentially expressed genes (DEGs were identified in root and leaf. In addition, 1745 genes exhibited a coordinated expression profile between the two tissues under drought stress, 1289 (approximately 74% of which showed an inverse relationship, demonstrating different regulation patterns between the root and leaf. The gene ontology (GO enrichment test indicated that up-regulated genes in root were mostly involved in “stimulus” “stress” biological process, and activated genes in leaf mainly functioned in “cell” “cell part” components. Furthermore, a comparative network related to plant hormone signal transduction and AREB/ABF, AP2/EREBP, NAC, WRKY and MYC/MYB transcription factors (TFs provided a view of different stress tolerance mechanisms between root and leaf. Some of the DEGs identified may be candidates for future research aimed at detecting drought-responsive genes and will be useful for understanding the molecular mechanisms of drought tolerance in root and leaf of B. napus.

  11. Substoichiometrically different mitotypes coexist in mitochondrial genomes of Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Jianmei Chen

    Full Text Available Cytoplasmic male sterility (CMS has been identified in numerous plant species. Brassica napus CMS plants, such as Polima (pol, MI, and Shaan 2A, have been identified independently by different researchers with different materials in conventional breeding processes. How this kind of CMS emerges is unclear. Here, we report the mitochondrial genome sequence of the prevalent mitotype in the most widely used pol-CMS line, which has a length of 223,412 bp and encodes 34 proteins, 3 ribosomal RNAs, and 18 tRNAs, including two near identical copies of trnH. Of these 55 genes, 48 were found to be identical to their equivalents in the "nap" cytoplasm. The nap mitotype carries only one copy of trnH, and the sequences of five of the six remaining genes are highly similar to their equivalents in the pol mitotype. Forty-four open reading frames (ORFs with unknown function were detected, including two unique to the pol mitotype (orf122 and orf132. At least five rearrangement events are required to account for the structural differences between the pol and nap sequences. The CMS-related orf224 neighboring region (∼5 kb rearranged twice. PCR profiling based on mitotype-specific primer pairs showed that both mitotypes are present in B. napus cultivars. Quantitative PCR showed that the pol cytoplasm consists mainly of the pol mitotype, and the nap mitotype is the main genome of nap cytoplasm. Large variation in the copy number ratio of mitotypes was found, even among cultivars sharing the same cytoplasm. The coexistence of mitochondrial mitotypes and substoichiometric shifting can explain the emergence of CMS in B. napus.


    Directory of Open Access Journals (Sweden)

    Sami Süzer


    Full Text Available Canola (Brassica napus L. is an important edible oilseed crop in the World and in Turkey. It has a healthy vegetable oil because of its balance with omega 3-6-9 essential fatty acids, making canola oil a healthy vegetable oil throughout the World for cooking and processed food industry. Canola production of high yield and good quality usually depends on well-balanced plant nutrition and growing conditions. A well-balanced soil condition also affects canola plants responses to stress factors such as disease and bad weather conditions. Nitrogen, phosphorus and potassium (NPK are some of the major nutrients required to significantly increase canola yield. Fertilizer application dosages in canola production vary because of the variable occurrence of NPK in the soil. A high yielding canola production needs a well-balanced fertilization program.

  13. A spatial assessment of Brassica napus gene flow potential to wild and weedy relatives in the Fynbos Biome

    Directory of Open Access Journals (Sweden)

    J. M. Kalwij


    Full Text Available Gene flow between related plant species, and between transgenic and non-transgenic crop varieties, may be considered a form of biological invasion. Brassica napus (oilseed rape or canola and its relatives are well known for intra- and inter-specific gene flow, hybridisation and weediness. Gene flow associated with B. napus poses a potential ecological risk in the Fynbos Biome of South Africa, because of the existence of both naturalised (alien, weedy and native relatives in this region. This risk is particularly pertinent given the proposed use of B. napus for biofuel and the potential future introduction of herbicide-tolerant transgenic B. napus. Here we quantify the presence and co-occurrence of B. napus and its wild and weedy relatives in the Fynbos Biome, as a first step in the ecological risk assessment for this crop. Several alien and at least one native relative of B. napus were found to be prevalent in the region, and to be spatially congruent with B. napus fields. The first requirement for potential gene flow to occur has thus been met. In addition, a number of these species have elsewhere been found to be reproductively compatible with B. napus. Further assessment of the potential ecological risks associated with B. napus in South Africa is constrained by uncertainties in the phylogeny of the Brassicaceae, difficulties with morphology-based identification, and poor knowledge of the biology of several of the species involved, particularly under South African conditions.

  14. Effects of EDTA on phytoextraction of heavy metals (Zn, Mn and Pb) from sludge-amended soil with Brassica napus. (United States)

    Zaier, Hanen; Ghnaya, Tahar; Ben Rejeb, Kilani; Lakhdar, Abdelbasset; Rejeb, Salwa; Jemal, Fatima


    Sludge application is a reliable practice to ameliorate soil fertility. However, repetitive sludge addition represents a potential soil contamination source with heavy metals, which must be extracted. The aim of this study was to evaluate the capacity of Brassica napus to remove metals from soils amended with sludge, and to study the effect of EDTA on this process. Seedlings were cultivated in presence of sludge combined or not with EDTA. Results showed that sludge ameliorate significantly biomass production. This effect was accompanied with an increase in Pb, Zn and Mn shoot concentrations. EDTA application does not affect significantly plant growth. However, this chelator enhances shoot metals accumulation. It's therefore concluded that sludge has a beneficial effect on soil fertility, B. napus can be used for the decontamination of affected soils and that the EDTA addition increases the ability of B. napus to accumulate heavy metals. Published by Elsevier Ltd.

  15. Functional characterization of Brassica napus DNA topoisomerase Iα-1 and its effect on flowering time when expressed in Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Gao, Chenhao; Qi, Shuanghui; Liu, Kaige; Li, Dong; Jin, Changyu; Duan, Shaowei; Zhang, Meng; Chen, Mingxun


    Previous studies have shown that DNA topoisomerase Iα (AtTOP1α) has specific developmental functions during growth and development in Arabidopsis thaliana. However, little is known about the roles of DNA topoisomerases in the closely related and commercially important plant, rapeseed (Brassica napus). Here, the full-length BnTOP1α-1 coding sequence was cloned from the A2 subgenome of the Brassica napus inbred line L111. We determine that all BnTOP1α paralogs showed differing patterns of expression in different organs of L111, and that when expressed in tobacco leaves as a fusion protein with green fluorescent protein, BnTOP1α-1 localized to the nucleus. We further showed that ectopic expression of BnTOP1α-1 in the A. thaliana top1α-7 mutant fully complemented the early flowering phenotype of the mutant. Moreover, altered expression levels in top1α-7 seedlings of several key genes controlling flowering time were restored to wild type levels by ectopic expression of BnTOP1α-1. These results provide valuable insights into the roles of rapeseed DNA topoisomerases in flowering time, and provide a promising target for genetic manipulation of this commercially significant process in rapeseed. - Highlights: • BnTOP1α-1 was cloned from the A2 subgenome of Brassica napus inbred line L111. • BnTOP1α-1 rescued the early flowering phenotype of the Attop1α-7 mutant. • BnTOP1α-1 rescued the altered expression of flowering time genes in the Attop1α-mutant. • The functions of BnTOP1α-1 and AtTOP1α are likely conserved.

  16. Comparative transcriptome analysis reveals carbohydrate and lipid metabolism blocks in Brassica napus L. male sterility induced by the chemical hybridization agent monosulfuron ester sodium. (United States)

    Li, Zhanjie; Cheng, Yufeng; Cui, Jianmin; Zhang, Peipei; Zhao, Huixian; Hu, Shengwu


    Chemical hybridization agents (CHAs) are often used to induce male sterility for the production of hybrid seeds. We previously discovered that monosulfuron ester sodium (MES), an acetolactate synthase (ALS) inhibitor of the herbicide sulfonylurea family, can induce rapeseed (Brassica napus L.) male sterility at approximately 1% concentration required for its herbicidal activity. To find some clues to the mechanism of MES inducing male sterility, the ultrastructural cytology observations, comparative transcriptome analysis, and physiological analysis on carbohydrate content were carried out in leaves and anthers at different developmental stages between the MES-treated and mock-treated rapeseed plants. Cytological analysis revealed that the plastid ultrastructure was abnormal in pollen mother cells and tapetal cells in male sterility anthers induced by MES treatment, with less material accumulation in it. However, starch granules were observed in chloroplastids of the epidermis cells in male sterility anthers. Comparative transcriptome analysis identified 1501 differentially expressed transcripts (DETs) in leaves and anthers at different developmental stages, most of these DETs being localized in plastid and mitochondrion. Transcripts involved in metabolism, especially in carbohydrate and lipid metabolism, and cellular transport were differentially expressed. Pathway visualization showed that the tightly regulated gene network for metabolism was reprogrammed to respond to MES treatment. The results of cytological observation and transcriptome analysis in the MES-treated rapeseed plants were mirrored by carbohydrate content analysis. MES treatment led to decrease in soluble sugars content in leaves and early stage buds, but increase in soluble sugars content and decrease in starch content in middle stage buds. Our integrative results suggested that carbohydrate and lipid metabolism were influenced by CHA-MES treatment during rapeseed anther development, which might

  17. Systemic Resistance to Powdery Mildew in Brassica napus (AACC) and Raphanus alboglabra (RRCC) by Trichoderma harzianum TH12. (United States)

    Alkooranee, Jawadayn Talib; Yin, Yongtai; Aledan, Tamarah Raad; Jiang, Yingfen; Lu, Guangyuan; Wu, Jiangsheng; Li, Maoteng


    Trichoderma harzianum TH12 is a microbial pesticide for certain rapeseed diseases. The mechanism of systemic resistance induced by TH12 or its cell-free culture filtrate (CF) in Brassica napus (AACC) and Raphanus alboglabra (RRCC) to powdery mildew disease caused by ascomycete Erysiphe cruciferarum was investigated. In this study, we conducted the first large-scale global study on the cellular and molecular aspects of B. napus and R. alboglabra infected with E. cruciferarum. The histological study showed the resistance of R. alboglabra to powdery mildew disease. The growth of fungal colonies was not observed on R. alboglabra leaves at 1, 2, 4, 6, 8, and 10 days post-inoculation (dpi), whereas this was clearly observed on B. napus leaves after 6 dpi. In addition, the gene expression of six plant defense-related genes, namely, PR-1, PR-2 (a marker for SA signaling), PR-3, PDF 1.2 (a marker for JA/ET signaling), CHI620, and CHI570, for both genotypes were analyzed in the leaves of B. napus and R. alboglabra after treatment with TH12 or CF and compared with the non-treated ones. The qRT-PCR results showed that the PR-1 and PR-2 expression levels increased in E. cruciferarum-infected leaves, but decreased in the TH12-treated leaves compared with leaves treated with CF. The expression levels of PR-3 and PDF1.2 decreased in plants infected by E. cruciferarum. However, expression levels increased when the leaves were treated with TH12. For the first time, we disclosed the nature of gene expression in B. napus and R. alboglabra to explore the resistance pathways in the leaves of both genotypes infected and non-infected by powdery mildew and inoculated or non-inoculated with elicitor factors. Results suggested that R. alboglabra exhibited resistance to powdery mildew disease, and the application of T. harzianum and its CF are a useful tool to facilitate new protection methods for resist or susceptible plants.

  18. Analysis of the a genome genetic diversity among brassica napus, b. rapa and b. juncea accessions using specific simple sequence repeat markers

    International Nuclear Information System (INIS)

    Tian, H.; Yan, J.; Zhang, R.; Guo, Y.; Hu, S.; Channa, S.A.


    This investigation was aimed at evaluating the genetic diversity of 127 accessions among Brassica napus, B. rapa, and B. juncea by using 15 pairs of the A genome specific simple sequence repeat primers. These 127 accessions could be clearly separated into three groups by cluster analysis, principal component analysis, and population structure analysis separately, and the results analyzed by the three methods were very similar. Group I comprised of mainly B. napus accessions and the most of B. juncea accessions formed Group II, Group III included nearly all of the B. rapa accessions. The result showed that 36.86% of the variance was due to significant differences among populations of species, indicated that abundance genetic diversity existed among the A genome of B. napus, B. rapa, and B. juncea accessions. B. napus, B. rapa, and B. juncea have the abundant genetic diversity in the A genome, and some elite genes can be used to broaden the genetic base of them, especially for B. napus, in future rapeseed breeding program. (author)

  19. Hormones and Pod Development in Oilseed Rape (Brassica napus) 1 (United States)

    de Bouille, Pierre; Sotta, Bruno; Miginiac, Emile; Merrien, André


    The endogenous levels of several plant growth substances (indole acetic acid, IAA; abscisic acid, ABA; zeatin, Z; zeatin riboside, [9R]Z; isopentenyladenine, iP; and isopentenyladenosine, [9R]iP were measured during pod development of field grown oilseed Rape (Brassica napus L. var oleifera cv Bienvenu) with high performance liquid chromatography and immunoenzymic (enzyme-linked immunosorbent assay, ELISA) techniques. Results show that pod development is characterized by high levels of Z and [9R]Z in 3 day old fruits and of IAA on the fourth day. During pod maturation, initially a significant increase of IAA and cytokinins was observed, followed by a progressive rise of ABA levels and a concomitant decline of IAA and cytokinin (except iP) levels. The relationship between hormone levels and development, especially pod number, seed number per pod, and seed weight determination, will be discussed. PMID:16666891

  20. Physical, biochemical and physiological effects of ultraviolet radiation on Brassica napus and Phaseolus vulgaris

    International Nuclear Information System (INIS)

    Cen Yan-Ping.


    In order to follow some of the changes induced by ultraviolet-B (UV-B, 280-320 nm) radiation in Phaseolus vulgaris and Brassica napus, experiments were designed to localize sites of changes in leaves and to correlate some of the physiological and biochemical changes with penetration of UV-B radiation. B.napus was exposed to 8.9 kJ m -2 day -1 biologically effective UV-B radiation (UV-B BE ). The penetration of UV-B radiation into the leaf was followed using a quartz fibre optic microprobe. Monochromatic radiation at 310 nm was decreased by ca 50 and 34% in the adaxial and abaxial epidermis, respectively, in plants not exposed to UV-B, whereas the radiation was decreased by ca 70 and 42%, respectively, in the same region in UV-treated plants. Polychromatic radiation showed a wavelength dependent change mainly for the collimated radiation. The results correlated with the distribution of phenolic compounds analysed from 40 μm paradermal leaf sections. The first adaxial section (40μm) contained 35% of the whole leaf sample flavonoid glycosides in control plants, and 66% in UV-treated plants. Hydroxycinnamic acid derivatives increased by 26% in UV-treated plants relative to controls. The ratio of quercetin to kaempferol derivatives increased from 0.11 in controls to 0.91 in leaves of UV-treated plants. The leaf epidermis protected the inner leaf tissue where most of the photosynthetic apparatus is located. P. vulgaris was subjected to 6.17 kJ m -2 day -1 UV-B BE with different levels of visible light. The largest UV-induced changes in photosynthesis, chlorophyll, carotenoids, UV-screening pigments, and surface leaf reflectance occurred under growth conditions of low levels of visible light together with UV radiation

  1. Physical, biochemical and physiological effects of ultraviolet radiation on Brassica napus and Phaseolus vulgaris

    Energy Technology Data Exchange (ETDEWEB)

    Cen Yan-Ping


    In order to follow some of the changes induced by ultraviolet-B (UV-B, 280-320 nm) radiation in Phaseolus vulgaris and Brassica napus, experiments were designed to localize sites of changes in leaves and to correlate some of the physiological and biochemical changes with penetration of UV-B radiation. B.napus was exposed to 8.9 kJ m{sup -2} day{sup -1} biologically effective UV-B radiation (UV-B{sub BE}). The penetration of UV-B radiation into the leaf was followed using a quartz fibre optic microprobe. Monochromatic radiation at 310 nm was decreased by ca 50 and 34% in the adaxial and abaxial epidermis, respectively, in plants not exposed to UV-B, whereas the radiation was decreased by ca 70 and 42%, respectively, in the same region in UV-treated plants. Polychromatic radiation showed a wavelength dependent change mainly for the collimated radiation. The results correlated with the distribution of phenolic compounds analysed from 40 {mu}m paradermal leaf sections. The first adaxial section (40{mu}m) contained 35% of the whole leaf sample flavonoid glycosides in control plants, and 66% in UV-treated plants. Hydroxycinnamic acid derivatives increased by 26% in UV-treated plants relative to controls. The ratio of quercetin to kaempferol derivatives increased from 0.11 in controls to 0.91 in leaves of UV-treated plants. The leaf epidermis protected the inner leaf tissue where most of the photosynthetic apparatus is located. P. vulgaris was subjected to 6.17 kJ m{sup -2} day{sup -1} UV-B{sub BE} with different levels of visible light. The largest UV-induced changes in photosynthesis, chlorophyll, carotenoids, UV-screening pigments, and surface leaf reflectance occurred under growth conditions of low levels of visible light together with UV radiation.

  2. Increased [CO2] does not compensate for negative effects on yield caused by higher temperature and [O3] in Brassica napus L

    DEFF Research Database (Denmark)

    Frenck, Georg; van der Linden, Leon Gareth; Mikkelsen, Teis Nørgaard


    in existing genotypes is vital. In this study, the responses in yield and biomass production of four different cultivars of oilseed rape (Brassica napus L.) were tested under five different combinations of increased [CO2] (700 ppm), temperature (+5 °C) and [O3] (+40 ppb). Especially the multifactor treatments...

  3. Metabolome classification of Brassica napus L. organs via UPLC-QTOF-PDA-MS and their anti-oxidant potential. (United States)

    Farag, Mohamed A; Sharaf Eldin, Mohamed G; Kassem, Hanaa; Abou el Fetouh, Mohamed


    Brassica napus L. is a crop widely grown for its oil production and other nutritional components in the seed. In addition to the seed, other organs contain a wide range of phenolic metabolites although they have not been investigated to the same extent as in seeds. To define and compare the phytochemical composition of B. napus L. organs, namely the root, stem, leaf, inflorescence and seeds. Non-targeted metabolomic analysis via UPLC-QTOF-MS was utilised in order to localise compounds belonging to various chemical classes (i.e. oxygenated fatty acids, flavonols, phenolic acids and sinapoyl choline derivatives). The vast majority of identified metabolites were flavonol glycosides that accumulated in most of the plant organs. Whereas other classes were detected predominantly in specific organs, i.e. sinapoyl cholines were present uniquely in seeds. Furthermore, variation in the accumulation pattern of metabolites from the same class was observed, particularly in the case of quercetin, kaempferol and isorhamnetin flavonols. Anti-oxidant activity, based on 2,2-diphenyl-1-picrylhdrazyl analysis was observed for all extracts, and correlated to some extent with total flavonoid content. This study provides the most complete map for polyphenol composition in B. napus L. organs. By describing the metabolites profile in B. napus L., this study provides the basis for future investigations of seeds for potential health and/or medicinal use. Copyright © 2012 John Wiley & Sons, Ltd.

  4. Overexpression of Three Glucosinolate Biosynthesis Genes in Brassica napus Identifies Enhanced Resistance to Sclerotinia sclerotiorum and Botrytis cinerea.

    Directory of Open Access Journals (Sweden)

    Yuanyuan Zhang

    Full Text Available Sclerotinia sclerotiorum and Botrytis cinerea are notorious plant pathogenic fungi with an extensive host range including Brassica crops. Glucosinolates (GSLs are an important group of secondary metabolites characteristic of the Brassicales order, whose degradation products are proving to be increasingly important in plant protection. Enhancing the defense effect of GSL and their associated degradation products is an attractive strategy to strengthen the resistance of plants by transgenic approaches. We generated the lines of Brassica napus with three biosynthesis genes involved in GSL metabolic pathway (BnMAM1, BnCYP83A1 and BnUGT74B1, respectively. We then measured the foliar GSLs of each transgenic lines and inoculated them with S. sclerotiorum and B. cinerea. Compared with the wild type control, over-expressing BnUGT74B1 in B. napus increased the aliphatic and indolic GSL levels by 1.7 and 1.5 folds in leaves respectively; while over-expressing BnMAM1 or BnCYP83A1 resulted in an approximate 1.5-fold higher only in the aliphatic GSL level in leaves. The results of plant inoculation demonstrated that BnUGT74B1-overexpressing lines showed less severe disease symptoms and tissue damage compared with the wild type control, but BnMAM1 or BnCYP83A1-overexpressing lines showed no significant difference in comparison to the controls. These results suggest that the resistance to S. sclerotiorum and B. cinerea in B. napus could be enhanced through tailoring the GSL profiles by transgenic approaches or molecular breeding, which provides useful information to assist plant breeders to design improved breeding strategies.

  5. Multiple NUCLEAR FACTOR Y transcription factors respond to abiotic stress in Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Li Xu

    Full Text Available Members of the plant NUCLEAR FACTOR Y (NF-Y family are composed of the NF-YA, NF-YB, and NF-YC subunits. In Brassica napus (canola, each of these subunits forms a multimember subfamily. Plant NF-Ys were reported to be involved in several abiotic stresses. In this study, we demonstrated that multiple members of thirty three BnNF-Ys responded rapidly to salinity, drought, or ABA treatments. Transcripts of five BnNF-YAs, seven BnNF-YBs, and two BnNF-YCs were up-regulated by salinity stress, whereas the expression of thirteen BnNF-YAs, ten BnNF-YBs, and four BnNF-YCs were induced by drought stress. Under NaCl treatments, the expression of one BnNF-YA10 and four NF-YBs (BnNF-YB3, BnNF-YB7, BnNF-YB10, and BnNF-YB14 were greatly increased. Under PEG treatments, the expression levels of four NF-YAs (BnNF-YA9, BnNF-YA10, BnNF-YA11, and BnNF-YA12 and five NF-YBs (BnNF-YB1, BnNF-YB8, BnNF-YB10, BnNF-YB13, and BnNF-YB14 were greatly induced. The expression profiles of 20 of the 27 salinity- or drought-induced BnNF-Ys were also affected by ABA treatment. The expression levels of six NF-YAs (BnNF-YA1, BnNF-YA7, BnNF-YA8, BnNF-YA9, BnNF-YA10, and BnNF-YA12 and seven BnNF-YB members (BnNF-YB2, BnNF-YB3, BnNF-YB7, BnNF-YB10, BnNF-YB11, BnNF-YB13, and BnNF-YB14 and two NF-YC members (BnNF-YC2 and BnNF-YC3 were greatly up-regulated by ABA treatments. Only a few BnNF-Ys were inhibited by the above three treatments. Several NF-Y subfamily members exhibited collinear expression patterns. The promoters of all stress-responsive BnNF-Ys harbored at least two types of stress-related cis-elements, such as ABRE, DRE, MYB, or MYC. The cis-element organization of BnNF-Ys was similar to that of Arabidopsis thaliana, and the promoter regions exhibited higher levels of nucleotide sequence identity with Brassica rapa than with Brassica oleracea. This work represents an entry point for investigating the roles of canola NF-Y proteins during abiotic stress responses and provides

  6. Multiple NUCLEAR FACTOR Y transcription factors respond to abiotic stress in Brassica napus L. (United States)

    Xu, Li; Lin, Zhongyuan; Tao, Qing; Liang, Mingxiang; Zhao, Gengmao; Yin, Xiangzhen; Fu, Ruixin


    Members of the plant NUCLEAR FACTOR Y (NF-Y) family are composed of the NF-YA, NF-YB, and NF-YC subunits. In Brassica napus (canola), each of these subunits forms a multimember subfamily. Plant NF-Ys were reported to be involved in several abiotic stresses. In this study, we demonstrated that multiple members of thirty three BnNF-Ys responded rapidly to salinity, drought, or ABA treatments. Transcripts of five BnNF-YAs, seven BnNF-YBs, and two BnNF-YCs were up-regulated by salinity stress, whereas the expression of thirteen BnNF-YAs, ten BnNF-YBs, and four BnNF-YCs were induced by drought stress. Under NaCl treatments, the expression of one BnNF-YA10 and four NF-YBs (BnNF-YB3, BnNF-YB7, BnNF-YB10, and BnNF-YB14) were greatly increased. Under PEG treatments, the expression levels of four NF-YAs (BnNF-YA9, BnNF-YA10, BnNF-YA11, and BnNF-YA12) and five NF-YBs (BnNF-YB1, BnNF-YB8, BnNF-YB10, BnNF-YB13, and BnNF-YB14) were greatly induced. The expression profiles of 20 of the 27 salinity- or drought-induced BnNF-Ys were also affected by ABA treatment. The expression levels of six NF-YAs (BnNF-YA1, BnNF-YA7, BnNF-YA8, BnNF-YA9, BnNF-YA10, and BnNF-YA12) and seven BnNF-YB members (BnNF-YB2, BnNF-YB3, BnNF-YB7, BnNF-YB10, BnNF-YB11, BnNF-YB13, and BnNF-YB14) and two NF-YC members (BnNF-YC2 and BnNF-YC3) were greatly up-regulated by ABA treatments. Only a few BnNF-Ys were inhibited by the above three treatments. Several NF-Y subfamily members exhibited collinear expression patterns. The promoters of all stress-responsive BnNF-Ys harbored at least two types of stress-related cis-elements, such as ABRE, DRE, MYB, or MYC. The cis-element organization of BnNF-Ys was similar to that of Arabidopsis thaliana, and the promoter regions exhibited higher levels of nucleotide sequence identity with Brassica rapa than with Brassica oleracea. This work represents an entry point for investigating the roles of canola NF-Y proteins during abiotic stress responses and provides insight into

  7. Genetic and Epigenetic Changes in Oilseed Rape (Brassica napus L.) Extracted from Intergeneric Allopolyploid and Additions with Orychophragmus. (United States)

    Gautam, Mayank; Dang, Yanwei; Ge, Xianhong; Shao, Yujiao; Li, Zaiyun


    Allopolyploidization with the merger of the genomes from different species has been shown to be associated with genetic and epigenetic changes. But the maintenance of such alterations related to one parental species after the genome is extracted from the allopolyploid remains to be detected. In this study, the genome of Brassica napus L. (2n = 38, genomes AACC) was extracted from its intergeneric allohexaploid (2n = 62, genomes AACCOO) with another crucifer Orychophragmus violaceus (2n = 24, genome OO), by backcrossing and development of alien addition lines. B. napus-type plants identified in the self-pollinated progenies of nine monosomic additions were analyzed by the methods of amplified fragment length polymorphism, sequence-specific amplified polymorphism, and methylation-sensitive amplified polymorphism. They showed modifications to certain extents in genomic components (loss and gain of DNA segments and transposons, introgression of alien DNA segments) and DNA methylation, compared with B. napus donor. The significant differences in the changes between the B. napus types extracted from these additions likely resulted from the different effects of individual alien chromosomes. Particularly, the additions which harbored the O. violaceus chromosome carrying dominant rRNA genes over those of B. napus tended to result in the development of plants which showed fewer changes, suggesting a role of the expression levels of alien rRNA genes in genomic stability. These results provided new cues for the genetic alterations in one parental genome that are maintained even after the genome becomes independent.

  8. Plant hormones in defense response of Brassica napus to Sclerotinia sclerotiorum - Reassessing the role of salicylic acid in the interaction with a necrotroph

    Czech Academy of Sciences Publication Activity Database

    Nováková, Miroslava; Šašek, Vladimír; Dobrev, Petre; Valentová, O.; Burketová, Lenka


    Roč. 80, JUL 2014 (2014), s. 308-317 ISSN 0981-9428 R&D Projects: GA ČR GA13-26798S Institutional support: RVO:61389030 Keywords : Brassica napus * Chorismate mutase * Defense signaling pathways Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection Impact factor: 2.756, year: 2014

  9. Structural Properties of Cruciferin and Napin of Brassica napus (Canola Show Distinct Responses to Changes in pH and Temperature

    Directory of Open Access Journals (Sweden)

    Suneru P. Perera


    Full Text Available The two major storage proteins identified in Brassica napus (canola were isolated and studied for their molecular composition, structural characteristics and the responses of structural features to the changes in pH and temperature. Cruciferin, a complex of six monomers, has a predominantly β-sheet-containing secondary structure. This protein showed low pH unstable tertiary structure, and distinctly different solubility behaviour with pH when intact in the seed cellular matrix. Cruciferin structure unfolds at pH 3 even at ambient temperature. Temperature-induced structure unfolding was observed above the maximum denaturation temperature of cruciferin. Napin was soluble in a wider pH range than cruciferin and has α-helices dominating secondary structure. Structural features of napin showed less sensitivity to the changes in medium pH and temperature. The surface hydrophobicity (S0 and intrinsic fluorescence of tryptophan residue appear to be good indicators of cruciferin unfolding, however they were not the best to demonstrate structural changes of napin. These two storage proteins of B. napus have distinct molecular characteristics, therefore properties and functionalities they provide are contrasting rather than complementary.

  10. Introduction of beet cyst nematode resistance from Sinapis alba L. and Raphanus sativus L. into Brassica napus L. (oil-seed rape) through sexual and somatic hybridization

    NARCIS (Netherlands)

    Lelivelt, C.L.C.


    Experiments were performed to select for beet cyst nematode (Heterodera schachtii Schm., abbrev. BCN) resistant genotypes of Brassica napus L. (oilseed rape), and to introduce BCN-resistance from the related species Raphanus

  11. Multiple evolutionary events involved in maintaining homologs of Resistance to Powdery Mildew 8 in Brassica napus

    Directory of Open Access Journals (Sweden)

    Qin Li


    Full Text Available The Resistance to Powdery Mildew 8 (RPW8 locus confers broad-spectrum resistance to powdery mildew in Arabidopsis thaliana. There are four Homologous to RPW8s (BrHRs in Brassica rapa and three in B. oleracea (BoHRs. B. napus (Bn is derived from diploidization of a hybrid between B. rapa and B. oleracea, thus should have seven homologs of RPW8 (BnHRs. It is unclear whether these genes are still maintained or lost in B. napus after diploidization and how they might have been evolved. Here we reported the identification and sequence polymorphisms of BnHRs from a set of B. napus accessions. Our data indicated that while the BoHR copy from B. oleracea is highly conserved, the BrHR copy from B. rapa is relatively variable in the B. napus genome owing to multiple evolutionary events, such as gene loss, point mutation, insertion, deletion and intragenic recombination. Given the overall high sequence homology of BnHR genes, it is not surprising that both intragenic recombination between two orthologs and two paralogs were detected in B. napus, which may explain the loss of BoHR genes in some B. napus accessions. When ectopically expressed in Arabidopsis, a C-terminally truncated version of BnHRa and BnHRb, as well as the full length BnHRd fused with YFP at their C-termini could trigger cell death in the absence of pathogens and enhanced resistance to powdery mildew disease. Moreover, subcellular localization analysis showed that both BnHRa-YFP and BnHRb-YFP were mainly localized to the extra-haustorial membrane (EHM encasing the haustorium of powdery mildew. Taken together, our data suggest that the duplicated BnHR genes might have been subjected to differential selection and at least some may play a role in defense and could serve as resistance resource in engineering disease-resistant plants.

  12. Brassica napus seed endosperm - metabolism and signaling in a dead end tissue. (United States)

    Lorenz, Christin; Rolletschek, Hardy; Sunderhaus, Stephanie; Braun, Hans-Peter


    Oilseeds are an important element of human nutrition and of increasing significance for the production of industrial materials. The development of the seeds is based on a coordinated interplay of the embryo and its surrounding tissue, the endosperm. This study aims to give insights into the physiological role of endosperm for seed development in the oilseed crop Brassica napus. Using protein separation by two-dimensional (2D) isoelectric focusing (IEF)/SDS polyacrylamide gel electrophoresis (PAGE) and protein identification by mass spectrometry three proteome projects were carried out: (i) establishment of an endosperm proteome reference map, (ii) proteomic characterization of endosperm development and (iii) comparison of endosperm and embryo proteomes. The endosperm proteome reference map comprises 930 distinct proteins, including enzymes involved in genetic information processing, carbohydrate metabolism, environmental information processing, energy metabolism, cellular processes and amino acid metabolism. To investigate dynamic changes in protein abundance during seed development, total soluble proteins were extracted from embryo and endosperm fractions at defined time points. Proteins involved in sugar converting and recycling processes, ascorbate metabolism, amino acid biosynthesis and redox balancing were found to be of special importance for seed development in B. napus. Implications for the seed filling process and the function of the endosperm for seed development are discussed. The endosperm is of key importance for embryo development during seed formation in plants. We present a broad study for characterizing endosperm proteins in the oilseed plant B. napus. Furthermore, a project on the biochemical interplay between the embryo and the endosperm during seed development is presented. We provide evidence that the endosperm includes a complete set of enzymes necessary for plant primary metabolism. Combination of our results with metabolome data will further

  13. Adventitious presence of other varieties in oilseed rape (¤Brassica napus¤) from seed banks and certified seed

    DEFF Research Database (Denmark)

    Jørgensen, T.; Hauser, Thure Pavlo; Bagger Jørgensen, Rikke


    To obtain information on possible sources of contamination of the seed harvest of oilseed rape (Brassica napus L., spp. napus) by other varieties (adventitious presence), we investigated the purity of certified seed lots; the abundance and origin of volunteers; and longevity and origin of seeds...... in the soil seed-bank. This information was acquired through DNA analysis of volunteers collected in the field and seedlings derived from the soil seed-bank. DNA profiles of the volunteers and seedlings were obtained using Inter Simple Sequence Repeat (ISSR) markers, and the profiles were compared with ISSR...... profiles from an assortment of 14 of the most commonly cultivated oilseed rape varieties from 1985 to 2004. This comparison was performed using the assignment program, AFLPOP. The age of the seed bank germinating to become volunteers was assumed from information on previously cultivated oilseed rape...

  14. Dissecting quantitative trait loci for boron efficiency across multiple environments in Brassica napus.

    Directory of Open Access Journals (Sweden)

    Zunkang Zhao

    Full Text Available High yield is the most important goal in crop breeding, and boron (B is an essential micronutrient for plants. However, B deficiency, leading to yield decreases, is an agricultural problem worldwide. Brassica napus is one of the most sensitive crops to B deficiency, and considerable genotypic variation exists among different cultivars in response to B deficiency. To dissect the genetic basis of tolerance to B deficiency in B. napus, we carried out QTL analysis for seed yield and yield-related traits under low and normal B conditions using the double haploid population (TNDH by two-year and the BQDH population by three-year field trials. In total, 80 putative QTLs and 42 epistatic interactions for seed yield, plant height, branch number, pod number, seed number, seed weight and B efficiency coefficient (BEC were identified under low and normal B conditions, singly explaining 4.15-23.16% and 0.53-14.38% of the phenotypic variation. An additive effect of putative QTLs was a more important controlling factor than the additive-additive effect of epistatic interactions. Four QTL-by-environment interactions and 7 interactions between epistatic interactions and the environment contributed to 1.27-4.95% and 1.17-3.68% of the phenotypic variation, respectively. The chromosome region on A2 of SYLB-A2 for seed yield under low B condition and BEC-A2 for BEC in the two populations was equivalent to the region of a reported major QTL, BE1. The B. napus homologous genes of Bra020592 and Bra020595 mapped to the A2 region and were speculated to be candidate genes for B efficiency. These findings reveal the complex genetic basis of B efficiency in B. napus. They provide a basis for the fine mapping and cloning of the B efficiency genes and for breeding B-efficient cultivars by marker-assisted selection (MAS.

  15. Genetic and epigenetic changes in oilseed rape (Brassica napus L. extracted from intergeneric allopolyploid and additions with Orychophragmus

    Directory of Open Access Journals (Sweden)

    Mayank eGautam


    Full Text Available ABSTRACT Allopolyploidization with the merger of the genomes from different species has been shown to be associated with genetic and epigenetic changes. But the maintenance of such alterations related to one parental species after the genome is extracted from the allopolyploid remains to be detected. In this study, the genome of Brassica napus L. (2n=38, genomes AACC was extracted from its intergeneric allohexaploid (2n=62, genomes AACCOO with another crucifer Orychophragmus violaceus (2n=24, genome OO, by backcrossing and development of alien addition lines. B. napus-type plants identified in the self-pollinated progenies of nine monosomic additions were analyzed by the methods of amplified fragment length polymorphism (AFLP, sequence-specific amplified polymorphism (SSAP, and methylation-sensitive amplified polymorphism (MSAP. They showed modifications to certain extents in genomic components (loss and gain of DNA segments and transposons, introgression of alien DNA segments and DNA methylation, compared with B. napus donor. The significant differences in the changes between the B. napus types extracted from these additions likely resulted from the different effects of individual alien chromosomes. Particularly, the additions which harbored the O. violaceus chromosome carrying dominant rRNA genes over those of B. napus tended to result in the development of plants which showed fewer changes, suggesting a role of the expression levels of alien rRNA genes in genomic stability. These results provided new cues for the genetic alterations in one parental genome that are maintained even after the genome becomes independent.

  16. Population genomic analysis reveals differential evolutionary histories and patterns of diversity across subgenomes and subpopulations of Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Elodie eGazave


    Full Text Available The allotetraploid species Brassica napus L. is a global crop of major economic importance, providing canola oil (seed and vegetables for human consumption and fodder and meal for livestock feed. Characterizing the genetic diversity present in the extant germplasm pool of B. napus is fundamental to better conserve, manage and utilize the genetic resources of this species. We used sequence-based genotyping to identify and genotype 30,881 SNPs in a diversity panel of 782 B. napus accessions, representing samples of winter and spring growth habits originating from 33 countries across Europe, Asia and America. We detected strong population structure broadly concordant with growth habit and geography, and identified three major genetic groups: spring (SP, winter Europe (WE, and winter Asia (WA. Subpopulation-specific polymorphism patterns suggest enriched genetic diversity within the WA group and a smaller effective breeding population for the SP group compared to WE. Interestingly, the two subgenomes of B. napus appear to have different geographic origins, with phylogenetic analysis placing WE and WA as basal clades for the other subpopulations in the C and A subgenomes, respectively. Finally, we identified 16 genomic regions where the patterns of diversity differed markedly from the genome-wide average, several of which are suggestive of genomic inversions. The results obtained in this study constitute a valuable resource for worldwide breeding efforts and the genetic dissection and prediction of complex B. napus traits.

  17. Apis mellifera (Hymenoptera: Apidae as a potential Brassica napus pollinator (cv. Hyola 432 (Brassicaceae, in Southern Brazil Apis mellifera (Hymenoptera: Apidae como potencial polinizador de Brassica napus (cv. Hyola 432 (Brassicaceae, no Sul do Brasil

    Directory of Open Access Journals (Sweden)

    AS. Rosa


    Full Text Available Brassica napus Linnaeus is considered a self-compatible crop; however, studies show that bee foraging elevates their seed production. Considering bee food shortages during the winter season and that the canola is a winter crop, this study aimed to evaluate the foraging behaviour of Apis mellifera Linnaeus, 1758 regarding those flowers, and to verify if it presents adequate behaviour for successfully pollinating this crop in Rio Grande do Sul State. The study was carried out in a canola field, in Southern Brazil. The anthesis stages were morphologically characterised and then related to stigma receptivity and pollen grain viability. Similarly, the behaviour of A. mellifera individuals on flowers was followed, considering the number of flowers visited per plant, the amount of time spent on the flowers, touched structures, and collected resources. Floral fidelity was inferred by analysing the pollen load of bees collected on flowers. The bees visited from 1-7 flowers/plant (x = 2.02; sd = 1.16, the time spent on the flowers varied between 1-43 seconds (x = 3.29; sd = 2.36 and, when seeking nectar and pollen, they invariably touched anthers and stigmas. The pollen load presented 100% of B. napus pollen. The bees' attendance to a small number of flowers/plants, their short permanence on flowers, their contact with anthers and stigma and the integral floral constancy allows their consideration as potential B. napus pollinators.Brassica napus Linnaeus é considerada uma cultura autocompatível, entretanto, estudos indicam que o forrageio de abelhas eleva sua produtividade de sementes. Considerando-se a escassez de alimento para abelhas no inverno e a canola sendo uma cultura desse período, objetivou-se avaliar o comportamento de forrageio de Apis mellifera Linnaeus, 1758 nas suas flores e verificar se apresenta comportamento propício ao sucesso de polinização dessa cultura no Rio Grande do Sul. O estudo foi desenvolvido em lavoura de canola, no Sul

  18. Effect of Heavy Metals in Plants of the Genus Brassica (United States)

    Mourato, Miguel P.; Moreira, Inês N.; Leitão, Inês; Pinto, Filipa R.; Sales, Joana R.; Louro Martins, Luisa


    Several species from the Brassica genus are very important agricultural crops in different parts of the world and are also known to be heavy metal accumulators. There have been a large number of studies regarding the tolerance, uptake and defense mechanism in several of these species, notably Brassica juncea and B. napus, against the stress induced by heavy metals. Numerous studies have also been published about the capacity of these species to be used for phytoremediation purposes but with mixed results. This review will focus on the latest developments in the study of the uptake capacity, oxidative damage and biochemical and physiological tolerance and defense mechanisms to heavy metal toxicity on six economically important species: B. juncea, B. napus, B. oleracea, B. carinata, B. rapa and B. nigra. PMID:26247945

  19. Ameliorating influence of sulfur on germination attributes of canola (brassica napus l.) under chromium stress

    International Nuclear Information System (INIS)

    Jahan, S.; Iqbal, S.; Jabeen, K.; Sadaf, S.


    An experiment was performed to evaluate the role of sulfur to induce tolerance in Brassica napus L. against chromium stress by estimating the changes in germination parameters. Petriplates were assembled in Randomized Complete Block Design. A total 9 sets of treatments viz., control, chromium treated (40 and 160ppm), sulfur treated (50 and 150ppm) and sulfur (50 and 150ppm) combined with chromium (40 and 160ppm) with three replicates was used. Chromium under both concentrations was responsible for significant decline in germination parameters i.e. germination percentage, germination rate, seedling vigor index, shoot and root length, fresh weight and dry weight of seedlings. Sulfur application under chromium stress resulted in improvement of germination parameters such as germination percentage, germination rate, seedling vigor index, shoot and root length, fresh weight and dry weight of seedlings in contrast to chromium treatment. So, it can be concluded that sulfur in appropriate dose can be used to ameliorate the negative effects of chromium by increasing the germination potential of canola. (author)

  20. Foliar K application delays leaf senescence of winter rape-seed (Brassica napus L.) under waterlogging

    Institute of Scientific and Technical Information of China (English)

    Lin Wan; Chao Hu; Chang Chen; Liyan Zhang; Ni Ma; Chunlei Zhang


    To better understand waterlogging effect on leaf senescence in winter rapseed (Brassica napus L.) during flowering stage, experiments were designed to explore foliar K application influences on adverse effects of waterlogging stress. Winter rapeseed was sprayed with K after waterlogging at initial flowering stage. Results indicated that waterlog-ging significantly decreased leaf net photosynthetic rate (Pn), stomatal conductance (Gs), intercellular CO2 concentration (Ci) and transpiration rate (Tr). It also declined maximum quantum yield of PS II (Fv/Fm), quantum yield of electron transport (ΦPS II) and pho-tochemical quenching (qP), but increased leaf non-photochemical quenching (NPQ) and minimal fluorescence (Fo). Interestingly, exogenous application of K significantly alleviated waterlogging-induced photosynthesis inhibition. Foliar K application increased RuBisCO activation, chlorophyll and soluble protein contents, while significantly decreased MDA con-tent under waterlogging stress. Moreover, K supplementation improved accumulation of K+, Ca2+, Mg2+, N, Zn2+, Mn2+, Fe2+ in leaves. In general, foliar K application is effective in alleviating deleterious effects of waterlogging stress and delays leaf senescence of winter rapeseed.

  1. Attack modes and defence reactions in pathosystems involving Sclerotinia sclerotiorum, Brassica carinata, B. juncea and B. napus. (United States)

    Uloth, Margaret B; Clode, Peta L; You, Ming Pei; Barbetti, Martin J


    Sclerotinia stem rot (SSR, Sclerotinia sclerotiorum) is a damaging disease of oilseed brassicas world-wide. Host resistance is urgently needed to achieve control, yet the factors that contribute to stem resistance are not well understood. This study investigated the mechanisms of resistance to SSR. Stems of 5-week-old Brassica carinata, B. juncea and B. napus of known resistance were infected via filter paper discs impregnated with S. sclerotiorum mycelium under controlled conditions. Transverse sections of the stem and portions of the stem surface were examined using optical and scanning electron microscopy. The association of anatomical features with the severity of disease (measured by mean lesion length) was determined. Several distinct resistance mechanisms were recorded for the first time in these Brassica-pathogen interactions, including hypersensitive reactions and lignification within the stem cortex, endodermis and in tissues surrounding the lesions. Genotypes showing a strong lignification response 72 h post-infection (hpi) tended to have smaller lesions. Extensive vascular invasion by S. sclerotiorum was observed only in susceptible genotypes, especially in the vascular fibres and xylem. Mean lesion length was negatively correlated with the number of cell layers in the cortex, suggesting progress of S. sclerotiorum is impeded by more cell layers. Hyphae in the centre of lesions became highly vacuolate 72 hpi, reflecting an ageing process in S. sclerotiorum hyphal networks that was independent of host resistance. The infection process of S. sclerotiorum was analogous in B. carinata and B. napus. Infection cushions of the highly virulent isolate of S. sclerotiorum MBRS-1 were grouped together in dense parallel bundles, while hyphae in the infection cushions of a less aggressive isolate WW-3 were more diffuse, and this was unaffected by host genotype. A variety of mechanisms contribute to host resistance against S. sclerotiorum across the three

  2. Growth and "1"3"7Cs uptake and accumulation among 56 Japanese cultivars of Brassica rapa, Brassica juncea and Brassica napus grown in a contaminated field in Fukushima: Effect of inoculation with a Bacillus pumilus strain

    International Nuclear Information System (INIS)

    Djedidi, Salem; Kojima, Katsuhiro; Ohkama-Ohtsu, Naoko; Bellingrath-Kimura, Sonoko Dorothea; Yokoyama, Tadashi


    Fifty six local Japanese cultivars of Brassica rapa (40 cultivars), Brassica juncea (10 cultivars) and Brassica napus (6 cultivars) were assessed for variability in growth and "1"3"7Cs uptake and accumulation in association with a Bacillus pumilus strain. Field trial was conducted at a contaminated farmland in Nihonmatsu city, in Fukushima prefecture. Inoculation resulted in different responses of the cultivars in terms of growth and radiocesium uptake and accumulation. B. pumilus induced a significant increase in shoot dry weight in 12 cultivars that reached up to 40% in one B. rapa and three B. juncea cultivars. Differences in radiocesium uptake were observed between the cultivars of each Brassica species. Generally, inoculation resulted in a significant increase in "1"3"7Cs uptake in 22 cultivars, while in seven cultivars it was significantly decreased. Regardless of plant cultivar and bacterial inoculation, the transfer of "1"3"7Cs to the plant shoots (TF) varied by a factor of up to 5 and it ranged from to 0.011 to 0.054. Five inoculated cultivars, showed enhanced shoot dry weights and decreased "1"3"7Cs accumulations, among which two B. rapa cultivars named Bitamina and Nozawana had a significantly decreased "1"3"7Cs accumulation in their shoots. Such cultivars could be utilized to minimize the entry of radiocesium into the food chain; however, verifying the consistency of their radiocesium accumulation in other soils is strongly required. Moreover, the variations in growth and radiocesium accumulation, as influenced by Bacillus inoculation, could help selecting well grown inoculated Brassica cultivars with low radiocesium accumulation in their shoots. - Highlights: • Out of 56 Brassica cultivars, inoculation significantly increased shoot dry weight in 12 cultivars. • Inoculation triggered a significant increase and decrease in "1"3"7Cs uptake, respectively in 22 and 7 cultivars. • Five cultivars had an enhanced shoot dry weight and decreased "1"3"7Cs

  3. Effect of arabinogalactan proteins from the root caps of pea and Brassica napus on Aphanomyces euteiches zoospore chemotaxis and germination. (United States)

    Cannesan, Marc Antoine; Durand, Caroline; Burel, Carole; Gangneux, Christophe; Lerouge, Patrice; Ishii, Tadashi; Laval, Karine; Follet-Gueye, Marie-Laure; Driouich, Azeddine; Vicré-Gibouin, Maïté


    Root tips of many plant species release a number of border, or border-like, cells that are thought to play a major role in the protection of root meristem. However, little is currently known on the structure and function of the cell wall components of such root cells. Here, we investigate the sugar composition of the cell wall of the root cap in two species: pea (Pisum sativum), which makes border cells, and Brassica napus, which makes border-like cells. We find that the cell walls are highly enriched in arabinose and galactose, two major residues of arabinogalactan proteins. We confirm the presence of arabinogalactan protein epitopes on root cap cell walls using immunofluorescence microscopy. We then focused on these proteoglycans by analyzing their carbohydrate moieties, linkages, and electrophoretic characteristics. The data reveal (1) significant structural differences between B. napus and pea root cap arabinogalactan proteins and (2) a cross-link between these proteoglycans and pectic polysaccharides. Finally, we assessed the impact of root cap arabinogalactan proteins on the behavior of zoospores of Aphanomyces euteiches, an oomycetous pathogen of pea roots. We find that although the arabinogalactan proteins of both species induce encystment and prevent germination, the effects of both species are similar. However, the arabinogalactan protein fraction from pea attracts zoospores far more effectively than that from B. napus. This suggests that root arabinogalactan proteins are involved in the control of early infection of roots and highlights a novel role for these proteoglycans in root-microbe interactions.

  4. Occurrence of Diaretiella rapae (Mc´Intosh, 1855 (Hymenoptera: Aphidiidae Parasitising Lipaphis erysimi (Kaltenbach, 1843 and Brevicoryne brassicae (L. 1758 (Homoptera: Aphididae in Brassica napus in Mato Grosso do Sul

    Directory of Open Access Journals (Sweden)

    Mussury Rosilda Mara


    Full Text Available The occurrence of Diaretiella rapae parasitising Lipaphis erysimi and Brevicoryne brassicae in canola field (Brassica napus was evaluated through two sample methods in Dourados-MS. The methods, used weekly, were: entomologic sweep net and plants sacking. The aphids population was observed from initial to the senescence plant development. Aphids were more abundant during the flowering phase, and they were usually located in the stems of the inflorescence and development fruits. In this phase the largest parasitism level for D. rapae (89,7% occurred. The sample method with a sweep net captured significantly (t=4,484, P <= 0,01 more D. rapae while sacking method captured more parasitise aphids (t=2,199 with P <= 0,05 and active aphids (t=3,513, P <= 0,01.

  5. Chromium-induced physio-chemical and ultrastructural changes in four cultivars of Brassica napus L. (United States)

    Gill, Rafaqat A; Zang, Lili; Ali, Basharat; Farooq, Muhammad A; Cui, Peng; Yang, Su; Ali, Shafaqat; Zhou, Weijun


    In nature, plants are continuously exposed to several biotic and abiotic stresses. Among these stresses, chromium (Cr) stress is one of the most adverse factors that affects the plant growth, and productivity, and imposes a severe threat for sustainable crop production. In the present study, toxic effects of Cr were studied in hydroponically grown seedlings of four different cultivars of Brassica napus L. viz. ZS 758, Zheda 619, ZY 50 and Zheda 622. The study revealed that elevated Cr concentrations reduced the plant growth rate and biomass as compared to respective controls in all the cultivars and this decline was more obvious in Zheda 622. It was observed that reduction of photosynthetic attributes was more pronounced in Zheda 622 as compared to other cultivars; while, cultivar ZS 758 performed better under Cr-toxicity. Results showed that Cr contents in different parts of seedlings were higher in Zheda 622 as compared to other cultivars and Cr contents were higher in roots than shoots in all the cultivars. Accumulation of reactive oxygen species (ROS) and malondialdehyde (MDA) were induced under different Cr concentrations. Results showed that some of anti-oxidant enzyme activities in leaves and roots were increased under the Cr-toxicity. The electron microscopic study showed that ultrastructural damages in leaf mesophyll and root tip cells were more prominent in Zheda 622 as compared to other cultivars under 400 μM Cr stress. Under 400 μM Cr concentration, changes like broken cell wall, immature nucleus, a number of mitochondria, ruptured thylakoid membranes and large size of vacuole and starch grains were observed in leaf ultrastructures. The damages in root cells were observed in the form of disruption of golgibodies and diffused cell wall under the higher concentration of Cr (400 μM). On the basis of these observations, it was concluded that Zheda 622 was found to be more sensitive as followed by ZY 50, Zheda 619 and ZS 758 under Cr-toxicity. Copyright

  6. Male fitness of oilseed rape (¤Brassica napus¤), weedy ¤B-rapa¤ and their F1 hybrids when pollinating ¤B-rapa¤ seeds

    DEFF Research Database (Denmark)

    Pertl, M.; Hauser, T.P.; Damgaard, C.


    The likelihood that two species hybridise and backcross may depend strongly on environmental conditions, and possibly on competitive interactions between parents and hybrids. We studied the paternity of seeds produced by weedy Brassica rapa growing in mixtures with oilseed rape (B. napus) and the...... is strongly influenced by their local frequencies, and that male fitness of F(1)hybrids, when pollinating B. rapa seeds, is low even when their female fitness (seed set) is high.......The likelihood that two species hybridise and backcross may depend strongly on environmental conditions, and possibly on competitive interactions between parents and hybrids. We studied the paternity of seeds produced by weedy Brassica rapa growing in mixtures with oilseed rape (B. napus......) and their F(1) hybrids at different frequencies and densities. Paternity was determined by the presence of a transgene, morphology, and AFLP markers. In addition, observations of flower and pollen production, and published data on pollen fertilisation success, zygote survival, and seed germination, allowed us...

  7. The receptor-like kinase SOBIR1 interacts with Brassica napus LepR3 and is required for Leptosphaeria maculans AvrLm1-triggered immunity

    Directory of Open Access Journals (Sweden)

    Lisong eMa


    Full Text Available AbstractThe fungus Leptosphaeria maculans (L. maculans is the causal agent of blackleg disease of canola/oilseed rape (Brassica napus worldwide. We previously reported cloning of the B. napus blackleg resistance gene, LepR3, which encodes a receptor-like protein. LepR3 triggers localised cell death upon recognition of its cognate Avr protein, AvrLm1. Here, we exploited the Nicotiana benthamiana model plant to investigate the recognition mechanism of AvrLm1 by LepR3. Co-expression of the LepR3/AvrLm1 gene pair in N. benthamiana resulted in development of a hypersensitive response (HR. However, a truncated AvrLm1 lacking its indigenous signal peptide was compromised in its ability to induce LepR3-mediated HR, indicating that AvrLm1 is perceived by LepR3 extracellularly. Structure-function analysis of the AvrLm1 protein revealed that the C-terminal region of AvrLm1 was required for LepR3-mediated HR in N. benthamiana and for resistance to L. maculans in B. napus. LepR3 was shown to be physically interacting with the B. napus receptor like kinase, SOBIR1 (BnSOBIR1. Silencing of NbSOBIR1 or NbSERK3 (BAK1 compromised LepR3-AvrLm1-dependent HR in N. benthamiana, suggesting that LepR3-mediated resistance to L. maculans in B. napus requires SOBIR1 and BAK1/SERK3. Using this model system, we determined that BnSOBIR1 and SERK3/BAK1 are essential partners in the LepR3 signalling complex and were able to define the AvrLm1 effector domain.

  8. Altered Fruit and Seed Development of Transgenic Rapeseed (Brassica napus Over-Expressing MicroRNA394.

    Directory of Open Access Journals (Sweden)

    Jian Bo Song

    Full Text Available Fruit and seed development in plants is a complex biological process mainly involved in input and biosynthesis of many storage compounds such as proteins and oils. Although the basic biochemical pathways for production of the storage metabolites in plants are well characterized, their regulatory mechanisms are not fully understood. In this study, we functionally identified rapeseed (Brassica napus miR394 with its target gene Brassica napus leaf curling responsiveness (BnLCR to dissect a role of miR394 during the fruit and seed development. Transgenic rapeseed plants over-expressing miR394 under the control of the cauliflower mosaic virus 35S promoter were generated. miR394 over-expression plants exhibited a delayed flowering time and enlarged size of plants, leaf blade, pods and seed body, but developed seeds with higher contents of protein and glucosinolates (GLS and lower levels of oil accumulation as compared to wild-type. Over-expression of miR394 altered the fatty acid (FA composition by increasing several FA species such as C16:0 and C18:0 and unsaturated species of C20:1 and C22:1 but lowering C18:3. This change was accompanied by induction of genes coding for transcription factors of FA synthesis including leafy cotyledon1 (BnLEC1, BnLEC2, and FUSCA3 (FUS3. Because the phytohormone auxin plays a crucial role in fruit development and seed patterning, the DR5-GUS reporter was used for monitoring the auxin response in Arabidopsis siliques and demonstrated that the DR5 gene was strongly expressed. These results suggest that BnmiR394 is involved in rapeseed fruit and seed development.

  9. Mutagenesis and haploid culture for disease resistance in Brassica napus

    Energy Technology Data Exchange (ETDEWEB)

    MacDonald, M V; Ahmad, I; Ingram, D S [Botany School, University of Cambridge, Cambridge (United Kingdom)


    Full text: Most winter oilseed rape cultivars share parentage and therefore show little genetic diversity. There is no known resistance to Alternaria spp. in oilseed rape or in any related Brassica species. Experiments with tissue culture yielded only transient, non-genetic resistance. Therefore, mutagenesis may be used to generate heritable resistance to Alternaria spp. Gamma irradiation was applied to seeds of 'Bienvenue', secondary embryoids of cvs 'Primor' and 'Rapora', and buds of cvs 'Primor' and 'Ariana'. Isolated microspores from cv 'Ariana' and rapid cycling B. napus were also treated. The doses used ranged from 0-100 Gy for isolated microspores and buds, up to 600 Gy for seeds and 960 Gy for secondary embryoids. EMS was used to treat seeds of line WRG-42 (supplied by Nickersons RPB) and microspores of cv 'Bienvenue' and rapid cycling B. napus. Seeds were treated with up to 2.0% EMS for 0.2 h. before plating them on the culture medium. Seed irradiation up to 600 Gy did not reduce germination. M{sub 1} and M{sub 2} progenies were tested both in the laboratory and in field trials, and none of these were found to be resistant to Alternaria. However, considerable variation for other characters was observed. Haploid cultures from these plants were extremely difficult to regenerate, and for this reason no regenerant plants have been tested for resistance. For irradiated secondary embryoids the regeneration capacity decreased with increasing dose. Regenerated plants have been tested for resistance to Alternaria, but stable resistance was not observed. Haploid cultures were obtained from irradiated buds, using both anther and microspore culture. Low irradiation treatment was beneficial to developing embryoids. Some regenerants have been obtained from EMS treated microspores and seeds. Four plants have repeatedly given increased levels of resistance to A. brassicicola, and progenies are being tested to determine the genetic nature of the resistance. (author)

  10. Mutagenesis and haploid culture for disease resistance in Brassica napus

    International Nuclear Information System (INIS)

    MacDonald, M.V.; Ahmad, I.; Ingram, D.S.


    Full text: Most winter oilseed rape cultivars share parentage and therefore show little genetic diversity. There is no known resistance to Alternaria spp. in oilseed rape or in any related Brassica species. Experiments with tissue culture yielded only transient, non-genetic resistance. Therefore, mutagenesis may be used to generate heritable resistance to Alternaria spp. Gamma irradiation was applied to seeds of 'Bienvenue', secondary embryoids of cvs 'Primor' and 'Rapora', and buds of cvs 'Primor' and 'Ariana'. Isolated microspores from cv 'Ariana' and rapid cycling B. napus were also treated. The doses used ranged from 0-100 Gy for isolated microspores and buds, up to 600 Gy for seeds and 960 Gy for secondary embryoids. EMS was used to treat seeds of line WRG-42 (supplied by Nickersons RPB) and microspores of cv 'Bienvenue' and rapid cycling B. napus. Seeds were treated with up to 2.0% EMS for 0.2 h. before plating them on the culture medium. Seed irradiation up to 600 Gy did not reduce germination. M 1 and M 2 progenies were tested both in the laboratory and in field trials, and none of these were found to be resistant to Alternaria. However, considerable variation for other characters was observed. Haploid cultures from these plants were extremely difficult to regenerate, and for this reason no regenerant plants have been tested for resistance. For irradiated secondary embryoids the regeneration capacity decreased with increasing dose. Regenerated plants have been tested for resistance to Alternaria, but stable resistance was not observed. Haploid cultures were obtained from irradiated buds, using both anther and microspore culture. Low irradiation treatment was beneficial to developing embryoids. Some regenerants have been obtained from EMS treated microspores and seeds. Four plants have repeatedly given increased levels of resistance to A. brassicicola, and progenies are being tested to determine the genetic nature of the resistance. (author)

  11. Comparative mitochondrial genome analysis reveals the evolutionary rearrangement mechanism in Brassica. (United States)

    Yang, J; Liu, G; Zhao, N; Chen, S; Liu, D; Ma, W; Hu, Z; Zhang, M


    The genus Brassica has many species that are important for oil, vegetable and other food products. Three mitochondrial genome types (mitotype) originated from its common ancestor. In this paper, a B. nigra mitochondrial main circle genome with 232,407 bp was generated through de novo assembly. Synteny analysis showed that the mitochondrial genomes of B. rapa and B. oleracea had a better syntenic relationship than B. nigra. Principal components analysis and development of a phylogenetic tree indicated maternal ancestors of three allotetraploid species in Us triangle of Brassica. Diversified mitotypes were found in allotetraploid B. napus, in which napus-type B. napus was derived from B. oleracea, while polima-type B. napus was inherited from B. rapa. In addition, the mitochondrial genome of napus-type B. napus was closer to botrytis-type than capitata-type B. oleracea. The sub-stoichiometric shifting of several mitochondrial genes suggested that mitochondrial genome rearrangement underwent evolutionary selection during domestication and/or plant breeding. Our findings clarify the role of diploid species in the maternal origin of allotetraploid species in Brassica and suggest the possibility of breeding selection of the mitochondrial genome. © 2015 German Botanical Society and The Royal Botanical Society of the Netherlands.

