WorldWideScience

Sample records for inactivation dna double

  1. Effects of heavy ions on inactivation and DNA double strand breaks in Deinococcus radiodurans R1.

    Science.gov (United States)

    Zimmermann, H; Schafer, M; Schmitz, C; Bucker, H

    1994-10-01

    Inactivation and double strand break (dsb) induction after heavy ion irradiation were studied in stationary phase cells of the highly radiation resistant bacterium Deinococcus radiodurans R1. There is evidence that the radiation sensitivity of this bacterium is nearly independent on energy in the range of up to 15 MeV/u for lighter ions (Ar). The responses to dsb induction for charged particles show direct relationship between increasing radiation dose and residual intact DNA.

  2. Inactivation of the budding yeast cohesin loader Scc2 alters gene expression both globally and in response to a single DNA double strand break.

    Science.gov (United States)

    Lindgren, Emma; Hägg, Sara; Giordano, Fosco; Björkegren, Johan; Ström, Lena

    2014-01-01

    Genome integrity is fundamental for cell survival and cell cycle progression. Important mechanisms for keeping the genome intact are proper sister chromatid segregation, correct gene regulation and efficient repair of damaged DNA. Cohesin and its DNA loader, the Scc2/4 complex have been implicated in all these cellular actions. The gene regulation role has been described in several organisms. In yeast it has been suggested that the proteins in the cohesin network would effect transcription based on its role as insulator. More recently, data are emerging indicating direct roles for gene regulation also in yeast. Here we extend these studies by investigating whether the cohesin loader Scc2 is involved in regulation of gene expression. We performed global gene expression profiling in the absence and presence of DNA damage, in wild type and Scc2 deficient G2/M arrested cells, when it is known that Scc2 is important for DNA double strand break repair and formation of damage induced cohesion. We found that not only the DNA damage specific transcriptional response is distorted after inactivation of Scc2 but also the overall transcription profile. Interestingly, these alterations did not correlate with changes in cohesin binding.

  3. Visualization of interaction between ribosome-inactivating proteins and supercoiled DNA with an atomic force microscope

    Institute of Scientific and Technical Information of China (English)

    吴晓华; 刘望夷; 欧阳振乾; 李民乾

    1997-01-01

    The interaction between ribosome-inactivating proteins (RIPs) and supercoiled DNA was observed with an atomic force microscope (AFM). It was found that RIPs can bind to both supercoiled DNA and the unwound double stranded loop region in supercoiled DNA. The RIPs hound to the supercoils can induce the conformational change of supercoiled DNA. Furthermore, the supercoiled DNA was relaxed and cleaved into nick or linear form by RIPs. It indicated that RIP seemed to be a supercoil-dependent DNA binding protein and exhibited the activity of su-percoil-dependent DNA endonuclease.

  4. Inactivation of the budding yeast cohesin loader Scc2 alters gene expression both globally and in response to a single DNA double strand break

    OpenAIRE

    Lindgren, Emma; Hägg, Sara; Giordano, Fosco; Börkegren, Johan; Ström, Lena

    2014-01-01

    Genome integrity is fundamental for cell survival and cell cycle progression. Important mechanisms for keeping the genome intact are proper sister chromatid segregation, correct gene regulation and efficient repair of damaged DNA. Cohesin and its DNA loader, the Scc2/4 complex have been implicated in all these cellular actions. The gene regulation role has been described in several organisms. In yeast it has been suggested that the proteins in the cohesin network would effect transcription ba...

  5. Conjugated Polymers/DNA Hybrid Materials for Protein Inactivation.

    Science.gov (United States)

    Zhao, Likun; Zhang, Jiangyan; Xu, Huiming; Geng, Hao; Cheng, Yongqiang

    2016-09-01

    Chromophore-assisted light inactivation (CALI) is a powerful tool for analyzing protein functions due to the high degree of spatial and temporal resolution. In this work, we demonstrate a CALI approach based on conjugated polymers (CPs)/DNA hybrid material for protein inactivation. The target protein is conjugated with single-stranded DNA in advance. Single-stranded DNA can form CPs/DNA hybrid material with cationic CPs via electrostatic and hydrophobic interactions. Through the formation of CPs/DNA hybrid material, the target protein that is conjugated with DNA is brought into close proximity to CPs. Under irradiation, CPs harvest light and generate reactive oxygen species (ROS), resulting in the inactivation of the adjacent target protein. This approach can efficiently inactivate any target protein which is conjugated with DNA and has good specificity and universality, providing a new strategy for studies of protein function and adjustment of protein activity.

  6. Sex chromosome inactivation in germ cells: emerging roles of DNA damage response pathways.

    Science.gov (United States)

    Ichijima, Yosuke; Sin, Ho-Su; Namekawa, Satoshi H

    2012-08-01

    Sex chromosome inactivation in male germ cells is a paradigm of epigenetic programming during sexual reproduction. Recent progress has revealed the underlying mechanisms of sex chromosome inactivation in male meiosis. The trigger of chromosome-wide silencing is activation of the DNA damage response (DDR) pathway, which is centered on the mediator of DNA damage checkpoint 1 (MDC1), a binding partner of phosphorylated histone H2AX (γH2AX). This DDR pathway shares features with the somatic DDR pathway recognizing DNA replication stress in the S phase. Additionally, it is likely to be distinct from the DDR pathway that recognizes meiosis-specific double-strand breaks. This review article extensively discusses the underlying mechanism of sex chromosome inactivation.

  7. Gene silencing: Double-stranded RNA mediated mRNA degradation and gene inactivation

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that doublestranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methylation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.

  8. Repair of DNA Double-Strand Breaks

    Science.gov (United States)

    Falk, Martin; Lukasova, Emilie; Kozubek, Stanislav

    The genetic information of cells continuously undergoes damage induced by intracellular processes including energy metabolism, DNA replication and transcription, and by environmental factors such as mutagenic chemicals and UV and ionizing radiation. This causes numerous DNA lesions, including double strand breaks (DSBs). Since cells cannot escape this damage or normally function with a damaged genome, several DNA repair mechanisms have evolved. Although most "single-stranded" DNA lesions are rapidly removed from DNA without permanent damage, DSBs completely break the DNA molecule, presenting a real challenge for repair mechanisms, with the highest risk among DNA lesions of incorrect repair. Hence, DSBs can have serious consequences for human health. Therefore, in this chapter, we will refer only to this type of DNA damage. In addition to the biochemical aspects of DSB repair, which have been extensively studied over a long period of time, the spatio-temporal organization of DSB induction and repair, the importance of which was recognized only recently, will be considered in terms of current knowledge and remaining questions.

  9. Sex chromosome inactivation in germ cells: emerging roles of DNA damage response pathways

    OpenAIRE

    Ichijima, Yosuke; Sin, Ho-Su; Satoshi H Namekawa

    2012-01-01

    Sex chromosome inactivation in male germ cells is a paradigm of epigenetic programming during sexual reproduction. Recent progress has revealed the underlying mechanisms of sex chromosome inactivation in male meiosis. The trigger of chromosome-wide silencing is activation of the DNA damage response (DDR) pathway, which is centered on the mediator of DNA damage checkpoint 1 (MDC1), a binding partner of phosphorylated histone H2AX (γH2AX). This DDR pathway shares features with the somatic DDR p...

  10. A double mutation in families with periodic paralysis defines new aspects of sodium channel slow inactivation

    Science.gov (United States)

    Bendahhou, Saïd; Cummins, Theodore R.; Hahn, Angelika F.; Langlois, Sylvie; Waxman, Stephen G.; Ptácek, Louis J.

    2000-01-01

    Hyperkalemic periodic paralysis (HyperKPP) is an autosomal dominant skeletal muscle disorder caused by single mutations in the SCN4A gene, encoding the human skeletal muscle voltage-gated Na+ channel. We have now identified one allele with two novel mutations occurring simultaneously in the SCN4A gene. These mutations are found in two distinct families that had symptoms of periodic paralysis and malignant hyperthermia susceptibility. The two nucleotide transitions predict phenylalanine 1490→leucine and methionine 1493→isoleucine changes located in the transmembrane segment S5 in the fourth repeat of the α-subunit Na+ channel. Surprisingly, this mutation did not affect fast inactivation parameters. The only defect produced by the double mutant (F1490L-M1493I, expressed in human embryonic kidney 293 cells) is an enhancement of slow inactivation, a unique behavior not seen in the 24 other disease-causing mutations. The behavior observed in these mutant channels demonstrates that manifestation of HyperKPP does not necessarily require disruption of slow inactivation. Our findings may also shed light on the molecular determinants and mechanism of Na+ channel slow inactivation and help clarify the relationship between Na+ channel defects and the long-term paralytic attacks experienced by patients with HyperKPP. PMID:10930446

  11. Microwave-induced inactivation of DNA-based hybrid catalyst in asymmetric catalysis.

    Science.gov (United States)

    Zhao, Hua; Shen, Kai

    2016-03-01

    DNA-based hybrid catalysts have gained strong interests in asymmetric reactions. However, to maintain the high enantioselectivity, these reactions are usually conducted at relatively low temperatures (e.g. DNA-based hybrid catalyst even at low temperatures (such as 5 °C). Circular dichroism (CD) spectra and gel electrophoresis of DNA suggest that microwave exposure degrades DNA molecules and disrupts DNA double-stranded structures, causing changes of DNA-metal ligand binding properties and thus poor DNA catalytic performance.

  12. RECQL4 Promotes DNA End Resection in Repair of DNA Double-Strand Breaks.

    Science.gov (United States)

    Lu, Huiming; Shamanna, Raghavendra A; Keijzers, Guido; Anand, Roopesh; Rasmussen, Lene Juel; Cejka, Petr; Croteau, Deborah L; Bohr, Vilhelm A

    2016-06-28

    The RecQ helicase RECQL4, mutated in Rothmund-Thomson syndrome, regulates genome stability, aging, and cancer. Here, we identify a crucial role for RECQL4 in DNA end resection, which is the initial and an essential step of homologous recombination (HR)-dependent DNA double-strand break repair (DSBR). Depletion of RECQL4 severely reduces HR-mediated repair and 5' end resection in vivo. RECQL4 physically interacts with MRE11-RAD50-NBS1 (MRN), which senses DSBs and initiates DNA end resection with CtIP. The MRE11 exonuclease regulates the retention of RECQL4 at laser-induced DSBs. RECQL4 also directly interacts with CtIP via its N-terminal domain and promotes CtIP recruitment to the MRN complex at DSBs. Moreover, inactivation of RECQL4's helicase activity impairs DNA end processing and HR-dependent DSBR without affecting its interaction with MRE11 and CtIP, suggesting an important role for RECQL4's unwinding activity in the process. Thus, we report that RECQL4 is an important participant in HR-dependent DSBR.

  13. RECQL4 Promotes DNA End Resection in Repair of DNA Double-Strand Breaks

    Directory of Open Access Journals (Sweden)

    Huiming Lu

    2016-06-01

    Full Text Available The RecQ helicase RECQL4, mutated in Rothmund-Thomson syndrome, regulates genome stability, aging, and cancer. Here, we identify a crucial role for RECQL4 in DNA end resection, which is the initial and an essential step of homologous recombination (HR-dependent DNA double-strand break repair (DSBR. Depletion of RECQL4 severely reduces HR-mediated repair and 5′ end resection in vivo. RECQL4 physically interacts with MRE11-RAD50-NBS1 (MRN, which senses DSBs and initiates DNA end resection with CtIP. The MRE11 exonuclease regulates the retention of RECQL4 at laser-induced DSBs. RECQL4 also directly interacts with CtIP via its N-terminal domain and promotes CtIP recruitment to the MRN complex at DSBs. Moreover, inactivation of RECQL4’s helicase activity impairs DNA end processing and HR-dependent DSBR without affecting its interaction with MRE11 and CtIP, suggesting an important role for RECQL4’s unwinding activity in the process. Thus, we report that RECQL4 is an important participant in HR-dependent DSBR.

  14. RECQL4 Promotes DNA End Resection in Repair of DNA Double-Strand Breaks

    DEFF Research Database (Denmark)

    Lu, Huiming; Shamanna, Raghavendra A; Keijzers, Guido

    2016-01-01

    The RecQ helicase RECQL4, mutated in Rothmund-Thomson syndrome, regulates genome stability, aging, and cancer. Here, we identify a crucial role for RECQL4 in DNA end resection, which is the initial and an essential step of homologous recombination (HR)-dependent DNA double-strand break repair (DSBR......). Depletion of RECQL4 severely reduces HR-mediated repair and 5' end resection in vivo. RECQL4 physically interacts with MRE11-RAD50-NBS1 (MRN), which senses DSBs and initiates DNA end resection with CtIP. The MRE11 exonuclease regulates the retention of RECQL4 at laser-induced DSBs. RECQL4 also directly...... interacts with CtIP via its N-terminal domain and promotes CtIP recruitment to the MRN complex at DSBs. Moreover, inactivation of RECQL4's helicase activity impairs DNA end processing and HR-dependent DSBR without affecting its interaction with MRE11 and CtIP, suggesting an important role for RECQL4's...

  15. RNF4 is required for DNA double-strand break repair in vivo

    DEFF Research Database (Denmark)

    Vyas, R; Kumar, R; Clermont, F

    2013-01-01

    for both homologous recombination (HR) and non-homologous end joining repair. To establish a link between Rnf4 and the DNA damage response (DDR) in vivo, we generated an Rnf4 allelic series in mice. We show that Rnf4-deficiency causes persistent ionizing radiation-induced DNA damage and signaling......Unrepaired DNA double-strand breaks (DSBs) cause genetic instability that leads to malignant transformation or cell death. Cells respond to DSBs with the ordered recruitment of signaling and repair proteins to the sites of DNA lesions. Coordinated protein SUMOylation and ubiquitylation have crucial......, and that Rnf4-deficient cells and mice exhibit increased sensitivity to genotoxic stress. Mechanistically, we show that Rnf4 targets SUMOylated MDC1 and SUMOylated BRCA1, and is required for the loading of Rad51, an enzyme required for HR repair, onto sites of DNA damage. Similarly to inactivating mutations...

  16. Inactivation of Pol ? and C-NHEJ eliminates off-target integration of exogenous DNA

    OpenAIRE

    Zelensky, Alex N; Schimmel, Joost; Kool, Hanneke; Kanaar, Roland; Tijsterman, Marcel

    2017-01-01

    Off-target or random integration of exogenous DNA hampers precise genomic engineering and presents a safety risk in clinical gene therapy strategies. Genetic definition of random integration has been lacking for decades. Here, we show that the A-family DNA polymerase ? (Pol ?) promotes random integration, while canonical non-homologous DNA end joining plays a secondary role; cells double deficient for polymerase ? and canonical non-homologous DNA end joining are devoid of any integration even...

  17. Lyn tyrosine kinase promotes silencing of ATM-dependent checkpoint signaling during recovery from DNA double-strand breaks

    Energy Technology Data Exchange (ETDEWEB)

    Fukumoto, Yasunori, E-mail: fukumoto@faculty.chiba-u.jp; Kuki, Kazumasa; Morii, Mariko; Miura, Takahito; Honda, Takuya; Ishibashi, Kenichi; Hasegawa, Hitomi; Kubota, Sho; Ide, Yudai; Yamaguchi, Noritaka; Nakayama, Yuji; Yamaguchi, Naoto, E-mail: nyama@faculty.chiba-u.jp

    2014-09-26

    Highlights: • Inhibition of Src family kinases decreased γ-H2AX signal. • Inhibition of Src family increased ATM-dependent phosphorylation of Chk2 and Kap1. • shRNA-mediated knockdown of Lyn increased phosphorylation of Kap1 by ATM. • Ectopic expression of Src family kinase suppressed ATM-mediated Kap1 phosphorylation. • Src is involved in upstream signaling for inactivation of ATM signaling. - Abstract: DNA damage activates the DNA damage checkpoint and the DNA repair machinery. After initial activation of DNA damage responses, cells recover to their original states through completion of DNA repair and termination of checkpoint signaling. Currently, little is known about the process by which cells recover from the DNA damage checkpoint, a process called checkpoint recovery. Here, we show that Src family kinases promote inactivation of ataxia telangiectasia mutated (ATM)-dependent checkpoint signaling during recovery from DNA double-strand breaks. Inhibition of Src activity increased ATM-dependent phosphorylation of Chk2 and Kap1. Src inhibition increased ATM signaling both in G2 phase and during asynchronous growth. shRNA knockdown of Lyn increased ATM signaling. Src-dependent nuclear tyrosine phosphorylation suppressed ATM-mediated Kap1 phosphorylation. These results suggest that Src family kinases are involved in upstream signaling that leads to inactivation of the ATM-dependent DNA damage checkpoint.

  18. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ss......DNA and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  19. DNA-like double helix formed by peptide nucleic acid

    DEFF Research Database (Denmark)

    Wittung, P; Nielsen, Peter E.; Buchardt, O;

    1994-01-01

    Although the importance of the nucleobases in the DNA double helix is well understood, the evolutionary significance of the deoxyribose phosphate backbone and the contribution of this chemical entity to the overall helical structure and stability of the double helix is not so clear. Peptide nucleic...... acid (PNA) is a DNA analogue with a backbone consisting of N-(2-aminoethyl)glycine units (Fig. 1) which has been shown to mimic DNA in forming Watson-Crick complementary duplexes with normal DNA. Using circular dichroism spectroscopy we show here that two complementary PNA strands can hybridize to one...

  20. UV-LEDs Efficiently Inactivate DNA and RNA Coliphages

    Directory of Open Access Journals (Sweden)

    Alyaa M. Zyara

    2017-01-01

    Full Text Available UV-LEDs are a new method of disinfecting drinking water. Some viruses are very resistant to UV and the efficiency of UV-LEDs to disinfect them needs to be studied. Drinking water was disinfected with UV-LEDs after spiking the water with MS2 and four UV- and/or Cl-resistant coliphages belonging to RNA or DNA coliphages isolated from municipal wastewater. UV-LEDs operating at a wavelength of 270 nm for 2 min with 120 mW of irradiation caused 0.93–2.73 Log10-reductions of coliphages tested in a reactor of a 5.2 L volume. Irradiation time of 10 min in the same system increased the Log10-reductions to 4.30–5.16. Traditional mercury UV (Hg-UV lamp at a 254 nm wavelength caused 0.67–4.08 Log10-reductions in 2 min and 4.56–7.21 Log10-reductions in 10 min in 10 mL of water. All coliphages tested except MS2 achieved 4 Log10-reductions with UV-LEDs at a dose that corresponded to 70 mWs/cm2 using Hg-UV. Thus, UV-LEDs are a promising method of disinfecting UV- and/or Cl-resistant viruses.

  1. DNA Origami with Double Stranded DNA as a Unified Scaffold

    Science.gov (United States)

    Yang, Yang; Han, Dongran; Nangreave, Jeanette; Liu, Yan; Yan, Hao

    2013-01-01

    Scaffolded DNA origami is a widely used technology for self-assembling precisely structured nanoscale objects that contain a large number of addressable features. Typical scaffolds are long, single strands of DNA (ssDNA) that are folded into distinct shapes through the action of many, short ssDNA staples that are complementary to several different domains of the scaffold. However, sources of long single stranded DNA are scarce, limiting the size and complexity of structures that can be assembled. Here we demonstrated that dsDNA scaffolds can be directly used to fabricate integrated DNA origami structures that incorporate both of the constituent ssDNA molecules. Two basic principles were employed in the design of scaffold folding paths – folding path asymmetry and periodic convergence of the two ssDNA scaffold strands. Asymmetry in the folding path minimizes unwanted complementarity between staples, and incorporating an offset between the folding paths of each ssDNA scaffold strand reduces the number of times that complementary portions of the strands are brought into close proximity with one another, both of which decrease the likelihood of dsDNA scaffold recovery. Meanwhile, the folding paths of the two ssDNA scaffold strands were designed to periodically converge to promote the assembly of a single, unified structure rather than two individual ones. Our results reveal that this basic strategy can be used to reliably assemble integrated DNA nanostructures from dsDNA scaffolds. PMID:22830653

  2. Nucleic Acid Analogue Induced Transcription of Double Stranded DNA

    DEFF Research Database (Denmark)

    1998-01-01

    RNA is transcribed from a double stranded DNA template by forming a complex by hybridizing to the template at a desired transcription initiation site one or more oligonucleic acid analogues of the PNA type capable of forming a transcription initiation site with the DNA and exposing the complex...

  3. Targeting DNA double-strand breaks with TAL effector nucleases.

    Science.gov (United States)

    Christian, Michelle; Cermak, Tomas; Doyle, Erin L; Schmidt, Clarice; Zhang, Feng; Hummel, Aaron; Bogdanove, Adam J; Voytas, Daniel F

    2010-10-01

    Engineered nucleases that cleave specific DNA sequences in vivo are valuable reagents for targeted mutagenesis. Here we report a new class of sequence-specific nucleases created by fusing transcription activator-like effectors (TALEs) to the catalytic domain of the FokI endonuclease. Both native and custom TALE-nuclease fusions direct DNA double-strand breaks to specific, targeted sites.

  4. Non-coding RNAs and epigenome: de novo DNA methylation, allelic exclusion and X-inactivation

    Directory of Open Access Journals (Sweden)

    V. A. Halytskiy

    2013-12-01

    Full Text Available Non-coding RNAs are widespread class of cell RNAs. They participate in many important processes in cells – signaling, posttranscriptional silencing, protein biosynthesis, splicing, maintenance of genome stability, telomere lengthening, X-inactivation. Nevertheless, activity of these RNAs is not restricted to posttranscriptional sphere, but cover also processes that change or maintain the epigenetic information. Non-coding RNAs can directly bind to the DNA targets and cause their repression through recruitment of DNA methyltransferases as well as chromatin modifying enzymes. Such events constitute molecular mechanism of the RNA-dependent DNA methylation. It is possible, that the RNA-DNA interaction is universal mechanism triggering DNA methylation de novo. Allelic exclusion can be also based on described mechanism. This phenomenon takes place, when non-coding RNA, which precursor is transcribed from one allele, triggers DNA methylation in all other alleles present in the cell. Note, that miRNA-mediated transcriptional silencing resembles allelic exclusion, because both miRNA gene and genes, which can be targeted by this miRNA, contain elements with the same sequences. It can be assumed that RNA-dependent DNA methylation and allelic exclusion originated with the purpose of counteracting the activity of mobile genetic elements. Probably, thinning and deregulation of the cellular non-coding RNA pattern allows reactivation of silent mobile genetic elements resulting in genome instability that leads to ageing and carcinogenesis. In the course of X-inactivation, DNA methylation and subsequent hete­rochromatinization of X chromosome can be triggered by direct hybridization of 5′-end of large non-coding RNA Xist with DNA targets in remote regions of the X chromosome.

  5. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA.

    Science.gov (United States)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela; Gamba, Cristina; Barnett, Ross; Samaniego, José Alfredo; Madrigal, Jazmín Ramos; Orlando, Ludovic; Gilbert, M Thomas P

    2015-12-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained DNA, but this enrichment is less pronounced when dsDNA preparations successfully recover short endogenous DNA fragments (mean size < 70 bp). Our findings can help researchers determine when to utilize the time- and resource-intensive ssDNA library preparation method.

  6. PROPERTIES OF DOUBLE-STRANDED DNA AS A POLYELECTROLYTE.

    Science.gov (United States)

    OHNISHI, T

    1963-11-01

    The stability of the structure of double-stranded DNA in the salt-free solution is discussed on the basis of the polyelectrolyte theory. Assuming that DNA is an infinitely long rod, and the formation of double strands is divided into combining process and folding process, the free energy changes required in these processes are calculated by the use of the exact solutions of two-dimensional Poisson-Boltzmann equation for the one rod and the two rod systems.By strong depression of electrostatic interaction due to counter-ion condensation phenomena, the free energy change is remarkably decreased so that the double-stranded structure of DNA can be stabilized by energy of hydrogen bonds between base pairs. The increase of the activity coefficient of a counterion upon heat denaturation of DNA is also explained.

  7. Chromatin inactivation precedes de novo dna methylation during the progressive epigenetic silencing of the rassf1a promoter

    Energy Technology Data Exchange (ETDEWEB)

    Strunnikova Maria; Schagdarsurengin, Undraga; Kehlen, Astrid; Garbe, James C.; Stampfer, Martha R.; Dammann, Reinhard

    2005-02-23

    Epigenetic inactivation of the RASSF1A tumor suppressor by CpG island methylation was frequently detected in cancer. However, the mechanisms of this aberrant DNA methylation are unknown. In the RASSF1A promoter, we characterized four Sp1 sites, which are frequently methylated in cancer. We examined the functional relationship between DNA methylation, histone modification, Sp1 binding, and RASSF1A expression in proliferating human mammary epithelial cells. With increasing passages, the transcription of RASSF1A was dramatically silenced. This inactivation was associated with deacetylation and lysine 9 trimethylation of histone H3 and an impaired binding of Sp1 at the RASSF1A promoter. In mammary epithelial cells that had overcome a stress-associated senescence barrier, a spreading of DNA methylation in the CpG island promoter was observed. When the RASSF1A-silenced cells were treated with inhibitors of DNA methyltransferase and histone deacetylase, binding of Sp1 and expression of RASSF1 A reoccurred. In summary, we observed that histone H3 deacetylation and H3 lysine 9 trimethylation occur in the same time window as gene inactivation and precede DNA methylation. Our data suggest that in epithelial cells, histone inactivation may trigger de novo DNA methylation of the RASSF1A promoter and this system may serve as a model for CpG island inactivation of tumor suppressor genes.

  8. Oxygen-independent inactivation of Haemophilus influenzae transforming DNA by monochromatic radiation: action spectrum, effect of histidine and repair

    Energy Technology Data Exchange (ETDEWEB)

    Cabrera-Juarez, E.; Setlow, J.K.; Swenson, P.A.; Peak, M.J.

    1976-01-01

    The action spectrum for the oxygen-independent inactivation of native transforming DNA from Haemophilus influenzae with near-uv radiation revealed a shoulder beginning at 334 and extending to 460 nm. The presence of 0.2 M histidine during irradiation produced a small increase in inactivation at 254, 290 and 313 nm, a large increase at 334 nm and a decrease in inactivation at 365, 405, and 460 nm. Photoreactivation did not reverse the DNA damage produced at pH 7.0 at 334, 365, 405 and 460 nm, but did reactivate the DNA after irradiation at 254, 290 and 313 nm. The inactivation of DNA irradiated at 254, 290 and 313 nm was considerably greater when the transforming ability was assayed in an excision-defective mutant compared with the wild type, although DNA irradiated at 334, 365, 405 and 460 nm showed smaller differences. These results suggest that the oxygen-independent inactivation of H. influenzae DNA at pH 7 by irradiation at 334, 365, 405 and 460 nm is caused by lesions other than pyrimidine dimers.