  12. Leptosphaeria maculans effector AvrLm4-7 affects salicylic acid (SA) and ethylene (ET) signalling and hydrogen peroxide (H2O2) accumulation in Brassica napus

    Czech Academy of Sciences Publication Activity Database

    Nováková, Miroslava; Šašek, Vladimír; Trdá, Lucie; Krutinová, Hana; Mongin, T.; Valentová, O.; Balesdent, M.H.; Rouxel, T.; Burketová, Lenka


    Roč. 17, č. 6 (2016), s. 818-831 ISSN 1464-6722 R&D Projects: GA ČR GA13-26798S Institutional support: RVO:61389030 Keywords : AvrLm4-7 * Brassica napus * effector Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection Impact factor: 4.697, year: 2016

  13. Different zinc sensitivity of Brassica organs is accompanied by distinct responses in protein nitration level and pattern. (United States)

    Feigl, Gábor; Kolbert, Zsuzsanna; Lehotai, Nóra; Molnár, Árpád; Ördög, Attila; Bordé, Ádám; Laskay, Gábor; Erdei, László


    Zinc is an essential microelement, but its excess exerts toxic effects in plants. Heavy metal stress can alter the metabolism of reactive oxygen (ROS) and nitrogen species (RNS) leading to oxidative and nitrosative damages; although the participation of these processes in Zn toxicity and tolerance is not yet known. Therefore this study aimed to evaluate the zinc tolerance of Brassica organs and the putative correspondence of it with protein nitration as a relevant marker for nitrosative stress. Both examined Brassica species (B. juncea and B. napus) proved to be moderate Zn accumulators; however B. napus accumulated more from this metal in its organs. The zinc-induced damages (growth diminution, altered morphology, necrosis, chlorosis, and the decrease of photosynthetic activity) were slighter in the shoot system of B. napus than in B. juncea. The relative zinc tolerance of B. napus shoot was accompanied by moderate changes of the nitration pattern. In contrast, the root system of B. napus suffered more severe damages (growth reduction, altered morphology, viability loss) and slighter increase in nitration level compared to B. juncea. Based on these, the organs of Brassica species reacted differentially to excess zinc, since in the shoot system modification of the nitration pattern occurred (with newly appeared nitrated protein bands), while in the roots, a general increment in the nitroproteome could be observed (the intensification of the same protein bands being present in the control samples). It can be assumed that the significant alteration of nitration pattern is coupled with enhanced zinc sensitivity of the Brassica shoot system and the general intensification of protein nitration in the roots is attached to relative zinc endurance. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Genome-Wide Analysis of Seed Acid Detergent Lignin (ADL) and Hull Content in Rapeseed (Brassica napus L.) (United States)

    Wei, Lijuan; Qu, Cunmin; Xu, Xinfu; Lu, Kun; Qian, Wei; Li, Jiana; Li, Maoteng; Liu, Liezhao


    A stable yellow-seeded variety is the breeding goal for obtaining the ideal rapeseed (Brassica napus L.) plant, and the amount of acid detergent lignin (ADL) in the seeds and the hull content (HC) are often used as yellow-seeded rapeseed screening indices. In this study, a genome-wide association analysis of 520 accessions was performed using the Q + K model with a total of 31,839 single-nucleotide polymorphism (SNP) sites. As a result, three significant associations on the B. napus chromosomes A05, A09, and C05 were detected for seed ADL content. The peak SNPs were within 9.27, 14.22, and 20.86 kb of the key genes BnaA.PAL4, BnaA.CAD2/BnaA.CAD3, and BnaC.CCR1, respectively. Further analyses were performed on the major locus of A05, which was also detected in the seed HC examination. A comparison of our genome-wide association study (GWAS) results and previous linkage mappings revealed a common chromosomal region on A09, which indicates that GWAS can be used as a powerful complementary strategy for dissecting complex traits in B. napus. Genomic selection (GS) utilizing the significant SNP markers based on the GWAS results exhibited increased predictive ability, indicating that the predictive ability of a given model can be substantially improved by using GWAS and GS. PMID:26673885

  15. Quantitative Trait Locus Mapping of Salt Tolerance and Identification of Salt-Tolerant Genes in Brassica napus L

    Directory of Open Access Journals (Sweden)

    Lina Lang


    Full Text Available Salinity stress is one of typical abiotic stresses that seriously limit crop production. In this study, a genetic linkage map based on 532 molecular markers covering 1341.1 cM was constructed to identify the loci associated with salt tolerance in Brassica napus. Up to 45 quantitative trait loci (QTLs for 10 indicators were identified in the F2:3 populations. These QTLs can account for 4.80–51.14% of the phenotypic variation. A major QTL, qSPAD5 on LG5 associated with chlorophyll can be detected in three replicates. Two intron polymorphic (IP markers in this QTL region were developed successfully to narrow down the QTL location to a region of 390 kb. A salt tolerance related gene Bra003640 was primary identified as the candidate gene in this region. The full length of the candidate gene was 1,063 bp containing three exons and two introns in B. napus L. The open reading frame (ORF is 867 bp and encodes 287 amino acids. Three amino acid differences (34, 54, and 83 in the conserved domain (B-box were identified. RT-qPCR analysis showed that the gene expression had significant difference between the two parents. The study laid great foundation for salt tolerance related gene mapping and cloning in B. napus L.

  16. Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L (United States)

    Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.


    Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

  17. Effects on Brassica napus L. Yield and Yield Components of Super Absorbent Polymer under Different Irrigation Regimes

    Directory of Open Access Journals (Sweden)

    Alireza PIRZAD


    Full Text Available For evaluation of the effects of super absorbent polymer under different irrigation regimes on the yield and yield components of Brassica napus L., a factorial experiment was carried out, based on randomized complete block design with four replicas. Treatments included super absorbent polymer (0, 1, 2, 3, 4 and 5 g/kg soil and induced drought stress (irrigation at 25, 50 and 75 mm evaporation from class A pan. The experiment was conducted in pots with 5 kg of soil. Data analysis of variance showed the significant interaction effect between polymer and irrigation on the stem length, width and weight, the number of seeds per sheath, number of seeds per plant, the number of sterile and fertile sheath per plant, fertile sheath percentage (fertile sheath/ total sheath ×100, 1000 seeds weight, seed weight per plant, sheath weight per plant and the number of total sheath. The present study revealed that indifferent from the applied amounts of the super absorbent polymer, in all cases the measured characters have been more affected by induced drought stress.

  18. Brassica villosa, a system for studying non-glandular trichomes and genes in the Brassicas. (United States)

    Nayidu, Naghabushana K; Tan, Yifang; Taheri, Ali; Li, Xiang; Bjorndahl, Trent C; Nowak, Jacek; Wishart, David S; Hegedus, Dwayne; Gruber, Margaret Y


    Brassica villosa is a wild Brassica C genome species with very dense trichome coverage and strong resistance to many insect pests of Brassica oilseeds and vegetables. Transcriptome analysis of hairy B. villosa leaves indicated higher expression of several important trichome initiation genes compared with glabrous B. napus leaves and consistent with the Arabidopsis model of trichome development. However, transcripts of the TRY inhibitory gene in hairy B. villosa were surprisingly high relative to B. napus and relative transcript levels of SAD2, EGL3, and several XIX genes were low, suggesting potential ancillary or less important trichome-related roles for these genes in Brassica species compared with Arabidopsis. Several antioxidant, calcium, non-calcium metal and secondary metabolite genes also showed differential expression between these two species. These coincided with accumulation of two alkaloid-like compounds, high levels of calcium, and other metals in B. villosa trichomes that are correlated with the known tolerance of B. villosa to high salt and the calcium-rich natural habitat of this wild species. This first time report on the isolation of large amounts of pure B. villosa trichomes, on trichome content, and on relative gene expression differences in an exceptionally hairy Brassica species compared with a glabrous species opens doors for the scientific community to understand trichome gene function in the Brassicas and highlights the potential of B. villosa as a trichome research platform.

  19. Transcriptomic basis for drought-resistance in Brassica napus L. (United States)

    Wang, Pei; Yang, Cuiling; Chen, Hao; Song, Chunpeng; Zhang, Xiao; Wang, Daojie


    Based on transcriptomic data from four experimental settings with drought-resistant and drought-sensitive cultivars under drought and well-watered conditions, statistical analysis revealed three categories encompassing 169 highly differentially expressed genes (DEGs) in response to drought in Brassica napus L., including 37 drought-resistant cultivar-related genes, 35 drought-sensitive cultivar-related genes and 97 cultivar non-specific ones. We provide evidence that the identified DEGs were fairly uniformly distributed on different chromosomes and their expression patterns are variety specific. Except commonly enriched in response to various stimuli or stresses, different categories of DEGs show specific enrichment in certain biological processes or pathways, which indicated the possibility of functional differences among the three categories. Network analysis revealed relationships among the 169 DEGs, annotated biological processes and pathways. The 169 DEGs can be classified into different functional categories via preferred pathways or biological processes. Some pathways might simultaneously involve a large number of shared DEGs, and these pathways are likely to cross-talk and have overlapping biological functions. Several members of the identified DEGs fit to drought stress signal transduction pathway in Arabidopsis thaliana. Finally, quantitative real-time PCR validations confirmed the reproducibility of the RNA-seq data. These investigations are profitable for the improvement of crop varieties through transgenic engineering.

  20. Comparative transcriptomic analysis of two Brassica napus near-isogenic lines reveals a network of genes that influences seed oil accumulation

    Directory of Open Access Journals (Sweden)

    Jingxue Wang


    Full Text Available Rapeseed (Brassica napus is an important oil seed crop, providing more than 13% of the world’s supply of edible oils. An in-depth knowledge of the gene network involved in biosynthesis and accumulation of seed oil is critical for the improvement of B. napus. Using available genomic and transcriptomic resources, we identified 1,750 acyl lipid metabolism (ALM genes that are distributed over 19 chromosomes in the B. napus genome. B. rapa and B. oleracea, two diploid progenitors of B. napus, contributed almost equally to the ALM genes. Genome collinearity analysis demonstrated that the majority of the ALM genes have arisen due to genome duplication or segmental duplication events. In addition, we profiled the expression patterns of the ALM genes in four different developmental stages. Furthermore, we developed two B. napus near isogenic lines (NILs. The high oil NIL, YC13-559, accumulates more than 10% of seed oil compared to the other, YC13-554. Comparative gene expression analysis revealed upregulation of lipid biosynthesis-related regulatory genes in YC13-559, including SHOOTMERISTEMLESS, LEAFY COTYLEDON 1 (LEC1, LEC2, FUSCA3, ABSCISIC ACID INSENSITIVE 3 (ABI3, ABI4, ABI5, and WRINKLED1, as well as structural genes, such as ACETYL-CoA CARBOXYLASE, ACYL-CoA DIACYLGLYCEROL ACYLTRANSFERASE, and LONG-CHAIN ACYL-CoA SYNTHETASES. We observed that several genes related to the phytohormones, gibberellins, jasmonate, and indole acetic acid, were differentially expressed in the NILs. Our findings provide a broad account of the numbers, distribution, and expression profiles of acyl lipid metabolism genes, as well as gene networks that potentially control oil accumulation in B. napus seeds. The upregulation of key regulatory and structural genes related to lipid biosynthesis likely plays a major role for the increased seed oil in YC13-559.

  1. Effects of Gamma Irradiation on Quality Characteristic and Microbiological Safety of Rape (Brassica napus) Pollen

    International Nuclear Information System (INIS)

    Kim, Kyoung-Hee; Jeong, Su-Ji; Kim, Dam; Yook, Hong-Sun; Kim, Kwang-Hun


    This study is carried out to sanitize rape (Brassica napus) pollen by gamma irradiation. Rape pollens were treated with 0, 5, 10 and 15 kGy gamma irradiations, and then analyzed for the following: general composition, microbial population, reducing sugar, Hunter color values, TBARS (2-thiobarbituric acid reactive substances) values, and VBN (volatile basic nitrogen). Mold and coliform bacteria were not detected in the samples irradiated at 5 kGy or more. Yeasts and total aerobic bacteria were not detected in the samples irradiated at 10 kGy or more (102 CFU/g). Moisture, ash, crude protein, crude fat, carbohydrate, reducing sugar and the contents of volatile basic nitrogen in the irradiated pollen did not show any significant changes by irradiation. Hunter color values, L, a and b values were decreased with increment of irradiation dose. TBARS values were increased with an increment of irradiation dose. In conclusion, gamma irradiation at 5 kGy was considered to be an effective treatment to control for mycotoxin producing fungi in rape pollen to minimize changes of general composition and physicochemical properties. Further studies should be investigated to reduce the detrimental effects induced by irradiation

  2. Availability of phosphorus from ground phosphate rocks for rape (Brassica napus L.)

    International Nuclear Information System (INIS)

    Zhu Yongyi; Yang Juncheng; Chen Jingjian; Liu Delin; Zhu Zhaomin; Wu Ming


    The availability of phosphorus from the ground phosphate rock, which is provided by Kaiyang mining plant, Guizhou Province of China, is investigated in pot experiment with acid red soil for rape (Brassica napus L. No. 13 Xingyou, Chinese Olive Group) by 32 P indirect labelling method. The results show that the yield increased significantly by applying ground phosphate rock (GPR) and the efficiency of GPR is equal to 17.1% of that from calcium superphosphate. It is calculated as that the fertilizer efficiency of 1 kg of calcium superphosphate is the same as that of 8.53 kg ground phosphate rock in Guizhou Province of China. The effect on the grain yield is evaluated by pot and field microplot experiments, and it is found that the main effect is to increase the pod number. The fertilizer efficiency in field experiment is the same as that in pot experiment. (9 refs., 1 fig., 7 tabs.)

  3. Flowering Without Vernalization in Winter Canola (Brassica napus: use of Virus-Induced Gene Silencing (VIGS to accelerate genetic gain

    Directory of Open Access Journals (Sweden)

    Raúl Álvarez-Venegas


    Full Text Available Ciclos de reproducción cortos y la oportunidad de incrementar la ganancia genética, junto con el estudio de las bases moleculares de la vernalización, son áreas esenciales de investigación dentro de la biología de plantas. Varios métodos se han empleado para lograr el silenciamiento génico en plantas, pero ninguno reportado a la fecha para canola (Brassica napus, y en particular para inducir la floración sin vernalización en líneas de invierno a través del uso de secuencias sentido de DNA en vectores diseñados para el silenciamiento génico inducido por virus (VIGS. La presente investigación provee los métodos para transitoriamente regular a la baja, por medio de VIGS, genes de la vernalización en plantas anuales de invierno, específicamente la familia de genes de Flowering Locus C (FLC en canola de invierno (BnFLC1 a BnFLC5. La regulación a la baja de estos genes permite a las plantas anuales de invierno florecer sin vernalización y, consecuentemente, provee los medios para acelerar la ganancia genética. El sistema de silenciamiento propuesto puede ser utilizado para regular a la baja familias de genes, para determinar la función génica, y para inducir la floración sin la vernalización en líneas de invierno tanto del género Brassica como de muchos cultivos importantes de invierno.

  4. Differential flavonoid response to enhanced UV-B radiation in Brassica napus

    International Nuclear Information System (INIS)

    Olsson, L.C.; Veit, M.; Weissenböck, G.; Bornman, J.F.


    We have examined the qualitative and quantitative differences in methanol-soluble flavonoids of leaves of two cultivars of Brassica napus, which were grown with or without (control) supplemental UV-B radiation. The flavonoids were identified using HPLC-diode array spectroscopy (-DAS), -electrospray ionization-mass spectroscopy (-ESI-MS) and 1H and 13C NMR, and quantitatively analysed by HPLC-DAS. After exposure to supplementary UV-B radiation, the overall amount of soluble flavonoids, kaempferol and quercetin glycosides, increased by ca 150% in cv. Paroll, compared to control plants. Cultivar Stallion showed a 70% increase, and also a lower overall content of soluble flavonoids compared to Paroll. The supplementary UV-B radiation resulted in a marked, specific increase in the amount of quercetin glycosides relative to the kaempferol glycosides with a 36- and 23-fold increase in cvs Paroll and Stallion, respectively. Four of the flavonol glycosides appearing after supplemental UV-B exposure were identified as quercetin- and kaempferol 3-sophoroside-7-glucoside and 3-(2″′-E-sinapoylsophoroside)-7-glucoside. (author)

  5. A mutant Brassica napus (canola population for the identification of new genetic diversity via TILLING and next generation sequencing.

    Directory of Open Access Journals (Sweden)

    Erin J Gilchrist

    Full Text Available We have generated a Brassica napus (canola population of 3,158 EMS-mutagenised lines and used TILLING to demonstrate that the population has a high enough mutation density that it will be useful for identification of mutations in genes of interest in this important crop species. TILLING is a reverse genetics technique that has been successfully used in many plant and animal species. Classical TILLING involves the generation of a mutagenised population, followed by screening of DNA samples using a mismatch-specific endonuclease that cleaves only those PCR products that carry a mutation. Polyacrylamide gel detection is then used to visualise the mutations in any gene of interest. We have used this TILLING technique to identify 432 unique mutations in 26 different genes in B. napus (canola cv. DH12075. This reflects a mutation density ranging from 1/56 kb to 1/308 kb (depending on the locus with an average of 1/109 kb. We have also successfully verified the utility of next generation sequencing technology as a powerful approach for the identification of rare mutations in a population of plants, even in polyploid species such as B. napus. Most of the mutants we have identified are publically available.

  6. Genome-wide identification, functional prediction, and evolutionary analysis of the R2R3-MYB superfamily in Brassica napus. (United States)

    Hajiebrahimi, Ali; Owji, Hajar; Hemmati, Shiva


    R2R3-MYB transcription factors (TFs) have been shown to play important roles in plants, including in development and in various stress conditions. Phylogenetic analysis showed the presence of 249 R2R3-MYB TFs in Brassica napus, called BnaR2R3-MYB TFs, clustered into 38 clades. BnaR2R3-MYB TFs were distributed on 19 chromosomes of B. napus. Sixteen gene clusters were identified. BnaR2R3-MYB TFs were characterized by motif prediction, gene structure analysis, and gene ontology. Evolutionary analysis revealed that BnaR2R3-MYB TFs are mainly formed as a result of whole-genome duplication. Orthologs and paralogs of BnaR2R3-MYB TFs were identified in B. napus, B. rapa, B. oleracea, and Arabidopsis thaliana using synteny-based methods. Purifying selection was pervasive within R2R3-MYB TFs. K n /K s values lower than 0.3 indicated that BnaR2R3-MYB TFs are being functionally converged. The role of gene conversion in the formation of BnaR2R3-MYB TFs was significant. Cis-regulatory elements in the upstream regions of BnaR2R3-MYB genes, miRNA targeting BnaR2R3MYB TFs, and post translational modifications were identified. Digital expression data revealed that BnaR2R3-MYB genes were highly expressed in the roots and under high salinity treatment after 24 h. BnaMYB21, BnaMYB141, and BnaMYB148 have been suggested for improving salt-tolerant B. napus. BnaR2R3-MYB genes were mostly up regulated on the 14th day post inoculation with Leptosphaeria biglobosa and L. maculan. BnaMYB150 is a candidate for increased tolerance to Leptospheria in B. napus.

  7. BraLTP1, a lipid transfer protein gene involved in epicuticular wax deposition, cell proliferation and flower development in Brassica napus.

    Directory of Open Access Journals (Sweden)

    Fang Liu

    Full Text Available Plant non-specific lipid transfer proteins (nsLTPs constitute large multigene families that possess complex physiological functions, many of which remain unclear. This study isolated and characterized the function of a lipid transfer protein gene, BraLTP1 from Brassica rapa, in the important oilseed crops Brassica napus. BraLTP1 encodes a predicted secretory protein, in the little known VI Class of nsLTP families. Overexpression of BnaLTP1 in B. napus caused abnormal green coloration and reduced wax deposition on leaves and detailed wax analysis revealed 17-80% reduction in various major wax components, which resulted in significant water-loss relative to wild type. BnaLTP1 overexpressing leaves exhibited morphological disfiguration and abaxially curled leaf edges, and leaf cross-sections revealed cell overproliferation that was correlated to increased cytokinin levels (tZ, tZR, iP, and iPR in leaves and high expression of the cytokinin biosynthsis gene IPT3. BnaLTP1-overexpressing plants also displayed morphological disfiguration of flowers, with early-onset and elongated carpel development and outwardly curled stamen. This was consistent with altered expression of a a number of ABC model genes related to flower development. Together, these results suggest that BraLTP1 is a new nsLTP gene involved in wax production or deposition, with additional direct or indirect effects on cell division and flower development.

  8. A Novel Cytoplasmic Male Sterility in Brassica napus (inap CMS) with Carpelloid Stamens via Protoplast Fusion with Chinese Woad. (United States)

    Kang, Lei; Li, Pengfei; Wang, Aifan; Ge, Xianhong; Li, Zaiyun


    A novel cytoplasmic male sterility (CMS) in Brassica napus (inap CMS) was selected from the somatic hybrid with Isatis indigotica (Chinese woad) by recurrent backcrossing. The male sterility was caused by the conversion of tetradynamous stamens into carpelloid structures with stigmatoid tissues at their tips and ovule-like tissues in the margins, and the two shorter stamens into filaments without anthers. The feminized development of the stamens resulted in the complete lack of pollen grains, which was stable in different years and environments. The pistils of inap CMS displayed normal morphology and good seed-set after pollinated by B. napus . Histological sections showed that the developmental alteration of the stamens initiated at the stage of stamen primordium differentiation. AFLP analysis of the nuclear genomic composition with 23 pairs of selective primers detected no woad DNA bands in inap CMS. Twenty out of 25 mitochondrial genes originated from I. indigotica , except for cox2-2 which was the recombinant between cox2 from woad and cox2-2 from rapeseed. The novel cox2-2 was transcribed in flower buds of inap CMS weakly and comparatively with the fertile B. napus addition line Me harboring one particular woad chromosome. The restorers of other autoplasmic and alloplasmic CMS systems in rapeseed failed to restore the fertility of inap CMS and the screening of B. napus wide resources found no fertility restoration variety, showing its distinct origin and the related mechanism of sterility. The reasons for the mitochondrial rearrangements and the breeding of the restorer for the novel CMS system were discussed.

  9. Maghemite Nanoparticles Acts as Nanozymes, Improving Growth and Abiotic Stress Tolerance in Brassica napus (United States)

    Palmqvist, N. G. Martin; Seisenbaeva, Gulaim A.; Svedlindh, Peter; Kessler, Vadim G.


    Yttrium doping-stabilized γ-Fe2O3 nanoparticles were studied for its potential to serve as a plant fertilizer and, through enzymatic activity, support drought stress management. Levels of both hydrogen peroxide and lipid peroxidation, after drought, were reduced when γ-Fe2O3 nanoparticles were delivered by irrigation in a nutrient solution to Brassica napus plants grown in soil. Hydrogen peroxide was reduced from 151 to 83 μM g-1 compared to control, and the malondialdehyde formation was reduced from 36 to 26 mM g-1. Growth rate of leaves was enhanced from 33 to 50% growth compared to fully fertilized plants and SPAD-measurements of chlorophyll increased from 47 to 52 suggesting improved agronomic properties by use of γ-Fe2O3 nanoparticles as fertilizer as compared to chelated iron.

  10. Role of nitric oxide in cadmium-induced stress on growth, photosynthetic components and yield of Brassica napus L. (United States)

    Jhanji, Shalini; Setia, R C; Kaur, Navjyot; Kaur, Parminder; Setia, Neelam


    Experiments were carried out to study the effect of cadmium (Cd) and exogenous nitric oxide (NO) on growth, photosynthetic attributes, yield components and structural features of Brassica napus L. (cv. GSL 1). Cadmium in the growth medium at different levels (1, 2 and 4 Mm) retarded plant growth viz. shoot (27%) and root (51%) length as compared to control. The accumulation of total dry matter and its partitioning to different plant parts was also reduced by 31% due to Cd toxicity. Photosynthetic parameters viz., leaf area plant(-1) (51%), total Chl (27%), Chl a / Chl b ratio (22%) and Hill reaction activity of chloroplasts (42%) were greatly reduced in Cd-treated plants. Cd treatments adversely affected various yield parameters viz., number of branches (23) and siliquae plant(-1) (246), seed number siliqua(-1) (10.3), 1000-seed weight (2.30g) and seed yield plant(-1) (7.09g). Different Cd treatments also suppressed the differentiation of various tissues like vessels in the root with a maximum inhibition caused by 4mM Cd. Exogenous application of nitric oxide (NO) improved the various morpho-physiological and photosynthetic parameters in control as well as Cd-treated plants.

  11. Effect of Arabinogalactan Proteins from the Root Caps of Pea and Brassica napus on Aphanomyces euteiches Zoospore Chemotaxis and Germination12[C][W (United States)

    Cannesan, Marc Antoine; Durand, Caroline; Burel, Carole; Gangneux, Christophe; Lerouge, Patrice; Ishii, Tadashi; Laval, Karine; Follet-Gueye, Marie-Laure; Driouich, Azeddine; Vicré-Gibouin, Maïté


    Root tips of many plant species release a number of border, or border-like, cells that are thought to play a major role in the protection of root meristem. However, little is currently known on the structure and function of the cell wall components of such root cells. Here, we investigate the sugar composition of the cell wall of the root cap in two species: pea (Pisum sativum), which makes border cells, and Brassica napus, which makes border-like cells. We find that the cell walls are highly enriched in arabinose and galactose, two major residues of arabinogalactan proteins. We confirm the presence of arabinogalactan protein epitopes on root cap cell walls using immunofluorescence microscopy. We then focused on these proteoglycans by analyzing their carbohydrate moieties, linkages, and electrophoretic characteristics. The data reveal (1) significant structural differences between B. napus and pea root cap arabinogalactan proteins and (2) a cross-link between these proteoglycans and pectic polysaccharides. Finally, we assessed the impact of root cap arabinogalactan proteins on the behavior of zoospores of Aphanomyces euteiches, an oomycetous pathogen of pea roots. We find that although the arabinogalactan proteins of both species induce encystment and prevent germination, the effects of both species are similar. However, the arabinogalactan protein fraction from pea attracts zoospores far more effectively than that from B. napus. This suggests that root arabinogalactan proteins are involved in the control of early infection of roots and highlights a novel role for these proteoglycans in root-microbe interactions. PMID:22645070

  12. Analysis of gene expression in resynthesized Brassica napus Allopolyploids using arabidopsis 70mer oligo microarrays.

    Directory of Open Access Journals (Sweden)

    Robert T Gaeta

    Full Text Available BACKGROUND: Studies in resynthesized Brassica napus allopolyploids indicate that homoeologous chromosome exchanges in advanced generations (S(5ratio6 alter gene expression through the loss and doubling of homoeologous genes within the rearrangements. Rearrangements may also indirectly affect global gene expression if homoeologous copies of gene regulators within rearrangements have differential affects on the transcription of genes in networks. METHODOLOGY/PRINCIPAL FINDINGS: We utilized Arabidopsis 70mer oligonucleotide microarrays for exploring gene expression in three resynthesized B. napus lineages at the S(0ratio1 and S(5ratio6 generations as well as their diploid progenitors B. rapa and B. oleracea. Differential gene expression between the progenitors and additive (midparent expression in the allopolyploids were tested. The S(5ratio6 lines differed in the number of genetic rearrangements, allowing us to test if the number of genes displaying nonadditive expression was related to the number of rearrangements. Estimates using per-gene and common variance ANOVA models indicated that 6-15% of 26,107 genes were differentially expressed between the progenitors. Individual allopolyploids showed nonadditive expression for 1.6-32% of all genes. Less than 0.3% of genes displayed nonadditive expression in all S(0ratio1 lines and 0.1-0.2% were nonadditive among all S(5ratio6 lines. Differentially expressed genes in the polyploids were over-represented by genes differential between the progenitors. The total number of differentially expressed genes was correlated with the number of genetic changes in S(5ratio6 lines under the common variance model; however, there was no relationship using a per-gene variance model, and many genes showed nonadditive expression in S(0ratio1 lines. CONCLUSIONS/SIGNIFICANCE: Few genes reproducibly demonstrated nonadditive expression among lineages, suggesting few changes resulted from a general response to polyploidization

  13. Studies on nitrogen uptake and utilization by rape (Brassica napus L.) under different sowing dates

    International Nuclear Information System (INIS)

    Liu Qixin; Nie Guangming


    The nitrogen uptake and utilization by low erucic acid variety, Zhong You Di Gai No.2, of rape (Brassica napus L.) under different sowing dates were studied. Total N uptake, the percentage N derived from the fertilizer, the rate of utilization of nitrogenous fertilizer, the production efficiency of N-fertilizer (seed yield g/gN derived by rape plant from the fertilizer), total P uptake and the production efficiency of phosphorus (seed yield g/gP derived by rape plant from fertilizer and soil) were all significantly higher at early sowing than that at later sowing within the range of normal sowing dates. Therefore, the biomass yield, the seed yield and oil content all increased significantly at early sowing treatment, but erucic acid content showed no significant difference

  14. Genetic load and transgenic mitigating genes in transgenic Brassica rapa (field mustard × Brassica napus (oilseed rape hybrid populations

    Directory of Open Access Journals (Sweden)

    Warwick Suzanne I


    Full Text Available Abstract Background One theoretical explanation for the relatively poor performance of Brassica rapa (weed × Brassica napus (crop transgenic hybrids suggests that hybridization imparts a negative genetic load. Consequently, in hybrids genetic load could overshadow any benefits of fitness enhancing transgenes and become the limiting factor in transgenic hybrid persistence. Two types of genetic load were analyzed in this study: random/linkage-derived genetic load, and directly incorporated genetic load using a transgenic mitigation (TM strategy. In order to measure the effects of random genetic load, hybrid productivity (seed yield and biomass was correlated with crop- and weed-specific AFLP genomic markers. This portion of the study was designed to answer whether or not weed × transgenic crop hybrids possessing more crop genes were less competitive than hybrids containing fewer crop genes. The effects of directly incorporated genetic load (TM were analyzed through transgene persistence data. TM strategies are proposed to decrease transgene persistence if gene flow and subsequent transgene introgression to a wild host were to occur. Results In the absence of interspecific competition, transgenic weed × crop hybrids benefited from having more crop-specific alleles. There was a positive correlation between performance and number of B. napus crop-specific AFLP markers [seed yield vs. marker number (r = 0.54, P = 0.0003 and vegetative dry biomass vs. marker number (r = 0.44, P = 0.005]. However under interspecific competition with wheat or more weed-like conditions (i.e. representing a situation where hybrid plants emerge as volunteer weeds in subsequent cropping systems, there was a positive correlation between the number of B. rapa weed-specific AFLP markers and seed yield (r = 0.70, P = 0.0001, although no such correlation was detected for vegetative biomass. When genetic load was directly incorporated into the hybrid genome, by inserting a

  15. Conserved Function of ACYL–ACYL CARRIER PROTEIN DESATURASE 5 on Seed Oil and Oleic Acid Biosynthesis between Arabidopsis thaliana and Brassica napus

    Directory of Open Access Journals (Sweden)

    Changyu Jin


    Full Text Available Previous studies have shown that several ACYL–ACYL CARRIER PROTEIN DESATURASE (AtAAD members in Arabidopsis thaliana are responsible for oleic acid (C18:1 biosynthesis. Limited research has been conducted on another member, AtAAD5, and its paralog BnAAD5 in the closely related and commercially important plant, Brassica napus. Here, we found that AtAAD5 was predominantly and exclusively expressed in developing embryos at the whole seed developmental stages. The aad5 mutation caused a significant decrease in the amounts of oil and C18:1, and a considerable increase in the content of stearic acid (C18:0 in mature seeds, suggesting that AtAAD5 functioned as an important facilitator of seed oil biosynthesis. We also cloned the full-length coding sequence of BnAAD5-1 from the A3 subgenome of the B. napus inbred line L111. We showed that ectopic expression of BnAAD5-1 in the A. thaliana aad5-2 mutant fully complemented the phenotypes of the mutant, such as lower oil content and altered contents of C18:0 and C18:1. These results help us to better understand the functions of AAD members in A. thaliana and B. napus and provide a promising target for genetic manipulation of B. napus.

  16. A candidate gene-based association study of tocopherol content and composition in rapeseed (Brassica napus

    Directory of Open Access Journals (Sweden)

    Steffi eFritsche


    Full Text Available Rapeseed (Brassica napus L. is the most important oil crop of temperate climates. Rapeseed oil contains tocopherols, also known as vitamin E, which is an indispensable nutrient for humans and animals due to its antioxidant and radical scavenging abilities. Moreover, tocopherols are also important for the oxidative stability of vegetable oils. Therefore, seed oil with increased tocopherol content or altered tocopherol composition is a target for breeding. We investigated the role of nucleotide variations within candidate genes from the tocopherol biosynthesis pathway. Field trials were carried out with 229 accessions from a worldwide B. napus collection which was divided into two panels of 96 and 133 accessions. Seed tocopherol content and composition were measured by HPLC. High heritabilities were found for both traits, ranging from 0.62 to 0.94. We identified polymorphisms by sequencing selected regions of the tocopherol genes from the 96 accession panel. Subsequently, we determined the population structure (Q and relative kinship (K as detected by genotyping with genome-wide distributed SSR markers. Association studies were performed using two models, the structure-based GLM+Q and the PK mixed model. Between 26 and 12 polymorphisms within two genes (BnaX.VTE3.a, BnaA.PDS1.c were significantly associated with tocopherol traits. The SNPs explained up to 16.93 % of the genetic variance for tocopherol composition and up to 10.48 % for total tocopherol content. Based on the sequence information we designed CAPS markers for genotyping the 133 accessions from the 2nd panel. Significant associations with various tocopherol traits confirmed the results from the first experiment. We demonstrate that the polymorphisms within the tocopherol genes clearly impact tocopherol content and composition in B. napus seeds. We suggest that these nucleotide variations may be used as selectable markers for breeding rapeseed with enhanced tocopherol quality.

  17. Microspore culture of winter oilseed rape (Brassica napus L.) in conjunction with other in vitro technologies

    International Nuclear Information System (INIS)

    Cegielska-Taras, T.; Szala, L.; Bartkowiak-Broda, I.


    Microspore culture in conjunction with other technologies such as selection, mutagenesis and transformation has been used for the production of novel genotypes of Brassica napus L. for crop improvement. The example of in vitro selection of microspore - derived embryos includes: a) ploidy level, b) seed oil composition (for example: high level of erucic acid), c) genotypes with restorer gene for CMS-ogura system (by means of isozyme marker PGI-2 ), d) herbicide resistant forms. Efficiency of microspore mutagenesis has been tested by the treatment of freshly isolated microspores with UV and MNU. Direct delivery of foreign gene to the microspores (microprojectile bombardment) combined with the use of Agrobacterium tumefaciens to microspore derived embryos seems to be a promising way of oilseed rape transformation. (author)

  18. The compact genome of the plant pathogen Plasmodiophora brassicae is adapted to intracellular interactions with host Brassica spp. (United States)

    Rolfe, Stephen A; Strelkov, Stephen E; Links, Matthew G; Clarke, Wayne E; Robinson, Stephen J; Djavaheri, Mohammad; Malinowski, Robert; Haddadi, Parham; Kagale, Sateesh; Parkin, Isobel A P; Taheri, Ali; Borhan, M Hossein


    The protist Plasmodiophora brassicae is a soil-borne pathogen of cruciferous species and the causal agent of clubroot disease of Brassicas including agriculturally important crops such as canola/rapeseed (Brassica napus). P. brassicae has remained an enigmatic plant pathogen and is a rare example of an obligate biotroph that resides entirely inside the host plant cell. The pathogen is the cause of severe yield losses and can render infested fields unsuitable for Brassica crop growth due to the persistence of resting spores in the soil for up to 20 years. To provide insight into the biology of the pathogen and its interaction with its primary host B. napus, we produced a draft genome of P. brassicae pathotypes 3 and 6 (Pb3 and Pb6) that differ in their host range. Pb3 is highly virulent on B. napus (but also infects other Brassica species) while Pb6 infects only vegetable Brassica crops. Both the Pb3 and Pb6 genomes are highly compact, each with a total size of 24.2 Mb, and contain less than 2 % repetitive DNA. Clustering of genome-wide single nucleotide polymorphisms (SNP) of Pb3, Pb6 and three additional re-sequenced pathotypes (Pb2, Pb5 and Pb8) shows a high degree of correlation of cluster grouping with host range. The Pb3 genome features significant reduction of intergenic space with multiple examples of overlapping untranslated regions (UTRs). Dependency on the host for essential nutrients is evident from the loss of genes for the biosynthesis of thiamine and some amino acids and the presence of a wide range of transport proteins, including some unique to P. brassicae. The annotated genes of Pb3 include those with a potential role in the regulation of the plant growth hormones cytokinin and auxin. The expression profile of Pb3 genes, including putative effectors, during infection and their potential role in manipulation of host defence is discussed. The P. brassicae genome sequence reveals a compact genome, a dependency of the pathogen on its host for some

  19. Evaluation of Yield Component Traits of Honeybee-Pollinated (Apis mellifera L.Rapeseed Canola (Brassica napus L. Evaluación de Parámetros de Rendimiento del Raps (Brassica napus L. Polinizado por Abejas (Apis mellifera L.

    Directory of Open Access Journals (Sweden)

    Ximena Araneda Durán


    Full Text Available Recent introduction of hybrid varieties raises the question if bees (Apis mellifera L. contribute as pollinator agents in developing the full yield potential of rapeseed (Brassica napus L.. In order to evaluate the yield achieved by B. napus cv. Artus pollinated by A. mellifera testing was carried out in the district of Freire, La Araucanía Region, Chile. This consisted in isolating or excluding rapeseed plants from pollinators with exclusion cages. Treatments applied were total exclusion (T1, partial exclusion (T2 and free pollination (T0 with a density of 6.5 hives ha-1, in order to determine the following yield components traits: grains per silique, siliques per plant, 1000 grain weight and yield. The experimental design used was randomized complete blocks with three treatments and three replicates. Results obtained show that the parameter least affected by bee intervention was the grains per silique variable. In contrast, siliques per plant and 1000 grain weight parameters presented significant differences, contributing to a yield greater than 5 t ha-1; which represented a figure 50.34% higher than in the treatment without bees. It may be concluded that the inclusion of bees in crops is fully justified as a production tool.La reciente introducción de variedades híbridas plantea la interrogante de la contribución que pueda tener la presencia de abejas (Apis mellifera L. como agentes polinizadores para desarrollar en pleno el potencial productivo del raps (Brassica napus L.. Con el objetivo de evaluar el rendimiento alcanzado por B. napus cv. Artus polinizado por A. mellifera, se realizó un ensayo en la localidad de Freire, Región de La Araucanía, Chile. Éste consistió en aislar o excluir las plantas de raps de los polinizadores mediante el uso de jaulas excluidoras. Los tratamientos consistieron en la exclusión total (T1, exclusión parcial (T2 y libre polinización (T0 con una densidad de 6,5 colmenas ha-1, con el fin de determinar

  20. SSR marker variations in Brassica species provide insight into the origin and evolution of Brassica amphidiploids. (United States)

    Thakur, Ajay Kumar; Singh, Kunwar Harendra; Singh, Lal; Nanjundan, Joghee; Khan, Yasin Jeshima; Singh, Dhiraj


    Oilseed Brassica represents an important group of oilseed crops with a long history of evolution and cultivation. To understand the origin and evolution of Brassica amphidiploids, simple sequence repeat (SSR) markers were used to unravel genetic variations in three diploids and three amphidiploid Brassica species of U's triangle along with Eruca sativa as an outlier. Of 124 Brassica-derived SSR loci assayed, 100% cross-transferability was obtained for B. juncea and three subspecies of B. rapa , while lowest cross-transferability (91.93%) was obtained for Eruca sativa . The average % age of cross-transferability across all the seven species was 98.15%. The number of alleles detected at each locus ranged from one to six with an average of 3.41 alleles per primer pair. Neighbor-Joining-based dendrogram divided all the 40 accessions into two main groups composed of B. juncea / B. nigra/B. rapa and B. carinata/B. napus/B. oleracea . C-genome of oilseed Brassica species remained relatively more conserved than A- and B-genome. A- genome present in B. juncea and B. napus seems distinct from each other and hence provides great opportunity for generating diversity through synthesizing amphidiploids from different sources of A- genome. B. juncea had least intra-specific distance indicating narrow genetic base. B. rapa appears to be more primitive species from which other two diploid species might have evolved. The SSR marker set developed in this study will assist in DNA fingerprinting of various Brassica species cultivars, evaluating the genetic diversity in Brassica germplasm, genome mapping and construction of linkage maps, gene tagging and various other genomics-related studies in Brassica species. Further, the evolutionary relationship established among various Brassica species would assist in formulating suitable breeding strategies for widening the genetic base of Brassica amphidiploids by exploiting the genetic diversity present in diploid progenitor gene pools.

  1. Genetic Diversity in Commercial Rapeseed (Brassica napus L. Varieties from Turkey as Revealed by RAPD

    Directory of Open Access Journals (Sweden)

    Özlem ÖZBEK


    Full Text Available In cultivated commercial crop species, genetic diversity tends to decrease because of the extensive breeding processes. Therefore, germplasm of commercial crop species, such as Brassica napus L. should be evaluated and the genotypes, which have higher genetic diversity index, should be addressed as potential parental cross materials in breeding programs. In this study, the genetic diversity was analysed by using randomly amplified polymorphic DNA analysis (RAPD technique in nine Turkish commercial rapeseed varieties. The RAPD primers (10-mer oligonucleotides produced 51 scorable loci, 31 loci of which were polymorphic (60.78% and 20 loci (39.22% were monomorphic The RAPD bands were scored as binary matrix data and were analysed using POPGENE version 1.32. At locus level, the values of genetic diversity within population (Hs and total (HT were 0.15 and 0.19 respectively. The genetic differentiation (GST and the gene flow (Nm values between the populations were 0.20 and 2.05 respectively. The mean number of alleles (na, the mean number of effective alleles (nae, and the mean value of genetic diversity (He were 2.00, 1.26, and 0.19 respectively. According to Pearson’s correlation, multiple regression and principal component analyses, eco-geographical conditions in combination had significant effect on genetic indices of commercial B. napus L. varieties were discussed.

  2. Potential impact of genetically modified Lepidoptera-resistant Brassica napus in biodiversity hotspots: Sicily as a theoretical model. (United States)

    Manachini, Barbara; Bazan, Giuseppe; Schicchi, Rosario


    The general increase of the cultivation and trade of Bt transgenic plants resistant to Lepidoptera pests raises concerns regarding the conservation of animal and plant biodiversity. Demand for biofuels has increased the cultivation and importation of oilseed rape (Brassica napus L.), including transgenic lines. In environmental risk assessments (ERAs) for its potential future cultivation as well as for food and feed uses, the impact on wild Brassicaeae relatives and on non-target Lepidoptera should be assessed. Here we consider the potential exposure of butterflies as results of possible cultivation or naturalization of spilled seed in Sicily (Italy). Diurnal Lepidoptera, which are pollinators, can be exposed directly to the insecticidal proteins as larvae (mainly of Pieridae) through the host and through the pollen that can deposit on other host plants. Adults can be exposed via pollen and nectar. The flight periods of butterflies were recorded, and they were found to overlap for about 90% of the flowering period of B. napus for the majority of the species. In addition, B. napus has a high potential to hybridise with endemic taxa belonging to the B. oleracea group. This could lead to an exposure of non-target Lepidoptera if introgression of the Bt gene into a wild population happens. A rank of the risk for butterflies and wild relatives of oilseed rape is given. We conclude that, in environmental risk assessments, attention should be paid to plant-insect interaction especially in a biodiversity hotspot such as Sicily. © 2018 Institute of Zoology, Chinese Academy of Sciences.

  3. The high-quality genome of Brassica napus cultivar 'ZS11' reveals the introgression history in semi-winter morphotype. (United States)

    Sun, Fengming; Fan, Guangyi; Hu, Qiong; Zhou, Yongming; Guan, Mei; Tong, Chaobo; Li, Jiana; Du, Dezhi; Qi, Cunkou; Jiang, Liangcai; Liu, Weiqing; Huang, Shunmou; Chen, Wenbin; Yu, Jingyin; Mei, Desheng; Meng, Jinling; Zeng, Peng; Shi, Jiaqin; Liu, Kede; Wang, Xi; Wang, Xinfa; Long, Yan; Liang, Xinming; Hu, Zhiyong; Huang, Guodong; Dong, Caihua; Zhang, He; Li, Jun; Zhang, Yaolei; Li, Liangwei; Shi, Chengcheng; Wang, Jiahao; Lee, Simon Ming-Yuen; Guan, Chunyun; Xu, Xun; Liu, Shengyi; Liu, Xin; Chalhoub, Boulos; Hua, Wei; Wang, Hanzhong


    Allotetraploid oilseed rape (Brassica napus L.) is an agriculturally important crop. Cultivation and breeding of B. napus by humans has resulted in numerous genetically diverse morphotypes with optimized agronomic traits and ecophysiological adaptation. To further understand the genetic basis of diversification and adaptation, we report a draft genome of an Asian semi-winter oilseed rape cultivar 'ZS11' and its comprehensive genomic comparison with the genomes of the winter-type cultivar 'Darmor-bzh' as well as two progenitors. The integrated BAC-to-BAC and whole-genome shotgun sequencing strategies were effective in the assembly of repetitive regions (especially young long terminal repeats) and resulted in a high-quality genome assembly of B. napus 'ZS11'. Within a short evolutionary period (~6700 years ago), semi-winter-type 'ZS11' and the winter-type 'Darmor-bzh' maintained highly genomic collinearity. Even so, certain genetic differences were also detected in two morphotypes. Relative to 'Darmor-bzh', both two subgenomes of 'ZS11' are closely related to its progenitors, and the 'ZS11' genome harbored several specific segmental homoeologous exchanges (HEs). Furthermore, the semi-winter-type 'ZS11' underwent potential genomic introgressions with B. rapa (A r ). Some of these genetic differences were associated with key agronomic traits. A key gene of A03.FLC3 regulating vernalization-responsive flowering time in 'ZS11' was first experienced HE, and then underwent genomic introgression event with A r , which potentially has led to genetic differences in controlling vernalization in the semi-winter types. Our observations improved our understanding of the genetic diversity of different B. napus morphotypes and the cultivation history of semi-winter oilseed rape in Asia. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  4. Variations in fatty acid composition, glucosinolate profile and some phytochemical contents in selected oil seed rape (Brassica napus L.) cultivars


    Amin Mohamed, Amal; El-Din Saad El-Beltagi, Hossam


    Rapeseed (Brassica napus L.) is now the third most important source of edible oil in the world after soybean and palm oil. In this study seeds of five different rapeseed cultivars namely; pactol, silvo, topas, serw 4 and serw 6 were evaluated for their fatty acid composition, glucosinolate profile, amino acids, total tocopherols and phenolic content. Among all cultivars significant variability in fatty acids were observed. The oleic acid (C18:1) ranged from 56.31% to 58.67%, linoleic acid (C1...

  5. The use of protein patterns in genetic diversity analysis in some Brassica napus cultivars

    Directory of Open Access Journals (Sweden)

    Roya Razavizadeh


    Full Text Available In this study, protein variations of seeds and five-day old cotyledonal leaves of four selected Brassica napus cultivars including Elite, Ocapy, Tasilo and Zarfam were analyzed by SDS-PAGE to identify protein markers. The amount of total soluble protein of seed storage proteins did not show significant differences in all cultivars whereas it was different in cotyledonal leaves. Protein patterns of seeds and cotyledonal leaves showed significant differences using SDS-PAGE and consequence analysis of bands by ImageJ program. Relative expression of six protein bands in seeds and five-day old cotyledonal leaves were significantly different. Three protein markers were identified by protein patterns of seed and cotyledonal leaves. The results of relationship analysis based on presence and absence of the specific protein bands in protein pattern of seed storage proteins showed that Tasilo and Elite cultivars had the highest similarities.

  6. Effect of Sugarcane Filter Muds, Chemical and Biological Fertilizers on Absorption of Some Macro- and Micro-Elementsand Heavy Metals by Canola (Brassica napus L.)


    H. Monjezi; M. R Moradi-Telavat; S. A. Siadat; A. Koochakzadeh; H. Hamdi


    In order to evaluate the effect of sugarcane (Sacharum officinarum L.) filter muds and chemical and biological fertilizers application on macro- and micronutrient elements and some heavy metals (Pb and Cd) absorption by canola (Brassica napus L.) grains, a factorial experiment was conducted in 2012 in the Experimental Farm of Ramin (Mollasani) Agriculture and Natural Resources University of Khouzestan, Iran. A complete blocks design was used for the experiment with three replications. Differe...

  7. Production and genetic analysis of resynthesized Brassica napus from a B. rapa landrace from the Qinghai-Tibet Plateau and B. alboglabra. (United States)

    Liu, H D; Zhao, Z G; Du, D Z; Deng, C R; Fu, G


    This study aimed to reveal the genetic and epigenetic variations involved in a resynthesized Brassica napus (AACC) generated from a hybridization between a B. rapa (AA) landrace and B. alboglabra (CC). Amplified fragment length polymorphism (AFLP), methylation-sensitive amplified polymorphism, and the cDNA-AFLP technique were performed to detect changes between different generations at the genome, methylation, and transcription levels. We obtained 30 lines of resynthesized B. napus with a mean 1000-seed weight of over 7.50 g. All of the lines were self-compatible, probably because both parents were self-compatible. At the genome level, the S0 generation had the lowest frequency of variations (0.18%) and the S3 generation had the highest (6.07%). The main variation pattern was the elimination of amplified restriction fragments on the CC genome from the S0 to the S4 generations. At the methylation level, we found three loci that exhibited altered methylation patterns on the parental A genome; the variance rate was 1.35%. At the transcription level, we detected 43.77% reverse mutations and 37.56% deletion mutations that mainly occurred on the A and C genomes, respectively, in the S3 generation. Our results highlight the genetic variations that occur during the diploidization of resynthesized B. napus.

  8. Neofunctionalization of duplicated Tic40 genes caused a gain-of-function variation related to male fertility in Brassica oleracea lineages. (United States)

    Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf


    Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. © 2014 American Society of Plant Biologists. All Rights Reserved.

  9. A Phylogenetic Analysis of Chloroplast Genomes Elucidates the Relationships of the Six Economically Important Brassica Species Comprising the Triangle of U

    NARCIS (Netherlands)

    Li, Peirong; Zhang, Shujiang; Li, Fei; Zhang, Shifan; Zhang, Hui; Wang, Xiaowu; Sun, Rifei; Bonnema, Guusje; Borm, Theo J.A.


    The Brassica genus comprises many economically important worldwide cultivated crops. The well-established model of the Brassica genus, U’s triangle, consists of three basic diploid plant species (Brassica rapa, Brassica oleracea, and Brassica nigra) and three amphidiploid species (Brassica napus,

  10. Generation and characterization of tribenuron-methyl herbicide-resistant rapeseed (Brasscia napus) for hybrid seed production using chemically induced male sterility. (United States)

    Li, Haitao; Li, Juanjuan; Zhao, Bo; Wang, Jing; Yi, Licong; Liu, Chao; Wu, Jiangsheng; King, Graham J; Liu, Kede


    Identification and molecular analysis of four tribenuron-methyl resistant mutants in Brassica napus , which would be very useful in hybrid production using a Chemically induced male sterility system. Chemically induced male sterility (CIMS) systems dependent on chemical hybridization agents (CHAs) like tribenuron-methyl (TBM) represent an important approach for practical utilization of heterosis in rapeseed. However, when spraying the female parents with TBM to induce male sterility the male parents must be protected with a shield to avoid injury to the stamens, which would otherwise complicate the seed production protocol and increase the cost of hybrid seed production. Here we report the first proposed application of a herbicide-resistant cultivar in hybrid production, using a CIMS system based on identifying four TBM-resistant mutants in Brassica napus. Genetic analysis indicated that the TBM resistance was controlled by a single dominant nuclear gene. An in vitro enzyme activity assay for acetohydroxyacid synthase (AHAS) suggested that the herbicide resistance is caused by a gain-of-function mutation in a copy of AHAS genes. Comparative sequencing of the mutants and wild type BnaA.AHAS.a coding sequences identified a C-to-T transition at either position 535 or 536 from the translation start site, which resulted in a substitution of proline with serine or leucine at position 197 according to the Arabidopsis thaliana protein sequence. An allele-specific dCAPS marker developed from the C536T variation co-segregated with the herbicide resistance. Transgenic A. thaliana plants expressing BnaA.ahas3.a conferred herbicide resistance, which confirmed that the P197 substitution in BnaA.AHAS.a was responsible for the herbicide resistance. Moreover, the TBM-resistant lines maintain normal male fertility under TBM treatment and can be of practical value in hybrid seed production using CIMS.

  11. Brassica napusGLABRA3-1 promotes anthocyanin biosynthesis and trichome formation in true leaves when expressed in Arabidopsis thaliana. (United States)

    Gao, C; Guo, Y; Wang, J; Li, D; Liu, K; Qi, S; Jin, C; Duan, S; Gong, J; Li, Z; Chen, M


    Previous studies have shown that GLABRA3 (AtGL3), a bHLH transcription factor, plays essential roles in anthocyanin biosynthesis and trichome formation in Arabidopsis thaliana. However, there have been no such studies of a homologue, BnGL3, from the closely related crop, Brassica napus. Here, we analysed the BnGL3-1 coding domain sequence from the B. napus cultivar QINYOU Seven, identified conserved protein domains and performed a phylogenetic analysis to elucidate its relationship with homologues form a range of plant species. When expressed in tobacco leaves as a fusion protein with green fluorescent protein, BnGL3-1 accumulated in the nucleus, consistent with its predicted function as a transcription factor. Ectopic expression of the BnGL3-1 gene in the A. thaliana gl3-3 mutant resulted in levels of anthocyanins and numbers of trichomes in true leaves that were higher than in wild-type plants. Moreover, overexpression of BnGL3-1 in gl3-3 compensated for the promotion and repression of genes involved in anthocyanin biosynthesis and trichome formation, respectively, that has been reported in gl3-3 young shoots and expanding true leaves. This study provides new insights into GL3 function in anthocyanin biosynthesis and trichome formation in crucifers, and represents a promising target for genetic manipulation of B. napus. © 2017 German Society for Plant Sciences and The Royal Botanical Society of the Netherlands.

  12. Greenhouse gas emissions from the energy crop oilseed rape (Brassica napus); the role of photosynthetically active radiation in diurnal N2O flux variation.


    Keane, J.Ben; Ineson, P.; Vallack, Harry W.; Blei, Emanuel; Howarth, Steve; McNamara, Niall P.; Rowe, Rebecca; Williams, Mathew; Toet, Sylvia


    Oilseed rape (OSR, Brassica napus L.) is an important feedstock for biodiesel; hence, carbon dioxide (CO2), methane (CH4) and particularly fertilizer-derived nitrous oxide (N2O) emissions during cultivation must be quantified to assess putative greenhouse gas (GHG) savings, thus creating an urgent and increasing need for such data. Substrates of nitrification [ammonium (NH4)] and denitrification [nitrate (NO3)], the predominant N2O production pathways, were supplied separately and in combinat...

  13. In silico studies on structure-function of DNA GCC- box binding domain of brassica napus DREB1 protein

    International Nuclear Information System (INIS)

    Qamarunnisa, S.; Hussain, M.


    DREB1 is a transcriptional factor, which selectively binds with the promoters of the genes involved in stress response in the plants. Homology of DREB protein and its binding element have been detected in the genome of many plants. However, only a few reports exist that discusses the binding properties of this protein with the gene (s) promoter. In the present study, we have undertaken studies exploring the structure-function relationship of Brassica napus DREB1. Multiple sequence alignment, protein homology modeling and intermolecular docking of GCC-box binding domain (GBD) of the said protein was carried out using atomic coordinates of GBD from Arabdiopsis thaliana and GCC-box containing DNA respectively. Similarities and/or identities in multiple, sequence alignment, particularly at the functionally important amino acids, strongly suggested the binding specificity of B. napus DREB1 to GCC-box. Similarly, despite 56% sequence homology, tertiary structures of both template and modeled protein were found to be extremely similar as indicated by root mean square deviation of 0.34 A. More similarities were established between GBD of both A. thaliana and B. napus DREB1 by conducting protein docking with the DNA containing GCC-box. It appears that both proteins interact through their beta-sheet with the major DNA groove including both nitrogen bases and phosphate and sugar moieties. Additionally, in most cases the interacting residues were also found to be identical. Briefly, this study attempts to elucidate the molecular basis of DREB1 interaction with its target sequence in the promoter. (author)

  14. Plant hormones in defense response of Brassica napus to Sclerotinia sclerotiorum - reassessing the role of salicylic acid in the interaction with a necrotroph. (United States)

    Nováková, Miroslava; Sašek, Vladimír; Dobrev, Petre I; Valentová, Olga; Burketová, Lenka


    According to general model, jasmonic acid (JA) and ethylene (ET) signaling pathways are induced in Arabidopsis after an attack of necrotroph, Sclerotinia sclerotiorum (Lib.) de Bary. However, abscisic acid (ABA) and salicylic acid (SA) also seem to play a role. While signaling events in Arabidopsis have been intensively studied recently, information for the natural host Brassica napus is limited. In this study, multiple plant hormone quantification and expression analysis of marker genes of the signaling pathways was used to gain a complete view of the interaction of B. napus with S. sclerotiorum. Strong response of ET biosynthetic gene ACS2 was observed, accompanied by increases of SA and JA levels that correspond to the elevated expression of marker genes PR1 and LOX3. Interestingly, the level of ABA and the expression of its marker gene RD26 were also elevated. Furthermore, induction of the SA-dependent defense decreased disease symptoms. In addition, SA signaling is suggested as a possible target for manipulation by S. sclerotiorum. A gene for putative chorismate mutase SS1G_14320 was identified that is highly expressed during infection but not in vitro. Our results bring the evidence of SA involvement in the interaction of plant with the necrotroph that conflict with the current model. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  15. Proteomic Analysis of Pollen and Blossom Honey from Rape Seed Brassica Napus L.

    Directory of Open Access Journals (Sweden)

    Borutinskaitė Veronika


    Full Text Available In the study, honey from oilseed rape Brassica napus L., and both hand-collected (winter rape Visby and Cult and bee-collected pollen of oilseed rape were analyzed for their proteome content, in order to see if any plant proteins were present to allow the proteo-typing of the oilseed rape honey. Proteins were fractionated by two-dimensional gel electrophoresis (2DE, stained by Coomassie blue and then analyzed by mass spectrometry. All identified proteins were divided into few groups due to their biological function. In 2DE gels with separated proteins from blossom honey, only bee (Apis mellifera main proteins (Major royal jelly protein 1-5 and Glucosidase were found. So we analyzed all proteins using gel-free based analysis with the SYNAPT G2 high definition mass spectrometry. We identified proteins that were present in both oilseed rape pollen and honey (Bna, Polygalacturonase, Non-specific lipid-transfer protein, GAPDH and others. We believe that these proteins are important for the nutritional value of plant pollen-enriched honey and further research is required on honey and honeybee pollen protein.

  16. Indications of selenium protection against cadmium and lead toxicity in oilseed rape (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Zhilin Wu


    Full Text Available The present study investigated the beneficial role of selenium (Se in protecting oilseed rape (Brassica napus L. plants from cadmium (Cd+2 and lead (Pb+2 toxicity. Exogenous Se markedly reduced Cd and Pb concentration in both roots and shoots. Supplementation of the medium with Se (5, 10 and 15 mg kg-1 alleviated the negative effect of Cd and Pb on growth and led to a decrease in oxidative damages caused by Cd and Pb. Furthermore, Se enhanced superoxide free radicals (O2-, hydrogen peroxide (H2O2 and lipid peroxidation, as indicated by malondialdehyde (MDA accumulation, but decreased superoxide dismutase (SOD and glutathione peroxidase (GPx activities. Meanwhile, the presence of Cd and Pb in the medium affected Se speciation in shoots. The results suggest that Se could alleviate Cd and Pb toxicity by preventing oxidative stress in oilseed rape plant.

  17. Difference in root K+ retention ability and reduced sensitivity of K+-permeable channels to reactive oxygen species confer differential salt tolerance in three Brassica species. (United States)

    Chakraborty, Koushik; Bose, Jayakumar; Shabala, Lana; Shabala, Sergey


    Brassica species are known to possess significant inter and intraspecies variability in salinity stress tolerance, but the cell-specific mechanisms conferring this difference remain elusive. In this work, the role and relative contribution of several key plasma membrane transporters to salinity stress tolerance were evaluated in three Brassica species (B. napus, B. juncea, and B. oleracea) using a range of electrophysiological assays. Initial root growth assay and viability staining revealed that B. napus was most tolerant amongst the three species, followed by B. juncea and B. oleracea At the mechanistic level, this difference was conferred by at least three complementary physiological mechanisms: (i) higher Na(+) extrusion ability from roots resulting from increased expression and activity of plasma membrane SOS1-like Na(+)/H(+) exchangers; (ii) better root K(+) retention ability resulting from stress-inducible activation of H(+)-ATPase and ability to maintain more negative membrane potential under saline conditions; and (iii) reduced sensitivity of B. napus root K(+)-permeable channels to reactive oxygen species (ROS). The last two mechanisms played the dominant role and conferred most of the differential salt sensitivity between species. Brassica napus plants were also more efficient in preventing the stress-induced increase in GORK transcript levels and up-regulation of expression of AKT1, HAK5, and HKT1 transporter genes. Taken together, our data provide the mechanistic explanation for differential salt stress sensitivity amongst these species and shed light on transcriptional and post-translational regulation of key ion transport systems involved in the maintenance of the root plasma membrane potential and cytosolic K/Na ratio as a key attribute for salt tolerance in Brassica species. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  18. Development of a novel Sinapis arvensis disomic addition line in Brassica napus containing the restorer gene for Nsa CMS and improved resistance to Sclerotinia sclerotiorum and pod shattering. (United States)

    Wei, Wenhui; Li, Yunchang; Wang, Lijun; Liu, Shengyi; Yan, Xiaohong; Mei, Desheng; Li, Yinde; Xu, Yusong; Peng, Pengfei; Hu, Qiong


    An allo-cytoplasmic male sterile line, which was developed through somatic hybridization between Brassica napus and Sinapis arvensis (thus designated as Nsa CMS line), possesses high potential for hybrid production of rapeseed. In order to select for restorer lines, fertile plants derived from the same somatic hybridization combination were self-pollinated and testcrossed with the parental Nsa CMS line for six generations. A novel disomic alien addition line, B. napus-S. arvensis, has been successfully developed. GISH analysis showed that it contains one pair of chromosomes from S. arvensis and 19 pairs from B. napus, and retains stable and regular mitotic and meiotic processes. The addition line displays very strong restoration ability to Nsa CMS line, high resistance to Sclerotinia sclerotiorum and a low incidence of pod shattering. Because the addition line shares these very important agricultural characters, it is a valuable restorer to Nsa CMS line, and is named NR1 here (Nsa restorer no. 1).

  19. An RNA-seq transcriptome analysis of floral buds of an interspecific Brassica hybrid between B. carinata and B. napus. (United States)

    Chu, Pu; Liu, Huijuan; Yang, Qing; Wang, Yankun; Yan, Guixia; Guan, Rongzhan


    Interspecific hybridizations promote gene transfer between species and play an important role in plant speciation and crop improvement. However, hybrid sterility that commonly found in the first generation of hybrids hinders the utilization of interspecific hybridization. The combination of divergent parental genomes can create extensive transcriptome variations, and to determine these gene expression alterations and their effects on hybrids, an interspecific Brassica hybrid of B. carinata × B. napus was generated. Scanning electron microscopy analysis indicated that some of the hybrid pollen grains were irregular in shape and exhibited abnormal exine patterns compared with those from the parents. Using the Illumina HiSeq 2000 platform, 39,598, 32,403 and 42,208 genes were identified in flower buds of B. carinata cv. W29, B. napus cv. Zhongshuang 11 and their hybrids, respectively. The differentially expressed genes were significantly enriched in pollen wall assembly, pollen exine formation, pollen development, pollen tube growth, pollination, gene transcription, macromolecule methylation and translation, which might be associated with impaired fertility in the F1 hybrid. These results will shed light on the mechanisms underlying the low fertility of the interspecific hybrids and expand our knowledge of interspecific hybridization.

  20. The effects of seed size on hybrids formed between oilseed rape (Brassica napus and wild brown mustard (B. juncea.

    Directory of Open Access Journals (Sweden)

    Yong-Bo Liu

    Full Text Available Seed size has significant implications in ecology, because of its effects on plant fitness. The hybrid seeds that result from crosses between crops and their wild relatives are often small, and the consequences of this have been poorly investigated. Here we report on plant performance of hybrid and its parental transgenic oilseed rape (Brassica napus and wild B. juncea, all grown from seeds sorted into three seed-size categories.Three seed-size categories were sorted by seed diameter for transgenic B. napus, wild B. juncea and their transgenic and non-transgenic hybrids. The seeds were sown in a field at various plant densities. Globally, small-seeded plants had delayed flowering, lower biomass, fewer flowers and seeds, and a lower thousand-seed weight. The seed-size effect varied among plant types but was not affected by plant density. There was no negative effect of seed size in hybrids, but it was correlated with reduced growth for both parents.Our results imply that the risk of further gene flow would probably not be mitigated by the small size of transgenic hybrid seeds. No fitness cost was detected to be associated with the Bt-transgene in this study.

  1. Overexpression of phyA and appA Genes Improves Soil Organic Phosphorus Utilisation and Seed Phytase Activity in Brassica napus (United States)

    Wang, Yi; Ye, Xiangsheng; Ding, Guangda; Xu, Fangsen


    Phytate is the major storage form of organic phosphorus in soils and plant seeds, and phosphorus (P) in this form is unavailable to plants or monogastric animals. In the present study, the phytase genes phyA and appA were introduced into Brassica napus cv Westar with a signal peptide sequence and CaMV 35S promoter, respectively. Three independent transgenic lines, P3 and P11 from phyA and a18 from appA, were selected. The three transgenic lines exhibited significantly higher exuded phytase activity when compared to wild-type (WT) controls. A quartz sand culture experiment demonstrated that transgenic Brassica napus had significantly improved P uptake and plant biomass. A soil culture experiment revealed that seed yields of transgenic lines P11 and a18 increased by 20.9% and 59.9%, respectively, when compared to WT. When phytate was used as the sole P source, P accumulation in seeds increased by 20.6% and 46.9% with respect to WT in P11 and a18, respectively. The P3 line accumulated markedly more P in seeds than WT, while no significant difference was observed in seed yields when phytate was used as the sole P source. Phytase activities in transgenic canola seeds ranged from 1,138 to 1,605 U kg–1 seeds, while no phytase activity was detected in WT seeds. Moreover, phytic acid content in P11 and a18 seeds was significantly lower than in WT. These results introduce an opportunity for improvement of soil and seed phytate-P bioavailability through genetic manipulation of oilseed rape, thereby increasing plant production and P nutrition for monogastric animals. PMID:23573285

  2. Overexpression of phyA and appA genes improves soil organic phosphorus utilisation and seed phytase activity in Brassica napus.

    Directory of Open Access Journals (Sweden)

    Yi Wang

    Full Text Available Phytate is the major storage form of organic phosphorus in soils and plant seeds, and phosphorus (P in this form is unavailable to plants or monogastric animals. In the present study, the phytase genes phyA and appA were introduced into Brassica napus cv Westar with a signal peptide sequence and CaMV 35S promoter, respectively. Three independent transgenic lines, P3 and P11 from phyA and a18 from appA, were selected. The three transgenic lines exhibited significantly higher exuded phytase activity when compared to wild-type (WT controls. A quartz sand culture experiment demonstrated that transgenic Brassica napus had significantly improved P uptake and plant biomass. A soil culture experiment revealed that seed yields of transgenic lines P11 and a18 increased by 20.9% and 59.9%, respectively, when compared to WT. When phytate was used as the sole P source, P accumulation in seeds increased by 20.6% and 46.9% with respect to WT in P11 and a18, respectively. The P3 line accumulated markedly more P in seeds than WT, while no significant difference was observed in seed yields when phytate was used as the sole P source. Phytase activities in transgenic canola seeds ranged from 1,138 to 1,605 U kg(-1 seeds, while no phytase activity was detected in WT seeds. Moreover, phytic acid content in P11 and a18 seeds was significantly lower than in WT. These results introduce an opportunity for improvement of soil and seed phytate-P bioavailability through genetic manipulation of oilseed rape, thereby increasing plant production and P nutrition for monogastric animals.

  3. Mass spectrometric amino acid sequencing of a mixture of seed storage proteins (napin) from Brassica napus, products of a multigene family.


    Gehrig, P M; Krzyzaniak, A; Barciszewski, J; Biemann, K


    The amino acid sequences of a number of closely related proteins ("napin") isolated from Brassica napus were determined by mass spectrometry without prior separation into individual components. Some of these proteins correspond to those previously deduced (napA, BngNAP1, and gNa), chiefly from DNA sequences. Others were found to differ to a varying extent (BngNAP1', BngNAP1A, BngNAP1B, BngNAP1C, gNa', and gNaA). The short chains of gNa and gNa' and of BngNAP1 and BngNAP1' differ by the replac...

  4. Could nitrile derivatives of turnip (Brassica rapa) glucosinolates be Hepato-and/or cholangiotoxic in cattle? (United States)

    Turnip (Brassica rapa ssp. rapa) and rape (Brassica napus ssp. biennis) and other brassica forage crops are generally regarded as “safe” feed for cattle during late summer and fall in New Zealand. However, when Pithomyces chartarum spore counts are high there are epidemics of sporidesmin toxicity (...

  5. Phytoextraction of heavy metals by canola (Brassica napus) and radish (Raphanus sativus) grown on multicontaminated soil. (United States)

    Marchiol, L; Assolari, S; Sacco, P; Zerbi, G


    Phytoextraction can provide an effective in situ technique for removing heavy metals from polluted soils. The experiment reported in this paper was undertaken to study the basic potential of phytoextraction of Brassica napus (canola) and Raphanus sativus (radish) grown on a multi-metal contaminated soil in the framework of a pot-experiment. Chlorophyll contents and gas exchanges were measured during the experiment; the heavy metal phytoextraction efficiency of canola and radish were also determined and the phytoextraction coefficient for each metal calculated. Data indicated that both species are moderately tolerant to heavy metals and that radish is more so than canola. These species showed relatively low phytoremediation potential of multicontaminated soils. They could possibly be used with success in marginally polluted soils where their growth would not be impaired and the extraction of heavy metals could be maintained at satisfying levels.

  6. Phytoextraction of heavy metals by canola (Brassica napus) and radish (Raphanus sativus) grown on multicontaminated soil

    International Nuclear Information System (INIS)

    Marchiol, L.; Assolari, S.; Sacco, P.; Zerbi, G.


    Phytoextraction can provide an effective in situ technique for removing heavy metals from polluted soils. The experiment reported in this paper was undertaken to study the basic potential of phytoextraction of Brassica napus (canola) and Raphanus sativus (radish) grown on a multi-metal contaminated soil in the framework of a pot-experiment. Chlorophyll contents and gas exchanges were measured during the experiment; the heavy metal phytoextraction efficiency of canola and radish were also determined and the phytoextraction coefficient for each metal calculated. Data indicated that both species are moderately tolerant to heavy metals and that radish is more so than canola. These species showed relatively low phytoremediation potential of multicontaminated soils. They could possibly be used with success in marginally polluted soils where their growth would not be impaired and the extraction of heavy metals could be maintained at satisfying levels

  7. Phytoextraction of heavy metals by canola (Brassica napus) and radish (Raphanus sativus) grown on multicontaminated soil

    Energy Technology Data Exchange (ETDEWEB)

    Marchiol, L.; Assolari, S.; Sacco, P.; Zerbi, G


    Phytoextraction can provide an effective in situ technique for removing heavy metals from polluted soils. The experiment reported in this paper was undertaken to study the basic potential of phytoextraction of Brassica napus (canola) and Raphanus sativus (radish) grown on a multi-metal contaminated soil in the framework of a pot-experiment. Chlorophyll contents and gas exchanges were measured during the experiment; the heavy metal phytoextraction efficiency of canola and radish were also determined and the phytoextraction coefficient for each metal calculated. Data indicated that both species are moderately tolerant to heavy metals and that radish is more so than canola. These species showed relatively low phytoremediation potential of multicontaminated soils. They could possibly be used with success in marginally polluted soils where their growth would not be impaired and the extraction of heavy metals could be maintained at satisfying levels.

  8. High Density Linkage Map Construction and QTL Detection for Three Silique-Related Traits in Orychophragmus violaceus Derived Brassica napus Population

    Directory of Open Access Journals (Sweden)

    Yi Yang


    Full Text Available Seeds per silique (SS, seed weight (SW, and silique length (SL are important determinant traits of seed yield potential in rapeseed (Brassica napus L., and are controlled by naturally occurring quantitative trait loci (QTLs. Mapping QTLs to narrow chromosomal regions provides an effective means of characterizing the genetic basis of these complex traits. Orychophragmus violaceus is a crucifer with long siliques, many SS, and heavy seeds. A novel B. napus introgression line with many SS was previously selected from multiple crosses (B. rapa ssp. chinesis × O. violaceus × B. napus. In present study, a doubled haploid (DH population with 167 lines was established from a cross between the introgression line and a line with far fewer SS, in order to detect QTLs for silique-related traits. By screening with a Brassica 60K single nucleotide polymorphism (SNP array, a high-density linkage map consisting of 1,153 bins and spanning a cumulative length of 2,209.1 cM was constructed, using 12,602 high-quality polymorphic SNPs in the DH population. The average recombination bin densities of the A and C subgenomes were 1.7 and 2.4 cM, respectively. 45 QTLs were identified for the three traits in all, which explained 4.0–34.4% of the total phenotypic variation; 20 of them were integrated into three unique QTLs by meta-analysis. These unique QTLs revealed a significant positive correlation between SS and SL and a significant negative correlation between SW and SS, and were mapped onto the linkage groups A05, C08, and C09. A trait-by-trait meta-analysis revealed eight, four, and seven consensus QTLs for SS, SW, and SL, respectively, and five major QTLs (cqSS.A09b, cqSS.C09, cqSW.A05, cqSW.C09, and cqSL.C09 were identified. Five, three, and four QTLs for SS, SW, and SL, respectively, might be novel QTLs because of the existence of alien genetic loci for these traits in the alien introgression. Thirty-eight candidate genes underlying nine QTLs for silique

  9. Response to multi-generational selection under elevated [CO2] in two temperature regimes suggests enhanced carbon assimilation and increased reproductive output in Brassica napus L

    DEFF Research Database (Denmark)

    Frenck, Georg; van der Linden, Leon; Mikkelsen, Teis Nørgaard


    Functional plant traits are likely to adapt under the sustained pressure imposed by environmental changes through natural selection. Employing Brassica napus as a model, a multi-generational study was performed to investigate the potential trajectories of selection at elevated [CO2] in two differ...... ameliorate depressions in plant reproductive fitness caused by higher temperatures in situations where both factors co-occur....

  10. Identification of the Relationship between Oil Body Morphology and Oil Content by Microstructure Comparison Combining with QTL Analysis in Brassica napus. (United States)

    Gu, Jianwei; Chao, Hongbo; Wang, Hao; Li, Yonghong; Li, Dianrong; Xiang, Jun; Gan, Jianping; Lu, Guangyuan; Zhang, Xuekun; Long, Yan; Li, Maoteng


    Oil bodies (OBs) are relatively simple but very important organelles comprising a matrix of triacylglycerol (TAG) surrounded by a phospholipid monolayer embedded and covered with unique proteins. The OB structure in Brassica napus with different oil content and the relationship between the oil content and the OB structure needs to be better understood. In this paper, the characteristics of OBs in the embryo of a series of B. napus materials with different oil content ranging from 34% to over 60% were studied. The results indicated that the OB size was significantly positively correlated with the oil content but was significantly negatively correlated with the glucosinolates and the protein content. Many genes associated with TAG synthesis, OB-membrane proteins, and the cell progress regulatory pathway were identified in the confidence interval of co-located QTLs for oil content, fatty acid (FA) compositions, and protein content. Our results suggested that the morphology of OBs might be directly controlled by the genes associated with OB-membrane proteins and indirectly controlled by the genes associated with TAG synthesis and cell progress regulatory pathway.

  11. Impact of Transgenic Brassica napus Harboring the Antifungal Synthetic Chitinase (NiC Gene on Rhizosphere Microbial Diversity and Enzyme Activities

    Directory of Open Access Journals (Sweden)

    Mohammad S. Khan


    Full Text Available Transgenic Brassica napus harboring the synthetic chitinase (NiC gene exhibits broad-spectrum antifungal resistance. As the rhizosphere microorganisms play an important role in element cycling and nutrient transformation, therefore, biosafety assessment of NiC containing transgenic plants on soil ecosystem is a regulatory requirement. The current study is designed to evaluate the impact of NiC gene on the rhizosphere enzyme activities and microbial community structure. The transgenic lines with the synthetic chitinase gene (NiC showed resistance to Alternaria brassicicola, a common disease causing fungal pathogen. The rhizosphere enzyme analysis showed no significant difference in the activities of fivesoil enzymes: alkalyine phosphomonoestarase, arylsulphatase, β-glucosidase, urease and sucrase between the transgenic and non-transgenic lines of B. napus varieties, Durr-e-NIFA (DN and Abasyne-95 (AB-95. However, varietal differences were observed based on the analysis of molecular variance. Some individual enzymes were significantly different in the transgenic lines from those of non-transgenic but the results were not reproducible in the second trail and thus were considered as environmental effect. Genotypic diversity of soil microbes through 16S–23S rRNA intergenic spacer region amplification was conducted to evaluate the potential impact of the transgene. No significant diversity (4% for bacteria and 12% for fungal between soil microbes of NiC B. napus and the non-transgenic lines was found. However, significant varietal differences were observed between DN and AB-95 with 79% for bacterial and 54% for fungal diversity. We conclude that the NiC B. napus lines may not affect the microbial enzyme activities and community structure of the rhizosphere soil. Varietal differences might be responsible for minor changes in the tested parameters.

  12. Neofunctionalization of Duplicated Tic40 Genes Caused a Gain-of-Function Variation Related to Male Fertility in Brassica oleracea Lineages1[W][OPEN (United States)

    Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf


    Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. PMID:25185122

  13. Flowering times in genetically modified Brassica hybrids in the absence of selection (United States)

    Changes in days to flowering (DTF) were observed among reciprocal F1 progeny of Brassica napus ‘RaideRR’ with other B. napus and also with weedy B. rapa. Changes in DTF are presented as factors to consider in evaluating the potential of crop to weed gene flow in different geograp...

  14. Genomic change, retrotransposon mobilization and extensive cytosine methylation alteration in Brassica napus introgressions from two intertribal hybridizations. (United States)

    Zhang, Xueli; Ge, Xianhong; Shao, Yujiao; Sun, Genlou; Li, Zaiyun


    Hybridization and introgression represent important means for the transfer and/or de novo origination of traits and play an important role in facilitating speciation and plant breeding. Two sets of introgression lines in Brassica napus L. were previously established by its intertribal hybridizations with two wild species and long-term selection. In this study, the methods of amplified fragment length polymorphisms (AFLP), sequence-specific amplification polymorphism (SSAP) and methylation-sensitive amplified polymorphism (MSAP) were used to determine their genomic change, retrotransposon mobilization and cytosine methylation alteration in these lines. The genomic change revealed by the loss or gain of AFLP bands occurred for ∼10% of the total bands amplified in the two sets of introgressions, while no bands specific for wild species were detected. The new and absent SSAP bands appeared for 9 out of 11 retrotransposons analyzed, with low frequency of new bands and their total percentage of about 5% in both sets. MSAP analysis indicated that methylation changes were common in these lines (33.4-39.8%) and the hypermethylation was more frequent than hypomethylation. Our results suggested that certain extents of genetic and epigenetic alterations were induced by hybridization and alien DNA introgression. The cryptic mechanism of these changes and potential application of these lines in breeding were also discussed.

  15. Microwave irradiation and citric acid assisted seed germination and phytoextraction of nickel (Ni) by Brassica napus L.: morpho-physiological and biochemical alterations under Ni stress. (United States)

    Farid, Mujahid; Ali, Shafaqat; Rizwan, Muhammad; Saeed, Rashid; Tauqeer, Hafiz Muhammad; Sallah-Ud-Din, Rasham; Azam, Ahmed; Raza, Nighat


    The complex bio-geochemistry of soil allows pollutant to persist for a longer period of time which further decreased the fertility and natural composition of land. Nickel, an inorganic pollutant, coming from a wide range of industrial and manufacturing units possesses serious threat to soil degradation and crop productivity around the world. The present study was carried to evaluate the combined role of microwave irradiation (MR) and citric acid (CA) on the phytoextraction potential of Brassica napus L. under Ni stress. An initial seed germination test was conducted to select effective time scale of MR exposure. Highest seed germination was observed at exposure of 2.45 GHz frequency for 30 s. Healthy seeds of B. napus L. genotype Faisal Canola (RBN-03060) treated with MR at 2.45 GHz for 30 s were sown in plastic pots filled with 5 kg of soil. Nickel and CA applied exogenously in solution form with different combinations to both MR-treated and untreated B. napus plants. The MR-treated plants showed higher growth, biomass, photosynthetic pigments (Chl a, b, total, and carotenoids) and activities of antioxidant enzymes (SOD, POD, APX, CAT) as compared to untreated plants who showed higher reactive oxygen species (MDA, H 2 O 2 ) and electrolyte leakage. Increasing Ni concentration significantly decreased the physiological and biochemical attributes of B. napus both in MR-treated and untreated plants. The addition of CA alleviated Ni-induced toxic effects in both MR-treated and untreated plants by improving antioxidant defense system. The degree of Ni stress mitigation was higher in MR-treated plants. The Ni concentration was higher in root, stem, and leaves of MR-treated plants under CA application as compared to untreated plants. The present study concluded that seeds treated with MR before sowing showed higher accumulation and concentration of Ni from soil, and this phenomenon boosted with the application of CA.

  16. BnEPFL6, an EPIDERMAL PATTERNING FACTOR-LIKE (EPFL) secreted peptide gene, is required for filament elongation in Brassica napus. (United States)

    Huang, Yi; Tao, Zhangsheng; Liu, Qiong; Wang, Xinfa; Yu, Jingyin; Liu, Guihua; Wang, Hanzhong


    Inflorescence architecture, pedicel length and stomata patterning in Arabidopsis thaliana are specified by inter-tissue communication mediated by ERECTA and its signaling ligands in the EPIDERMAL PATTERNING FACTOR-LIKE (EPFL) family of secreted cysteine-rich peptides. Here, we identified and characterized BnEPFL6 from Brassica napus. Heterologous expression of this gene under the double enhanced CaMV promoter (D35S) in Arabidopsis resulted in shortened stamen filaments, filaments degradation, and reduced filament cell size that displayed down-regulated expression of AHK2, in which phenotypic variation of ahk2-1 mutant presented highly consistent with that of BnEPFL6 transgenic lines. Especially, the expression level of BnEPFL6 in the shortened filaments of four B. napus male sterile lines (98A, 86A, SA, and Z11A) was similar to that of BnEPFL6 in the transgenic Arabidopsis lines. The activity of pBnEPFL6.2::GUS was intensive in the filaments of transgenic lines. These observations reveal that BnEPFL6 plays an important role in filament elongation and may also affect organ morphology and floral organ specification via a BnEPFL6-mediated cascade.

  17. Effects of helium ions of an early embryo on postembryonic leaf development in Brassica napus L.

    Energy Technology Data Exchange (ETDEWEB)

    Sakurai, Noboru [Tokyo Metropolitan Industrial Technology Research Institute, Tokyo (Japan); Minami, Harufumi [Tokyo Metropolitan Agricultural Experiment Station, Tachikawa, Tokyo (Japan); Shikazono, Naoya; Tanaka, Atsushi; Watanabe, Hiroshi [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment


    We examined postembryonic effects after helium ion and gamma ray irradiation of an isolated whole flower (a flower with pedicel) of Brassica napus through a flower organ culture, and estimated the effects of irradiation on embryogenesis in sexual reproductive stages. The whole flowers were irradiated with 30 Gy of helium ions and gamma rays in the early globular embryo and/or torpedo embryo stages. The helium ion and gamma ray irradiation of early globular embryos caused some drastic malformations in the first true leaves. Those malformations were classified into four types: cup-shaped, funnel-shaped, shrunk and the other varied leaves. The types were observed in 40% of plants that developed first true leaves. Both cup-shaped and funnel-shaped types were observed in over 15%. On the other hand, the irradiation of gamma rays of torpedo embryos caused sectors lacking chlorophyll in first true leaves. (author)

  18. Enteric methane production and ruminal fermentation of forage brassica diets fed in continuous culture (United States)

    The aim of the current study was to determine nutrient digestibility, VFA production, N metabolism, and CH4 production of canola (Brassica napus L.), rapeseed (B. napus L.), turnip (B. rapa L.), and annual ryegrass (Lolium multiflorum Lam.) fed with orchardgrass (Dactylis glomerata L.) in continuous...

  19. Effects of thermal stress of protein synthesis and gene expression in Brassica napus

    International Nuclear Information System (INIS)

    Halle, J.R.; Ghosh, S.; Dumbroff, E.B.; Heikkila, J.J.


    Leaf segments of Brassica napus were exposed to 22 degrees, 35 degrees, 38 degrees or 40 degrees C for up to 4 h. Analysis of radiolabelled proteins by 2-D SDS-PAGE and fluorography revealed two major groups of heat shock proteins (HSPs). One group comprised HSPs, 70, 76 and 87, with pIs ranging from 5.7 to 6.1, whereas the second group had molecular weights ranging from 23 to 16 kD and pIs from 5.6 to 6.9. Immunoblot analysis using antibodies directed against the large (RLSU) and small (RSSU) subunits of ribulose-1,5-bisphosphate carboxylase (RUBISCO) showed that increasing temperatures from 35 degrees to 38 degrees or 40 degrees C or the duration of thermal stress from 1 to 5 h did not affect levels of the RSSU (15 kd) whereas levels of the RLSU (52 kD) fell sharply. Nevertheless, RUBISCO activity was not adversely affected at 38 degree C for periods of up to 5 h. The increase observed in HSP 70 during heat shock was transcriptionally regulated, but the decrease in the RLSU was not accompanied by any detectable change in levels of its mRNA

  20. Genetic variants associated with the root system architecture of oilseed rape (Brassica napus L.) under contrasting phosphate supply. (United States)

    Wang, Xiaohua; Chen, Yanling; Thomas, Catherine L; Ding, Guangda; Xu, Ping; Shi, Dexu; Grandke, Fabian; Jin, Kemo; Cai, Hongmei; Xu, Fangsen; Yi, Bin; Broadley, Martin R; Shi, Lei


    Breeding crops with ideal root system architecture for efficient absorption of phosphorus is an important strategy to reduce the use of phosphate fertilizers. To investigate genetic variants leading to changes in root system architecture, 405 oilseed rape cultivars were genotyped with a 60K Brassica Infinium SNP array in low and high P environments. A total of 285 single-nucleotide polymorphisms were associated with root system architecture traits at varying phosphorus levels. Nine single-nucleotide polymorphisms corroborate a previous linkage analysis of root system architecture quantitative trait loci in the BnaTNDH population. One peak single-nucleotide polymorphism region on A3 was associated with all root system architecture traits and co-localized with a quantitative trait locus for primary root length at low phosphorus. Two more single-nucleotide polymorphism peaks on A5 for root dry weight at low phosphorus were detected in both growth systems and co-localized with a quantitative trait locus for the same trait. The candidate genes identified on A3 form a haplotype 'BnA3Hap', that will be important for understanding the phosphorus/root system interaction and for the incorporation into Brassica napus breeding programs. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  1. Comparative analysis of Brassica napus plasma membrane proteins under phosphorus deficiency using label-free and MaxQuant-based proteomics approaches. (United States)

    Chen, Shuisen; Luo, Ying; Ding, Guangda; Xu, Fangsen


    Phosphorus (P) deficiency is a primary constraint for plant growth in terrestrial ecosystems. To better understand the genotypic differences in the adaptation mechanism of Brassica napus to P deficiency, we purified the plasma membrane (PM) from the roots of two genotypes: P-efficient "Eyou Changjia" and P-inefficient "B104-2". Combining label-free quantitative proteomics with the MaxQuant approach, a total of 71 proteins that significantly changed in abundances were identified in the two genotypes in response to P-free starvation, including 31 in "Eyou Changjia" and 40 in "B104-2". Based on comparative genomics study, 28 proteins were mapped to the confidence intervals of quantitative trait loci (QTLs) for P efficiency related traits. Seven decreased proteins with transporter activity were found to be located in the PM by subcellular localization analyses. These proteins involved in intracellular protein transport and ATP hydrolysis coupled proton transport were mapped to the QTL for P content and dry weight. Compared with "B104-2", more decreased proteins referring to transporter activity were found in "Eyou Changjia", showing that substance exchange was decreased in response to short-term P-free starvation. Together with the finding, more decreased proteins functioning in signal transduction and protein synthesis/degradation suggested that "Eyou Changjia" could slow the progression of growth and save more P in response to short-term P-free starvation. P deficiency seriously limits the production and quality of B. napus. Roots absorb water and nutrients and anchor the plant in the soil. Therefore, to study root PM proteome under P stress would be helpful to understand the adaptation mechanism for P deficiency. However, PM proteome analysis in B. napus has been seldom reported due to the high hydrophobicity and low abundance of PM. Thus, we herein investigated the PM proteome alteration of roots in two B. napus genotypes, with different P deficient tolerances, in

  2. Characterization and tissue-differential expression of fad2 genes in brassica napus

    International Nuclear Information System (INIS)

    Zhuang, Li.; Cong, Y. S.; Hao, L.; Ze, L. Y.; Cheng, W. Y.; Xing, G. S.; Lili, L.


    In this study, genome DNA and RNA of fad2 genes from three types of oleic acid content from B. napus were isolated by PCR amplification, respectively, the results showed that not only had nucleotides sequences little differences from three types of oleic acid content B. napus, but also that of genome DNA and cDNA had still little differences from B. napus as far as specific one type of rape. Different genotypes fad2-I and fad2-II could be easily distinguished by sequence analysis of the cDNAs in G type and CK type except in D type. By analysis on cDNAs, specific differences could be found in three types of rape when compared with the sequence from Genebank. Conserved domains prediction and phylogenetic analysis showed that both six transmembrane domains and three H boxes could be found in FAD2 protein from three types of oleic acid content B. napus, respectively. BnFAD2-I and BnFAD2-II belonged to different classes and class I could be divided into two kinds. By QPCR, expression pattern of fad2 gene in different tissues showed that simple division of fad2-I and fad2-II was not apply to all oleic acid content B. napus. By southern blot, there were differences in copy numbers of fad2 genes on different oleic acid content B. napus. (author)

  3. Wrinkled1 accelerates flowering and regulates lipid homeostasis between oil accumulation and membrane lipid anabolism in Brassica napus

    Directory of Open Access Journals (Sweden)

    Qing eLi


    Full Text Available Wrinkled1 (WRI1 belongs to the APETALA2 transcription factor family; it is unique to plants and is a central regulator of oil synthesis in Arabidopsis. The effects of WRI1 on comprehensive lipid metabolism and plant development were unknown, especially in crop plants. This study found that BnWRI1 in Brassica napus accelerated flowering and enhanced oil accumulation in both seeds and leaves without leading to a visible growth inhibition. BnWRI1 decreased storage carbohydrates and increased soluble sugars to facilitate the carbon flux to lipid anabolism. BnWRI1 is localized to the nucleus and directly binds to the AW-box at proximal upstream regions of genes involved in fatty acid synthesis and lipid assembly. The overexpression (OE of BnWRI1 resulted in the up-regulation of genes involved in glycolysis, fatty acid synthesis, lipid assembly, and flowering. Lipid profiling revealed increased galactolipid monogalactosyldiacylglycerol (MGDG, digalactosyldiacylglycerol (DGDG, and phosphatidylcholine (PC in the leaves of OE plants, whereas it exhibited a reduced level of the galactolipids DGDG and MGDG and increased levels of PC, phosphatidylethanolamide (PE, and oil (triacylglycerol, TAG in the siliques of OE plants during the early seed development stage. These results suggest that BnWRI1 is important for homeostasis among TAG, membrane lipids and sugars, and thus facilitates flowering and oil accumulation in B. napus.

  4. QTL meta-analysis of root traits in Brassica napus under contrasting phosphorus supply in two growth systems. (United States)

    Zhang, Ying; Thomas, Catherine L; Xiang, Jinxia; Long, Yan; Wang, Xiaohua; Zou, Jun; Luo, Ziliang; Ding, Guangda; Cai, Hongmei; Graham, Neil S; Hammond, John P; King, Graham J; White, Philip J; Xu, Fangsen; Broadley, Martin R; Shi, Lei; Meng, Jinling


    A high-density SNP-based genetic linkage map was constructed and integrated with a previous map in the Tapidor x Ningyou7 (TNDH) Brassica napus population, giving a new map with a total of 2041 molecular markers and an average marker density which increased from 0.39 to 0.97 (0.82 SNP bin) per cM. Root and shoot traits were screened under low and 'normal' phosphate (Pi) supply using a 'pouch and wick' system, and had been screened previously in an agar based system. The P-efficient parent Ningyou7 had a shorter primary root length (PRL), greater lateral root density (LRD) and a greater shoot biomass than the P-inefficient parent Tapidor under both treatments and growth systems. Quantitative trait loci (QTL) analysis identified a total of 131 QTL, and QTL meta-analysis found four integrated QTL across the growth systems. Integration reduced the confidence interval by ~41%. QTL for root and shoot biomass were co-located on chromosome A3 and for lateral root emergence were co-located on chromosomes A4/C4 and C8/C9. There was a major QTL for LRD on chromosome C9 explaining ~18% of the phenotypic variation. QTL underlying an increased LRD may be a useful breeding target for P uptake efficiency in Brassica.

  5. Hyperspectral and thermal imaging of oilseed rape (Brassica napus response to fungal species of the genus Alternaria.

    Directory of Open Access Journals (Sweden)

    Piotr Baranowski

    Full Text Available In this paper, thermal (8-13 µm and hyperspectral imaging in visible and near infrared (VNIR and short wavelength infrared (SWIR ranges were used to elaborate a method of early detection of biotic stresses caused by fungal species belonging to the genus Alternaria that were host (Alternaria alternata, Alternaria brassicae, and Alternaria brassicicola and non-host (Alternaria dauci pathogens to oilseed rape (Brassica napus L.. The measurements of disease severity for chosen dates after inoculation were compared to temperature distributions on infected leaves and to averaged reflectance characteristics. Statistical analysis revealed that leaf temperature distributions on particular days after inoculation and respective spectral characteristics, especially in the SWIR range (1000-2500 nm, significantly differed for the leaves inoculated with A. dauci from the other species of Alternaria as well as from leaves of non-treated plants. The significant differences in leaf temperature of the studied Alternaria species were observed in various stages of infection development. The classification experiments were performed on the hyperspectral data of the leaf surfaces to distinguish days after inoculation and Alternaria species. The second-derivative transformation of the spectral data together with back-propagation neural networks (BNNs appeared to be the best combination for classification of days after inoculation (prediction accuracy 90.5% and Alternaria species (prediction accuracy 80.5%.

  6. Increased Agrobacterium-mediated transformation and rooting efficiencies in canola (Brassica napus L.) from hypocotyl segment explants (United States)

    Cardoza, V.; Stewart, C. N.


    An efficient protocol for the production of transgenic Brassica napus cv. Westar plants was developed by optimizing two important parameters: preconditioning time and co-cultivation time. Agrobacterium tumefaciens-mediated transformation was performed using hypocotyls as explant tissue. Two variants of a green fluorescent protein (GFP)-encoding gene--mGFP5-ER and eGFP--both under the constitutive expression of the cauliflower mosaic virus 35S promoter, were used for the experiments. Optimizing the preconditioning time to 72 h and co-cultivation time with Agrobacterium to 48 h provided the increase in the transformation efficiency from a baseline of 4% to 25%. With mGFP5-ER, the transformation rate was 17% and with eGFP it was 25%. Transgenic shoots were selected on 200 mg/l kanamycin. Rooting efficiency was 100% on half-strength Murashige and Skoog medium with 10 g/l sucrose and 0.5 mg/l indole butyric acid in the presence of kanamycin.

  7. Cysteine- and glutathione-mediated uptake of lead and cadmium into Zea mays and Brassica napus roots

    International Nuclear Information System (INIS)

    Vadas, Timothy M.; Ahner, Beth A.


    This study examines a new mechanism for the uptake of Pb and Cd into Brassica napus and Zea mays roots. During hydroponic experiments, the uptake of Pb and Cd was enhanced in the presence of cysteine and glutathione, whereas no or very low uptake was observed in EDTA and penicillamine controls. Uptake rates were also enhanced after pre-exposure to cysteine or glutathione and inhibited in the presence of vanadate, suggesting a biological mechanism of uptake. Increasing concentrations of glutathione in solution resulted in decreasing Pb uptake rates, indicating competition for transport between free-glutathione and Pb-glutathione species. Pb uptake in the presence of increasing cysteine concentrations resulted in decreased uptake initially but linearly increasing uptake at higher concentrations. Experimentation showed concentration dependent Pb uptake rates. We speculate that there are specific transporters for these thiol ligands and describe what barriers remain for application of this novel transport mechanism in chelator-assisted phytoremediation. - Cysteine and glutathione mediate the transport of lead and cadmium into plant roots.

  8. Cysteine- and glutathione-mediated uptake of lead and cadmium into Zea mays and Brassica napus roots

    Energy Technology Data Exchange (ETDEWEB)

    Vadas, Timothy M., E-mail: tvadas@umbc.ed [Department of Biological and Environmental Engineering, Cornell University, 320 Riley-Robb Hall, Ithaca, NY 14853 (United States); Ahner, Beth A., E-mail: baa7@cornell.ed [Department of Biological and Environmental Engineering, Cornell University, 320 Riley-Robb Hall, Ithaca, NY 14853 (United States)


    This study examines a new mechanism for the uptake of Pb and Cd into Brassica napus and Zea mays roots. During hydroponic experiments, the uptake of Pb and Cd was enhanced in the presence of cysteine and glutathione, whereas no or very low uptake was observed in EDTA and penicillamine controls. Uptake rates were also enhanced after pre-exposure to cysteine or glutathione and inhibited in the presence of vanadate, suggesting a biological mechanism of uptake. Increasing concentrations of glutathione in solution resulted in decreasing Pb uptake rates, indicating competition for transport between free-glutathione and Pb-glutathione species. Pb uptake in the presence of increasing cysteine concentrations resulted in decreased uptake initially but linearly increasing uptake at higher concentrations. Experimentation showed concentration dependent Pb uptake rates. We speculate that there are specific transporters for these thiol ligands and describe what barriers remain for application of this novel transport mechanism in chelator-assisted phytoremediation. - Cysteine and glutathione mediate the transport of lead and cadmium into plant roots.

  9. Variations in fatty acid composition, glucosinolate profile and some phyto chemical contents in selected oil seed rape (Brassica napus L.) cultivars

    Energy Technology Data Exchange (ETDEWEB)

    El-Din Saad El-Beltag, H.; Mohamed, A. A.


    Rapeseed (Brassica napus L.) is now the third most important source of edible oil in the world after soybean and palm oil. In this study seeds of five different rapeseed cultivars namely; pactol, silvo, topas, serw 4 and serw 6 were evaluated for their fatty acid composition, glucosinolate profile, amino acids, total tocopherols and phenolic content. Among all cultivars significant variability in fatty acids were observed. The oleic acid (C18:1) ranged from 56.31% to 58.67%, linoleic acid (C18:2) from 10.52% to 13.74%, {alpha}-linolenic acid (C18:3) from 8.83% to 10.32% and erucic acid (22:1) from 0.15% to 0.91%. The glucosinolate profile of rapeseed was also separated and identified using high-performance liquid chromatography. Small variations in the glucosinolate profile were observed among all tested cultivars; however, progoitrin and gluconapin were the major glucosinolate found. Additionally, silvo cultivar showed the highest total glucosinolate contents (5.97 {mu}mol/g dw). Generally, the contents of aspartic, glutamic, arginine and leucine were high, while the contents of tyrosine and isoleucine were low among all cultivars. For total tocopherols, the results indicated that both serw 6 and pactol cultivars had the highest total tocopherol contents (138.3 and 102.8 mg/100 g oil, respectively). Total phenolic contents varied from 28.0 to 35.4 mg/g dw. The highest total phenolic content was found in topas while the lowest value was detected in serw 6. These parameters; fatty acid contents, glucosinolate profile and amino acids together with total tocopherols and phenolic contents, could be taken into consideration by oilseed rape breeders as selection criteria for developing genotypes with modified seed quality traits in Brassica napus L. (Author)

  10. Genetic diversity of notary-national uniform rape seed yield trial and brassica napus varieties using raped markers and biochemical analysis

    International Nuclear Information System (INIS)

    Bakhat, J.; Fareed, A.; Swati, Z.A.; Shafi, M.


    In Pakistan, Brassica is the second most important source of oil after cotton. Seventeen NURYT (National Uniform Rape Seed Yield Trial) lines and 5 Brassica napus varieties were assessed through RAPD primers and biochemical assays. Seven different Randomly Amplified Polymorphic DNA markers (RAPD) were employed during the present study. A total of 30 RAPD bands were scored by these primers. Size of the scorable fragments ranged from approximately 250 to 2000 bp. Diversity index was estimated to be 42%. Mean genetic distance estimates ranged between 0.10 and 1.00. For the assessment of various biochemical parameters, Near Infrared Reflectance Spectroscopy (NIRS) was used. Oil content ranged from 38.30 to 49% and protein content from 19.80 to 29.10% among the 22 genotypes. Maximum protein content was assayed in genotype RBN 3046 while minimum in Hyola 405. Glucosinolates ranged between 2 and 84% for genotype CRH 60/08 and CRH05/08 showing the maximum and minimum values respectively. Oleic acid (52 to 72.5%), linolenic acid (7.07 and 9.90%) and erucic acid content (9.57 to 38.3%) was also recorded during the present study. (author)

  11. Application of Endophytic Pseudomonas fluorescens and a Bacterial Consortium to Brassica napus Can Increase Plant Height and Biomass under Greenhouse and Field Conditions

    Directory of Open Access Journals (Sweden)

    Richard D. Lally


    Full Text Available Plant associated bacteria with plant growth promotion (PGP properties have been proposed for use as environmentally friendly biofertilizers for sustainable agriculture; however, analysis of their efficacy in the field is often limited. In this study, greenhouse and field trials were carried out using individual endophytic Pseudomonas fluorescens strains, the well characterized rhizospheric P. fluorescens F113 and an endophytic microbial consortium of 10 different strains. These bacteria had been previously characterized with respect to their PGP properties in vitro and had been shown to harbor a range of traits associated with PGP including siderophore production, 1-aminocyclopropane-1-carboxylic acid (ACC deaminase activity, and inorganic phosphate solubilization. In greenhouse experiments individual strains tagged with gfp and Kmr were applied to Brassica napus as a seed coat and were shown to effectively colonize the rhizosphere and root of B. napus and in addition they demonstrated a significant increase in plant biomass compared with the non-inoculated control. In the field experiment, the bacteria (individual and consortium were spray inoculated to winter oilseed rape B. napus var. Compass which was grown under standard North Western European agronomic conditions. Analysis of the data provides evidence that the application of the live bacterial biofertilizers can enhance aspects of crop development in B. napus at field scale. The field data demonstrated statistically significant increases in crop height, stem/leaf, and pod biomass, particularly, in the case of the consortium inoculated treatment. However, although seed and oil yield were increased in the field in response to inoculation, these data were not statistically significant under the experimental conditions tested. Future field trials will investigate the effectiveness of the inoculants under different agronomic conditions.

  12. Productivity and nutritive quality of three brassica varieties for use in pasture-based systems (United States)

    Brassicas are gaining popularity among pasture-based livestock producers to extend grazing during the ‘summer slump’ and throughout the fall. A 2-yr study was conducted to compare biomass production and nutrient composition of ‘Barisca’ rapeseed (RAP; Brassica napus L.), ‘Inspiration’ canola (CAN; B...

  13. Atividade de alguns insetos em flores de Brassica napus L. em Dourados-MS e a interação com fatores climáticos Activity of some insects in Brassica napus L. flowers at Dourados-MS and the interaction with climatic factors

    Directory of Open Access Journals (Sweden)

    Rosilda Mara Mussury


    Full Text Available Objetivou-se estudar a flutuação populacional, horários de visitação e a interação com fatores climáticos de insetos visitantes de flores de Brassica napus L. em diversos estádios fenológicos. O trabalho foi realizado em Dourados, MS, Brasil. Os insetos foram coletados com rede entomológica de 30 cm de diâmetro, a cada duas horas, no período de 7 as 17 horas. Foram coletadas as abelhas Apis mellifera, Linnaeus, 1758, Trigona sp., o vespídeo Brachygastra lecheguana (Latreille - 1824 e uma espécie de Chloropidae (Diptera, que foi a mais abundante e freqüente nas amostragens. O pico populacional da maioria dos insetos foi das 9 às 15 horas; contudo, para Trigona sp., foi entre 9 e 11 horas. A maior frequência de insetos ocorreu durante o estádio fenológico III. A análise de correlação evidenciou que a umidade relativa entre 11 horas (r = 0,57 e 13 horas (r = 0,43 favoreceu a ocorrência do díptero da família Chloropidae. Reduções nas populações de insetos do estádio III para o IV foram devidas, provavelmente, a temperaturas mais baixas, que atingiram a média de 16,1ºC.The objective of this work was to study the populational fluctuation, the preferred visiting time, and the interaction with climatic factors in several phenological stages from visitant insects in Brassica napus L. flowers. The study was accomplished in Dourados-MS, Brazil. The insects were collected with a 30-cm wide entomologic sweep net every 2 hours from 7h00 to 17h00. Apis mellifera L., 1758, Trigona sp., and Brachygastra lecheguana (Latreille - 1824 were gathered in B. napus flowers. A dipterous from the Chloropidae family was the insect with the largest populational density in the samples. The large occurrence of most pollinators was between 9h00 and 15h00, but Trigona sp. was present in larger numbers between 9h00 and 11h00. The largest frequency of pollinator insects occurred during stage III of flowering. The correlation analysis indicated

  14. Genomic change, retrotransposon mobilization and extensive cytosine methylation alteration in Brassica napus introgressions from two intertribal hybridizations.

    Directory of Open Access Journals (Sweden)

    Xueli Zhang

    Full Text Available Hybridization and introgression represent important means for the transfer and/or de novo origination of traits and play an important role in facilitating speciation and plant breeding. Two sets of introgression lines in Brassica napus L. were previously established by its intertribal hybridizations with two wild species and long-term selection. In this study, the methods of amplified fragment length polymorphisms (AFLP, sequence-specific amplification polymorphism (SSAP and methylation-sensitive amplified polymorphism (MSAP were used to determine their genomic change, retrotransposon mobilization and cytosine methylation alteration in these lines. The genomic change revealed by the loss or gain of AFLP bands occurred for ∼10% of the total bands amplified in the two sets of introgressions, while no bands specific for wild species were detected. The new and absent SSAP bands appeared for 9 out of 11 retrotransposons analyzed, with low frequency of new bands and their total percentage of about 5% in both sets. MSAP analysis indicated that methylation changes were common in these lines (33.4-39.8% and the hypermethylation was more frequent than hypomethylation. Our results suggested that certain extents of genetic and epigenetic alterations were induced by hybridization and alien DNA introgression. The cryptic mechanism of these changes and potential application of these lines in breeding were also discussed.

  15. Biology and harmfulness of Brassica pod midge (Dasineura brassicae Winn. in winter oilseed rape

    Directory of Open Access Journals (Sweden)

    Draga Graora


    Full Text Available The Brassica pod midge (Dasineura brassicae Winn. is an important pest in oilseed rape (Brasica napus L.. It develops two generations per year and overwinters in the larval stage in cocoons in soil. Immigration of the first generation adults lasted from the beginning of April until the end of May. Larvae developed in pods from mid-April to mid-June, causing pod deformation and cracking, which resulted in premature falling out of seeds and yield reduction. Pod damage amounted to 11.6%. The emergence of the second generation adults was detected at the end of May and in the first ten days of June. D. brassicae was found to lay eggs in healthy pods and no correlation was found with the cabbage seed weevil, Ceutorhynchus assimilis Paykull.

  16. Effect of Pre-culture Irradiation and Explant Types on Efficiency of Brassica napus Genetic Transformation

    International Nuclear Information System (INIS)

    Amer, I.M.; Moustafa, H.A.M.; Azzam, C.R.


    The irradiated seeds of canola cv. Drakkar ( Brassica napus l. ) were germinated under aspect conditions, cotyledonary petioles and hypocotyl of 6 days old seedlings were used for Agrobacterium-mediated transformation. Agrobacterium tumefaciens has construct with the selectable marker gene (NPT II) and the desirable gene (HPPD). Direct and indirect shoot organogenesis were obtained from the both explants. Cotyledonary petioles was higher responded than hypocotyl with respective 26% and 14% of the explants producing NPT II-positive shoots after the selection on 50mg/l kanamycin. Calli might develop on and not in the agar medium were un transformation. This explains the higher number of escapes detected in hypocotyl explants than in experiments with cotyledons. The frequency of transformation plants as a function of indirect organogenesis was more than direct shoot regeneration from explants. The pre- irradiation with 75 Gy of gamma rays enhanced the genetic transformation frequencies by about 10 % as compared to that of the un-irradiated material. The obtained shoots were rooted and regenerated mature plants

  17. Sequential light programs shape kale (Brassica napus) sprout appearance and alter metabolic and nutrient content (United States)

    Carvalho, Sofia D; Folta, Kevin M


    Different light wavelengths have specific effects on plant growth and development. Narrow-bandwidth light-emitting diode (LED) lighting may be used to directionally manipulate size, color and metabolites in high-value fruits and vegetables. In this report, Red Russian kale (Brassica napus) seedlings were grown under specific light conditions and analyzed for photomorphogenic responses, pigment accumulation and nutraceutical content. The results showed that this genotype responds predictably to darkness, blue and red light, with suppression of hypocotyl elongation, development of pigments and changes in specific metabolites. However, these seedlings were relatively hypersensitive to far-red light, leading to uncharacteristically short hypocotyls and high pigment accumulation, even after growth under very low fluence rates (<1 μmol m−2 s−1). General antioxidant levels and aliphatic glucosinolates are elevated by far-red light treatments. Sequential treatments of darkness, blue light, red light and far-red light were applied throughout sprout development to alter final product quality. These results indicate that sequential treatment with narrow-bandwidth light may be used to affect key economically important traits in high-value crops. PMID:26504531

  18. Variations in fatty acid composition, glucosinolate profile and some phytochemical contents in selected oil seed rape (Brassica napus L. cultivars

    Directory of Open Access Journals (Sweden)

    Amin Mohamed, Amal


    Full Text Available Rapeseed (Brassica napus L. is now the third most important source of edible oil in the world after soybean and palm oil. In this study seeds of five different rapeseed cultivars namely; pactol, silvo, topas, serw 4 and serw 6 were evaluated for their fatty acid composition, glucosinolate profile, amino acids, total tocopherols and phenolic content. Among all cultivars significant variability in fatty acids were observed. The oleic acid (C18:1 ranged from 56.31% to 58.67%, linoleic acid (C18:2 from 10.52% to 13.74%, α-linolenic acid (C18:3 from 8.83% to 10.32% and erucic acid (22:1 from 0.15% to 0.91%. The glucosinolate profile of rapeseed was also separated and identified using high-performance liquid chromatography. Small variations in the glucosinolate profile were observed among all tested cultivars; however, progoitrin and gluconapin were the major glucosinolate found. Additionally, silvo cultivar showed the highest total glucosinolate c ontents (5.97 μmol/g dw. Generally, the contents of aspartic, glutamic, arginine and leucine were high, while the contents of tyrosine and isoleucine were low among all cultivars. For total tocopherols, the results indicated that both serw 6 and pactol cultivars had the highest total tocopherol contents (138.3 and 102.8 mg/100 g oil, respectively. Total phenolic contents varied from 28.0 to 35.4 mg/g dw. The highest total phenolic content was found in topas while the lowest value was detected in serw 6. These parameters; fatty acid contents, glucosinolate profile and amino acids together with total tocopherols and phenolic contents, could be taken into consideration by oilseed rape breeders as selection criteria for developing genotypes with modified seed quality traits in Brassica napus L.La colza (Brassica napus L. es hoy en día el tercer cultivo más importante de aceites comestibles en el mundo tras el aceite de soja y de palma. En este estudio semillas de cinco cultivos diferentes de colza

  19. Unraveling the genetic basis of seed tocopherol content and composition in rapeseed (Brassica napus L.). (United States)

    Wang, Xingxing; Zhang, Chunyu; Li, Lingjuan; Fritsche, Steffi; Endrigkeit, Jessica; Zhang, Wenying; Long, Yan; Jung, Christian; Meng, Jinling


    Tocopherols are important antioxidants in vegetable oils; when present as vitamin E, tocopherols are an essential nutrient for humans and livestock. Rapeseed (Brassica napus L, AACC, 2 n = 38) is one of the most important oil crops and a major source of tocopherols. Although the tocopherol biosynthetic pathway has been well elucidated in the model photosynthetic organisms Arabidopsis thaliana and Synechocystis sp. PCC6803, knowledge about the genetic basis of tocopherol biosynthesis in seeds of rapeseed is scant. This project was carried out to dissect the genetic basis of seed tocopherol content and composition in rapeseed through quantitative trait loci (QTL) detection, genome-wide association analysis, and homologous gene mapping. We used a segregating Tapidor × Ningyou7 doubled haploid (TNDH) population, its reconstructed F(2) (RC-F(2)) population, and a panel of 142 rapeseed accessions (association panel). Genetic effects mainly contributed to phenotypic variations in tocopherol content and composition; environmental effects were also identified. Thirty-three unique QTL were detected for tocopherol content and composition in TNDH and RC-F(2) populations. Of these, seven QTL co-localized with candidate sequences associated with tocopherol biosynthesis through in silico and linkage mapping. Several near-isogenic lines carrying introgressions from the parent with higher tocopherol content showed highly increased tocopherol content compared with the recurrent parent. Genome-wide association analysis was performed with 142 B. napus accessions. Sixty-one loci were significantly associated with tocopherol content and composition, 11 of which were localized within the confidence intervals of tocopherol QTL. This joint QTL, candidate gene, and association mapping study sheds light on the genetic basis of seed tocopherol biosynthesis in rapeseed. The sequences presented here may be used for marker-assisted selection of oilseed rape lines with superior tocopherol

  20. Unraveling the genetic basis of seed tocopherol content and composition in rapeseed (Brassica napus L..

    Directory of Open Access Journals (Sweden)

    Xingxing Wang

    Full Text Available BACKGROUND: Tocopherols are important antioxidants in vegetable oils; when present as vitamin E, tocopherols are an essential nutrient for humans and livestock. Rapeseed (Brassica napus L, AACC, 2 n = 38 is one of the most important oil crops and a major source of tocopherols. Although the tocopherol biosynthetic pathway has been well elucidated in the model photosynthetic organisms Arabidopsis thaliana and Synechocystis sp. PCC6803, knowledge about the genetic basis of tocopherol biosynthesis in seeds of rapeseed is scant. This project was carried out to dissect the genetic basis of seed tocopherol content and composition in rapeseed through quantitative trait loci (QTL detection, genome-wide association analysis, and homologous gene mapping. METHODOLOGY/PRINCIPAL FINDINGS: We used a segregating Tapidor × Ningyou7 doubled haploid (TNDH population, its reconstructed F(2 (RC-F(2 population, and a panel of 142 rapeseed accessions (association panel. Genetic effects mainly contributed to phenotypic variations in tocopherol content and composition; environmental effects were also identified. Thirty-three unique QTL were detected for tocopherol content and composition in TNDH and RC-F(2 populations. Of these, seven QTL co-localized with candidate sequences associated with tocopherol biosynthesis through in silico and linkage mapping. Several near-isogenic lines carrying introgressions from the parent with higher tocopherol content showed highly increased tocopherol content compared with the recurrent parent. Genome-wide association analysis was performed with 142 B. napus accessions. Sixty-one loci were significantly associated with tocopherol content and composition, 11 of which were localized within the confidence intervals of tocopherol QTL. CONCLUSIONS/SIGNIFICANCE: This joint QTL, candidate gene, and association mapping study sheds light on the genetic basis of seed tocopherol biosynthesis in rapeseed. The sequences presented here may be used

  1. Significant reductions in oil quality and lipid content of oilseed rape (Brassica napus L.) under climate change

    DEFF Research Database (Denmark)

    Namazkar, Shahla; Egsgaard, Helge; Frenck, Georg


    Despite of the potential importance to food and bioenergy purposes, effects from climate change on plant oil quality have hardly been characterized.On a global basis Brassica napus L., rapeseed or oilseed rape, is the second largest source of vegetable oil after soybean and the predominant oil crop...... in Europe. We found significant changes in oil quality and quantity of four cultivars of oilseed rape grown in five future climate scenarios with elevated [CO2], [O-3] temperature and combinations hereof (similar to RCP8.5,(1)). Populations of the cultivars were grown under ambient and climate change...... conditions in a climate-phytotron. The treatments were ambient (360 ppm CO2, 19/12 degrees C (day/night), 20/20 ppb O-3 (day/night)), all factors elevated (650 ppm CO2, 24/17 degrees C, 60/20 ppb O-3), as well as two- and single-factor treatments with the elevated factors.The overall trend was that oil...

  2. Contrastive response of Brassica napus L. to exogenous salicylic acid, selenium and silicon supplementation under water stress

    Directory of Open Access Journals (Sweden)

    Habibi Ghader


    Full Text Available The present research was designed to determine the effects of exogenous salicylic acid (SA, selenium (Se and silicon (Si on the resistance of canola (Brassica napus L. cv Okapi seedlings to salt stress. Foliar application of SA (0.1 mM in canola plants under drought stress for 25 days exhibited a significantly positive effect on shoot dry mass and raised the levels of total chlorophyll as well as boosting the activity of superoxide dismutase (SOD and catalase (CAT. In addition, soil application of silicon (0.35 g Na2SiO3/kg soil had ameliorative effects on canola root growth under drought. It is concluded that SA and Si enhanced the salt tolerance of canola by protecting the cell membrane against lipid peroxidation. However, the foliar application of Se (10 mg/l had no ameliorative effects on canola growth and antioxidant capacity under drought stress, as could be judged by accumulation of malondialdehyde (MDA.

  3. Brassica napus has a key role in the recovery of the health of soils contaminated with metals and diesel by rhizoremediation. (United States)

    Lacalle, Rafael G; Gómez-Sagasti, María T; Artetxe, Unai; Garbisu, Carlos; Becerril, José M


    Contaminated soils are frequently characterized by the simultaneous presence of organic and inorganic contaminants, as well as a poor biological and nutritional status. Rhizoremediation, the combined use of phytoremediation and bioremediation, has been proposed as a Gentle Remediation Option to rehabilitate multi-contaminated soils. Recently, newer techniques, such as the application of metallic nanoparticles, are being deployed in an attempt to improve traditional remediation options. In order to implement a phytomanagement strategy on calcareous alkaline peri-urban soils simultaneously contaminated with several metals and diesel, we evaluated the effectiveness of Brassica napus L., a profitable crop species, assisted with organic amendment and zero-valent iron nanoparticles (nZVI). A two-month phytotron experiment was carried out using two soils, i.e. amended and unamended with organic matter. Soils were artificially contaminated with Zn, Cu and Cd (1500, 500 and 50mgkg -1 , respectively) and diesel (6000mgkg -1 ). After one month of stabilization, soils were treated with nZVI and/or planted with B. napus. The experiment was conducted with 16 treatments resulting from the combination of the following factors: amended/unamended, contaminated/non-contaminated, planted/unplanted and nZVI/no-nZVI. Soil physicochemical characteristics and biological indicators (plant performance and soil microbial properties) were determined at several time points along the experiment. Carbonate content of soils was the crucial factor for metal immobilization and, concomitantly, reduction of metal toxicity. Organic amendment was essential to promote diesel degradation and to improve the health and biomass of B. napus. Soil microorganisms degraded preferably diesel hydrocarbons of biological origin (biodiesel). Plants had a remarkable positive impact on the activity and functional diversity of soil microbial communities. The nZVI were ineffective as soil remediation tools, but did not

  4. Influence of a Vertical Cutting Device on Brassica Napus Seed Loss in Direct Combining

    Energy Technology Data Exchange (ETDEWEB)

    Pari, L.; Fedrizzi, M.; Assirelli, A. (Consiglio per la Ricerca e la Sperimentazione in Agricoltura, Unita di Ricerca per l' Ingegneria Agraria, Monterotondo, RM (Italy))


    EU requires that by 2010 5.65% of diesel fuel must be of vegetable origin. To reduce Italian dependence from imported palm oil, it is necessary to increase national production of vegetable oils: together with sunflower and soybean, canola (Brassica napus or Brassica napus oleifera) is an interesting possibility to satisfy vegetable oil demand, that is rapidly increasing for its use in biodiesel production. In Italy potential areas are available for the cultivation in relation to adequate rainfall and mild winters, that are very promising factors for canola production. However, the long period of seed maturity, non uniform growth, natural dehiscent process and variable weather conditions, such as wind and rain, are some of the factors which can lead to large seed losses: this is the main problem limiting this specie diffusion. Amongst available harvesting techniques, direct harvest of canola is an hazardous practice because there are several important questions related to it. The success of canola may depend on research initiatives to reduce some of the obstacles associated with its growing. The objective of this study is to determine if different cropping heads in direct combining can reduce seed losses. In Northern Italy (Piedmont) the trials were conducted in a 16 ha canola cultivation, in which was seeded the -Lion variety of canola. In order to realize direct harvest, the combine cylinder speed was regulated as slow as possible (500 rpm), the concave was opened at 3/4 of the way (about 25 mm clearance) and the fan speed was set at 2/3 of small grain settings (800 rpm). Only one combine was used for the trials, a New Holland CX 9080, in order to avoid any influence on seed losses. The combine was equipped with two different cutting heads: a common wheat type (type 1) and another, similar to the first, but equipped with vertical cutting devices on both ends of the head (type 2), because the plants are very dense and entangled. The losses of seeds were measured

  5. Effects of Glucosinolates and Flavonoids on Colonization of the Roots of Brassica napus by Azorhizobium caulinodans ORS571 (United States)

    O'Callaghan, Kenneth J.; Stone, Philip J.; Hu, Xiaojia; Griffiths, D. Wynne; Davey, Michael R.; Cocking, Edward C.


    Plants of Brassica napus were assessed quantitatively for their susceptibility to lateral root crack colonization by Azorhizobium caulinodans ORS571(pXLGD4) (a rhizobial strain carrying the lacZ reporter gene) and for the concentration of glucosinolates in their roots by high-pressure liquid chromatography (HPLC). High- and low-glucosinolate-seed (HGS and LGS) varieties exhibited a relatively low and high percentage of colonized lateral roots, respectively. HPLC showed that roots of HGS plants contained a higher concentration of glucosinolates than roots of LGS plants. One LGS variety showing fewer colonized lateral roots than other LGS varieties contained a higher concentration of glucosinolates than other LGS plants. Inoculated HGS plants treated with the flavonoid naringenin showed significantly more colonization than untreated HGS plants. This increase was not mediated by a naringenin-induced lowering of the glucosinolate content of HGS plant roots, nor did naringenin induce bacterial resistance to glucosinolates or increase the growth of bacteria. The erucic acid content of seed did not appear to influence colonization by azorhizobia. Frequently, leaf assays are used to study glucosinolates and plant defense; this study provides data on glucosinolates and bacterial colonization in roots and describes a bacterial reporter gene assay tailored easily to the study of ecologically important phytochemicals that influence bacterial colonization. These data also form a basis for future assessments of the benefits to oilseed rape plants of interaction with plant growth-promoting bacteria, especially diazotrophic bacteria potentially able to extend the benefits of nitrogen fixation to nonlegumes. PMID:10788398

  6. BnDGAT1s Function Similarly in Oil Deposition and Are Expressed with Uniform Patterns in Tissues of Brassica napus

    Directory of Open Access Journals (Sweden)

    Cuizhu Zhao


    Full Text Available As an allotetraploid oilcrop, Brassica napus contains four duplicated Acyl-CoA:diacylglycerol acyltransferase 1 (DGAT1 genes, which catalyze one of the rate-limiting steps in triacylglycerol (TAG biosynthesis in plants. While all four BnDGAT1s have been expressed functionally in yeast, their expression patterns in different germplasms and tissues and also consequent contribution to seed oil accumulation in planta remain to be elucidated. In this study, the coding regions of the four BnDGAT1s were expressed in an Arabidopsis dgat1 mutant. All four BnDGAT1s showed similar effects on oil content and fatty acid composition, a result which is different from that observed in previous studies of their expression in yeast. Expression patterns of BnDGAT1s were analyzed in developing seeds of 34 B. napus inbred lines and in different tissues of 14 lines. Different expression patterns were observed for the four BnDGAT1s, which suggests that they express independently or randomly in different germplasm sources. Higher expression of BnDGAT1s was correlated with higher seed oil content lines. Tissue-specific analyses showed that the BnDGAT1s were expressed in a uniform pattern in different tissues. Our results suggest that it is important to maintain expression of the four BnDGAT1s for maximum return on oil content.