  9. Different fates of oocytes with DNA double-strand breaks in vitro and in vivo.

    Science.gov (United States)

    Lin, Fei; Ma, Xue-Shan; Wang, Zhen-Bo; Wang, Zhong-Wei; Luo, Yi-Bo; Huang, Lin; Jiang, Zong-Zhe; Hu, Meng-Wen; Schatten, Heide; Sun, Qing-Yuan

    2014-01-01

    In female mice, despite the presence of slight DNA double-strand breaks (DSBs), fully grown oocytes are able to undergo meiosis resumption as indicated by germinal vesicle breakdown (GVBD); however, severe DNA DSBs do reduce and delay entry into M phase through activation of the DNA damage checkpoint. But little is known about the effect of severe DNA DSBs on the spindle assembly checkpoint (SAC) during oocyte maturation. We showed that nearly no first polar body (PB1) was extruded at 12 h of in vitro maturation (IVM) in severe DNA DSBs oocytes, and the limited number of oocytes with PB1 were actually at telophase. However, about 60% of the severe DNA DSBs oocytes which underwent GVBD at 2 h of IVM released a PB1 at 18 h of IVM and these oocytes did reach the second metaphase (MII) stage. Chromosome spread at MI and MII stages showed that chromosomes fragmented after GVBD in severe DNA DSBs oocytes. The delayed PB1 extrusion was due to the disrupted attachment of microtubules to kinetochores and activation of the SAC. At the same time, misaligned chromosome fragments became obvious at the first metaphase (MI) in severe DNA DSBs oocytes. These data implied that the inactivation of SAC during the metaphase-anaphase transition of first meiosis was independent of chromosome integrity. Next, we induced DNA DSBs in vivo, and found that the number of superovulated oocytes per mouse was significantly reduced; moreover, this treatment increased the percentage of apoptotic oocytes. These results suggest that DNA DSBs oocytes undergo apoptosis in vivo.

  10. Molecular crowding effects on stability of DNA double helix

    Science.gov (United States)

    Singh, Amar; Singh, Navin

    2016-05-01

    Cellular environmental conditions critically affect the structure and stability of double stranded DNA (dsDNA) molecule. It is known that 20-30% of the total volume of the cell is occupied by the molecular crowders. The presence of these crowders, reduces the free space available to the base pairs of a DNA molecule, hence the movement of base pair is restricted. Here, we study the thermal opening of dsDNA molecule using Peyrard Bishop Dauxois (PBD) model. The presence of crowders in the model, that mimic those found in the cell nucleus, is realized through the potential term. Using the equilibrium statistical calculations, we find melting profile and melting probabilities of the chain. The opening of DNA molecule in the presence of these crowders is shown through the density plots. This study reveals that the stability of dsDNA molecule is influenced by entropic as well as enthalpic effects and is more stable in the crowded environment.

  11. Constructing higher order DNA origami arrays using DNA junctions of anti-parallel/parallel double crossovers

    Science.gov (United States)

    Ma, Zhipeng; Park, Seongsu; Yamashita, Naoki; Kawai, Kentaro; Hirai, Yoshikazu; Tsuchiya, Toshiyuki; Tabata, Osamu

    2016-06-01

    DNA origami provides a versatile method for the construction of nanostructures with defined shape, size and other properties; such nanostructures may enable a hierarchical assembly of large scale architecture for the placement of other nanomaterials with atomic precision. However, the effective use of these higher order structures as functional components depends on knowledge of their assembly behavior and mechanical properties. This paper demonstrates construction of higher order DNA origami arrays with controlled orientations based on the formation of two types of DNA junctions: anti-parallel and parallel double crossovers. A two-step assembly process, in which preformed rectangular DNA origami monomer structures themselves undergo further self-assembly to form numerically unlimited arrays, was investigated to reveal the influences of assembly parameters. AFM observations showed that when parallel double crossover DNA junctions are used, the assembly of DNA origami arrays occurs with fewer monomers than for structures formed using anti-parallel double crossovers, given the same assembly parameters, indicating that the configuration of parallel double crossovers is not energetically preferred. However, the direct measurement by AFM force-controlled mapping shows that both DNA junctions of anti-parallel and parallel double crossovers have homogeneous mechanical stability with any part of DNA origami.

  12. Chromatin remodelers in the DNA double strand break response

    NARCIS (Netherlands)

    Smeenk, Godelieve

    2012-01-01

    During my PhD project, I studied the role of several chromatin remodelers in the DNA double strand break (DSB) response. We discovered that both CHD4 and SMARCA5 are required for ubiquitin signaling through the E3 ubiquitin ligases RNF8 and RNF168, which is a central signaling event in the response

  13. Chromatin remodelers in the DNA double strand break response

    NARCIS (Netherlands)

    Smeenk, Godelieve

    2012-01-01

    During my PhD project, I studied the role of several chromatin remodelers in the DNA double strand break (DSB) response. We discovered that both CHD4 and SMARCA5 are required for ubiquitin signaling through the E3 ubiquitin ligases RNF8 and RNF168, which is a central signaling event in the response

  14. Euler buckling and nonlinear kinking of double-stranded DNA.

    Science.gov (United States)

    Fields, Alexander P; Meyer, Elisabeth A; Cohen, Adam E

    2013-11-01

    The bending stiffness of double-stranded DNA (dsDNA) at high curvatures is fundamental to its biological activity, yet this regime has been difficult to probe experimentally, and literature results have not been consistent. We created a 'molecular vise' in which base-pairing interactions generated a compressive force on sub-persistence length segments of dsDNA. Short dsDNA strands (Euler buckling'. We monitored the buckling transition via Förster Resonance Energy Transfer (FRET) between appended fluorophores. For low-to-moderate concentrations of monovalent salt (up to ∼150 mM), our results are in quantitative agreement with the worm-like chain (WLC) model of DNA elasticity, without the need to invoke any 'kinked' states. Greater concentrations of monovalent salts or 1 mM Mg(2+) induced an apparent softening of the dsDNA, which was best accounted for by a kink in the region of highest curvature. We tested the effects of all single-nucleotide mismatches on the DNA bending. Remarkably, the propensity to kink correlated with the thermodynamic destabilization of the mismatched DNA relative the perfectly complementary strand, suggesting that the kinked state is locally melted. The molecular vise is exquisitely sensitive to the sequence-dependent linear and nonlinear elastic properties of dsDNA.

  15. Double strand breaks in DNA resulting from double-electron-emission events

    CERN Document Server

    Surdutovich, Eugene

    2012-01-01

    A mechanism of double strand breaking (DSB) in DNA due to the action of two electrons is considered. These are the electrons produced in the vicinity of DNA molecules due to ionization of water molecules with a consecutive emission of two electrons, making such a mechanism possible. This effect qualitatively solves a puzzle of large yields of DSBs following irradiation of DNA molecules. The transport of secondary electrons, including the additional electrons, is studied in relation to the assessment of radiation damage due to incident ions. This work is a stage in the inclusion of Auger mechanism and like effects into the multiscale approach to ion-beam cancer therapy.

  16. An effective mesoscopic model of double-stranded DNA.

    Science.gov (United States)

    Jeon, Jae-Hyung; Sung, Wokyung

    2014-01-01

    Watson and Crick's epochal presentation of the double helix structure in 1953 has paved the way to intense exploration of DNA's vital functions in cells. Also, recent advances of single molecule techniques have made it possible to probe structures and mechanics of constrained DNA at length scales ranging from nanometers to microns. There have been a number of atomistic scale quantum chemical calculations or molecular level simulations, but they are too computationally demanding or analytically unfeasible to describe the DNA conformation and mechanics at mesoscopic levels. At micron scales, on the other hand, the wormlike chain model has been very instrumental in describing analytically the DNA mechanics but lacks certain molecular details that are essential in describing the hybridization, nano-scale confinement, and local denaturation. To fill this fundamental gap, we present a workable and predictive mesoscopic model of double-stranded DNA where the nucleotides beads constitute the basic degrees of freedom. With the inter-strand stacking given by an interaction between diagonally opposed monomers, the model explains with analytical simplicity the helix formation and produces a generalized wormlike chain model with the concomitant large bending modulus given in terms of the helical structure and stiffness. It also explains how the helical conformation undergoes overstretch transition to the ladder-like conformation at a force plateau, in agreement with the experiment.

  17. DNA double strand break repair, aging and the chromatin connection.

    Science.gov (United States)

    Gorbunova, Vera; Seluanov, Andrei

    2016-06-01

    Are DNA damage and mutations possible causes or consequences of aging? This question has been hotly debated by biogerontologists for decades. The importance of DNA damage as a possible driver of the aging process went from being widely recognized to then forgotten, and is now slowly making a comeback. DNA double strand breaks (DSBs) are particularly relevant to aging because of their toxicity, increased frequency with age and the association of defects in their repair with premature aging. Recent studies expand the potential impact of DNA damage and mutations on aging by linking DNA DSB repair and age-related chromatin changes. There is overwhelming evidence that increased DNA damage and mutations accelerate aging. However, an ultimate proof of causality would be to show that enhanced genome and epigenome stability delays aging. This is not an easy task, as improving such complex biological processes is infinitely more difficult than disabling it. We will discuss the possibility that animal models with enhanced DNA repair and epigenome maintenance will be generated in the near future.

  18. Ternary and senary representations using DNA double-crossover tiles

    CERN Document Server

    Kim, Byeonghoon; Son, Junyoung; Kim, Junghoon; Hwang, Si Un; Dugasani, Sreekantha Reddy; Kim, Min Hyeok; Kim, Byung-Dong; Chang, Iksoo; Liu, Wing Kam; Kim, Moon Ki; Park, Sung Ha

    2016-01-01

    The information capacity of double-crossover (DX) tiles was successfully increased beyond a binary representation to higher base representations. By controlling the length and the position of DNA hairpins on the DX tile, ternary and senary (base-3 and base-6) digit representations were realized and verified by atomic force microscopy (AFM). Also, normal mode analysis (NMA) was carried out to study the mechanical characteristics of each structure.

  19. What Governs the Unzipping Process of Double-Stranded DNA

    Institute of Scientific and Technical Information of China (English)

    WANG Xiao-Feng; LEI Xiao-Ling; FANG Hai-Ping

    2006-01-01

    @@ The unzipping process of double-stranded DNA is analysed using a discrete model at the base level [Chin. Phys.Lett. 22 (2005)1540]. The numerical results are consistent with the experimental observations on the force-displacement behaviour including the sequence-dependence. We find that the hydrogen bond interaction in a base pair is crucially important to the force-displacement profile.

  20. Electronic transport in double-strand DNA segments

    Science.gov (United States)

    Albuquerque, E. L.; Mauriz, P. W.; Moreira, D. A.

    2008-03-01

    We report in this work a numerical study of the electronic density of states in π-stacked arrays of DNA double-strand segments made up from the nucleotides guanine G, adenine A, cytosine C and thymine T. In order to reveal the relevance of the underlying correlations in the nucleotides distribution, we compare the results for a genomic DNA sequence, considering a segment of the first sequenced human chromosome 22 (Ch 22), with those of two artificial sequences forming a Rudin-Shapiro (RS) as well as a Fibonacci (FB) polyGC quasiperiodic sequences. Our theoretical method uses an electronic tight-binding Hamiltonian suitable to describe the DNA segments modeled by the quasiperiodic chains.

  1. Current-voltage characteristics of double-strand DNA sequences

    Science.gov (United States)

    Bezerril, L. M.; Moreira, D. A.; Albuquerque, E. L.; Fulco, U. L.; de Oliveira, E. L.; de Sousa, J. S.

    2009-09-01

    We use a tight-binding formulation to investigate the transmissivity and the current-voltage (I-V) characteristics of sequences of double-strand DNA molecules. In order to reveal the relevance of the underlying correlations in the nucleotides distribution, we compare the results for the genomic DNA sequence with those of artificial sequences (the long-range correlated Fibonacci and Rudin-Shapiro one) and a random sequence, which is a kind of prototype of a short-range correlated system. The random sequence is presented here with the same first neighbors pair correlations of the human DNA sequence. We found that the long-range character of the correlations is important to the transmissivity spectra, although the I-V curves seem to be mostly influenced by the short-range correlations.

  2. Electronic transport in double-strand DNA segments

    Energy Technology Data Exchange (ETDEWEB)

    Albuquerque, E L; Moreira, D A [Departamento de Fisica, Universidade Federal do Rio Grande do Norte 59072-970 Natal-RN (Brazil); Mauriz, P W [Departamento de Ciencias Exatas, Centro Federal de Educacao Tecnologica do Maranhao 65025-001 Sao Luis-MA (Brazil)], E-mail: eudenilson@dfte.ufrn.br

    2008-03-15

    We report in this work a numerical study of the electronic density of states in {pi}-stacked arrays of DNA double-strand segments made up from the nucleotides guanine G, adenine A, cytosine C and thymine T. In order to reveal the relevance of the underlying correlations in the nucleotides distribution, we compare the results for a genomic DNA sequence, considering a segment of the first sequenced human chromosome 22 (Ch 22), with those of two artificial sequences forming a Rudin-Shapiro (RS) as well as a Fibonacci (FB) polyGC quasiperiodic sequences. Our theoretical method uses an electronic tight-binding Hamiltonian suitable to describe the DNA segments modeled by the quasiperiodic chains.

  3. Current-voltage characteristics of double-strand DNA sequences

    Energy Technology Data Exchange (ETDEWEB)

    Bezerril, L.M.; Moreira, D.A. [Departamento de Fisica, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@dfte.ufrn.b [Departamento de Fisica, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil); Fulco, U.L. [Departamento de Biofisica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil); Oliveira, E.L. de; Sousa, J.S. de [Departamento de Fisica, Universidade Federal do Ceara, 60455-760, Fortaleza-CE (Brazil)

    2009-09-07

    We use a tight-binding formulation to investigate the transmissivity and the current-voltage (I-V) characteristics of sequences of double-strand DNA molecules. In order to reveal the relevance of the underlying correlations in the nucleotides distribution, we compare the results for the genomic DNA sequence with those of artificial sequences (the long-range correlated Fibonacci and Rudin-Shapiro one) and a random sequence, which is a kind of prototype of a short-range correlated system. The random sequence is presented here with the same first neighbors pair correlations of the human DNA sequence. We found that the long-range character of the correlations is important to the transmissivity spectra, although the I-V curves seem to be mostly influenced by the short-range correlations.

  4. Inactivation of Pol θ and C-NHEJ eliminates off-target integration of exogenous DNA.

    Science.gov (United States)

    Zelensky, Alex N; Schimmel, Joost; Kool, Hanneke; Kanaar, Roland; Tijsterman, Marcel

    2017-07-07

    Off-target or random integration of exogenous DNA hampers precise genomic engineering and presents a safety risk in clinical gene therapy strategies. Genetic definition of random integration has been lacking for decades. Here, we show that the A-family DNA polymerase θ (Pol θ) promotes random integration, while canonical non-homologous DNA end joining plays a secondary role; cells double deficient for polymerase θ and canonical non-homologous DNA end joining are devoid of any integration events, demonstrating that these two mechanisms define random integration. In contrast, homologous recombination is not reduced in these cells and gene targeting is improved to 100% efficiency. Such complete reversal of integration outcome, from predominately random integration to exclusively gene targeting, provides a rational way forward to improve the efficacy and safety of DNA delivery and gene correction approaches.Random off-target integration events can impair precise gene targeting and poses a safety risk for gene therapy. Here the authors show that repression of polymerase θ and classical non-homologous recombination eliminates random integration.

  5. Lack of dependence on p53 for DNA double strand break repair of episomal vectors in human lymphoblasts

    Science.gov (United States)

    Kohli, M.; Jorgensen, T. J.

    1999-01-01

    The p53 tumor suppressor gene has been shown to be involved in a variety of repair processes, and recent findings have suggested that p53 may be involved in DNA double strand break repair in irradiated cells. The role of p53 in DNA double strand break repair, however, has not been fully investigated. In this study, we have constructed a novel Epstein-Barr virus (EBV)-based shuttle vector, designated as pZEBNA, to explore the influence of p53 on DNA strand break repair in human lymphoblasts, since EBV-based vectors do not inactivate the p53 pathway. We have compared plasmid survival of irradiated, restriction enzyme linearized, and calf intestinal alkaline phosphatase (CIP)-treated pZEBNA with a Simian virus 40 (SV40)-based shuttle vector, pZ189, in TK6 (wild-type p53) and WTK1 (mutant p53) lymphoblasts and determined that p53 does not modulate DNA double strand break repair in these cell lines. Copyright 1999 Academic Press.

  6. Optical and dielectric properties of double helix DNA thin films

    Energy Technology Data Exchange (ETDEWEB)

    Soenmezoglu, Savas, E-mail: svssonmezoglu@kmu.edu.tr [Department of Physics, Faculty of Kamil Ozdag Science, Karamanoglu Mehmetbey University, 70100, Karaman (Turkey); Ates Soenmezoglu, Ozlem [Department of Biology, Faculty of Kamil Ozdag Science, Karamanoglu Mehmetbey University, 70100, Karaman (Turkey)

    2011-12-01

    In this work, the thin film of wheat DNA was deposited by spin-coating technique onto glass substrate, and the optical and dielectric properties of the double helix DNA thin film were investigated. The optical constants such as refractive index, extinction coefficient, dielectric constant, dissipation factor, relaxation time, and optical conductivity were determined from the measured transmittance spectra in the wavelength range 190-1100 nm. Meanwhile, the dispersion behavior of the refractive index was studied in terms of the single oscillator Wemple-DiDomenico (W-D) model, and the physical parameters of the average oscillator strength, average oscillator wavelength, average oscillator energy, the refractive index dispersion parameter and the dispersion energy were achieved. Furthermore, the optical band gap values were calculated by W-D model and Tauc model, respectively, and the values obtained from W-D model are in agreement with those determined from the Tauc model. The analysis of the optical absorption data indicates that the optical band gap E{sub g} was indirect transitions. These results provide some useful references for the potential application of the DNA thin films in fiber optic, solar cell and optoelectronic devices. Highlights: {yields} The optical constants of DNA in full UV-vis spectrum were determined. {yields} The change in optical and dielectric property demonstrates that this material has potential to be used as a novel technology. {yields} DNA shows promise to be more suitable material than other materials currently being used for photonic devices.

  7. Charge Migration in DNA: A Double Stranded Model

    Institute of Scientific and Technical Information of China (English)

    BAO, Han; LU, Jing; FAN, Kang-Nian

    2006-01-01

    In particular, charge migration phenomena in DNA have attracted much interest because of relevance to the generation of damage and mutations which play important roles in most of life processes. In this paper a theory method was presented in which the DNA chain was treated as a double-stranded system, and the charge migration in DNA based on the donor-bridge-acceptor system was investigated by this model. After having obtained the Hamiltonian, the effects of the surrounding were explained and calculated. The double-strand calculation could lead to good exponential decay curves and this time two different falloff parameters were found respectively before and after 3 or 4 AT base pair bridge lengths as prediction. Lately theoretical study showed this result by addition of more parameter, and sequence effect was then concentrated on. The difference of transfer integral caused the different decay rate of unlike sequences, but bridge length was still proved to be the main factor on the decay rates.

  8. Genes and the physics of the DNA double-helix.

    Science.gov (United States)

    Yeramian, E

    2000-09-19

    The processing of the genetic information stored in the double-helical DNA implies the separation of the two strands, the physics of which is described by the helix-coil transition model. Is there a relationship between genetic maps and DNA physical stability maps that plot the sequence-specific propensity for the thermal disruption of the double-helix? Here, with appropriate methodological formulations, such maps are derived for a large set of sequences, including complete genomes. The superposition of the two maps leads to a contrasted picture with correlations ranging between two extremes: from almost perfect (with the genes precisely delineated as stable regions) to more or less complete unrelatedness. The simplest explanation for the results is that the observed striking correlations correspond to the relics of a primeval organisation of the genetic message, with the physics of DNA playing a role in the delimitation of coding regions. In order to trace the evolutionary fate of this signal further, a detailed study of the yeast complete genome is performed. In this study, the superposition of the genetic and physical stability maps is examined in the light of information concerning gene duplication. On the basis of this analysis it is concluded that the 'signature' associated with the supposed archaic signal is in the process of being erased, most probably because the underlying feature is no longer under selective pressure. There are many evolutionary implications for the results presented and for their proposed interpretations, notably concerning models of mutational dynamics in relation to erasure processes.

  9. P16-specific DNA methylation by engineered zinc finger methyltransferase inactivates gene transcription and promotes cancer metastasis

    OpenAIRE

    Cui, Chenghua; Gan, Ying; Gu, Liankun; Wilson, James; Liu, Zhaojun; Zhang, Baozhen; Deng, Dajun

    2015-01-01

    Background P16 DNA methylation is well known to be the most frequent event in cancer development. It has been reported that genetic inactivation of P16 drives cancer growth and metastasis, however, whether P16 DNA methylation is truly a driver in cancer metastasis remains unknown. Results A P16-specific DNA methyltransferase (P16-dnmt) expression vector is designed using a P16 promoter-specific engineered zinc finger protein fused with the catalytic domain of dnmt3a. P16-dnmt transfection sig...

  10. DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair

    Directory of Open Access Journals (Sweden)

    Elisa Mentegari

    2016-08-01

    Full Text Available DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell’s genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy.

  11. Heavy Metal Exposure Influences Double Strand Break DNA Repair Outcomes.

    Directory of Open Access Journals (Sweden)

    Maria E Morales

    Full Text Available Heavy metals such as cadmium, arsenic and nickel are classified as carcinogens. Although the precise mechanism of carcinogenesis is undefined, heavy metal exposure can contribute to genetic damage by inducing double strand breaks (DSBs as well as inhibiting critical proteins from different DNA repair pathways. Here we take advantage of two previously published culture assay systems developed to address mechanistic aspects of DNA repair to evaluate the effects of heavy metal exposures on competing DNA repair outcomes. Our results demonstrate that exposure to heavy metals significantly alters how cells repair double strand breaks. The effects observed are both specific to the particular metal and dose dependent. Low doses of NiCl2 favored resolution of DSBs through homologous recombination (HR and single strand annealing (SSA, which were inhibited by higher NiCl2 doses. In contrast, cells exposed to arsenic trioxide preferentially repaired using the "error prone" non-homologous end joining (alt-NHEJ while inhibiting repair by HR. In addition, we determined that low doses of nickel and cadmium contributed to an increase in mutagenic recombination-mediated by Alu elements, the most numerous family of repetitive elements in humans. Sequence verification confirmed that the majority of the genetic deletions were the result of Alu-mediated non-allelic recombination events that predominantly arose from repair by SSA. All heavy metals showed a shift in the outcomes of alt-NHEJ repair with a significant increase of non-templated sequence insertions at the DSB repair site. Our data suggest that exposure to heavy metals will alter the choice of DNA repair pathway changing the genetic outcome of DSBs repair.

  12. Impact of two DNA repair pathways, homologous recombination and non-homologous end joining, on bacterial spore inactivation under simulated martian environmental conditions

    Science.gov (United States)

    Moeller, Ralf; Schuerger, Andrew C.; Reitz, Günther; Nicholson, Wayne L.

    2011-09-01

    Spores of Bacillus subtilis were used as a model system to study the impact of the two major DNA double-strand break (DSB) repair mechanisms [homologous recombination (HR) and non-homologous end-joining (NHEJ)] on the survivability of air-dried mono- and multilayers of bacterial spores under a simulated martian environment; i.e., an environment with low temperature (-10 °C), pure CO 2 atmosphere (99.99% CO 2), 200-1100 nm UV-VIS-NIR radiation, and 0.69 kPa pressure. Spores in multilayers exhibited low inactivation rates compared to monolayers, mainly due to shadowing effects of overlying spores. Simulated martian UV irradiation reduced dramatically spore viability, whereas when shielded from martian UV radiation, spores deficient in NHEJ- and HR-mediated DNA repair were significantly more sensitive to simulated martian environmental conditions than were wild-type spores. In addition, NHEJ-deficient spores were consistently more sensitive than HR-deficient spores to simulated Mars environmental conditions, suggesting that DSBs were an important type of DNA damage. The results indicated that both HR and NHEJ provide an efficient set of DNA repair pathways ensuring spore survival after exposure to simulated martian environmental conditions.

  13. Nampt is involved in DNA double-strand break repair

    Institute of Scientific and Technical Information of China (English)

    Bingtao Zhu; Xiaoli Deng; Yifan Sun; Lin Bai; Zhikai Xiahou; Yusheng Cong; Xingzhi Xu

    2012-01-01

    DNA double-strand break (DSB) is the most severe form of DNA damage,which is repaired mainly through high-fidelity homologous recombination (HR) or error-prone non-homologous end joining (NHEJ).Defects in the DNA damage response lead to genomic instability and ultimately predispose organs to cancer.Nicotinamide phosphoribosyltransferase (Nampt),which is involved in nicotinamide adenine dinucleotide metabolism,is overexpressed in a variety of tumors.In this report,we found that Nampt physically associated with CtlP and DNA-PKcs/Ku80,which are key factors in HR and NHEJ,respectively.Depletion of Nampt by small interfering RNA (siRNA) led to defective NHEJ-mediated DSB repair and enhanced HR-mediated repair.Furthermore,the inhibition of Nampt expression promoted proliferation of cancer cells and normal human fibroblasts and decreased β-galactosidase staining,indicating a delay in the onset of cellular senescence in normal human fibroblasts.Taken together,our results suggest that Nampt is a suppressor of HR-mediated DSB repair and an enhancer of NHEJ-mediated DSB repair,contributing to the acceleration of cellular senescence.

  14. Regulation of DNA double-strand break repair pathway choice

    Institute of Scientific and Technical Information of China (English)

    Meena Shrivastav; Leyma P De Haro; Jac A Nickoloff

    2008-01-01

    DNA double-strand breaks (DSBs) are critical lesions that can result in cell death or a wide variety of genetic alterations including large- or small-scale deletions, loss of heterozygosity, translocations, and chromosome loss. DSBs are repaired by non-homologous end-joining (NHEJ) and homologous recombination (HR), and defects in these pathways cause genome instability and promote tumorigenesis. DSBs arise from endogenous sources includ-ing reactive oxygen species generated during cellular metabolism, collapsed replication forks, and nucleases, and from exogenous sources including ionizing radiation and chemicals that directly or indirectly damage DNA and are commonly used in cancer therapy. The DSB repair pathways appear to compete for DSBs, but the balance between them differs widely among species, between different cell types of a single species, and during different cell cycle phases of a single cell type. Here we review the regulatory factors that regulate DSB repair by NHEJ and HR in yeast and higher eukaryotes. These factors include regulated expression and phosphorylation of repair proteins, chromatin modulation of repair factor accessibility, and the availability of homologous repair templates. While most DSB repair proteins appear to function exclusively in NHEJ or HR, a number of proteins influence both pathways, including the MRE11/RAD50/NBS1 (XRS2) complex, BRCA1, histone H2AX, PARP-1, RAD18, DNA-dependent protein kinase catalytic subunit (DNA-PKcs), and ATM. DNA-PKcs plays a role in mammalian NHEJ, but it also influences HR through a complex regulatory network that may involve crosstalk with ATM, and the regulation of at least 12 proteins involved in HR that are phosphorylated by DNA-PKcs and/or ATM.

  15. Analysis of DNA Double-strand Break (DSB) Repair in Mammalian Cells

    Science.gov (United States)

    Seluanov, Andrei; Mao, Zhiyong; Gorbunova, Vera

    2010-01-01

    DNA double-strand breaks are the most dangerous DNA lesions that may lead to massive loss of genetic information and cell death. Cells repair DSBs using two major pathways: nonhomologous end joining (NHEJ) and homologous recombination (HR). Perturbations of NHEJ and HR are often associated with premature aging and tumorigenesis, hence it is important to have a quantitative way of measuring each DSB repair pathway. Our laboratory has developed fluorescent reporter constructs that allow sensitive and quantitative measurement of NHEJ and HR. The constructs are based on an engineered GFP gene containing recognition sites for a rare-cutting I-SceI endonuclease for induction of DSBs. The starting constructs are GFP negative as the GFP gene is inactivated by an additional exon, or by mutations. Successful repair of the I-SceI-induced breaks by NHEJ or HR restores the functional GFP gene. The number of GFP positive cells counted by flow cytometry provides quantitative measure of NHEJ or HR efficiency. PMID:20864925

  16. Analysis of DNA double-strand break (DSB) repair in mammalian cells.

    Science.gov (United States)

    Seluanov, Andrei; Mao, Zhiyong; Gorbunova, Vera

    2010-09-08

    DNA double-strand breaks are the most dangerous DNA lesions that may lead to massive loss of genetic information and cell death. Cells repair DSBs using two major pathways: nonhomologous end joining (NHEJ) and homologous recombination (HR). Perturbations of NHEJ and HR are often associated with premature aging and tumorigenesis, hence it is important to have a quantitative way of measuring each DSB repair pathway. Our laboratory has developed fluorescent reporter constructs that allow sensitive and quantitative measurement of NHEJ and HR. The constructs are based on an engineered GFP gene containing recognition sites for a rare-cutting I-SceI endonuclease for induction of DSBs. The starting constructs are GFP negative as the GFP gene is inactivated by an additional exon, or by mutations. Successful repair of the I-SceI-induced breaks by NHEJ or HR restores the functional GFP gene. The number of GFP positive cells counted by flow cytometry provides quantitative measure of NHEJ or HR efficiency.