  7. Effects of gamma irradiation of an isolated flower in reproductive stages on seed production of Brassica napus L

    International Nuclear Information System (INIS)

    Minami, Harufumi; Sakurai, Noboru; Muroyama, Takeo; Hogetsu, Daisuke


    We examined seed production after gamma irradiation of an isolated whole flower (a flower with pedicel) of Brassica napus strain 1 through a flower organ culture and estimated the effects of gamma rays on embryogenesis in sexual reproductive stages. The whole flowers were irradiated with 17, 32, 57 and 87 Gy of gamma rays in unpollinated stage at day of anthesis, in stage shortly after fertilization and early embryo stage. The gamma irradiation of flowers in stage shortly after fertilization showed a drastic effect on the mature seed production. The number of seeds per pod began to decrease at 17 Gy and dropped to 15% of that of unirradiated flowers at 32 Gy. On the other hand, the flowers irradiated in the unpollinated and early embryo stages began to reduce the number of seeds at 57 Gy. The ovary elongation was suppressed with increasing irradiation dose when the flower was irradiated in unpollinated stage and stage shortly after fertilization. (author)

  8. Hydroponics versus field lysimeter studies of urea, ammonium and nitrate uptake by oilseed rape (Brassica napus L.). (United States)

    Arkoun, Mustapha; Sarda, Xavier; Jannin, Laëtitia; Laîné, Philippe; Etienne, Philippe; Garcia-Mina, José-Maria; Yvin, Jean-Claude; Ourry, Alain


    N-fertilizer use efficiencies are affected by their chemical composition and suffer from potential N-losses by volatilization. In a field lysimeter experiment, (15)N-labelled fertilizers were used to follow N uptake by Brassica napus L. and assess N-losses by volatilization. Use of urea with NBPT (urease inhibitor) showed the best efficiency with the lowest N losses (8% of N applied compared with 25% with urea alone). Plants receiving ammonium sulphate, had similar yield achieved through a better N mobilization from vegetative tissues to the seeds, despite a lower N uptake resulting from a higher volatilization (43% of applied N). Amounts of (15)N in the plant were also higher when plants were fertilized with ammonium nitrate but N-losses reached 23% of applied N. In parallel, hydroponic experiments showed a deleterious effect of ammonium and urea on the growth of oilseed rape. This was alleviated by the nitrate supply, which was preferentially taken up. B. napus was also characterized by a very low potential for urea uptake. BnDUR3 and BnAMT1, encoding urea and ammonium transporters, were up-regulated by urea, suggesting that urea-grown plants suffered from nitrogen deficiency. The results also suggested a role for nitrate as a signal for the expression of BnDUR3, in addition to its role as a major nutrient. Overall, the results of the hydroponic study showed that urea itself does not contribute significantly to the N nutrition of oilseed rape. Moreover, it may contribute indirectly since a better use efficiency for urea fertilizer, which was further increased by the application of a urease inhibitor, was observed in the lysimeter study.

  9. Cerium oxide nanoparticles alter the salt stress tolerance of Brassica napus L. by modifying the formation of root apoplastic barriers. (United States)

    Rossi, Lorenzo; Zhang, Weilan; Ma, Xingmao


    Rapidly growing global population adds significant strains on the fresh water resources. Consequently, saline water is increasingly tapped for crop irrigation. Meanwhile, rapid advancement of nanotechnology is introducing more and more engineered nanoparticles into the environment and in agricultural soils. While some negative effects of ENPs on plant health at very high concentrations have been reported, more beneficial effects of ENPs at relatively low concentrations are increasingly noticed, opening doors for potential applications of nanotechnology in agriculture. In particular, we found that cerium oxide nanoparticles (CeO 2 NPs) improved plant photosynthesis in salt stressed plants. Due to the close connections between salt stress tolerance and the root anatomical structures, we postulated that CeO 2 NPs could modify plant root anatomy and improve plant salt stress tolerance. This study aimed at testing the hypothesis with Brassica napus in the presence of CeO 2 NPs (0, 500 mg kg -1 dry sand) and/or NaCl (0, 50 mM) in a growth chamber. Free hand sections of fresh roots were taken every seven days for three weeks and the suberin lamellae development was examined under a fluorescence microscope. The results confirmed the hypothesis that CeO 2 NPs modified the formation of the apoplastic barriers in Brassica roots. In salt stressed plants, CeO 2 NPs shortened the root apoplastic barriers which allowed more Na + transport to shoots and less accumulation of Na + in plant roots. The altered Na + fluxes and transport led to better physiological performance of Brassica and may lead to new applications of nanotechnology in agriculture. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Yield performance of brassica varieties under rainfed condition

    International Nuclear Information System (INIS)

    Hassan, M.Z.U.; Wahla, A.J.; Waqar, M.Q.


    A field study was conducted to evaluate crop growth and seed yield performance of Brassica varieties under Rainfed conditions. The varieties, included in the study, were BSA, Zafar-2000, Pakola, Con.1, Con.2, Abaseen, Rainbow, SPS-5, Bard-1, and KJ-119. KJ-119 (2500.0 KG/HA) among Brassica juncea L. varieties and Abaseen (2425.9 kg/ha) among Brassica napusL. Varieties produced with maximum seed yield as compared to rest of varieties. Significantly, minimum seed yield was observed in check variety BSA. The significant difference in seed yield of Brassica varieties, Abaseen and KJ 119, was attributed to improve yield components over other varieties. Maximum pods per plant and seeds per pod led these varieties to attain maximum yield. Inspite of weather variations existence during years 2007-09,the same varieties produced with maximum seed yield. (author)

  11. Production and cytogenetics of Brassica campestris-alboglabra chromosome addition lines

    DEFF Research Database (Denmark)

    Chen, B.Y.; Cheng, B.F.; Bagger Jørgensen, Rikke


    Four different Brassica campestris-alboglabra monosomic addition lines (AA + 1 chromosome from C, 2n = 21) were obtained after consecutive backcrosses between resynthesized B. napus (AACC, 2n = 38) and the parental B. campestris (AA, 2n = 20) accession. The alien chromosomes of B. alboglabra (CC, 2...

  12. Functional characterization of a heterologously expressed Brassica napus WRKY41-1 transcription factor in regulating anthocyanin biosynthesis in Arabidopsis thaliana. (United States)

    Duan, Shaowei; Wang, Jianjun; Gao, Chenhao; Jin, Changyu; Li, Dong; Peng, Danshuai; Du, Guomei; Li, Yiqian; Chen, Mingxun


    Previous studies have shown that a plant WRKY transcription factor, WRKY41, has multiple functions, and regulates seed dormancy, hormone signaling pathways, and both biotic and abiotic stress responses. However, it is not known about the roles of AtWRKY41 from the model plant, Arabidopsis thaliana, and its ortholog, BnWRKY41, from the closely related and important oil-producing crop, Brassica napus, in the regulation of anthocyanin biosynthesis. Here, we found that the wrky41 mutation in A. thaliana resulted in a significant increase in anthocyanin levels in rosette leaves, indicating that AtWRKY41 acts as repressor of anthocyanin biosynthesis. RNA sequencing and quantitative real-time PCR analysis revealed increased expression of three regulatory genes AtMYB75, AtMYB111, and AtMYBD, and two structural genes, AT1G68440 and AtGSTF12, all of which contribute to anthocyanin biosynthesis, in the sixth rosette leaves of wrky41-2 plants at 20 days after germination. We cloned the full length complementary DNA of BnWRKY41-1 from the C2 subgenome of the B. napus genotype Westar and observed that, when overexpressed in tobacco leaves as a fusion protein with green fluorescent protein, BnWRKY41-1 is localized to the nucleus. We further showed that overexpression of BnWRKY41-1 in the A. thaliana wrky41-2 mutant rescued the higher anthocyanin content phenotype in rosette leaves of the mutant. Moreover, the elevated expression levels in wrky41-2 rosette leaves of several important regulatory and structural genes regulating anthocyanin biosynthesis were not observed in the BnWRKY41-1 overexpressing lines. These results reveal that BnWRKY41-1 has a similar role with AtWRKY41 in regulating anthocyanin biosynthesis when overexpressed in A. thaliana. This gene represents a promising target for genetically manipulating B. napus to increase the amounts of anthocyanins in rosette leaves. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Persistence of seeds from crops of conventional and herbicide tolerant oilseed rape (Brassica napus). (United States)

    Lutman, Peter J W; Berry, Kate; Payne, Roger W; Simpson, Euan; Sweet, Jeremy B; Champion, Gillian T; May, Mike J; Wightman, Pat; Walker, Kerr; Lainsbury, Martin


    A series of rotation experiments at five sites over four years has explored the environmental and agronomic implications of growing herbicide tolerant oilseed rape and sugar beet. This paper reports on the population dynamics of volunteer rape (Brassica napus). The experiments compared four winter oilseed rape (WOSR) cultivars: a conventional cultivar (Apex) and three developmental cultivars either genetically modified (GM) to be tolerant to glyphosate or glufosinate, or conventionally bred to be tolerant to herbicides of the imidazolinone group. Seed losses at harvest averaged 3575 seeds m(-2) but ranged from less than 2000 up to more than 10000 seeds m(-2). There was a rapid decline in seed numbers during the first few months after harvest, resulting in a mean loss of seeds of 60%. In subsequent seasons, the seedbank declined much more slowly at four of the five sites (ca 20% per year) and the models predicted 95% seed loss after approximately 9 years. Seed decline was much faster at the fifth site. There were no clear differences between the four cultivars in either the numbers of seeds shed at harvest or in their subsequent persistence. The importance of the persistence of GM rape seeds, in the context of the coexistence of GM and non-GM crops and the role of good management practices that minimize seed persistence, are discussed.

  14. Study of total seed storage protein in indigenous Brassica species ...

    African Journals Online (AJOL)



    Nov 8, 2010 ... Brassica napus. Acc. No Location. Acc. No Location. Acc. No Location. Acc. No Location. 500. Islamsbad. 522. Hassan Abdal. 544. Naseer abad. 566. Rawalpindi. 501. Islamsbad. 523. Bannu. 545. Jaglot. 567. Karak. 502. Rawalakot. 524. Karak. 546. Haripur North. 568. Akora Khattack. 503. Sibi. 525.

  15. Embryonal Control of Yellow Seed Coat Locus ECY1 Is Related to Alanine and Phenylalanine Metabolism in the Seed Embryo of Brassica napus. (United States)

    Wang, Fulin; He, Jiewang; Shi, Jianghua; Zheng, Tao; Xu, Fei; Wu, Guanting; Liu, Renhu; Liu, Shengyi


    Seed coat color is determined by the type of pigment deposited in the seed coat cells. It is related to important agronomic traits of seeds such as seed dormancy, longevity, oil content, protein content and fiber content. In Brassica napus, inheritance of seed coat color is related to maternal effects and pollen effects (xenia effects). In this research we isolated a mutation of yellow seeded B. napus controlled by a single Mendelian locus, which is named Embryonal Control of Yellow seed coat 1 (Ecy1). Microscopy of transverse sections of the mature seed show that pigment is deposited only in the outer layer of the seed coat. Using Illumina Hisequation 2000 sequencing technology, a total of 12 GB clean data, 116× coverage of coding sequences of B. napus, was achieved from seeds 26 d after pollination (DAP). It was assembled into 172,238 independent transcripts, and 55,637 unigenes. A total of 139 orthologous genes of Arabidopsis transparent testa (TT) genes were mapped in silico to 19 chromosomes of B. napus Only 49 of the TT orthologous genes are transcribed in seeds. However transcription of all orthologs was independent of embryonal control of seed coat color. Only 55 genes were found to be differentially expressed between brown seeds and the yellow mutant. Of these 55, 50 were upregulated and five were downregulated in yellow seeds as compared to their brown counterparts. By KEGG classification, 14 metabolic pathways were significantly enriched. Of these, five pathways: phenylpropanoid biosynthesis, cyanoamino acid metabolism, plant hormone signal transduction, metabolic pathways, and biosynthesis of secondary metabolites, were related with seed coat pigmentation. Free amino acid quantification showed that Ala and Phe were present at higher levels in the embryos of yellow seeds as compared to those of brown seeds. This increase was not observed in the seed coat. Moreover, the excess amount of free Ala was exactly twice that of Phe in the embryo. The pigment

  16. Embryonal Control of Yellow Seed Coat Locus ECY1 Is Related to Alanine and Phenylalanine Metabolism in the Seed Embryo of Brassica napus

    Directory of Open Access Journals (Sweden)

    Fulin Wang


    Full Text Available Seed coat color is determined by the type of pigment deposited in the seed coat cells. It is related to important agronomic traits of seeds such as seed dormancy, longevity, oil content, protein content and fiber content. In Brassica napus, inheritance of seed coat color is related to maternal effects and pollen effects (xenia effects. In this research we isolated a mutation of yellow seeded B. napus controlled by a single Mendelian locus, which is named Embryonal Control of Yellow seed coat 1 (Ecy1. Microscopy of transverse sections of the mature seed show that pigment is deposited only in the outer layer of the seed coat. Using Illumina Hisequation 2000 sequencing technology, a total of 12 GB clean data, 116× coverage of coding sequences of B. napus, was achieved from seeds 26 d after pollination (DAP. It was assembled into 172,238 independent transcripts, and 55,637 unigenes. A total of 139 orthologous genes of Arabidopsis transparent testa (TT genes were mapped in silico to 19 chromosomes of B. napus. Only 49 of the TT orthologous genes are transcribed in seeds. However transcription of all orthologs was independent of embryonal control of seed coat color. Only 55 genes were found to be differentially expressed between brown seeds and the yellow mutant. Of these 55, 50 were upregulated and five were downregulated in yellow seeds as compared to their brown counterparts. By KEGG classification, 14 metabolic pathways were significantly enriched. Of these, five pathways: phenylpropanoid biosynthesis, cyanoamino acid metabolism, plant hormone signal transduction, metabolic pathways, and biosynthesis of secondary metabolites, were related with seed coat pigmentation. Free amino acid quantification showed that Ala and Phe were present at higher levels in the embryos of yellow seeds as compared to those of brown seeds. This increase was not observed in the seed coat. Moreover, the excess amount of free Ala was exactly twice that of Phe in the

  17. Genome-Wide Identification and Expression Profiling of Cytokinin Oxidase/Dehydrogenase (CKX) Genes Reveal Likely Roles in Pod Development and Stress Responses in Oilseed Rape (Brassica napus L.). (United States)

    Liu, Pu; Zhang, Chao; Ma, Jin-Qi; Zhang, Li-Yuan; Yang, Bo; Tang, Xin-Yu; Huang, Ling; Zhou, Xin-Tong; Lu, Kun; Li, Jia-Na


    Cytokinin oxidase/dehydrogenases (CKXs) play a critical role in the irreversible degradation of cytokinins, thereby regulating plant growth and development. Brassica napus is one of the most widely cultivated oilseed crops worldwide. With the completion of whole-genome sequencing of B. napus , genome-wide identification and expression analysis of the BnCKX gene family has become technically feasible. In this study, we identified 23 BnCKX genes and analyzed their phylogenetic relationships, gene structures, conserved motifs, protein subcellular localizations, and other properties. We also analyzed the expression of the 23 BnCKX genes in the B. napus cultivar Zhong Shuang 11 ('ZS11') by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), revealing their diverse expression patterns. We selected four BnCKX genes based on the results of RNA-sequencing and qRT-PCR and compared their expression in cultivated varieties with extremely long versus short siliques. The expression levels of BnCKX5-1 , 5-2 , 6-1 , and 7-1 significantly differed between the two lines and changed during pod development, suggesting they might play roles in determining silique length and in pod development. Finally, we investigated the effects of treatment with the synthetic cytokinin 6-benzylaminopurine (6-BA) and the auxin indole-3-acetic acid (IAA) on the expression of the four selected BnCKX genes. Our results suggest that regulating BnCKX expression is a promising way to enhance the harvest index and stress resistance in plants.

  18. Expression analysis of four flower-specific promoters of Brassica spp ...

    African Journals Online (AJOL)

    The 5'-flanking region of ca. 1200 bp upstream of the translation start site (TSS) of a putative cell wall protein gene was cloned from Brassica campestris, B. chinensis, B. napus and B. oleracea, and transferred to tobacco via Agrobacterium-mediation after fused to promoter-less beta-glucuronidase (GUS) reporter gene.

  19. A rich TILLING resource for studying gene function in Brassica rapa

    Directory of Open Access Journals (Sweden)

    Amoah Stephen


    Full Text Available Abstract Background The Brassicaceae family includes the model plant Arabidopsis thaliana as well as a number of agronomically important species such as oilseed crops (in particular Brassica napus, B. juncea and B. rapa and vegetables (eg. B. rapa and B. oleracea. Separated by only 10-20 million years, Brassica species and Arabidopsis thaliana are closely related, and it is expected that knowledge obtained relating to Arabidopsis growth and development can be translated into Brassicas for crop improvement. Moreover, certain aspects of plant development are sufficiently different between Brassica and Arabidopsis to warrant studies to be carried out directly in the crop species. However, mutating individual genes in the amphidiploid Brassicas such as B. napus and B. juncea may, on the other hand, not give rise to expected phenotypes as the genomes of these species can contain up to six orthologues per single-copy Arabidopsis gene. In order to elucidate and possibly exploit the function of redundant genes for oilseed rape crop improvement, it may therefore be more efficient to study the effects in one of the diploid Brassica species such as B. rapa. Moreover, the ongoing sequencing of the B. rapa genome makes this species a highly attractive model for Brassica research and genetic resource development. Results Seeds from the diploid Brassica A genome species, B. rapa were treated with ethyl methane sulfonate (EMS to produce a TILLING (Targeting Induced Local Lesions In Genomes population for reverse genetics studies. We used the B. rapa genotype, R-o-18, which has a similar developmental ontogeny to an oilseed rape crop. Hence this resource is expected to be well suited for studying traits with relevance to yield and quality of oilseed rape. DNA was isolated from a total of 9,216 M2 plants and pooled to form the basis of the TILLING platform. Analysis of six genes revealed a high level of mutations with a density of about one per 60 kb. This

  20. Different roles of glutathione in copper and zinc chelation in Brassica napus roots. (United States)

    Zlobin, Ilya E; Kartashov, Alexander V; Shpakovski, George V


    We investigated the specific features of copper and zinc excess action on the roots of canola (Brassica napus L.) plants. Copper rapidly accumulated in canola root cells and reached saturation during several hours of treatment, whereas the root zinc content increased relatively slowly. Excessive copper and zinc entry inside the cell resulted in significant cell damage, as evidenced by alterations in plasmalemma permeability and decreases in cellular enzymatic activity. Zinc excess specifically damaged root hair cells, which correlated with a pronounced elevation of their labile zinc level. In vitro, we showed that reduced glutathione (GSH) readily reacted with copper ions to form complexes with blocked sulfhydryl groups. In contrast, zinc ions were ineffective as glutathione blockers, and glutathione molecules did not lose their specific chemical activity in the presence of Zn 2+ ions. The effect of copper and zinc excess on the glutathione pool in canola root cells was analysed by a combination of biochemical determination of total and oxidized glutathione contents and fluorescent staining of free reduced glutathione with monochlorobimane dye. Excess copper led to dose-dependent diminution of free reduced glutathione contents in the root cells, which could not be explained by the loss of total cellular glutathione or its oxidation. In contrast, we observed little effect of much higher intracellular zinc concentrations on the free reduced glutathione content. We concluded that GSH plays an important role in copper excess, but not zinc excess chelation, in canola root cells. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  1. Methyl jasmonate regulates antioxidant defense and suppresses arsenic uptake in Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Muhammad A Farooq


    Full Text Available Methyl jasmonate (MJ is an important plant growth regulator, involved in plant defense against abiotic stresses, however its possible function in response to metal stress is poorly understood. In the present study, the effect of MJ on physiological and biochemical changes of the plants exposed to arsenic (As stress were investigated in two Brassica napus L. cultivars (ZS 758 – a black seed type, and Zheda 622 – a yellow seed type. The As treatment at 200 µM was more phytotoxic, however its combined application with MJ resulted in significant increase in leaf chlorophyll fluorescence, biomass production and reduced malondialdehyde content compared with As stressed plants. The application of MJ minimized the oxidative stress, as revealed via a lower level of reactive oxygen species (ROS synthesis (H2O2 and OH- in leaves and the maintenance of high redox states of glutathione and ascorbate. Enhanced enzymatic activities and gene expression of important antioxidants (SOD, APX, CAT, POD, secondary metabolites (PAL, PPO, CAD and induction of lypoxygenase gene suggest that MJ plays an effective role in the regulation of multiple transcriptional pathways which were involved in oxidative stress responses. The content of As was higher in yellow seeded plants (cv. Zheda 622 as compared to black seeded plants (ZS 758. The application of MJ significantly reduced the As content in leaves and roots of both cultivars. Findings of the present study reveal that MJ improves ROS scavenging through enhanced antioxidant defense system, secondary metabolite and reduced As contents in both the cultivars.

  2. Radio-sensitivity analysis and selection of useful mutants of rape (Brassica napus L.) by gamma irradiation

    International Nuclear Information System (INIS)

    Goh, Eun Jeong; Kim, Wook Jin; Kim, Jin Baek; Kim, Dong Sub; Kim, Sang Hoon; Kang, Si Yong


    Rape (Brassica napus L.) plants are one of the major oilseed crops. The main components of rapeseed are oil (35 to 47%) and protein (15 to 32%). For the biodiesel production, the development of a new variety of rape plant with high biomass and/or oleic acid contents is required. In order to determine the optimum dose of gamma-ray irradiation, the rape seeds of cvs. Hanra (Hr), Youngsan (Ys), Tammi (Tm), and Tamra (Tr) were irradiated with a 100 ∼ 4,000 Gy dose range of gamma-rays. Considering the growth factors, the optimum doses were determined to be within the range of 600 ∼ 1,000 Gy for the selection of useful mutant lines. Six-hundred and eighty eight (688) M 2 mutant lines were obtained from 600 ∼ 1,000 Gy gamma-ray-irradiated M 1 plants through selfing. The growth characteristics, leaf shape, early flowering, and flower color were all investigated. The selected mutant numbers of early flowering, leaf shape, and flower color were 34, 52, and 3 from the four cultivars, respectively. These mutant lines will be used for the development of a new variety of rape plant with high biomass and oleic acid contents

  3. Effect of rhizobacteria inoculation and humic acid application on canola (Brassica napus L.) crop

    International Nuclear Information System (INIS)

    Ahmad, S.; Duar, I.; Solaimani, S.G.A.; Mahmood, S.


    This study investigated eco-friendly approach of utilizing plant growth promoting rhizobacteria (PGPR) and humic acid (HA) as bio-stimulants to improve the growth, yield and nutrition of canola (Brassica napus L.). In this study, we isolated 20 indigenous rhizobacterial strains that were subsequently screened and characterized for their plant growth promoting traits. After that one promising PGPR strain identified as Acinetobacter pittii by 16S rRNA gene sequencing was selected for field trial. The field experiment was conducted using RCB design with split-plot arrangement that was replicated four times. Three levels of humic acid (0, 10 and 20 kg ha-1) as main plot factor and two treatments of PGPR (with and without PGPR) as sub-plot factor were used. Data was recorded on plant height (cm), root dry matter plant-1, number of lateral root plant-1, number of pods plant-1, number of seeds pod-1, 1000 seed weight (g), seed yield(kg ha-1), oil content (%), nitrogen (N), phosphorus (P) and potassium (K) contents and uptake. For most of the above mentioned parameters, significant enhancement was observed with the increment of humic acid, and also PGPR treatments were better than their respective control treatments. Maximum values of these parameters were recorded for the interaction of 20 kg HA ha-1 with the PGPR strain. It can be concluded that integrated application of HA and PGPR is a better strategy to improve nutrition and yield of canola. (author)

  4. A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.). (United States)

    Hou, Jinna; Long, Yan; Raman, Harsh; Zou, Xiaoxiao; Wang, Jing; Dai, Shutao; Xiao, Qinqin; Li, Cong; Fan, Longjiang; Liu, Bin; Meng, Jinling


    Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral 'A' genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in

  5. Senescence-specific alteration of hydrogen peroxide levels in Arabidopsis thaliana and oilseed rape spring variety Brassica napus L. cv. Mozart. (United States)

    Bieker, Stefan; Riester, Lena; Stahl, Mark; Franzaring, Jürgen; Zentgraf, Ulrike


    In order to analyze the signaling function of hydrogen peroxide (H(2)O(2)) production in senescence in more detail, we manipulated intracellular H(2)O(2) levels in Arabidopsis thaliala (L.) Heynh by using the hydrogen-peroxide-sensitive part of the Escherichia coli transcription regulator OxyR, which was directed to the cytoplasm as well as into the peroxisomes. H(2)O(2) levels were lowered and senescence was delayed in both transgenic lines, but OxyR was found to be more effective in the cytoplasm. To transfer this knowledge to crop plants, we analyzed oilseed rape plants Brassica napus L. cv. Mozart for H(2)O(2) and its scavenging enzymes catalase (CAT) and ascorbate peroxidase (APX) during leaf and plant development. H(2)O(2) levels were found to increase during bolting and flowering time, but no increase could be observed in the very late stages of senescence. With increasing H(2)O(2) levels, CAT and APX activities declined, so it is likely that similar mechanisms are used in oilseed rape and Arabidopsis to control H(2)O(2) levels. Under elevated CO(2) conditions, oilseed rape senescence was accelerated and coincided with an earlier increase in H(2)O(2) levels, indicating that H(2)O(2) may be one of the signals to inducing senescence in a broader range of Brassicaceae. © 2012 Institute of Botany, the Chinese Academy of Sciences.

  6. Diversity and Genome Analysis of Australian and Global Oilseed Brassica napus L. Germplasm Using Transcriptomics and Whole Genome Re-sequencing

    Directory of Open Access Journals (Sweden)

    M. Michelle Malmberg


    Full Text Available Intensive breeding of Brassica napus has resulted in relatively low diversity, such that B. napus would benefit from germplasm improvement schemes that sustain diversity. As such, samples representative of global germplasm pools need to be assessed for existing population structure, diversity and linkage disequilibrium (LD. Complexity reduction genotyping-by-sequencing (GBS methods, including GBS-transcriptomics (GBS-t, enable cost-effective screening of a large number of samples, while whole genome re-sequencing (WGR delivers the ability to generate large numbers of unbiased genomic single nucleotide polymorphisms (SNPs, and identify structural variants (SVs. Furthermore, the development of genomic tools based on whole genomes representative of global oilseed diversity and orientated by the reference genome has substantial industry relevance and will be highly beneficial for canola breeding. As recent studies have focused on European and Chinese varieties, a global diversity panel as well as a substantial number of Australian spring types were included in this study. Focusing on industry relevance, 633 varieties were initially genotyped using GBS-t to examine population structure using 61,037 SNPs. Subsequently, 149 samples representative of global diversity were selected for WGR and both data sets used for a side-by-side evaluation of diversity and LD. The WGR data was further used to develop genomic resources consisting of a list of 4,029,750 high-confidence SNPs annotated using SnpEff, and SVs in the form of 10,976 deletions and 2,556 insertions. These resources form the basis of a reliable and repeatable system allowing greater integration between canola genomics studies, with a strong focus on breeding germplasm and industry applicability.

  7. Cultivar Variation in Hormonal Balance Is a Significant Determinant of Disease Susceptibility to Xanthomonas campestris pv. campestris in Brassica napus

    Directory of Open Access Journals (Sweden)

    Md. Tabibul Islam


    Full Text Available This study aimed to directly elucidate cultivar variation in disease susceptibility and disease responses in relation to hormonal status in the interaction of Brassica napus cultivars and Xanthomonas campestris pv. campestris (Xcc, the causal agent of black rot disease. Fully expanded leaves of six B. napus cultivars (cvs. Capitol, Youngsan, Saturnin, Colosse, Tamra, and Mosa were inoculated with Xcc. At 14 days post-inoculation with Xcc, cultivar variation in susceptibility or resistance was interpreted with defense responses as estimated by redox status, defensive metabolites, and expression of phenylpropanoid synthesis-related genes in relation to endogenous hormonal status. Disease susceptibility of six cultivars was distinguished by necrotic lesions in the Xcc-inoculated leaves and characterized concurrently based on the higher increase in reactive oxygen species and lipid peroxidation. Among these cultivars, as the susceptibility was higher, the ratios of abscisic acid (ABA/jasmonic acid (JA and salicylic acid (SA/JA tended to increase with enhanced expression of SA signaling regulatory gene NPR1 and transcriptional factor TGA1 and antagonistic suppression of JA-regulated gene PDF 1.2. In the resistant cultivar (cv. Capitol, accumulation of defensive metabolites with enhanced expression of genes involved in flavonoids (chalcone synthase, proanthocyanidins (anthocyanidin reductase, and hydroxycinnamic acids (ferulate-5-hydroxylase biosynthesis and higher redox status were observed, whereas the opposite results were obtained for susceptible cultivars (cvs. Mosa and Tamra. These results clearly indicate that cultivar variation in susceptibility to infection by Xcc was determined by enhanced alteration of the SA/JA ratio, as a negative regulator of redox status and phenylpropanoid synthesis in the Brasica napus–Xcc pathosystem.

  8. Disruption of a CAROTENOID CLEAVAGE DIOXYGENASE 4 gene converts flower colour from white to yellow in Brassica species. (United States)

    Zhang, Bao; Liu, Chao; Wang, Yaqin; Yao, Xuan; Wang, Fang; Wu, Jiangsheng; King, Graham J; Liu, Kede


    In Brassica napus, yellow petals had a much higher content of carotenoids than white petals present in a small number of lines, with violaxanthin identified as the major carotenoid compound in yellow petals of rapeseed lines. Using positional cloning we identified a carotenoid cleavage dioxygenase 4 gene, BnaC3.CCD4, responsible for the formation of flower colour, with preferential expression in petals of white-flowered B. napus lines. Insertion of a CACTA-like transposable element 1 (TE1) into the coding region of BnaC3.CCD4 had disrupted its expression in yellow-flowered rapeseed lines. α-Ionone was identified as the major volatile apocarotenoid released from white petals but not from yellow petals. We speculate that BnaC3.CCD4 may use δ- and/or α-carotene as substrates. Four variations, including two CACTA-like TEs (alleles M1 and M4) and two insertion/deletions (INDELs, alleles M2 and M3), were identified in yellow-flowered Brassica oleracea lines. The two CACTA-like TEs were also identified in the coding region of BcaC3.CCD4 in Brassica carinata. However, the two INDELs were not detected in B. napus and B. carinata. We demonstrate that the insertions of TEs in BolC3.CCD4 predated the formation of the two allotetraploids. © 2015 The Authors New Phytologist © 2015 New Phytologist Trust.

  9. Identification of QTLs for resistance to sclerotinia stem rot and BnaC.IGMT5.a as a candidate gene of the major resistant QTL SRC6 in Brassica napus.

    Directory of Open Access Journals (Sweden)

    Jian Wu

    Full Text Available Stem rot caused by Sclerotinia sclerotiorum in many important dicotyledonous crops, including oilseed rape (Brassica napus, is one of the most devastating fungal diseases and imposes huge yield loss each year worldwide. Currently, breeding for Sclerotinia resistance in B. napus, as in other crops, can only rely on germplasms with quantitative resistance genes. Thus, the identification of quantitative trait locus (QTL for S. sclerotiorum resistance/tolerance in this crop holds immediate promise for the genetic improvement of the disease resistance. In this study, ten QTLs for stem resistance (SR at the mature plant stage and three QTLs for leaf resistance (LR at the seedling stage in multiple environments were mapped on nine linkage groups (LGs of a whole genome map for B. napus constructed with SSR markers. Two major QTLs, LRA9 on LG A9 and SRC6 on LG C6, were repeatedly detected across all environments and explained 8.54-15.86% and 29.01%-32.61% of the phenotypic variations, respectively. Genotypes containing resistant SRC6 or LRA9 allele showed a significant reduction in disease lesion after pathogen infection. Comparative mapping with Arabidopsis and data mining from previous gene profiling experiments identified that the Arabidopsis homologous gene of IGMT5 (At1g76790 was related to the SRC6 locus. Four copies of the IGMT5 gene in B. napus were isolated through homologous cloning, among which, only BnaC.IGMT5.a showed a polymorphism between parental lines and can be associated with the SRC6. Furthermore, two parental lines exhibited a differential expression pattern of the BnaC.IGMT5.a gene in responding to pathogen inoculation. Thus, our data suggested that BnaC.IGMT5.a was very likely a candidate gene of this major resistance QTL.


    Identification of fitness traits potentially impacted by gene flow from genetically modified (GM) crops to compatible relatives is of interest in risk assessments for GM crops. Reciprocal crosses were made between GM canola, Brassica napus cv. RaideRR that expresses CP4 EPSPS fo...

  11. Response to multi-generational selection under elevated [CO2] in two temperature regimes suggests enhanced carbon assimilation and increased reproductive output in Brassica napus L

    DEFF Research Database (Denmark)

    Frenck, Georg; van der Linden, Leon; Mikkelsen, Teis Nørgaard


    different temperature regimes. To reveal phenotypic divergence at the manipulated [CO2] and temperature conditions, a full-factorial natural selection regime was established in a phytotron environment over the range of four generations. It is demonstrated that a directional response to selection at elevated......Functional plant traits are likely to adapt under the sustained pressure imposed by environmental changes through natural selection. Employing Brassica napus as a model, a multi-generational study was performed to investigate the potential trajectories of selection at elevated [CO2] in two...... subjected to increased levels of CO2 over the generational range investigated. The results of this study suggest that phenotypic divergence of plants selected under elevated atmospheric CO2 concentration may drive the future functions of plant productivity to be different from projections that do...

  12. Properties of a membrane-bound triglyceride lipase of rapeseed (Brassica napus L.) cotyledons. (United States)

    Rosnitschek, I; Theimer, R R


    The properties of the alkaline lipase activity (EC that was recovered almost completely from a microsomal membrane fraction of 4-d-old rapeseed (Brassica napus L.) cotyledons were studied employing a titrimetric test procedure. The apparent KM was 6.5 mmol l(-1), with emulgated sunflower oil as the substrate. The products of triglyceride hydrolysis in vitro were glycerol, free fatty acids, and minor amounts of mono- and diglycerides. Maximum lipase activity depended on the preincubation of the lipolytic membrane fraction in 0.15 mol l(-1) NaCl and on the presence of at least 0.1 mol l(-1) NaCl in the test mixture. Desoxycholate and up to 0.1 mol l(-1) CaCl2 also activated the enzyme while EDTA and detergents such as trito x-100, digitonin, tween 85, and sodium dodecylsulfate were inhibitory. The rapeseed lipase displayed a conspicuous substrate selectivity among different plant triglycerides; the activity was inversely correlated with the oleic acid content of the oils. Water-soluble triacetin and the phospholipid lecithin were not hydrolyzed. Increasing amounts of free fatty acids reduced lipase activity; erucic acid, a major component of rapeseed oil, exhibited the strongest effect, suggesting a possible role in the regulation of lipase activity in vivo. The data demonstrate that the lipolytic membrane fraction houses a triglyceride lipase with properties similar to other plant and animal lipases. It can both qualitatively and quantitatively account for the fat degradation in rapeseed cotyledons. The evidence that provides further reason to acknowledge the membranous appendices of the spherosomes as the intracellular site of lipolysis is discussed.

  13. Cadmium stress alters the redox reaction and hormone balance in oilseed rape (Brassica napus L.) leaves. (United States)

    Yan, Hui; Filardo, Fiona; Hu, Xiaotao; Zhao, Xiaomin; Fu, DongHui


    In order to understand the physiological response of oilseed rape (Brassica napus L.) leaves to cadmium (Cd) stress and exploit the physiological mechanisms involved in Cd tolerance, macro-mineral and chlorophyll concentrations, reactive oxygen species (ROS) accumulation, activities of enzymatic antioxidants, nonenzymatic compounds metabolism, endogenous hormonal changes, and balance in leaves of oilseed rape exposed to 0, 100, or 200 μM CdSO4 were investigated. The results showed that under Cd exposure, Cd concentrations in the leaves continually increased while macro-minerals and chlorophyll concentrations decreased significantly. Meanwhile, with increased Cd stress, superoxide anion (O2(• -)) production rate and hydrogen peroxide (H2O2) concentrations in the leaves increased significantly, which caused malondialdehyde (MDA) accumulation and oxidative stress. For scavenging excess accumulated ROS and alleviating oxidative injury in the leaves, the activity of enzymatic antioxidants, such as superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT), was increased significantly at certain stress levels. However, with increased Cd stress, the antioxidant enzyme activities all showed a trend towards reduction. The nonenzymatic antioxidative compounds, such as proline and total soluble sugars, accumulated continuously with increased Cd stress to play a long-term role in scavenging ROS. In addition, ABA levels also increased continuously with Cd stress while ZR decreased and the ABA/ZR ratio increased, which might also be providing a protective role against Cd toxicity.

  14. Evaluating relative contribution of osmotolerance and tissue tolerance mechanisms toward salinity stress tolerance in three Brassica species. (United States)

    Chakraborty, Koushik; Bose, Jayakumar; Shabala, Lana; Eyles, Alieta; Shabala, Sergey


    Three different species of Brassica, with differential salt sensitivity were used to understand physiological mechanisms of salt tolerance operating in these species and to evaluate the relative contribution of different strategies to cope with salt load. Brassica napus was the most tolerant species in terms of the overall performance, with Brassica juncea and Brassica oleracea being much more sensitive to salt stress with no obvious difference between them. While prominent reduction in net CO2 assimilation was observed in both sensitive species, physiological mechanisms beyond this reduction differed strongly. Brassica juncea plants possessed high osmotolerance and were able to maintain high transpiration rate but showed a significant reduction in leaf chlorophyll content and efficiency of leaf photochemistry. On the contrary, B. oleracea plants possessed the highest (among the three species) tissue tolerance but showed a very significant stomatal limitation of photosynthesis. Electrophysiological experiments revealed that the high tissue tolerance in B. oleracea was related to the ability of leaf mesophyll cells to maintain highly negative membrane potential in the presence of high apoplastic Na(+) . In addition to high osmotolerance, the most tolerant B. napus showed also lesser accumulation of toxic Na(+) and Cl(-) in the leaf, possessed moderate tissue tolerance and had a superior K(+) retention ability. Taken together, the results from this study indicate that the three Brassica species employ very different mechanisms to cope with salinity and, despite its overall sensitivity to salinity, B. oleracea could be recommended as a valuable 'donor' of tissue tolerance genes to confer this trait for marker-assisted breeding programs. © 2016 Scandinavian Plant Physiology Society.

  15. Refined global methyl halide budgets with respect to rapeseed (Brassica napus) by life-cycle measurements (United States)

    Jiao, Y.; Acdan, J.; Xu, R.; Deventer, M. J.; Rhew, R. C.


    A precise quantification of global methyl halide budgets is needed to evaluate the ozone depletion potential of these compounds and to predict future changes of stratospheric ozone. However, the global budgets of methyl halides are not balanced between currently identified and quantified sources and sinks. Our study re-evaluated the methyl bromide budget from global cultivated rapeseed (Brassica napus) through life-cycle flux measurements both in the greenhouse and in the field, yielding a methyl bromide emission rate that scales globally to 1.0 - 1.2 Gg yr-1. While this indicates a globally significant source, it is much smaller than the previously widely cited value of 5 - 6 Gg yr-1(Mead et al., 2008), even taking into account the near tripling of annual global yield of rapeseed since the previous evaluation was conducted. Our study also evaluated the methyl chloride and methyl iodide emission levels from rapeseed, yielding emission rates that scale to 5.4 Gg yr-1 for methyl chloride and 1.8 Gg yr-1 of methyl iodide. The concentrations of the methyl donor SAM (S-adenosyl methionine) and the resultant product SAH (S-Adenosyl-L-homocysteine) were also analyzed to explore their role in biogenic methyl halide formation. Halide gradient incubations showed that the magnitude of methyl halide emissions from rapeseed is highly correlated to soil halide levels, thus raising the concern that the heterogeneity of soil halide contents geographically should be considered when extrapolating to global budget.

  16. Use of Plackett-Burman design for rapid screening of nitrogen and carbon sources for the production of lipase in solid state fermentation by Yarrowia lipolytica from mustard oil cake (Brassica napus

    Directory of Open Access Journals (Sweden)

    Sarat Babu Imandi


    Full Text Available Mustard oil cake (Brassica napus, the residue obtained after extraction of mustard oil from mustard oil seeds, was investigated for the production of lipase under solid state fermentation (SSF using the marine yeast Yarrowia lipolytica NCIM 3589. Process parameters such as incubation time, biomass concentration, initial moisture content, carbon source concentration and nitrogen source concentration of the medium were optimized. Screening of ten nitrogen and five carbon sources has been accomplished with the help of Plackett-Burman design. The highest lipase activity of 57.89 units per gram of dry fermented substrate (U/gds was observed with the substrate of mustard oil cake in four days of fermentation.

  17. A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Hou Jinna


    Full Text Available Abstract Background Rapeseed (Brassica napus L. has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. Results We fine-mapped the spring environment specific quantitative trait locus (QTL for flowering time, qFT10-4,in a doubled haploid (DH mapping population of rapeseed derived from a cross between Tapidor (winter-type and Ningyou7 (semi-winter and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50. This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral ‘A’ genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Conclusions Our findings strongly suggest that (i BnFLC.A10 is the gene underlying qFT10

  18. Impact of Brassica and Lucerne Finishing Feeds and Intramuscular Fat on Lamb Eating Quality and Flavor. A Cross-Cultural Study Using Chinese and Non-Chinese Australian Consumers. (United States)

    Frank, Damian; Watkins, Peter; Ball, Alex; Krishnamurthy, Raju; Piyasiri, Udayasika; Sewell, James; Ortuño, Jordi; Stark, Janet; Warner, Robyn


    Use of forage brassicas (Brassica napus) and lucerne (alfalfa; Medicago sativa) as ruminant feeds has been linked to unacceptable flavors in sheepmeat. Lambs from low and high intramuscular fat sires were allocated to one of four finishing feeds-perennial ryegrass (Lolium perenne), lucerne, and two brassica forages-for a 6 week period. Grilled loins (Longissimus thoracis et lumborum) were subjected to chemical and sensory analysis by a trained panel and also evaluated by non-Chinese and Chinese background Australian consumers. Consumer liking was similar for both groups, and liking was highest for the brassica- and lucerne-finished lamb, especially from high intramuscular fat sires. No evidence of a distinctive lucerne- or brassica-induced flavor taint was measured by the trained panel or gas chromatography-mass spectrometry-olfactometry. The diets influenced the composition of lipids and branched-chain fatty acids in the subcutaneous fat, and the concentration of total branched-chain fatty acids was positively correlated with flavor and overall liking. Significantly higher levels of key aroma volatiles were measured in the higher fat samples.

  19. Irradiation effect on the seed vigor, SOD activity and MDA content in germinating seeds of yellow-seeded and black-seeded rape seed (Brassica napus L.)

    International Nuclear Information System (INIS)

    Han Jixiang; Hu Danhong; Liu Houli


    Seeds of a set of near-isogenic lines (Brassica napus L.) with different seed coat color from yellow to black were irradiated by 60 Co γ-rays of 150 krad. Seed vigor, superoxide dismutase (SOD) and malondialdehyde (MDA) in germinating seeds were analysed. In these characters, no significant difference between yellow-seeded lines (YLs) and black-seeded lines (BLs) showed before irradiation. But after irradiation, SOD activity in YLs was lower than that in BLs. While MDA content in YLs was obviously higher that that in DLs. As a result of irradiation, seed vigor of YLs was lower than that in BLs. these results indicated that the irradiation resistance of rape seed was related to the level of SOD as well as protective structure or substances in seed coat and that the radiosensitivity of YLs was higher than that of DLs

  20. Effects of abscisic acid and high osmoticum on storage protein gene expression in microspore embryos of Brassica napus

    International Nuclear Information System (INIS)

    Wilen, R.W.; Mandel, R.M.; Pharis, R.P.; Moloney, M.M.; Holbrook, L.A.


    Storage protein gene expression, characteristic of mid- to late embryogenesis, was investigated in microspore embryos of rapeseed (Brassica napus). These embryos, derived from the immature male gametophyte, accumulate little or no detectable napin or cruciferin mRNA when cultured on hormone-free medium containing 13% sucrose. The addition of abscisic acid (ABA) to the medium results in an increase in detectable transcripts encoding both these polypeptides. Storage protein mRNA is induced at 1 micromolar ABA with maximum stimulation occurring between 5 and 50 micromolar. This hormone induction results in a level of storage protein mRNA that is comparable to that observed in zygotic embryos of an equivalent morphological stage. Effects similar to that of ABA are noted when 12.5% sorbitol is added to the microspore embryo medium (osmotic potential = 25.5 bars). Time course experiments, to study the induction of napin and cruciferin gene expression demonstrated that the ABA effect occurred much more rapidly than the high osmoticum effect, although after 48 hours, the levels of napin or cruciferin mRNA detected were similar in both treatments. This difference in the rates of induction is consistent with the idea that the osmotic effect may be mediated by ABA which is synthesized in response to the reduced water potential. Measurements of ABA (by gas chromatography-mass spectrometry using [ 2 H 6 ]ABA as an internal standard) present in microspore embryos during sorbitol treatment and in embryos treated with 10 micromolar ABA were performed to investigate this possibility. Within 2 hours of culture on high osmoticum the level of ABA increased substantially and significantly above control and reached a maximum concentration within 24 hours. This elevated concentration was maintained for 48 hours after culturing and represents a sixfold increase over control embryos

  1. Wastewater impact on physiology, biomass and yield of canola (brassica napus L.)

    International Nuclear Information System (INIS)

    Khan, I.U.; Khan, M.J.


    The impact of domestic/municipal wastewater (mww) of Dera Ismail Khan, Pakistan was assessed through its effects on biomass, physiology and yield of canola (Brassica napus L.). The pot experiments were conducted in a completely randomized design with three replications in net house during winter season 2006-07 and 2007-08 at Gomal University, Dera Ismail Khan, Pakistan. Treatments included were T0 (tube well/tap water), T/sub 1/ (20% mww), T/sub 2/ (40% mww), T/sub 3/ (80% mww) and T/sub 4/ (100% mww/raw-form municipal wastewater). The quality and chemical composition of wastewater was deviating from international (Anon., 1985) as well as NEQS (2005) standard. Analysis of wastewater showed that biochemical oxygen demand (BOD), chemical oxygen demand (COD), sodium adsorption ratio (SAR) and total suspended solids (TSS) were above the permissible limit of irrigation. In pods per plant, the reduction was 61.55% by recording 110 pods per plant with T/sub 4/ (100% mww) as compared to control T0 (286.1 pods per plant). Similarly pod length (reduced by 59.72%), seeds per pod (reduced by 42.53%), Seeds per plant (reduced by 82%), seed weight per plant (reduced by 88%), 100-seed weight (reduced by 19.54%) and straw yield (reduced by 54.23%) were significantly reduced by applying 100% wastewater. The most affected yield contributing traits were seeds per plant and seed weight per plant with 82% and 88% reduction, respectively due to T/sub 4/ (100% mww). On average, the decrease was 60% in the first stage and a further decrement of 4.83% was observed when the obtained seeds were re-sown in 2007-08. Results revealed that utilizing municipal wastewater of the area under investigation for irrigation purpose of food and feed crops might not be safe. The major reason seems to be the high salinity and sodium adsorption ratio that restricted crop growth and yield. (author)

  2. Genome-wide microsatellite characterization and marker development in the sequenced Brassica crop species. (United States)

    Shi, Jiaqin; Huang, Shunmou; Zhan, Jiepeng; Yu, Jingyin; Wang, Xinfa; Hua, Wei; Liu, Shengyi; Liu, Guihua; Wang, Hanzhong


    Although much research has been conducted, the pattern of microsatellite distribution has remained ambiguous, and the development/utilization of microsatellite markers has still been limited/inefficient in Brassica, due to the lack of genome sequences. In view of this, we conducted genome-wide microsatellite characterization and marker development in three recently sequenced Brassica crops: Brassica rapa, Brassica oleracea and Brassica napus. The analysed microsatellite characteristics of these Brassica species were highly similar or almost identical, which suggests that the pattern of microsatellite distribution is likely conservative in Brassica. The genomic distribution of microsatellites was highly non-uniform and positively or negatively correlated with genes or transposable elements, respectively. Of the total of 115 869, 185 662 and 356 522 simple sequence repeat (SSR) markers developed with high frequencies (408.2, 343.8 and 356.2 per Mb or one every 2.45, 2.91 and 2.81 kb, respectively), most represented new SSR markers, the majority had determined physical positions, and a large number were genic or putative single-locus SSR markers. We also constructed a comprehensive database for the newly developed SSR markers, which was integrated with public Brassica SSR markers and annotated genome components. The genome-wide SSR markers developed in this study provide a useful tool to extend the annotated genome resources of sequenced Brassica species to genetic study/breeding in different Brassica species.

  3. Tolerance of transgenic canola plants (Brassica napus) amended with plant growth-promoting bacteria to flooding stress at a metal-contaminated field site

    International Nuclear Information System (INIS)

    Farwell, Andrea J.; Vesely, Susanne; Nero, Vincent; Rodriguez, Hilda; McCormack, Kimberley; Shah, Saleh; Dixon, D. George; Glick, Bernard R.


    The growth of transgenic canola (Brassica napus) expressing a gene for the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase was compared to non-transformed canola exposed to flooding and elevated soil Ni concentration, in situ. In addition, the ability of the plant growth-promoting bacterium Pseudomonas putida UW4, which also expresses ACC deaminase, to facilitate the growth of non-transformed and transgenic canola under the above mentioned conditions was examined. Transgenic canola and/or canola treated with P. putida UW4 had greater shoot biomass compared to non-transformed canola under low flood-stress conditions. Under high flood-stress conditions, shoot biomass was reduced and Ni accumulation was increased in all instances relative to low flood-stress conditions. This is the first field study to document the increase in plant tolerance utilizing transgenic plants and plant growth-promoting bacteria exposed to multiple stressors. - Using transgenic plants and plant growth-promoting bacteria as phytoremediation methods increased plant tolerance at a metal-contaminated field site under low flood conditions

  4. Modification of "1"3"7Cs transfer to rape (Brassica napus L.) phytomass under the influence of soil microorganisms

    International Nuclear Information System (INIS)

    Pareniuk, O.; Shavanova, K.; Laceby, J.P.; Illienko, V.; Tytova, L.; Levchuk, S.; Gudkov, I.; Nanba, K.


    After nuclear accidents, such as those experienced in Chernobyl and Fukushima, microorganisms may help purify contaminated soils by changing the mobility of radionuclides and their availability for plants by altering the physical and chemical properties of the substrate. Here, using model experiments with quartz sand as a substrate we investigate the influence of microorganisms on "1"3"7Cs transfer from substrate to plants. The highest transition of "1"3"7Cs from substrate to plants (50% increase compared to the control) was observed after Brassica napus L. seeds were inoculated by Azotobacter chroococcum. The best results for reducing the accumulation of "1"3"7Cs radionuclides (30% less) were noted after the inoculation by Burkholderia sp.. Furthermore, Bacillus megaterium demonstrated an increased ability to accumulate "1"3"7Cs. This research improves our prediction of the behavior of radionuclides in soil and may contribute towards new, microbiological countermeasures for soil remediation following nuclear accidents. - Highlights: • Representatives of soil bacteria can alter "1"3"7Cs soil-to-plant transfer factor. • This ability does not depend on the localization of bacteria on the root surface. • Selection of bacteria to increase or decrease the "1"3"7Cs transfer factor is possible.

  5. Centromere Locations in Brassica A and C Genomes Revealed Through Half-Tetrad Analysis. (United States)

    Mason, Annaliese S; Rousseau-Gueutin, Mathieu; Morice, Jérôme; Bayer, Philipp E; Besharat, Naghmeh; Cousin, Anouska; Pradhan, Aneeta; Parkin, Isobel A P; Chèvre, Anne-Marie; Batley, Jacqueline; Nelson, Matthew N


    Locating centromeres on genome sequences can be challenging. The high density of repetitive elements in these regions makes sequence assembly problematic, especially when using short-read sequencing technologies. It can also be difficult to distinguish between active and recently extinct centromeres through sequence analysis. An effective solution is to identify genetically active centromeres (functional in meiosis) by half-tetrad analysis. This genetic approach involves detecting heterozygosity along chromosomes in segregating populations derived from gametes (half-tetrads). Unreduced gametes produced by first division restitution mechanisms comprise complete sets of nonsister chromatids. Along these chromatids, heterozygosity is maximal at the centromeres, and homologous recombination events result in homozygosity toward the telomeres. We genotyped populations of half-tetrad-derived individuals (from Brassica interspecific hybrids) using a high-density array of physically anchored SNP markers (Illumina Brassica 60K Infinium array). Mapping the distribution of heterozygosity in these half-tetrad individuals allowed the genetic mapping of all 19 centromeres of the Brassica A and C genomes to the reference Brassica napus genome. Gene and transposable element density across the B. napus genome were also assessed and corresponded well to previously reported genetic map positions. Known centromere-specific sequences were located in the reference genome, but mostly matched unanchored sequences, suggesting that the core centromeric regions may not yet be assembled into the pseudochromosomes of the reference genome. The increasing availability of genetic markers physically anchored to reference genomes greatly simplifies the genetic and physical mapping of centromeres using half-tetrad analysis. We discuss possible applications of this approach, including in species where half-tetrads are currently difficult to isolate. Copyright © 2016 by the Genetics Society of America.

  6. Transcriptome profile analysis of young floral buds of fertile and sterile plants from the self-pollinated offspring of the hybrid between novel restorer line NR1 and Nsa CMS line in Brassica napus

    Directory of Open Access Journals (Sweden)

    Yan Xiaohong


    Full Text Available Abstract Background The fertile and sterile plants were derived from the self-pollinated offspring of the F1 hybrid between the novel restorer line NR1 and the Nsa CMS line in Brassica napus. To elucidate gene expression and regulation caused by the A and C subgenomes of B. napus, as well as the alien chromosome and cytoplasm from Sinapis arvensis during the development of young floral buds, we performed a genome-wide high-throughput transcriptomic sequencing for young floral buds of sterile and fertile plants. Results In this study, equal amounts of total RNAs taken from young floral buds of sterile and fertile plants were sequenced using the Illumina/Solexa platform. After filtered out low quality data, a total of 2,760,574 and 2,714,441 clean tags were remained in the two libraries, from which 242,163 (Ste and 253,507 (Fer distinct tags were obtained. All distinct sequencing tags were annotated using all possible CATG+17-nt sequences of the genome and transcriptome of Brassica rapa and those of Brassica oleracea as the reference sequences, respectively. In total, 3231 genes of B. rapa and 3371 genes of B. oleracea were detected with significant differential expression levels. GO and pathway-based analyses were performed to determine and further to understand the biological functions of those differentially expressed genes (DEGs. In addition, there were 1089 specially expressed unknown tags in Fer, which were neither mapped to B. oleracea nor to B. rapa, and these unique tags were presumed to arise basically from the added alien chromosome of S. arvensis. Fifteen genes were randomly selected and their expression levels were confirmed by quantitative RT-PCR, and fourteen of them showed consistent expression patterns with the digital gene expression (DGE data. Conclusions A number of genes were differentially expressed between the young floral buds of sterile and fertile plants. Some of these genes may be candidates for future research on CMS in

  7. Transcriptome profile analysis of young floral buds of fertile and sterile plants from the self-pollinated offspring of the hybrid between novel restorer line NR1 and Nsa CMS line in Brassica napus. (United States)

    Yan, Xiaohong; Dong, Caihua; Yu, Jingyin; Liu, Wanghui; Jiang, Chenghong; Liu, Jia; Hu, Qiong; Fang, Xiaoping; Wei, Wenhui


    The fertile and sterile plants were derived from the self-pollinated offspring of the F1 hybrid between the novel restorer line NR1 and the Nsa CMS line in Brassica napus. To elucidate gene expression and regulation caused by the A and C subgenomes of B. napus, as well as the alien chromosome and cytoplasm from Sinapis arvensis during the development of young floral buds, we performed a genome-wide high-throughput transcriptomic sequencing for young floral buds of sterile and fertile plants. In this study, equal amounts of total RNAs taken from young floral buds of sterile and fertile plants were sequenced using the Illumina/Solexa platform. After filtered out low quality data, a total of 2,760,574 and 2,714,441 clean tags were remained in the two libraries, from which 242,163 (Ste) and 253,507 (Fer) distinct tags were obtained. All distinct sequencing tags were annotated using all possible CATG+17-nt sequences of the genome and transcriptome of Brassica rapa and those of Brassica oleracea as the reference sequences, respectively. In total, 3231 genes of B. rapa and 3371 genes of B. oleracea were detected with significant differential expression levels. GO and pathway-based analyses were performed to determine and further to understand the biological functions of those differentially expressed genes (DEGs). In addition, there were 1089 specially expressed unknown tags in Fer, which were neither mapped to B. oleracea nor to B. rapa, and these unique tags were presumed to arise basically from the added alien chromosome of S. arvensis. Fifteen genes were randomly selected and their expression levels were confirmed by quantitative RT-PCR, and fourteen of them showed consistent expression patterns with the digital gene expression (DGE) data. A number of genes were differentially expressed between the young floral buds of sterile and fertile plants. Some of these genes may be candidates for future research on CMS in Nsa line, fertility restoration and improved agronomic

  8. The responses of crop - wild Brassica hybrids to simulated herbivory and interspecific competition: implications for transgene introgression. (United States)

    Sutherland, Jamie P; Justinova, Lenka; Poppy, Guy M


    Brassica rapa grows as a wild and weedy species throughout the world and is the most likely recipient of transgenes from GM oilseed rape. For transgene introgression to occur, the critical step which must be realized, is the formation of an F1 hybrid. Concerns exist that hybrid populations could be more vigorous and competitive compared to the parental species. This study examines the effect of simulated herbivory and interspecific competition on the vegetative and reproductive performance of non-transgenic F1 hybrids and their parental lines. Several vegetative and reproductive performance measures were used to determine the effect of simulated herbivory and competition on the Brassica lines, including leaf length and biomass for herbivory and seedling height and biomass for competition. For defoliation experiments, B. rapa showed little response in terms of leaf length but B. napus and the F1 hybrid responded negatively. Brassica rapa showed elevated biomass responses, but B. napus and the hybrid demonstrated negative responses to defoliation. Defoliation at the cotyledon stage had a slight effect upon final biomass with the F1 hybrid performing significantly worse than B. napus, although seed counts were not significantly different. For the series of competition experiments, hybrids seemed to be more similar to B. rapa in terms of early seedling growth and reproductive measures. The underperformance of hybrid plants when challenged by herbivory and competition, could potentially decrease survivorship and explain the rarity of hybrids in field surveys. However, should transgene introgression occur, the dynamics of hybrids could change radically thus increasing the risk of gene flow from a transgenic oilseed rape crop to the wild recipient.

  9. of integrated application of farmyard manure, plant growth promoting rhizobacteria and chemical fertilizers on production of canola (Brassica napus L. in saline soil of Qum

    Directory of Open Access Journals (Sweden)

    H. Sabahi


    Full Text Available Canola (Brassica napus L. is one of the most important oil seed crops. In order to evaluate the effects of integrated fertilization (chemical, manure and biofertilizers on canola (B. napus variety Hyola 401 yield and uptake of mineral nutrients in saline soil and water, a field experiment was conducted in randomized complete blocks (RCBD arrangement with eight treatments in three replications in Qum Province, Iran. Treatments were: (1 Control, P%100 (Phosphorus %100, (2 P%75B1 (Phosphorus %75+ Barvar biofertilizer, (3 P%75B2 (Phosphorus %75+ Nitroxin biofertilizer, (4 P%75M (Phosphorus %75+ farmyard manure, (5 P%75B1M (Phosphorus %75+ Barvar + Farmyard manure, (6 P%75B2M (Phosphorus %75+ Nitroxin+ Farmyard manure, (7 P%100B1 (Phosphorus %100 + Barvar and (8 P%125B2 (Phosphorus %125+ Nitroxin. The results showed that the highest yield was obtained from P%75B1M. Difference between integrated fertilization of farmyard manure and other treatments was significant. Farmyard manure increased canola yield which was attributed to increase in availability of mineral nutrients, decreasing effects of salinity and toxic ions. Integrated application of 5 t. ha-1 of farmyard manure and %75 recommended chemical P increased yield and decreased fertilizer consumption. The results revealed that integrated applications of farmyard manure and chemical fertilizer and after that integrated use of bio- and chemical fertilizer are the best strategies to increase nutrient availability and improving canola yield in saline soil.

  10. A- or C-chromosomes, does it matter for the transfer of transgenes from ¤Brassica napus¤

    DEFF Research Database (Denmark)

    Tomiuk, J.; Hauser, T.P.; Bagger Jørgensen, Rikke


    of herbicide-tolerant plants was explained by selection against the C-chromosomes of B. napus in favor of the homeologous ii-chromosomes. Obviously, such C-chromosomes could be potential candidates as safe integration sites for transgenes. We considered these safety aspects using a simple population genetic...... model. Theory and experiments, however, do not favor the chromosomes of B. napus as safe candidates with respect to the introgression of transgenes into wild populations of B. rapa....

  11. Fatty Acid and Transcript Profiling in Developing Seeds of Three Brassica napus Cultivars

    Directory of Open Access Journals (Sweden)

    Petkova Mariana


    Full Text Available Fatty acid levels and gene expression profiles for selected genes associated with the synthesis of fatty acids (FA, triacylglycerol, and oil body proteins were examined in three oilseed rape (Brassica napus cultivars that have utility for cultivar development in our spring canola breeding program. The seed oil content of Bronowski, Q2, and Westar was 39.0, 40.1, and 40.6%, respectively at 40 days after flowering (DAF. During the 20 to 40 day period of seed development, cultivars had varying levels of palmitic, stearic, oleic, linoleic, α-linolenic, eicosenoic, and erucic acid. In general, the percentage of each FA was similar among the cultivars during seed development. However, the level of oleic acid was lower and the levels of eicosenoic acid and erucic acid were higher in Bronowski than in Q2 and Westar seeds; linoleic acid also tended to be lower in Bronowski. Gene expression among the cultivars was similar from 10 to 40 DAF. The few exceptions were that expression of KAS1 and SAD were higher in Westar and Q2 than in Bronowski at 25 DAF, SAD was highest in Q2, intermediate in Westar, and lowest in Bronowski at 35 DAF, FAD2 was higher in Q2 than in Bronowski at 35 DAF, FAD3 was higher in Q2 than in Bronowski at 15 DAF and Q2 and Westar at 25 and 30 DAF, and FAE1 was higher in Westar and Q2 than in Bronowski at 30 DAF. Correlation analysis for gene expression against DAF for each genotype supported a common trend in gene expression among the three cultivars with gene expression tending to decrease over time; except for LPAAT, which tended to increase. The correlation between the level of FAs and expression of genes by genotype indicated no general trend; rather correlations seem to depend on the genotype.

  12. Major Co-localized QTL for Plant Height, Branch Initiation Height, Stem Diameter, and Flowering Time in an Alien Introgression Derived Brassica napus DH Population

    Directory of Open Access Journals (Sweden)

    Yusen Shen


    Full Text Available Plant height (PH, branch initiation height (BIH, and stem diameter (SD are three stem-related traits that play crucial roles in plant architecture and lodging resistance. Herein, we show one doubled haploid (DH population obtained from a cross between Y689 (one Capsella bursa-pastoris derived Brassica napus intertribal introgression and Westar (B. napus cultivar that these traits were significantly positively correlated with one another and with flowering time (FT. Based on a high-density SNP map, a total of 102 additive quantitative trait loci (QTL were identified across six environments. Seventy-two consensus QTL and 49 unique QTL were identified using a two-round strategy of QTL meta-analysis. Notably, a total of 19 major QTL, including 11 novel ones, were detected for these traits, which comprised two QTL clusters on chromosomes A02 and A07. Conditional QTL mapping was performed to preliminarily evaluate the genetic basis (pleiotropy or tight linkage of the co-localized QTL. In addition, QTL by environment interactions (QEI mapping was performed to verify the additive QTL and estimate the QEI effect. In the genomic regions of all major QTL, orthologs of the genes involved in phytohormone biosynthesis, phytohormone signaling, flower development, and cell differentiation in Arabidopsis were proposed as candidate genes. Of these, BnaA02g02560, an ortholog of Arabidopsis GASA4, was suggested as a candidate gene for PH, SD, and FT; and BnaA02g08490, an ortholog of Arabidopsis GNL, was associated with PH, BIH and FT. These results provide useful information for further genetic studies on stem-related traits and plant growth adaptation.

  13. High-density single nucleotide polymorphism (SNP) array mapping in Brassica oleracea: identification of QTL associated with carotenoid variation in broccoli florets. (United States)

    Brown, Allan F; Yousef, Gad G; Chebrolu, Kranthi K; Byrd, Robert W; Everhart, Koyt W; Thomas, Aswathy; Reid, Robert W; Parkin, Isobel A P; Sharpe, Andrew G; Oliver, Rebekah; Guzman, Ivette; Jackson, Eric W


    A high-resolution genetic linkage map of B. oleracea was developed from a B. napus SNP array. The work will facilitate genetic and evolutionary studies in Brassicaceae. A broccoli population, VI-158 × BNC, consisting of 150 F2:3 families was used to create a saturated Brassica oleracea (diploid: CC) linkage map using a recently developed rapeseed (Brassica napus) (tetraploid: AACC) Illumina Infinium single nucleotide polymorphism (SNP) array. The map consisted of 547 non-redundant SNP markers spanning 948.1 cM across nine chromosomes with an average interval size of 1.7 cM. As the SNPs are anchored to the genomic reference sequence of the rapid cycling B. oleracea TO1000, we were able to estimate that the map provides 96 % coverage of the diploid genome. Carotenoid analysis of 2 years data identified 3 QTLs on two chromosomes that are associated with up to half of the phenotypic variation associated with the accumulation of total or individual compounds. By searching the genome sequences of the two related diploid species (B. oleracea and B. rapa), we further identified putative carotenoid candidate genes in the region of these QTLs. This is the first description of the use of a B. napus SNP array to rapidly construct high-density genetic linkage maps of one of the constituent diploid species. The unambiguous nature of these markers with regard to genomic sequences provides evidence to the nature of genes underlying the QTL, and demonstrates the value and impact this resource will have on Brassica research.

  14. Effects of Source and Rate of Nitrogen Fertilizer on Yield, Yield Components and Quality of Winter Rapeseed (Brassica napus L. Efecto de la Fuente y Dosis de Fertilizantes Nitrogenados en el Rendimiento, Componentes de Rendimiento y Calidad de Semilla de Canola (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Özden Öztürk


    Full Text Available Winter rapeseed (Brassica napus L. has potential to become an alternate oilseed crop both for edible oil production and energy agriculture (biofuel production for Turkey. This study was conducted to determine the effect of year, N sources and doses on the yield and quality traits of winter rapeseed in a cereal system in calcareous soils over two seasons, 2000-2001 and 2001-2002, in Central Anatolia. Three N sources, ammonium sulfate, ammonium nitrate and urea, were applied as hand broadcast on the soil surface at five doses (0, 50, 100, 150, and 200 kg N ha-1. The traits investigated were plant height, number of branches and pods per plant, number of seed per pod, thousand seed weight, seed yield, oil and protein content. There were significantly effects on seed yield, oil and protein content, and other yield components due to N sources and rates. In general, ammonium sulfate and urea gave higher seed yield than ammonium nitrate. Mean values of both seasons indicated that 100 and 150 kg N ha-1 rate increased significantly yield and quality traits with regard to other N treatments. The present results highlight the practical importance of adequate N fertilization and true N source in seed yield in winter rapeseed and suggest that ammonium sulfate at 150 kg N ha-1 will be about adequate to meet crop N requirements.El raps (Brassica napus L. tiene potencial para convertirse en un cultivo oleaginoso alternativo para producción de aceite comestible y agricultura energética (producción de biodiesel en Turquía. Este estudio fue conducido para determinar el efecto del año, fuente y dosis de N en las características de rendimiento y calidad de raps en un sistema cerealero en suelos calcáreos en dos temporadas, 2000-2001 y 2001-2002, en Anatolia Central. Se aplicaron al voleo tres fuentes de N (sulfato de amonio, nitrato de amonio y urea en cinco dosis (0, 50, 100, 150 y 200 kg N ha-1. Las características investigadas fueron altura de planta, n

  15. Effects of Cd, Pb, Zn, Cu-resistant endophytic Enterobacter sr CBSB1 and Rhodotorula sp. CBSB79 on the growth and phytoextraction of Brassica plants in multimetal contaminated soils. (United States)

    Wang, Wenfeng; Deng, Zujun; Tan, Hongming; Cao, Lixiang


    To survey the effects of endophytic Enterobacter sp. CBSB1 and Rhodotorula sp. CBSB79 resistant to Cd2+, Pb2+, Zn2+, and Cu2+ on the growth and phytoextraction of Brassica, the endophytes were isolated by surface- sterilized methods and characterized. The CBSB1 significantly increased 44.2% of the dry weight of Brassica napus in the multimetal contaminated soil (P Rhodotorula sp CBSB79 showed higher potentials to improve extraction efficacy of Cd, Pb, Zn, and Cu by Brassica seedlings in the field.

  16. Physiological responses of Brassica napus to fulvic acid under water stress: Chlorophyll a fluorescence and antioxidant enzyme activity

    Directory of Open Access Journals (Sweden)

    Ramin Lotfi


    Full Text Available The ameliorative effect of fulvic acid (0, 300, and 600 mg L− 1 on photosystem II and antioxidant enzyme activity of the rapeseed (Brassica napus L. plant under water stress (60, 100, and 140 mm evaporation from class A pan was studied using split plots in a randomized complete block design with three replications. Results indicated that application of fulvic acid (FA improved the maximum quantum efficiency of PSII (Fv/Fm and performance index (PI of plants under both well-watered and limited-water conditions. The time span from Fo to Fm and the energy necessary for the closure of all reaction centers was significantly increased, but the size of the plastoquinone pool was reduced with increasing water stress levels. Plants treated with FA had higher peroxidase and catalase activities under all irrigation conditions. Activities of ascorbate peroxidase and superoxide dismutase in plants increased with increasing water stress. Malondialdehyde increased under severe water stress, but application of FA significantly decreased lipid peroxidation. Production of reactive oxygen species (ROS is a common phenomenon in plants under stress. Under this condition, the balance between the production of ROS and the quenching activity of antioxidants is upset, often resulting in oxidative damage. In this study, application of FA significantly increased fluorescence of chlorophyll a, inhibiting ROS production and enhancing antioxidant enzymes activity that destroyed ROS. Thus, ROS in plant cells was reduced under water stress by application of FA and consequently lipid peroxidation was reduced.

  17. Genome-wide survey of flavonoid biosynthesis genes and gene expression analysis between black- and yellow-seeded Brassica napus

    Directory of Open Access Journals (Sweden)

    Cunmin Qu


    Full Text Available Flavonoids, the compounds that impart color to fruits, flowers, and seeds, are the most widespread secondary metabolites in plants. However, a systematic analysis of these loci has not been performed in Brassicaceae. In this study, we isolated 649 nucleotide sequences related to flavonoid biosynthesis, i.e., the Transparent Testa (TT genes, and their associated amino acid sequences in 17 Brassicaceae species, grouped into Arabidopsis or Brassicaceae subgroups. Moreover, 36 copies of 21 genes of the flavonoid biosynthesis pathway were identified in A. thaliana, 53 were identified in B. rapa, 50 in B. oleracea, and 95 in B. napus, followed the genomic distribution, collinearity analysis and genes triplication of them among Brassicaceae species. The results showed that the extensive gene loss, whole genome triplication, and diploidization that occurred after divergence from the common ancestor. Using qRT-PCR methods, we analyzed the expression of eighteen flavonoid biosynthesis genes in 6 yellow- and black-seeded B. napus inbred lines with different genetic background, found that 12 of which were preferentially expressed during seed development, whereas the remaining genes were expressed in all B. napus tissues examined. Moreover, fourteen of these genes showed significant differences in expression level during seed development, and all but four of these (i.e., BnTT5, BnTT7, BnTT10, and BnTTG1 had similar expression patterns among the yellow- and black-seeded B. napus. Results showed that the structural genes (BnTT3, BnTT18 and BnBAN, regulatory genes (BnTTG2 and BnTT16 and three encoding transfer proteins (BnTT12, BnTT19, and BnAHA10 might play an crucial roles in the formation of different seed coat colors in B. napus. These data will be helpful for illustrating the molecular mechanisms of flavonoid biosynthesis in Brassicaceae species.

  18. Characterization of a new high copy Stowaway family MITE, BRAMI-1 in Brassica genome (United States)


    Background Miniature inverted-repeat transposable elements (MITEs) are expected to play important roles in evolution of genes and genome in plants, especially in the highly duplicated plant genomes. Various MITE families and their roles in plants have been characterized. However, there have been fewer studies of MITE families and their potential roles in evolution of the recently triplicated Brassica genome. Results We identified a new MITE family, BRAMI-1, belonging to the Stowaway super-family in the Brassica genome. In silico mapping revealed that 697 members are dispersed throughout the euchromatic regions of the B. rapa pseudo-chromosomes. Among them, 548 members (78.6%) are located in gene-rich regions, less than 3 kb from genes. In addition, we identified 516 and 15 members in the 470 Mb and 15 Mb genomic shotgun sequences currently available for B. oleracea and B. napus, respectively. The resulting estimated copy numbers for the entire genomes were 1440, 1464 and 2490 in B. rapa, B. oleracea and B. napus, respectively. Concurrently, only 70 members of the related Arabidopsis ATTIRTA-1 MITE family were identified in the Arabidopsis genome. Phylogenetic analysis revealed that BRAMI-1 elements proliferated in the Brassica genus after divergence from the Arabidopsis lineage. MITE insertion polymorphism (MIP) was inspected for 50 BRAMI-1 members, revealing high levels of insertion polymorphism between and within species of Brassica that clarify BRAMI-1 activation periods up to the present. Comparative analysis of the 71 genes harbouring the BRAMI-1 elements with their non-insertion paralogs (NIPs) showed that the BRAMI-1 insertions mainly reside in non-coding sequences and that the expression levels of genes with the elements differ from those of their NIPs. Conclusion A Stowaway family MITE, named as BRAMI-1, was gradually amplified and remained present in over than 1400 copies in each of three Brassica species. Overall, 78% of the members were identified in

  19. A comprehensive transcriptome analysis of silique development and dehiscence in Arabidopsis and Brassica integrating genotypic, interspecies and developmental comparisons (United States)

    Jaradat, Masrur R; Ruegger, Max; Bowling, Andrew; Butler, Holly; Cutler, Adrian J


    Asynchronous flowering of Brassica napus (canola) leads to seeds and siliques at varying stages of maturity as harvest approaches. This range of maturation can result in premature silique dehiscence (pod shattering), resulting in yield losses, which may be worsened by environmental stresses. Therefore, a goal for canola crop improvement is to reduce shattering in order to maximize yield. We performed a comprehensive transcriptome analysis on the dehiscence zone (DZ) and valve of Arabidopsis and Brassica siliques in shatter resistant and sensitive genotypes at several developmental stages. Among known Arabidopsis dehiscence genes, we confirmed that homologs of SHP1/2, FUL, ADPG1, NST1/3 and IND were associated with shattering in B. juncea and B. napus. We noted a correlation between reduced pectin degradation genes and shatter-resistance. Tension between lignified and non-lignified cells in the silique DZ plays a major role in dehiscence. Light microscopy revealed a smaller non-lignified separation layer in relatively shatter-resistant B. juncea relative to B. napus and this corresponded to increased expression of peroxidases involved in monolignol polymerization. Sustained repression of auxin biosynthesis, transport and signaling in B. juncea relative to B. napus may cause differences in dehiscence zone structure and cell wall constituents. Tension on the dehiscence zone is a consequence of shrinkage and loss of flexibility in the valves, which is caused by senescence and desiccation. Reduced shattering was generally associated with upregulation of ABA signaling and down-regulation of ethylene and jasmonate signaling, corresponding to more pronounced stress responses and reduced senescence and photosynthesis. Overall, we identified 124 cell wall related genes and 103 transcription factors potentially involved in silique dehiscence. PMID:25523176

  20. A comprehensive transcriptome analysis of silique development and dehiscence in Arabidopsis and Brassica integrating genotypic, interspecies and developmental comparisons. (United States)

    Jaradat, Masrur R; Ruegger, Max; Bowling, Andrew; Butler, Holly; Cutler, Adrian J


    Asynchronous flowering of Brassica napus (canola) leads to seeds and siliques at varying stages of maturity as harvest approaches. This range of maturation can result in premature silique dehiscence (pod shattering), resulting in yield losses, which may be worsened by environmental stresses. Therefore, a goal for canola crop improvement is to reduce shattering in order to maximize yield. We performed a comprehensive transcriptome analysis on the dehiscence zone (DZ) and valve of Arabidopsis and Brassica siliques in shatter resistant and sensitive genotypes at several developmental stages. Among known Arabidopsis dehiscence genes, we confirmed that homologs of SHP1/2, FUL, ADPG1, NST1/3 and IND were associated with shattering in B. juncea and B. napus. We noted a correlation between reduced pectin degradation genes and shatter-resistance. Tension between lignified and non-lignified cells in the silique DZ plays a major role in dehiscence. Light microscopy revealed a smaller non-lignified separation layer in relatively shatter-resistant B. juncea relative to B. napus and this corresponded to increased expression of peroxidases involved in monolignol polymerization. Sustained repression of auxin biosynthesis, transport and signaling in B. juncea relative to B. napus may cause differences in dehiscence zone structure and cell wall constituents. Tension on the dehiscence zone is a consequence of shrinkage and loss of flexibility in the valves, which is caused by senescence and desiccation. Reduced shattering was generally associated with upregulation of ABA signaling and down-regulation of ethylene and jasmonate signaling, corresponding to more pronounced stress responses and reduced senescence and photosynthesis. Overall, we identified 124 cell wall related genes and 103 transcription factors potentially involved in silique dehiscence.

  1. Quantitative Trait Loci Mapping in Brassica rapa Revealed the Structural and Functional Conservation of Genetic Loci Governing Morphological and Yield Component Traits in the A, B, and C Subgenomes of Brassica Species (United States)

    Li, Xiaonan; Ramchiary, Nirala; Dhandapani, Vignesh; Choi, Su Ryun; Hur, Yoonkang; Nou, Ill-Sup; Yoon, Moo Kyoung; Lim, Yong Pyo


    Brassica rapa is an important crop species that produces vegetables, oilseed, and fodder. Although many studies reported quantitative trait loci (QTL) mapping, the genes governing most of its economically important traits are still unknown. In this study, we report QTL mapping for morphological and yield component traits in B. rapa and comparative map alignment between B. rapa, B. napus, B. juncea, and Arabidopsis thaliana to identify candidate genes and conserved QTL blocks between them. A total of 95 QTL were identified in different crucifer blocks of the B. rapa genome. Through synteny analysis with A. thaliana, B. rapa candidate genes and intronic and exonic single nucleotide polymorphisms in the parental lines were detected from whole genome resequenced data, a few of which were validated by mapping them to the QTL regions. Semi-quantitative reverse transcriptase PCR analysis showed differences in the expression levels of a few genes in parental lines. Comparative mapping identified five key major evolutionarily conserved crucifer blocks (R, J, F, E, and W) harbouring QTL for morphological and yield components traits between the A, B, and C subgenomes of B. rapa, B. juncea, and B. napus. The information of the identified candidate genes could be used for breeding B. rapa and other related Brassica species. PMID:23223793

  2. Induced accumulation of Au, Ag and Cu in Brassica napus grown in a mine tailings with the inoculation of Aspergillus niger and the application of two chemical compounds. (United States)

    González-Valdez, Eduardo; Alarcón, Alejandro; Ferrera-Cerrato, Ronald; Vega-Carrillo, Héctor René; Maldonado-Vega, María; Salas-Luévano, Miguel Ángel; Argumedo-Delira, Rosalba


    This study evaluated the ability of Brassica napus for extracting gold (Au), silver (Ag) and copper (Cu) from a mine tailings, with the inoculation of two Aspergillus niger strains, and the application of ammonium thiocyanate (NH 4 SCN) or ammonium thiosulfate [(NH 4 ) 2 S 2 O 3 ]. After seven weeks of growth inoculated or non-inoculated plants were applied with 1 or 2 g kg -1 of either NH 4 SCN or (NH 4 ) 2 S 2 O 3 , respectively. Eight days after the application of the chemical compounds, plants were harvested for determining the total dry biomass, and the content of Au, Ag, and Cu in plant organs. Application of (NH 4 ) 2 S 2 O 3 or NH 4 SCN resulted in enhanced Au-accumulation in stems (447% and 507%, respectively), while either (NH 4 ) 2 S 2 O 3 +Aspergillus, or NH 4 SCN increased the Au-accumulation in roots (198.5% and 404%, respectively) when compared to the control. Treatments with (NH 4 ) 2 S 2 O 3 or (NH 4 ) 2 S 2 O 3 +Aspergillus significantly increased (P ≤ 0.001) the accumulation of Ag in leaves (677% and 1376%, respectively), while NH 4 SCN + Aspergillus, and (NH 4 ) 2 S 2 O 3 enhanced the accumulation in stems (7153% and 6717.5%). The Ag-accumulation in roots was stimulated by NH 4 SCN+ Aspergillus, and (NH 4 ) 2 S 2 O 3 + Aspergillus (132.5% and 178%, respectively), when compared to the control. The combination of NH 4 SCN+Aspergillus significantly enhanced the Cu-accumulation in leaves (228%); whereas NH 4 SCN+ Aspergillus, or (NH 4 ) 2 S 2 O 3 + Aspergillus resulted in greater accumulation of Cu in stems (1233.5% and 1580%, respectively) than the control. Results suggest that either NH 4 SCN or (NH 4 ) 2 S 2 O 3 (with or without Aspergillus) improved the accumulation of Au and Ag by B. napus. Accumulation of Au and Ag in plant organs overpassed the hyperaccumulation criterion (> 1 mg kg -1 of plant biomass); whereas Cu-accumulation in stems and roots also overpassed such criterion (> 1000 mg kg -1 ) by applying

  3. A comparison of screening methods to identify waterlogging tolerance in the field in Brassica napus L. during plant ontogeny.

    Directory of Open Access Journals (Sweden)

    Xiling Zou

    Full Text Available Waterlogging tolerance is typically evaluated at a specific development stage, with an implicit assumption that differences in waterlogging tolerance expressed in these systems will result in improved yield performance in fields. It is necessary to examine these criteria in fields. In the present study, three experiments were conducted to screen waterlogging tolerance in 25 rapeseed (Brassica napus L. varieties at different developmental stages, such as seedling establishment stage and seedling stage at controlled environment, and maturity stage in the fields. The assessments for physiological parameters at three growth stages suggest that there were difference of waterlogging tolerance at all the development stages, providing an important basis for further development of breeding more tolerant materials. The results indicated that flash waterlogging restricts plant growth and growth is still restored after removal of the stress. Correlation analysis between waterlogging tolerance coefficient (WTC of yield and other traits revealed that there was consistency in waterlogging tolerance of the genotypes until maturity, and good tolerance at seedling establishment stage and seedling stage can guarantee tolerance in later stages. The waterlogging-tolerant plants could be selected using some specific traits at any stage, and selections would be more effective at the seedling establishment stage. Thus, our study provides a method for screening waterlogging tolerance, which would enable the suitable basis for initial selection of a large number of germplasm or breeding populations for waterlogging tolerance and help for verifying their potential utility in crop-improvement.

  4. The bioaccumulation of heavy metals in Brassica napus L. in the area around Turów Power Station, Poland

    Directory of Open Access Journals (Sweden)

    Niedźwiecka Alicja


    Full Text Available Brassica napus L. is a known bioaccumulator of copper, zinc, cadmium, lead, chromium, nickel and arsenic from soils. The metal ions are accumulated in the roots, stems, leaves and seeds of the oilseed rape. The samples of soils and plants were collected in the area around the Turów power station (Bogatynia city, Lower Silesia. The soil samples were collected from the surface layer of 0-25 cm. Roots, stems and pods of the oilseed rape were used in the study. The environmental samples were digested in HNO3, 60%, using the Microwave Digestion System. Metal concentrations have been dermined through the FAAS method. Three heavy metals - zinc, copper and lead – have been analyzed. The content of zinc was higher than the content of copper in all samples (plants and soils. In the roots of the oilseed rape higher concentration of metals compared to other parts of the plant was observed. In the soil samples, there was no correlation between the concentration of pollution and the distance from the power plant. Permissible concentrations of heavy metals relative to the standard according to the Polish Ministry of Environment Regulation from September 1st, 2016, have not been exceeded. The permissible pollution indexes (Wn in soils were exceeded compared to the geochemical background in uncontaminated soils of Poland. The bioaccumulation coefficients of heavy metals indicate lower metal concentrations in plants than in soils

  5. Combining Ability Analysis and Genetic-Effects Studies for Some Important Quality Characters in Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Aamar Shehzad


    Full Text Available Combining ability analysis has an important position in rapeseed breeding. To evaluate genetic and combining ability effects, three Brassica napus L. testers “Punjab Sarson, Legend and Durre-NIFA” and five lines “Duncled, K-258, ZN-R-1, ZN-R-8, ZN-M-6” were crossed using line × tester design in Randomized Complete Block Design (RCBD with three replications. Mean sum of squares of the analysis of variances (ANOVA for genotypes was highly significant for all of the traits. Most of the lines and testers exhibited significant results of mean sum of squares for combining ability. Line ‘Duncled’ was proved good general combiner for oil (8.8, protein (3.7, erucic acid (33.0, oleic acid (13.0 and glucosinolate (-19.3 over other lines and tester ‘Durree-NIFA’ for protein (6.6, erucic acid (-23.4, and linolenic acid (-5.3 over other testers. Significant specific combining ability effects were also observed. The best hybrid combinations were Legend × ZN-R-1 for oil (9.6, Punjab Sarson × Duncled for minimum erucic acid (-14.0 and linolenic acid contents (-6.0, and Legend × ZN-M-6 for maximum protein (8.2 and minimum glucosinolate contents (-11.1. The maximum oil contents were observed in ‘Legend × ZN-R-1’ (52.4%. The cross ‘Punjab Sarson × Duncled’ expressed maximum values of protein (26.5% and oleic acid (62.5% while minimum for erucic acid (2.3%, linolenic acid (5.4% and glucosinolate contents (19.3µmol/g. This research discloses the significance of non-additive genetic effects for most of the studied traits except oil contents. These studies will also help to improve nutritional values of rapeseed crop by selecting noble crosses.

  6. Sulphur Nutrition and its Effect on Yield and Oil Content of Oilseed Rape (Brassica Napus L.

    Directory of Open Access Journals (Sweden)

    Mária Varényiová


    Full Text Available The aim of the experiment was to study the importance of sulphur in oilseed rape (Brassica napus L. nutrition as well as the effect of rising doses of sulphur in combination with nitrogen on yield, oiliness, oil production, nutrients content in seed and nutrients uptake by rapeseed. The plot–scale experiment was established in years 2013/14 and 2014/15 within the agricultural cooperative in Mojmírovce. There were four fertilization treatments on 600 m2 experimental plots in three replications in this experiment. The first treatment was unfertilized control. Other three treatments were fertilized by the same nitrogen dose of 160 kg.ha−1 and by increasing doses of sulphur. The second treatment was fertilized by a dose of 15 kg.ha−1 S, the third by a dose of 40 kg.ha−1 and a dose of 65 kg.ha−1 S was applied at the fourth treatment. The highest average yield 3.96 t.ha-1 was found when a dose of 40 kg.ha−1 S was applied. The application of sulphur in a dose of 65 kg.ha−1 was accompanied by a yield decrease by 11.4 % as compared to the treatment where a sulphur dose of 40 kg.ha−1 was used. An average oil content of 45.1, 45.5, and 44.0 % was found in treatments in which the doses of sulphur of 15, 40 and 65 kg.ha−1 were applied. No significant difference among the treatments fertilized by sulphur was found. The average oil production reached 1809, 1802 and 1595 kg.ha−1 in cases of treatments fertilized by sulphur doses of 15, 40 and 65 kg.ha−1.

  7. Glyphosate drift promotes changes in fitness and transgene flow in canola (Brassica napus) and hybrids (United States)

    1. With the advent of transgenic crops, genetically modified, herbicide resistant B. napus has become a model system for examining the risks of escape of transgenes from cultivation and for evaluating potential ecological consequences of novel genes in wild species. 2. We exam...

  8. The effect of Ni on concentration of the most abundant essential cations in several Brassica species

    Directory of Open Access Journals (Sweden)

    Putnik-Delić Marina I.


    Full Text Available Some plants from the genus Brassica have the ability to tolerate excessive concentrations of heavy metals, including Ni. Considering the fact that Ni is a very toxic element for living beings we wanted to examine its influence on some species from genus Brassicaceae. The aim of this study was to investigate the effect of Ni on distribution and accumulation of essential macronutrients from the standpoint of food quality and phytoremediation potential. Experiments were performed using winter (W and spring (S varieties of rapeseed (Brassica napus, L., white mustard (Brassica alba, L., black mustard (Brassica nigra, L. and turnip (Brassica rapa, L.. The seeds were exposed to 10 μM Ni from the beginning of germination. Plants were grown in water cultures, in semi-controlled conditions of a greenhouse, on ½ strength Hoagland solution to which was added Ni in the same concentration as during germination. Concentrations and distribution of Ca, Mg, K in leaf and stem were altered in the presence of increased concentration of Ni. Significant differences were found between the control and Ni-treated plants as well as among the genotypes. [Projekat Ministarstva nauke Republike Srbije, br. TR 31036 i br. TR 31016

  9. Colorless chlorophyll catabolites in senescent florets of broccoli (Brassica oleracea var. italica). (United States)

    Roiser, Matthias H; Müller, Thomas; Kräutler, Bernhard


    Typical postharvest storage of broccoli (Brassica oleracea var. italica) causes degreening of this common vegetable with visible loss of chlorophyll (Chl). As shown here, colorless Chl-catabolites are generated. In fresh extracts of degreening florets of broccoli, three colorless tetrapyrrolic Chl-catabolites accumulated and were detected by high performance liquid chromatography (HPLC): two "nonfluorescent" Chl-catabolites (NCCs), provisionally named Bo-NCC-1 and Bo-NCC-2, and a colorless 1,19-dioxobilin-type "nonfluorescent" Chl-catabolite (DNCC), named Bo-DNCC. Analysis by nuclear magnetic resonance spectroscopy and mass spectrometry of these three linear tetrapyrroles revealed their structures. In combination with a comparison of their HPL-chromatographic properties, this allowed their identification with three known catabolites from two other brassicacea, namely two NCCs from oil seed rape (Brassica napus) and a DNCC from degreened leaves of Arabidopsis thaliana.

  10. Brassica database (BRAD) version 2.0: integrating and mining Brassicaceae species genomic resources. (United States)

    Wang, Xiaobo; Wu, Jian; Liang, Jianli; Cheng, Feng; Wang, Xiaowu


    The Brassica database (BRAD) was built initially to assist users apply Brassica rapa and Arabidopsis thaliana genomic data efficiently to their research. However, many Brassicaceae genomes have been sequenced and released after its construction. These genomes are rich resources for comparative genomics, gene annotation and functional evolutionary studies of Brassica crops. Therefore, we have updated BRAD to version 2.0 (V2.0). In BRAD V2.0, 11 more Brassicaceae genomes have been integrated into the database, namely those of Arabidopsis lyrata, Aethionema arabicum, Brassica oleracea, Brassica napus, Camelina sativa, Capsella rubella, Leavenworthia alabamica, Sisymbrium irio and three extremophiles Schrenkiella parvula, Thellungiella halophila and Thellungiella salsuginea. BRAD V2.0 provides plots of syntenic genomic fragments between pairs of Brassicaceae species, from the level of chromosomes to genomic blocks. The Generic Synteny Browser (GBrowse_syn), a module of the Genome Browser (GBrowse), is used to show syntenic relationships between multiple genomes. Search functions for retrieving syntenic and non-syntenic orthologs, as well as their annotation and sequences are also provided. Furthermore, genome and annotation information have been imported into GBrowse so that all functional elements can be visualized in one frame. We plan to continually update BRAD by integrating more Brassicaceae genomes into the database. Database URL: © The Author(s) 2015. Published by Oxford University Press.

  11. Epidermal transmittance and phenolic composition in leaves of atrazine-tolerant and atrazine-sensitive cultivars of Brassica napus grown under enhanced UV-B radiation

    International Nuclear Information System (INIS)

    Olsson, L.C.; Veit, M.; Bornman, J.F.


    Experiments were conducted on the atrazine-tolerant mutant Stallion and the atrazine-sensitive cv. Paroll of Brassica napus L., which were grown under either visible light or with the addition of UV-B radiation (280–320 nm) for 15 days. The mutant has been shown to be sensitive to high levels of visible light as compared to the atrazine-sensitive cultivar and therefore we wished to determine plant response to UV-B radiation with respect to potential pigment changes, certain anatomical features, radiation penetration and partial photosynthesis. With regard to pigment changes, we were particularly interested in whether the compositional shift in flavonol pigments under enhanced UV-B radiation, previously suggested to favour increased antioxidant activity, is confined to the adaxial epidermis, which generally receives most UV-B radiation or whether the pigment shift is also inducible in the abaxial epidermis.As was to be expected, the penetration of UV-B radiation (310 nm) was lower in the UV-B-exposed plants, which was correlated with an increased amount of UV-screening pigments in the adaxial and abaxial epidermal layers. The main flavonoid glycosides showed the largest shift from kaempferol to quercetin as aglycone moiety in the adaxial epidermal layer. However, in the abaxial epidermal layer the hydroxycinnamic acid (HCA) derivatives and kaempferol glycosides were predominant. Penetration of 430 nm light was higher after UV-B exposure, and probably contributed to the fact that photosynthetic efficiency of photosystem II was unchanged or higher after UV-B exposure. UV-B radiation decreased leaf area in the atrazine-tolerant mutant only. Both cultivars showed an increased leaf thickness after UV-B exposure due to cell elongation mainly of the palisade tissue. This was especially evident in the mutant

  12. Comparative mapping of Brassica juncea and Arabidopsis thaliana using Intron Polymorphism (IP markers: homoeologous relationships, diversification and evolution of the A, B and C Brassica genomes

    Directory of Open Access Journals (Sweden)

    Gupta Vibha


    Full Text Available Abstract Background Extensive mapping efforts are currently underway for the establishment of comparative genomics between the model plant, Arabidopsis thaliana and various Brassica species. Most of these studies have deployed RFLP markers, the use of which is a laborious and time-consuming process. We therefore tested the efficacy of PCR-based Intron Polymorphism (IP markers to analyze genome-wide synteny between the oilseed crop, Brassica juncea (AABB genome and A. thaliana and analyzed the arrangement of 24 (previously described genomic block segments in the A, B and C Brassica genomes to study the evolutionary events contributing to karyotype variations in the three diploid Brassica genomes. Results IP markers were highly efficient and generated easily discernable polymorphisms on agarose gels. Comparative analysis of the segmental organization of the A and B genomes of B. juncea (present study with the A and B genomes of B. napus and B. nigra respectively (described earlier, revealed a high degree of colinearity suggesting minimal macro-level changes after polyploidization. The ancestral block arrangements that remained unaltered during evolution and the karyotype rearrangements that originated in the Oleracea lineage after its divergence from Rapa lineage were identified. Genomic rearrangements leading to the gain or loss of one chromosome each between the A-B and A-C lineages were deciphered. Complete homoeology in terms of block organization was found between three linkage groups (LG each for the A-B and A-C genomes. Based on the homoeology shared between the A, B and C genomes, a new nomenclature for the B genome LGs was assigned to establish uniformity in the international Brassica LG nomenclature code. Conclusion IP markers were highly effective in generating comparative relationships between Arabidopsis and various Brassica species. Comparative genomics between the three Brassica lineages established the major rearrangements

  13. Effects of derived meals from juncea (Brassica juncea, yellow and black seeded canola (Brassica napus and multicarbohydrase enzymes supplementation on apparent metabolizable energy in broiler chickens

    Directory of Open Access Journals (Sweden)

    Balachandar Jayaraman


    Full Text Available Two experiments were conducted to determine the nitrogen-corrected apparent metabolizable energy (AMEn of differently processed meals from Juncea (Brassica juncea, yellow and black seeded canola (Brassica napus, with or without supplementation of multi-carbohydrase enzymes (Enz in diets for broiler chickens. The first experiment was a 3 × 2 × 2 factorial arrangement with the main factors being seed type (yellow [Yellow] or black [B1] canola seeds and Juncea seeds, processed at two temperatures (high temperature desolventized-toasted [HTDT] at 95°C or low temperature desolventized-toasted [LTDT] at 57°C, with or without Enz. In Exp. 1, a total of 384 one-day-old male broiler chicks were randomly assigned to 64 battery cages, with 6 birds/cage. The second experiment was a 2 × 2 × 2 factorial arrangement with the main factors being seed type (Yellow or black [B2], seed source (Scott, Saskatchewan or Truro, Nova Scotia and Enz (with or without supplementation. A total of 264 one-day-old male broiler chicks were randomly assigned to 44 battery cages, with 6 birds per cage. In Exp. 1 and 2, all birds were fed a common starter diet from 1 to 14 days of age. From d 15 to 21, the birds were fed one of the test treatments, a basal grower diet or the basal grower diet replaced with 30% test ingredient with celite (0.8% added as an inert marker. Excreta was collected on d 20 and 21. In Exp. 1, there were no interactions (P > 0.05 among seed type, processing temperature and Enz. Processing temperature and dietary Enz did not affect (P > 0.05 AMEn of different canola meals. The AMEn of prepress solvent extracted canola and juncea meals (PSEM from Yellow (11.2 MJ/kg was higher (P  0.05 among seed color, location and Enz. Supplementation of dietary Enz did not affect (P > 0.05 AMEn of different cold press canola meals. The AMEn of cold press canola meals (CPM from Yellow (14.7 MJ/kg was higher (P < 0.05 compared with B2 (12.2

  14. Identification of microRNAs actively involved in fatty acid biosynthesis in developing Brassica napus seeds using high-throughput sequencing

    Directory of Open Access Journals (Sweden)

    Jia Wang


    Full Text Available Seed development has a critical role during the spermatophyte life cycle. In Brassica napus, a major oil crop, fatty acids are synthesized and stored in specific tissues during embryogenesis, and understanding the molecular mechanism underlying fatty acid biosynthesis during seed development is an important research goal. In this study, we constructed three small RNA libraries from early seeds at 14, 21 and 28 days after flowering (DAF and used high-throughput sequencing to examine microRNA (miRNA expression. A total of 85 known miRNAs from 30 families and 1,160 novel miRNAs were identified, of which 24, including 5 known and 19 novel miRNAs, were found to be involved in fatty acid biosynthesis. bna-miR156b, bna-miR156c, bna-miR156g, novel_mir_1706, novel_mir_1407, novel_mir_173, and novel_mir_104 were significantly down-regulated at 21 DAF and 28 DAF, whereas bna-miR159, novel_mir_1081, novel_mir_19 and novel_mir_555 were significantly up-regulated. In addition, we found that some miRNAs regulate functional genes that are directly involved in fatty acid biosynthesis and that other miRNAs regulate the process of fatty acid biosynthesis by acting on a large number of transcription factors. The miRNAs and their corresponding predicted targets were partially validated by quantitative RT-PCR. Our data suggest that diverse and complex miRNAs are involved in the seed development process and that miRNAs play important roles in fatty acid biosynthesis during seed development.

  15. Dynamic Metabolic Profiles and Tissue-Specific Source Effects on the Metabolome of Developing Seeds of Brassica napus.

    Directory of Open Access Journals (Sweden)

    Helin Tan

    Full Text Available Canola (Brassica napus is one of several important oil-producing crops, and the physiological processes, enzymes, and genes involved in oil synthesis in canola seeds have been well characterized. However, relatively little is known about the dynamic metabolic changes that occur during oil accumulation in seeds, as well as the mechanistic origins of metabolic changes. To explore the metabolic changes that occur during oil accumulation, we isolated metabolites from both seed and silique wall and identified and characterized them by using gas chromatography coupled with mass spectrometry (GC-MS. The results showed that a total of 443 metabolites were identified from four developmental stages. Dozens of these metabolites were differentially expressed during seed ripening, including 20 known to be involved in seed development. To investigate the contribution of tissue-specific carbon sources to the biosynthesis of these metabolites, we examined the metabolic changes of silique walls and seeds under three treatments: leaf-detachment (Ld, phloem-peeling (Pe, and selective silique darkening (Sd. Our study demonstrated that the oil content was independent of leaf photosynthesis and phloem transport during oil accumulation, but required the metabolic influx from the silique wall. Notably, Sd treatment resulted in seed senescence, which eventually led to a severe reduction of the oil content. Sd treatment also caused a significant accumulation of fatty acids (FA, organic acids and amino acids. Furthermore, an unexpected accumulation of sugar derivatives and organic acid was observed in the Pe- and Sd-treated seeds. Consistent with this, the expression of a subset of genes involved in FA metabolism, sugar and oil storage was significantly altered in Pe and Sd treated seeds. Taken together, our studies suggest the metabolite profiles of canola seeds dynamically varied during the course of oil accumulation, which may provide a new insight into the mechanisms

  16. Exploring genotypic variations for improved oil content and healthy fatty acids composition in rapeseed (Brassica napus L.). (United States)

    Ishaq, Muhammad; Razi, Raziuddin; Khan, Sabaz Ali


    Development of new genotypes having high oil content and desirable levels of fatty acid compositions is a major objective of rapeseed breeding programmes. In the current study combining ability was determined for oil, protein, glucosinolates and various fatty acids content using 8 × 8 full diallel in rapeseed (Brassica napus). Highly significant genotypic differences were observed for oil, protein, glucosinolates, oleic acid, linolenic acid and erucic acid content. Mean squares due to general combining ability (GCA), specific combining ability (SCA) and reciprocal combining ability (RCA) were highly significant (P ≤ 0.01) for biochemical traits. Parental line AUP-17 for high oil content and low glucosinolates, genotype AUP-2 for high protein and oleic acids, and AUP-18 for low lenolenic and erucic acid were best general combiners. Based on desirable SCA effects, F 1 hybrids AUP-17 × AUP-20; AUP-2 × AUP-8; AUP-7 × AUP-14; AUP-2 × AUP-9; AUP-7 × AUP-14 and AUP-2 × AUP-9 were found superior involving at least one best general combiner. F 1 hybrids AUP-17 × AUP-20 (for oil content); AUP-2 × AUP-8 (for protein content); AUP-7 × AUP-14 (for glucosinolates); AUP-2 × AUP-9 (for oleic acid); AUP-7 × AUP-14 (for linolenic acid) and AUP-2 × AUP-9 (for erucic acid) were found superior involving at least one best general combiner. As reciprocal crosses of AUP-14 with AUP-7 and AUP-8 were superior had low × low and low × high GCA effects for glucosinolates and oleic acid, respectively therefore, these could be exploited in future rapeseed breeding programmes to develop new lines with good quality. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  17. Mitochondrial genome sequencing helps show the evolutionary mechanism of mitochondrial genome formation in Brassica (United States)


    Background Angiosperm mitochondrial genomes are more complex than those of other organisms. Analyses of the mitochondrial genome sequences of at least 11 angiosperm species have showed several common properties; these cannot easily explain, however, how the diverse mitotypes evolved within each genus or species. We analyzed the evolutionary relationships of Brassica mitotypes by sequencing. Results We sequenced the mitotypes of cam (Brassica rapa), ole (B. oleracea), jun (B. juncea), and car (B. carinata) and analyzed them together with two previously sequenced mitotypes of B. napus (pol and nap). The sizes of whole single circular genomes of cam, jun, ole, and car are 219,747 bp, 219,766 bp, 360,271 bp, and 232,241 bp, respectively. The mitochondrial genome of ole is largest as a resulting of the duplication of a 141.8 kb segment. The jun mitotype is the result of an inherited cam mitotype, and pol is also derived from the cam mitotype with evolutionary modifications. Genes with known functions are conserved in all mitotypes, but clear variation in open reading frames (ORFs) with unknown functions among the six mitotypes was observed. Sequence relationship analysis showed that there has been genome compaction and inheritance in the course of Brassica mitotype evolution. Conclusions We have sequenced four Brassica mitotypes, compared six Brassica mitotypes and suggested a mechanism for mitochondrial genome formation in Brassica, including evolutionary events such as inheritance, duplication, rearrangement, genome compaction, and mutation. PMID:21988783

  18. Comparative field evaluation of some newer versus conventional insecticides for the control of aphids (homoptera: aphididae) on oilseed rape (brassica napus l.)

    International Nuclear Information System (INIS)

    Sarwar, M.; Ahmad, N.; Bux, M.; Nasrullah, A.; Tofique, M.


    This study was designed to evaluate the effects of new insecticides like, Imidacloprid (Confidor 200 EC), Thiomethoxam (Actara 25 WG) and Acetamiprid (Megamos 20 SL) belonging to Nitroguanidine group along with conventional insecticides such as, Chlorpyrifos (Lorsban 40 EC) and Dimethoate (Systoate 40 EC) belonging to Organophosphate group against aphids' population on oilseed rape (Brassica napus L.). A perusal of data, based on the overall performance of the test compounds, reflected that newer insecticides were superior in reducing the population of aphids and yield enhancement as compared to conventional insecticides. The best results were achieved with the application of Imidacloprid by recording the lowest number of aphids (2.2 per plant) than obtained with Thiomethoxam and Acetamiprid (3.22 and 4.66, respectively). Other insecticides, viz., Chlorpyrifos and Dimethoate were also found to be effective in maintaining the aphids' population at lower levels per plant (16.2 and 17.5, respectively) over untreated control (227.7). Imidacloprid was responsible for increasing the grain yield to 3722.85 Kg per Hectare, approached by Thiomethoxam, Acetamiprid, Chlorpyrifos and Dimethoate as against unsprayed control (2980.0, 2542.85, 1542.85, 540.0 and 604.85 Kg per Hectare, respectively). Study indicated that selective use of newer insecticides would seem a reasonable strategy in aphids controlling and integration of such chemicals in insects' management package could help to reduce pest densities. (author)

  19. Effects of different roasting conditions on the nutritional value and oxidative stability of high-oleic and yellow-seeded Brassica napus oils

    Directory of Open Access Journals (Sweden)

    Rękas, A.


    Full Text Available This study was conducted to evaluate the possibility of enhancing the nutritional value and oxidative stability of rapeseed oil obtained from seeds subjected to thermal treatment prior to pressing. The yellowseeded and high-oleic B. napus lines, harvested in Poland, were roasted prior to pressing for 1 h at 100 and 150 °C. This study highlighted how rapeseed breeding lines affect the quality profile of the oils obtained both before and after the roasting process. In principle, the high-oleic B. napus was accompanied by a nearly 2-fold increase in oxidative stability compared to the yellow-seeded B. napus, most likely due to a higher content of oxidation-resistant oleic fatty acids (~74.24% vs. ~60.76% and a decreased concentration of oxidizable PUFAs (~16.32% vs. ~31.09%. Similar to the case of roasting black-seeded rapeseed, the thermal pre-treatment of yellow-seeded and high-oleic B. napus prior to pressing did not alter the composition of their fatty acids. Based on the results obtained in this study, it can be concluded that roasting seeds prior to pressing does not reduce the amount of tocopherols in the oil; moreover, a slight increase in γ-tocopherol content was observed.Este estudio se realizó para evaluar la posibilidad de aumentar el valor nutritivo y la estabilidad oxidativa del aceite de colza obtenido a partir de semillas sometidas a tratamiento térmico antes del prensado. Las líneas de B. napus sembrados amarillos y alto oleico, cosechadas en Polonia, fueron tostadas antes de ser prensadas durante 1 hora a 100 y 150 °C. Este estudio pone de relieve cómo las líneas de colza mejoradas ven afectado el perfil de calidad de los aceites obtenidos antes y después del proceso de tostado. En principio, el alto oleico B. napus aumenta casi 2 veces la estabilidad a la oxidación en comparación con semilla amarilla B. napus, muy probablemente debido a un mayor contenido de ácido graso oleico resistente a la oxidación (~74,24% vs

  20. Effect of Sugarcane Filter Muds, Chemical and Biological Fertilizers on Absorption of Some Macro- and Micro-Elementsand Heavy Metals by Canola (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    H. Monjezi


    Full Text Available In order to evaluate the effect of sugarcane (Sacharum officinarum L. filter muds and chemical and biological fertilizers application on macro- and micronutrient elements and some heavy metals (Pb and Cd absorption by canola (Brassica napus L. grains, a factorial experiment was conducted in 2012 in the Experimental Farm of Ramin (Mollasani Agriculture and Natural Resources University of Khouzestan, Iran. A complete blocks design was used for the experiment with three replications. Different integrated treatments of filter muds and chemical fertilizers (A1: 100% filter muds, A2: 75% filter muds + 25% chemical fertilizers, A3: 50% filter muds + 50% chemical fertilizers, A4: 25% filter muds + 75% chemical fertilizers and A5: 100% chemical fertilizers along with two levels of biological fertilizers application (with and without biological fertilizers were investigated. The biological fertilizers investigated in this study were Nitroxin and Barvar2. Application of filter muds led to decreases in nitrogen, phosphorus and Cd of canola seeds. On the other hand, increase of filter muds application led to increase of Zn, Cu, Fe and Pb content in canola seeds. Biological and chemical fertilizers application resulted in increases of nitrogen, phosphorus and cadmium contents in canola seeds. Biofertilizers also increased phosphorus and cadmium contents in canola seeds.

  1. Analysis of yield and plant traits of oilseed rape (Brassica napus L. cultivated in temperate region in light of the possibilities of sowing in arid areas

    Directory of Open Access Journals (Sweden)

    Tadeusz Zając


    Full Text Available This work is a review of selected literature on the species of Brassica with the greatest economic significance. Oilseed rape (Brassica napus ssp. oleifera currently ranks third worldwide among oilseed crops used for oil production and is the most important in the temperate zone. The manifold uses of rape include not only human consumption of oil, but also the use of post-extraction meal to feed livestock as well as industrial applications as a source of bioenergy or cellulose. The improvement in the economic position of rape among crop plants is also due to the doubling of its yield between 1970 and 2009; the average annual increase in seed yield worldwide was 27 kg ha−1 yr−1. The yield level in Europe exceeds the average yields achieved in the world, particularly in Asia. Recently, the cultivation of oilseed rape was started on a relatively large acreage in Iran where the yield amounted 2.1 t ha−1, exceeding the yields of China and India. In Poland, the acreage of oilseed rape cultivation between 1965 and 2013 increased 3–4 times, and during this period the annual increase in seed yield was 29 kg ha−1 yr−1. Under the field conditions of the temperate climate zone, winter oilseed rape yield is mainly determined by agro-climatic conditions during the growing period, the level of nitrogen fertilization, and the production potential of varieties, which is currently highest in hybrids. There is a noticeable tendency of hybrids towards formation of more siliques by individual oilseed plants. Different production categories of plants appear in a rape crop. Semi-dwarf varieties of winter rapeseed are distinguished by greater silique density, particularly on the main shoot. Moreover, these hybrids are characterized by faster growth of the root system, which enables them to take up nitrogen from the soil more efficiently.

  2. Growth and physiological responses of canola (Brassica napus) to three components of global climate change: temperature, carbon dioxide and drought

    Energy Technology Data Exchange (ETDEWEB)

    Qaderi, M.M.; Kurepin, L.V.; Reid, D.M. [Univ. of Calgary, Dept. of Biological Sciences, Calgary, Alberta (Canada)


    Elevated CO{sub 2} appears to be a significant factor in global warming, which will likely lead to drought conditions in many areas. Few studies have considered the interactive effects of higher CO{sub 2}, temperature and drought on plant growth and physiology. We grew canola (Brassica napus cv. 45H72) plants under lower (22/18 deg. C) and higher (28/24 deg. C) temperature regimes in controlled-environment chambers at ambient (370 {mu}mol mol-1) and elevated (740 {mu}mol mol-1) CO{sub 2} levels. One half of the plants were watered to field capacity and the other half at wilting point. In three separate experiments, we determined growth, various physiological parameters and content of abscisic acid (ABA), indole-3-acetic acid and ethylene. Drought-stressed plants grown under higher temperature at ambient CO{sub 2} had decreased stem height and diameter, leaf number and area, dry matter, leaf area ratio, shoot/root weight ratio, net CO{sub 2} assimilation and chlorophyll fluorescence. However, these plants had increased specific leaf weight, leaf weight ratio and chlorophyll concentration. Elevated CO{sub 2} generally had the opposite effect. and partially reversed the inhibitory effects of higher temperature and drought on leaf dry weight accumulation. This study showed that higher temperature and drought inhibit many processes but elevated CO{sub 2} partially mitigate some adverse effects. As expected, drought stress increased ABA but higher temperature inhibited the ability of plants to produce ABA in response to drought. (au)

  3. Re-exploration of U's Triangle Brassica Species Based on Chloroplast Genomes and 45S nrDNA Sequences. (United States)

    Kim, Chang-Kug; Seol, Young-Joo; Perumal, Sampath; Lee, Jonghoon; Waminal, Nomar Espinosa; Jayakodi, Murukarthick; Lee, Sang-Choon; Jin, Seungwoo; Choi, Beom-Soon; Yu, Yeisoo; Ko, Ho-Cheol; Choi, Ji-Weon; Ryu, Kyoung-Yul; Sohn, Seong-Han; Parkin, Isobel; Yang, Tae-Jin


    The concept of U's triangle, which revealed the importance of polyploidization in plant genome evolution, described natural allopolyploidization events in Brassica using three diploids [B. rapa (A genome), B. nigra (B), and B. oleracea (C)] and derived allotetraploids [B. juncea (AB genome), B. napus (AC), and B. carinata (BC)]. However, comprehensive understanding of Brassica genome evolution has not been fully achieved. Here, we performed low-coverage (2-6×) whole-genome sequencing of 28 accessions of Brassica as well as of Raphanus sativus [R genome] to explore the evolution of six Brassica species based on chloroplast genome and ribosomal DNA variations. Our phylogenomic analyses led to two main conclusions. (1) Intra-species-level chloroplast genome variations are low in the three allotetraploids (2~7 SNPs), but rich and variable in each diploid species (7~193 SNPs). (2) Three allotetraploids maintain two 45SnrDNA types derived from both ancestral species with maternal dominance. Furthermore, this study sheds light on the maternal origin of the AC chloroplast genome. Overall, this study clarifies the genetic relationships of U's triangle species based on a comprehensive genomics approach and provides important genomic resources for correlative and evolutionary studies.

  4. Identification and expression analysis of WRKY transcription factor genes in canola (Brassica napus L. in response to fungal pathogens and hormone treatments

    Directory of Open Access Journals (Sweden)

    Deyholos Michael K


    Full Text Available Abstract Background Members of plant WRKY transcription factor families are widely implicated in defense responses and various other physiological processes. For canola (Brassica napus L., no WRKY genes have been described in detail. Because of the economic importance of this crop, and its evolutionary relationship to Arabidopsis thaliana, we sought to characterize a subset of canola WRKY genes in the context of pathogen and hormone responses. Results In this study, we identified 46 WRKY genes from canola by mining the expressed sequence tag (EST database and cloned cDNA sequences of 38 BnWRKYs. A phylogenetic tree was constructed using the conserved WRKY domain amino acid sequences, which demonstrated that BnWRKYs can be divided into three major groups. We further compared BnWRKYs to the 72 WRKY genes from Arabidopsis and 91 WRKY from rice, and we identified 46 presumptive orthologs of AtWRKY genes. We examined the subcellular localization of four BnWRKY proteins using green fluorescent protein (GFP and we observed the fluorescent green signals in the nucleus only. The responses of 16 selected BnWRKY genes to two fungal pathogens, Sclerotinia sclerotiorum and Alternaria brassicae, were analyzed by quantitative real time-PCR (qRT-PCR. Transcript abundance of 13 BnWRKY genes changed significantly following pathogen challenge: transcripts of 10 WRKYs increased in abundance, two WRKY transcripts decreased after infection, and one decreased at 12 h post-infection but increased later on (72 h. We also observed that transcript abundance of 13/16 BnWRKY genes was responsive to one or more hormones, including abscisic acid (ABA, and cytokinin (6-benzylaminopurine, BAP and the defense signaling molecules jasmonic acid (JA, salicylic acid (SA, and ethylene (ET. We compared these transcript expression patterns to those previously described for presumptive orthologs of these genes in Arabidopsis and rice, and observed both similarities and differences in

  5. Digital gene expression analysis of gene expression differences within Brassica diploids and allopolyploids. (United States)

    Jiang, Jinjin; Wang, Yue; Zhu, Bao; Fang, Tingting; Fang, Yujie; Wang, Youping


    Brassica includes many successfully cultivated crop species of polyploid origin, either by ancestral genome triplication or by hybridization between two diploid progenitors, displaying complex repetitive sequences and transposons. The U's triangle, which consists of three diploids and three amphidiploids, is optimal for the analysis of complicated genomes after polyploidization. Next-generation sequencing enables the transcriptome profiling of polyploids on a global scale. We examined the gene expression patterns of three diploids (Brassica rapa, B. nigra, and B. oleracea) and three amphidiploids (B. napus, B. juncea, and B. carinata) via digital gene expression analysis. In total, the libraries generated between 5.7 and 6.1 million raw reads, and the clean tags of each library were mapped to 18547-21995 genes of B. rapa genome. The unambiguous tag-mapped genes in the libraries were compared. Moreover, the majority of differentially expressed genes (DEGs) were explored among diploids as well as between diploids and amphidiploids. Gene ontological analysis was performed to functionally categorize these DEGs into different classes. The Kyoto Encyclopedia of Genes and Genomes analysis was performed to assign these DEGs into approximately 120 pathways, among which the metabolic pathway, biosynthesis of secondary metabolites, and peroxisomal pathway were enriched. The non-additive genes in Brassica amphidiploids were analyzed, and the results indicated that orthologous genes in polyploids are frequently expressed in a non-additive pattern. Methyltransferase genes showed differential expression pattern in Brassica species. Our results provided an understanding of the transcriptome complexity of natural Brassica species. The gene expression changes in diploids and allopolyploids may help elucidate the morphological and physiological differences among Brassica species.

  6. Ozone affects growth and development of Pieris brassicae on the wild host plant Brassica nigra

    International Nuclear Information System (INIS)

    Khaling, Eliezer; Papazian, Stefano; Poelman, Erik H.; Holopainen, Jarmo K.; Albrectsen, Benedicte R.; Blande, James D.


    When plants are exposed to ozone they exhibit changes in both primary and secondary metabolism, which may affect their interactions with herbivorous insects. Here we investigated the performance and preferences of the specialist herbivore Pieris brassicae on the wild plant Brassica nigra under elevated ozone conditions. The direct and indirect effects of ozone on the plant-herbivore system were studied. In both cases ozone exposure had a negative effect on P. brassicae development. However, in dual-choice tests larvae preferentially consumed plant material previously fumigated with the highest concentration tested, showing a lack of correlation between larval preference and performance on ozone exposed plants. Metabolomic analysis of leaf material subjected to combinations of ozone and herbivore-feeding, and focussing on known defence metabolites, indicated that P. brassicae behaviour and performance were associated with ozone-induced alterations to glucosinolate and phenolic pools. - Highlights: • We examined the effects of ozone on Pieris brassicae performance and preference. • We studied ozone and herbivore induced changes in the metabolome of Brassica nigra. • The performance of P. brassicae did not correlate with preference of ozonated plants. • Ozone and herbivore-feeding stress changes the phytochemical pools of B. nigra. - Ozone indirectly reduces herbivore performance, which is associated with change in phytochemical pools, but does not correlate with host plant preference

  7. The effect of exposure to enhanced UV-B radiation on the penetration of monochromatic and polychromatic UV-B radiation in leaves of Brassica napus

    International Nuclear Information System (INIS)

    Cen, Y.-P.; Bornman, J.F.


    Using quartz optical fibres, penetration of both monochromatic (310 nm) and polychromatic UV-B (280–320 nm) radiation in leaves of Brassica napus L. (cv. Ceres) was measured. Plants were grown under either visible light (750 μmol m −2 s −1 photosynthetically active radiation) or with the addition of 8. 9 KJ m −2 day −1 biologically effective UV-B (UV-B BE ) radiation. Results showed that of the 310 nm radiation that penetreated the leaf, 90% was within the intial one third of the leaf with high attenuation in the leaf epidermis, especially in UV-treated plants. Polychromatic UV-B radiation, relative to incident radiation, showed a relatively uniform spectral distribution within the leaf, except for collimated radiation. Over 30% of the UV-screening pigments in the leaf, including flavonoids, were found in the adaxial epidermal layer, making this layer less transparent to UV-B radiation than the abaxial epidermis, which contained less than 12% of the UV-screening pigments. UV-screening pigments increased by 20% in UV-treated leaves relative to control leaves. Densely arranged epicuticular wax on the adaxial leaf surface of UV-treated plants may have further decreased penetration of UV-B radiation by reflectance. An increased leaf thickness, and decreases in leaf area and leaf dry weight were also found for UV-treated plants. (author)

  8. Oilseed brassica improvement: through induced mutations

    International Nuclear Information System (INIS)

    Shah, S.A.; Ali, I.; Rehman, K.


    The oilseed brassica improvement programme is discussed in this report. Some observations on different plant mutants were made throughout the growth period and results revealed that most of the selected mutants of both the varieties expressed better performance than the parent by showing superior plant traits. A new species named brassica carinata has tremendous untapped potential as an oilseed crop. Efforts for creating maximum variability in rapeseed mustard varieties by means other than gamma radiation continued. (A.B.)

  9. Responses of the cabbage seedpod weevil, Ceutorhynchus obstrictus (Marsham) (Coleoptera: Curculionidae), to seed treatments of canola (Brassica napus L.) with the neonicotinoid compounds clothianidin and imidacloprid. (United States)

    Dosdall, Lloyd M


    The cabbage seedpod weevil, Ceutorhynchus obstrictus (Marsham), is a major pest in the production of canola (Brassica napus L.) in North America and Europe, and effective population control is often essential for economical crop production. In North America, neonicotinoid insecticides have been used for several years in canola as seed treatments for reducing herbivory by flea beetles. The neonicotinoids clothianidin and imidacloprid were investigated to determine their effects on preimaginal development and on emergence of new-generation adults of C. obstrictus in comparison with effects of lindane, a chlorinated hydrocarbon seed treatment. Mean numbers of second- and third-instar larvae were significantly higher in plants seed-treated with lindane than in plants treated with the neonicotinoid compounds, even though weevil oviposition was similar for all treatments. Emergence of new-generation adults was reduced by 52 and 39% for plants seed-treated with clothianidin and imidacloprid, respectively, compared with emergence from plants treated with lindane. Seed treatment with both clothianidin and imidacloprid produced systemic insecticidal effects on larvae of C. obstrictus, with clothianidin slightly more effective than imidacloprid. Use of clothianidin or imidacloprid as seed treatments can comprise an important component in the integrated management of cabbage seedpod weevil in canola. (c) 2009 Society of Chemical Industry.