  17. Radiation induced DNA double-strand breaks in radiology; Strahleninduzierte DNA-Doppelstrangbrueche in der Radiologie

    Energy Technology Data Exchange (ETDEWEB)

    Kuefner, M.A. [Dornbirn Hospital (Austria). Dept. of Radiology; Brand, M.; Engert, C.; Uder, M. [Erlangen University Hospital (Germany). Dept. of Radiology; Schwab, S.A. [Radiologis, Oberasbach (Germany)

    2015-10-15

    Shortly after the discovery of X-rays, their damaging effect on biological tissues was observed. The determination of radiation exposure in diagnostic and interventional radiology is usually based on physical measurements or mathematical algorithms with standardized dose simulations. γ-H2AX immunofluorescence microscopy is a reliable and sensitive method for the quantification of radiation induced DNA double-strand breaks (DSB) in blood lymphocytes. The detectable amount of these DNA damages correlates well with the dose received. However, the biological radiation damage depends not only on dose but also on other individual factors like radiation sensitivity and DNA repair capacity. Iodinated contrast agents can enhance the x-ray induced DNA damage level. After their induction DSB are quickly repaired. A protective effect of antioxidants has been postulated in experimental studies. This review explains the principle of the γ-H2AX technique and provides an overview on studies evaluating DSB in radiologic examinations.

  18. Nucleotide sequence of cDNA coding for dianthin 30, a ribosome inactivating protein from Dianthus caryophyllus.

    Science.gov (United States)

    Legname, G; Bellosta, P; Gromo, G; Modena, D; Keen, J N; Roberts, L M; Lord, J M

    1991-08-27

    Rabbit antibodies raised against dianthin 30, a ribosome inactivating protein from carnation (Dianthus caryophyllus) leaves, were used to identify a full length dianthin precursor cDNA clone from a lambda gt11 expression library. N-terminal amino acid sequencing of purified dianthin 30 and dianthin 32 confirmed that the clone encoded dianthin 30. The cDNA was 1153 basepairs in length and encoded a precursor protein of 293 amino acid residues. The first 23 N-terminal amino acids of the precursor represented the signal sequence. The protein contained a carboxy-terminal region which, by analogy with barley lectin, may contain a vacuolar targeting signal.

  19. The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

    Science.gov (United States)

    Leem, S H; Ropp, P A; Sugino, A

    1994-08-11

    We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in DNA metabolism. The deletion strains did not exhibit UV-sensitivity. However, they did show weak sensitivity to MMS-treatment and exhibited a hyper-recombination phenotype when intragenic recombination was measured during meiosis. Furthermore, MAT alpha pol4 delta segregants had a higher frequency of illegitimate mating with a MAT alpha tester strain than that of wild-type cells. These results suggest that DNA polymerase IV participates in a double-strand break repair pathway. A 3.2kb of the POL4 transcript was weakly expressed in mitotically growing cells. During meiosis, a 2.2 kb POL4 transcript was greatly induced, while the 3.2 kb transcript stayed at constant levels. This induction was delayed in a swi4 delta strain during meiosis, while no effect was observed in a swi6 delta strain.

  20. Characterization of immune responses induced by inactivated, live attenuated and DNA vaccines against Japanese encephalitis virus in mice.

    Science.gov (United States)

    Li, Jieqiong; Chen, Hui; Wu, Na; Fan, Dongying; Liang, Guodong; Gao, Na; An, Jing

    2013-08-28

    Vaccination is the most effective countermeasure for protecting individuals from Japanese encephalitis virus (JEV) infection. There are two types of JEV vaccines currently used in China: the Vero cell-derived inactivated vaccine and the live attenuated vaccine. In this study, we characterized the immune response and protective efficacy induced in mice by the inactivated vaccine, live attenuated vaccine and the DNA vaccine candidate pCAG-JME, which expresses JEV prM-E proteins. We found that the live attenuated vaccine conferred 100% protection and resulted in the generation of high levels of specific anti-JEV antibodies and cytokines. The pCAG-JME vaccine induced protective immunity as well as the live attenuated vaccine. Unexpectedly, immunization with the inactivated vaccine only induced a limited immune response and partial protection, which may be due to the decreased activity of dendritic cells and the expansion of CD4+CD25+Foxp3+ regulatory T cells observed in these mice. Altogether, our results suggest that the live attenuated vaccine is more effective in providing protection against JEV infection than the inactivated vaccine and that pCAG-JME will be a potential JEV vaccine candidate. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Torsional regulation of hRPA-induced unwinding of double-stranded DNA

    NARCIS (Netherlands)

    De Vlaminck, I.; Vidic, I.; Van Loenhout, M.T.J.; Kanaar, R.; Lebbink, J.H.G.; Dekker, C.

    2010-01-01

    All cellular single-stranded (ss) DNA is rapidly bound and stabilized by single stranded DNA-binding proteins (SSBs). Replication protein A, the main eukaryotic SSB, is able to unwind double-stranded (ds) DNA by binding and stabilizing transiently forming bubbles of ssDNA. Here, we study the dynamic

  2. The dynamic DNA methylomes of double-stranded DNA viruses associated with human cancer

    Science.gov (United States)

    Fernandez, Agustin F.; Rosales, Cecilia; Lopez-Nieva, Pilar; Graña, Osvaldo; Ballestar, Esteban; Ropero, Santiago; Espada, Jesus; Melo, Sonia A.; Lujambio, Amaia; Fraga, Mario F.; Pino, Irene; Javierre, Biola; Carmona, Francisco J.; Acquadro, Francesco; Steenbergen, Renske D.M.; Snijders, Peter J.F.; Meijer, Chris J.; Pineau, Pascal; Dejean, Anne; Lloveras, Belen; Capella, Gabriel; Quer, Josep; Buti, Maria; Esteban, Juan-Ignacio; Allende, Helena; Rodriguez-Frias, Francisco; Castellsague, Xavier; Minarovits, Janos; Ponce, Jordi; Capello, Daniela; Gaidano, Gianluca; Cigudosa, Juan Cruz; Gomez-Lopez, Gonzalo; Pisano, David G.; Valencia, Alfonso; Piris, Miguel Angel; Bosch, Francesc X.; Cahir-McFarland, Ellen; Kieff, Elliott; Esteller, Manel

    2009-01-01

    The natural history of cancers associated with virus exposure is intriguing, since only a minority of human tissues infected with these viruses inevitably progress to cancer. However, the molecular reasons why the infection is controlled or instead progresses to subsequent stages of tumorigenesis are largely unknown. In this article, we provide the first complete DNA methylomes of double-stranded DNA viruses associated with human cancer that might provide important clues to help us understand the described process. Using bisulfite genomic sequencing of multiple clones, we have obtained the DNA methylation status of every CpG dinucleotide in the genome of the Human Papilloma Viruses 16 and 18 and Human Hepatitis B Virus, and in all the transcription start sites of the Epstein-Barr Virus. These viruses are associated with infectious diseases (such as hepatitis B and infectious mononucleosis) and the development of human tumors (cervical, hepatic, and nasopharyngeal cancers, and lymphoma), and are responsible for 1 million deaths worldwide every year. The DNA methylomes presented provide evidence of the dynamic nature of the epigenome in contrast to the genome. We observed that the DNA methylome of these viruses evolves from an unmethylated to a highly methylated genome in association with the progression of the disease, from asymptomatic healthy carriers, through chronically infected tissues and pre-malignant lesions, to the full-blown invasive tumor. The observed DNA methylation changes have a major functional impact on the biological behavior of the viruses. PMID:19208682

  3. Mechanisms of DNA Packaging by Large Double-Stranded DNA Viruses.

    Science.gov (United States)

    Rao, Venigalla B; Feiss, Michael

    2015-11-01

    Translocation of viral double-stranded DNA (dsDNA) into the icosahedral prohead shell is catalyzed by TerL, a motor protein that has ATPase, endonuclease, and translocase activities. TerL, following endonucleolytic cleavage of immature viral DNA concatemer recognized by TerS, assembles into a pentameric ring motor on the prohead's portal vertex and uses ATP hydrolysis energy for DNA translocation. TerL's N-terminal ATPase is connected by a hinge to the C-terminal endonuclease. Inchworm models propose that modest domain motions accompanying ATP hydrolysis are amplified, through changes in electrostatic interactions, into larger movements of the C-terminal domain bound to DNA. In phage ϕ29, four of the five TerL subunits sequentially hydrolyze ATP, each powering translocation of 2.5 bp. After one viral genome is encapsidated, the internal pressure signals termination of packaging and ejection of the motor. Current focus is on the structures of packaging complexes and the dynamics of TerL during DNA packaging, endonuclease regulation, and motor mechanics.

  4. Inactivation of ATM/ATR DNA damage checkpoint promotes androgen induced chromosomal instability in prostate epithelial cells.

    Directory of Open Access Journals (Sweden)

    Yung-Tuen Chiu

    Full Text Available The ATM/ATR DNA damage checkpoint functions in the maintenance of genetic stability and some missense variants of the ATM gene have been shown to confer a moderate increased risk of prostate cancer. However, whether inactivation of this checkpoint contributes directly to prostate specific cancer predisposition is still unknown. Here, we show that exposure of non-malignant prostate epithelial cells (HPr-1AR to androgen led to activation of the ATM/ATR DNA damage response and induction of cellular senescence. Notably, knockdown of the ATM gene expression in HPr-1AR cells can promote androgen-induced TMPRSS2: ERG rearrangement, a prostate-specific chromosome translocation frequently found in prostate cancer cells. Intriguingly, unlike the non-malignant prostate epithelial cells, the ATM/ATR DNA damage checkpoint appears to be defective in prostate cancer cells, since androgen treatment only induced a partial activation of the DNA damage response. This mechanism appears to preserve androgen induced autophosphorylation of ATM and phosphorylation of H2AX, lesion processing and repair pathway yet restrain ATM/CHK1/CHK2 and p53 signaling pathway. Our findings demonstrate that ATM/ATR inactivation is a crucial step in promoting androgen-induced genomic instability and prostate carcinogenesis.

  5. Inhibition of DNA double-strand break repair by the Ku heterodimer in mrx mutants of Saccharomyces cerevisiae

    Science.gov (United States)

    Wasko, Brian M.; Holland, Cory L.; Resnick, Michael A.; Lewis, L. Kevin

    2009-01-01

    Yeast rad50 and mre11 nuclease mutants are hypersensitive to physical and chemical agents that induce DNA double-strand breaks (DSBs). This sensitivity was suppressed by elevating intracellular levels of TLC1, the RNA subunit of telomerase. Suppression required proteins linked to homologous recombination, including Rad51, Rad52, Rad59 and Exo1, but not genes of the nonhomologous end-joining (NHEJ) repair pathway. Deletion mutagenesis experiments demonstrated that the 5′ end of TLC1 RNA was essential and a segment containing a binding site for the Yku70/Yku80 complex was sufficient for suppression. A mutant TLC1 RNA unable to associate with Yku80 protein did not increase resistance. These and other genetic studies indicated that association of the Ku heterodimer with broken DNA ends inhibits recombination in mrx mutants, but not in repair-proficient cells or in other DNA repair single mutants. In support of this model, DNA damage resistance of mrx cells was enhanced when YKU70 was co-inactivated. Defective recombinational repair of DSBs in mrx cells thus arises from at least two separate processes: loss of Mrx nuclease-associated DNA end-processing and inhibition of the Exo1-mediated secondary recombination pathway by Ku. PMID:18992851

  6. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

    Science.gov (United States)

    Jette, Nicholas; Lees-Miller, Susan P.

    2015-01-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemistry, structure and function of DNA-PK, its roles in DNA double strand break repair and its newly described roles in mitosis and other cellular processes. PMID:25550082

  7. Protein kinase CK2 localizes to sites of DNA double-strand break regulating the cellular response to DNA damage

    Directory of Open Access Journals (Sweden)

    Olsen Birgitte B

    2012-03-01

    Full Text Available Abstract Background The DNA-dependent protein kinase (DNA-PK is a nuclear complex composed of a large catalytic subunit (DNA-PKcs and a heterodimeric DNA-targeting subunit Ku. DNA-PK is a major component of the non-homologous end-joining (NHEJ repair mechanism, which is activated in the presence of DNA double-strand breaks induced by ionizing radiation, reactive oxygen species and radiomimetic drugs. We have recently reported that down-regulation of protein kinase CK2 by siRNA interference results in enhanced cell death specifically in DNA-PKcs-proficient human glioblastoma cells, and this event is accompanied by decreased autophosphorylation of DNA-PKcs at S2056 and delayed repair of DNA double-strand breaks. Results In the present study, we show that CK2 co-localizes with phosphorylated histone H2AX to sites of DNA damage and while CK2 gene knockdown is associated with delayed DNA damage repair, its overexpression accelerates this process. We report for the first time evidence that lack of CK2 destabilizes the interaction of DNA-PKcs with DNA and with Ku80 at sites of genetic lesions. Furthermore, we show that CK2 regulates the phosphorylation levels of DNA-PKcs only in response to direct induction of DNA double-strand breaks. Conclusions Taken together, these results strongly indicate that CK2 plays a prominent role in NHEJ by facilitating and/or stabilizing the binding of DNA-PKcs and, possibly other repair proteins, to the DNA ends contributing to efficient DNA damage repair in mammalian cells.

  8. The isothermal amplification detection of double-stranded DNA based on a double-stranded fluorescence probe.

    Science.gov (United States)

    Shi, Chao; Shang, Fanjin; Pan, Mei; Liu, Sen; Ma, Cuiping

    2016-06-15

    Here we have developed a novel method of isothermal amplification detection of double-stranded DNA (dsDNA) based on double-stranded fluorescence probe (ds-probe). Target dsDNA repeatedly generated single-stranded DNA (ssDNA) with polymerase and nicking enzyme. The ds-probe as a primer hybridized with ssDNA and extended to its 5'-end. The displaced ssDNA served as a new detection target to initiate above-described reaction. Meanwhile, the extended ds-probe could dynamically dissociate from ssDNA and self-hybridize, converting into a turn-back structure to initiate another amplification reaction. In particular, the ds-probe played a key role in the entire experimental process, which not only was as a primer but also produced the fluorescent signal by an extension and displacement reaction. Our method could detect the pBluescript II KS(+) plasmid with a detection limit of 2.3 amol, and it was also verified to exhibit a high specificity, even one-base mismatch. Overall, it was a true isothermal dsDNA detection strategy with a strongly anti-jamming capacity and one-pot, only requiring one ds-probe, which greatly reduced the cost and the probability of contamination. With its advantages, the approach of dsDNA detection will offer a promising tool in the field of point-of-care testing (POCT).

  9. Improved immunogenicity of Newcastle disease virus inactivated vaccine following DNA vaccination using Newcastle disease virus hemagglutinin-neuraminidase and fusion protein genes.

    Science.gov (United States)

    Firouzamandi, Masoumeh; Moeini, Hassan; Hosseini, Davood; Bejo, Mohd Hair; Omar, Abdul Rahman; Mehrbod, Parvaneh; Ideris, Aini

    2016-03-01

    The present study describes the development of DNA vaccines using the hemagglutinin-neuraminidase (HN) and fusion (F) genes from AF2240 Newcastle disease virus strain, namely pIRES/HN, pIRES/F and pIRES-F/HN. Transient expression analysis of the constructs in Vero cells revealed the successful expression of gene inserts in vitro. Moreover, in vivo experiments showed that single vaccination with the constructed plasmid DNA (pDNA) followed by a boost with inactivated vaccine induced a significant difference in enzyme-linked immunosorbent assay antibody levels (p < 0.05) elicited by either pIRES/F, pIRES/F+ pIRES/HN or pIRES-F/HN at one week after the booster in specific pathogen free chickens when compared with the inactivated vaccine alone. Taken together, these results indicated that recombinant pDNA could be used to increase the efficacy of the inactivated vaccine immunization procedure.

  10. The enzyme and the cDNA sequence of a thermolabile and double-strand specific DNase from Northern shrimps (Pandalus borealis.

    Directory of Open Access Journals (Sweden)

    Inge W Nilsen

    Full Text Available BACKGROUND: We have previously isolated a thermolabile nuclease specific for double-stranded DNA from industrial processing water of Northern shrimps (Pandalus borealis and developed an application of the enzyme in removal of contaminating DNA in PCR-related technologies. METHODOLOGY/PRINCIPAL FINDINGS: A 43 kDa nuclease with a high specific activity of hydrolysing linear as well as circular forms of DNA was purified from hepatopancreas of Northern shrimp (Pandalus borealis. The enzyme displayed a substrate preference that was shifted from exclusively double-stranded DNA in the presence of magnesium to also encompass significant activity against single-stranded DNA when calcium was added. No activity against RNA was detected. Although originating from a cold-environment animal, the shrimp DNase has only minor low-temperature activity. Still, the enzyme was irreversibly inactivated by moderate heating with a half-life of 1 min at 65 degrees C. The purified protein was partly sequenced and derived oligonucleotides were used to prime amplification of the encoding cDNA. This cDNA sequence revealed an open reading frame encoding a 404 amino acid protein containing a signal peptide. By sequence similarity the enzyme is predicted to belong to a family of DNA/RNA non-specific nucleases even though this shrimp DNase lacks RNase activity and is highly double-strand specific in some respects. These features are in agreement with those previously established for endonucleases classified as similar to the Kamchatka crab duplex-specific nuclease (Par_DSN. Sequence comparisons and phylogenetic analyses confirmed that the Northern shrimp nuclease resembles the Par_DSN-like nucleases and displays a more distant relationship to the Serratia family of nucleases. CONCLUSIONS/SIGNIFICANCE: The shrimp nuclease contains enzyme activity that may be controlled by temperature or buffer compositions. The double-stranded DNA specificity, as well as the thermolabile feature

  11. Facile synthesis of Graphene Oxide/Double-stranded DNA composite liquid crystals and Hydrogels

    Indian Academy of Sciences (India)

    Rajendra Kurapati; Ashok M Raichur; U Venkateswara Reddy; N Suryaprakash

    2016-03-01

    Investigation of the interactions between graphene oxide (GO) and biomolecules is very crucialfor the development of biomedical applications based on GO. This study reports the first observation of thespontaneous formation of self-assembled liquid crystals and three-dimensional hydrogels of graphene oxidewith double-stranded DNA by simple mixing in an aqueous buffer media without unwinding double-strandedDNA to single-stranded DNA. The GO/dsDNA hydrogels have shown controlled porosity by changing the concentration of the components. The strong binding between dsDNA and graphene is proved by Ramanspectroscopy

  12. Self-assembly and DNA binding of the blocking factor in x chromosome inactivation.

    Directory of Open Access Journals (Sweden)

    Mario Nicodemi

    2007-11-01

    Full Text Available X chromosome inactivation (XCI is the phenomenon occurring in female mammals whereby dosage compensation of X-linked genes is obtained by transcriptional silencing of one of their two X chromosomes, randomly chosen during early embryo development. The earliest steps of random X-inactivation, involving counting of the X chromosomes and choice of the active and inactive X, are still not understood. To explain "counting and choice," the longstanding hypothesis is that a molecular complex, a "blocking factor" (BF, exists. The BF is present in a single copy and can randomly bind to just one X per cell which is protected from inactivation, as the second X is inactivated by default. In such a picture, the missing crucial step is to explain how the molecular complex is self-assembled, why only one is formed, and how it binds only one X. We answer these questions within the framework of a schematic Statistical Physics model, investigated by Monte Carlo computer simulations. We show that a single complex is assembled as a result of a thermodynamic process relying on a phase transition occurring in the system which spontaneously breaks the symmetry between the X's. We discuss, then, the BF interaction with X chromosomes. The thermodynamics of the mechanism that directs the two chromosomes to opposite fates could be, thus, clarified. The insights on the self-assembling and X binding properties of the BF are used to derive a quantitative scenario of biological implications describing current experimental evidences on "counting and choice."

  13. Inactivation of RAD52 and HDF1 DNA repair genes leads to premature chronological aging and cellular instability

    Indian Academy of Sciences (India)

    SILVIA MERCADO-SÁENZ; BEATRIZ LÓPEZ-DÍAZ; FRANCISCO SENDRA-PORTERO; MANUEL MARTÍNEZ-MORILLO; MIGUEL J RUIZ-GÓMEZ

    2017-06-01

    The present study aims to investigate the role of radiation sensitive 52 (RAD52) and high-affinity DNA binding factor1 (HDF1) DNA repair genes on the life span of budding yeasts during chronological aging. Wild type (wt) and rad52,hdf1, and rad52 hdf1 mutant Saccharomyces cerevisiae strains were used. Chronological aging and survival assayswere studied by clonogenic assay and drop test. DNA damage was analyzed by electrophoresis after phenol extraction.Mutant analysis, colony forming units and the index of respiratory competence were studied by growing on dextroseand glycerol plates as a carbon source. Rad52 and rad52 hdf1 mutants showed a gradual decrease in surviving fractionin relation to wt and hdf1 mutant during aging. Genomic DNA was spontaneously more degraded during aging,mainly in rad52 mutants. This strain showed an increased percentage of revertant colonies. Moreover, all mutantsshowed a decrease in the index of respiratory competence during aging. The inactivation of RAD52 leads to prematurechronological aging with an increase in DNA degradation and mutation frequency. In addition, RAD52 and HDF1contribute to maintain the metabolic state, in a different way, during chronological aging. The results obtained couldhave important implications in the chronobiology of aging.

  14. A bichaperone (Hsp70-Hsp78) system restores mitochondrial DNA synthesis following thermal inactivation of Mip1p polymerase.

    Science.gov (United States)

    Germaniuk, Aleksandra; Liberek, Krzysztof; Marszalek, Jaroslaw

    2002-08-02

    Mitochondrial DNA synthesis is a thermosensitive process in the yeast Saccharomyces cerevisiae. We found that restoration of mtDNA synthesis following heat treatment of cells is dependent on reactivation of the mtDNA polymerase Mip1p through the action of a mitochondrial bichaperone system consisting of the Hsp70 system and the Hsp78 oligomeric protein. mtDNA synthesis was inefficiently restored after heat shock in yeast lacking either functional component of the bichaperone system. Furthermore, the activity of purified Mip1p was also thermosensitive; however, the purified components of the mitochondrial bichaperone system (Ssc1p, Mdj1p, Mge1p, and Hsp78p) were able to protect its activity under moderate heat shock conditions as well as to reactivate thermally inactivated Mip1p. Interestingly, the reactivation of endogenous Mip1p contributed more significantly to the restoration of mtDNA synthesis than did import of newly synthesized Mip1p from the cytosol. These observations suggest an important link between function of mitochondrial chaperones and the propagation of mitochondrial genomes under ever-changing environmental conditions.

  15. Sgs1 helicase and two nucleases Dna2 and Exo1 resect DNA double strand break ends

    OpenAIRE

    Zhu, Zhu; Chung, Woo-Hyun; Shim, Eun Yong; Lee, Sang Eun; Ira, Grzegorz

    2008-01-01

    Formation of single-strand DNA (ssDNA) tails at a double-strand break (DSB) is a key step in homologous recombination and DNA damage signaling. The enzyme(s) producing ssDNA at DSBs in eukaryotes remains unknown. We monitored 5’-strand resection at inducible DSB ends and identified proteins required for two stages of resection: initiation and long-range 5’-strand resection. The Mre11-Rad50-Xrs2 complex (MRX) initiates 5’ degradation, whereas Sgs1 and Dna2 degrade 5’-strands exposing long 3’-s...

  16. Site-Selective Binding of Nanoparticles to Double-Stranded DNA via Peptide Nucleic Acid "Invasion"

    Energy Technology Data Exchange (ETDEWEB)

    Stadler, A.L.; van der Lelie, D.; Sun, D.; Maye, M. M.; Gang, O.

    2011-04-01

    We demonstrate a novel method for by-design placement of nano-objects along double-stranded (ds) DNA. A molecular intercalator, designed as a peptide nucleic acid (PNA)-DNA chimera, is able to invade dsDNA at the PNA-side due to the hybridization specificity between PNA and one of the duplex strands. At the same time, the single-stranded (ss) DNA tail of the chimera, allows for anchoring of nano-objects that have been functionalized with complementary ssDNA. The developed method is applied for interparticle attachment and for the fabrication of particle clusters using a dsDNA template. This method significantly broadens the molecular toolbox for constructing nanoscale systems by including the most conventional not yet utilized DNA motif, double helix DNA.

  17. Theoretical Study on Effects of Salt and Temperature on Denaturation Transition of Double-stranded DNA

    Institute of Scientific and Technical Information of China (English)

    DONG Rui-Xin; YAN Xun-Ling; PANG Xiao-Feng; JIANG Shan; LIU Sheng-Gang

    2004-01-01

    We investigate the statistical mechanics properties of a nonlinear dynamics model of the denaturation of the DNA double-helix and study the effects of salt concentration and temperature on denaturation transition of DNA. The specific heat, entropy, and denaturation temperature of the system versus salt concentration are obtained. These results show that the denaturation of DNA not only depends on the temperature but also is influenced by the salt concentration in the solution of DNA, which are in agreement with experimental measurement.

  18. A requirement for polymerized actin in DNA double-strand break repair.

    Science.gov (United States)

    Andrin, Christi; McDonald, Darin; Attwood, Kathleen M; Rodrigue, Amélie; Ghosh, Sunita; Mirzayans, Razmik; Masson, Jean-Yves; Dellaire, Graham; Hendzel, Michael J

    2012-07-01

    Nuclear actin is involved in several nuclear processes from chromatin remodeling to transcription. Here we examined the requirement for actin polymerization in DNA double-strand break repair. Double-strand breaks are considered the most dangerous type of DNA lesion. Double-strand break repair consists of a complex set of events that are tightly regulated. Failure at any step can have catastrophic consequences such as genomic instability, oncogenesis or cell death. Many proteins involved in this repair process have been identified and their roles characterized. We discovered that some DNA double-strand break repair factors are capable of associating with polymeric actin in vitro and specifically, that purified Ku70/80 interacts with polymerized actin under these conditions. We find that the disruption of polymeric actin inhibits DNA double strand break repair both in vitro and in vivo. Introduction of nuclear targeted mutant actin that cannot polymerize, or the depolymerization of endogenous actin filaments by the addition of cytochalasin D, alters the retention of Ku80 at sites of DNA damage in live cells. Our results suggest that polymeric actin is required for proper DNA double-strand break repair and may function through the stabilization of the Ku heterodimer at the DNA damage site.