  10. Brassica cover crops for nitrogen retention in the Mid-Atlantic coastal plain. (United States)

    Dean, Jill E; Weil, Ray R


    Brassica cover crops are new to the mid-Atlantic region, and limited information is available on their N uptake capabilities for effective N conservation. Forage radish (Raphanus sativus L. cv. Daikon), oilseed radish (Raphanus sativus L. cv. Adagio), and rape (Brassica napus L. cv. Dwarf Essex) were compared with rye (Secale cereale L. cv. Wheeler), a popular cover crop in the region, with regard to N uptake ability and potential to decrease N leaching at two sites in Maryland. Plants were harvested in fall and spring for dry matter and N analysis. Soil samples from 0 cm to 105 to 180 cm depth were obtained in fall and spring for NH(4)-N and NO(3)-N analyses. Ceramic cup tension lysimeters were installed at depths of 75 to 120 cm to monitor NO(3)-N in soil pore water. Averaged across 3 site-years, forage radish and rape shoots had greater dry matter production and captured more N in fall than rye shoots. Compared with a weedy fallow control, rape and rye caused similar decreases in soil NO(3)-N in fall and spring throughout the sampled profile. Cover crops had no effect on soil NH(4)-N. During the spring on coarse textured soil, pore water NO(3)-N concentrations in freeze-killed Brassica (radish) plots were greater than in control and overwintering Brassica (rape) and rye plots. On fine textured soil, all cover crops provided a similar decrease in pore water NO(3)-N concentration compared with control. On coarse textured soils, freeze-killed Brassica cover crops should be followed by an early-planted spring main crop.

  11. Determination of Flowering Phenology, Number of Flowers, Nectar and Pollen Potential of Oil Rape (Brassica napus L., Plant in Black Sea Coastal Region

    Directory of Open Access Journals (Sweden)

    Necda Çankaya


    Full Text Available This research was carried out in 2011 and 2012 in order to determine the flowering phenology, number of flowers, nectar and pollen potential in the Samsun province of the oilseed rape (Brassica napus L., which is widely used in agriculture in our country. In the first year of the study (2011, it was determined that the rapeseed plant was in flower for 44 days, there were 2.694 flowers per plant, 1.89 kg/da nectar per day and 1330 kg/da pollen production. In the second year of the research (2012, it was revealed that the rapeseed plant was in flower for 39 days, there were 701 plants/flower in the plant, 0.38 kg/da nectar secreted daily and 331.57 kg/da pollen. According to the results of two years, the yield of rapeseed was found to be 41.5 days, the daily nectar production was 0.23 mg/flower/day, the nectar dry matter level was 20.25% and the pollen production was 0.48 mg/flower/day. In Samsun province, it was determined that rapeseed plants flowered before the flowering of many plants in the vicinity in the early spring, and provided honey bees, Apis mellifera L., and many other honey bees, nectar and pollen. It has been demonstrated that the cultivation of rapeseed is cultivated in the early spring, and it can be a convenient source of food for honey bees and other dusty insects.

  12. Enhancing freezing tolerance of Brassica napus L. by overexpression of a stearoyl-acyl carrier protein desaturase gene (SAD) from Sapium sebiferum (L.) Roxb. (United States)

    Peng, Dan; Zhou, Bo; Jiang, Yueqiao; Tan, XiaoFeng; Yuan, DeYi; Zhang, Lin


    Sapium sebiferum (L.) Roxb. is an important woody oil tree and traditional herbal medicine in China. Stearoyl-acyl carrier protein desaturase (SAD) is a dehydrogenase enzyme that plays a key role in the transformation of saturated fatty acids into unsaturated fatty acids in oil; these fatty acids greatly influence the freezing tolerance of plants. However, it remains unclear whether freezing tolerance can be regulated by the expression level of SsSAD in S. sebiferum L. Our research indicated that SsSAD expression in S. sebiferum L. increased under freezing stress. To further confirm this result, we constructed a pEGAD-SsSAD vector and transformed it into B. napus L. W10 by Agrobacterium tumefaciens-mediated transformation. Transgenic plants that overexpressed the SsSAD gene exhibited significantly higher linoleic (18:2) and linolenic acid (18:3) content and advanced freezing tolerance. These results suggest that SsSAD overexpression in B. napus L. can increase the content of polyunsaturated fatty acids (PUFAs) such as linoleic (18:2) and linolenic acid (18:3), which are likely pivotal in improving freezing tolerance in B. napus L. plants. Thus, SsSAD overexpression could be useful in the production of freeze-tolerant varieties of B. napus L. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Regulatory network of secondary metabolism in Brassica rapa: insight into the glucosinolate pathway.

    Directory of Open Access Journals (Sweden)

    Dunia Pino Del Carpio

    Full Text Available Brassica rapa studies towards metabolic variation have largely been focused on the profiling of the diversity of metabolic compounds in specific crop types or regional varieties, but none aimed to identify genes with regulatory function in metabolite composition. Here we followed a genetical genomics approach to identify regulatory genes for six biosynthetic pathways of health-related phytochemicals, i.e carotenoids, tocopherols, folates, glucosinolates, flavonoids and phenylpropanoids. Leaves from six weeks-old plants of a Brassica rapa doubled haploid population, consisting of 92 genotypes, were profiled for their secondary metabolite composition, using both targeted and LC-MS-based untargeted metabolomics approaches. Furthermore, the same population was profiled for transcript variation using a microarray containing EST sequences mainly derived from three Brassica species: B. napus, B. rapa and B. oleracea. The biochemical pathway analysis was based on the network analyses of both metabolite QTLs (mQTLs and transcript QTLs (eQTLs. Co-localization of mQTLs and eQTLs lead to the identification of candidate regulatory genes involved in the biosynthesis of carotenoids, tocopherols and glucosinolates. We subsequently focused on the well-characterized glucosinolate pathway and revealed two hotspots of co-localization of eQTLs with mQTLs in linkage groups A03 and A09. Our results indicate that such a large-scale genetical genomics approach combining transcriptomics and metabolomics data can provide new insights into the genetic regulation of metabolite composition of Brassica vegetables.

  14. Bioinformatics analysis of the ς-carotene desaturase gene in cabbage (Brassica oleracea var. capitata) (United States)

    Sun, Bo; Zheng, Aihong; Jiang, Min; Xue, Shengling; Zhang, Fen; Tang, Haoru


    ς-carotene desaturase (ZDS) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata ZDS (BocZDS) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocZDS gene mapped to Scaffold000363, and contains an open reading frame of 1,686 bp that encodes a 561-amino acid protein with a calculated molecular mass of 62.00 kD and an isoelectric point (pI) of 8.2. Subcellular localization predicted the BocZDS gene was in the chloroplast. The conserved domain of the BocZDS protein is PLN02487, indicating that it belongs the member of zeta-carotene desaturase. Homology analysis indicates that the ZDS protein is apparently conserved during plant evolution and is most closely related to B. oleracea var. oleracea, B. napus, and B. rapa. The findings of the present study provide a molecular basis for the elucidation of ZDS gene function in cabbage.

  15. Genetic diversity analysis of brassica napus/brassica campestris progenies using microsatellite markers

    International Nuclear Information System (INIS)

    Fayyaz, L.; Farhatullah, A.; Iqbal, S.; Kanwal, M.; Nawaz, I.


    Genetic diversity and relationship of F2 segregating progenies of interspecific crosses between B. napus N-501/B. campestris C-118 were studied. A set of 90 genotypes (2 parental lines and their 88 F2 progenies) was characterized separately using 24 microsatellite or SSR markers to cover the diversity as broadly as possibly present in them. In initial screening only 12 out of 24 SSR primers combination amplified DNA fragments, while the remaining 12 SSR primers did not amplify DNA fragment therefore those 12 SSR molecular markers were not used for further analysis. The 12 SSR primer combinations generated a total of 33 alleles, of that 32 were polymorphic loci, whereas only one was monomorphic locus. Primers BRMS-19 and BRMS-40 were highly polymorphic producing 4 bands each. Primer Ra2-D04 was less polymorphic and it produced only one band. The proportion of polymorphic loci was 95.83% which indicates high genetic diversity among the progenies. The average number of polymorphic alleles per locus was 2.66. The PIC values ranged from 0.395 for primer Ra2-E03 to 0.726 for primer BRMS-019 with an average genetic diversity (PIC value) of 0.584 per locus. Seven primers showed PIC values above 0.5 (50%) indicating high genetic diversity in the studied plant materials. Pair-wise similarity indices among 90 genotypes ranged from 0.3 to 0.95. Dendrogram obtained through UPGMA clustering of F2 progenies depicted eight main groups using similarity coefficient of 0.70. The progenies could be similar to their parents if they have the same banding patterns as that of the parents and could be distinguished from each other by the combination of fragments which are repeatedly present in one progeny and absent in the other. Considerable genetic diversity has been found among the F2 segregating progenies and their parents using SSR markers thus, SSR analysis proved to be a useful tool. (author)

  16. Investigation of growth indices and yield of canola (Brassica napus L. in competition with wild mustard (Sinapis arvensis L. as influenced by different amount of nitrogen application

    Directory of Open Access Journals (Sweden)

    F. Soleymani


    Full Text Available To evaluate the effect of different levels of nitrogen fertilizer on growth indices and competitive ability of canola (Brassica napus L. against wild mustard (Sinapis arvensis L., a split plot trial based on a randomized complete block design with three replications, was carried out at Agricultural Faculty of Bu-Ali Sina University, during 2008-2009. Experimental factors were amounts of nitrogen fertilizer of urea at four levels (100, 150, 200 and 250 kgN.ha-1 and five wild mustard plant densities (0, 4, 8, 16 and 32 plants.m-2. The results showed that wild mustard interference led to reduction of leaf area index (LAI, dry matter accumulation, crop growth rate (CGR, leaf area index duration (LAID, dry matter duration (BMD and seed yield of canola, while these characteristics were increased with more nitrogen fertilizer application. The maximum indices were obtained at 250 kg N.ha-1 and weed-free condition, but generally, the least reduction in maximum LAI, CGR, LAID and BMD of canola affected by wild mustard competition occurred at 200 kg N.ha-1. In conclusion, the results showed that optimum level of fertilizer 200 kg N.ha-1, increased competitive ability of canola against wild mustard and improved yield and growth indices.

  17. QTL for phytosterol and sinapate ester content in Brassica napus L. collocate with the two erucic acid genes (United States)

    Amar, Samija; Ecke, Wolfgang; Becker, Heiko C.


    Improving oil and protein quality for food and feed purposes is an important goal in rapeseed (Brassica napus L.) breeding programs. Rapeseed contains phytosterols, used to enrich food products, and sinapate esters, which are limiting the utilization of rapeseed proteins in the feed industry. Increasing the phytosterol content of oil and lowering sinapate ester content of meal could increase the value of the oilseed rape crop. The objective of the present study was to identify quantitative trait loci (QTL) for phytosterol and sinapate ester content in a winter rapeseed population of 148 doubled haploid lines, previously found to have a large variation for these two traits. This population also segregated for the two erucic acid genes. A close negative correlation was found between erucic acid and phytosterol content (Spearman’s rank correlation, rs = −0.80**). For total phytosterol content, three QTL were detected, explaining 60% of the genetic variance. The two QTL with the strongest additive effects were mapped on linkage groups N8 and N13 within the confidence intervals of the two erucic acid genes. For sinapate ester content four QTL were detected, explaining 53% of the genetic variance. Again, a close negative correlation was found between erucic acid and sinapate ester content (rs = −0.66**) and the QTL with the strongest additive effects mapped on linkage groups N8 and N13 within the confidence intervals of the two erucic acid genes. The results suggests, that there is a pleiotropic effect of the two erucic acid genes on phytosterol and sinapate ester content; the effect of the alleles for low erucic acid content is to increase phytosterol and sinapate ester content. Possible reasons for this are discussed based on known biosynthetic pathways. Electronic supplementary material The online version of this article (doi:10.1007/s00122-008-0734-2) contains supplementary material, which is available to authorized users. PMID:18335203

  18. Low level impurities in imported wheat are a likely source of feral transgenic oilseed rape (Brassica napus L.) in Switzerland. (United States)

    Schulze, Juerg; Brodmann, Peter; Oehen, Bernadette; Bagutti, Claudia


    In Switzerland, the cultivation of genetically modified (GM) oilseed rape (Brassica napus L.) and the use of its seeds for food and feed are not permitted. Nevertheless, the GM oilseed rape events GT73, MS8×RF3, MS8 and RF3 have recently been found in the Rhine port of Basel, Switzerland. The sources of GM oilseed rape seeds have been unknown. The main agricultural good being imported at the Rhine port of Basel is wheat and from 2010 to 2013, 19% of all Swiss wheat imports originated from Canada. As over 90% of all oilseed rape grown in Canada is GM, we hypothesised that imports of Canadian wheat may contain low level impurities of GM oilseed rape. Therefore, waste fraction samples gathered during the mechanical cleaning of Canadian wheat from two Swiss grain mills were analysed by separating oilseed rape seeds from waste fraction samples and testing DNA of pooled seeds for the presence of transgenes by real-time PCR. Furthermore, oilseed rape seeds from each grain mill were sown in a germination experiment, and seedling DNA was tested for the presence of transgenes by real-time PCR. GT73, MS8×RF3, MS8 and RF3 oilseed rape was detected among seed samples and seedlings of both grain mills. Based on this data, we projected a mean proportion of 0.005% of oilseed rape in wheat imported from Canada. Besides Canadian wheat, the Rhine port of Basel does not import any other significant amounts of agricultural products from GM oilseed rape producing countries. We therefore conclude that Canadian wheat is the major source of unintended introduction of GM oilseed rape seeds into Switzerland.

  19. Broadening the genetic base of Abyssinian mustard (Brassica carinata A. Braun through introgression of genes from related allotetraploid species

    Directory of Open Access Journals (Sweden)

    Farooq A. Sheikh


    Full Text Available Brassica carinata (BBCC, 2n=34 has still to emerge as a major oilseed crop owing to poor agronomic attributes like long stature, long maturity duration and low seed yield. The restricted amount of genetic variability available in natural B. carinata necessitates utilization of new sources of variability for broadening its genetic base. Interspecific hybridization followed by selection in selfed and back cross progenies was employed to generate useful variability into B. carinata cv ˈPC5ˈ from elite lines of Brassica napus (AACC, 2n=38 and Brassica juncea (AABB, 2n=36. The morphological evaluation of 24 stable introgressed progenies revealed wide range of variability for key economic traits. The progenies with mean maturity duration of 161 ± 2.1 days, short stature of 139.5 ± 6.5 cm and seed yield per plant of 18.6 ± 2.0 g in comparison to the corresponding figures of 168 ± 4.6 days, 230.6 ± 12.7 cm and 12.0 ± 2.4 g in ˈPC5ˈ (recurrent parent were recovered. Diversity analysis at morphological level revealed that 22 out of 24 stable introgressed progenies were grouped with B. carinata ˈPC5ˈ at average taxonomic distance of 1.19. The diversity at molecular level using 25 polymorphic and reproducible RAPD primers revealed that 19 out of 21 introgressed progenies grouped with B. carinata ˈPC5ˈ at a similarity coefficient of 0.68. The clusters in general represent a wide range of genetic diversity in the back cross lines of B. carinata as a result of introgression of genes from elite lines of B. napus and B. juncea parents.

  20. A comparison of two stomatal conductance models for ozone flux modelling using data from two Brassica species

    International Nuclear Information System (INIS)

    Op de Beeck, M.; De Bock, M.; Vandermeiren, K.; Temmerman, L. de; Ceulemans, R.


    In this study we tested and compared a multiplicative stomatal model and a coupled semi-empirical stomatal-photosynthesis model in their ability to predict stomatal conductance to ozone (g st ) using leaf-level data from oilseed rape (Brassica napus L.) and broccoli (Brassica oleracea L. var. italica Plenck). For oilseed rape, the multiplicative model and the coupled model were able to explain 72% and 73% of the observed g st variance, respectively. For broccoli, the models were able to explain 53% and 51% of the observed g st variance, respectively. These results support the coupled semi-empirical stomatal-photosynthesis model as a valid alternative to the multiplicative stomatal model for O 3 flux modelling, in terms of predictive performance. - A multiplicative stomatal model and a coupled semi-empirical stomatal-photosynthesis model performed equally well when tested against leaf-level data for oilseed rape and broccoli.

  1. The fate of chromosomes and alleles in an allohexaploid Brassica population. (United States)

    Mason, Annaliese S; Nelson, Matthew N; Takahira, Junko; Cowling, Wallace A; Alves, Gustavo Moreira; Chaudhuri, Arkaprava; Chen, Ning; Ragu, Mohana E; Dalton-Morgan, Jessica; Coriton, Olivier; Huteau, Virginie; Eber, Frédérique; Chèvre, Anne-Marie; Batley, Jacqueline


    Production of allohexaploid Brassica (2n = AABBCC) is a promising goal for plant breeders due to the potential for hybrid heterosis and useful allelic contributions from all three of the Brassica genomes present in the cultivated diploid (2n = AA, 2n = BB, 2n = CC) and allotetraploid (2n = AABB, 2n = AACC, and 2n = BBCC) crop species (canola, cabbages, mustards). We used high-throughput SNP molecular marker assays, flow cytometry, and fluorescent in situ hybridization (FISH) to characterize a population of putative allohexaploids derived from self-pollination of a hybrid from the novel cross (B. napus × B. carinata) × B. juncea to investigate whether fertile, stable allohexaploid Brassica can be produced. Allelic segregation in the A and C genomes generally followed Mendelian expectations for an F2 population, with minimal nonhomologous chromosome pairing. However, we detected no strong selection for complete 2n = AABBCC chromosome complements, with weak correlations between DNA content and fertility (r(2) = 0.11) and no correlation between missing chromosomes or chromosome segments and fertility. Investigation of next-generation progeny resulting from one highly fertile F2 plant using FISH revealed general maintenance of high chromosome numbers but severe distortions in karyotype, as evidenced by recombinant chromosomes and putative loss/duplication of A- and C-genome chromosome pairs. Our results show promise for the development of meiotically stable allohexaploid lines, but highlight the necessity of selection for 2n = AABBCC karyotypes.

  2. Conjugated linoleic acid content in milk of Chilean Black Friesian cows under pasture conditions and supplemented with canola seed (Brassica napus concentrate

    Directory of Open Access Journals (Sweden)

    J. P. Avilez Ruiz


    Full Text Available At present, there is limited and contradictory information about the effects of the use of canola (Brassica napus seed as supplement on the contents of conjugated linoleic acid (CLA in milk of grazing cows. The objective of this study was to evaluate the effect of a dietary supplement with canola seed on the production and composition of milk, and CLA concentration in Chilean Black Friesian cows under pasture conditions. Three experiments were done. Experiment 1: control group was fed 5 kg d-1 of commercial concentrate without canola (0-TC1 and treatment group that was fed 3.75 kg of commercial concentrate plus 1.16 kg of whole canola seed (1.16-TC1. Experiment 2: Control group was fed 8 kg d-1 commercial concentrate without canola (0-TC2 and treatment group that was fed 6.2 kg of commercial concentrate plus 1.2 kg of ground canola seed (1.2-TC2. Experiment 3: control group was fed 6 kg d-1 commercial concentrate without canola (0-TC3 and treatment group was fed 6 kg of commercial concentrate with 20% of whole canola seed (1.2 kg d-1, 1.2-TC3. The duration of each experiment was 60 days. No differences in milk production and quality were observed among the experimental groups in every assay. The CLA isomers trans-10, cis-12 and cis-10, cis-12 were higher than those normally found in the scientific literature. There was no effect of the inclusion of canola seed on total CLA content or the content of cis-9, trans-11, trans-10, cis-12 and cis-10, cis-12 isomers.

  3. Herbivore-Induced DNA Demethylation Changes Floral Signalling and Attractiveness to Pollinators in Brassica rapa.

    Directory of Open Access Journals (Sweden)

    Roman T Kellenberger

    Full Text Available Plants have to fine-tune their signals to optimise the trade-off between herbivore deterrence and pollinator attraction. An important mechanism in mediating plant-insect interactions is the regulation of gene expression via DNA methylation. However, the effect of herbivore-induced DNA methylation changes on pollinator-relevant plant signalling has not been systematically investigated. Here, we assessed the impact of foliar herbivory on DNA methylation and floral traits in the model crop plant Brassica rapa. Methylation-sensitive amplified fragment length polymorphism (MSAP analysis showed that leaf damage by the caterpillar Pieris brassicae was associated with genome-wide methylation changes in both leaves and flowers of B. rapa as well as a downturn in flower number, morphology and scent. A comparison to plants with jasmonic acid-induced defence showed similar demethylation patterns in leaves, but both the floral methylome and phenotype differed significantly from P. brassicae infested plants. Standardised genome-wide demethylation with 5-azacytidine in five different B. rapa full-sib groups further resulted in a genotype-specific downturn of floral morphology and scent, which significantly reduced the attractiveness of the plants to the pollinator bee Bombus terrestris. These results suggest that DNA methylation plays an important role in adjusting plant signalling in response to changing insect communities.

  4. Effects of salt stress on phosphorus uptake by european rape sheiaralle

    International Nuclear Information System (INIS)

    Li Guihua; Zhang Jianfeng; Wei Dongpu; Yang Juncheng; Mei Yong


    The effects of different salinity on phosphorus uptake by European rape Sheiaralle were studied under hydroponics and sand culture conditions. The results showed that above ground uptake of instant P increased with the salinity increased, the uptake of 32 P by roots firstly decreased and then increased with the increase salinity. Instant P uptake by Brassica napus was lower under different salinity treatment than in non-saline condition (P - , but the biomass yield decreased much faster than P uptake, so P relatively condensed, and uptake of P by Brassica napus increased as the salinity (including non-saline treatment) was increased (P<0.05). Fresh weight of Brassica napus decreased significantly with the salinity increased (P<0.05). (authors)

  5. Comparison of sugars, iridoid glycosides and amino acids in nectar and phloem sap of Maurandya barclayana, Lophospermum erubescens, and Brassica napus. (United States)

    Lohaus, Gertrud; Schwerdtfeger, Michael


    Floral nectar contains sugars and amino acids to attract pollinators. In addition, nectar also contains different secondary compounds, but little is understood about their origin or function. Does nectar composition reflect phloem composition, or is nectar synthesized and/or modified in nectaries? Studies where both, the nectar as well as the phloem sap taken from the same plant species were analyzed in parallel are rare. Therefore, phloem sap and nectar from different plant species (Maurandya barclayana, Lophospermum erubescens, and Brassica napus) were compared. Nectar was collected with microcapillary tubes and phloem sap with the laser-aphid-stylet technique. The nectar of all three plant species contained high amounts of sugars with different percentages of glucose, fructose, and sucrose, whereas phloem sap sugars consisted almost exclusively of sucrose. One possible reason for this could be the activity of invertases in the nectaries. The total concentration of amino acids was much lower in nectars than in phloem sap, indicating selective retention of nitrogenous solutes during nectar formation. Nectar amino acid concentrations were negatively correlated with the nectar volumes per flower of the different plant species. Both members of the tribe Antirrhineae (Plantaginaceae) M. barclayana and L. erubescens synthesized the iridoid glycoside antirrhinoside. High amounts of antirrhinoside were found in the phloem sap and lower amounts in the nectar of both plant species. The parallel analyses of nectar and phloem sap have shown that all metabolites which were found in nectar were also detectable in phloem sap with the exception of hexoses. Otherwise, the composition of both aqueous solutions was not the same. The concentration of several metabolites was lower in nectar than in phloem sap indicating selective retention of some metabolites. Furthermore, the existence of antirrhinoside in nectar could be based on passive secretion from the phloem.

  6. Genome-Wide Gene Expression Disturbance by Single A1/C1 Chromosome Substitution in Brassica rapa Restituted From Natural B. napus

    Directory of Open Access Journals (Sweden)

    Bin Zhu


    Full Text Available Alien chromosome substitution (CS lines are treated as vital germplasms for breeding and genetic mapping. Previously, a whole set of nine Brassica rapa-oleracea monosonic alien addition lines (MAALs, C1-C9 was established in the background of natural B. napus genotype “Oro,” after the restituted B. rapa (RBR for Oro was realized. Herein, a monosomic substitution line with one alien C1 chromosome (Cs1 in the RBR complement was selected in the progenies of MAAL C1 and RBR, by the PCR amplification of specific gene markers and fluorescence in situ hybridization. Cs1 exhibited the whole plant morphology similar to RBR except for the defective stamens without fertile pollen grains, but it produced some seeds and progeny plants carrying the C1 chromosome at high rate besides those without the alien chromosome after pollinated by RBR. The viability of the substitution and its progeny for the RBR diploid further elucidated the functional compensation between the chromosome pairs with high homoeology. To reveal the impact of such aneuploidy on genome-wide gene expression, the transcriptomes of MAAL C1, Cs1 and euploid RBR were analyzed. Compared to RBR, Cs1 had sharply reduced gene expression level across chromosome A1, demonstrating the loss of one copy of A1 chromosome. Both additional chromosome C1 in MAAL and substitutional chromosome C1 in Cs1 caused not only cis-effect but also prevalent trans-effect differentially expressed genes. A dominant gene dosage effects prevailed among low expressed genes across chromosome A1 in Cs1, and moreover, dosage effects for some genes potentially contributed to the phenotype deviations. Our results provided novel insights into the transcriptomic perturbation and gene dosage effects on phenotype in CS related to one naturally evolved allopolyploid.

  7. Comparison of sugars, iridoid glycosides and amino acids in nectar and phloem sap of Maurandya barclayana, Lophospermum erubescens, and Brassica napus.

    Directory of Open Access Journals (Sweden)

    Gertrud Lohaus

    Full Text Available BACKGROUND: Floral nectar contains sugars and amino acids to attract pollinators. In addition, nectar also contains different secondary compounds, but little is understood about their origin or function. Does nectar composition reflect phloem composition, or is nectar synthesized and/or modified in nectaries? Studies where both, the nectar as well as the phloem sap taken from the same plant species were analyzed in parallel are rare. Therefore, phloem sap and nectar from different plant species (Maurandya barclayana, Lophospermum erubescens, and Brassica napus were compared. METHODOLOGY AND PRINCIPAL FINDINGS: Nectar was collected with microcapillary tubes and phloem sap with the laser-aphid-stylet technique. The nectar of all three plant species contained high amounts of sugars with different percentages of glucose, fructose, and sucrose, whereas phloem sap sugars consisted almost exclusively of sucrose. One possible reason for this could be the activity of invertases in the nectaries. The total concentration of amino acids was much lower in nectars than in phloem sap, indicating selective retention of nitrogenous solutes during nectar formation. Nectar amino acid concentrations were negatively correlated with the nectar volumes per flower of the different plant species. Both members of the tribe Antirrhineae (Plantaginaceae M. barclayana and L. erubescens synthesized the iridoid glycoside antirrhinoside. High amounts of antirrhinoside were found in the phloem sap and lower amounts in the nectar of both plant species. CONCLUSIONS/SIGNIFICANCE: The parallel analyses of nectar and phloem sap have shown that all metabolites which were found in nectar were also detectable in phloem sap with the exception of hexoses. Otherwise, the composition of both aqueous solutions was not the same. The concentration of several metabolites was lower in nectar than in phloem sap indicating selective retention of some metabolites. Furthermore, the existence of

  8. Unexpected diversity of feral genetically modified oilseed rape (Brassica napus L. despite a cultivation and import ban in Switzerland.

    Directory of Open Access Journals (Sweden)

    Juerg Schulze

    Full Text Available Despite cultivation and seed import bans of genetically modified (GM oilseed rape (Brassica napus L., feral GM plants were found growing along railway lines and in port areas at four sites in Switzerland in 2011 and 2012. All GM plants were identified as glyphosate-resistant GM event GT73 (Roundup Ready, Monsanto. The most affected sites were the Rhine port of Basel and the St. Johann freight railway station in Basel. To assess the distribution and intra- and interspecific outcrossing of GM oilseed rape in more detail, we monitored these two sites in 2013. Leaves and seed pods of feral oilseed rape plants, their possible hybridization partners and putative hybrid plants were sampled in monthly intervals and analysed for the presence of transgenes by real-time PCR. Using flow cytometry, we measured DNA contents of cell nuclei to confirm putative hybrids. In total, 2787 plants were sampled. The presence of GT73 oilseed rape could be confirmed at all previously documented sampling locations and was additionally detected at one new sampling location within the Rhine port. Furthermore, we found the glufosinate-resistant GM events MS8xRF3, MS8 and RF3 (all traded as InVigor, Bayer at five sampling locations in the Rhine port. To our knowledge, this is the first time that feral MS8xRF3, MS8 or RF3 plants were detected in Europe. Real-time PCR analyses of seeds showed outcrossing of GT73 into two non-GM oilseed rape plants, but no outcrossing of transgenes into related wild species was observed. We found no hybrids between oilseed rape and related species. GM plants most frequently occurred at unloading sites for ships, indicating that ship cargo traffic is the main entry pathway for GM oilseed rape. In the future, it will be of major interest to determine the source of GM oilseed rape seeds.

  9. Unexpected diversity of feral genetically modified oilseed rape (Brassica napus L.) despite a cultivation and import ban in Switzerland. (United States)

    Schulze, Juerg; Frauenknecht, Tina; Brodmann, Peter; Bagutti, Claudia


    Despite cultivation and seed import bans of genetically modified (GM) oilseed rape (Brassica napus L.), feral GM plants were found growing along railway lines and in port areas at four sites in Switzerland in 2011 and 2012. All GM plants were identified as glyphosate-resistant GM event GT73 (Roundup Ready, Monsanto). The most affected sites were the Rhine port of Basel and the St. Johann freight railway station in Basel. To assess the distribution and intra- and interspecific outcrossing of GM oilseed rape in more detail, we monitored these two sites in 2013. Leaves and seed pods of feral oilseed rape plants, their possible hybridization partners and putative hybrid plants were sampled in monthly intervals and analysed for the presence of transgenes by real-time PCR. Using flow cytometry, we measured DNA contents of cell nuclei to confirm putative hybrids. In total, 2787 plants were sampled. The presence of GT73 oilseed rape could be confirmed at all previously documented sampling locations and was additionally detected at one new sampling location within the Rhine port. Furthermore, we found the glufosinate-resistant GM events MS8xRF3, MS8 and RF3 (all traded as InVigor, Bayer) at five sampling locations in the Rhine port. To our knowledge, this is the first time that feral MS8xRF3, MS8 or RF3 plants were detected in Europe. Real-time PCR analyses of seeds showed outcrossing of GT73 into two non-GM oilseed rape plants, but no outcrossing of transgenes into related wild species was observed. We found no hybrids between oilseed rape and related species. GM plants most frequently occurred at unloading sites for ships, indicating that ship cargo traffic is the main entry pathway for GM oilseed rape. In the future, it will be of major interest to determine the source of GM oilseed rape seeds.

  10. Ideotype population exploration: growth, photosynthesis, and yield components at different planting densities in winter oilseed rape (Brassica napus L.). (United States)

    Ma, Ni; Yuan, Jinzhan; Li, Ming; Li, Jun; Zhang, Liyan; Liu, Lixin; Naeem, Muhammad Shahbaz; Zhang, Chunlei


    Rapeseed is one of the most important edible oil crops in the world and the seed yield has lagged behind the increasing demand driven by population growth. Winter oilseed rape (Brassica napus L.) is widely cultivated with relatively low yield in China, so it is necessary to find the strategies to improve the expression of yield potential. Planting density has great effects on seed yield of crops. Hence, field experiments were conducted in Wuhan in the Yangtze River basin with one conventional variety (Zhongshuang 11, ZS11) and one hybrid variety (Huayouza 9, HYZ9) at five planting densities (27.0×10(4), 37.5×10(4), 48.0×10(4), 58.5×10(4), 69.0×10(4) plants ha(-1)) during 2010-2012 to investigate the yield components. The physiological traits for high-yield and normal-yield populations were measured during 2011-2013. Our results indicated that planting densities of 58.5×10(4) plants ha(-1) in ZS11 and 48.0×10(4) plants ha(-1) in HYZ9 have significantly higher yield compared with the density of 27.0×10(4) plants ha(-1) for both varieties. The ideal silique numbers for ZS11 and HYZ9 were ∼0.9×10(4) (n m(-2)) and ∼1×10(4) (n m(-2)), respectively, and ideal primary branches for ZS11 and HYZ9 were ∼250 (n m(-2)) and ∼300 (n m(-2)), respectively. The highest leaf area index (LAI) and silique wall area index (SAI) was ∼5.0 and 7.0, respectively. Moreover, higher leaf net photosynthetic rate (Pn) and water use efficiency (WUE) were observed in the high-yield populations. A significantly higher level of silique wall photosynthesis and rapid dry matter accumulation were supposed to result in the maximum seed yield. Our results suggest that increasing the planting density within certain range is a feasible approach for higher seed yield in winter rapeseed in China.

  11. Transcriptome analysis of Brassica juncea var. tumida Tsen responses to Plasmodiophora brassicae primed by the biocontrol strain Zhihengliuella aestuarii. (United States)

    Luo, Yuanli; Dong, Daiwen; Su, Yu; Wang, Xuyi; Peng, Yumei; Peng, Jiang; Zhou, Changyong


    Mustard clubroot, caused by Plasmodiophora brassicae, is a serious disease that affects Brassica juncea var. tumida Tsen, a mustard plant that is the raw material for a traditional fermented food manufactured in Chongqing, China. In our laboratory, we screened the antagonistic bacteria Zhihengliuella aestuarii against P. brassicae. To better understand the biocontrol mechanism, three transcriptome analyses of B. juncea var. tumida Tsen were conducted using Illumina HiSeq 4000, one from B. juncea only inoculated with P. brassicae (P), one inoculated with P. brassica and the biocontrol agent Z. aestuarii at the same time (P + B), and the other was the control (H), in which P. brassicae was replaced by sterile water. A total of 19.94 Gb was generated by Illumina HiSeq sequencing. The sequence data were de novo assembled, and 107,617 unigenes were obtained. In total, 5629 differentially expressed genes between biocontrol-treated (P + B) and infected (P) samples were assigned to 126 KEGG pathways. Using multiple testing corrections, 20 pathways were significantly enriched with Qvalue ≤ 0.05. The resistance-related genes, involved in the production of pathogenesis-related proteins, pathogen-associated molecular pattern-triggered immunity, and effector-triggered immunity signaling pathways, calcium influx, salicylic acid pathway, reactive oxygen intermediates, and mitogen-activated protein kinase cascades, and cell wall modification, were obtained. The various defense responses induced by the biocontrol strain combatted the P. brassicae infection. The genes and pathways involved in plant resistance were induced by a biocontrol strain. The transcriptome data explained the molecular mechanism of the potential biocontrol strain against P. brassicae. The data will also serve as an important public information platform to study B. juncea var. tumida Tsen and will be useful for breeding mustard plants resistant to P. brassicae.

  12. Could nitrile derivatives of turnip (Brassica rapa) glucosinolates be hepato- or cholangiotoxic in cattle? (United States)

    Collett, Mark G; Stegelmeier, Bryan L; Tapper, Brian A


    Turnip (Brassica rapa ssp. rapa) and rape (Brassica napus ssp. biennis) and other brassica forage crops are regarded as "safe" feed for cattle during late summer and fall in the North Island of New Zealand when high Pithomyces chartarum spore counts in pastures frequently lead to sporidesmin toxicity (facial eczema). Sporadic acute severe cases of turnip photosensitization in dairy cows characteristically exhibit high γ-glutamyl transferase and glutamate dehydrogenase serum enzyme activities that mimic those seen in facial eczema. The two diseases can, however, be distinguished by histopathology of the liver, where lesions, in particular those affecting small bile ducts, differ. To date, the hepato-/cholangiotoxic phytochemical causing liver damage in turnip photosensitization in cattle is unknown. Of the hydrolysis products of the various glucosinolate secondary compounds found in high concentrations in turnip and rape, work has shown that nitriles and epithionitriles can be hepatotoxic (and nephro- or pancreatotoxic) in rats. These derivatives include β-hydroxy-thiiranepropanenitrile and 3-hydroxy-4-pentenenitrile from progoitrin; thiiranepropanenitrile and 4-pentenenitrile from gluconapin; thiiranebutanenitrile and 5-hexenenitrile from glucobrassicanapin; phenyl-3-propanenitrile from gluconasturtiin; and indole-3-acetonitrile from glucobrassicin. This perspective explores the possibility of the preferential formation of such derivatives, especially the epithionitriles, in acidic conditions in the bovine rumen, followed by absorption, hepatotoxicity, and secondary photosensitization.

  13. Impact of municipal waste water of Quetta city on biomass, physiology and yield of canola (brassica napus l.)

    International Nuclear Information System (INIS)

    Kakar, S.R.; Tareen, R.B.; Kayani, S.A.; Tariq, M.


    The present study was carried out in order to investigate the impact of municipal wastewater effluents of Quetta city on the biomass, physiology, and productivity of two canola (Brassica napus L.) cultivars viz., Oscar and Rainbow. Plants were grown in pots from seed to maturity during 2005-2006 growth season. Different concentrations of effluents (T1: 20% ,T2: 40%, T3: 60% T4: 80; T5: 100%) were supplied to plants as a soil drench compared to control plants (T0) receiving normal tap water. The wastewater effluents were highly alkaline in nature along with very high Electrical Conductivity, Biological Oxygen Demand; Chemical Oxygen Demand; Sodium Adsorption Ratio, Total Suspended Solids and minerals concentrations have found well above threshold limits set for the usage of municipal wastewater for irrigation purposes. Growth performance of both canola cultivars showed statistically significant effects on some physiological attributes. All treated plants showed reductions in growth and yield parameters, but T5 treated plants were most affected compared to control. There were significantly higher reductions in stomatal conductance (49% in Oscar; 53% in Rainbow), transpiration rate (62% Oscar; 67% in Rainbow), and photosynthetic rate (62% in Oscar; 69% in Rainbow) of T5 treatment plants compared with control. Both pigments of chlorophyll (a and b) responded efficiently to the applied stress of wastewater effluents showing reductions in chlorophyll a and b by 68-82% in cv. Oscar and 74-86% in cv. Rainbow. Similarly, fresh and dry biomass also showed reductions in different effluents treated plants (T1 to T5) ranging from 2-78% in both the cultivars of canola. Drastic reductions were recorded in the number of siliqua per plant (70-72%), seeds per plant (84-85%), seed weight per plant (87-90), and in the harvest index (72-74%) in cultivars Oscar and Rainbow, respectively than that of control. The overall result of the municipal wastewater impacts on canola cultivars are

  14. VALOR NUTRICIO Y CONTENIDO DE SAPONINAS EN GERMINADOS DE HUAUZONTLE (Chenopodium nuttalliae Saff., CALABACITA (Cucurbita pepo L., CANOLA (Brassica napus L. Y AMARANTO (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.

    Directory of Open Access Journals (Sweden)

    M. R. Barrón-Yánez


    (Brassica napus L. y amaranto (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.. Se realizó un análisis proximal y la cuantificación de saponinas en semillas y germinados de las cuatro especies. El contenido de proteína fue más alto en los germinados de canola que en las semillas, pero en huauzontle, calabacita y amaranto no varió. El contenido de lípidos en las semillas de canola, huauzontle y amaranto disminuyó en sus germinados, pero se incrementó en calabacita. El contenido de saponinas en los germinados fue de 2,873.23 en huauzontle, 155.40 en calabacita, 429.81 en canola, y 491.45 mg 100·g-1 de peso seco en amaranto. El contenido de saponinas en semillas fue de 5280.57, 0.00, 35.77 y 42.84 mg 100·g-1 en peso seco, respectivamente. Los niveles del contenido de saponinas en semillas y germinados para las cuatro especies estudiadas no representan toxicidad para humanos. El valor nutricio fue mejor en el germinado de canola que en el de huauzontle, calabaza y amaranto. El sabor de los germinados de huauzontle y amaranto fue mejor que en los de canola y calabacita.

  15. Improvement of large quantity breeding method for making radiation breeding efficient and development of cell culture techniques, (3)

    International Nuclear Information System (INIS)

    Hogetsu, Daisuke; Koyama, Motoko; Minami, Harufumi


    In the creation of useful mutant plants using cell culture techniques, the examination on the effectiveness of selecting useful mutation at cell level and the possibility of raising the selection efficiency by irradiation was aimed at. The experimental method is described. The young plants which accumulate proline were obtained. The cells which showed the resistance to hydroxyproline also showed the resistance to salt. In the improvement of redifferentiation ability by irradiation, the method of fixing IAA in the tissues of azuki plants was examined. The possibility of examining the change of IAA due to irradiation by microautoradiography was obtained. It is intended to examine the distribution of IAA in the formation of adventitious roots from the epicotyl of azuki plants. In the introduction of cell engineering techniques in radiation breeding, it is the objective to introduce the genes which resist sour rot that Brassica campestris, Brassica napus, Brassica oleracea and so on have by utilizing cell fusion process. The fusion of the reproduction cells of Brassica napus pollens and the cell protoplasts of Brassica campestris was successfully carried out. The possibility of new asymmetric fusion in Brassica napus was shown. (K.I.)


    Directory of Open Access Journals (Sweden)



    Full Text Available Oil seed rape (Brassica napus L. cultivars, donors of quality (SC and self-incompatible (SI lines have been analysed using identification of S-locus. In several Brassica napus cultivars one S-locus SLG gene was detected as dominant and the second S-locus as recessive. Amplification class II SLG gene screened recessive gene in all analysed samples (SC and SI. The DNA fragment of recessive gene corresponded to SLG gene W found in cv. Westar. S-haplotypes were analysed by PCR-RFLP. Different Brassica napus cultivars had an identical electrophoretic profile conforming with nonfunctional A10 allele in B. campestris. In B. napus A10 allele is localised in genome A. The functional recessive SLG gene is probably localised in genome C. Model of their segregation was suggested. SC and SI plants segregated in F2 generation at the ratio of approximately 3:1. This indicates a recessive monogenic disposition of SI in the experimental population.

  17. Evaluation of Effect of Gamma Rays Irradiation for Increasing of Variation in Germination and Agronomic Traits in Oilseed rape (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    R. Momeni


    Full Text Available Increasing of genetic diversity is one of primary and basic goals of plant breeding programs. Induction of mutation is a method to increase genetic diversity that can be used in accommodate with selection, recombination and or combination of them in plant breeding. The aim of this study was to investigate the impact of different doses of gamma rays (500, 700, 900, 1100 and 1300 Gry on primary growth characters, such as: rate and percentage of germination, the length of rootlet and stemlet in M1 generation, and on agronomic characters such as: plant height, number of lateral branches, number of pods on main and lateral stem, length of pods and weigth of 1000-seed in M2 generation for two varieties of oilseed rape (Brassica napus, PF and Zarfam. Results of lab experiments showed that for both varieties, the germination percentage, the length of rootlet and the length of stemlet were significantly decreased by mutagen in compare with the control. While germination rate was only significantly affected by mutagen in PF. The estimation of "F" showed that there was significant difference between the variance of treatments for the germination rate and germination percentage in PF cultivar and for germination rate and stemlet length in Zarfam cultivar. In fact, increasing of gamma doses causes considerable enhancement in variance of treatment in compare with the control. The maximum relative coefficient of variation was related to 1300 Gry for germination rate of PF. In M2, all traits of study except number of pods on main stem was decreased by different doses of Gamma rays in PF cultivar. In opposition to other traits, Pods on main stem in PF cultivar was increased in different doses of gamma ray in compare with the control. But in Zarfam cultivar, only 1000-seed weight was significantly affected by Gamma rays.

  18. Effect of elevated atmospheric CO/sub 2/on nitrogen distribution and N utilization efficiency in winter rape (brassica napus L.)

    International Nuclear Information System (INIS)

    Zhang, Z. H.; Lu, S.; Wang, W. M.; Song, H. X.; Lepo, J. E.


    We characterized the responses of plant dry biomass, nitrogen (N) distribution and N-utilization efficiency (NUtE) to changes in CO/sub 2/ concentration through exposure and culture of winter rape under normal-(380 mu mol.mol/sup -1/) and elevated-CO/sub 2/ (760 mu mo mol/sup -1/) conditions. Brassica napus (Xiangyou 15) was used as an agriculturally important model plant. Plants were cultivated in a greenhouse with sand culture under normal- (15 mmol.L/sup -1/) and limited-N (5 mmol.L/sup -1/) conditions. NUtE increased with elevated CO/sub 2/ regardless of whether N was limited. NUtE was higher under N limitation than under normal N conditions for both normal- and elevated-CO/sub 2/ conditions. 15N labeling was used to assess the distribution of N from vegetative- to reproductive-organs.N distribution within the plant and during different developmental stages was affected by CO/sub 2/ concentration and the level of N application. A higher proportion of N was found in siliques at the harvest stage for N-limited plants compared to normal-N plants. The proportion of N absorbed into siliques after the stem elongation stage under elevated-CO/sub 2/ conditions was significantly higher than under normal CO/sub 2/. The proportion of N transport, as well as the total amount of N, absorbed at the stem elongation stage from vegetative organs into siliques under elevated CO/sub 2/ was significantly lower than under normal-CO/sub 2/ conditions. However, the proportion of N absorbed at the stem elongation stage and thus lost from the silique under elevated CO/sub 2/ was significantly higher than under normal CO/sub 2/. In conclusion, limited N or elevated CO/sub 2/ generally benefitted plant NUtE. In addition, after the stem elongation stage, elevated CO/sub 2/ promoted the redistribution of N from plant vegetative tissues to reproductive organs; however, elevated CO/sub 2/ during or before stem elongation had the opposite effect. (author)

  19. Do competitive conditions affect introgression of transgenes from oilseed rape (Brassica napus) to weedy Brassica rapa? AS case study with special reference to transplastomic oilseed rape

    DEFF Research Database (Denmark)

    Johannessen, Marina

    In species where chloroplast inheritance is exclusively or predominantly maternal, pollen-mediated flow of transgenes is reduced if transgenes are inserted in chloroplast DNA instead of nuclear DNA. However, transmission of chloroplast-encoded transgeneswill still occur if transgenic individuals ...... affected the thousand-kernel weight significantly. It was concluded that further introgression of transgenes from transplastomic oilseed rape to B. rapa is mostlikely at current field densities of B. napus and when B. rapa is an abundant weed....

  20. Concentrations of thiocyanate and goitrin in human plasma, their precursor concentrations in brassica vegetables, and associated potential risk for hypothyroidism. (United States)

    Felker, Peter; Bunch, Ronald; Leung, Angela M


    Brassica vegetables are common components of the diet and have beneficial as well as potentially adverse health effects. Following enzymatic breakdown, some glucosinolates in brassica vegetables produce sulforaphane, phenethyl, and indolylic isothiocyanates that possess anticarcinogenic activity. In contrast, progoitrin and indolylic glucosinolates degrade to goitrin and thiocyanate, respectively, and may decrease thyroid hormone production. Radioiodine uptake to the thyroid is inhibited by 194 μmol of goitrin, but not by 77 μmol of goitrin. Collards, Brussels sprouts, and some Russian kale (Brassica napus) contain sufficient goitrin to potentially decrease iodine uptake by the thyroid. However, turnip tops, commercial broccoli, broccoli rabe, and kale belonging to Brassica oleracae contain less than 10 μmol of goitrin per 100-g serving and can be considered of minimal risk. Using sulforaphane plasma levels following glucoraphanin ingestion as a surrogate for thiocyanate plasma concentrations after indole glucosinolate ingestion, the maximum thiocyanate contribution from indole glucosinolate degradation is estimated to be 10 μM, which is significantly lower than background plasma thiocyanate concentrations (40-69 μM). Thiocyanate generated from consumption of indole glucosinolate can be assumed to have minimal adverse risks for thyroid health. © The Author(s) 2016. Published by Oxford University Press on behalf of the International Life Sciences Institute. All rights reserved. For Permissions, please e-mail:

  1. The effect of plant growth-promoting rhizobacteria on the phytoextraction of Cd and Zn by Brassica napus L. (United States)

    Dąbrowska, G; Hrynkiewicz, K; Trejgell, A; Baum, C


    The test strains Bacteroidetes bacterium (Ba), Pseudomonas fluorescens (Pf) and Variovorax sp. (Va) were selected in advance for their in vitro capability for growth promotion of rapeseed in the presence of increased concentrations of Cd, Cu, Pb and Zn in the medium. In the pot experiment, the strains were used for single Ba, Pf, Va or combined Ba + Pf, Ba + Va, Pf + Va, and Ba + Pf + Va inoculation of B. napus growing in contaminated soil from alluvial deposits. The positive effect of bacterial strains on plant growth was observed in vitro, but was not confirmed in situ in the contaminated soil, where the tested strains inhibited biomass production, rather than stimulating it. However, single inoculation with Ba significantly increased the chlorophyll content and K + concentration in the leaves. The inoculation of rapeseed with Ba and Va strains was indicated to be the most promising combination for phytoextraction of Cd and Zn from contaminated soil. Combined inoculation with Pf+Va and Pf + Ba+Va significantly decreased the concentration of heavy metals in the roots of rapeseed. We conclude that suitable combinations of PGPR can control the metal uptake of B. napus, selectively increasing either metal extraction or metal stabilization in the rhizosphere and offering promising applications in soil remediation.

  2. Dicty_cDB: Contig-U03328-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available aria DNA, clone: DAB1-004E12.F.fa, ... 48 0.16 1 ( EC770709 ) EST 7205 Guarana fruits cDNA library Paul...... 44 2.4 1 ( EI726036 ) 2B421023C20TR BAC library from breast tumor sampl... 44...s sativus) mature stigma l... 44 2.4 1 ( EV118860 ) 0124172 Brassica napus Root lib...rary Brassica napu... 44 2.4 1 ( ES560299 ) B79 Ascochyta rabiei induced library Cicer arieti..... 50 0.040 1 ( BM027318 ) GIT0000656 Root-induced cDNA library from Glomus ... 50 0.040 1 ( BI505723 ) BB17

  3. Comparative analysis of vitamin C, crude protein, elemental nitrogen ...

    African Journals Online (AJOL)



    Dec 21, 2011 ... greens (Brassica napus L.) and kale (Brassica oleracea var. acephala) ... Nitrogen is essential for protein production, for proper growth of ... Brassica crops. ..... the effect of trace element-amended fertilizers on their Co, Se, and.

  4. Infestation of Polish Agricultural Soils by Plasmodiophora Brassicae Along The Polish-Ukrainian Border

    Directory of Open Access Journals (Sweden)

    Jędryczka Małgorzata


    Full Text Available There has been a rapid, worldwide increase in oilseed rape production that has resulted in enormous intensification of oilseed rape cultivation, leading to tight rotations. This in turn, has caused an accumulation of pests as well as foliar and soil-borne diseases. Recently, clubroot has become one of the biggest concerns of oilseed rape growers. Clubroot is caused by the soil-borne protist Plasmodiophora brassicae Woronin. The pathogen may be present in groundwater, lakes, and irrigation water used in sprinkling systems. It can be easily transmitted from one field to another not only by water, but also by soil particles and dust transmitted by wind and on machinery. The aim of our overall study was to check for P. brassicae infestation of Polish agricultural soils. This paper presents the 2012 results of a study performed along the Polish-Ukrainian border in two provinces: Lublin (Lubelskie Voivodeship and the Carpathian Foothills (Podkarpackie Voivodeship, in south-east Poland. Monitoring was done in 11 counties, including nine rural and two municipal ones. In total, 40 samples were collected, out of which 36 were collected from fields located in rural areas and four from municipal areas, with two per municipal region. Each sample was collected at 8-10 sites per field, using a soil auger. The biotest to detect the presence of P. brassicae was done under greenhouse conditions using seedlings of the susceptible Brassicas: B. rapa ssp. pekinensis and the Polish variety of oilseed rape B. napus cv. Monolit. Susceptible plants grown in heavily infested soils produced galls on their roots. A county was regarded as free from the pathogen, if none of the bait plants became infected. The pathogen was found in three out of 40 fields monitored (7.5% in the Carpathian Foothill region. The fields were located in two rural counties. The pathogen was not found in Lublin province, and was also not detected in any of the municipal counties. The detection with


    Directory of Open Access Journals (Sweden)

    Raldugina G.N.


    Full Text Available This work aims to study the response of the transgenic spring rape plants (Brassica napus L. var. ‘Westar’ with the rice transfactor-encoding gene Osmyb4 to treatment with salts of heavy metals (HM CuSO4 or ZnSO4 and accumulation in the leaves of biomass, metals, photosynthetic pigments, lipid peroxidation, and antioxidant compounds: total phenols, anthocyanins, and antioxidant enzyme activity superoxide dismutase (SOD and guaiacol peroxidase (POX were determined. Vegetatively propagated transgenic plants and wild-type plants were grown on Hoagland-Snyder medium at 24°C, then at the 5-6th leaves-stage, CuSO4 (in concentration 25-150 mM or ZnSO4 (500 - 5000 mM were added to the growth medium, and plants were exposed to the salts for 15 days. Under the action of small concentrations of salts, the results obtained for the transgenic and untransformed plants did not differ, but at high concentrations strong differences between transgenic and untransformed plants were observed. In transgenic plants, accumulation of biomass was greater. Carotene and xanthophyll were destroyed in transgenic plants less than in the untransformed plants. They have accumulated in their leaves more metal, especially Zn, reaching almost to the accumulation of 7 mg per g of dry biomass, bringing these plants to the hyperaccumulation of Zn. In the tissues of transgenic plants exposed to high concentrations of salts, the content of total phenols, anthocyanins, and low molecular weight compounds, that are responsible for protection against ROS, increased significantly. All these results indicate a greater stability of the transgenic plants to the action of heavy metals, as evidenced also by less activity of lipid peroxidases in their tissue: at high salt concentrations, malondialdehyde (MDA accumulated significantly less in transgenic plants than in non-transformed plant tissues. The greater stability of transgenic plants to stressful effect of HM is also evidenced by the

  6. Transpiration flow controls Zn transport in Brassica napus and Lolium multiflorum under toxic levels as evidenced from isotopic fractionation (United States)

    Couder, Eléonore; Mattielli, Nadine; Drouet, Thomas; Smolders, Erik; Delvaux, Bruno; Iserentant, Anne; Meeus, Coralie; Maerschalk, Claude; Opfergelt, Sophie; Houben, David


    Stable zinc (Zn) isotope fractionation between soil and plant has been used to suggest the mechanisms affecting Zn uptake under toxic conditions. Here, changes in Zn isotope composition in soil, soil solution, root and shoot were studied for ryegrass (Lolium multiflorum L.) and rape (Brassica napus L.) grown on three distinct metal-contaminated soils collected near Zn smelters (total Zn 0.7-7.5%, pH 4.8-7.3). The Zn concentrations in plants reflected a toxic Zn supply. The Zn isotopic fingerprint of total soil Zn varied from -0.05‰ to +0.26 ± 0.02‰ (δ66Zn values relative to the JMC 3-0749L standard) among soils, but the soil solution Zn was depleted in 66Zn, with a constant Zn isotope fractionation of about -0.1‰ δ66Zn unit compared to the bulk soil. Roots were enriched with 66Zn relative to soil solution (δ66Znroot - δ66Znsoil solution = Δ66Znroot-soil solution = +0.05 to +0.2 ‰) and shoots were strongly depleted in 66Zn relative to roots (Δ66Znshoot-root = -0.40 to -0.04 ‰). The overall δ66Zn values in shoots reflected that of the bulk soil, but were lowered by 0.1-0.3 ‰ units as compared to the latter. The isotope fractionation between root and shoot exhibited a markedly strong negative correlation (R2 = 0.83) with transpiration per unit of plant weight. Thus, the enrichment with light Zn isotopes in shoot progressed with increasing water flux per unit plant biomass dry weight, showing a passive mode of Zn transport by transpiration. Besides, the light isotope enrichment in shoots compared to roots was larger for rape than for rye grass, which may be related to the higher Zn retention in rape roots. This in turn may be related to the higher cation exchange capacity of rape roots. Our finding can be of use to trace the biogeochemical cycles of Zn and evidence the tolerance strategies developed by plants in Zn-excess conditions.

  7. Heritability and genetic advance studies for biochemical traits in F2-3 introgressed families of Brassica

    International Nuclear Information System (INIS)

    Farhatullah, N.K.; Khalil, I.H.; Nahed, H.


    Higher heritability estimates along with high genetic advance values are effective in envisaging gain under selection in developing genotypes. The objective of the present study was to evaluate variability, heritability and genetic advance in 10 interspecific F2-3 families of Brassica species (B. napus * B. juncea, B. napus * B. rapa). These families were studied for heterospecific introgression of biochemical traits. Low to high heritability estimates were recorded for seed quality traits. Considerable variations within F2-3 families were observed for biochemical traits. Most of the F2-3 families for oil content and erucic showed moderate to high heritability indicating the slightest influence of environment thus modification of trait by selection would be more effective. Among F2-3 introgressed families Bn-510 x Bj-109 produced high oil i.e., 49.5% while Bn-532 x Br-118 (24.4%), Bn-533 x Bj-109 (24.1%) and high protein percentage in terms of mean performance. In the present research, individual segregating progenies of interspecific cross populations i.e., which possessed combination of desirable traits, were identified which could be incorporated in the future Breeding programs and it may facilitate varietal development. (author)

  8. Cryptochrome 1 regulates growth and development in Brassica through alteration in the expression of genes involved in light, phytohormone and stress signalling. (United States)

    Sharma, Pooja; Chatterjee, Mithu; Burman, Naini; Khurana, Jitendra P


    The blue light photoreceptors cryptochromes are ubiquitous in higher plants and are vital for regulating plant growth and development. In spite of being involved in controlling agronomically important traits like plant height and flowering time, cryptochromes have not been extensively characterized from agriculturally important crops. Here we show that overexpression of CRY1 from Brassica napus (BnCRY1), an oilseed crop, results in short-statured Brassica transgenics, likely to be less prone to wind and water lodging. The overexpression of BnCRY1 accentuates the inhibition of cell elongation in hypocotyls of transgenic seedlings. The analysis of hypocotyl growth inhibition and anthocyanin accumulation responses in BnCRY1 overexpressors substantiates that regulation of seedling photomorphogenesis by cry1 is dependent on light intensity. This study highlights that the photoactivated cry1 acts through coordinated induction and suppression of specific downstream genes involved in phytohormone synthesis or signalling, and those involved in cell wall modification, during de-etiolation of Brassica seedlings. The microarray-based transcriptome profiling also suggests that the overexpression of BnCRY1 alters abiotic/biotic stress signalling pathways; the transgenic seedlings were apparently oversensitive to abscisic acid (ABA) and mannitol. © 2013 John Wiley & Sons Ltd.

  9. Influence of radiation damage repair inhibitor on superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) in different sensitive crops

    International Nuclear Information System (INIS)

    Song Daojun; Xu Dengyi; Wan Zhaoliang; He Shoulin


    The activities of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) were affected remarkably by 60 Co γ-ray irradiation and radiation damage repair inhibitor (Caf, EDTA). SOD, CAT and POD activities showed the similar change pattern in both soybean (sensitive to radiation) and Brassica napus L. (resistant to radiation) seedlings in all treatments. After reaching the maximum value, SOD activity decreased with the increase of doses. CAT activity had the same change pattern as that of SOD in soybean, while with Brassica napus L., CAT activity remained relatively steady from 300 Gy to 1000 Gy. And POD activity increased with the increase of doses. Compared with H 2 O-treatments, CaF, EDAT post-treatments obviously enhanced SOD, CAT and POD activities. With all the treatments, the three enzyme activities were higher in Brassica napus L. than those in soybean seedlings

  10. Synthesis and Herbicidal Activity of 5-Heterocycloxy-3-substituted-1-(3-trifluoromethyl)phenyl-1H-pyrazole

    Institute of Scientific and Technical Information of China (English)

    XU Han; HU Xu-hong; ZOU Xiao-mao; ZHU You-quan; LIU Bin; HU Fang-zhong; YANG Hua-zheng


    The authors synthesized a series of novel 5-heterocycloxy-3-substituted-1-(3-trifluoromethyl)phenyl-1H- pyrazole derivatives.Herbicidal activities of the two intermediate compounds and thirteen target compounds were evaluated via Brassica napus and Echinochloa crusgalli(L.) Beauv tests.Bioassay results show that some of the compounds exhibit better inhibiting activities against Brassica napus and some of the compounds exhibit bleaching activities against Echinochloa crusgalli(L.) Beauv at 100 μg/mL.

  11. Identification, duplication, evolution and expression analyses of caleosins in Brassica plants and Arabidopsis subspecies. (United States)

    Shen, Yue; Liu, Mingzhe; Wang, Lili; Li, Zhuowei; Taylor, David C; Li, Zhixi; Zhang, Meng


    Caleosins are a class of Ca(2+) binding proteins that appear to be ubiquitous in plants. Some of the main proteins embedded in the lipid monolayer of lipid droplets, caleosins, play critical roles in the degradation of storage lipids during germination and in lipid trafficking. Some of them have been shown to have histidine-dependent peroxygenase activity, which is believed to participate in stress responses in Arabidopsis. In the model plant Arabidopsis thaliana, caleosins have been examined extensively. However, little is known on a genome-wide scale about these proteins in other members of the Brassicaceae. In this study, 51 caleosins in Brassica plants and Arabidopsis lyrata were investigated and analyzed in silico. Among them, 31 caleosins, including 7 in A. lyrata, 11 in Brassica oleracea and 13 in Brassica napus, are herein identified for the first time. Segmental duplication was the main form of gene expansion. Alignment, motif and phylogenetic analyses showed that Brassica caleosins belong to either the H-family or the L-family with different motif structures and physicochemical properties. Our findings strongly suggest that L-caleosins are evolved from H-caleosins. Predicted phosphorylation sites were differentially conserved in H-caleosin and L-caleosins, respectively. 'RY-repeat' elements and phytohormone-related cis-elements were identified in different caleosins, which suggest diverse physiological functions. Gene structure analysis indicated that most caleosins (38 out of 44) contained six exons and five introns and their intron phases were highly conserved. Structurally integrated caleosins, such as BrCLO3-3 and BrCLO4-2, showed high expression levels and may have important roles. Some caleosins, such as BrCLO2 and BoCLO8-2, lost motifs of the calcium binding domain, proline knot, potential phosphorylation sites and haem-binding sites. Combined with their low expression, it is suggested that these caleosins may have lost function.

  12. Brassica napus

    Indian Academy of Sciences (India)


    Dec 16, 2011 ... 2School of Agriculture and Food Science, Zhejiang A & F University, Lin'an, 311300, People's Republic of China ... was affected by the environmental conditions on 15, 22, 29 or 36 days after ... Journal of Genetics, Vol. 90, No ...

  13. Tolerance of Brassica nigra to Pieris brassicae herbivory

    NARCIS (Netherlands)

    Blatt, S.E.; Smallegange, R.C.; Hess, L.; Harvey, J.A.; Dicke, M.; Loon, van J.J.A.


    Black mustard, Brassica nigra (L.) Koch, is a wild annual species found throughout Europe and fed on by larvae of the large cabbage-white butterfly, Pieris brassicae L. We examined the impact of herbivory from P. brassicae, a gregarious herbivore, on B. nigra grown from wild seed collected locally.

  14. Dicty_cDB: Contig-U16187-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CI 5 ALP Hydra magnipapill... 62 2e-14 2 ( AW719233 ) LjNEST1e12r Lotus japonicus nodule library, matur... 5... 17ACDHMS_UP_015_C09_27OCT2004_075 Brassica napus ... 50 2e-09 3 ( EX123282 ) BR107112 mature green leaf cDNA library...a rapa sub... 50 2e-09 3 ( EX125217 ) BR109047 mature green leaf cDNA library KHLM Bras... 50 2e-09 3 ( EV161608 ) 0085470 Brassic...ETGS6H_UP_013_E04_15NOV2004_024 Brassica napus 6... 50 3e-08 3 ( CV515629 ) 0048P0010Z_H11_T7 Mimulus guttatus library 1 Mimu...E543256 ) 9RDBNGA_UP_037_C07_03DEC2003_059 Brassica napus -... 50 3e-08 3 ( CV515401 ) 0048P0009Z_D01_T7 Mimulus guttatus library

  15. Role of relative humidity in processing and storage of seeds and assessment of variability in storage behaviour in Brassica spp. and Eruca sativa. (United States)

    Suma, A; Sreenivasan, Kalyani; Singh, A K; Radhamani, J


    The role of relative humidity (RH) while processing and storing seeds of Brassica spp. and Eruca sativa was investigated by creating different levels of relative humidity, namely, 75%, 50%, 32%, and 11% using different saturated salt solutions and 1% RH using concentrated sulphuric acid. The variability in seed storage behaviour of different species of Brassica was also evaluated. The samples were stored at 40 ± 2°C in sealed containers and various physiological parameters were assessed at different intervals up to three months. The seed viability and seedling vigour parameters were considerably reduced in all accessions at high relative humidity irrespective of the species. Storage at intermediate relative humidities caused minimal decline in viability. All the accessions performed better at relative humidity level of 32% maintaining seed moisture content of 3%. On analyzing the variability in storage behaviour, B. rapa and B. juncea were better performers than B. napus and Eruca sativa.


    Directory of Open Access Journals (Sweden)



    Full Text Available Self-incompatibility (AI is a widespread mechanism used by flowering plants to prevent inbreeding depression and helps create and maintain genetic diversity within a species. Oilseed rape (Brassica napus L. and especially its modern varieties are characterized by high level of self-fertility. In an effort to increase the production current breeding is focused on the production of inbred lines for making the F1 hybrids and the self-incompatibility can be an interesting tool for production self- sterile lines. In Brassica napus, we found two recessive alleles of a gene SCR II. Different expression of both alleles does not correspond to phenotypic manifestation of self-incompatibility and we can assume that it is prevailed by repressor gene that does not lie on the S-locus. This is also reason, why the SCR gene cannot serve as a molecular marker of self-incompatibility in Brassica napus, although many authors believe that this gene is essential in AI reaction. Brassica napus belong to plants with complex genetic constitution, is composed by two genomes, A and C, which give the possibility of different interactions and makes it difficult to study compared with diploid B. rapa and B. oleracea. In further study it is therefore important to focus on the interactions between genes SCR, SRK and SLG, and their influence on others, such as supressor gene systems.

  17. Overexpression of NPR1 in Brassica juncea Confers Broad Spectrum Resistance to Fungal Pathogens

    Directory of Open Access Journals (Sweden)

    Sajad Ali


    Full Text Available Brassica juncea (Indian mustard is a commercially important oil seed crop, which is highly affected by many biotic stresses. Among them, Alternaria leaf blight and powdery mildew are the most devastating diseases leading to huge yield losses in B. juncea around the world. In this regard, genetic engineering is a promising tool that may possibly allow us to enhance the B. juncea disease resistance against these pathogens. NPR1 (non-expressor of pathogen-related gene 1 is a bonafide receptor of salicylic acid (SA which modulates multiple immune responses in plants especially activation of induced and systemic acquired resistance (SAR. Here, we report the isolation and characterization of new NPR1 homolog (BjNPR1 from B. juncea. The phylogenetic tree constructed based on the deduced sequence of BjNPR1 with homologs from other species revealed that BjNPR1 grouped together with other known NPR1 proteins of Cruciferae family, and was nearest to B. napus. Furthermore, expression analysis showed that BjNPR1 was upregulated after SA treatment and fungal infection but not by jasmonic acid or abscisic acid. To understand the defensive role of this gene, we generated B. juncea transgenic lines overexpressing BjNPR1, and further confirmed by PCR and Southern blotting. The transgenic lines showed no phenotypic abnormalities, and constitutive expression of BjNPR1 activates defense signaling pathways by priming the expression of antifungal PR genes. Moreover, BjNPR1 transgenic lines showed enhanced resistance to Alternaria brassicae and Erysiphe cruciferarum as there was delay in symptoms and reduced disease severity than non-transgenic plants. In addition, the rate of disease spreading to uninfected or distal parts was also delayed in transgenic plants thus suggesting the activation of SAR. Altogether, the present study suggests that BjNPR1 is involved in broad spectrum of disease resistance against fungal pathogens.

  18. High-throughput phenotyping (HTP) identifies seedling root traits linked to variation in seed yield and nutrient capture in field-grown oilseed rape (Brassica napus L.). (United States)

    Thomas, C L; Graham, N S; Hayden, R; Meacham, M C; Neugebauer, K; Nightingale, M; Dupuy, L X; Hammond, J P; White, P J; Broadley, M R


    Root traits can be selected for crop improvement. Techniques such as soil excavations can be used to screen root traits in the field, but are limited to genotypes that are well-adapted to field conditions. The aim of this study was to compare a low-cost, high-throughput root phenotyping (HTP) technique in a controlled environment with field performance, using oilseed rape (OSR;Brassica napus) varieties. Primary root length (PRL), lateral root length and lateral root density (LRD) were measured on 14-d-old seedlings of elite OSR varieties (n = 32) using a 'pouch and wick' HTP system (∼40 replicates). Six field experiments were conducted using the same varieties at two UK sites each year for 3 years. Plants were excavated at the 6- to 8-leaf stage for general vigour assessments of roots and shoots in all six experiments, and final seed yield was determined. Leaves were sampled for mineral composition from one of the field experiments. Seedling PRL in the HTP system correlated with seed yield in four out of six (r = 0·50, 0·50, 0·33, 0·49;P emergence in three out of five (r = 0·59, 0·22, 0·49;P emergence, general early vigour or yield in the field. Associations between PRL and field performance are generally related to early vigour. These root traits might therefore be of limited additional selection value, given that vigour can be measured easily on shoots/canopies. In contrast, LRD cannot be assessed easily in the field and, if LRD can improve nutrient uptake, then it may be possible to use HTP systems to screen this trait in both elite and more genetically diverse, non-field-adapted OSR. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company.

  19. Characterization of the Mamestra configurata (Lepidoptera: Noctuidae) larval midgut protease complement and adaptation to feeding on artificial diet, Brassica species, and protease inhibitor. (United States)

    Erlandson, Martin A; Hegedus, Dwayne D; Baldwin, Douglas; Noakes, Amy; Toprak, Umut


    The midgut protease profiles from 5th instar Mamestra configurata larvae fed various diets (standard artificial diet, low protein diet, low protein diet with soybean trypsin inhibitor [SBTI], or Brassica napus) were characterized by one-dimensional enzymography in gelatin gels. The gut protease profile of larvae fed B. napus possessed protease activities of molecular masses of approximately 33 and 55 kDa, which were not present in the guts of larvae fed artificial diet. Similarly, larvae fed artificial diet had protease activities of molecular masses of approximately 21, 30, and 100 kDa that were absent in larvae fed B. napus. Protease profiles changed within 12 to 24 h after switching larvae from artificial diet to plant diet and vice versa. The gut protease profiles from larvae fed various other brassicaceous species and lines having different secondary metabolite profiles did not differ despite significant differences in larval growth rates on the different host plants. Genes encoding putative digestive proteolytic enzymes, including four carboxypeptidases, five aminopeptidases, and 48 serine proteases, were identified in cDNA libraries from 4th instar M. configurata midgut tissue. Many of the protease-encoding genes were expressed at similar levels on all diets; however, three chymoptrypsin-like genes (McSP23, McSP27, and McSP37) were expressed at much higher levels on standard artificial diet and diet containing SBTI as was the trypsin-like gene McSP34. The expression of the trypsin-like gene McSP50 was highest on B. napus. The adaptation of M. configurata digestive biochemistry to different diets is discussed in the context of the flexibility of polyphagous insects to changing diet sources.

  20. Depletion of cellular brassinolide decreases embryo production and disrupts the architecture of the apical meristems in Brassica napus microspore-derived embryos. (United States)

    Belmonte, Mark; Elhiti, Mohamed; Waldner, Blaine; Stasolla, Claudio


    Exogenous applications of brassinolide (BL) increased the number and quality of microspore-derived embryos (MDEs) whereas treatments with brassinazole (BrZ), a BL biosynthetic inhibitor, had the opposite effect. At the optimal concentration (4x10(-6) M) BrZ decreased both embryo yield and conversion to less than half the value of control embryos. Metabolic studies revealed that BL levels had profound effects on glutathione and ascorbate metabolism by altering the amounts of their reduced forms (ASC and GSH) and oxidized forms [dehydroascorbate (DHA), ascorbate free radicals (AFRs), and GSSG]. Applications of BL switched the glutathione and ascorbate pools towards the oxidized forms, thereby lowering the ASC/ASC+DHA+AFR and GSH/GSH+GSSG ratios. These changes were ascribed to the ability of BL to increase the activity of ascorbate peroxidase (APX) and decrease that of glutathione reductase (GR). This trend was reversed in a BL-depleted environment, effected by BrZ applications. These metabolic alterations were associated with changes in embryo structure and performance. BL-treated MDEs developed zygotic-like shoot apical meristems (SAMs) whereas embryos treated with BrZ developed abnormal meristems. In the presence of BrZ, embryos either lacked a visible SAM, or formed SAMs in which the meristematic cells showed signs of differentiation, such as vacuolation and storage product accumulation. These abnormalities were accompanied by the lack or misexpression of three meristem marker genes isolated from Brassica napus (denoted as BnSTM, BnCLV1, and BnZLL-1) homologous to the Arabidopsis SHOOTMERISTEMLESS (STM), CLAVATA 1 (CLV1), and ZWILLE (ZLL). The expression of BnSTM and BnCLV1 increased after a few days in cultures in embryos treated with BL whereas an opposite tendency was observed with applications of BrZ. Compared with control embryos where these two genes exhibited abnormal localization patterns, BnSTM and BnCLV1 always localized throughout the subapical domains

  1. Comparative Transcriptome Analysis between Broccoli (Brassica oleracea var. italica) and Wild Cabbage (Brassica macrocarpa Guss.) in Response to Plasmodiophora brassicae during Different Infection Stages. (United States)

    Zhang, Xiaoli; Liu, Yumei; Fang, Zhiyuan; Li, Zhansheng; Yang, Limei; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao


    Clubroot, one of the most devastating diseases to the Brassicaceae family, is caused by the obligate biotrophic pathogen Plasmodiophora brassicae . However, studies of the molecular basis of disease resistance are still poor especially in quantitative resistance. In the present paper, two previously identified genotypes, a clubroot-resistant genotype (wild cabbage, B2013) and a clubroot-susceptible genotype (broccoli, 90196) were inoculated by P. brassicae for 0 (T0), 7 (T7), and 14 (T14) day after inoculation (DAI). Gene expression pattern analysis suggested that response changes in transcript level of two genotypes under P. brassicae infection were mainly activated at the primary stage (T7). Based on the results of DEGs functional enrichments from two infection stages, genes associated with cell wall biosynthesis, glucosinolate biosynthesis, and plant hormone signal transduction showed down-regulated at T14 compared to T7, indicating that defense responses to P. brassicae were induced earlier, and related pathways were repressed at T14. In addition, the genes related to NBS-LRR proteins, SA signal transduction, cell wall and phytoalexins biosynthesis, chitinase, Ca 2+ signals and RBOH proteins were mainly up-regulated in B2013 by comparing those of 90196, indicating the pathways of response defense to clubroot were activated in the resistant genotype. This is the first report about comparative transcriptome analysis for broccoli and its wild relative during the different stages of P. brassicae infection and the results should be useful for molecular assisted screening and breeding of clubroot-resistant genotypes.

  2. Characterization of cysteine-degrading and H2S-releasing enzymes of higher plants - From the field to the test tube and back

    DEFF Research Database (Denmark)

    Jutta, Papenbrock; Anja, Riemenschneider; Kamp, Anja


    focussed mainly on the release of H2S as defence strategy. In field experiments using different Brassica napus genotypes it was shown that the genetic differ- ences among Brassica genotypes lead to differences in sulfur content and L-cysteine desulfhydrase activity. Another field ex- periment demonstrated...... that sulfur supply and infection with Pyrenopeziza brassica influenced L-cysteine desulfhydrase activity in Brassica napus. Cysteine-degrading enzymes such as cysteine desulfhydrases are hypothesized to be involved in H2S release. Several L- and D-cysteine-specific desulfhydrase candidates have been isolated...... in plants which might be involved in SIR, such as high levels of thiols, glucosinolates, cysteine-rich proteins, phytoalexins, elemental sulfur, or H2S. Probably more than one strategy is used by plants. Species- or even variety-dependent differences in the development of SIR are probably used. Our research...

  3. Genome-wide identification of QTL for seed yield and yield-related traits and construction of a high-density consensus map for QTL comparison in Brassica napus

    Directory of Open Access Journals (Sweden)

    Weiguo eZhao


    Full Text Available Seed yield (SY is the most important trait in rapeseed, which was determined by multiple seed yield-related traits (SYRTs and also easily subject to environmental influence. Lots of quantitative trait loci (QTL for SY and SYRTs were reported in Brassica napus. However, no studies have focused on SY and seven agronomic traits affecting SY simultaneous. Genome-wide QTL analysis for SY and seven SYRTs in eight environments was conducted in a doubled haploid population containing 348 lines. Totally, 18 and 208 QTLs for SY and SYRTs were observed, respectively, and then these QTLs were integrated into 144 consensus QTLs by a meta-analysis. Three major QTLs for SY were observed, including cqSY-C6-2 and cqSY-C6-3 that expressed stably in winter cultivation area for three years and cqSY-A2-2 only expressed in spring rapeseed area. Trait-by-trait meta-analysis revealed that the 144 consensus QTLs were integrated into 72 pleiotropic unique QTLs. Among them, all the unique QTLs affected SY, except for uq-A6-1, including uq.A2-3, uq.C1-2, uq.C1-3, uq.C6-1, uq.C6-5 and uq.C6-6 could also affect more than two SYRTs. According to high density consensus map construction and QTL comparison from literature, 36 QTLs from five populations were co-localized with QTLs identified in this study. In addition, 13 orthologs genes were observed, including five each genes for SY and SW, one each gene for BY, BH and PH, respectively. The genomic information of these QTLs would be valuable in hybrid cultivar breeding, and be helpful to analyze QTL expression in different environments.

  4. Effect of different methods of soil fertility increasing via application of organic, chemical and biological fertilizers on grain yield and quality of canola (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    K. Mohammadi


    Full Text Available Different resource of fertilizers had an effect on grain yield, oil and grain quality. Information regarding the effect of simultaneous application of organic, chemical and biological fertilizers on canola (Brassica napus L. traits is not available. In order to study the effect of different systems of soil fertility on grain yield and quality of canola (Talayeh cultivar, an experiment was conducted at experimental farm of Agricultural Research Center of Sanandaj, Iran, during two growing seasons of 2007-2008 and 2008-2009. The experimental units were arranged as split plots based on randomized complete blocks design with three replications. Main plots consisted of five methods for obtaining the basal fertilizers requirement including (N1: farm yard manure; (N2: compost; (N3: chemical fertilizers; (N4: farm yard manure + compost and (N5: farm yard manure + compost + chemical fertilizers; and control (N6. Sub plots consisted four levels of biofertilizers were (B1: Bacillus lentus and Pseudomonas putida; (B2: Trichoderma harzianum; (B3: Bacillus lentus and Pseudomonas putida and Trichoderma harzianum; and (B4: control, (without biofertilizers. Results showed that basal fertilizers and biofertilizers have a significant effect on grain yield. The highest grain yield was obtained from N5 treatment in which organic and chemical fertilizers were applied simultaneously applied. Basal fertilizers, biofertilizers have a significant effect on leaf chlorophyll. The highest nitrogen content (42.85 mg.g-1 and least amount of (N/S were obtained from N5 treatment. The highest oil percent was obtained from N1 and N2 treatments and highest oil yield was obtained from N5 treatment. Finally, application of organic manure and biofertilizers with chemical fertilizer led to an increase in yield and quality of canola grain.

  5. Comparative transcript profiling of the fertile and sterile flower buds of pol CMS in B. napus. (United States)

    An, Hong; Yang, Zonghui; Yi, Bin; Wen, Jing; Shen, Jinxiong; Tu, Jinxing; Ma, Chaozhi; Fu, Tingdong


    The Polima (pol) system of cytoplasmic male sterility (CMS) and its fertility restoration gene Rfp have been used in hybrid breeding in Brassica napus, which has greatly improved the yield of rapeseed. However, the mechanism of the male sterility transition in pol CMS remains to be determined. To investigate the transcriptome during the male sterility transition in pol CMS, a near-isogenic line (NIL) of pol CMS was constructed. The phenotypic features and sterility stage were confirmed by anatomical analysis. Subsequently, we compared the genomic expression profiles of fertile and sterile young flower buds by RNA-Seq. A total of 105,481,136 sequences were successfully obtained. These reads were assembled into 112,770 unigenes, which composed the transcriptome of the bud. Among these unigenes, 72,408 (64.21%) were annotated using public protein databases and classified into functional clusters. In addition, we investigated the changes in expression of the fertile and sterile buds; the RNA-seq data showed 1,148 unigenes had significantly different expression and they were mainly distributed in metabolic and protein synthesis pathways. Additionally, some unigenes controlling anther development were dramatically down-regulated in sterile buds. These results suggested that an energy deficiency caused by orf224/atp6 may inhibit a series of genes that regulate pollen development through nuclear-mitochondrial interaction. This results in the sterility of pol CMS by leading to the failure of sporogenous cell differentiation. This study may provide assistance for detailed molecular analysis and a better understanding of pol CMS in B. napus.

  6. Diversity Analysis of Ethiopian Mustard Breeding Lines Using RAPD ...

    African Journals Online (AJOL)

    Ethiopian mustard (Brassica carinata A. Braun) is an oilseed crop less known to the ... have also been used for cultivar identification in B. napus (Ren et al. ..... of Brassica oleracea L. group (2n=18) using random amplified polymorphic DNA.

  7. High oleic acid content materials of rapeseed (Brassica napus) produced by radiation breeding

    International Nuclear Information System (INIS)

    Guan Chunyun; Liu Chunlin; Chen Sheyuan


    High oleic acid content rapeseed breeding has great significance, because high oleic acid oil is a healthy and nutritious oil, which is of a long shelflife and also propitious to producing biodiesel fuel. The high oleic acid content breeding materials of rapeseed (B. napus) were obtained by 80-100 kR ~(60)Co gamma ray ionizing radiation treatment of dry seeds and continuous selection. The results showed that the oleic acid contents of M (2), M (3) and M (4) progenies increased by different grades. Moreover, the oleic acid content of M (5) progeny increased greatly. The oleic acid contents were higher than 70% in the most of the plants and the highest one reached 93.5 %. The base G was transited by base A in fad (2) gene at the 270 site of high oleic acid mutation (M(6) 04-855). The location is at the beta folding area and conservative area of this protein. Base mutation at sites 1 044 and 1 062 also led to produce a stop condon. These changes in structure led to loss the function of fad (2). According to molecular mechanism of gene mutation, no matter what transvertion or transition happens, several replications are needed. That is to say several generations are needed. That was also the reason why high oleic acid content mutation occurred in later generations

  8. Brassica ASTRA: an integrated database for Brassica genomic research. (United States)

    Love, Christopher G; Robinson, Andrew J; Lim, Geraldine A C; Hopkins, Clare J; Batley, Jacqueline; Barker, Gary; Spangenberg, German C; Edwards, David


    Brassica ASTRA is a public database for genomic information on Brassica species. The database incorporates expressed sequences with Swiss-Prot and GenBank comparative sequence annotation as well as secondary Gene Ontology (GO) annotation derived from the comparison with Arabidopsis TAIR GO annotations. Simple sequence repeat molecular markers are identified within resident sequences and mapped onto the closely related Arabidopsis genome sequence. Bacterial artificial chromosome (BAC) end sequences derived from the Multinational Brassica Genome Project are also mapped onto the Arabidopsis genome sequence enabling users to identify candidate Brassica BACs corresponding to syntenic regions of Arabidopsis. This information is maintained in a MySQL database with a web interface providing the primary means of interrogation. The database is accessible at

  9. In Silico Identification of Mimicking Molecules as Defense Inducers Triggering Jasmonic Acid Mediated Immunity against Alternaria Blight Disease in Brassica Species

    Directory of Open Access Journals (Sweden)

    Dinesh Pandey


    Full Text Available Alternaria brassicae and Alternaria brassicicola are two major phytopathogenic fungi which cause Alternaria blight, a recalcitrant disease on Brassica crops throughout the world, which is highly destructive and responsible for significant yield losses. Since no resistant source is available against Alternaria blight, therefore, efforts have been made in the present study to identify defense inducer molecules which can induce jasmonic acid (JA mediated defense against the disease. It is believed that JA triggered defense response will prevent necrotrophic mode of colonization of Alternaria brassicae fungus. The JA receptor, COI1 is one of the potential targets for triggering JA mediated immunity through interaction with JA signal. In the present study, few mimicking compounds more efficient than naturally occurring JA in terms of interaction with COI1 were identified through virtual screening and molecular dynamics simulation studies. A high quality structural model of COI1 was developed using the protein sequence of Brassica rapa. This was followed by virtual screening of 767 analogs of JA from ZINC database for interaction with COI1. Two analogs viz. ZINC27640214 and ZINC43772052 showed more binding affinity with COI1 as compared to naturally occurring JA. Molecular dynamics simulation of COI1 and COI1-JA complex, as well as best screened interacting structural analogs of JA with COI1 was done for 50 ns to validate the stability of system. It was found that ZINC27640214 possesses efficient, stable, and good cell permeability properties. Based on the obtained results and its physicochemical properties, it is capable of mimicking JA signaling and may be used as defense inducers for triggering JA mediated resistance against Alternaria blight, only after further validation through field trials.

  10. Molecular Diversity Analysis and Genetic Mapping of Pod Shatter Resistance Loci in Brassica carinata L.

    Directory of Open Access Journals (Sweden)

    Rosy Raman


    Full Text Available Seed lost due to easy pod dehiscence at maturity (pod shatter is a major problem in several members of Brassicaceae family. We investigated the level of pod shatter resistance in Ethiopian mustard (Brassica carinata and identified quantitative trait loci (QTL for targeted introgression of this trait in Ethiopian mustard and its close relatives of the genus Brassica. A set of 83 accessions of B. carinata, collected from the Australian Grains Genebank, was evaluated for pod shatter resistance based on pod rupture energy (RE. In comparison to B. napus (RE = 2.16 mJ, B. carinata accessions had higher RE values (2.53 to 20.82 mJ. A genetic linkage map of an F2 population from two contrasting B. carinata selections, BC73526 (shatter resistant with high RE and BC73524 (shatter prone with low RE comprising 300 individuals, was constructed using a set of 6,464 high quality DArTseq markers and subsequently used for QTL analysis. Genetic analysis of the F2 and F2:3 derived lines revealed five statistically significant QTL (LOD ≥ 3 that are linked with pod shatter resistance on chromosomes B1, B3, B8, and C5. Herein, we report for the first time, identification of genetic loci associated with pod shatter resistance in B. carinata. These characterized accessions would be useful in Brassica breeding programs for introgression of pod shatter resistance alleles in to elite breeding lines. Molecular markers would assist marker-assisted selection for tracing the introgression of resistant alleles. Our results suggest that the value of the germplasm collections can be harnessed through genetic and genomics tools.

  11. Heritability studies for seed quality traits in introgressed segregating populations of brassica

    International Nuclear Information System (INIS)

    Farhatullah, S.; Nasim, A.; Fayyaz, L.


    Estimation of genetic parameters in the context of trait characterization is an essential component of future targeted crop improvement programs. Collection of knowledge about genetic behavior such as genetic variability and heritability etc., of the germplasm is the basic step for initiation of any breeding program. Genetic variability and Broad sense heritability for various seed quality traits in 10 brassica genotypes and their 12 F2 progenies comprising of introgressed hybrids were studied. The genotypes had highly significant variation for oil content, protein, glucosinolates contents, oleic, linolenic and erucic acid contents. Glucosinolates content and erucic acid showed high heritability in all F2 populations, while rest of the traits showed variable trends. The cross combination 547 x 118 (B. napus x B. campestris) proved to be a good interspecific hybrid that had high proportion of introgression and has high heritability for beneficial traits. The individual plants having combination of desirable traits were also identified from the F2 populations. (author)

  12. Landscape-scale distribution and persistence of genetically modified oilseed rape (Brassica napus) in Manitoba, Canada. (United States)

    Knispel, Alexis L; McLachlan, Stéphane M


    Genetically modified herbicide-tolerant (GMHT) oilseed rape (OSR; Brassica napus L.) was approved for commercial cultivation in Canada in 1995 and currently represents over 95% of the OSR grown in western Canada. After a decade of widespread cultivation, GMHT volunteers represent an increasing management problem in cultivated fields and are ubiquitous in adjacent ruderal habitats, where they contribute to the spread of transgenes. However, few studies have considered escaped GMHT OSR populations in North America, and even fewer have been conducted at large spatial scales (i.e. landscape scales). In particular, the contribution of landscape structure and large-scale anthropogenic dispersal processes to the persistence and spread of escaped GMHT OSR remains poorly understood. We conducted a multi-year survey of the landscape-scale distribution of escaped OSR plants adjacent to roads and cultivated fields. Our objective was to examine the long-term dynamics of escaped OSR at large spatial scales and to assess the relative importance of landscape and localised factors to the persistence and spread of these plants outside of cultivation. From 2005 to 2007, we surveyed escaped OSR plants along roadsides and field edges at 12 locations in three agricultural landscapes in southern Manitoba where GMHT OSR is widely grown. Data were analysed to examine temporal changes at large spatial scales and to determine factors affecting the distribution of escaped OSR plants in roadside and field edge habitats within agricultural landscapes. Additionally, we assessed the potential for seed dispersal between escaped populations by comparing the relative spatial distribution of roadside and field edge OSR. Densities of escaped OSR fluctuated over space and time in both roadside and field edge habitats, though the proportion of GMHT plants was high (93-100%). Escaped OSR was positively affected by agricultural landscape (indicative of cropping intensity) and by the presence of an

  13. Bt-transgenic oilseed rape hybridization with its weedy relative, Brassica rapa. (United States)

    Halfhill, Matthew D; Millwood, Reginald J; Raymer, Paul L; Stewart, C Neal


    The movement of transgenes from crops to weeds and the resulting consequences are concerns of modern agriculture. The possible generation of "superweeds" from the escape of fitness-enhancing transgenes into wild populations is a risk that is often discussed, but rarely studied. Oilseed rape, Brassica napus (L.), is a crop with sexually compatible weedy relatives, such as birdseed rape (Brassica rapa (L.)). Hybridization of this crop with weedy relatives is an extant risk and an excellent interspecific gene flow model system. In laboratory crosses, T3 lines of seven independent transformation events of Bacillus thuringiensis (Bt) oilseed rape were hybridized with two weedy accessions of B. rapa. Transgenic hybrids were generated from six of these oilseed rape lines, and the hybrids exhibited an intermediate morphology between the parental species. The Bt transgene was present in the hybrids, and the protein was synthesized at similar levels to the corresponding independent oilseed rape lines. Insect bioassays were performed and confirmed that the hybrid material was insecticidal. The hybrids were backcrossed with the weedy parent, and only half the oilseed rape lines were able to produce transgenic backcrosses. After two backcrosses, the ploidy level and morphology of the resultant plants were indistinguishable from B. rapa. Hybridization was monitored under field conditions (Tifton, GA, USA) with four independent lines of Bt oilseed rape with a crop to wild relative ratio of 1200:1. When B. rapa was used as the female parent, hybridization frequency varied among oilseed rape lines and ranged from 16.9% to 0.7%.

  14. Effects of Drought Stress on Canola (Brassica napus L. Genotypes Yield and Yield Components

    Directory of Open Access Journals (Sweden)

    R Khani


    Full Text Available Introduction Canola (Brassica napus L. genotypes with wide adaptability to environmental conditions could play a major role in Iran’s oilseed crop production. Selection of high performing genotypes is very important for developing canola cultivation. Water stress can reduce crop yield by affecting both source and sink for assimilation. Canola yield depends on genotype and environmental conditions and response of genotypes to environmental factors. Canola genotypes response to stress depends on the developmental stage and the events occurring prior to and during flowering stage. Resistance to water stress is divided to avoidance and tolerance. Some species are tolerable against water stress. In a while, other species respond ending life cycle, falling leaves and other reactions into water stress. Therefore, investigation of canola genotypes response to water stress in phenological growth stages can be valuable in order to determine resistant or tolerant genotypes. Materials and Methods In order to study the effect of drought stress on canola genotypes yield and its components, an experiment was conducted in 2013-2014 as a split plot based on randomized complete block design with three replications at the research farm, Agricultural and Natural Resources Research Center of East-Azarbaijan, Tabriz-Iran. Three levels of drought stress were considered as main plot (No-stress, stress at the flowering and pod setting growth stages and 18 canola genotypes including HW113, RS12, Karaj1, KR18, L73, L72, HW101, L146, L210, L183, SW101, L5, L201, HW118, KR4, Karaj2, Karaj3 and KS7 as subplots. Flood irrigation was scheduled at 50% field capacity, 30 and 30% field capacity for no-stress, stress at the flowering and pod setting growth stages, respectively; i.e. soil moisture capacity was maintained at 30% by irrigating to 100% field capacity when available moisture reached 30% in drought stress treatments. An ANOVA was conducted using the PROC-GLM procedure

  15. Preferential exclusion of hybrids in mixed pollinations between oilseed rape (Brassica napus) and weedy B. campestris (Brassicaceae)

    DEFF Research Database (Denmark)

    Hauser, T.P.; Bagger Jørgensen, Rikke; Østergård, Hanne


    amplified polymorphic DNA analysis. Using data on the proportion of fully developed seeds and the proportion of these seeds that were hybrids, a statistical model was constructed to estimate the fitness of conspecific and heterospecific pollen and the survival of conspecific and heterospecific zygotes...... for competition between male gametophytes and/or seeds within pods. To test whether competition influences the success of hybridization, pollen from the two species was mixed in different proportions and applied to stigmas of both species. The resulting seeds were scored for paternity by isozyme and randomly...... to seeds. B. campestris pollen in B. napus styles had a significantly lower fitness than the conspecific pollen, whereas no difference between pollen types was found in B. campestris styles. Hybrid zygotes survived to significantly lower proportions than conspecific zygotes in both species, with the lowest...

  16. BrassicaTED - a public database for utilization of miniature transposable elements in Brassica species. (United States)

    Murukarthick, Jayakodi; Sampath, Perumal; Lee, Sang Choon; Choi, Beom-Soon; Senthil, Natesan; Liu, Shengyi; Yang, Tae-Jin


    MITE, TRIM and SINEs are miniature form transposable elements (mTEs) that are ubiquitous and dispersed throughout entire plant genomes. Tens of thousands of members cause insertion polymorphism at both the inter- and intra- species level. Therefore, mTEs are valuable targets and resources for development of markers that can be utilized for breeding, genetic diversity and genome evolution studies. Taking advantage of the completely sequenced genomes of Brassica rapa and B. oleracea, characterization of mTEs and building a curated database are prerequisite to extending their utilization for genomics and applied fields in Brassica crops. We have developed BrassicaTED as a unique web portal containing detailed characterization information for mTEs of Brassica species. At present, BrassicaTED has datasets for 41 mTE families, including 5894 and 6026 members from 20 MITE families, 1393 and 1639 members from 5 TRIM families, 1270 and 2364 members from 16 SINE families in B. rapa and B. oleracea, respectively. BrassicaTED offers different sections to browse structural and positional characteristics for every mTE family. In addition, we have added data on 289 MITE insertion polymorphisms from a survey of seven Brassica relatives. Genes with internal mTE insertions are shown with detailed gene annotation and microarray-based comparative gene expression data in comparison with their paralogs in the triplicated B. rapa genome. This database also includes a novel tool, K BLAST (Karyotype BLAST), for clear visualization of the locations for each member in the B. rapa and B. oleracea pseudo-genome sequences. BrassicaTED is a newly developed database of information regarding the characteristics and potential utility of mTEs including MITE, TRIM and SINEs in B. rapa and B. oleracea. The database will promote the development of desirable mTE-based markers, which can be utilized for genomics and breeding in Brassica species. BrassicaTED will be a valuable repository for scientists

  17. Interspecific hybridization, polyploidization, and backcross of Brassica oleracea var. alboglabra with B. rapa var. purpurea morphologically recapitulate the evolution of Brassica vegetables. (United States)

    Zhang, Xiaohui; Liu, Tongjin; Li, Xixiang; Duan, Mengmeng; Wang, Jinglei; Qiu, Yang; Wang, Haiping; Song, Jiangping; Shen, Di


    Brassica oleracea and B. rapa are two important vegetable crops. Both are composed of dozens of subspecies encompassing hundreds of varieties and cultivars. Synthetic B. napus with these two plants has been used extensively as a research model for the investigation of allopolyploid evolution. However, the mechanism underlying the explosive evolution of hundreds of varieties of B. oleracea and B. rapa within a short period is poorly understood. In the present study, interspecific hybridization between B. oleracea var. alboglabra and B. rapa var. purpurea was performed. The backcross progeny displayed extensive morphological variation, including some individuals that phenocopied subspecies other than their progenitors. Numerous interesting novel phenotypes and mutants were identified among the backcross progeny. The chromosomal recombination between the A and C genomes and the chromosomal asymmetric segregation were revealed using Simple Sequence Repeats (SSR) markers. These findings provide direct evidence in support of the hypothesis that interspecific hybridization and backcrossing have played roles in the evolution of the vast variety of vegetables among these species and suggest that combination of interspecific hybridization and backcrossing may facilitate the development of new mutants and novel phenotypes for both basic research and the breeding of new vegetable crops.

  18. Use of Se-enriched mustard and canola seed meals as potential bioherbicides and green fertilizers in strawberry production (United States)

    New plant-based products can be produced from seed harvested from Brassica species used for phytomanaging selenium (Se) in the westside of central California. We tested Se-enriched seed meals produced from canola (Brassica napus) and mustard (Sinapis alba) plants as potential bio-herbicides and as g...

  19. Amplifying recombination genome-wide and reshaping crossover landscapes in Brassicas (United States)

    Falque, Matthieu; Trotoux, Gwenn; Eber, Frédérique; Nègre, Sylvie; Gilet, Marie; Huteau, Virginie; Lodé, Maryse; Jousseaume, Thibaut; Dechaumet, Sylvain; Morice, Jérôme; Coriton, Olivier; Rousseau-Gueutin, Mathieu


    Meiotic recombination by crossovers (COs) is tightly regulated, limiting its key role in producing genetic diversity. However, while COs are usually restricted in number and not homogenously distributed along chromosomes, we show here how to disrupt these rules in Brassica species by using allotriploid hybrids (AAC, 2n = 3x = 29), resulting from the cross between the allotetraploid rapeseed (B. napus, AACC, 2n = 4x = 38) and one of its diploid progenitors (B. rapa, AA, 2n = 2x = 20). We produced mapping populations from different genotypes of both diploid AA and triploid AAC hybrids, used as female and/or as male. Each population revealed nearly 3,000 COs that we studied with SNP markers well distributed along the A genome (on average 1 SNP per 1.25 Mbp). Compared to the case of diploids, allotriploid hybrids showed 1.7 to 3.4 times more overall COs depending on the sex of meiosis and the genetic background. Most surprisingly, we found that such a rise was always associated with (i) dramatic changes in the shape of recombination landscapes and (ii) a strong decrease of CO interference. Hybrids carrying an additional C genome exhibited COs all along the A chromosomes, even in the vicinity of centromeres that are deprived of COs in diploids as well as in most studied species. Moreover, in male allotriploid hybrids we found that Class I COs are mostly responsible for the changes of CO rates, landscapes and interference. These results offer the opportunity for geneticists and plant breeders to dramatically enhance the generation of diversity in Brassica species by disrupting the linkage drag coming from limits on number and distribution of COs. PMID:28493942

  20. Oilseed brassica improvement through induced mutations

    International Nuclear Information System (INIS)

    Shah, S.A.; Ali, I.; Rehman, K.


    The improvement in processing and refining technologies of oil seed brassica have now made possible the use of rape seed mustard oil as cooking medium shortening, salad ingredients and in margarine in many countries. Different promising rape seed mutants were tested for yield and other agronomic traits in eight preliminary yields trails and results of these trails are presented in this report. Three varieties of rape seeds were subjected to 80, 100, 120 krads and two varieties of mustard were treated 60, 80, 100 krads dose of gamma rays. (A.B.)

  1. Origination, expansion, evolutionary trajectory, and expression bias of AP2/ERF superfamily in Brassica napus

    Directory of Open Access Journals (Sweden)

    Xiaoming Song


    Full Text Available The AP2/ERF superfamily, one of the most important transcription factor families, plays crucial roles in response to biotic and abiotic stresses. So far, a comprehensive evolutionary inference of its origination and expansion has not been available. Here, we identified 515 AP2/ERF genes in B. napus, a neo-tetraploid forming ~7500 years ago, and found that 82.14% of them were duplicated in the tetraploidization. A prominent subgenome bias was revealed in gene expression, tissue-specific, and gene conversion. Moreover, a large-scale analysis across plants and alga suggested that this superfamily could have been originated from AP2 family, expanding to form other families (ERF, and RAV. This process was accompanied by duplicating and/or alternative deleting AP2 domain, intragenic domain sequence conversion, and/or by acquiring other domains, resulting in copy number variations, alternatively contributing to functional innovation. We found that significant positive selection occurred at certain critical nodes during the evolution of land plants, possibly responding to changing environment. In conclusion, the present research revealed origination, functional innovation, and evolutionary trajectory of the AP2/ERF superfamily, contributing to understanding their roles in plant stress tolerance.

  2. The BnALMT1 Protein That is an Aluminum-Activated Malate Transporter is Localized in the Plasma Membrane


    Ligaba, Ayalew; Katsuhara, Maki; Sakamoto, Wataru; Matsumoto, Hideaki


    We have previously reported that Al-induces citrate and malate efflux from P-sufficient and P-deficient plants of rape (Brassica napus L.) and that P-deficiency alone could not induce this response. Further investigation showed that the transcript of two genes designated BnALMT1 and BnALMT2 is accumulated in roots by Al-treatment. Transgenic tobacco cells (Nicotiana tabacum) and Xenopus laevis oocytes expressing the BnALMT1 and BnALMT2 proteins released more malate than control cells in the p...

  3. Lambs Fed Fresh Winter Forage Rape (Brassica napus L.) Emit Less Methane than Those Fed Perennial Ryegrass (Lolium perenne L.), and Possible Mechanisms behind the Difference (United States)

    Sun, Xuezhao; Henderson, Gemma; Cox, Faith; Molano, German; Harrison, Scott J.; Luo, Dongwen; Janssen, Peter H.; Pacheco, David


    The objectives of this study were to examine long-term effects of feeding forage rape (Brassica napus L.) on methane yields (g methane per kg of feed dry matter intake), and to propose mechanisms that may be responsible for lower emissions from lambs fed forage rape compared to perennial ryegrass (Lolium perenne L.). The lambs were fed fresh winter forage rape or ryegrass as their sole diet for 15 weeks. Methane yields were measured using open circuit respiration chambers, and were 22-30% smaller from forage rape than from ryegrass (averages of 13.6 g versus 19.5 g after 7 weeks, and 17.8 g versus 22.9 g after 15 weeks). The difference therefore persisted consistently for at least 3 months. The smaller methane yields from forage rape were not related to nitrate or sulfate in the feed, which might act as alternative electron acceptors, or to the levels of the potential inhibitors glucosinolates and S-methyl L-cysteine sulfoxide. Ruminal microbial communities in forage rape-fed lambs were different from those in ryegrass-fed lambs, with greater proportions of potentially propionate-forming bacteria, and were consistent with less hydrogen and hence less methane being produced during fermentation. The molar proportions of ruminal acetate were smaller and those of propionate were greater in forage rape-fed lambs, consistent with the larger propionate-forming populations and less hydrogen production. Forage rape contained more readily fermentable carbohydrates and less structural carbohydrates than ryegrass, and was more rapidly degraded in the rumen, which might favour this fermentation profile. The ruminal pH was lower in forage rape-fed lambs, which might inhibit methanogenic activity, shifting the rumen fermentation to more propionate and less hydrogen and methane. The significance of these two mechanisms remains to be investigated. The results suggest that forage rape is a potential methane mitigation tool in pastoral-based sheep production systems. PMID:25803688

  4. Cadmium-Induced Hydrogen Accumulation Is Involved in Cadmium Tolerance in Brassica campestris by Reestablishment of Reduced Glutathione Homeostasis. (United States)

    Wu, Qi; Su, Nana; Chen, Qin; Shen, Wenbiao; Shen, Zhenguo; Xia, Yan; Cui, Jin


    Hydrogen gas (H2) was recently proposed as a therapeutic antioxidant and signaling molecule in clinical trials. However, the underlying physiological roles of H2 in plants remain unclear. In the present study, hydrogen-rich water (HRW) was used to characterize the physiological roles of H2 in enhancing the tolerance of Brassica campestris against cadmium (Cd). The results showed that both 50 μM CdCl2 and 50%-saturated HRW induced an increase of endogenous H2 in Brassica campestris seedlings, and HRW alleviated Cd toxicity related to growth inhibition and oxidative damage. Seedlings supplied with HRW exhibited increased root length and reduced lipid peroxidation, similar to plants receiving GSH post-treatment. Additionally, seedlings post-treated with HRW accumulated higher levels of reduced glutathione (GSH) and ascorbic acid (AsA) and showed increased GST and GPX activities in roots. Molecular evidence illustrated that the expression of genes such as GS, GR1 and GR2, which were down-regulated following the addition of Cd, GSH or BSO, could be reversed to varying degrees by the addition of HRW. Based on these results, it could be proposed that H2 might be an important regulator for enhancing the tolerance of Brassica campestris seedlings against Cd, mainly by governing reduced glutathione homeostasis.

  5. Phospholipase Dε enhances Braasca napus growth and seed production in response to nitrogen availability. (United States)

    Lu, Shaoping; Yao, Shuaibing; Wang, Geliang; Guo, Liang; Zhou, Yongming; Hong, Yueyun; Wang, Xuemin


    Phospholipase D (PLD), which hydrolyses phospholipids to produce phosphatidic acid, has been implicated in plant response to macronutrient availability in Arabidopsis. This study investigated the effect of increased PLDε expression on nitrogen utilization in Brassica napus to explore the application of PLDε manipulation to crop improvement. In addition, changes in membrane lipid species in response to nitrogen availability were determined in the oil seed crop. Multiple PLDε over expression (PLDε-OE) lines displayed enhanced biomass accumulation under nitrogen-deficient and nitrogen-replete conditions. PLDε-OE plants in the field produced more seeds than wild-type plants but have no impact on seed oil content. Compared with wild-type plants, PLDε-OE plants were enhanced in nitrate transporter expression, uptake and reduction, whereas the activity of nitrite reductase was higher under nitrogen-depleted, but not at nitrogen-replete conditions. The level of nitrogen altered membrane glycerolipid metabolism, with greater impacts on young than mature leaves. The data indicate increased expression of PLDε has the potential to improve crop plant growth and production under nitrogen-depleted and nitrogen-replete conditions. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  6. Defective APETALA2 Genes Lead to Sepal Modification in Brassica Crops (United States)

    Zhang, Yanfeng; Huang, Shuhua; Wang, Xuefang; Liu, Jianwei; Guo, Xupeng; Mu, Jianxin; Tian, Jianhua; Wang, Xiaofeng


    Many vegetable and oilseed crops belong to Brassica species. The seed production of these crops is hampered often by abnormal floral organs, especially under the conditions of abiotic conditions. However, the molecular reasons for these abnormal floral organs remains poorly understood. Here, we report a novel pistil-like flower mutant of B. rapa. In the flower of this mutant, the four sepals are modified to one merged carpel that look like a ring in the sepal positions, enveloping some abnormal stamens and a pistil, and resulting in poor seed production. This novel mutant is named sepal-carpel modification (scm). DNA sequencing showed that the BrAP2a gene, the ortholog of Arabidopsis APETALA2 (AP2) that specifies sepal identity, losses the function of in scm mutant due to a 119-bp repeated sequence insertion that resulted in an early transcription termination. BrAP2b, the paralog of BrAP2a featured two single-nucleotide substitutions that cause a single amino acid substitution in the highly conserved acidic serine-rich transcriptional activation domain. Each of the two BrAP2 genes rescues the sepal defective phenotype of the ap2-5 mutant of Arabidopsis. Furthermore, the knockout mutation of the corresponding BnAP2 genes of oilseed rape (B. napus) by CRISPR/Cas9-mediated genome editing system resulted in scm-like phenotype. These results suggest that BrAP2 gene plays a key role in sepal modification. Our finding provides an insight into molecular mechanism underlying morphological modification of floral organs and is useful for genetic manipulation of flower modification and improvement of seed production of Brassica crops. PMID:29616073

  7. Defective APETALA2 Genes Lead to Sepal Modification in Brassica Crops

    Directory of Open Access Journals (Sweden)

    Yanfeng Zhang


    Full Text Available Many vegetable and oilseed crops belong to Brassica species. The seed production of these crops is hampered often by abnormal floral organs, especially under the conditions of abiotic conditions. However, the molecular reasons for these abnormal floral organs remains poorly understood. Here, we report a novel pistil-like flower mutant of B. rapa. In the flower of this mutant, the four sepals are modified to one merged carpel that look like a ring in the sepal positions, enveloping some abnormal stamens and a pistil, and resulting in poor seed production. This novel mutant is named sepal-carpel modification (scm. DNA sequencing showed that the BrAP2a gene, the ortholog of Arabidopsis APETALA2 (AP2 that specifies sepal identity, losses the function of in scm mutant due to a 119-bp repeated sequence insertion that resulted in an early transcription termination. BrAP2b, the paralog of BrAP2a featured two single-nucleotide substitutions that cause a single amino acid substitution in the highly conserved acidic serine-rich transcriptional activation domain. Each of the two BrAP2 genes rescues the sepal defective phenotype of the ap2-5 mutant of Arabidopsis. Furthermore, the knockout mutation of the corresponding BnAP2 genes of oilseed rape (B. napus by CRISPR/Cas9-mediated genome editing system resulted in scm-like phenotype. These results suggest that BrAP2 gene plays a key role in sepal modification. Our finding provides an insight into molecular mechanism underlying morphological modification of floral organs and is useful for genetic manipulation of flower modification and improvement of seed production of Brassica crops.

  8. Yeast cell wall extract induces disease resistance against bacterial and fungal pathogens in Arabidopsis thaliana and Brassica crop.

    Directory of Open Access Journals (Sweden)

    Mari Narusaka

    Full Text Available Housaku Monogatari (HM is a plant activator prepared from a yeast cell wall extract. We examined the efficacy of HM application and observed that HM treatment increased the resistance of Arabidopsis thaliana and Brassica rapa leaves to bacterial and fungal infections. HM reduced the severity of bacterial leaf spot and anthracnose on A. thaliana and Brassica crop leaves with protective effects. In addition, gene expression analysis of A. thaliana plants after treatment with HM indicated increased expression of several plant defense-related genes. HM treatment appears to induce early activation of jasmonate/ethylene and late activation of salicylic acid (SA pathways. Analysis using signaling mutants revealed that HM required SA accumulation and SA signaling to facilitate resistance to the bacterial pathogen Pseudomonas syringae pv. maculicola and the fungal pathogen Colletotrichum higginsianum. In addition, HM-induced resistance conferred chitin-independent disease resistance to bacterial pathogens in A. thaliana. These results suggest that HM contains multiple microbe-associated molecular patterns that activate defense responses in plants. These findings suggest that the application of HM is a useful tool that may facilitate new disease control methods.

  9. Mercury-induced oxidative stress in Indian mustard (Brassica juncea L.). (United States)

    Shiyab, Safwan; Chen, Jian; Han, Fengxiang X; Monts, David L; Matta, Fank B; Gu, Mengmeng; Su, Yi; Masad, Motasim A


    Mercury, a potent neurotoxin, is released to the environment in significant amounts by both natural processes and anthropogenic activities. No natural hyperaccumulator plant has been reported for mercury phytoremediation. Few studies have been conducted on the physiological responses of Indian mustard, a higher biomass plant with faster growth rates, to mercury pollution. This study investigated the phytotoxicity of mercury to Indian mustard (Brassica juncea L.) and mercury-induced oxidative stress in order to examine the potential application of Indian mustard to mercury phytoremediation. Two common cultivars (Florida Broadleaf and Longstanding) of Indian mustard were grown hydroponically in a mercury-spiked solution. Plant uptake, antioxidative enzymes, peroxides, and lipid peroxidation under mercury stress were investigated. Antioxidant enzymes (catalase, CAT; peroxidase, POD; and superoxide dismutase, SOD) were the most sensitive indices of mercury-induced oxidative response of Indian mustard plants. Indian mustard effectively generated an enzymatic antioxidant defense system (especially CAT) to scavenge H(2)O(2), resulting in lower H(2)O(2) in shoots with higher mercury concentrations. These two cultivars of Indian mustard demonstrated an efficient metabolic defense and adaptation system to mercury-induced oxidative stress. A majority of Hg was accumulated in the roots and low translocations of Hg from roots to shoots were found in two cultivars of Indian mustard. Thus Indian mustard might be a potential candidate plant for phytofiltration/phytostabilization of mercury contaminated waters and wastewater.

  10. Subgenome parallel selection is associated with morphotype diversification and convergent crop domestication in Brassica rapa and Brassica oleracea

    NARCIS (Netherlands)

    Cheng, Feng; Sun, Rifei; Hou, Xilin; Zheng, Hongkun; Zhang, Fenglan; Zhang, Yangyong; Liu, Bo; Liang, Jianli; Zhuang, Mu; Liu, Yunxia; Liu, Dongyuan; Wang, Xiaobo; Li, Pingxia; Liu, Yumei; Lin, Ke; Bucher, Johan; Zhang, Ningwen; Wang, Yan; Wang, Hui; Deng, Jie; Liao, Yongcui; Wei, Keyun; Zhang, Xueming; Fu, Lixia; Hu, Yunyan; Liu, Jisheng; Cai, Chengcheng; Zhang, Shujiang; Zhang, Shifan; Li, Fei; Zhang, Hui; Zhang, Jifang; Guo, Ning; Liu, Zhiyuan; Liu, Jin; Sun, Chao; Ma, Yuan; Zhang, Haijiao; Cui, Yang; Freeling, Micheal R.; Borm, Theo; Bonnema, Guusje; Wu, Jian; Wang, Xiaowu


    Brassica species, including crops such as cabbage, turnip and oilseed, display enormous phenotypic variation. Brassica genomes have all undergone a whole-genome triplication (WGT) event with unknown effects on phenotype diversification. We resequenced 199 Brassica rapa and 119 Brassica oleracea

  11. Breeding response of transcript profiling in developing seeds of Brassica napus

    Directory of Open Access Journals (Sweden)

    Li Xiaodan


    Full Text Available Abstract Background The upgrading of rapeseed cultivars has resulted in a substantial improvement in yield and quality in China over the past 30 years. With the selective pressure against fatty acid composition and oil content, high erucic acid- and low oil-content cultivars have been replaced by low erucic acid- and high oil-content cultivars. The high erucic acid cultivar Zhongyou 821 and its descendent, low erucic acid cultivar Zhongshuang 9, are representatives of two generations of the most outstanding Chinese rapeseed cultivars (B. napus developed the past 2 decades. This paper compares the transcriptional profiles of Zhongshuang 9 and Zhongyou 821 for 32 genes that are principally involved in lipid biosynthesis during seed development in order to elucidate how the transcriptional profiles of these genes responded to quality improvement over the past 20 years. Results Comparison of the cultivar Zhongyou 821 with its descendent, Zhongshuang 9, shows that the transcriptional levels of seven of the 32 genes were upregulated by 30% to 109%, including FAD3, ACCase, FAE1, GKTP, Caleosin, GAPDH, and PEPC. Of the 32 genes, 10 (KAS3, β-CT, BcRK6, P450, FatA, Oleosin, FAD6, FatB, α-CT and SUC1 were downregulated by at least 20% and most by 50%. The Napin gene alone accounted for over 75% of total transcription from all 32 genes assessed in both cultivars. Most of the genes showed significant correlation with fatty acid accumulation, but the correlation in ZS9 was significantly different from that in ZY821. Higher KCR2 activity is associated with higher C16:0, C18:0, and C18:2 in both cultivars, lower C22:1 and total fatty acid content in ZY821, and lower 18:1 in ZS9. Conclusion This paper illustrates the response of the transcription levels of 32 genes to breeding in developing rapeseed seeds. Both cultivars showed similar transcription profiles, with the Napin gene predominantly transcribed. Selective pressure for zero erucic acid, low

  12. Genic Microsatellite Markers in Brassica rapa: Development, Characterization, Mapping, and Their Utility in Other Cultivated and Wild Brassica Relatives (United States)

    Ramchiary, Nirala; Nguyen, Van Dan; Li, Xiaonan; Hong, Chang Pyo; Dhandapani, Vignesh; Choi, Su Ryun; Yu, Ge; Piao, Zhong Yun; Lim, Yong Pyo


    Genic microsatellite markers, also known as functional markers, are preferred over anonymous markers as they reveal the variation in transcribed genes among individuals. In this study, we developed a total of 707 expressed sequence tag-derived simple sequence repeat markers (EST-SSRs) and used for development of a high-density integrated map using four individual mapping populations of B. rapa. This map contains a total of 1426 markers, consisting of 306 EST-SSRs, 153 intron polymorphic markers, 395 bacterial artificial chromosome-derived SSRs (BAC-SSRs), and 572 public SSRs and other markers covering a total distance of 1245.9 cM of the B. rapa genome. Analysis of allelic diversity in 24 B. rapa germplasm using 234 mapped EST-SSR markers showed amplification of 2 alleles by majority of EST-SSRs, although amplification of alleles ranging from 2 to 8 was found. Transferability analysis of 167 EST-SSRs in 35 species belonging to cultivated and wild brassica relatives showed 42.51% (Sysimprium leteum) to 100% (B. carinata, B. juncea, and B. napus) amplification. Our newly developed EST-SSRs and high-density linkage map based on highly transferable genic markers would facilitate the molecular mapping of quantitative trait loci and the positional cloning of specific genes, in addition to marker-assisted selection and comparative genomic studies of B. rapa with other related species. PMID:21768136

  13. Mitochondrial nad2 gene is co-transcripted with CMS-associated orfB gene in cytoplasmic male-sterile stem mustard (Brassica juncea). (United States)

    Yang, Jing-Hua; Zhang, Ming-Fang; Yu, Jing-Quan


    The transcriptional patterns of mitochondrial respiratory related genes were investigated in cytoplasmic male-sterile and fertile maintainer lines of stem mustard, Brassica juncea. There were numerous differences in nad2 (subunit 2 of NADH dehydrogenase) between stem mustard CMS and its maintainer line. One novel open reading frame, hereafter named orfB gene, was located at the downstream of mitochondrial nad2 gene in the CMS. The novel orfB gene had high similarity with YMF19 family protein, orfB in Raphanus sativus, Helianthus annuus, Nicotiana tabacum and Beta vulgaris, orfB-CMS in Daucus carota, atp8 gene in Arabidopsis thaliana, 5' flanking of orf224 in B. napus (nap CMS) and 5' flanking of orf220 gene in CMS Brassica juncea. Three copies probed by specific fragment (amplified by primers of nad2F and nad2R from CMS) were found in the CMS line following Southern blotting digested with HindIII, but only a single copy in its maintainer line. Meanwhile, two transcripts were shown in the CMS line following Northern blotting while only one transcript was detected in the maintainer line, which were probed by specific fragment (amplified by primers of nad2F and nad2R from CMS). Meanwhile, the expression of nad2 gene was reduced in CMS bud compared to that in its maintainer line. We thus suggested that nad2 gene may be co-transcripted with CMS-associated orfB gene in the CMS. In addition, the specific fragment that was amplified by primers of nad2F and nad2R just spanned partial sequences of nad2 gene and orfB gene. Such alterations in the nad2 gene would impact the activity of NADH dehydrogenase, and subsequently signaling, inducing the expression of nuclear genes involved in male sterility in this type of cytoplasmic male sterility.

  14. Characterization of cysteine-degrading and H2S-releasing enzymes of higher plants - from the field to the test tube and back. (United States)

    Papenbrock, J; Riemenschneider, A; Kamp, A; Schulz-Vogt, H N; Schmidt, A


    Due to the clean air acts and subsequent reduction of emission of gaseous sulfur compounds sulfur deficiency became one of the major nutrient disorders in Northern Europe. Typical sulfur deficiency symptoms can be diagnosed. Especially plants of the Cruciferae family are more susceptible against pathogen attack. Sulfur fertilization can in part recover or even increase resistance against pathogens in comparison to sulfur-deficient plants. The term sulfur-induced resistance (SIR) was introduced, however, the molecular basis for SIR is largely unknown. There are several sulfur-containing compounds in plants which might be involved in SIR, such as high levels of thiols, glucosinolates, cysteine-rich proteins, phytoalexins, elemental sulfur, or H2S. Probably more than one strategy is used by plants. Species- or even variety-dependent differences in the development of SIR are probably used. Our research focussed mainly on the release of H2S as defence strategy. In field experiments using different BRASSICA NAPUS genotypes it was shown that the genetic differences among BRASSICA genotypes lead to differences in sulfur content and L-cysteine desulfhydrase activity. Another field experiment demonstrated that sulfur supply and infection with PYRENOPEZIZA BRASSICA influenced L-cysteine desulfhydrase activity in BRASSICA NAPUS. Cysteine-degrading enzymes such as cysteine desulfhydrases are hypothesized to be involved in H2S release. Several L- and D-cysteine-specific desulfhydrase candidates have been isolated and partially analyzed from the model plant ARABIDOPSIS THALIANA. However, it cannot be excluded that H2S is also released in a partial back reaction of O-acetyl-L-serine(thiol)lyase or enzymes not yet characterized. For the exact determination of the H2S concentration in the cell a H2S-specific microsensor was used the first time for plant cells. The transfer of the results obtained for application back on BRASSICA was initiated.

  15. Production of viable male unreduced gametes in Brassica interspecific hybrids is genotype specific and stimulated by cold temperatures

    Directory of Open Access Journals (Sweden)

    Cowling Wallace A


    Full Text Available Abstract Background Unreduced gametes (gametes with the somatic chromosome number may provide a pathway for evolutionary speciation via allopolyploid formation. We evaluated the effect of genotype and temperature on male unreduced gamete formation in Brassica allotetraploids and their interspecific hybrids. The frequency of unreduced gametes post-meiosis was estimated in sporads from the frequency of dyads or giant tetrads, and in pollen from the frequency of viable giant pollen compared with viable normal pollen. Giant tetrads were twice the volume of normal tetrads, and presumably resulted from pre-meiotic doubling of chromosome number. Giant pollen was defined as pollen with more than 1.5 × normal diameter, under the assumption that the doubling of DNA content in unreduced gametes would approximately double the pollen cell volume. The effect of genotype was assessed in five B. napus, two B. carinata and one B. juncea parents and in 13 interspecific hybrid combinations. The effect of temperature was assessed in a subset of genotypes in hot (day/night 30°C/20°C, warm (25°C/15°C, cool (18°C/13°C and cold (10°C/5°C treatments. Results Based on estimates at the sporad stage, some interspecific hybrid genotypes produced unreduced gametes (range 0.06 to 3.29% at more than an order of magnitude higher frequency than in the parents (range 0.00% to 0.11%. In nine hybrids that produced viable mature pollen, the frequency of viable giant pollen (range 0.2% to 33.5% was much greater than in the parents (range 0.0% to 0.4%. Giant pollen, most likely formed from unreduced gametes, was more viable than normal pollen in hybrids. Two B. napus × B. carinata hybrids produced 9% and 23% unreduced gametes based on post-meiotic sporad observations in the cold temperature treatment, which was more than two orders of magnitude higher than in the parents. Conclusions These results demonstrate that sources of unreduced gametes, required for the triploid

  16. Cytoplasmic and Genomic Effects on Meiotic Pairing in Brassica Hybrids and Allotetraploids from Pair Crosses of Three Cultivated Diploids (United States)

    Cui, Cheng; Ge, Xianhong; Gautam, Mayank; Kang, Lei; Li, Zaiyun


    Interspecific hybridization and allopolyploidization contribute to the origin of many important crops. Synthetic Brassica is a widely used model for the study of genetic recombination and “fixed heterosis” in allopolyploids. To investigate the effects of the cytoplasm and genome combinations on meiotic recombination, we produced digenomic diploid and triploid hybrids and trigenomic triploid hybrids from the reciprocal crosses of three Brassica diploids (B. rapa, AA; B. nigra, BB; B. oleracea, CC). The chromosomes in the resultant hybrids were doubled to obtain three allotetraploids (B. juncea, AA.BB; B. napus, AA.CC; B. carinata, BB.CC). Intra- and intergenomic chromosome pairings in these hybrids were quantified using genomic in situ hybridization and BAC-FISH. The level of intra- and intergenomic pairings varied significantly, depending on the genome combinations and the cytoplasmic background and/or their interaction. The extent of intragenomic pairing was less than that of intergenomic pairing within each genome. The extent of pairing variations within the B genome was less than that within the A and C genomes, each of which had a similar extent of pairing. Synthetic allotetraploids exhibited nondiploidized meiotic behavior, and their chromosomal instabilities were correlated with the relationship of the genomes and cytoplasmic background. Our results highlight the specific roles of the cytoplasm and genome to the chromosomal behaviors of hybrids and allopolyploids. PMID:22505621

  17. The Emerging British Verticillium longisporum Population Consists of Aggressive Brassica Pathogens. (United States)

    Depotter, Jasper R L; Rodriguez-Moreno, Luis; Thomma, Bart P H J; Wood, Thomas A


    Verticillium longisporum is an economically important fungal pathogen of brassicaceous crops that originated from at least three hybridization events between different Verticillium spp., leading to the hybrid lineages A1/D1, A1/D2, and A1/D3. Isolates of lineage A1/D1 generally cause stem striping on oilseed rape (Brassica napus), which has recently been reported for the first time to occur in the United Kingdom. Intriguingly, the emerging U.K. population is distinct from the north-central European stem striping population. Little is known about the pathogenicity of the newly emerged U.K. population; hence, pathogenicity tests were executed to compare British isolates to previously characterized reference strains. In addition to the model plant Arabidopsis thaliana, the pathogenicity of four British isolates was assessed on four cultivars of three Brassica crop species: oilseed rape (Quartz and Incentive), cauliflower (Clapton), and Chinese cabbage (Hilton). To this end, vascular discoloration of the roots, plant biomass accumulations, and fungal stem colonization upon isolate infection were evaluated. The British isolates appeared to be remarkably aggressive, because plant biomass was significantly affected and severe vascular discoloration was observed. The British isolates were successful stem colonizers and the extent of fungal colonization negatively correlated with plant biomass of cauliflower and Quartz oilseed rape. However, in Quartz, the fungal colonization of A1/D1 isolates was significantly lower than that of the virulent reference isolate from lineage A1/D3, PD589. Moreover, despite levels of stem colonization similar to those of A1/D1 strains, PD589 did not cause significant disease on Incentive. Thus, A1/D1 isolates, including British isolates, are aggressive oilseed rape pathogens despite limited colonization levels in comparison with a virulent A1/D3 isolate.