  19. Endonuclease-based Method for Detecting the Sequence Specific DNA Binding Protein on Double-stranded DNA Microarray

    Institute of Scientific and Technical Information of China (English)

    Yun Fei BAI; Qin Yu GE; Tong Xiang LI; Jin Ke WANG; Quan Jun LIU; Zu Hong LU

    2005-01-01

    The double-stranded DNA (dsDNA) probe contains two different protein binding sites.One is for DNA- binding proteins to be detected and the other is for a DNA restriction enzyme.The two sites were arranged together with no base interval. The working principle of the capturing dsDNA probe is described as follows: the capturing probe can be cut with the DNA restriction enzyme (such as EcoR I) to cause a sticky terminal, if the probe is not bound with a target protein, and the sticky terminal can be extended and labeled with Cy3-dUTP by DNA polymerase. When the probe is bound with a target protein, the probe is not capable to be cut by the restriction enzyme because of space obstruction. The amount of the target DNA binding proteins can be measured according to the variations of fluorescent signals of the corresponding probes.

  20. Optical Tweezers Analysis of Double-Stranded DNA Denaturation in the Presence of Urea

    Science.gov (United States)

    Zhu, Chunli; Li, Jing

    2016-09-01

    Urea is a kind of denaturant prone to form hydrogen bonds with the electronegative centers of the nitrogenous bases, threatening the stability of hydrogen bonds between DNA base pairs. In this paper, the stability and stiffness of DNA double helix influenced by urea are investigated at single-molecule level using optical tweezers. Experimental results show that DNA's double helix stability and stiffness both decrease with increasing urea concentration. In addition, the re-forming of ruptured hydrogen bonds between the base pairs is blocked by urea as the tension on DNA is released.

  1. Self-assembly of fully addressable DNA nanostructures from double crossover tiles.

    Science.gov (United States)

    Wang, Wen; Lin, Tong; Zhang, Suoyu; Bai, Tanxi; Mi, Yongli; Wei, Bryan

    2016-09-19

    DNA origami and single-stranded tile (SST) are two proven approaches to self-assemble finite-size complex DNA nanostructures. The construction elements appeared in structures from these two methods can also be found in multi-stranded DNA tiles such as double crossover tiles. Here we report the design and observation of four types of finite-size lattices with four different double crossover tiles, respectively, which, we believe, in terms of both complexity and robustness, will be rival to DNA origami and SST structures.

  2. Fabrication of Unimolecular Double-stranded DNA Microarrays on Solid Surfaces for Probing DNA-Protein/Drug Interactions

    Directory of Open Access Journals (Sweden)

    Zuhong Lu

    2003-01-01

    Full Text Available We present a novel method for fabricating unimole cular double-stranded DNA microarrays on solid surfaces, which were used to probe sequence-specific DNA/protein interactions. For manufacturing the unimolecular double-stranded DNA microarrays, two kinds of special single-stranded oligonucleotides, constant oligonucleotide and target oligonucleotide, were chemically synthesized. The constant oligonucleotides with internal aminated dT were used to capture and immobilize the target oligonucleotides onto the solid surface, and also to provide a primer for later enzymatic extension reactions, while target oligonucleotides took the role of harbouring DNA-binding sites of DNA-binding proteins. The variant target oligonucleotides were annealed and ligated with the constant oligonucleotides to form the new unimolecular oligonucleotides for microspotting. The prepared unimolecular oligonucleotides were microspotted on aldehyde-derivatized glass slides to make partial-dsDNA microarrays. Finally, the partial-dsDNA microarrays were converted into a unimolecular complete-dsDNA microarray by a DNA polymerase extension reaction. The efficiency and accuracy of the polymerase synthesis were demonstrated by the fluorescent-labeled dUTP incorporation in the enzymatic extension reaction and the restriction endonuclease digestion of the fabricated unimolecular complete-dsDNA microarray. The accessibility and specificity of the sequence-specific DNA-binding proteins binding to the immobilized unimolecular dsDNA probes were demonstrated by the binding of Cy3 labeled NF-?B (p50·p50 to the unimolecular dsDNA microarray. This unimolecular dsDNA microarray provides a general technique for high-throughput DNA-protein or DNA-drugs interactions.

  3. A cDNA Clone-Launched Platform for High-Yield Production of Inactivated Zika Vaccine

    Directory of Open Access Journals (Sweden)

    Yujiao Yang

    2017-03-01

    Full Text Available A purified inactivated vaccine (PIV using the Zika virus (ZIKV Puerto Rico strain PRVABC59 showed efficacy in monkeys, and is currently in a phase I clinical trial. High-yield manufacture of this PIV is essential for its development and vaccine access. Here we report an infectious cDNA clone-launched platform to maximize its yield. A single NS1 protein substitution (K265E was identified to increase ZIKV replication on Vero cells (a cell line approved for vaccine production for both Cambodian FSS13025 and Puerto Rico PRVABC59 strains. The NS1 mutation did not affect viral RNA synthesis, but significantly increased virion assembly through an increased interaction between NS1 and NS2A (a known regulator of flavivirus assembly. The NS1 mutant virus retained wild-type virulence in the A129 mouse model, but decreased its competence to infect Aedes aegypti mosquitoes. To further increase virus yield, we constructed an infectious cDNA clone of the clinical trial PIV strain PRVABC59 containing three viral replication-enhancing mutations (NS1 K265E, prM H83R, and NS3 S356F. The mutant cDNA clone produced >25-fold more ZIKV than the wild-type parent on Vero cells. This cDNA clone-launched manufacture platform has the advantages of higher virus yield, shortened manufacture time, and minimized chance of contamination.

  4. Mutagenesis and ultraviolet inactivation of transforming DNA of ``Haemophilus influenzae`` complexed with a ``Bacillus subtilis`` protein that alter DNA conformation

    Energy Technology Data Exchange (ETDEWEB)

    Setlow, Jane K. [Brookhaven National Lab., Upton, NY (United States); Setlow, Barbara C.; Setlow, Peter [Connecticut Univ., Farmington, CT (United States)

    1996-12-31

    The wild-type ``Bacillus subtilis`` spore protein, SspC{sup wt}, binds to DNA ``in vitro`` and ``in vivo`` and changes the conformation of DNA from B to A. Synthesis of the cloned SspC{sup wt} gene in ``Escherichia coli`` also causes large increases in mutation frequency. Binding of SspC{sup wt} to transforming DNA from ``Haemophilus influenzae`` made the DNA resistant to ultraviolet (UV) radiation. The mutant protein, SspC{sup ala}, which does not bind DNA, did not change the UV resistance. The UV sensitivity of the DNA/SspC{sup wt} complex was not increased when the recipients of the DNA were defective in excision of pyrimidine dimers. These data indicate that the ``H. influenzae`` excision mechanism does not operate on the spore photoproduct formed by UV irradiation of the complex. Selection for the streptomycin- or erythromycin-resistance markers on the transforming DNA evidenced significant mutations at loci closely linked to these, but not at other loci. SspC{sup wt} apparently entered the cell attached to the transforming DNA, and caused mutations in adjacent loci. The amount of such mutations decreased when the transforming DNA was UV irradiated, because UV unlinks linked markers. (author). 22 refs, 4 figs, 4 tabs.

  5. A mitotic phosphorylation feedback network connects Cdk1, Plk1, 53BP1, and Chk2 to inactivate the G(2)/M DNA damage checkpoint

    DEFF Research Database (Denmark)

    van Vugt, Marcel A T M; Gardino, Alexandra K; Linding, Rune;

    2010-01-01

    the DNA damage response. We demonstrate that the non-enzymatic checkpoint adaptor protein 53BP1 is an in vivo target of the cell cycle kinases Cyclin-dependent kinase-1 and Polo-like kinase-1 (Plk1). We show that Plk1 binds 53BP1 during mitosis and that this interaction is required for proper inactivation......DNA damage checkpoints arrest cell cycle progression to facilitate DNA repair. The ability to survive genotoxic insults depends not only on the initiation of cell cycle checkpoints but also on checkpoint maintenance. While activation of DNA damage checkpoints has been studied extensively, molecular...... of the DNA damage checkpoint. 53BP1 mutants that are unable to bind Plk1 fail to restart the cell cycle after ionizing radiation-mediated cell cycle arrest. Importantly, we show that Plk1 also phosphorylates the 53BP1-binding checkpoint kinase Chk2 to inactivate its FHA domain and inhibit its kinase activity...

  6. DNA double-strand breaks and ATM activation by transcription-blocking DNA lesions.

    Science.gov (United States)

    Sordet, Olivier; Nakamura, Asako J; Redon, Christophe E; Pommier, Yves

    2010-01-15

    A taxia telangiectasia mutated (ATM), the deficiency of which causes a severe neurodegenerative disease, is a crucial mediator for the DNA double-strand break (DSB) response. We recently showed that transcription-blocking topoisomerase I cleavage complexes (TOP1cc) produce DSBs related to R-loop formation and activate ATM in post-mitotic neurons and lymphocytes. Here we discuss how TOP1cc can produce transcription arrest with R-loop formation and generate DSBs that activate ATM, as well as data suggesting that those transcription-dependent DSBs tend to form at the IgH locus and at specific genomic sites. We also address the potential roles of ATM in response to transcription-blocking TOP1cc.

  7. Balancing Pathways in DNA Double Strand Break Repair

    NARCIS (Netherlands)

    I. Brandsma (Inger)

    2016-01-01

    markdownabstractAll information a cell needs to live and survive is stored in the genomic DNA. Maintenance of an intact and uncompromised genome is of vital importance for cell survival. Damaged DNA can block transcription and replication, processes essential for cell viability. Persistent DNA

  8. Balancing Pathways in DNA Double Strand Break Repair

    NARCIS (Netherlands)

    I. Brandsma (Inger)

    2016-01-01

    markdownabstractAll information a cell needs to live and survive is stored in the genomic DNA. Maintenance of an intact and uncompromised genome is of vital importance for cell survival. Damaged DNA can block transcription and replication, processes essential for cell viability. Persistent DNA damag

  9. Inactivation of PNKP by mutant ATXN3 triggers apoptosis by activating the DNA damage-response pathway in SCA3.

    Directory of Open Access Journals (Sweden)

    Rui Gao

    2015-01-01

    Full Text Available Spinocerebellar ataxia type 3 (SCA3, also known as Machado-Joseph disease (MJD, is an untreatable autosomal dominant neurodegenerative disease, and the most common such inherited ataxia worldwide. The mutation in SCA3 is the expansion of a polymorphic CAG tri-nucleotide repeat sequence in the C-terminal coding region of the ATXN3 gene at chromosomal locus 14q32.1. The mutant ATXN3 protein encoding expanded glutamine (polyQ sequences interacts with multiple proteins in vivo, and is deposited as aggregates in the SCA3 brain. A large body of literature suggests that the loss of function of the native ATNX3-interacting proteins that are deposited in the polyQ aggregates contributes to cellular toxicity, systemic neurodegeneration and the pathogenic mechanism in SCA3. Nonetheless, a significant understanding of the disease etiology of SCA3, the molecular mechanism by which the polyQ expansions in the mutant ATXN3 induce neurodegeneration in SCA3 has remained elusive. In the present study, we show that the essential DNA strand break repair enzyme PNKP (polynucleotide kinase 3'-phosphatase interacts with, and is inactivated by, the mutant ATXN3, resulting in inefficient DNA repair, persistent accumulation of DNA damage/strand breaks, and subsequent chronic activation of the DNA damage-response ataxia telangiectasia-mutated (ATM signaling pathway in SCA3. We report that persistent accumulation of DNA damage/strand breaks and chronic activation of the serine/threonine kinase ATM and the downstream p53 and protein kinase C-δ pro-apoptotic pathways trigger neuronal dysfunction and eventually neuronal death in SCA3. Either PNKP overexpression or pharmacological inhibition of ATM dramatically blocked mutant ATXN3-mediated cell death. Discovery of the mechanism by which mutant ATXN3 induces DNA damage and amplifies the pro-death signaling pathways provides a molecular basis for neurodegeneration due to PNKP inactivation in SCA3, and for the first time offers

  10. CK2 phosphorylation inactivates DNA binding by the papillomavirus E1 and E2 proteins.

    Science.gov (United States)

    Schuck, Stephen; Ruse, Cristian; Stenlund, Arne

    2013-07-01

    Papillomaviruses have complex life cycles that are understood only superficially. Although it is well established that the viral E1 and E2 proteins play key roles in controlling viral transcription and DNA replication, how these factors are regulated is not well understood. Here, we demonstrate that phosphorylation by the protein kinase CK2 controls the biochemical activities of the bovine papillomavirus E1 and E2 proteins by modifying their DNA binding activity. Phosphorylation at multiple sites in the N-terminal domain in E1 results in the loss of sequence-specific DNA binding activity, a feature that is also conserved in human papillomavirus (HPV) E1 proteins. The bovine papillomavirus (BPV) E2 protein, when phosphorylated by CK2 on two specific sites in the hinge, also loses its site-specific DNA binding activity. Mutation of these sites in E2 results in greatly increased levels of latent viral DNA replication, indicating that CK2 phosphorylation of E2 is a negative regulator of viral DNA replication during latent viral replication. In contrast, mutation of the N-terminal phosphorylation sites in E1 has no effect on latent viral DNA replication. We propose that the phosphorylation of the N terminus of E1 plays a role only in vegetative viral DNA replication, and consistent with such a role, caspase 3 cleavage of E1, which has been shown to be necessary for vegetative viral DNA replication, restores the DNA binding activity to phosphorylated E1.

  11. [Superparamagnetic Cobalt Ferrite Nanoparticles "Blow up" Spatial Ordering of Double-stranded DNA Molecules].

    Science.gov (United States)

    Yevdokimov, Yu M; Pershina, A G; Salyanov, V I; Magaeva, A A; Popenko, V I; Shtykova, E V; Dadinova, L A; Skuridin, S G

    2015-01-01

    The formation of cholesteric liquid-crystalline dispersions formed by double-stranded DNA molecules, handled by positively charged superparamagnetic cobalt ferrite nanoparticles, as well as action of these nanoparticles on DNA dispersion, are considered. The binding of magnetic nanoparticles to the linear double-stranded DNA in solution of high ionic strength (0.3 M NaCl) and subsequent phase exclusion of these complexes from polyethylene glycol-containing solutions lead to their inability to form dispersions, whose particles do possess the spatially twisted arrangement of neighboring double-stranded DNA molecules. The action of magnetic nanoparticles on DNA dispersion (one magnetic nanoparticle per one double-stranded DNA molecule) results in such "perturbation" of DNA structure at sites of magnetic nanoparticles binding that the regular spatial structure of DNA dispersion particles "blows up"; this process is accompanied by disappearance of both abnormal optical activity and characteristic Bragg maximum on the small-angle X-ray scattering curve. Allowing with the fact that the physicochemical properties of the DNA liquid-crystalline dispersion particles reflect features of spatial organization of these molecules in chromosomes of primitive organisms, it is possible, that the found effect can have the relevant biological consequences.

  12. Studies of interaction between two alkaloids and double helix DNA

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Yantao [Key Laboratory of Preparation and Applications of Environmentally Friendly Materials (Jilin Normal University), Ministry of Education China, Siping 136000 (China); College of Chemistry, Jilin Normal University, Siping 136000 (China); Peng, Tingting [College of Chemistry, Jilin Normal University, Siping 136000 (China); College of Chemistry, Baicheng Normal University, Baicheng, 130032 (China); Zhao, Lei [Siping Institute for Food and Drug Control, Siping 136000 (China); Jiang, Dayu [Key Laboratory of Preparation and Applications of Environmentally Friendly Materials (Jilin Normal University), Ministry of Education China, Siping 136000 (China); College of Chemistry, Jilin Normal University, Siping 136000 (China); Cui, Yuncheng, E-mail: 1979yanzi@163.com [Key Laboratory of Preparation and Applications of Environmentally Friendly Materials (Jilin Normal University), Ministry of Education China, Siping 136000 (China); College of Chemistry, Jilin Normal University, Siping 136000 (China)

    2014-12-15

    This article presents the study on the interaction of two alkaloids (matrine and evodiamine) and hs-DNA by absorption, fluorescence, circular dichroism (CD), DNA melting and viscosity experiments. The spectroscopic studies suggested that two alkaloids can bind to DNA through an intercalative mode. The viscosity measurement and thermal denaturation also indicated that two alkaloids can intercalate to DNA. The binding constants (K{sub A}) and the number of binding sites (n) were determined. At the same time, some significant thermodynamic parameters of the binding of the alkaloids to DNA were obtained. Competitive binding studies revealed that alkaloids had an effect on ethidium bromide (EB) bound DNA. In addition, it was also proved that the fluorescence quenching was influenced by ionic strength. - Highlights: • Interaction between two alkaloids and DNA is studied by spectral methods. • The binding constant and the binding sites between two alkaloids and DNA are obtained. • There are a classical intercalative mode between alkaloids and DNA. • The binding of matrine with DNA is weaker than that of evodiamine. • It is important for us to understand the alkaloids–DNA interactions at a molecular level.

  13. Modular construction of DNA nanotubes of tunable geometry and single- or double-stranded character.

    Science.gov (United States)

    Aldaye, Faisal A; Lo, Pik Kwan; Karam, Pierre; McLaughlin, Christopher K; Cosa, Gonzalo; Sleiman, Hanadi F

    2009-06-01

    DNA nanotubes can template the growth of nanowires, orient transmembrane proteins for nuclear magnetic resonance determination, and can potentially act as stiff interconnects, tracks for molecular motors and nanoscale drug carriers. Current methods for the construction of DNA nanotubes result in symmetrical and cylindrical assemblies that are entirely double-stranded. Here, we report a modular approach to DNA nanotube synthesis that provides access to geometrically well-defined triangular and square-shaped DNA nanotubes. We also construct the first nanotube assemblies that can exist in double- and single-stranded forms with significantly different stiffness. This approach allows for parameters such as geometry, stiffness, and single- or double-stranded character to be fine-tuned, and could enable the creation of designer nanotubes for a range of applications, including the growth of nanowires of controlled shape, the loading and release of cargo, and the real-time modulation of stiffness and persistence length within DNA interconnects.

  14. RecG Directs DNA Synthesis during Double-Strand Break Repair.

    Directory of Open Access Journals (Sweden)

    Benura Azeroglu

    2016-02-01

    Full Text Available Homologous recombination provides a mechanism of DNA double-strand break repair (DSBR that requires an intact, homologous template for DNA synthesis. When DNA synthesis associated with DSBR is convergent, the broken DNA strands are replaced and repair is accurate. However, if divergent DNA synthesis is established, over-replication of flanking DNA may occur with deleterious consequences. The RecG protein of Escherichia coli is a helicase and translocase that can re-model 3-way and 4-way DNA structures such as replication forks and Holliday junctions. However, the primary role of RecG in live cells has remained elusive. Here we show that, in the absence of RecG, attempted DSBR is accompanied by divergent DNA replication at the site of an induced chromosomal DNA double-strand break. Furthermore, DNA double-stand ends are generated in a recG mutant at sites known to block replication forks. These double-strand ends, also trigger DSBR and the divergent DNA replication characteristic of this mutant, which can explain over-replication of the terminus region of the chromosome. The loss of DNA associated with unwinding joint molecules previously observed in the absence of RuvAB and RecG, is suppressed by a helicase deficient PriA mutation (priA300, arguing that the action of RecG ensures that PriA is bound correctly on D-loops to direct DNA replication rather than to unwind joint molecules. This has led us to put forward a revised model of homologous recombination in which the re-modelling of branched intermediates by RecG plays a fundamental role in directing DNA synthesis and thus maintaining genomic stability.

  15. Ligation of double-stranded and single-stranded [Oligo(dT)] DNA by vaccinia virus DNA ligase

    OpenAIRE

    1996-01-01

    Vaccinia virus DNA ligase has been expressed in Escherichia coli, purified, and biochemically characterized. The enzyme ligates double-stranded (ds) DNA substrates with either cohesive or blunt-end termini and the latter reaction is stimulated by PEG. Vaccinia virus DNA ligase can also ligate oligo(dT) when annealed to either a poly(dA) or a poly(rA) backbone and, remarkably, free oligo(dT). This ligation of a single-stranded (ss) substrate is unique among eukaryotic DNA ligases. The enzyme r...

  16. A multistep genomic screen identifies new genes required for repair of DNA double-strand breaks in Saccharomyces cerevisiae.

    Science.gov (United States)

    McKinney, Jennifer Summers; Sethi, Sunaina; Tripp, Jennifer DeMars; Nguyen, Thuy N; Sanderson, Brian A; Westmoreland, James W; Resnick, Michael A; Lewis, L Kevin

    2013-04-15

    Efficient mechanisms for rejoining of DNA double-strand breaks (DSBs) are vital because misrepair of such lesions leads to mutation, aneuploidy and loss of cell viability. DSB repair is mediated by proteins acting in two major pathways, called homologous recombination and nonhomologous end-joining. Repair efficiency is also modulated by other processes such as sister chromatid cohesion, nucleosome remodeling and DNA damage checkpoints. The total number of genes influencing DSB repair efficiency is unknown. To identify new yeast genes affecting DSB repair, genes linked to gamma radiation resistance in previous genome-wide surveys were tested for their impact on repair of site-specific DSBs generated by in vivo expression of EcoRI endonuclease. Eight members of the RAD52 group of DNA repair genes (RAD50, RAD51, RAD52, RAD54, RAD55, RAD57, MRE11 and XRS2) and 73 additional genes were found to be required for efficient repair of EcoRI-induced DSBs in screens utilizing both MATa and MATα deletion strain libraries. Most mutants were also sensitive to the clastogenic chemicals MMS and bleomycin. Several of the non-RAD52 group genes have previously been linked to DNA repair and over half of the genes affect nuclear processes. Many proteins encoded by the protective genes have previously been shown to associate physically with each other and with known DNA repair proteins in high-throughput proteomics studies. A majority of the proteins (64%) share sequence similarity with human proteins, suggesting that they serve similar functions. We have used a genetic screening approach to detect new genes required for efficient repair of DSBs in Saccharomyces cerevisiae. The findings have spotlighted new genes that are critical for maintenance of genome integrity and are therefore of greatest concern for their potential impact when the corresponding gene orthologs and homologs are inactivated or polymorphic in human cells.

  17. Folding DNA origami from a double-stranded source of scaffold

    Science.gov (United States)

    Högberg, Björn; Liedl, Tim; Shih, William M.

    2009-01-01

    Combined heat and chemical denaturation of double-stranded DNA scaffold strands in the presence of staple strands, followed by a sudden temperature drop and then stepwise dialysis to remove the chemical denaturant, leads to self-assembly of two distinct DNA-origami structures. PMID:19566089

  18. Chromatin mobility is increased at sites of DNA double-strand breaks

    NARCIS (Netherlands)

    P.M. Krawczyk (Przemek); T. Borovski (Tijana); J. Stap (Jan); T. Cijsouw (Tony); R. ten Cate (Rebecca); J.P. Medema (Jan Paul); R. Kanaar (Roland); N.A.P. Franken (Nicolaas); J.A. Aten (Jacob)

    2012-01-01

    textabstractDNA double-strand breaks (DSBs) can efficiently kill cancer cells, but they can also produce unwanted chromosome rearrangements when DNA ends from different DSBs are erroneously joined. Movement of DSB-containing chromatin domains might facilitate these DSB interactions and promote the f

  19. Simultaneous labeling of single- and double-strand DNA breaks by DNA breakage detection-FISH (DBD-FISH).

    Science.gov (United States)

    Fernández, José Luis; Cajigal, Dioleyda; Gosálvez, Jaime

    2011-01-01

    DNA Breakage Detection-Fluorescence In Situ Hybridization (DBD-FISH) permits simultaneous and selective labeling of single- and double-strand DNA breaks in individual cells, either in the whole genome or within specific DNA sequences. In this technique, cells are embedded into agarose microgels, lysed and subjected to electrophoresis under nondenaturing conditions. Subsequently, the produced "comets" are exposed to a controlled denaturation step which transforms DNA breaks into single-stranded DNA regions, detected by hybridization with whole genome fluorescent probes or the probes to specific DNA sequences. This makes possible a targeted analysis of various chromatin areas for the presence of DNA breaks. The migration length of the DBD-FISH signal is proportional to the number of double strand breaks, whereas its fluorescence intensity depends on numbers of single-strand breaks.The detailed protocol for detection of two types of DNA breaks produced by ionizing radiation is presented. The technique can be used to determine intragenomic and intercellular heterogeneity in the induction and repair of DNA damage.

  20. Translocation of double-stranded DNA through membrane-adapted phi29 motor protein nanopores

    Science.gov (United States)

    Wendell, David; Jing, Peng; Geng, Jia; Subramaniam, Varuni; Lee, Tae Jin; Montemagno, Carlo; Guo, Peixuan

    2009-11-01

    Biological pores have been used to study the transport of DNA and other molecules, but most pores have channels that allow only the movement of small molecules and single-stranded DNA and RNA. The bacteriophage phi29 DNA-packaging motor, which allows double-stranded DNA to enter the virus during maturation and exit during an infection, contains a connector protein with a channel that is between 3.6 and 6 nm wide. Here we show that a modified version of this connector protein, when reconstituted into liposomes and inserted into planar lipid bilayers, allows the translocation of double-stranded DNA. The measured conductance of a single connector channel was 4.8 nS in 1 M KCl. This engineered and membrane-adapted phage connector is expected to have applications in microelectromechanical sensing, microreactors, gene delivery, drug loading and DNA sequencing.

  1. Colocalization of multiple DNA double-strand breaks at a single Rad52 repair centre

    DEFF Research Database (Denmark)

    Lisby, M.; Mortensen, Uffe Hasbro; Rothstein, R.

    2003-01-01

    DNA double-strand break repair (DSBR) is an essential process for preserving genomic integrity in all organisms. To investigate this process at the cellular level, we engineered a system of fluorescently marked DNA double-strand breaks (DSBs) in the yeast Saccharomyces cerevisiae to visualize...... in vivo DSBR in single cells. Using this system, we demonstrate for the first time that Rad52 DNA repair foci and DSBs colocalize. Time-lapse microscopy reveals that the relocalization of Rad52 protein into a focal assembly is a rapid and reversible process. In addition, analysis of DNA damage checkpoint......-deficient cells provides direct evidence for coordination between DNA repair and subsequent release from checkpoint arrest. Finally, analyses of cells experiencing multiple DSBs demonstrate that Rad52 foci are centres of DNA repair capable of simultaneously recruiting more than one DSB....

  2. Point Defects in Double Helix Induced by Interaction of Silver Nanoparticles with DNA

    CERN Document Server

    Bregadze, Vasil G; Giorgadze, Tamar G; Monaselidze, Jamlet R; Jaliashvili, Zaza V; Khuskivadze, Temur B

    2012-01-01

    Interaction of DNA-silver nanoparticles (AgNPs) complexes with H3O+, Cu2+ and Cl- has been studied by spectro-photometric, spectro-fluorimetric and differential scanning micro calorimetric methods. It is shown that DNA is a catalyst in redox reactions taking place in AgNPs adsorbed on its surface. We also demonstrate that Ag+ ions that are freed after corrosion of nanoparticles show absorption into the inner part of DNA double helix, i.e. they make the so-called cross-links between complementary base pairs of DNA. The cross-links present point defects of DNA which leads in-vivo to cell death.

  3. De novo-engineered transcription activator-like effector (TALE) hybrid nuclease with novel DNA binding specificity creates double-strand breaks

    KAUST Repository

    Mahfouz, Magdy M.

    2011-01-24

    Site-specific and rare cutting nucleases are valuable tools for genome engineering. The generation of double-strand DNA breaks (DSBs) promotes homologous recombination in eukaryotes and can facilitate gene targeting, additions, deletions, and inactivation. Zinc finger nucleases have been used to generate DSBs and subsequently, for genome editing but with low efficiency and reproducibility. The transcription activator-like family of type III effectors (TALEs) contains a central domain of tandem repeats that could be engineered to bind specific DNA targets. Here, we report the generation of a Hax3-based hybrid TALE nuclease with a user-selected DNA binding specificity. We show that the engineered TALE nuclease can bind to its target sequence in vitro and that the homodimeric TALE nuclease can cleave double-stranded DNA in vitro if the DNA binding sites have the proper spacing and orientation. Transient expression assays in tobacco leaves suggest that the hybrid nuclease creates DSB in its target sequence, which is subsequently repaired by nonhomologous end-joining repair. Taken together, our data show the feasibility of engineering TALE-based hybrid nucleases capable of generating site-specific DSBs and the great potential for site-specific genome modification in plants and eukaryotes in general.

  4. De novo-engineered transcription activator-like effector (TALE) hybrid nuclease with novel DNA binding specificity creates double-strand breaks.

    Science.gov (United States)

    Mahfouz, Magdy M; Li, Lixin; Shamimuzzaman, Md; Wibowo, Anjar; Fang, Xiaoyun; Zhu, Jian-Kang

    2011-02-08

    Site-specific and rare cutting nucleases are valuable tools for genome engineering. The generation of double-strand DNA breaks (DSBs) promotes homologous recombination in eukaryotes and can facilitate gene targeting, additions, deletions, and inactivation. Zinc finger nucleases have been used to generate DSBs and subsequently, for genome editing but with low efficiency and reproducibility. The transcription activator-like family of type III effectors (TALEs) contains a central domain of tandem repeats that could be engineered to bind specific DNA targets. Here, we report the generation of a Hax3-based hybrid TALE nuclease with a user-selected DNA binding specificity. We show that the engineered TALE nuclease can bind to its target sequence in vitro and that the homodimeric TALE nuclease can cleave double-stranded DNA in vitro if the DNA binding sites have the proper spacing and orientation. Transient expression assays in tobacco leaves suggest that the hybrid nuclease creates DSB in its target sequence, which is subsequently repaired by nonhomologous end-joining repair. Taken together, our data show the feasibility of engineering TALE-based hybrid nucleases capable of generating site-specific DSBs and the great potential for site-specific genome modification in plants and eukaryotes in general.

  5. Packaging Double-Helical DNA into Viral Capsids: Structures, Forces, and Energetics

    OpenAIRE

    Petrov, Anton S.; Harvey, Stephen C.

    2008-01-01

    Small, icosahedral double-stranded DNA bacteriophage pack their genomes tightly into preformed protein capsids using an ATP-driven motor. Coarse-grain molecular-mechanics models provide a detailed picture of DNA packaging in bacteriophage, revealing how conformation depends on capsid size and shape, and the presence or absence of a protein core. The forces that oppose packaging have large contributions from both electrostatic repulsions and the entropic penalty of confining the DNA into the c...

  6. Evaluation of The Interaction between Netropsin and Double Stranded DNA by Capillary Zone Electrophoresis

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Capillary zone electrophoresis (CZE) was applied to study the interaction between netropsin and a 14mer double stranded DNA (dsDNA). The binding constant of this interaction calculated from Scatchard plot was (1.07±0.10)×105 (mol/L)-1. The binding stoichiometry was 1:1. The use of polyacrylamide coated capillary showed better effect in the analysis of DNA than noncoated capillary.

  7. Arabidopsis DNA polymerase lambda mutant is mildly sensitive to DNA double strand breaks but defective in integration ofa transgene.

    Directory of Open Access Journals (Sweden)

    Tomoyuki eFurukawa

    2015-05-01

    Full Text Available The DNA double-strand break (DSB is a critical type of damage, and can be induced by both endogenous sources (e.g. errors of oxidative metabolism, transposable elements, programmed meiotic breaks, or perturbation of the DNA replication fork and exogenous sources (e.g. ionizing radiation or radiomimetic chemicals. Although higher plants, like mammals, are thought to preferentially repair DSBs via nonhomologous end joining (NHEJ, much remains unclear about plant DSB repair pathways. Our reverse genetic approach suggests that DNA polymerase λ is involved in DSB repair in Arabidopsis. The Arabidopsis T-DNA insertion mutant (atpolλ-1 displayed sensitivity to both gamma-irradiation and treatment with radiomimetic reagents, but not to other DNA damaging treatments. The atpolλ-1 mutant showed a moderate sensitivity to DSBs, while Arabidopsis Ku70 and DNA ligase 4 mutants (atku70-3 and atlig4-2, both of which play critical roles in NHEJ, exhibited a hypersensitivity to these treatments. The atpolλ-1/atlig4-2 double mutant exhibited a higher sensitivity to DSBs than each single mutant, but the atku70/atpolλ-1 showed similar sensitivity to the atku70-3 mutant. We showed that transcription of the DNA ligase 1, DNA ligase 6, and Wee1 genes was quickly induced by BLM in several NHEJ deficient mutants in contrast to wild-type. Finally, the T-DNA transformation efficiency dropped in NHEJ deficient mutants and the lowest transformation efficiency was scored in the atpolλ-1/atlig4-2 double mutant. These results imply that AtPolλ is involved in both DSB repair and DNA damage response pathway.

  8. Simulating Molecular Interactions of Carbon Nanoparticles with a Double-Stranded DNA Fragment

    Directory of Open Access Journals (Sweden)

    Zhuang Wang

    2015-01-01

    Full Text Available Molecular interactions between carbon nanoparticles (CNPs and a double-stranded deoxyribonucleic acid (dsDNA fragment were investigated using molecular dynamics (MD simulations. Six types of CNPs including fullerenes (C60 and C70, (8,0 single-walled carbon nanotube (SWNT, (8,0 double-walled carbon nanotube (DWNT, graphene quantum dot (GQD, and graphene oxide quantum dot (GOQD were studied. Analysis of the best geometry indicates that the dsDNA fragment can bind to CNPs through pi-stacking and T-shape. Moreover, C60, DWNT, and GOQD bind to the dsDNA molecules at the minor groove of the nucleotide, and C70, SWNT, and GQD bind to the dsDNA molecules at the hydrophobic ends. Estimated interaction energy implies that van der Waals force may mainly contribute to the mechanisms for the dsDNA-C60, dsDNA-C70, and dsDNA-SWNT interactions and electrostatic force may contribute considerably to the dsDNA-DWNT, dsDNA-GQD, and dsDNA-GOQD interactions. On the basis of the results from large-scale MD simulations, it was found that the presence of the dsDNA enhances the dispersion of C60, C70, and SWNT in water and has a slight impact on DWNT, GQD, and GOQD.

  9. Induction of protective immune responses in mice by double DNA ...

    African Journals Online (AJOL)

    Tropical Journal of Pharmaceutical Research October 2016; 15 (10): 2077-2083. ISSN: 1596-5996 (print); .... 1 unit pfu DNA polymerase (Roche Applied. Science, Penzberg ..... response may affect the control of cell growth. CONCLUSION.

  10. Double-stranded DNA homology produces a physical signature

    Science.gov (United States)

    Wang, Xing; Zhang, Xiaoping; Mao, Chengde; Seeman, Nadrian C.

    2010-01-01

    DNA is found in the cell largely as a negatively supercoiled molecule. This high-energy form of the genetic material can engender sequence-dependent structures, such as cruciforms, Z-DNA, or H-DNA, even though they are not favored by conventional conditions in relaxed DNA. A key feature of DNA in living systems is the presence of homology. We have sought homology-dependent structural phenomena based on topological relaxation. Using two-dimensional electrophoresis, we demonstrate a structural transition in supercoiled plasmid molecules containing homologous segments. Atomic force microscopy (AFM) reveals a dumbbell structure in molecules whose linking difference is beyond the transition point. The position of the dumbbell shaft is a function of the site of homology, and its extent is proportional to the linking difference. Second-site-reversion electrophoresis data support the notion that the shaft contains PX-DNA. Predicted cross-linking patterns generated in vivo suggest that homology-dependent structures can occur within the cell. PMID:20616051

  11. Millisecond analysis of double stranded DNA with fluorescent intercalator by micro-thermocontrol-device.

    Science.gov (United States)

    Arata, Hideyuki F; Gillot, Frederic; Collard, Dominique; Fujita, Hiroyuki

    2009-08-15

    Study of interaction between DNA and intercalator at molecular level is important to understand the mechanisms of DNA replication and repair. A micro-fabricated local heating thermodevice was adapted to perform denaturation experiments of DNA with fluorescent intercalator on millisecond time scale. Response time of complete unzipping of double stranded DNA, 16 microm in length, was measured to be around 5 min by commercial thermocycler. Response time of quenching of double stranded DNA with fluorescent intercalator SYBR Green was measured to be 10 ms. Thus, quenching properties owing to strand unzipping and denaturation at base pair level were distinguished. This method has provided easy access to measure this parameter and may be a powerful methodology in analyzing biomolecules on millisecond time scale.

  12. Amplification methods bias metagenomic libraries of uncultured single-stranded and double-stranded DNA viruses.

    Science.gov (United States)

    Kim, Kyoung-Ho; Bae, Jin-Woo

    2011-11-01

    Investigation of viruses in the environment often requires the amplification of viral DNA before sequencing of viral metagenomes. In this study, two of the most widely used amplification methods, the linker amplified shotgun library (LASL) and multiple displacement amplification (MDA) methods, were applied to a sample from the seawater surface. Viral DNA was extracted from viruses concentrated by tangential flow filtration and amplified by these two methods. 454 pyrosequencing was used to read the metagenomic sequences from different libraries. The resulting taxonomic classifications of the viruses, their functional assignments, and assembly patterns differed substantially depending on the amplification method. Only double-stranded DNA viruses were retrieved from the LASL, whereas most sequences in the MDA library were from single-stranded DNA viruses, and double-stranded DNA viral sequences were minorities. Thus, the two amplification methods reveal different aspects of viral diversity.

  13. The human RAD54 recombinational DNA repair protein is a double-stranded DNA-dependent ATPase

    NARCIS (Netherlands)

    J. Essers (Jeroen); J. de Wit (Jan); R. Kanaar (Roland); J.H.J. Hoeijmakers (Jan); S.M.A. Swagemakers (Sigrid)

    1998-01-01

    textabstractDNA double-strand break repair through the RAD52 homologous recombination pathway in the yeast Saccharomyces cerevisiae requires, among others, the RAD51, RAD52, and RAD54 genes. The biological importance of homologous recombination is underscored by the conservation of

  14. The ability of sperm selection techniques to remove single-or double-strand DNA damage

    Institute of Scientific and Technical Information of China (English)

    Maria Enciso; Miriam Iglesias; Isabel Galin; Jonas Sarasa; Antonio Gosalvez; Jaime Gosalvez

    2011-01-01

    @@ A wide variety of techniques for the preparation of sperm are currently available,of which the most commonly employed are densitygradient centrifugation (DGC) and swim-up (SUP).To date,these methods appear to be effective in selecting functional sperm for assisted reproduction techniques (ART),but they may have negative effects on sperm DNA.In this study,the ability of these semen processing techniques to eliminate spermatozoa containing single- and double-strand DNA damage was assessed by the two-tailed comet assay and the sperm chromatin dispersion test in 1[57]semen samples from patients seeking assisted reproduction treatment.Our results indicated that SUP and DGC are equally efficient in eliminating spermatozoa containing double-strand DNA damage and sperm with highly damaged (degraded) DNA,as characterized by the presence of both single- and double-strand DNA breaks.However,DGC is more efficient than SUP in selecting spermatozoa that are free from single-strand DNA damage.Future studies should characterise the importance of the various types of DNA damage and examine the sperm processing protocols used in each laboratory to determine their ability to eliminate DNA damage and hence,prevent the potential transmission of genetic mutations via ART.

  15. Extensive ssDNA end formation at DNA double-strand breaks in non-homologous end-joining deficient cells during the S phase

    Directory of Open Access Journals (Sweden)

    Stenerlöw Bo

    2007-10-01

    Full Text Available Abstract Background Efficient and correct repair of DNA damage, especially DNA double-strand breaks, is critical for cellular survival. Defects in the DNA repair may lead to cell death or genomic instability and development of cancer. Non-homologous end-joining (NHEJ is the major repair pathway for DNA double-strand breaks in mammalian cells. The ability of other repair pathways, such as homologous recombination, to compensate for loss of NHEJ and the ways in which contributions of different pathways are regulated are far from fully understood. Results In this report we demonstrate that long single-stranded DNA (ssDNA ends are formed at radiation-induced DNA double-strand breaks in NHEJ deficient cells. At repair times ≥ 1 h, processing of unrejoined DNA double-strand breaks generated extensive ssDNA at the DNA ends in cells lacking the NHEJ protein complexes DNA-dependent protein kinase (DNA-PK or DNA Ligase IV/XRCC4. The ssDNA formation was cell cycle dependent, since no ssDNA ends were observed in G1-synchronized NHEJ deficient cells. Furthermore, in wild type cells irradiated in the presence of DNA-PKcs (catalytic subunit of DNA-PK inhibitors, or in DNA-PKcs deficient cells complemented with DNA-PKcs mutated in six autophosphorylation sites (ABCDE, no ssDNA was formed. The ssDNA generation also greatly influences DNA double-strand break quantification by pulsed-field gel electrophoresis, resulting in overestimation of the DNA double-strand break repair capability in NHEJ deficient cells when standard protocols for preparing naked DNA (i. e., lysis at 50°C are used. Conclusion We provide evidence that DNA Ligase IV/XRCC4 recruitment by DNA-PK to DNA double-strand breaks prevents the formation of long ssDNA ends at double-strand breaks during the S phase, indicating that NHEJ components may downregulate an alternative repair process where ssDNA ends are required.

  16. DNA ligase 1 deficient plants display severe growth defects and delayed repair of both DNA single and double strand breaks

    Directory of Open Access Journals (Sweden)

    Bray Clifford M

    2009-06-01

    Full Text Available Abstract Background DNA ligase enzymes catalyse the joining of adjacent polynucleotides and as such play important roles in DNA replication and repair pathways. Eukaryotes possess multiple DNA ligases with distinct roles in DNA metabolism, with clear differences in the functions of DNA ligase orthologues between animals, yeast and plants. DNA ligase 1, present in all eukaryotes, plays critical roles in both DNA repair and replication and is indispensable for cell viability. Results Knockout mutants of atlig1 are lethal. Therefore, RNAi lines with reduced levels of AtLIG1 were generated to allow the roles and importance of Arabidopsis DNA ligase 1 in DNA metabolism to be elucidated. Viable plants were fertile but displayed a severely stunted and stressed growth phenotype. Cell size was reduced in the silenced lines, whilst flow cytometry analysis revealed an increase of cells in S-phase in atlig1-RNAi lines relative to wild type plants. Comet assay analysis of isolated nuclei showed atlig1-RNAi lines displayed slower repair of single strand breaks (SSBs and also double strand breaks (DSBs, implicating AtLIG1 in repair of both these lesions. Conclusion Reduced levels of Arabidopsis DNA ligase 1 in the silenced lines are sufficient to support plant development but result in retarded growth and reduced cell size, which may reflect roles for AtLIG1 in both replication and repair. The finding that DNA ligase 1 plays an important role in DSB repair in addition to its known function in SSB repair, demonstrates the existence of a previously uncharacterised novel pathway, independent of the conserved NHEJ. These results indicate that DNA ligase 1 functions in both DNA replication and in repair of both ss and dsDNA strand breaks in higher plants.

  17. A Single Nucleotide Resolution Model for Large-Scale Simulations of Double Stranded DNA

    CERN Document Server

    Fosado, Y A G; Allan, J; Brackley, C; Henrich, O; Marenduzzo, D

    2016-01-01

    The computational modelling of DNA is becoming crucial in light of new advances in DNA nanotechnology, single-molecule experiments and in vivo DNA tampering. Here we present a mesoscopic model for double stranded DNA (dsDNA) at the single nucleotide level which retains the characteristic helical structure, while being able to simulate large molecules -- up to a million base pairs -- for time-scales which are relevant to physiological processes. This is made possible by an efficient and highly-parallelised implementation of the model which we discuss here. We compare the behaviour of our model with single molecule experiments where dsDNA is manipulated by external forces or torques. We also present some results on the kinetics of denaturation of linear DNA.

  18. DNA Double-Strand Breaks,Potential Targets for HBV Integration

    Institute of Scientific and Technical Information of China (English)

    胡晓文; 林菊生; 谢琼慧; 任精华; 常莹; 吴文杰; 夏羽佳

    2010-01-01

    Hepatitis B virus(HBV)-induced hepatocellular carcinoma(HCC) is one of the most fre-quently occurring cancers.Hepadnaviral DNA integrations are considered to be essential agents which can promote the process of the hepatocarcinogenesis.More and more researches were designed to find the relationship of the two.In this study,we investigated whether HBV DNA integration occurred at sites of DNA double-strand breaks(DSBs),one of the most detrimental DNA damage.An 18-bp I-SceI homing endonuclease recognition site...

  19. Multiplectoneme phase of double-stranded DNA under torsion

    NARCIS (Netherlands)

    Emanuel, M.; Lanzani, G.; Schiessel, H.

    2013-01-01

    We use the wormlike chain model to study supercoiling of DNA under tension and torque. The model reproduces experimental data for a broad range of forces, salt concentrations, and contour lengths. We find a plane of first-order phase transitions ending in a smeared-out line of critical points, the m

  20. Sequence-Dependent Fluorescence of Cy3- and Cy5-Labeled Double-Stranded DNA.

    Science.gov (United States)

    Kretschy, Nicole; Sack, Matej; Somoza, Mark M

    2016-03-16

    The fluorescent intensity of Cy3 and Cy5 dyes is strongly dependent on the nucleobase sequence of the labeled oligonucleotides. Sequence-dependent fluorescence may significantly influence the data obtained from many common experimental methods based on fluorescence detection of nucleic acids, such as sequencing, PCR, FRET, and FISH. To quantify sequence dependent fluorescence, we have measured the fluorescence intensity of Cy3 and Cy5 bound to the 5' end of all 1024 possible double-stranded DNA 5mers. The fluorescence intensity was also determined for these dyes bound to the 5' end of fixed-sequence double-stranded DNA with a variable sequence 3' overhang adjacent to the dye. The labeled DNA oligonucleotides were made using light-directed, in situ microarray synthesis. The results indicate that the fluorescence intensity of both dyes is sensitive to all five bases or base pairs, that the sequence dependence is stronger for double- (vs single-) stranded DNA, and that the dyes are sensitive to both the adjacent dsDNA sequence and the 3'-ssDNA overhang. Purine-rich sequences result in higher fluorescence. The results can be used to estimate measurement error in experiments with fluorescent-labeled DNA, as well as to optimize the fluorescent signal by considering the nucleobase environment of the labeling cyanine dye.

  1. A chiroptical switch based on DNA/layered double hydroxide ultrathin films.

    Science.gov (United States)

    Shi, Wenying; Jia, Yankun; Xu, Simin; Li, Zhixiong; Fu, Yi; Wei, Min; Shi, Shuxian

    2014-11-04

    A highly oriented film was fabricated by layer-by-layer self-assembly of DNA and MgAl-layered double hydroxide nanosheets, and its application in chiroptical switch was demonstrated via intercalation and deintercalation of an achiral molecule into the DNA cavity. DNA molecules are prone to forming an ordered and dispersive state in the interlayer region of rigid layered double hydroxide (LDH) nanosheets as confirmed by scanning electron microscopy and atomic force microscopy. The induced chiroptical ultrathin film (UTF) is achieved via the intercalation of an achiral chromophore [5,10,15,20-tetrakis(4-N-methylpyridyl)porphine tetra(p-toluenesulfonate) (TMPyP)] into the spiral cavity of DNA stabilized in the LDH matrix [denoted as TMPyP-(DNA/LDH)20]. Fluorescence and circular dichroism spectroscopy are utilized to testify the intercalation of TMPyP into (DNA/LDH)20 UTF that involves two steps: the electrostatic binding of TMPyP onto the surface of (DNA/LDH)20 followed by intercalation into base pairs of DNA. In addition, the TMPyP-(DNA/LDH)20 UTF exhibits good reversibility and repeatability in induced optical chirality, based on the intercalation and deintercalation of TMPyP by alternate exposure to HCl and NH3/H2O vapor, which can be potentially used as a chiroptical switch in data storage.

  2. Atrazine Triggers DNA Damage Response and Induces DNA Double-Strand Breaks in MCF-10A Cells.

    Science.gov (United States)

    Huang, Peixin; Yang, John; Ning, Jie; Wang, Michael; Song, Qisheng

    2015-06-24

    Atrazine, a pre-emergent herbicide in the chloro-s-triazine family, has been widely used in crop lands and often detected in agriculture watersheds, which is considered as a potential threat to human health. Although atrazine and its metabolites showed an elevated incidence of mammary tumors in female Sprague-Dawley (SD) rats, no molecular evidence was found relevant to its carcinogenesis in humans. This study aims to determine whether atrazine could induce the expression of DNA damage response-related proteins in normal human breast epithelial cells (MCF-10A) and to examine the cytotoxicity of atrazine at a molecular level. Our results indicate that a short-term exposure of MCF-10A to an environmentally-detectable concentration of atrazine (0.1 µg/mL) significantly increased the expression of tumor necrosis factor receptor-1 (TNFR1) and phosphorylated Rad17 in the cells. Atrazine treatment increased H2AX phosphorylation (γH2AX) and the formation of γH2AX foci in the nuclei of MCF-10A cells. Atrazine also sequentially elevated DNA damage checkpoint proteins of ATM- and RAD3-related (ATR), ATRIP and phospho-Chk1, suggesting that atrazine could induce DNA double-strand breaks and trigger the DNA damage response ATR-Chk1 pathway in MCF-10A cells. Further investigations are needed to determine whether atrazine-triggered DNA double-strand breaks and DNA damage response ATR-Chk1 pathway occur in vivo.

  3. Repair of radiation-induced DNA double-strand breaks in isolated nuclei of Physarum polycephalum

    Energy Technology Data Exchange (ETDEWEB)

    Brewer, E.N.

    1979-08-01

    Radiation-induced DNA double-strand breaks are rejoined in homogenates and isolated nuclei of Physarum polycephalum. In agreement with results obtained previously for intact plasmodia, double-strand breaks are less extensively repaired in nuclei isolated from S-phase, as compared to G/sub 2/-phase, cultures. A corresponding propensity of DNA present in unirradiated nuclei of S-phase plasmodia toward breakage during incubation in vitro was observed. Repair of putative single-strand breaks, as ascertained from alkaline sucrose density-gradient centrifugation analysis, was not observed. The possible relationships between these phenomena are discussed.

  4. Wave propagation of coupled modes in the DNA double helix

    Energy Technology Data Exchange (ETDEWEB)

    Tabi, C B; Ekobena Fouda, H P [Laboratory of Biophysics, Department of Physics, Faculty of Science, University of Yaounde I, PO Box 812, Yaounde (Cameroon); Mohamadou, A [Condensed Matter Laboratory, Department of Physics, Faculty of Science, University of Douala, PO Box 24157, Douala (Cameroon); Kofane, T C, E-mail: contab408@hotmail.com [Laboratory of Mechanics, Department of Physics, Faculty of Science, University of Yaounde I, PO Box 812, Yaounde (Cameroon)

    2011-03-15

    The remarkable dynamics of waves propagating along the DNA molecule is described by the coupled nonlinear Schroedinger equations. We consider both the single and the coupled nonlinear excitation modes and, under numerical simulations of the Peyrard-Bishop model, with the use of realistic values of parameters, their biological implications are studied. Furthermore, the characteristics of the coupled mode solution are discussed and we show that such a solution can describe the local opening observed within the transcription and the replication phenomena.

  5. DNA double strand break repair via non-homologous end-joining

    OpenAIRE

    Davis, Anthony J.; Chen, David J.

    2013-01-01

    DNA double-stranded breaks (DSB) are among the most dangerous forms of DNA damage. Unrepaired DSBs results in cells undergoing apoptosis or senescence whereas mis-processing of DSBs can lead to genomic instability and carcinogenesis. One important pathway in eukaryotic cells responsible for the repair of DSBs is non-homologous end-joining (NHEJ). In this review we will discuss the interesting new insights into the mechanism of the NHEJ pathway and the proteins which mediate this repair proces...

  6. Restrictions Limiting the Generation of DNA Double Strand Breaks during Chromosomal V(D)J Recombination

    Science.gov (United States)

    Tillman, Robert E.; Wooley, Andrea L.; Hughes, Maureen M.; Wehrly, Tara D.; Swat, Wojciech; Sleckman, Barry P.

    2002-01-01

    Antigen receptor loci are composed of numerous variable (V), diversity (D), and joining (J) gene segments, each flanked by recombination signal sequences (RSSs). The V(D)J recombination reaction proceeds through RSS recognition and DNA cleavage steps making it possible for multiple DNA double strand breaks (DSBs) to be introduced at a single locus. Here we use ligation-mediated PCR to analyze DNA cleavage intermediates in thymocytes from mice with targeted RSS mutations at the endogenous TCRβ locus. We show that DNA cleavage does not occur at individual RSSs but rather must be coordinated between RSS pairs flanking gene segments that ultimately form coding joins. Coordination of the DNA cleavage step occurs over great distances in the chromosome and favors intra- over interchromosomal recombination. Furthermore, through several restrictions imposed on the generation of both nonpaired and paired DNA DSBs, this requirement promotes antigen receptor gene integrity and genomic stability in developing lymphocytes undergoing V(D)J recombination. PMID:11828005

  7. RecA Binding to a Single Double-Stranded DNA Molecule: A Possible Role of DNA Conformational Fluctuations

    Science.gov (United States)

    Leger, J. F.; Robert, J.; Bourdieu, L.; Chatenay, D.; Marko, J. F.

    1998-10-01

    Most genetic regulatory mechanisms involve protein-DNA interactions. In these processes, the classical Watson-Crick DNA structure sometimes is distorted severely, which in turn enables the precise recognition of the specific sites by the protein. Despite its key importance, very little is known about such deformation processes. To address this general question, we have studied a model system, namely, RecA binding to double-stranded DNA. Results from micromanipulation experiments indicate that RecA binds strongly to stretched DNA; based on this observation, we propose that spontaneous thermal stretching fluctuations may play a role in the binding of RecA to DNA. This has fundamental implications for the protein-DNA binding mechanism, which must therefore rely in part on a combination of flexibility and thermal fluctuations of the DNA structure. We also show that this mechanism is sequence sensitive. Theoretical simulations support this interpretation of our experimental results, and it is argued that this is of broad relevance to DNA-protein interactions.

  8. Mechanical properties of double-stranded DNA biolayers immobilized on microcantilever under axial compression.

    Science.gov (United States)

    Zhang, Neng-Hui; Chen, Jian-Zhong

    2009-07-22

    In label-free biodetections based on microcantilever technology, double-stranded DNA (dsDNA) structures form through the linkage between probe single-stranded DNA (ssDNA) molecules immobilized on solid substrates and target ssDNA molecules in solutions. Mechanical/electrical properties of these biolayers are important factors for nanomechanical deflections of microcantilevers. In this paper, the biolayer immobilized on microcantilever is treated as a bar with a macroscopic elastic modulus on the basis of continuum mechanics viewpoints. In consideration of hydration force, screened electrostatic repulsion and conformational fluctuation in biolayers, load-deformation curves of dsDNA biolayers under axial compression are depicted with the help of the energy conservation law and a mesoscopic free energy presented by Strey et al. (1997, 1999) [Strey, H.H., Parsegian, V.A., Podgornik, R., 1997. Equation of state for DNA liquid crystals: fluctuation enhanced electrostatic double layer repulsion. Physical Review Letters 78, 895-898; Strey, H.H., Parsegian, V.A., Podgornik, R., 1999. Equation of state for polymer liquid crystals: theory and experiment. Physical Review E 59, 999-1008] from a liquid crystal theory. And the analytical relation between macroscopic Young's modulus of biolayers and nanoscopic geometrical properties of dsDNA, packing density, buffer salt solution concentration, etc. is also formulated.