  18. Growth of Verticillium longisporum in Xylem Sap of Brassica napus is Independent from Cultivar Resistance but Promoted by Plant Aging. (United States)

    Lopisso, Daniel Teshome; Knüfer, Jessica; Koopmann, Birger; von Tiedemann, Andreas


    As Verticillium stem striping of oilseed rape (OSR), a vascular disease caused by Verticillium longisporum, is extending into new geographic regions and no control with fungicides exists, the demand for understanding mechanisms of quantitative resistance increases. Because V. longisporum is strictly limited to the xylem and resistance is expressed in the systemic stage post root invasion, we investigated a potential antifungal role of soluble constituents and nutritional conditions in xylem sap as determinants of cultivar resistance of OSR to V. longisporum. Assessment of biometric and molecular genetic parameters applied to describe V. longisporum resistance (net area under disease progress curve, stunting, stem thickness, plant biomass, and V. longisporum DNA content) showed consistent susceptibility of cultivar 'Falcon' in contrast to two resistant genotypes, 'SEM' and 'Aviso'. Spectrophotometric analysis revealed a consistently stronger in vitro growth of V. longisporum in xylem sap extracted from OSR compared with the water control. Further comparisons of fungal growth in xylem sap of different cultivars revealed the absence of constitutive or V. longisporum induced antifungal activity in the xylem sap of resistant versus susceptible genotypes. The similar growth of V. longisporum in xylem sap, irrespective of cultivar, infection with V. longisporum and xylem sap filtration, was correlated with about equal amounts of total soluble proteins in xylem sap from these treatments. Interestingly, compared with younger plants, xylem sap from older plants induced significantly stronger fungal growth. Growth enhancement of V. longisporum in xylem sap of aging plants was reflected by increased contents of carbohydrates, which was consistent in mock or V. longisporum-infected plants and independent from cultivar resistance. The improved nutritional conditions in the xylem of more mature plants may explain the late appearance of disease symptoms, which are observed only in

  19. Growth and ions (Na/sup +/, K/sup +/ and Cl/sup-1/-) accumulating pattern of some brassica genotypes under saline - sodic field condition

    International Nuclear Information System (INIS)

    Shirazi, M.U.; Ali, M.; Khan, M.A.; Mumtaz, S.; Rajpoot, M.A.; Ali, M.


    The growth and ionic uptake pattern of some Brassica genotypes i.e., Rainbow, Wester, Durr-e-NIFA, Abaseen 95 (Brassica napus) and NIFA raya (Brassica juncea) under saline-sodic field conditions was studied. Two sets of experiments on normal and saline-sodic site were conducted at NIA experimental farm, Tandojam, Pakistan during Rabi 2006-07. The salinity of the experimental site ranged between 11.0-22.9 dS/m and the pH was alkaline (8-8.6). The dominant cation was sodium (Na). The growth performance was recorded at the time of crop harvest in terms of plant height, grain weight / plant, grain yield and 100 grain weight. It was observed that the performance of Wester was better followed by NIFA- raya. The ionic uptake pattern, of leaves, stem and roots showed that the accumulation of Na was less in leaf as compared to stem and roots. However, the genotypes having better performance we re found to have accumulating type of behavior showing comparatively higher Na contents in all plant parts than other genotypes. This suggests that these genotypes might adjust their osmotic potential through the accumulation of sodium in vacuole. On the other hand trend in case of K accumulation was reverse i.e. high in leaves and stem as compared to roots. Higher accumulating pattern of K in leaves might be helpful for reducing the toxic effects of sodium. However, no correlation was observed between K-Na selectivity or K/Na ratio among the genotypes tested. It is therefore concluded that better selective mechanism for Na uptake and strict control of intercellular Na influx for cellular osmotic adjustment could be selected for saline environment. (author)

  20. (Brassica napus L.) cultivars

    African Journals Online (AJOL)



    Mar 7, 2011 ... African Journal of Biotechnology Vol. 10(10), pp. 1827-1832, 7 ... and even death (Zhu, 2001). ... as a nitrogen fertilizer equivalent to 150 kg N ha-1 and triple- super- ... negatively the plant fresh weight, but the effect ratio.

  1. Early interspecific interference in the wheat/faba bean (Triticum aestivum/ Vicia faba ssp. minor and rapeseed/squarrosum clover (Brassica napus var. oleifera/Trifolium squarrosum intercrops

    Directory of Open Access Journals (Sweden)

    Paolo Benincasa


    Full Text Available Most of research on intercrops evaluate performances and interference between species on the basis of final yield, while little knowledge is available on the interference in early stages and at the root level, at least for cultivated intercrops. In fact, in the few studies on this subject species are often combined minding at experimental needs (e.g. common substrate, temperature and water requirements, easy root separation more than at their actual use in the farm. The present work evaluates interspecific interference during early developmental stages for two intercrops of agricultural interest: soft wheat-faba bean and rapeseed-squarrosum clover. Improving this knowledge would help intercrop growth modelling and rational cultivation. The experiments were carried out on soft wheat (Triticum aestivum, faba bean (Vicia faba var. minor, rapeseed (Brassica napus var. oleifera and squarrosum clover (Trifolium squarrosum, germinated and grown until 32 days after sowing (DAS as one-species stands or as wheat/faba bean and rapeseed/squarrosum clover intercrops, with different densities and proportions for the two species in each couple. Germination was studied in controlled-temperature chamber, plantlet growth was studied on pots in the greenhouse. During germination no interspecific interference was observed for both wheat/faba bean and rapeseed/squarrosum clover intercrops. During plantlet growth, interspecific interference occurred in both intercrops causing variations in whole plant and root dry matter accumulation. In the wheat/faba bean intercrop each species suffered from the competitive effect of the companion species and faba bean was the dominant species when present in lower proportion than wheat. The unexpectedly high aggressivity of faba bean may be explained either with the greater seed size that could have represented an initial advantage within the short duration of the experiment or with the competition towards wheat for substrate N

  2. Cardinal Temperatures of Brassica sp. and How to Determine It

    Directory of Open Access Journals (Sweden)



    Full Text Available Cardinal temperatures consist of minimum, optimum and maximum of plant growth, and might beable to be determined by assessing effect of temperature on seed germination. An experiment ofseed germination was conducted in laboratory, using thermal gradient plate for ten days. To test hypothesisthat rapeseed genotypes vary in their response to temperatures. The design of this experiment was asplit plot with four replications. The main-treatments were 14 different temperatures: 0.4°C, 3.3°C,7.8°C, 11.6°C, 13.3°C, 15.0°C, 16.8°C, 18.3°C, 20.9°C, 21.1°C, 25.6°C, 29.0°C, 33.0°C and36.3°C. Sub-treatments were 6 brassica genotypes: Brassica napus genotypes (Tatyoon and Marnoo;B. campestris (Jumbuck and Chinoli B; B. juncea (No. 81797 and Zero Erusic Mustard (ZEM 2.Each treatment was using 50 seeds. Germinations were observed daily for ten days and data wereanalyzed with regression and correlation. Genotypes responded differently to temperatures with Jumbuckthe most sensitive to low temperature with minimum temperature (7.90°C, then respectively followedby Chinoli B (6.36°C, ZEM 2 (4.77°C, Tatyoon (4.63°C, No. 81797 (2.59°C, and Marnoo(1.00°C. For high temperature the most sensitive was No. 81797 with maximum temperature 38.61°C.and then respectively followed by Marnoo (39.76°C, Chinoli B (42.93°C, Tatyoon (43.79°C,Jumbuck (44.58°C and ZEM 2 (45.88°C. Optimum temperatures were for Jumbuck was 24.56°C,ZEM 2 (26.95°C, Tatyoon (27.12°C, No. 81797 (28.12°C, Chinoli B (29.74°C and Marnoo(30.48°C.

  3. Isolation and characterization of useful mutants induced by gamma irradiation in 'Kranti' indian mustard (Brassica juncea)

    International Nuclear Information System (INIS)

    Rai, B.; Kumar, H.


    Genetic variability was induced, in the 'Kranti' Indian mustard [Brassica/juncea (L.) Czemj. & Cosson]. utilizing 30,40 and 50 kr doses of gamma-ray Irradiation. 'In M 3 generation, compared with the econtrol, substantial decrease was observed in the mean value of various quantitative characters in the mutagen-treated populations. More variation was induced at 30 kr compared with that at 40 or 50 kr dose. Four mutants were identified ar 30 kr dose, which besides being early in maturity, gave better yield also-compared with the control. The better seed yield of the transmutated plants was due either to increase in seed weight or to increase in number of siliquae/plant

  4. The endogenous nitric oxide mediates selenium-induced phytotoxicity by promoting ROS generation in Brassica rapa.

    Directory of Open Access Journals (Sweden)

    Yi Chen

    Full Text Available Selenium (Se is suggested as an emerging pollutant in agricultural environment because of the increasing anthropogenic release of Se, which in turn results in phytotoxicity. The most common consequence of Se-induced toxicity in plants is oxidative injury, but how Se induces reactive oxygen species (ROS burst remains unclear. In this work, histofluorescent staining was applied to monitor the dynamics of ROS and nitric oxide (NO in the root of Brassica rapa under Se(IV stress. Se(IV-induced faster accumulation of NO than ROS. Both NO and ROS accumulation were positively correlated with Se(IV-induced inhibition of root growth. The NO accumulation was nitrate reductase (NR- and nitric oxide synthase (NOS-dependent while ROS accumulation was NADPH oxidase-dependent. The removal of NO by NR inhibitor, NOS inhibitor, and NO scavenger could alleviate Se(IV-induced expression of Br_Rbohs coding for NADPH oxidase and the following ROS accumulation in roots, which further resulted in the amelioration of Se(IV-induced oxidative injury and growth inhibition. Thus, we proposed that the endogenous NO played a toxic role in B. rapa under Se(IV stress by triggering ROS burst. Such findings can be used to evaluate the toxic effects of Se contamination on crop plants.

  5. User Guidelines for the Brassica Database: BRAD. (United States)

    Wang, Xiaobo; Cheng, Feng; Wang, Xiaowu


    The genome sequence of Brassica rapa was first released in 2011. Since then, further Brassica genomes have been sequenced or are undergoing sequencing. It is therefore necessary to develop tools that help users to mine information from genomic data efficiently. This will greatly aid scientific exploration and breeding application, especially for those with low levels of bioinformatic training. Therefore, the Brassica database (BRAD) was built to collect, integrate, illustrate, and visualize Brassica genomic datasets. BRAD provides useful searching and data mining tools, and facilitates the search of gene annotation datasets, syntenic or non-syntenic orthologs, and flanking regions of functional genomic elements. It also includes genome-analysis tools such as BLAST and GBrowse. One of the important aims of BRAD is to build a bridge between Brassica crop genomes with the genome of the model species Arabidopsis thaliana, thus transferring the bulk of A. thaliana gene study information for use with newly sequenced Brassica crops.

  6. Incorporation of [14C]-palmitate into lipids of Brassica cells during the induction of freezing tolerance

    International Nuclear Information System (INIS)

    Lynch, D.V.; Joseph, R.A.


    Changes in plasma membrane lipid composition have been causally related to increased freezing tolerance. Studies of lipid metabolism during ABA induction of freezing tolerance in Brassica napus suspension cultures were undertaken. Cells were labeled with [ 14 C]-palmitate four days after transfer to fresh medium (control) or medium containing ABA (which increases freezing tolerance). At times between one and 20 hrs after labeling, ABA-treated cells incorporated almost twice the amount of label as controls cells. Approximately 80% of the radioactivity was associated with neutral lipids in ABA-treated cells and controls. Incorporation of label into total cellular polar lipids was 4.9 x 10 5 dpm/mg protein for control cells and 1 x 10 6 dpm/mg protein for cells transferred to medium containing ABA. Analysis of lipids following alkaline hydrolysis indicated that incorporation of [ 14 C]-palmitate into glucosylceramide of ABA-treated cells was less than 60% of control values when expressed relative to that of the total polar lipids. Incorporation into ceramides was also depressed in ABA-treated cells

  7. Effects of different combinations and concentrations of growth ...

    African Journals Online (AJOL)



    Nov 16, 2009 ... artificial seed (Büyükalaca and Mavituna, 1995; Vicient and Martinez .... light stimulated somatic embryo formation and maturation in Brassica napus. .... Effects of Abscisic Acid on Somatic Embryogenesis and Induction of.

  8. The effect of nitrogen and sulphur on the agronomical and water use ...

    African Journals Online (AJOL)

    The effect of nitrogen and sulphur on the agronomical and water use efficiencies of canola (Brassica napus L.) grown in selected localities of the Western Cape province, South Africa. Wonder Ngezimana, Gert A. Agenbag ...

  9. Development of transgenic finger millet (Eleusine coracana (L ...

    Indian Academy of Sciences (India)


    Jan 18, 2012 ... plants engineered with chitinase gene have been found to be effective in .... primers (forward: 5′ GCTTCTACACCTACGACGCCTT 3′; reverse: ..... and Toppan A 1996 Field tolerance to fungal pathogens of. Brassica napus ...

  10. Vernalization and photoperiod-related changes in the DNA methylation state in winter and spring rapeseed

    Czech Academy of Sciences Publication Activity Database

    Guzy-Wrobelska, J.; Filek, M.; Kaliciak, A.; Szarejko, I.; Macháčková, Ivana; Krekule, Jan; Barciszewska, M.


    Roč. 35, č. 3 (2013), s. 817-827 ISSN 0137-5881 Institutional research plan: CEZ:AV0Z50380511 Keywords : Brassica napus * DNA methylation * MSAP Subject RIV: EF - Botanics Impact factor: 1.524, year: 2013

  11. African Journal of Biotechnology - Vol 8, No 20 (2009)

    African Journals Online (AJOL)

    Identification of differentially expressed genes in seeds of two Brassica napus ... DNA in burial place remains of Turkey using real time polymerase chain reaction ... Varietal response of four cowpea cultivars (Vigna unguiculata L. Walp) to ...

  12. Effect of different doses of urea on the uptake of cadmium from soil ...

    African Journals Online (AJOL)



    Jan 19, 2012 ... uptake by canola (Brassica napus L.) applied in full and split doses. Nine different ... production of ruminants being reared on the pasture. Key words: ... combined nitrogen fertilizer used in today's agricultural practices ...

  13. Download this PDF file

    African Journals Online (AJOL)

    ajl yemi


    Nov 30, 2011 ... Morphological data included plant height (cm), number of days to emergence, number .... Option500 and Fusia; third group contained. Option501 ..... Summer Rapeseed (Brassica napus ssp. oleifera L.) cultivars for yield and ...

  14. Subgenome parallel selection is associated with morphotype diversification and convergent crop domestication in Brassica rapa and Brassica oleracea. (United States)

    Cheng, Feng; Sun, Rifei; Hou, Xilin; Zheng, Hongkun; Zhang, Fenglan; Zhang, Yangyong; Liu, Bo; Liang, Jianli; Zhuang, Mu; Liu, Yunxia; Liu, Dongyuan; Wang, Xiaobo; Li, Pingxia; Liu, Yumei; Lin, Ke; Bucher, Johan; Zhang, Ningwen; Wang, Yan; Wang, Hui; Deng, Jie; Liao, Yongcui; Wei, Keyun; Zhang, Xueming; Fu, Lixia; Hu, Yunyan; Liu, Jisheng; Cai, Chengcheng; Zhang, Shujiang; Zhang, Shifan; Li, Fei; Zhang, Hui; Zhang, Jifang; Guo, Ning; Liu, Zhiyuan; Liu, Jin; Sun, Chao; Ma, Yuan; Zhang, Haijiao; Cui, Yang; Freeling, Micheal R; Borm, Theo; Bonnema, Guusje; Wu, Jian; Wang, Xiaowu


    Brassica species, including crops such as cabbage, turnip and oilseed, display enormous phenotypic variation. Brassica genomes have all undergone a whole-genome triplication (WGT) event with unknown effects on phenotype diversification. We resequenced 199 Brassica rapa and 119 Brassica oleracea accessions representing various morphotypes and identified signals of selection at the mesohexaploid subgenome level. For cabbage morphotypes with their typical leaf-heading trait, we identified four subgenome loci that show signs of parallel selection among subgenomes within B. rapa, as well as four such loci within B. oleracea. Fifteen subgenome loci are under selection and are shared by these two species. We also detected strong subgenome parallel selection linked to the domestication of the tuberous morphotypes, turnip (B. rapa) and kohlrabi (B. oleracea). Overall, we demonstrated that the mesohexaploidization of the two Brassica genomes contributed to their diversification into heading and tuber-forming morphotypes through convergent subgenome parallel selection of paralogous genes.

  15. Complete mitochondrial genome sequence of black mustard (Brassica nigra; BB) and comparison with Brassica oleracea (CC) and Brassica carinata (BBCC). (United States)

    Yamagishi, Hiroshi; Tanaka, Yoshiyuki; Terachi, Toru


    Crop species of Brassica (Brassicaceae) consist of three monogenomic species and three amphidiploid species resulting from interspecific hybridizations among them. Until now, mitochondrial genome sequences were available for only five of these species. We sequenced the mitochondrial genome of the sixth species, Brassica nigra (nuclear genome constitution BB), and compared it with those of Brassica oleracea (CC) and Brassica carinata (BBCC). The genome was assembled into a 232 145 bp circular sequence that is slightly larger than that of B. oleracea (219 952 bp). The genome of B. nigra contained 33 protein-coding genes, 3 rRNA genes, and 17 tRNA genes. The cox2-2 gene present in B. oleracea was absent in B. nigra. Although the nucleotide sequences of 52 genes were identical between B. nigra and B. carinata, the second exon of rps3 showed differences including an insertion/deletion (indel) and nucleotide substitutions. A PCR test to detect the indel revealed intraspecific variation in rps3, and in one line of B. nigra it amplified a DNA fragment of the size expected for B. carinata. In addition, the B. carinata lines tested here produced DNA fragments of the size expected for B. nigra. The results indicate that at least two mitotypes of B. nigra were present in the maternal parents of B. carinata.

  16. Comparative mapping reveals similar linkage of functional genes to ...

    Indian Academy of Sciences (India)

    related traits between Brassica napus and Oryza sativa. Fupeng Li, Chaozhi Ma, Qingfang Chen, Touming Liu, Jinxiong Shen, Jinxing Tu, Yongzhong Xing and Tingdong Fu. J. Genet. 91, 163–170. Length of. Position of. Position of. Expect.

  17. Tolerence of Braccica nigra to Pieris brassicae herbivory

    NARCIS (Netherlands)

    Blatt, S.E.; Smallegange, R.C.; Hess, L.; Harvey, J.A.; Dicke, D.; van Loon, J.J.A.


    Black mustard, Brassica nigra (L.) Koch, is a wild annual species found throughout Europe and fed on by larvae of the large cabbage-white butterfly, Pieris brassicae L. We examined the impact of herbivory from P. brassicae, a gregarious herbivore, on B. nigra grown from wild seed collected locally.

  18. Collinearity analysis of Brassica A and C genomes based on an updated inferred unigene order

    Directory of Open Access Journals (Sweden)

    Ian Bancroft


    Full Text Available This data article includes SNP scoring across lines of the Brassica napus TNDH population based on Illumina sequencing of mRNA, expanded to 75 lines. The 21, 323 mapped markers defined 887 recombination bins, representing an updated genetic linkage map for the species. Based on this new map, 5 genome sequence scaffolds were split and the order and orientation of scaffolds updated to establish a new pseudomolecule specification. The order of unigenes and SNP array probes within these pseudomolecules was determined. Unigenes were assessed for sequence similarity to the A and C genomes. The 57, 246 that mapped to both enabled the collinearity of the A and C genomes to be illustrated graphically. Although the great majority was in collinear positions, some were not. Analyses of 60 such instances are presented, suggesting that the breakdown in collinearity was largely due to either the absence of the homoeologue on one genome (resulting in sequence match to a paralogue or multiple similar sequences being present. The mRNAseq datasets for the TNDH lines are available from the SRA repository (ERA283648; the remaining datasets are supplied with this article.

  19. Cover crop-based ecological weed management: exploration and optimization

    NARCIS (Netherlands)

    Kruidhof, H.M.


    Keywords: organic farming, ecologically-based weed management, cover crops, green manure, allelopathy, Secale cereale, Brassica napus, Medicago sativa

    Cover crop-based ecological weed management: exploration and optimization. In organic farming systems, weed control is recognized as one

  20. Transactivation of the Brassica napus napin promoter by ABI3 requires interaction of the conserved B2 and B3 domains of ABI3 with different cis-elements: B2 mediates activation through an ABRE, whereas B3 interacts with an RY/G-box. (United States)

    Ezcurra, I; Wycliffe, P; Nehlin, L; Ellerström, M; Rask, L


    The transcriptional activator ABI3 is a key regulator of gene expression during embryo maturation in crucifers. In monocots, the related VP1 protein regulates the Em promoter synergistically with abscisic acid (ABA). We identified cis-elements in the Brassica napus napin napA promoter mediating regulation by ABI3 and ABA, by analyzing substitution mutation constructs of napA in transgenic tobacco plantlets ectopically expressing ABI3. In transient analysis using particle bombardment of tobacco leaf sections, a tetramer of the distB ABRE (abscisic acid-responsive element) mediated transactivation by ABI3 and ABI3-dependent response to ABA, whereas a tetramer of the composite RY/G complex, containing RY repeats and a G-box, mediated only ABA-independent transactivation by ABI3. Deletion of the conserved B2 and B3 domains of ABI3 abolished transactivation of napA by ABI3. The two domains of ABI3 interact with different cis-elements: B2 is necessary for ABA-independent and ABA-dependent activations through the distB ABRE, whereas B3 interacts with the RY/G complex. Thus B2 mediates the interaction of ABI3 with the protein complex at the ABRE. The regulation of napA by ABI3 differs from Em regulation by VP1, in that the B3 domain of ABI3 is essential for the ABA-dependent regulation of napA.

  1. Yield and seed oil content response of dwarf, rapid-cycling Brassica to nitrogen treatments, planting density, and carbon dioxide enrichment (United States)

    Frick, J.; Nielsen, S. S.; Mitchell, C. A.


    Effects of N level (15 to 30 mM), time of N increase (14 to 28 days after planting), and planting density (1163 to 2093 plants/m2) were determined for crop yield responses of dwarf, rapid-cycling brassica (Brassica napus L., CrGC 5-2, Genome: ACaacc). Crops were grown in solid-matrix hydroponic systems and under controlled-environment conditions, including nonsupplemented (ambient) or elevated CO2 concentrations (998 +/- 12 micromoles mol-1). The highest seed yield rate obtained (4.4 g m-2 day-1) occurred with the lowest N level (15 mM) applied at the latest treatment time (day 28). In all trials, CO2 enrichment reduced seed yield rate and harvest index by delaying the onset of flowering and senescence and stimulating vegetative shoot growth. The highest shoot biomass accumulation rate (55.5 g m-2 day-1) occurred with the highest N level (30 mM) applied at the earliest time (day 14). Seed oil content was not significantly affected by CO2 enrichment. Maximum seed oil content (30% to 34%, dry weight basis) was obtained using the lowest N level (15 mM) initiated at the latest treatment time (day 28). In general, an increase in seed oil content was accompanied by a decrease in seed protein. Seed carbohydrate, moisture, and ash contents did not vary significantly in response to experimental treatments. Effects of N level and time of N increase were consistently significant for most crop responses. Planting density was significant only under elevated CO2 conditions.

  2. Genome-wide Investigation of microRNAs and Their Targets in Brassica rapa ssp. pekinensis Root with Plasmodiophora brassicae Infection

    Directory of Open Access Journals (Sweden)

    Xiaochun Wei


    Full Text Available Increasing evidence has revealed that microRNAs play a pivotal role in the post transcriptional regulation of gene expression in response to pathogens in plants. However, there is little information available about the expression patterns of miRNAs and their targets in Chinese cabbage (Brassica rapa ssp. pekinensis under Plasmodiophora brassicae stress. In the present study, using deep sequencing and degradome analysis, a genome-wide identification of miRNAs and their targets during P. brassicae stress was performed. A total of 221 known and 93 potentially novel miRNAs were successfully identified from two root libraries of one control (635-10CK and P. brassicae-treated Chinese cabbage samples (635-10T. Of these, 14 known and 10 potentially novel miRNAs were found to be differentially expressed after P. brassicae treatment. Degradome analysis revealed that the 223 target genes of the 75 miRNAs could be potentially cleaved. KEGG (Kyoto Encyclopedia of Genes and Genomes pathway analysis suggested that the putative target genes of the miRNAs were predominately involved in selenocompound metabolism and plant hormone signal transduction. Then the expression of 12 miRNAs was validated by quantitative real-time PCR (qRT-PCR. These results provide insights into the miRNA-mediated regulatory networks underlying the stress response to the plant pathogen P. brassicae.

  3. Assessing the risk of Glyphosate to native plants and weedy Brassicaceae species of North Dakota (United States)

    This study was conducted to determine the ecological risk to native plants and weedy Brassicaceae species which may be growing in areas affected by off target movement of glyphosate applied to glyphosate-resistant canola (Brassica napus). Ten native grass and forb species were ...

  4. Effect of salinity stress on plant fresh weight and nutrient ...

    African Journals Online (AJOL)

    Effect of salinity stress on plant fresh weight and nutrient composition of some Canola ( Brassica napus L.) cultivars. ... K+, Ca2+ and K+/Na+ contents in plants decreased by salt stress, but Na+ and Cl- content in the roots, ... from 32 Countries:.

  5. Adjuvants for single droplet application of glyphosate

    DEFF Research Database (Denmark)

    Mathiassen, Solvejg Kopp; Kudsk, Per; Lund, Ivar


    Retention and biological activity of droplets of glyphosate deposited onto plant leaves using a Drop on Demand inkjet printer application system, was examined on pot-grown Brassica napus, Solanum nigrum, Chenopodium album, Silene noctiflora and Echinocloa crus-galli plants. Retention was measured...

  6. The intensity of tyrosine nitration is associated with selenite and selenate toxicity in Brassica juncea L. (United States)

    Molnár, Árpád; Feigl, Gábor; Trifán, Vanda; Ördög, Attila; Szőllősi, Réka; Erdei, László; Kolbert, Zsuzsanna


    Selenium phytotoxicity involves processes like reactive nitrogen species overproduction and nitrosative protein modifications. This study evaluates the toxicity of two selenium forms (selenite and selenate at 0µM, 20µM, 50µM and 100µM concentrations) and its correlation with protein tyrosine nitration in the organs of hydroponically grown Indian mustard (Brassica juncea L.). Selenate treatment resulted in large selenium accumulation in both Brassica organs, while selenite showed slight root-to-shoot translocation resulting in a much lower selenium accumulation in the shoot. Shoot and root growth inhibition and cell viability loss revealed that Brassica tolerates selenate better than selenite. Results also show that relative high amounts of selenium are able to accumulate in Brassica leaves without obvious visible symptoms such as chlorosis or necrosis. The more severe phytotoxicity of selenite was accompanied by more intense protein tyrosine nitration as well as alterations in nitration pattern suggesting a correlation between the degree of Se forms-induced toxicities and nitroproteome size, composition in Brassica organs. These results imply the possibility of considering protein tyrosine nitration as novel biomarker of selenium phytotoxicity, which could help the evaluation of asymptomatic selenium stress of plants. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Rape embryogenesis I. The proembryo development

    Directory of Open Access Journals (Sweden)

    Teresa Tykarska


    Full Text Available The development of the proembryo of rape Brassica napus L. from the zygote to the young embryo proper is described. A number of regularities were found in the direction, succession, and distribution of segmental and differentiating divisions of the proembryo. The direction of the divisions seems to foe determined by the direction of growth and the shape of the cells. The termyoung embryo proper is proposed to denote the globular embryo which already possesses separate plerome and periblem mother-cells and mother-cells of the iec layer and of clumella. The body of the embryo proper is derived from the apical cell ca which arose from the first division of the zygote and from the hypophysis - the only suspensor cell which closes the spheroid of the embryo. The development of the Brassica napus L. proembryo follows the sub-archetype Capsella bursa-pastoris in the IV megarchetype of Soueges.

  8. Alternaria resistance of Brassicae campestris L. improved by induced mutations

    International Nuclear Information System (INIS)

    Das, M.L.; Rahman, A.


    Full text: Seeds of 'YS 52', a cultivar susceptible to Alternaria brassicae (Berk.) Sacc., were exposed to gamma rays (30-90 kR). Eight more resistant mutants were selected in M3 and subjected to further field evaluation. The best mutant '17-5-83' appeared resistant and gave 44% higher yield than the parent, mutant '70-7-82' was found to be moderately resistant and gave a yield 21% higher than the parent. The yield increases seem to be connected with plant architecture changes. (author)

  9. In vitro propagation of Ethiopian mustard ( Brassica carinata A ...

    African Journals Online (AJOL)

    Brassica carinata (A. Braun) is an amphi-diploid species that originated from interspecific hybridization between Brassica nigra and Brassica oleracea in the highlands of Ethiopia. The crop has many desirable agronomic traits but with oil quality constraints like high erucic acid and glucosinolate contents. In this study, two ...

  10. Unleashing the genome of Brassica rapa

    Directory of Open Access Journals (Sweden)

    Haibao eTang


    Full Text Available The completion and release of the Brassica rapa genome is of great benefit to researchers of the Brassicas, Arabidopsis, and genome evolution. While its lineage is closely related to the model organism Arabidopsis thaliana, the Brassicas experienced a whole genome triplication subsequent to their divergence. This event contemporaneously created three copies of its ancestral genome, which had diploidized through the process of homeologous gene loss known as fractionation. By the fractionation of homeologous gene content and genetic regulatory binding sites, Brassica’s genome is well placed to use comparative genomic techniques to identify syntenic regions, homeologous gene duplications, and putative regulatory sequences. Here, we use the comparative genomics platform CoGe to perform several different genomic analyses with which to study structural changes of its genome and dynamics of various genetic elements. Starting with whole genome comparisons, the Brassica paleohexaploidy is characterized, syntenic regions with Arabidopsis thaliana are identified, and the TOC1 gene in the circadian rhythm pathway from Arabidopsis thaliana is used to find duplicated orthologs in Brassica rapa. These TOC1 genes are further analyzed to identify conserved noncoding sequences that contain cis-acting regulatory elements and promoter sequences previously implicated in circadian rhythmicity. Each 'cookbook style' analysis includes a step-by-step walkthrough with links to CoGe to quickly reproduce each step of the analytical process.

  11. Standardized gene nomenclature for the Brassica genus

    Directory of Open Access Journals (Sweden)

    King Graham J


    Full Text Available Abstract The genus Brassica (Brassicaceae, Brassiceae is closely related to the model plant Arabidopsis, and includes several important crop plants. Against the background of ongoing genome sequencing, and in line with efforts to standardize and simplify description of genetic entities, we propose a standard systematic gene nomenclature system for the Brassica genus. This is based upon concatenating abbreviated categories, where these are listed in descending order of significance from left to right (i.e. genus – species – genome – gene name – locus – allele. Indicative examples are provided, and the considerations and recommendations for use are discussed, including outlining the relationship with functionally well-characterized Arabidopsis orthologues. A Brassica Gene Registry has been established under the auspices of the Multinational Brassica Genome Project that will enable management of gene names within the research community, and includes provisional allocation of standard names to genes previously described in the literature or in sequence repositories. The proposed standardization of Brassica gene nomenclature has been distributed to editors of plant and genetics journals and curators of sequence repositories, so that it can be adopted universally.

  12. Canola versus Wheat Rotation Effects on Subsequent Wheat Yield (United States)

    Winter canola (Brassica napus L.) (WC) is considered the most promising, domestically-produced oilseed feedstock for biodiesel production and for diversifying wheat (Triticum aestivum L.)-based cropping systems in the Inland Pacific Northwest, USA (PNW). A law passed in 2006 requires that at least t...

  13. Browse Title Index

    African Journals Online (AJOL)

    Items 101 - 132 of 132 ... Effect of an organic plant fertiliser on the establishment of rooted cuttings of ... of Potato virus Y (PVY) infecting vegetable crops in KwaZulu-Natal, ... on the grain yield and quality of canola (Brassica napus L.) grown in the ...

  14. Data from: Can above-ground ecosystem services compensate for reduced fertilizer input and soil organic matter in annual crops?

    NARCIS (Netherlands)

    Gils, van S.H.; Putten, van der W.H.; Kleijn, D.


    Above-ground and below-ground environmental conditions influence crop yield by pollination, pest pressure, and resource supply. However, little is known about how interactions between these factors contribute to yield. Here, we used oilseed rape Brassica napus to test their effects on crop yield. We

  15. Can above-ground ecosystem services compensate for reduced fertilizer input and soil organic matter in annual crops?

    NARCIS (Netherlands)

    van Gils, Stijn; van der Putten, Wim H; Kleijn, David


    1.Above-ground and below-ground environmental conditions influence crop yield by pollination, pest pressure, and resource supply. However, little is known about how interactions between these factors contribute to yield. Here, we used oilseed rape Brassica napus to test their effects on crop

  16. Can above-ground ecosystem services compensate for reduced fertilizer input and soil organic matter in annual crops?

    NARCIS (Netherlands)

    Gils, van S.H.; Putten, van der W.H.; Kleijn, D.


    1.Above-ground and below-ground environmental conditions influence crop yield by pollination, pest pressure and resource supply. However, little is known about how interactions between these factors contribute to yield. Here, we used oilseed rape Brassica napus to test their effects on crop

  17. BRAD, the genetics and genomics database for Brassica plants

    Directory of Open Access Journals (Sweden)

    Li Pingxia


    Full Text Available Abstract Background Brassica species include both vegetable and oilseed crops, which are very important to the daily life of common human beings. Meanwhile, the Brassica species represent an excellent system for studying numerous aspects of plant biology, specifically for the analysis of genome evolution following polyploidy, so it is also very important for scientific research. Now, the genome of Brassica rapa has already been assembled, it is the time to do deep mining of the genome data. Description BRAD, the Brassica database, is a web-based resource focusing on genome scale genetic and genomic data for important Brassica crops. BRAD was built based on the first whole genome sequence and on further data analysis of the Brassica A genome species, Brassica rapa (Chiifu-401-42. It provides datasets, such as the complete genome sequence of B. rapa, which was de novo assembled from Illumina GA II short reads and from BAC clone sequences, predicted genes and associated annotations, non coding RNAs, transposable elements (TE, B. rapa genes' orthologous to those in A. thaliana, as well as genetic markers and linkage maps. BRAD offers useful searching and data mining tools, including search across annotation datasets, search for syntenic or non-syntenic orthologs, and to search the flanking regions of a certain target, as well as the tools of BLAST and Gbrowse. BRAD allows users to enter almost any kind of information, such as a B. rapa or A. thaliana gene ID, physical position or genetic marker. Conclusion BRAD, a new database which focuses on the genetics and genomics of the Brassica plants has been developed, it aims at helping scientists and breeders to fully and efficiently use the information of genome data of Brassica plants. BRAD will be continuously updated and can be accessed through

  18. Characterization and expression patterns of small RNAs in synthesized Brassica hexaploids. (United States)

    Shen, Yanyue; Zhao, Qin; Zou, Jun; Wang, Wenliang; Gao, Yi; Meng, Jinling; Wang, Jianbo


    Polyploidy has played an important role in promoting plant evolution through genomic merging and doubling. We used high-throughput sequencing to compare miRNA expression profiles between Brassica hexaploid and its parents. A total of 613, 784 and 742 known miRNAs were identified in Brassica rapa, Brassica carinata, and Brassica hexaploid, respectively. We detected 618 miRNAs were differentially expressed (log(2)Ratio ≥ 1, P ≤ 0.05) between Brassica hexaploid and its parents, and 425 miRNAs were non-additively expressed in Brassica hexaploid, which suggest a trend of non-additive miRNA regulation following hybridization and polyploidization. Remarkably, majority of the non-additively expressed miRNAs in the Brassica hexaploid are repressed, and there was a bias toward repression of B. rapa miRNAs, which is consistent with the progenitor-biased gene repression in the synthetic allopolyploids. In addition, we identified 653 novel mature miRNAs in Brassica hexaploid and its parents. Finally, we found that almost all the non-additive accumulation of siRNA clusters exhibited a low-parent pattern in Brassica hexaploid. Non-additive small RNA regulation is involved in a range of biological pathways, probably providing a driving force for variation and adaptation in allopolyploids.

  19. Phenolic Compounds in Brassica Vegetables

    Directory of Open Access Journals (Sweden)

    Pablo Velasco


    Full Text Available Phenolic compounds are a large group of phytochemicals widespread in the plant kingdom. Depending on their structure they can be classified into simple phenols, phenolic acids, hydroxycinnamic acid derivatives and flavonoids. Phenolic compounds have received considerable attention for being potentially protective factors against cancer and heart diseases, in part because of their potent antioxidative properties and their ubiquity in a wide range of commonly consumed foods of plant origin. The Brassicaceae family includes a wide range of horticultural crops, some of them with economic significance and extensively used in the diet throughout the world. The phenolic composition of Brassica vegetables has been recently investigated and, nowadays, the profile of different Brassica species is well established. Here, we review the significance of phenolic compounds as a source of beneficial compounds for human health and the influence of environmental conditions and processing mechanisms on the phenolic composition of Brassica vegetables.

  20. Widespread and evolutionary analysis of a MITE family Monkey King in Brassicaceae. (United States)

    Dai, Shutao; Hou, Jinna; Long, Yan; Wang, Jing; Li, Cong; Xiao, Qinqin; Jiang, Xiaoxue; Zou, Xiaoxiao; Zou, Jun; Meng, Jinling


    Miniature inverted repeat transposable elements (MITEs) are important components of eukaryotic genomes, with hundreds of families and many copies, which may play important roles in gene regulation and genome evolution. However, few studies have investigated the molecular mechanisms involved. In our previous study, a Tourist-like MITE, Monkey King, was identified from the promoter region of a flowering time gene, BnFLC.A10, in Brassica napus. Based on this MITE, the characteristics and potential roles on gene regulation of the MITE family were analyzed in Brassicaceae. The characteristics of the Tourist-like MITE family Monkey King in Brassicaceae, including its distribution, copies and insertion sites in the genomes of major Brassicaceae species were analyzed in this study. Monkey King was actively amplified in Brassica after divergence from Arabidopsis, which was indicated by the prompt increase in copy number and by phylogenetic analysis. The genomic variations caused by Monkey King insertions, both intra- and inter-species in Brassica, were traced by PCR amplification. Genomic sequence analysis showed that most complete Monkey King elements are located in gene-rich regions, less than 3kb from genes, in both the B. rapa and A. thaliana genomes. Sixty-seven Brassica expressed sequence tags carrying Monkey King fragments were also identified from the NCBI database. Bisulfite sequencing identified specific DNA methylation of cytosine residues in the Monkey King sequence. A fragment containing putative TATA-box motifs in the MITE sequence could bind with nuclear protein(s) extracted from leaves of B. napus plants. A Monkey King-related microRNA, bna-miR6031, was identified in the microRNA database. In transgenic A. thaliana, when the Monkey King element was inserted upstream of 35S promoter, the promoter activity was weakened. Monkey King, a Brassicaceae Tourist-like MITE family, has amplified relatively recently and has induced intra- and inter-species genomic

  1. Genome-wide identification of aquaporin encoding genes in Brassica oleracea and their phylogenetic sequence comparison to Brassica crops and Arabidopsis (United States)

    Diehn, Till A.; Pommerrenig, Benjamin; Bernhardt, Nadine; Hartmann, Anja; Bienert, Gerd P.


    Aquaporins (AQPs) are essential channel proteins that regulate plant water homeostasis and the uptake and distribution of uncharged solutes such as metalloids, urea, ammonia, and carbon dioxide. Despite their importance as crop plants, little is known about AQP gene and protein function in cabbage (Brassica oleracea) and other Brassica species. The recent releases of the genome sequences of B. oleracea and Brassica rapa allow comparative genomic studies in these species to investigate the evolution and features of Brassica genes and proteins. In this study, we identified all AQP genes in B. oleracea by a genome-wide survey. In total, 67 genes of four plant AQP subfamilies were identified. Their full-length gene sequences and locations on chromosomes and scaffolds were manually curated. The identification of six additional full-length AQP sequences in the B. rapa genome added to the recently published AQP protein family of this species. A phylogenetic analysis of AQPs of Arabidopsis thaliana, B. oleracea, B. rapa allowed us to follow AQP evolution in closely related species and to systematically classify and (re-) name these isoforms. Thirty-three groups of AQP-orthologous genes were identified between B. oleracea and Arabidopsis and their expression was analyzed in different organs. The two selectivity filters, gene structure and coding sequences were highly conserved within each AQP subfamily while sequence variations in some introns and untranslated regions were frequent. These data suggest a similar substrate selectivity and function of Brassica AQPs compared to Arabidopsis orthologs. The comparative analyses of all AQP subfamilies in three Brassicaceae species give initial insights into AQP evolution in these taxa. Based on the genome-wide AQP identification in B. oleracea and the sequence analysis and reprocessing of Brassica AQP information, our dataset provides a sequence resource for further investigations of the physiological and molecular functions of

  2. Importance of winter rape for small rodents

    Czech Academy of Sciences Publication Activity Database

    Heroldová, Marta; Zejda, J.; Zapletal, M.; Obdržálková, D.; Jánová, E.; Bryja, Josef; Tkadlec, E.


    Roč. 50, č. 4 (2004), s. 175-181 ISSN 0370-663X R&D Projects: GA AV ČR KSK6005114 Keywords : Microtus arvalis * Apodemus microps * Brassica napus Subject RIV: EG - Zoology Impact factor: 0.379, year: 2004

  3. High-Performance Liquid Chromatography–Mass Spectrometry Analysis of Plant Metabolites in Brassicaceae

    NARCIS (Netherlands)

    Vos, de C.H.; Schipper, A.; Hall, R.D.


    The Brassicaceae family comprises a variety of plant species that are of high economic importance as -vegetables or industrial crops. This includes crops such as Brassica rapa (turnip, Bok Choi), B. oleracea (cabbages, broccoli, cauliflower, etc.), and B. napus (oil seed rape), and also includes the

  4. Chitosan oligosaccharides-triggered innate immunity contributes to oilseed rape resistance against Sclerotinia sclerotiorum

    DEFF Research Database (Denmark)

    Yin, Heng; Yan, Li; HongYan, Zhang


    Chitosan oligosaccharides (collectively, oligochitosan, or COS) are considered to be potent plant immunity elicitors. In this article, the induction of resistance to Sclerotinia sclerotiorum in Brassica napus L. var. Huyou 15 by COS is studied. Even though COS (50 mg mL1) did not affect radial...

  5. First insights in the Eu(III) speciation in plant cell suspension cultures

    International Nuclear Information System (INIS)

    Moll, Henry; Sachs, Susanne


    More than 80 % of the initial Eu(III) amount was associated on Brassica napus cells after an incubation time of 24 h. The spectroscopic speciation of the cell-bound Eu(III) is characterized by an increased intensity of the "7F_2 transition and prolonged luminescence lifetimes.

  6. Biomass production, symbiotic nitrogen fixation and inorganic N use in dual tri-component annual intercrops

    DEFF Research Database (Denmark)

    Andersen, M.K.; Hauggaard-Nielsen, H.; Ambus, P.


    The interspecific complementary and competitive interactions between pea (Pisum sativum L.), barley (Hordeum vulgare L.) and oilseed rape (Brassica napus L.), grown as dual and tri-component intercrops were assessed in a field study in Denmark. Total biomass production and N use at two levels of ...

  7. Induced polyploidization in Brassica campestris L. (Brassicaceae). (United States)

    Kumar, G; Dwivedi, K


    Present experimental design has been made up to obtain crop with higher ploidy level via synthetic polyploidization. Since ploidy manipulation is generally associated with the obtainment of some increased enviable traits of the crop and also provides them greater adaptability to unfavorable or harsh circumstances as compared to its diploids counterparts. Thus, herein present research autotetraploids of Brassica campestris L. have been lucratively achieved by the application of colchicine. Two methods of treatment were utilized i.e. seed treatment and seedling treatment. No polyploidy could be obtained through seed treatment while seedling treatment responded well towards polyploidy. However, the status of autotetraploidy has been confirmed by cytomorphological investigations of treated plants as against its diploids counterparts. For the purpose, morphological parameters such as increased stomata size, pollen diameter, flower size, reproductive organs whereas reduction in plant height, leaf length, leaf breadth, stomata frequency, number of flowers/inflorescence etc. were appraised. Further, cytological observations were made that had clearly revealed the doubling of genome in the autotetraploids as compared to diploids. Meanwhile, pollen fertility and size of pollen grains were evaluated as well.

  8. First insights in the Eu(III) speciation in plant cell suspension cultures

    Energy Technology Data Exchange (ETDEWEB)

    Moll, Henry; Sachs, Susanne [Helmholtz-Zentrum Dresden-Rossendorf e.V., Dresden (Germany). Biogeochemistry


    More than 80 % of the initial Eu(III) amount was associated on Brassica napus cells after an incubation time of 24 h. The spectroscopic speciation of the cell-bound Eu(III) is characterized by an increased intensity of the {sup 7}F{sub 2} transition and prolonged luminescence lifetimes.

  9. Microspore culture of Zantedeschia aethiopica: The role of ...

    African Journals Online (AJOL)



    Sep 5, 2011 ... constitutions. Key words: Calla lily, haploid plant production, isolated microspore culture, glucose, fructose. ... (16%:16%:16%) granule fertilizer was applied every two weeks (10 g/m2). ... Initially, the method described for Brassica napus microspore ... For studying the effect of initial short term cultivation with.

  10. Response of sunflower hybrids to management practices under ...

    African Journals Online (AJOL)



    Apr 4, 2011 ... sunflower (Helianthus annuus L.) and canola (Brassica napus L.), etc. The total edible oil ... hybrids with high fertilizer requirements. The farmers are applying ... Crop growth and productivity can be discussed in terms of biomass ... the interactive effects of hybrids, planting geometries and nitrogen rates on ...

  11. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Genetic correlations of nutrient quality traits including lysine, methionine, leucine, isoleucine, phenylalanine, valine and threonine contents in rapeseed meal were analysed by the genetic model for quantitative traits of diploid plants using a diallel design with nine parents of Brassica napus L. These results indicated that the ...

  12. Thylakoid-bound ascorbate peroxidase increases resistance to salt ...

    African Journals Online (AJOL)

    Reactive oxygen species (ROS) are cellular indicators of stress. In plants, they function as secondary messengers in response to environmental stress. Ascorbate peroxidase (APX) is an important enzyme directly involved in the scavenging of ROS. In this study, we aimed at identifying the function of the Brassica napus ...

  13. Epidemiological studies on Brassica vegetables and cancer risk

    NARCIS (Netherlands)

    Verhoeven, D.T.H.; Goldbohm, R.A.; Poppel, G. van; Verhagen, H.; Brandt, P.A. van den


    This paper gives an overview of the epidemiological data concerning the cancer-preventive effect of brassica vegetables, including cabbage, kale, broccoli, Brussels sprouts, and cauliflower. The protective effect of brassicas against cancer may be due to their relatively high content of

  14. Comparation of the Uptake and Accumulation of Heavy Metals by Rape Species Grown in Contaminated Soil Surrounding Mining Tails in Chenzhou, China

    Directory of Open Access Journals (Sweden)

    YANG Yang


    Full Text Available The rape is usually used for phytoremediation of metal-contaminated soils, because it has the characteristics of rapid growth, large biomass, and high potential to tolerate and accumulate large quantities of heavy metals. In this work, accumulation and transformation of Cu, Zn, Pb, Cd in four rape species(B. juncea L.(BJ, Brassica napus L.(BL, Canadian Brassica napus L.(CBL, local rape(LRwere investigated in soils surrounding mine area contaminated by lead-zinc ore tailings in Chenzhou, Hunan Province. The results showed a significantly high accumulation of Cu, Zn and Cd in leaves and roots of four rape species. However, the concentration of Pb in roots of all rape species was usually one or two orders of magnitude than other parts, and the concentration of heavy metals in stems and fruits was lower. The accumulation of heavy metals in leaves parts was in the order: Zn >Cu >Pb >Cd, and in roots was as: Pb >Zn >Cu >Cd; the order of bioconcentration factor(BCFof heavy metals in above-ground parts(leavesof rape species was: Cu: BJ ≥LR >BL >CBL, Zn: BL >CBL >BJ >LR, Pb: BJ≈LR > BL≈CBL, Cd: BL >CBL >BJ >LR; and the order of translocation factor(TFfrom stems to leaves was: Cu: LR >BJ≈CBL >BL,Zn: BL >LR > BJ >CBL, Pb: BJ >CBL≈LR >BL,Cd: BJ >BL >CBL >LR. It indicated there were significant differences among the species. The results of the field experiment suggested that B. juncea L. was suitable for phytoextraction of Cu, Pb contaminated soil, Brassica napus L. could be used to remediate Zn, Cd or heavy metal combined polluted soils.

  15. Identification and evolutionary dynamics of cacta DNA transposons in brassica

    International Nuclear Information System (INIS)

    Nouroz, F.; Noreen, S.; Harrison, J.S.H.


    Transposable elements are the major drivers of genome evolution and plasticity. Due to their transposition mode, they are classified into two major classes as Retrotransposons and DNA transposons. The En/Spm or CACTA elements are diverse group of DNA transposons proliferating in plant genomes. Various bioinformatics and molecular approaches were used for identification and distribution of CACTA transposons in Brassica genome. A combination of dot plot analysis and BLASTN searches yielded 35 autonomous and 7 non-autonomous CACTA elements in Brassica. The elements ranged in sizes from 1.2 kb non-autonomous elements to 11kb autonomous elements, terminated by 3 bp Target Site Duplication (TSD) and ~15 bp conserved Terminal Inverted Repeat (TIR) motifs (5'-CACTACAAGAAAACA-3'), with heterogeneous internal regions. The transposase (TNP) was identified from autonomous CACTA elements, while other protein domains from Brassica and other plants CACTA revealed similar organizations with minor differences. Both transposases (TNPD, TNPA) are present in most CACTA, while a few CACTA harboured an additional ATHILA ORF1-like domain. The PCR analysis amplified the CACTA transposases from 40 Brassica accessions (A, B, and C-genome) suggesting their distribution among various Brassica crops. A detailed characterization and evolutionary analysis of the identified CACTA elements allowed some to be placed in genome-specific groups, while most of them (Brassica-Arabidopsis elements) have followed the same evolutionary line. The distribution of CACTA in Brassica concluded that 3 bp TSDs generating CACTA transposons contributed significantly to genome size and evolution of Brassica genome. (author)

  16. Identification and expression analysis of cold and freezing stress responsive genes of Brassica oleracea. (United States)

    Ahmed, Nasar Uddin; Jung, Hee-Jeong; Park, Jong-In; Cho, Yong-Gu; Hur, Yoonkang; Nou, Ill-Sup


    Cold and freezing stress is a major environmental constraint to the production of Brassica crops. Enhancement of tolerance by exploiting cold and freezing tolerance related genes offers the most efficient approach to address this problem. Cold-induced transcriptional profiling is a promising approach to the identification of potential genes related to cold and freezing stress tolerance. In this study, 99 highly expressed genes were identified from a whole genome microarray dataset of Brassica rapa. Blast search analysis of the Brassica oleracea database revealed the corresponding homologous genes. To validate their expression, pre-selected cold tolerant and susceptible cabbage lines were analyzed. Out of 99 BoCRGs, 43 were differentially expressed in response to varying degrees of cold and freezing stress in the contrasting cabbage lines. Among the differentially expressed genes, 18 were highly up-regulated in the tolerant lines, which is consistent with their microarray expression. Additionally, 12 BoCRGs were expressed differentially after cold stress treatment in two contrasting cabbage lines, and BoCRG54, 56, 59, 62, 70, 72 and 99 were predicted to be involved in cold regulatory pathways. Taken together, the cold-responsive genes identified in this study provide additional direction for elucidating the regulatory network of low temperature stress tolerance and developing cold and freezing stress resistant Brassica crops. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. The response of transgenic Brassica species to salt stress: a review. (United States)

    Shah, Nadil; Anwar, Sumera; Xu, Jingjing; Hou, Zhaoke; Salah, Akram; Khan, Shahbaz; Gong, Jianfang; Shang, Zhengwei; Qian, Li; Zhang, Chunyu


    Salt stress is considered one of the main abiotic factors to limit crop growth and productivity by affecting morpho-physiological and biochemical processes. Genetically, a number of salt tolerant Brassica varieties have been developed and introduced, but breeding of such varieties is time consuming. Therefore, current focus is on transgenic technology, which plays an important role in the development of salt tolerant varieties. Various salt tolerant genes have been characterized and incorporated into Brassica. Therefore, such genetic transformation of Brassica species is a significant step for improvement of crops, as well as conferring salt stress resistance qualities to Brassica species. Complete genome sequencing has made the task of genetically transforming Brassica species easier, by identifying desired candidate genes. The present review discusses relevant information about the principles which should be employed to develop transgenic Brassica species, and also will recommend tools for improved tolerance to salinity.

  18. Brassica oleracea: the dog of the plant world (United States)

    The horticultural crop Brassica oleracea L. plays an important role in global food systems. Brassica oleracea is unique in that it has been domesticated into several morphotypes (cultivars), including broccoli, Brussels sprout, cabbage, cauliflower, kale, kohlrabi, and several lesser well known morp...

  19. Brassica oleracea; The dog of the plant world (United States)

    The horticultural crop Brassica oleracea L. plays an important role in global food systems. Brassica oleracea is unique in that it has been domesticated into several morphotypes (cultivars), including broccoli, Brussels sprout, cabbage, cauliflower, kale, kohlrabi, and several lesser well known morp...

  20. Molecular breeding in Brassica for salt tolerance: importance of microsatellite (SSR) markers for molecular breeding in Brassica. (United States)

    Kumar, Manu; Choi, Ju-Young; Kumari, Nisha; Pareek, Ashwani; Kim, Seong-Ryong


    Salinity is one of the important abiotic factors for any crop management in irrigated as well as rainfed areas, which leads to poor harvests. This yield reduction in salt affected soils can be overcome by improving salt tolerance in crops or by soil reclamation. Salty soils can be reclaimed by leaching the salt or by cultivation of salt tolerance crops. Salt tolerance is a quantitative trait controlled by several genes. Poor knowledge about mechanism of its inheritance makes slow progress in its introgression into target crops. Brassica is known to be a good reclamation crop. Inter and intra specific variation within Brassica species shows potential of molecular breeding to raise salinity tolerant genotypes. Among the various molecular markers, SSR markers are getting high attention, since they are randomly sparsed, highly variable and show co-dominant inheritance. Furthermore, as sequencing techniques are improving and softwares to find SSR markers are being developed, SSR markers technology is also evolving rapidly. Comparative SSR marker studies targeting Arabidopsis thaliana and Brassica species which lie in the same family will further aid in studying the salt tolerance related QTLs and subsequent identification of the "candidate genes" and finding out the origin of important QTLs. Although, there are a few reports on molecular breeding for improving salt tolerance using molecular markers in Brassica species, usage of SSR markers has a big potential to improve salt tolerance in Brassica crops. In order to obtain best harvests, role of SSR marker driven breeding approaches play important role and it has been discussed in this review especially for the introgression of salt tolerance traits in crops.

  1. Molecular breeding in Brassica for salt tolerance: importance of microsatellite (SSR) markers for molecular breeding in Brassica (United States)

    Kumar, Manu; Choi, Ju-Young; Kumari, Nisha; Pareek, Ashwani; Kim, Seong-Ryong


    Salinity is one of the important abiotic factors for any crop management in irrigated as well as rainfed areas, which leads to poor harvests. This yield reduction in salt affected soils can be overcome by improving salt tolerance in crops or by soil reclamation. Salty soils can be reclaimed by leaching the salt or by cultivation of salt tolerance crops. Salt tolerance is a quantitative trait controlled by several genes. Poor knowledge about mechanism of its inheritance makes slow progress in its introgression into target crops. Brassica is known to be a good reclamation crop. Inter and intra specific variation within Brassica species shows potential of molecular breeding to raise salinity tolerant genotypes. Among the various molecular markers, SSR markers are getting high attention, since they are randomly sparsed, highly variable and show co-dominant inheritance. Furthermore, as sequencing techniques are improving and softwares to find SSR markers are being developed, SSR markers technology is also evolving rapidly. Comparative SSR marker studies targeting Arabidopsis thaliana and Brassica species which lie in the same family will further aid in studying the salt tolerance related QTLs and subsequent identification of the “candidate genes” and finding out the origin of important QTLs. Although, there are a few reports on molecular breeding for improving salt tolerance using molecular markers in Brassica species, usage of SSR markers has a big potential to improve salt tolerance in Brassica crops. In order to obtain best harvests, role of SSR marker driven breeding approaches play important role and it has been discussed in this review especially for the introgression of salt tolerance traits in crops. PMID:26388887

  2. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven


    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...

  3. Effect of selenium-enriched defatted rape seeds on tissue cadmium and essential elements utilization in rats

    Czech Academy of Sciences Publication Activity Database

    Myška, A.; Száková, J.; Fučíková, A.; Mlejnek, Petr; Zídek, Václav; Tremlová, J.; Mestek, O.; Koplík, R.; Zídková, J.; Melčová, M.; Tlustoš, P.


    Roč. 61, č. 11 (2016), s. 496-505 ISSN 1212-1819 R&D Projects: GA ČR(CZ) GA13-04580S Institutional support: RVO:67985823 Keywords : Se * Brassica napus * fortification * Rattus norvegicus * trace and major minerals Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 0.741, year: 2016

  4. 147 - 154 Genetic Variability, Heritability and Correlation Coefficient

    African Journals Online (AJOL)


    twelve upland rice genotypes during 2013 main cropping season. ... spikelet per panicle, number of filled grains per panicle and biomass yield had a positive and significant correlation ... fertilizers were applied at the rate of 100 kg per hectare. ..... ultimate effect for selecting superior varieties (Ali et al., .... (Brassica napus L.).

  5. Effects of β-Glucans and resistant starch on fermentation of recalcitrant fibers in growing pigs

    NARCIS (Netherlands)

    Vries, de S.; Gerrits, W.J.J.; Kabel, M.A.; Zijlstra, Ruurd; Vasanthan, Thava


    Effects of the presence of β-glucans and resistant starch in diets on nutrient and fiber degradability of rapeseed meal [RSM] (Brassica napus) and Distillers Dried Grain with Solubles (DDGS) were tested in a 2 × 3 factorial arrangement. Two basal diets, containing either 500 g/kg RSM or DDGS and

  6. A Mechanistic Perspective on Process-Induced Changes in Glucosinolate Content in Brassica Vegetables: A Review

    NARCIS (Netherlands)

    Nugrahedi, P.Y.; Verkerk, R.; Widianarko, B.; Dekker, M.


    Brassica vegetables are consumed mostly after processing, which is expected to give beneficial effects on the vegetable properties, such as improved palatability and bioavailability of nutrients, or shelf life extension. But processing also results to various changes in the content of health

  7. Occurrence of Xanthomonas campestris pv. campestris (Pammel, 1895) Dowson 1939, on brassicas in Montenegro


    Radunović Dragana; Balaž Jelica


    Brassicas form the most important group of vegetable crops in Montenegro. The cabbage (Brassica oleracea var. capitata) is most commonly grown, although other brassicas, particularly kale, Brussels sprout, cauliflower and broccoli, have been increasingly produced since recently. One of the specialties of vegetable production in Montenegro is growing of collard (Brassica oleracea var. acephala), which is the simplest variety of the Brassica oleracea species ...

  8. Powdery mildew suppresses herbivore-induced plant volatiles and interferes with parasitoid attraction in Brassica rapa (United States)

    The co-occurrence of different antagonists on a plant can greatly affect infochemicals with ecological consequences for higher trophic levels. Here we investigated how the presence of a plant pathogen, the powdery mildew Erysiphe cruciferarum, on Brassica rapa affects 1) plant volatiles emitted in r...

  9. Antioxidant Enzyme Activities of some Brassica Species

    Directory of Open Access Journals (Sweden)

    Rodica SOARE


    Full Text Available This paper set out to comparatively study five species: white cabbage (Brassica oleracea L. var. c