  9. Electrochemical molecular beacon biosensor for sequence-specific recognition of double-stranded DNA.

    Science.gov (United States)

    Miao, Xiangmin; Guo, Xiaoting; Xiao, Zhiyou; Ling, Liansheng

    2014-09-15

    Direct recognition of double-stranded DNA (dsDNA) was crucial to disease diagnosis and gene therapy, because DNA in its natural state is double stranded. Here, a novel sensor for the sequence-specific recognition of dsDNA was developed based on the structure change of ferrocene (Fc) redox probe modified molecular beacon (MB). For constructing such a sensor, gold nanoparticles (AuNPs) were initially electrochemical-deposited onto glass carbon electrode (GCE) surface to immobilize thiolated MB in their folded states with Au-S bond. Hybridization of MB with target dsDNA induced the formation of parallel triplex DNA and opened the stem-loop structure of it, which resulted in the redox probe (Fc) away from the electrode and triggered the decrease of current signals. Under optimal conditions, dsDNA detection could be realized in the range from 350 pM to 25 nM, with a detection limit of 275 pM. Moreover, the proposed method has good sequence-specificity for target dsDNA compared with single base pair mismatch and two base pairs mismatches.

  10. Effect of temperature on DNA double helix: An insight from molecular dynamics simulation

    Indian Academy of Sciences (India)

    Sangeeta Kundu; Sanchita Mukherjee; Dhananjay Bhattacharyya

    2012-07-01

    The three-dimensional structure of DNA contains various sequence-dependent structural information, which control many cellular processes in life, such as replication, transcription, DNA repair, etc. For the above functions, DNA double helices need to unwind or melt locally, which is different from terminal melting, as often seen in molecular dynamics (MD) simulations or even in many DNA crystal structures. We have carried out detailed MD simulations of DNA double helices of regular oligonucleotide fragments as well as in polymeric constructs with water and charge-neutralizing counter-ions at several different temperatures. We wanted to eliminate the end-effect or terminal melting propensity by employing MD simulation of DNA oligonucleotides in such a manner that gives rise to properties of polymeric DNA of infinite length. The polymeric construct is expected to allow us to see local melting at elevated temperatures. Comparative structural analysis of oligonucleotides and its corresponding virtual polymer at various temperatures ranging from 300 K to 400 K is discussed. The general behaviour, such as volume expansion coefficients of both the simulations show high similarity, indicating polymeric construct, does not give many artificial constraints. Local melting of a polymer, even at elevated temperature, may need a high nucleation energy that was not available in the short (7 ns) simulations. We expected to observe such nucleation followed by cooperative melting of the polymers in longer MD runs. Such simulations of different polymeric sequences would facilitate us to predict probable melting origins in a polymeric DNA.

  11. The DNA damage-binding protein XPC is a frequent target for inactivation in squamous cell carcinomas.

    Science.gov (United States)

    de Feraudy, Sebastien; Ridd, Katie; Richards, Lauren M; Kwok, Pui-Yan; Revet, Ingrid; Oh, Dennis; Feeney, Luzviminda; Cleaver, James E

    2010-08-01

    XPC, the main damage-recognition protein responsible for nucleotide excision repair of UVB damage to DNA, is lost or mutated in xeroderma pigmentosum group C (XP-C), a rare inherited disease characterized by high incidence and early onset of non-melanoma and melanoma skin cancers. The high incidence of skin cancers in XP-C patients suggests that loss of expression of XPC protein might also provide a selective advantage for initiation and progression of similar cancers in non XP-C patients in the general population. To test whether XPC is selectively lost in squamous cell carcinomas from non XP-C patients, we examined XPC expression by immunohistochemistry on a tissue microarray with 244 tissue cores, including in situ and invasive squamous-cell carcinomas (SCCs), keratoacanthoma (KA), and normal skin samples from both immunocompetent and immunosuppressed patients. We found that XPC expression was lost in 49% of invasive squamous cell carcinomas from immunocompetent patients and 59% from immunosuppressed patients. Loss of expression was correlated with deletions of chromosomal 3p and mutations in the XPC gene. The XPC gene is consequently inactivated or lost in almost half of squamous cell carcinomas from non XP-C patients. Loss or mutation of XPC may be an early event during skin carcinogenesis that provides a selective advantage for initiation and progression of squamous cell carcinomas in non XP-C patients.

  12. Evolution of DNA polymerases: an inactivated polymerase-exonuclease module in Pol epsilon and a chimeric origin of eukaryotic polymerases from two classes of archaeal ancestors.

    Science.gov (United States)

    Tahirov, Tahir H; Makarova, Kira S; Rogozin, Igor B; Pavlov, Youri I; Koonin, Eugene V

    2009-03-18

    Evolution of DNA polymerases, the key enzymes of DNA replication and repair, is central to any reconstruction of the history of cellular life. However, the details of the evolutionary relationships between DNA polymerases of archaea and eukaryotes remain unresolved. We performed a comparative analysis of archaeal, eukaryotic, and bacterial B-family DNA polymerases, which are the main replicative polymerases in archaea and eukaryotes, combined with an analysis of domain architectures. Surprisingly, we found that eukaryotic Polymerase epsilon consists of two tandem exonuclease-polymerase modules, the active N-terminal module and a C-terminal module in which both enzymatic domains are inactivated. The two modules are only distantly related to each other, an observation that suggests the possibility that Pol epsilon evolved as a result of insertion and subsequent inactivation of a distinct polymerase, possibly, of bacterial descent, upstream of the C-terminal Zn-fingers, rather than by tandem duplication. The presence of an inactivated exonuclease-polymerase module in Pol epsilon parallels a similar inactivation of both enzymatic domains in a distinct family of archaeal B-family polymerases. The results of phylogenetic analysis indicate that eukaryotic B-family polymerases, most likely, originate from two distantly related archaeal B-family polymerases, one form giving rise to Pol epsilon, and the other one to the common ancestor of Pol alpha, Pol delta, and Pol zeta. The C-terminal Zn-fingers that are present in all eukaryotic B-family polymerases, unexpectedly, are homologous to the Zn-finger of archaeal D-family DNA polymerases that are otherwise unrelated to the B family. The Zn-finger of Polepsilon shows a markedly greater similarity to the counterpart in archaeal PolD than the Zn-fingers of other eukaryotic B-family polymerases. Evolution of eukaryotic DNA polymerases seems to have involved previously unnoticed complex events. We hypothesize that the archaeal

  13. Some aspects of the mechanism of bacteriophage function. Final progress report. [Mechanisms of inactivation of bacteriophages by ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Freifelder, D.

    1977-06-12

    Data are summarized from a ten-year study on the radiobiology of phages. The results showed that: phages are inactivated principally by damage to DNA; DNA damage is of two types, base damage and double-strand breakage; double-strand breakage may be lethal because of interruption within a gene, however in phage systems the damage is more fundamental in that only a single DNA fragment is injected into the host; E. coli phage T4 is relatively resistant to inactivation by x-rays; and the rate of production of strand breaks and base damage is nearly the same in bacteriophage and bacteria.

  14. Sae2, Exo1 and Sgs1 collaborate in DNA double-strand break processing

    OpenAIRE

    Mimitou, Eleni P.; Symington, Lorraine S.

    2008-01-01

    DNA ends exposed after introduction of double-strand breaks (DSBs) undergo 5′-3′ nucleolytic degradation to generate single-stranded DNA (ssDNA), the substrate for binding by the Rad51 protein to initiate homologous recombination. This process is poorly understood in eukaryotes, but several factors have been implicated, including the Mre11 complex (Mre11-Rad50-Xrs2/NBS1), Sae2/CtIP/Ctp1 and Exo1. Here we demonstrate that yeast Exo1 nuclease and Sgs1 helicase function in alternate pathways for...

  15. Branch migration prevents DNA loss during double-strand break repair.

    Directory of Open Access Journals (Sweden)

    Julia S P Mawer

    2014-08-01

    Full Text Available The repair of DNA double-strand breaks must be accurate to avoid genomic rearrangements that can lead to cell death and disease. This can be accomplished by promoting homologous recombination between correctly aligned sister chromosomes. Here, using a unique system for generating a site-specific DNA double-strand break in one copy of two replicating Escherichia coli sister chromosomes, we analyse the intermediates of sister-sister double-strand break repair. Using two-dimensional agarose gel electrophoresis, we show that when double-strand breaks are formed in the absence of RuvAB, 4-way DNA (Holliday junctions are accumulated in a RecG-dependent manner, arguing against the long-standing view that the redundancy of RuvAB and RecG is in the resolution of Holliday junctions. Using pulsed-field gel electrophoresis, we explain the redundancy by showing that branch migration catalysed by RuvAB and RecG is required for stabilising the intermediates of repair as, when branch migration cannot take place, repair is aborted and DNA is lost at the break locus. We demonstrate that in the repair of correctly aligned sister chromosomes, an unstable early intermediate is stabilised by branch migration. This reliance on branch migration may have evolved to help promote recombination between correctly aligned sister chromosomes to prevent genomic rearrangements.

  16. Differential regulation of the cellular response to DNA double-strand breaks in G1

    DEFF Research Database (Denmark)

    Barlow, Jacqueline H; Lisby, Michael; Rothstein, Rodney

    2008-01-01

    Double-strand breaks (DSBs) are potentially lethal DNA lesions that can be repaired by either homologous recombination (HR) or nonhomologous end-joining (NHEJ). We show that DSBs induced by ionizing radiation (IR) are efficiently processed for HR and bound by Rfa1 during G1, while endonuclease-in...

  17. Mouse RAD54 affects DNA double-strand break repair and sister chromatid exchange

    NARCIS (Netherlands)

    H.B. Beverloo (Berna); R.D. Johnson (Roger); M. Jasin (Maria); R. Kanaar (Roland); J.H.J. Hoeijmakers (Jan); M.L.G. Dronkert (Mies)

    2000-01-01

    textabstractCells can achieve error-free repair of DNA double-strand breaks (DSBs) by homologous recombination through gene conversion with or without crossover. In contrast, an alternative homology-dependent DSB repair pathway, single-strand annealing (SSA), results in deletions. In this study, we

  18. Double-strand break repair and G4 DNA stability in Caenorhabditis elegans

    NARCIS (Netherlands)

    Pontier, D.B.

    2010-01-01

    DNA double-strand breaks (DSBs) can be repaired by three canonical repair pathways. Homologous recombination (HR) uses the sister chromatid or homologous chromosome as a template to repair the DSB in an error-free manner. In non-homologous end-joining (NHEJ), the broken ends are ligated with little

  19. DNA Double-Strand Break Repair Pathway Choice Is Directed by Distinct MRE11 Nuclease Activities

    NARCIS (Netherlands)

    A. Shibata (Atsushi); D. Moiani (Davide); A.S. Arvai (Andrew); J. Perry (Jefferson); S.M. Harding (Shane); M.-M. Genois (Marie-Michelle); R. Maity (Ranjan); S.E. van Rossum-Fikkert (Sari); A. Kertokalio (Aryandi); F. Romoli (Filippo); A. Ismail (Amani); E. Ismalaj (Ermal); E. Petricci (Elena); M.J. Neale (Matthew); R.G. Bristow (Robert); J.-Y. Masson (Jean-Yves); C. Wyman (Claire); P.A. Jeggo (Penny); J.A. Tainer (John)

    2014-01-01

    textabstractMRE11 within the MRE11-RAD50-NBS1 (MRN) complex acts in DNA double-strand break repair (DSBR), detection, and signaling; yet, how its endo- and exonuclease activities regulate DSBR by nonhomologous end-joining (NHEJ) versus homologous recombination (HR) remains enigmatic. Here, we employ

  20. DNA double-strand break rejoining in human follicular lymphoma and glioblastoma tumor cells

    NARCIS (Netherlands)

    Macann, AMJ; Britten, RA; Poppema, S; Pearcey, R; Rosenberg, E; Allalunis-Turner, MJ; Murray, D

    2000-01-01

    Follicle center cell lymphoma is among the most radioresponsive of human cancers. To assess whether this radioresponsiveness might be a result of a compromised ability of the tumor cells to accomplish the biologically-effective repair of DNA double-strand breaks (DSBs), we have measured i) the exten

  1. A role for small RNAs in DNA double-strand break repair

    DEFF Research Database (Denmark)

    Wei, W.; Ba, Z.; Wu, Y.

    2012-01-01

    Eukaryotes have evolved complex mechanisms to repair DNA double-strand breaks (DSBs) through coordinated actions of protein sensors, transducers, and effectors. Here we show that ∼21-nucleotide small RNAs are produced from the sequences in the vicinity of DSB sites in Arabidopsis and in human cel...

  2. Meiotic and mitotic functions of mammalian RAD 18 in DNA double-strand break repair

    NARCIS (Netherlands)

    A. Inagaki (Akiko)

    2010-01-01

    textabstractThis thesis focuses on the role of RAD 18 in DNA double-strand break (DSB ) repair. Much is known about the role of RAD 18, and its critical substrate PCNA in replication damage bypass (RDB ) repair. However, the roles of RAD 18 in DSB repair are still elusive, although several

  3. Double-strand break repair and G4 DNA stability in Caenorhabditis elegans

    NARCIS (Netherlands)

    Pontier, D.B.

    2010-01-01

    DNA double-strand breaks (DSBs) can be repaired by three canonical repair pathways. Homologous recombination (HR) uses the sister chromatid or homologous chromosome as a template to repair the DSB in an error-free manner. In non-homologous end-joining (NHEJ), the broken ends are ligated with little

  4. DNA Double-Strand Break Repair Pathway Choice Is Directed by Distinct MRE11 Nuclease Activities

    NARCIS (Netherlands)

    A. Shibata (Atsushi); D. Moiani (Davide); A.S. Arvai (Andrew); J. Perry (Jefferson); S.M. Harding (Shane); M.-M. Genois (Marie-Michelle); R. Maity (Ranjan); S.E. van Rossum-Fikkert (Sari); A. Kertokalio (Aryandi); F. Romoli (Filippo); A. Ismail (Amani); E. Ismalaj (Ermal); E. Petricci (Elena); M.J. Neale (Matthew); R.G. Bristow (Robert); J.-Y. Masson (Jean-Yves); C. Wyman (Claire); P.A. Jeggo (Penny); J.A. Tainer (John)

    2014-01-01

    textabstractMRE11 within the MRE11-RAD50-NBS1 (MRN) complex acts in DNA double-strand break repair (DSBR), detection, and signaling; yet, how its endo- and exonuclease activities regulate DSBR by nonhomologous end-joining (NHEJ) versus homologous recombination (HR) remains enigmatic. Here, we

  5. Nanoconstructions on the base of double-stranded DNA molecules and their optical properties

    Science.gov (United States)

    Skuridin, S. G.; Yevdokimov, Yu. M.; Chulkov, D. P.; Gusev, V. M.; Kompanets, O. N.; Vereschagin, F. V.

    2016-12-01

    Experimental results have been presented on studying optical properties of nanoconstructions formed of orientationally ordered neighbouring double-stranded DNA molecules in the structure of their liquid-crystalline phases and dispersion particles of these phases including ones cured with intercalators.

  6. DNA double strand breaks repair pathways in mouse male germ cells

    NARCIS (Netherlands)

    Ahmed, E.A.

    2009-01-01

    DNA double strand breaks (DSBs) are induced by ionizing radiation, and during meiotic recombination. DSBs are repaired via two main pathways, homologous recombination (HR) and non homologous end-joining (NHEJ). There are three main types of male germ cells, spermatogonia, spermatocytes and spermatid

  7. Meiotic and mitotic functions of mammalian RAD 18 in DNA double-strand break repair

    NARCIS (Netherlands)

    A. Inagaki (Akiko)

    2010-01-01

    textabstractThis thesis focuses on the role of RAD 18 in DNA double-strand break (DSB ) repair. Much is known about the role of RAD 18, and its critical substrate PCNA in replication damage bypass (RDB ) repair. However, the roles of RAD 18 in DSB repair are still elusive, although several interacti

  8. Mixed-Sequence Recognition of Double-Stranded DNA Using Enzymatically Stable Phosphorothioate Invader Probes

    Directory of Open Access Journals (Sweden)

    Brooke A. Anderson

    2015-07-01

    Full Text Available Development of probes that allow for sequence-unrestricted recognition of double-stranded DNA (dsDNA continues to attract much attention due to the prospect for molecular tools that enable detection, regulation, and manipulation of genes. We have recently introduced so-called Invader probes as alternatives to more established approaches such as triplex-forming oligonucleotides, peptide nucleic acids and polyamides. These short DNA duplexes are activated for dsDNA recognition by installment of +1 interstrand zippers of intercalator-functionalized nucleotides such as 2′-N-(pyren-1-ylmethyl-2′-N-methyl-2′-aminouridine and 2′-O-(pyren-1-ylmethyluridine, which results in violation of the nearest neighbor exclusion principle and duplex destabilization. The individual probes strands have high affinity toward complementary DNA strands, which generates the driving force for recognition of mixed-sequence dsDNA regions. In the present article, we characterize Invader probes that are based on phosphorothioate backbones (PS-DNA Invaders. The change from the regular phosphodiester backbone furnishes Invader probes that are much more stable to nucleolytic degradation, while displaying acceptable dsDNA-recognition efficiency. PS-DNA Invader probes therefore present themselves as interesting probes for dsDNA-targeting applications in cellular environments and living organisms.

  9. Preventing damage limitation: targeting DNA-PKcs and DNA double strand break repair pathways for ovarian cancer therapy

    Directory of Open Access Journals (Sweden)

    Daniela A Dungl

    2015-10-01

    Full Text Available Platinum-based chemotherapy is the cornerstone of ovarian cancer treatment, and its efficacy is dependent on the generation of DNA damage, with subsequent induction of apoptosis. Inappropriate or aberrant activation of the DNA damage response network is are associated with resistance to platinum, and defects in DNA repair pathways play critical roles in determining patient response to chemotherapy. In ovarian cancer, tumour cell defects in homologous recombination - a repair pathway activated in response to DNA double strand breaks (DSB - are most commonly associated with platinum sensitive disease. However, despite initial sensitivity, the emergence of resistance is frequent. Here, we review strategies for directly interfering with DNA repair pathways, with particular focus on direct inhibition of non-homologous end joining (NHEJ, another DSB repair pathway. DNA-PKcs is a core component of NHEJ and it has shown considerable promise as a chemosensitization target in numerous cancer types, including ovarian cancer where it functions to promote platinum-induced survival signalling, via AKT activation. The development of pharmacological inhibitors of DNA-PKcs is on-going, and clinic-ready agents offer real hope to patients with chemoresistant disease.

  10. Enrichment of Cdk1-cyclins at DNA double-strand breaks stimulates Fun30 phosphorylation and DNA end resection.

    Science.gov (United States)

    Chen, Xuefeng; Niu, Hengyao; Yu, Yang; Wang, Jingjing; Zhu, Shuangyi; Zhou, Jianjie; Papusha, Alma; Cui, Dandan; Pan, Xuewen; Kwon, Youngho; Sung, Patrick; Ira, Grzegorz

    2016-04-07

    DNA double-strand breaks (DSBs) are one of the most cytotoxic types of DNA lesion challenging genome integrity. The activity of cyclin-dependent kinase Cdk1 is essential for DSB repair by homologous recombination and for DNA damage signaling. Here we identify the Fun30 chromatin remodeler as a new target of Cdk1. Fun30 is phosphorylated by Cdk1 on Serine 28 to stimulate its functions in DNA damage response including resection of DSB ends. Importantly, Cdk1-dependent phosphorylation of Fun30-S28 increases upon DNA damage and requires the recruitment of Fun30 to DSBs, suggesting that phosphorylation increases in situ at the DNA damage. Consistently, we find that Cdk1 and multiple cyclins become highly enriched at DSBs and that the recruitment of Cdk1 and cyclins Clb2 and Clb5 ensures optimal Fun30 phosphorylation and checkpoint activation. We propose that the enrichment of Cdk1-cyclin complexes at DSBs serves as a mechanism for enhanced targeting and modulating of the activity of DNA damage response proteins.

  11. Use of RAPD and PCR double amplification in the study of ancient DNA

    Directory of Open Access Journals (Sweden)

    F. Balzano

    2011-01-01

    Full Text Available This project analysed the DNA extracted from bones of ancient sheep which have been brought to light in Sardinian different archaeological sites. In order to better analyse this highly fragmented DNA, a double amplification technique was chosen. The first approach consisted of RAPD-PCR abd the second one in classic PCR. The RAPD-PCR amplified random fragments and allowed the production of numerous amplicons. The products of RAPD amplification have been amplified, more specifically, by the second PCR using primers for a sequence of 176 bp of mitochondrial D-loop region. These DNA fragments have been sequenced and the sequence analysis has confirmed that it belonged to Ovis aries. Consequently, this provedure can be considered a valid tool to perform amplification of degraded DNA, such as ancient DNA.

  12. Carbon ion induced DNA double-strand breaks in melanophore B{sub 16}

    Energy Technology Data Exchange (ETDEWEB)

    Wei Zengquan; Zhou Guangming; Wang Jufang; He Jing; Li Qiang; Li Wenjian; Xie Hongmei; Cai Xichen; Tao Huang; Dang Bingrong; Han Guangwu [Chinese Academy of Sciences, Lanzhou (China). Inst. of Modern Physics; Gao Qingxiang [Lanzhou Univ. (China)

    1997-09-01

    DNA double-strand breaks (DSBs) in melanophore B{sub 16} induced by plateau and extended Bragg peak of 75 MeV/u {sup 12}C{sup 6+} ions were studied by using a technique of inverse pulsed-field gel electrophoresis (PIGE). DNA fragment lengths were distributed in two ranges: the larger in 1.4 Mbp-3.2 Mbp and the smaller in less than 1.2 Mbp. It indicates that distribution of DNA fragments induced by heavy ion irradiation is not stochastic and there probably are sensitive sites to heavy ions in DNA molecules of B{sub 16}. Percentage of DNA released from plug (PR) increased and trended towards a quasi-plateau {proportional_to}85% as dose increased. Content of the larger fragments decreased and flattened with increasing dose while content of the smaller ones increased and trended towards saturation. (orig.)

  13. Structural and magnetic properties of a variety of transition metal incorporated DNA double helices.

    Science.gov (United States)

    Samanta, Pralok K; Pati, Swapan K

    2014-02-03

    By using density functional theory calculations, the structural, energetic, magnetic, and optical properties for a variety of transition metal (M = Mn, Fe, Co, Ni and Cu) ions incorporated modified-DNA (M-DNA) double helices has been investigated. The DNA is modified with either hydroxypyridone (H) or bis(salicylaldehyde)ethylenediamine (S-en) metalated bases. We find the formation of extended M-O network leading to the ferromagnetic interactions for the case of H-DNA for all the metal ions. More ordered stacking arrangement was found for S-en-DNA. We calculate the exchange coupling constant (J) considering Heisenberg Hamiltonian for quantitative description of magnetic interactions. The ferromagnetic and antiferromagnetic interactions are obtained by varying different transition metal ions. The extent of the magnetic interaction depends on the number of transition metal ions. Optical profiles show peaks below 2 eV, a clear signature of spin-spin coupling.

  14. Splicing stimulates siRNA formation at Drosophila DNA double-strand breaks.

    Directory of Open Access Journals (Sweden)

    Karin Merk

    2017-06-01

    Full Text Available DNA double-strand breaks trigger the production of locus-derived siRNAs in fruit flies, human cells and plants. At least in flies, their biogenesis depends on active transcription running towards the break. Since siRNAs derive from a double-stranded RNA precursor, a major question is how broken DNA ends can generate matching sense and antisense transcripts. We performed a genome-wide RNAi-screen in cultured Drosophila cells, which revealed that in addition to DNA repair factors, many spliceosome components are required for efficient siRNA generation. We validated this observation through site-specific DNA cleavage with CRISPR-cas9 followed by deep sequencing of small RNAs. DNA breaks in intron-less genes or upstream of a gene's first intron did not efficiently trigger siRNA production. When DNA double-strand breaks were induced downstream of an intron, however, this led to robust siRNA generation. Furthermore, a downstream break slowed down splicing of the upstream intron and a detailed analysis of siRNA coverage at the targeted locus revealed that unspliced pre-mRNA contributes the sense strand to the siRNA precursor. Since splicing factors are stimulating the response but unspliced transcripts are entering the siRNA biogenesis, the spliceosome is apparently stalled in a pre-catalytic state and serves as a signaling hub. We conclude that convergent transcription at DNA breaks is stimulated by a splicing dependent control process. The resulting double-stranded RNA is converted into siRNAs that instruct the degradation of cognate mRNAs. In addition to a potential role in DNA repair, the break-induced transcription may thus be a means to cull improper RNAs from the transcriptome of Drosophila melanogaster. Since the splicing factors identified in our screen also stimulated siRNA production from high copy transgenes, it is possible that this surveillance mechanism serves in genome defense beyond DNA double-strand breaks.

  15. Effects of beta interferon on human fibroblasts at different population doubling levels. Proliferation, cell volume, thymidine uptake, and DNA synthesis

    OpenAIRE

    1984-01-01

    Cellular aging had no effect on the ability of beta interferon to increase cell volume and population doubling time in 76-109 cells, a line of human skin fibroblasts. However, DNA synthesis in cells at high population doubling levels (PDL 55-70) was inhibited after 72 h of beta interferon treatment (1,000 U/ml) while no inhibition of DNA synthesis was observed in cells at middle population doubling levels (PDL 30-40).

  16. PARP-1 and Ku compete for repair of DNA double strand breaks by distinct NHEJ pathways

    Science.gov (United States)

    Wang, Minli; Wu, Weizhong; Wu, Wenqi; Rosidi, Bustanur; Zhang, Lihua; Wang, Huichen; Iliakis, George

    2006-01-01

    Poly(ADP-ribose)polymerase 1 (PARP-1) recognizes DNA strand interruptions in vivo and triggers its own modification as well as that of other proteins by the sequential addition of ADP-ribose to form polymers. This modification causes a release of PARP-1 from DNA ends and initiates a variety of responses including DNA repair. While PARP-1 has been firmly implicated in base excision and single strand break repair, its role in the repair of DNA double strand breaks (DSBs) remains unclear. Here, we show that PARP-1, probably together with DNA ligase III, operates in an alternative pathway of non-homologous end joining (NHEJ) that functions as backup to the classical pathway of NHEJ that utilizes DNA-PKcs, Ku, DNA ligase IV, XRCC4, XLF/Cernunnos and Artemis. PARP-1 binds to DNA ends in direct competition with Ku. However, in irradiated cells the higher affinity of Ku for DSBs and an excessive number of other forms of competing DNA lesions limit its contribution to DSB repair. When essential components of the classical pathway of NHEJ are absent, PARP-1 is recruited for DSB repair, particularly in the absence of Ku and non-DSB lesions. This form of DSB repair is sensitive to PARP-1 inhibitors. The results define the function of PARP-1 in DSB repair and characterize a candidate pathway responsible for joining errors causing genomic instability and cancer. PMID:17088286

  17. The peptide antibiotic microcin B17 induces double-strand cleavage of DNA mediated by E. coli DNA gyrase.

    Science.gov (United States)

    Vizán, J L; Hernández-Chico, C; del Castillo, I; Moreno, F

    1991-02-01

    Microcin B17 (MccB17) is a bactericidal peptide antibiotic which inhibits DNA replication. Two Escherichia coli MccB17 resistant mutants were isolated and the mutations were shown to map to 83 min of the genetic map. Cloning of the mutations and Tn5 insertional analysis demonstrated that they were located inside gyrB. The approximate location of the mutations within gyrB was determined by constructing hybrid genes, as a previous step to sequencing. Both mutations were shown to consist of a single AT----GC transition at position 2251 of the gene, which produces a Trp751----Arg substitution in the amino acid sequence of the GyrB polypeptide. The inhibitory effect of MccB17 on replicative cell-free extracts was assayed. In this in vitro system, interaction of MccB17 with a component of the extracts induced double-strand cleavage of plasmid DNA. In vivo treatment with MccB17 also induced a well-defined cleavage pattern on chromosomal DNA. These effects were not observed with a MccB17-resistant, gyrB mutant. Altogether, our results indicate that MccB17 blocks DNA gyrase by trapping an enzyme-DNA cleavable complex. Thus, the mode of action of this peptide antibiotic resembles that of quinolones and a variety of antitumour drugs currently used in cancer chemotherapy. MccB17 is the first peptide shown to inhibit a type II DNA topoisomerase.

  18. Bi-directional routing of DNA mismatch repair protein human exonuclease 1 to replication foci and DNA double strand breaks

    DEFF Research Database (Denmark)

    Liberti, Sascha E; Andersen, Sofie Dabros; Wang, Jing

    2011-01-01

    Human exonuclease 1 (hEXO1) is implicated in DNA metabolism, including replication, recombination and repair, substantiated by its interactions with PCNA, DNA helicases BLM and WRN, and several DNA mismatch repair (MMR) proteins. We investigated the sub-nuclear localization of hEXO1 during S......-phase progression and in response to laser-induced DNA double strand breaks (DSBs). We show that hEXO1 and PCNA co-localize in replication foci. This apparent interaction is sustained throughout S-phase. We also demonstrate that hEXO1 is rapidly recruited to DNA DSBs. We have identified a PCNA interacting protein...... (PIP-box) region on hEXO1 located in its COOH-terminal ((788)QIKLNELW(795)). This motif is essential for PCNA binding and co-localization during S-phase. Recruitment of hEXO1 to DNA DSB sites is dependent on the MMR protein hMLH1. We show that two distinct hMLH1 interaction regions of hEXO1 (residues...

  19. Design and implementation of a microfluidic half adder chip based on double-stranded DNA.

    Science.gov (United States)

    Wang, Jing; Huang, Yourui

    2014-06-01

    In recent years, DNA computing has gained significant research interest. The design of a biochip with DNA computing as a carrier has become a key area in the development of a DNA molecular computer. The half adder, as the basic unit of various arithmetic units, has a complex structure that directly affects the overall complexity of a computer's structure. In this study, a half adder on a microfluidic chip is developed by means of bio-reaction. This technology is combined with a biochip and adopts glass and polydimethylsiloxane to fabricate a microscale hybrid chip. Using a DNA strand as an operand, realization of the half adder on a microfluidic chip is achieved by controlling the annealing and denaturation of double-stranded DNA. The computing results are rapidly and accurately obtained by detecting the presence of double-stranded DNA in a solution by agarose gel electrophoresis. The microfluidic half-adder chip accurately realizes half-adder computations and overcomes the shortcomings of traditional integrated circuit half adders, optical half adders, and chemical molecule half adders, such as complex structure, limited component size, and low accuracy.

  20. Atrazine Triggers DNA Damage Response and Induces DNA Double-Strand Breaks in MCF-10A Cells

    Directory of Open Access Journals (Sweden)

    Peixin Huang

    2015-06-01

    Full Text Available Atrazine, a pre-emergent herbicide in the chloro-s-triazine family, has been widely used in crop lands and often detected in agriculture watersheds, which is considered as a potential threat to human health. Although atrazine and its metabolites showed an elevated incidence of mammary tumors in female Sprague–Dawley (SD rats, no molecular evidence was found relevant to its carcinogenesis in humans. This study aims to determine whether atrazine could induce the expression of DNA damage response-related proteins in normal human breast epithelial cells (MCF-10A and to examine the cytotoxicity of atrazine at a molecular level. Our results indicate that a short-term exposure of MCF-10A to an environmentally-detectable concentration of atrazine (0.1 µg/mL significantly increased the expression of tumor necrosis factor receptor-1 (TNFR1 and phosphorylated Rad17 in the cells. Atrazine treatment increased H2AX phosphorylation (γH2AX and the formation of γH2AX foci in the nuclei of MCF-10A cells. Atrazine also sequentially elevated DNA damage checkpoint proteins of ATM- and RAD3-related (ATR, ATRIP and phospho-Chk1, suggesting that atrazine could induce DNA double-strand breaks and trigger the DNA damage response ATR-Chk1 pathway in MCF-10A cells. Further investigations are needed to determine whether atrazine-triggered DNA double-strand breaks and DNA damage response ATR-Chk1 pathway occur in vivo.

  1. Understanding the similarity in thermophoresis between single- and double-stranded DNA or RNA.

    Science.gov (United States)

    Reichl, Maren; Herzog, Mario; Greiss, Ferdinand; Wolff, Manuel; Braun, Dieter

    2015-06-01

    Thermophoresis is the movement of molecules in a temperature gradient. For aqueous solutions its microscopic basis is debated. Understanding thermophoresis for this case is, however, important since it proved very useful to detect the binding affinity of biomolecules and since thermophoresis could have played an important role in early molecular evolution. Here we discuss why the thermophoresis of single- and double-stranded oligonucleotides - DNA and RNA - is surprisingly similar. This finding is understood by comparing the spherical capacitor model for single-stranded species with the case of a rod-shaped model for double-stranded oligonucleotides. The approach describes thermophoresis of DNA and RNA with fitted effective charges consistent with electrophoresis measurements and explains the similarity between single- and double-stranded species. We could not confirm the sign change for the thermophoresis of single- versus double-stranded DNA in crowded solutions containing polyethylene glycol [Y. T. Maeda, T. Tlusty, and A. Libchaber, Proc. Natl. Acad. Sci. USA 109, 17972 (2012)], but find a salt-independent offset while the Debye length dependence still satisfies the capacitor model. Overall, the analysis documents the continuous progress in the microscopic understanding of thermophoresis.

  2. The Transcriptional Response to DNA-Double-Strand Breaks in Physcomitrella patens

    Science.gov (United States)

    Kamisugi, Yasuko; Whitaker, John W.

    2016-01-01

    The model bryophyte Physcomitrella patens is unique among plants in supporting the generation of mutant alleles by facile homologous recombination-mediated gene targeting (GT). Reasoning that targeted transgene integration occurs through the capture of transforming DNA by the homology-dependent pathway for DNA double-strand break (DNA-DSB) repair, we analysed the genome-wide transcriptomic response to bleomycin-induced DNA damage and generated mutants in candidate DNA repair genes. Massively parallel (Illumina) cDNA sequencing identified potential participants in gene targeting. Transcripts encoding DNA repair proteins active in multiple repair pathways were significantly up-regulated. These included Rad51, CtIP, DNA ligase 1, Replication protein A and ATR in homology-dependent repair, Xrcc4, DNA ligase 4, Ku70 and Ku80 in non-homologous end-joining and Rad1, Tebichi/polymerase theta, PARP in microhomology-mediated end-joining. Differentially regulated cell-cycle components included up-regulated Rad9 and Hus1 DNA-damage-related checkpoint proteins and down-regulated D-type cyclins and B-type CDKs, commensurate with the imposition of a checkpoint at G2 of the cell cycle characteristic of homology-dependent DNA-DSB repair. Candidate genes, including ATP-dependent chromatin remodelling helicases associated with repair and recombination, were knocked out and analysed for growth defects, hypersensitivity to DNA damage and reduced GT efficiency. Targeted knockout of PpCtIP, a cell-cycle activated mediator of homology-dependent DSB resection, resulted in bleomycin-hypersensitivity and greatly reduced GT efficiency. PMID:27537368

  3. [Role of layered double hydroxide (LDH) in the protection of herring testis DNA from heavy metals].

    Science.gov (United States)

    Tang, Yi-Ni; Wu, Ping-Xiao; Zhu, Neng-Wu

    2012-10-01

    The role of layered double hydroxide (LDH) in the protection of herring testis DNA from heavy metals Cd2+ and Pb2+ was studied by X-ray diffraction ( XRD) spectra, Fourier transform infrared (FTIR) spectra, Scanning Electron Microscopy (SEM), Cyclic Voltammetry and Ultraviolet Spectrometry. Size expansion of the basal spacing (003) from 0. 76 nm in LDH to 2. 30 nm was observed in the resulting DNA-LDH nanohybrids and it gave peaks corresponding to C=O (1 534 cm(-1) and 1488 cm(-1)) in skeleton and bases, C-O stretching vibration (1228 cm(-1)), and P-O symmetrical stretching vibration (1096 cm(-1)) in functional groups of DNA, indicating that DNA were intercalated into the LDH by the ion exchange. However, the displacement of NO3(-) was not fully complete (partial intercalation of DNA). The DNA outside LDH interlayers was absorbed on the surface of LDH. The cyclic voltammetric curves showed that DNA in the composites exhibited a very similar peaks, which corresponded to the two reduction current peaks (E(P) = - 1.2 mV and E(P) = -2.4 mV) of free DNA. Also there was no cathode sag emerging in cyclic voltammetric curves, suggesting that both Cd2+ and Pb2+ cannot insert into the groove of DNA to associate with base pairs or other groups when DNA was bound on LDH. The results showed that, on the one hand, both Cd2+ and Pb2+ were absorbed on the external surface of LDH for immobilization, on the other hand, the layer of LDH provided ideal space for DNA by the action of protecting DNA molecules from Cd2+ and Pb2+.

  4. Forster Resonance Energy Transfer and Laser Fluorescent Analysis of Defects in DNA Double Helix

    CERN Document Server

    Bregadze, Vasil G; Giorgadze, Tamar G; Jaliashvili, Zaza V; Chkhaberidze, Jemal G; Monaselidze, Jamlet R; Khuskivadze, Temur B

    2013-01-01

    Real time laser induced fluorescence spectroscopy usage for microanalysis of DNA double helix defects is shown. The method is based on Forster resonance energy transfer (FRET) in intercalator-donor pair (acridine orange as a donor and ethidium bromide as an acceptor). Transition metal ions such as Cu(II), Cu(I), Ag(I), silver nanoparticles (AgNPs), photo- and thermo effects were used to cause double helix defects in DNA. FRET radii were experimentally estimated in background electrolyte solution (0.01 M NaNO3) and proved to be 3.9 +- 0.3 nm and the data are in satisfactory agreement with the theoretically calculated value Ro = 3.5 +- 0.3 nm. Concentration of DNA sites, exposed to Cu(II), Cu(I), Ag(I) ions, AgNPs impact as well as laser irradiation ({\\lambda} = 457 nm) and temperature, which are applicable for intercalation, were estimated in relative units. FRET method allows to estimate the concentration of double helix areas with high quality stability applicable for intercalation in DNA after it was subjec...

  5. Anthracyclines induce double-strand DNA breaks at active gene promoters.

    Science.gov (United States)

    Yang, Fan; Kemp, Christopher J; Henikoff, Steven

    2015-03-01

    Doxorubicin is a widely used chemotherapeutic drug that intercalates between DNA base-pairs and poisons Topoisomerase II, although the mechanistic basis for cell killing remains speculative. Doxorubicin and related anthracycline compounds have been shown to increase nucleosome turnover and/or eviction around promoters, which suggests that the resulting enhanced exposure of DNA might underlie cell killing. Previously, we showed that low doses of anthracyclines increase nucleosome turnover around active gene promoters, which suggests that loss of nucleosomes might contribute to cancer cell killing. Here we apply a genome-wide method to precisely map DNA double-strand breaks (DSBs) in cancer cells. We find that spontaneous DSBs occur preferentially around promoters of active genes, and that both anthracyclines and etoposide, a Topoisomerase II poison, increase DSBs around promoters, although CpG islands are conspicuously protected from DSBs. We propose that torsion-based enhancement of nucleosome turnover by anthracyclines exposes promoter DNA, ultimately causing DSBs around promoters.

  6. Understanding the origin of liquid crystal ordering of ultrashort double-stranded DNA

    Science.gov (United States)

    Saurabh, Suman; Lansac, Yves; Jang, Yun Hee; Glaser, Matthew A.; Clark, Noel A.; Maiti, Prabal K.

    2017-03-01

    Recent experiments have shown that short double-stranded DNA (dsDNA) fragments having six- to 20-base pairs exhibit various liquid crystalline phases. This violates the condition of minimum molecular shape anisotropy that analytical theories demand for liquid crystalline ordering. It has been hypothesized that the liquid crystalline ordering is the result of end-to-end stacking of dsDNA to form long supramolecular columns which satisfy the shape anisotropy criterion necessary for ordering. To probe the thermodynamic feasibility of this process, we perform molecular dynamics simulations on ultrashort (four base pair long) dsDNA fragments, quantify the strong end-to-end attraction between them, and demonstrate that the nematic ordering of the self-assembled stacked columns is retained for a large range of temperature and salt concentration.

  7. Compound Poisson Processes and Clustered Damage of Radiation Induced DNA Double Strand Breaks

    Science.gov (United States)

    Gudowska-Nowak, E.; Ritter, S.; Taucher-Scholz, G.; Kraft, G.

    2000-05-01

    Recent experimental data have demonstrated that DNA damage induced by densely ionizing radiation in mammalian cells is distributed along the DNA molecule in the form of clusters. The principal constituent of DNA damage are double-strand breaks (DSB) which are formed when the breaks occur in both DNA strands and are directly opposite or separated by only a few base pairs. DSBs are believed to be most important lesions produced in chromosomes by radiation; interaction between DSBs can lead to cell killing, mutation or carcinogenesis. The paper discusses a model of clustered DSB formation viewed in terms of compound Poisson process along with the predictive essay of the formalism in application to experimental data.

  8. Stiffer double-stranded DNA in two-dimensional confinement due to bending anisotropy

    Science.gov (United States)

    Salari, H.; Eslami-Mossallam, B.; Ranjbar, H. F.; Ejtehadi, M. R.

    2016-12-01

    Using analytical approach and Monte Carlo (MC) simulations, we study the elastic behavior of the intrinsically twisted elastic ribbons with bending anisotropy, such as double-stranded DNA (dsDNA), in two-dimensional (2D) confinement. We show that, due to the bending anisotropy, the persistence length of dsDNA in 2D conformations is always greater than three-dimensional (3D) conformations. This result is in consistence with the measured values for DNA persistence length in 2D and 3D in equal biological conditions. We also show that in two dimensions, an anisotropic, intrinsically twisted polymer exhibits an implicit twist-bend coupling, which leads to the transient curvature increasing with a half helical turn periodicity along the bent polymer.

  9. The role of DNA double-strand breaks in spontaneous homologous recombination in S. cerevisiae

    DEFF Research Database (Denmark)

    Lettier, Gaëlle; Feng, Q.; Mayolo, A.A. de

    2006-01-01

    Homologous recombination (HR) is a source of genomic instability and the loss of heterozygosity in mitotic cells. Since these events pose a severe health risk, it is important to understand the molecular events that cause spontaneous HR. In eukaryotes, high levels of HR are a normal feature...... of meiosis and result from the induction of a large number of DNA double-strand breaks (DSBs). By analogy, it is generally believed that the rare spontaneous mitotic HR events are due to repair of DNA DSBs that accidentally occur during mitotic growth. Here we provide the first direct evidence that most...... spontaneous mitotic HR in Saccharomyces cerevisiae is initiated by DNA lesions other than DSBs. Specifically, we describe a class of rad52 mutants that are fully proficient in inter- and intra-chromosomal mitotic HR, yet at the same time fail to repair DNA DSBs. The conclusions are drawn from genetic analyses...

  10. Electronic transport in double-strand poly(dG)-poly(dC) DNA segments

    Energy Technology Data Exchange (ETDEWEB)

    Sarmento, R.G. [Departamento de Fisica, Universidade Federal do Rio Grande do Norte, 59072-970 Natal, RN (Brazil); Albuquerque, E.L. [Departamento de Fisica, Universidade Federal do Rio Grande do Norte, 59072-970 Natal, RN (Brazil)], E-mail: eudenilson@dfte.ufrn.br; Sesion, P.D. [Departamento de Fisica, Universidade Federal do Rio Grande do Norte, 59072-970 Natal, RN (Brazil); Fulco, U.L. [Departamento de Biofisica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal, RN (Brazil); Oliveira, B.P.W. de [Department of Physics and Astronomy, University of Southern California, Los Angeles, CA 90089 (United States)

    2009-04-06

    We study the electronic properties of a double-strand quasiperiodic DNA molecule modeled by a one-dimensional effective Hamiltonian, which includes contributions from the nucleobasis system as well as the sugar-phosphate backbone. Our theoretical approach makes use of Dyson's equation together with a transfer-matrix treatment, considering an electronic tight-binding Hamiltonian model to investigate the electronic density of states (DOS) and the electronic transmissivity of sequences of DNA finite segments. To mimic the DNA segments, we consider the finite quasiperiodic sequences of Fibonacci's type, in a poly(dG)-poly(dC) configuration, whose building blocks are the bases guanine G and cytosine C. We compared the electronic transport found for the quasiperiodic structure to those using a sequence of natural DNA, as part of the human chromosome Ch22.

  11. Electronic transport in double-strand poly(dG)-poly(dC) DNA segments

    Science.gov (United States)

    Sarmento, R. G.; Albuquerque, E. L.; Sesion, P. D.; Fulco, U. L.; de Oliveira, B. P. W.

    2009-04-01

    We study the electronic properties of a double-strand quasiperiodic DNA molecule modeled by a one-dimensional effective Hamiltonian, which includes contributions from the nucleobasis system as well as the sugar-phosphate backbone. Our theoretical approach makes use of Dyson's equation together with a transfer-matrix treatment, considering an electronic tight-binding Hamiltonian model to investigate the electronic density of states (DOS) and the electronic transmissivity of sequences of DNA finite segments. To mimic the DNA segments, we consider the finite quasiperiodic sequences of Fibonacci's type, in a poly(dG)-poly(dC) configuration, whose building blocks are the bases guanine G and cytosine C. We compared the electronic transport found for the quasiperiodic structure to those using a sequence of natural DNA, as part of the human chromosome Ch22.

  12. [Bacterial infections as seen from the eukaryotic genome: DNA double strand breaks, inflammation and cancer].

    Science.gov (United States)

    Lemercier, Claudie

    2014-01-01

    An increasing number of studies report that infection by pathogenic bacteria alters the host genome, producing highly hazardous DNA double strand breaks for the eukaryotic cell. Even when DNA repair occurs, it often leaves "scars" on chromosomes that might generate genomic instability at the next cell division. Chronic intestinal inflammation promotes the expansion of genotoxic bacteria in the intestinal microbiote which in turn triggers tumor formation and colon carcinomas. Bacteria act at the level of the host DNA repair machinery. They also highjack the host cell cycle to allow themselves time for replication in an appropriate reservoir. However, except in the case of bacteria carrying the CDT nuclease, the molecular mechanisms responsible for DNA lesions are not well understood, even if reactive oxygen species released during infection make good candidates. © 2014 médecine/sciences – Inserm.

  13. Evaluation of five commercial nucleic acid extraction kits for their ability to inactivate Bacillus anthracis spores and comparison of DNA yields from spores and spiked environmental samples.

    Science.gov (United States)

    Dauphin, Leslie A; Moser, Benjamin D; Bowen, Michael D

    2009-01-01

    This study evaluated five commercial extraction kits for their ability to recover DNA from Bacillus anthracis spores and spiked environmental samples. The kits evaluated represent the major types of methodologies which are commercially available for DNA or total nucleic acid extraction, and included the ChargeSwitch gDNA Mini Bacteria Kit, NucliSens Isolation Kit, Puregene Genomic DNA Purification Kit, QIAamp DNA Blood Mini Kit, and the UltraClean Microbial DNA Isolation Kit. Extraction methods were performed using the spores of eight virulent strains of B. anthracis. Viability testing of nucleic acid extracts showed that the UltraClean kit was the most efficient at depleting samples of live B. anthracis spores. TaqMan real-time PCR analysis revealed that the NucliSens, QIAamp and UltraClean kits yielded the best level of detection from spore suspensions. Comparisons of processed samples from spiked swabs and three powder types indicated that DNA extraction using the UltraClean kit resulted in the most consistently positive results and the lowest limit of detection. This study demonstrated that different nucleic extraction methodologies, represented here by various commercial extraction kits, differ in their ability to inactivate live B. anthracis spores as well as DNA yield and purity. In addition, the extraction method used can influence the sensitivity of real-time PCR assays for B. anthracis.

  14. Surface shapes and surrounding environment analysis of single- and double-stranded DNA-binding proteins in protein-DNA interface.

    Science.gov (United States)

    Wang, Wei; Liu, Juan; Sun, Lin

    2016-07-01

    Protein-DNA bindings are critical to many biological processes. However, the structural mechanisms underlying these interactions are not fully understood. Here, we analyzed the residues shape (peak, flat, or valley) and the surrounding environment of double-stranded DNA-binding proteins (DSBs) and single-stranded DNA-binding proteins (SSBs) in protein-DNA interfaces. In the results, we found that the interface shapes, hydrogen bonds, and the surrounding environment present significant differences between the two kinds of proteins. Built on the investigation results, we constructed a random forest (RF) classifier to distinguish DSBs and SSBs with satisfying performance. In conclusion, we present a novel methodology to characterize protein interfaces, which will deepen our understanding of the specificity of proteins binding to ssDNA (single-stranded DNA) or dsDNA (double-stranded DNA). Proteins 2016; 84:979-989. © 2016 Wiley Periodicals, Inc.

  15. Retinoblastoma-binding protein 1 has an interdigitated double Tudor domain with DNA binding activity.

    Science.gov (United States)

    Gong, Weibin; Wang, Jinfeng; Perrett, Sarah; Feng, Yingang

    2014-02-21

    Retinoblastoma-binding protein 1 (RBBP1) is a tumor and leukemia suppressor that binds both methylated histone tails and DNA. Our previous studies indicated that RBBP1 possesses a Tudor domain, which cannot bind histone marks. In order to clarify the function of the Tudor domain, the solution structure of the RBBP1 Tudor domain was determined by NMR and is presented here. Although the proteins are unrelated, the RBBP1 Tudor domain forms an interdigitated double Tudor structure similar to the Tudor domain of JMJD2A, which is an epigenetic mark reader. This indicates the functional diversity of Tudor domains. The RBBP1 Tudor domain structure has a significant area of positively charged surface, which reveals a capability of the RBBP1 Tudor domain to bind nucleic acids. NMR titration and isothermal titration calorimetry experiments indicate that the RBBP1 Tudor domain binds both double- and single-stranded DNA with an affinity of 10-100 μM; no apparent DNA sequence specificity was detected. The DNA binding mode and key interaction residues were analyzed in detail based on a model structure of the Tudor domain-dsDNA complex, built by HADDOCK docking using the NMR data. Electrostatic interactions mediate the binding of the Tudor domain with DNA, which is consistent with NMR experiments performed at high salt concentration. The DNA-binding residues are conserved in Tudor domains of the RBBP1 protein family, resulting in conservation of the DNA-binding function in the RBBP1 Tudor domains. Our results provide further insights into the structure and function of RBBP1.

  16. The adsorption-desorption transition of double-stranded DNA interacting with an oppositely charged dendrimer induced by multivalent anions.

    Science.gov (United States)

    Jiang, Yangwei; Zhang, Dong; Zhang, Yaoyang; Deng, Zhenyu; Zhang, Linxi

    2014-05-28

    The adsorption-desorption transition of DNA in DNA-dendrimer solutions is observed when high-valence anions, such as hexavalent anions, are added to the DNA-dendrimer solutions. In the DNA-dendrimer solutions with low-valence anions, dendrimers bind tightly with the V-shaped double-stranded DNA. When high-valence anions, such as pentavalent or hexavalent anions, are added to the DNA-dendrimer solutions, the double-stranded DNA chains can be stretched straightly and the dendrimers are released from the double-stranded DNA chains. In fact, adding high-valence anions to the solutions can change the charge spatial distribution in the DNA-dendrimer solutions, and weaken the electrostatic interactions between the positively charged dendrimers and the oppositely charged DNA chains. Adsorption-desorption transition of DNA is induced by the overcharging of dendrimers. This investigation is capable of helping us understand how to control effectively the release of DNA in gene/drug delivery because an effective gene delivery for dendrimers includes non-covalent DNA-dendrimer binding and the effective release of DNA in gene therapy.

  17. Tying the loose ends together in DNA double strand break repair with 53BP1

    Directory of Open Access Journals (Sweden)

    Carpenter Phillip B

    2006-08-01

    Full Text Available Abstract To maintain genomic stability and ensure the fidelity of chromosomal transmission, cells respond to various forms of genotoxic stress, including DNA double-stranded breaks (DSBs, through the activation of DNA damage response signaling networks. In response to DSBs as induced by ionizing radiation (IR, during DNA replication, or through immunoglobulin heavy chain (IgH rearrangements in B cells of lymphoid origin, the phosphatidyl inositol-like kinase (PIK kinases ATM (mutated in ataxia telangiectasia, ATR (ATM and Rad3-related kinase, and the DNA-dependent protein kinase (DNA-PK activate signaling pathways that lead to DSB repair. DSBs are repaired by either of two major, non-mutually exclusive pathways: homologous recombination (HR that utilizes an undamaged sister chromatid template (or homologous chromosome and non- homologous end joining (NHEJ, an error prone mechanism that processes and joins broken DNA ends through the coordinated effort of a small set of ubiquitous factors (DNA-PKcs, Ku70, Ku80, artemis, Xrcc4/DNA lig IV, and XLF/Cernunnos. The PIK kinases phosphorylate a variety of effector substrates that propagate the DNA damage signal, ultimately resulting in various biological outputs that influence cell cycle arrest, transcription, DNA repair, and apoptosis. A variety of data has revealed a critical role for p53-binding protein 1 (53BP1 in the cellular response to DSBs including various aspects of p53 function. Importantly, 53BP1 plays a major role in suppressing translocations, particularly in B and T cells. This report will review past experiments and current knowledge regarding the role of 53BP1 in the DNA damage response.

  18. Non-redundant Functions of ATM and DNA-PKcs in Response to DNA Double-Strand Breaks

    Directory of Open Access Journals (Sweden)

    Pierre Caron

    2015-11-01

    Full Text Available DNA double-strand breaks (DSBs elicit the so-called DNA damage response (DDR, largely relying on ataxia telangiectasia mutated (ATM and DNA-dependent protein kinase (DNA-PKcs, two members of the PI3K-like kinase family, whose respective functions during the sequential steps of the DDR remains controversial. Using the DIvA system (DSB inducible via AsiSI combined with high-resolution mapping and advanced microscopy, we uncovered that both ATM and DNA-PKcs spread in cis on a confined region surrounding DSBs, independently of the pathway used for repair. However, once recruited, these kinases exhibit non-overlapping functions on end joining and γH2AX domain establishment. More specifically, we found that ATM is required to ensure the association of multiple DSBs within “repair foci.” Our results suggest that ATM acts not only on chromatin marks but also on higher-order chromatin organization to ensure repair accuracy and survival.

  19. How quantum entanglement in DNA synchronizes double-strand breakage by type II restriction endonucleases.

    Science.gov (United States)

    Kurian, P; Dunston, G; Lindesay, J

    2016-02-21

    Macroscopic quantum effects in living systems have been studied widely in pursuit of fundamental explanations for biological energy transport and sensing. While it is known that type II endonucleases, the largest class of restriction enzymes, induce DNA double-strand breaks by attacking phosphodiester bonds, the mechanism by which simultaneous cutting is coordinated between the catalytic centers remains unclear. We propose a quantum mechanical model for collective electronic behavior in the DNA helix, where dipole-dipole oscillations are quantized through boundary conditions imposed by the enzyme. Zero-point modes of coherent oscillations would provide the energy required for double-strand breakage. Such quanta may be preserved in the presence of thermal noise by the enzyme's displacement of water surrounding the DNA recognition sequence. The enzyme thus serves as a decoherence shield. Palindromic mirror symmetry of the enzyme-DNA complex should conserve parity, because symmetric bond-breaking ceases when the symmetry of the complex is violated or when physiological parameters are perturbed from optima. Persistent correlations in DNA across longer spatial separations-a possible signature of quantum entanglement-may be explained by such a mechanism.

  20. Regulation of DNA double-strand break repair by ubiquitin and ubiquitin-like modifiers

    DEFF Research Database (Denmark)

    Schwertman, Petra; Bekker-Jensen, Simon; Mailand, Niels

    2016-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions. The swift recognition and faithful repair of such damage is crucial for the maintenance of genomic stability, as well as for cell and organismal fitness. Signalling by ubiquitin, SUMO and other ubiquitin-like modifiers (UBLs......) orchestrates and regulates cellular responses to DSBs at multiple levels, often involving extensive crosstalk between these modifications. Recent findings have revealed compelling insights into the complex mechanisms by which ubiquitin and UBLs regulate protein interactions with DSB sites to promote accurate...

  1. Translocation frequency of double-stranded DNA through a solid-state nanopore

    CERN Document Server

    Bell, Nicholas A W; Keyser, Ulrich F

    2015-01-01

    Solid-state nanopores are single molecule sensors that measure changes in ionic current as charged polymers such as DNA pass through. Here, we present comprehensive experiments on the length, voltage and salt dependence of the frequency of double-stranded DNA translocations through conical quartz nanopores with mean opening diameter 15 nm. We observe an entropic barrier limited, length dependent translocation frequency at 4M LiCl salt concentration and a drift-dominated, length independent translocation frequency at 1M KCl salt concentration. These observations are described by a unifying convection-diffusion equation which includes the contribution of an entropic barrier for polymer entry.

  2. SCAI promotes DNA double-strand break repair in distinct chromosomal contexts

    DEFF Research Database (Denmark)

    Hansen, Rebecca Kring; Mund, Andreas; Poulsen, Sara Lund

    2016-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions, whose accurate repair by non-homologous end-joining (NHEJ) or homologous recombination (HR) is crucial for genome integrity and is strongly influenced by the local chromatin environment. Here, we identify SCAI (suppressor of cancer...... in repressive chromatin environments. Moreover, we establish an important role of SCAI in meiotic recombination, as SCAI deficiency in mice leads to germ cell loss and subfertility associated with impaired retention of the DMC1 recombinase on meiotic chromosomes. Collectively, our findings uncover SCAI...

  3. Population Dynamics of Viral Inactivation

    Science.gov (United States)

    Freeman, Krista; Li, Dong; Behrens, Manja; Streletzky, Kiril; Olsson, Ulf; Evilevitch, Alex

    We have investigated the population dynamics of viral inactivation in vitrousing time-resolved cryo electron microscopy combined with light and X-ray scattering techniques. Using bacteriophage λ as a model system for pressurized double-stranded DNA viruses, we found that virions incubated with their cell receptor eject their genome in a stochastic triggering process. The triggering of DNA ejection occurs in a non synchronized manner after the receptor addition, resulting in an exponential decay of the number of genome-filled viruses with time. We have explored the characteristic time constant of this triggering process at different temperatures, salt conditions, and packaged genome lengths. Furthermore, using the temperature dependence we determined an activation energy for DNA ejections. The dependences of the time constant and activation energy on internal DNA pressure, affected by salt conditions and encapsidated genome length, suggest that the triggering process is directly dependent on the conformational state of the encapsidated DNA. The results of this work provide insight into how the in vivo kinetics of the spread of viral infection are influenced by intra- and extra cellular environmental conditions. This material is based upon work supported by the National Science Foundation Graduate Research Fellowship under Grant No. DGE-1252522.

  4. Structure of the replicative form of bacteriophage φX174 : VI. Studies on alkali-denatured double-stranded φX DNA

    NARCIS (Netherlands)

    Pouwels, P.H.; Knijnenburg, C.M.; Rotterdam, J. van; Cohen, J.A.; Jansz, H.S.

    1968-01-01

    Double-stranded φX DNA which accumulates after infection with bacteriophage φX174 in the presence of chloramphenicol consists mainly of twisted circular double-stranded DNA with no single-strand breaks (component I) and of circular double-stranded DNA, in which single-strand breaks are present (comp

  5. Dynamic tuning of DNA-nanoparticle superlattices by molecular intercalation of double helix.

    Science.gov (United States)

    Pal, Suchetan; Zhang, Yugang; Kumar, Sanat K; Gang, Oleg

    2015-04-01

    Nanoparticle (NP) assembly using DNA recognition has emerged as a powerful tool for the fabrication of 3D superlattices. In addition to the vast structural diversity, this approach provides an avenue for dynamic 3D NP assembly, which is promising for the modulation of interparticle distances and, hence, for example, for in situ tuning of optical properties. While several approaches have been explored for changing NP separations in the lattices using responsiveness of single-stranded DNA (ss-DNA), far less work has been done for the manipulation of most abundant double-stranded DNA (ds-DNA) motifs. Here, we present a novel strategy for modulation of interparticle distances in DNA linked 3D self-assembled NP lattices by molecular intercalator. We utilize ethidium bromide (EtBr) as a model intercalator to demonstrate selective and isotropic lattice expansion for three superlattice types (bcc, fcc, and AlB2) due to the intercalation of ds-DNA linking NPs. We further show the reversibility of the lattice parameter using n-butanol as a retrieving agent as well as an increased lattice thermal stability by 12-14 °C due to the inclusion of EtBr. The proposed intercalator-based strategy permits the creation of reconfigurable and thermally stable superlattices, which could lead to tunable and functionally responsive materials.

  6. Energy band gap and optical transition of metal ion modified double crossover DNA lattices.

    Science.gov (United States)

    Dugasani, Sreekantha Reddy; Ha, Taewoo; Gnapareddy, Bramaramba; Choi, Kyujin; Lee, Junwye; Kim, Byeonghoon; Kim, Jae Hoon; Park, Sung Ha

    2014-10-22

    We report on the energy band gap and optical transition of a series of divalent metal ion (Cu(2+), Ni(2+), Zn(2+), and Co(2+)) modified DNA (M-DNA) double crossover (DX) lattices fabricated on fused silica by the substrate-assisted growth (SAG) method. We demonstrate how the degree of coverage of the DX lattices is influenced by the DX monomer concentration and also analyze the band gaps of the M-DNA lattices. The energy band gap of the M-DNA, between the lowest unoccupied molecular orbital (LUMO) and the highest occupied molecular orbital (HOMO), ranges from 4.67 to 4.98 eV as judged by optical transitions. Relative to the band gap of a pristine DNA molecule (4.69 eV), the band gap of the M-DNA lattices increases with metal ion doping up to a critical concentration and then decreases with further doping. Interestingly, except for the case of Ni(2+), the onset of the second absorption band shifts to a lower energy until a critical concentration and then shifts to a higher energy with further increasing the metal ion concentration, which is consistent with the evolution of electrical transport characteristics. Our results show that controllable metal ion doping is an effective method to tune the band gap energy of DNA-based nanostructures.

  7. Transcription-induced DNA double strand breaks: both oncogenic force and potential therapeutic target?

    Science.gov (United States)

    Haffner, Michael C; De Marzo, Angelo M; Meeker, Alan K; Nelson, William G; Yegnasubramanian, Srinivasan

    2011-06-15

    An emerging model of transcriptional activation suggests that induction of transcriptional programs, for instance by stimulating prostate or breast cells with androgens or estrogens, respectively, involves the formation of DNA damage, including DNA double strand breaks (DSB), recruitment of DSB repair proteins, and movement of newly activated genes to transcription hubs. The DSB can be mediated by the class II topoisomerase TOP2B, which is recruited with the androgen receptor and estrogen receptor to regulatory sites on target genes and is apparently required for efficient transcriptional activation of these genes. These DSBs are recognized by the DNA repair machinery triggering the recruitment of repair proteins such as poly(ADP-ribose) polymerase 1 (PARP1), ATM, and DNA-dependent protein kinase (DNA-PK). If illegitimately repaired, such DSBs can seed the formation of genomic rearrangements like the TMPRSS2-ERG fusion oncogene in prostate cancer. Here, we hypothesize that these transcription-induced, TOP2B-mediated DSBs can also be exploited therapeutically and propose that, in hormone-dependent tumors like breast and prostate cancers, a hormone-cycling therapy, in combination with topoisomerase II poisons or inhibitors of the DNA repair components PARP1 and DNA-PK, could overwhelm cancer cells with transcription-associated DSBs. Such strategies may find particular utility in cancers, like prostate cancer, which show low proliferation rates, in which other chemotherapeutic strategies that target rapidly proliferating cells have had limited success.

  8. Generation of Gross Chromosomal Rearrangements by a Single Engineered DNA Double Strand Break

    Science.gov (United States)

    Qiu, Zhijun; Zhang, Zhenhua; Roschke, Anna; Varga, Tamas; Aplan, Peter D.

    2017-01-01

    Gross chromosomal rearrangements (GCRs), including translocations, inversions amplifications, and deletions, can be causal events leading to malignant transformation. GCRs are thought to be triggered by DNA double strand breaks (DSBs), which in turn can be spontaneous or induced by external agents (eg. cytotoxic chemotherapy, ionizing radiation). It has been shown that induction of DNA DSBs at two defined loci can produce stable balanced chromosomal translocations, however, a single engineered DNA DSB could not. Herein, we report that although a single engineered DNA DSB in H2AX “knockdown” cells did not generate GCRs, repair of a single engineered DNA DSB in fibroblasts that had ablated H2ax did produce clonal, stable GCRs, including balanced translocations and megabase-pair inversions. Upon correction of the H2ax deficiency, cells no longer generated GCRs following a single engineered DNA DSB. These findings demonstrate that clonal, stable GCRs can be produced by a single engineered DNA DSB in H2ax knockout cells, and that the production of these GCRs is ameliorated by H2ax expression. PMID:28225067

  9. Exact Solutions of Nonlinear Dynamics Equation in a New Double-Chain Model of DNA

    Institute of Scientific and Technical Information of China (English)

    QIAN Xian-Min; LOU Sen-Yue

    2003-01-01

    The exact solutions of the general nonlinear dynamic system in a new double-chain model of DNA are studiedkink shape excitations can be found in both the Conte's truncation expansion and the Pickering's truncation expansion.Three types of new localized excitations, the asymmetric kink-kink excitations, the soliton-kink excitation, and thekink-soliton excitations, are found by using the Pickering's nonstandard truncation expansion.

  10. Multinuclear non-heme iron complexes for double-strand DNA cleavage

    NARCIS (Netherlands)

    Megens, Rik P.; van den Berg, Tieme A.; de Bruijn, A. Dowine; Feringa, Ben L.; Roelfes, Gerard

    2009-01-01

    The cytotoxicity of the antitumor drug BLM is believed to be related to the ability of the corresponding iron complex (Fe-BLM) to engage in oxidative double-strand DNA cleavage. The iron complex of the ligand N4Py (Fe-N4Py; N4Py - N,N-bis(2-pyridyl)-N-bis(2-pyridyl)methylamine has proven to be a

  11. DNA replication initiation, doubling of rate of phospholipid synthesis, and cell division in Escherichia coli.

    OpenAIRE

    Joseleau-Petit, D; Képès, F; Peutat, L; D'Ari, R; Képès, A

    1987-01-01

    In synchronized culture of Escherichia coli, the specific arrest of phospholipid synthesis (brought about by glycerol starvation in an appropriate mutant) did not affect the rate of ongoing DNA synthesis but prevented the initiation of new rounds. The initiation block did not depend on cell age at the time of glycerol removal, which could be before, during, or after the doubling in the rate of phospholipid synthesis (DROPS) and as little as 10 min before the expected initiation. We conclude t...

  12. Real Estate in the DNA Damage Response: Ubiquitin and SUMO Ligases Home in on DNA Double-Strand Breaks.

    Science.gov (United States)

    Dantuma, Nico P; Pfeiffer, Annika

    2016-01-01

    Ubiquitin and the ubiquitin-like modifier SUMO are intimately connected with the cellular response to various types of DNA damage. A striking feature is the local accumulation of these proteinaceous post-translational modifications in the direct vicinity to DNA double-strand breaks, which plays a critical role in the formation of ionizing radiation-induced foci. The functional significance of these modifications is the coordinated recruitment and removal of proteins involved in DNA damage signaling and repair in a timely manner. The central orchestrators of these processes are the ubiquitin and SUMO ligases that are responsible for accurately tagging a broad array of chromatin and chromatin-associated proteins thereby changing their behavior or destination. Despite many differences in the mode of action of these enzymes, they share some striking features that are of direct relevance for their function in the DNA damage response. In this review, we outline the molecular mechanisms that are responsible for the recruitment of ubiquitin and SUMO ligases and discuss the importance of chromatin proximity in this process.

  13. Homologous recombination is a primary pathway to repair DNA double-strand breaks generated during DNA rereplication.

    Science.gov (United States)

    Truong, Lan N; Li, Yongjiang; Sun, Emily; Ang, Katrina; Hwang, Patty Yi-Hwa; Wu, Xiaohua

    2014-10-17

    Re-initiation of DNA replication at origins within a given cell cycle would result in DNA rereplication, which can lead to genome instability and tumorigenesis. DNA rereplication can be induced by loss of licensing control at cellular replication origins, or by viral protein-driven multiple rounds of replication initiation at viral origins. DNA double-strand breaks (DSBs) are generated during rereplication, but the mechanisms of how these DSBs are repaired to maintain genome stability and cell viability are poorly understood in mammalian cells. We generated novel EGFP-based DSB repair substrates, which specifically monitor the repair of rereplication-associated DSBs. We demonstrated that homologous recombination (HR) is an important mechanism to repair rereplication-associated DSBs, and sister chromatids are used as templates for such HR-mediated DSB repair. Micro-homology-mediated non-homologous end joining (MMEJ) can also be used but to a lesser extent compared to HR, whereas Ku-dependent classical non-homologous end joining (C-NHEJ) has a minimal role to repair rereplication-associated DSBs. In addition, loss of HR activity leads to severe cell death when rereplication is induced. Therefore, our studies identify HR, the most conservative repair pathway, as the primary mechanism to repair DSBs upon rereplication. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Linear induction of DNA double-strand breakage with X-ray dose, as determined from DNA fragment size distribution

    Energy Technology Data Exchange (ETDEWEB)

    Erixon, K.; Cedervall, B. [Karolinksa Institutet, Stockholm (Sweden)

    1995-05-01

    Pulsed-field gel electrophoresis has been applied to separate DNA from mouse L1210 cells exposed to X-ray doses of 1 to 50 Gy. Simultaneous separation of marker chromosomes in the range 0.1 to 12.6 Mbp allowed calculation of the size distribution of the radiation-induced fragments. The distribution was consistent with a random induction of double-strand breaks (DSBs). A theoretical relationship between the size distribution of such fragments and the average number of induced breaks was used to calculate the yield and dose response. The DNA distribution was determined by both radiolabeling and fluorescence staining. Two independent methods were use to evaluate the radiation-induced yield of DSBs, both assuming that all DNA is broken at random. In the first method we compared the theoretical and experimental fraction of DNA that is below a given size limit. By this method we estimated the yield to be 0.006-0.007 DSB/GY per million base pairs using the radiolabel and 0.004-0.008 DSB/Gy per million base pairs by fluorescence staining. The dose response was linear in both cases. In the second method we looked only at the size distribution in the resolving part of the gel and compared it to the theoretical distribution. By this method a value of approximately 0.012 DSB/Gy/Mb was found, using fluorescence as a measure of DNA distribution. In a normal diploid mammalian genome of size 60000 Mbp, this is equivalent to a yield of 25-50 DSBs/Gy or 70 DSBs/GY, respectively. The second approach, which looks only at the smaller fragments, may overestimate the yield, while the first approach suffers from uncertainties about the fraction of DNA irreversibly trapped in the well. The assay has the capacity to detect a dose of less than 1 Gy. 58 refs., 10 figs.

  15. New tools to study DNA double-strand break repair pathway choice.

    Directory of Open Access Journals (Sweden)

    Daniel Gomez-Cabello

    Full Text Available A broken DNA molecule is difficult to repair, highly mutagenic, and extremely cytotoxic. Such breaks can be repaired by homology-independent or homology-directed mechanisms. Little is known about the network that controls the repair pathway choice except that a licensing step for homology-mediated repair exists, called DNA-end resection. The choice between these two repair pathways is a key event for genomic stability maintenance, and an imbalance of the ratio is directly linked with human diseases, including cancer. Here we present novel reporters to study the balance between both repair options in human cells. In these systems, a double-strand break can be alternatively repaired by homology-independent or -dependent mechanisms, leading to the accumulation of distinct fluorescent proteins. These reporters thus allow the balance between both repair pathways to be analyzed in different experimental setups. We validated the reporters by analyzing the effect of protein downregulation of the DNA end resection and non-homologous end-joining pathways. Finally, we analyzed the role of the DNA damage response on double-strand break (DSB repair mechanism selection. Our reporters could be used in the future to understand the roles of specific factors, whole pathways, or drugs in DSB repair pathway choice, or for genome-wide screening. Moreover, our findings can be applied to increase gene-targeting efficiency, making it a beneficial tool for a broad audience in the biological sciences.

  16. The Caenorhabditis elegans homolog of Gen1/Yen1 resolvases links DNA damage signaling to DNA double-strand break repair.

    Directory of Open Access Journals (Sweden)

    Aymeric P Bailly

    2010-07-01

    Full Text Available DNA double-strand breaks (DSBs can be repaired by homologous recombination (HR, which can involve Holliday junction (HJ intermediates that are ultimately resolved by nucleolytic enzymes. An N-terminal fragment of human GEN1 has recently been shown to act as a Holliday junction resolvase, but little is known about the role of GEN-1 in vivo. Holliday junction resolution signifies the completion of DNA repair, a step that may be coupled to signaling proteins that regulate cell cycle progression in response to DNA damage. Using forward genetic approaches, we identified a Caenorhabditis elegans dual function DNA double-strand break repair and DNA damage signaling protein orthologous to the human GEN1 Holliday junction resolving enzyme. GEN-1 has biochemical activities related to the human enzyme and facilitates repair of DNA double-strand breaks, but is not essential for DNA double-strand break repair during meiotic recombination. Mutational analysis reveals that the DNA damage-signaling function of GEN-1 is separable from its role in DNA repair. GEN-1 promotes germ cell cycle arrest and apoptosis via a pathway that acts in parallel to the canonical DNA damage response pathway mediated by RPA loading, CHK1 activation, and CEP-1/p53-mediated apoptosis induction. Furthermore, GEN-1 acts redundantly with the 9-1-1 complex to ensure genome stability. Our study suggests that GEN-1 might act as a dual function Holliday junction resolvase that may coordinate DNA damage signaling with a late step in DNA double-strand break repair.

  17. Fine resolution mapping of double-strand break sites for human ribosomal DNA units

    Directory of Open Access Journals (Sweden)

    Bernard J. Pope

    2016-12-01

    Full Text Available DNA breakage arises during a variety of biological processes, including transcription, replication and genome rearrangements. In the context of disease, extensive fragmentation of DNA has been described in cancer cells and during early stages of neurodegeneration (Stephens et al., 2011 Stephens et al. (2011 [5]; Blondet et al., 2001 Blondet et al. (2001 [1]. Stults et al. (2009 Stults et al. (2009 [6] reported that human rDNA gene clusters are hotspots for recombination and that rDNA restructuring is among the most common chromosomal alterations in adult solid tumours. As such, analysis of rDNA regions is likely to have significant prognostic and predictive value, clinically. Tchurikov et al. (2015a, 2016 Tchurikov et al. (2015a, 2016 [7,9] have made major advances in this direction, reporting that sites of human genome double-strand breaks (DSBs occur frequently at sites in rDNA that are tightly linked with active transcription - the authors used a RAFT (rapid amplification of forum termini protocol that selects for blunt-ended sites. They reported the relative frequency of these rDNA DSBs within defined co-ordinate ‘windows’ of varying size and made these data (as well as the relevant ‘raw’ sequencing information available to the public (Tchurikov et al., 2015b. Assay designs targeting rDNA DSB hotspots will benefit greatly from the publication of break sites at greater resolution. Here, we re-analyse public RAFT data and make available rDNA DSB co-ordinates to the single-nucleotide level.

  18. DNA double-strand breaks activate ATM independent of mitochondrial dysfunction in A549 cells.

    Science.gov (United States)

    Kalifa, Lidza; Gewandter, Jennifer S; Staversky, Rhonda J; Sia, Elaine A; Brookes, Paul S; O'Reilly, Michael A

    2014-10-01

    Excessive nuclear or mitochondrial DNA damage can lead to mitochondrial dysfunction, decreased energy production, and increased generation of reactive oxygen species (ROS). Although numerous cell signaling pathways are activated when cells are injured, the ataxia telangiectasia mutant (ATM) protein has emerged as a major regulator of the response to both mitochondrial dysfunction and nuclear DNA double-strand breaks (DSBs). Because mitochondrial dysfunction is often a response to excessive DNA damage, it has been difficult to determine whether nuclear and/or mitochondrial DNA DSBs activate ATM independent of mitochondrial dysfunction. In this study, mitochondrial and nuclear DNA DSBs were generated in the A549 human lung adenocarcinoma cell line by infecting with retroviruses expressing the restriction endonuclease PstI fused to a mitochondrial targeting sequence (MTS) or nuclear localization sequence (NLS) and a hemagglutinin antigen epitope tag (HA). Expression of MTS-PstI-HA or NLS-PstI-HA activated the DNA damage response defined by phosphorylation of ATM, the tumor suppressor protein p53 (TP53), KRAB-associated protein (KAP)-1, and structural maintenance of chromosomes (SMC)-1. Phosphorylated ATM and SMC1 were detected in nuclear fractions, whereas phosphorylated TP53 and KAP1 were detected in both mitochondrial and nuclear fractions. PstI also enhanced expression of the cyclin-dependent kinase inhibitor p21 and inhibited cell growth. This response to DNA damage occurred in the absence of detectable mitochondrial dysfunction and excess production of ROS. These findings reveal that DNA DSBs are sufficient to activate ATM independent of mitochondrial dysfunction and suggest that the activated form of ATM and some of its substrates are restricted to the nuclear compartment, regardless of the site of DNA damage.

  19. c-Myc Suppression of DNA Double-strand Break Repair12

    Science.gov (United States)

    Li, Zhaozhong; Owonikoko, Taofeek K; Sun, Shi-Yong; Ramalingam, Suresh S; Doetsch, Paul W; Xiao, Zhi-Qiang; Khuri, Fadlo R; Curran, Walter J; Deng, Xingming

    2012-01-01

    c-Myc is a transcriptional factor that functions as a central regulator of cell growth, proliferation, and apoptosis. Overexpression of c-Myc also enhances DNA double-strand breaks (DSBs), genetic instability, and tumorigenesis. However, the mechanism(s) involved remains elusive. Here, we discovered that γ-ray ionizing radiation-induced DSBs promote c-Myc to form foci and to co-localize with γ-H2AX. Conditional expression of c-Myc in HO15.19 c-Myc null cells using the Tet-Off/Tet-On inducible system results in down-regulation of Ku DNA binding and suppressed activities of DNA-dependent protein kinase catalytic subunit (DNA-PKcs) and DNA end-joining, leading to inhibition of DSB repair and enhanced chromosomal and chromatid breaks. Expression of c-Myc reduces both signal and coding joins with decreased fidelity during V(D)J recombination. Mechanistically, c-Myc directly interacts with Ku70 protein through its Myc box II (MBII) domain. Removal of the MBII domain from c-Myc abrogates its inhibitory effects on Ku DNA binding, DNA-PKcs, and DNA end-joining activities, which results in loss of c-Myc's ability to block DSB repair and V(D)J recombination. Interestingly, c-Myc directly disrupts the Ku/DNA-PKcs complex in vitro and in vivo. Thus, c-Myc suppression of DSB repair and V(D)J recombination may occur through inhibition of the nonhomologous end-joining pathway, which provides insight into the mechanism of c-Myc in the development of tumors through promotion of genomic instability. PMID:23308051

  20. Immunogenicity and safety of trivalent inactivated influenza vaccine: a randomized, double-blind, multi-center, phase 3 clinical trial in a vaccine-limited country.

    Science.gov (United States)

    Song, Joon Young; Cheong, Hee Jin; Woo, Heung Jeong; Wie, Seong-Heon; Lee, Jin-Soo; Chung, Moon-Hyun; Kim, Yang Ree; Jung, Sook In; Park, Kyung-Hwa; Kim, Tae Hyong; Uh, Soo-Taek; Kim, Woo Joo

    2011-02-01

    Influenza vaccines are the primary method for controlling influenza and its complications. This study was conducted as a phase 3, randomized, double-blind, controlled, multi-center trial at seven university hospitals to evaluate the immunogenicity and safety of an inactivated, split, trivalent influenza vaccine (GC501, Green Cross Corporation, Yongin, Korea), which was newly manufactured in Korea in 2008. Between September 21 and 26, a total of 329 healthy subjects were recruited for the immunogenicity analysis, while 976 subjects were enrolled for the safety analysis. The GC501 vaccine met both FDA and EMEA criteria with ≥ 80% of subjects achieving post-vaccination titers ≥ 40 for all three subtypes, even in the elderly. The vaccine was well tolerated with only mild systemic and local adverse events. In summary, GC501 showed excellent immunogenicity and a good safety profile in both young adults and the elderly. The licensure of GC501 might be an important basis in preparation for the future influenza pandemic.

  1. Writers, Readers, and Erasers of Histone Ubiquitylation in DNA Double-Strand Break Repair

    DEFF Research Database (Denmark)

    Smeenk, Godelieve; Mailand, Niels

    2016-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions, whose faulty repair may alter the content and organization of cellular genomes. To counteract this threat, numerous signaling and repair proteins are recruited hierarchically to the chromatin areas surrounding DSBs to facilitate...... accurate lesion repair and restoration of genome integrity. In vertebrate cells, ubiquitin-dependent modifications of histones adjacent to DSBs by RNF8, RNF168, and other ubiquitin ligases have a key role in promoting the assembly of repair protein complexes, serving as direct recruitment platforms...... for a range of genome caretaker proteins and their associated factors. These DNA damage-induced chromatin ubiquitylation marks provide an essential component of a histone code for DSB repair that is controlled by multifaceted regulatory circuits, underscoring its importance for genome stability maintenance...

  2. γ-H2AX as a biomarker for DNA double-strand breaks in ecotoxicology.

    Science.gov (United States)

    Gerić, Marko; Gajski, Goran; Garaj-Vrhovac, Vera

    2014-07-01

    The visualisation of DNA damage response proteins enables the indirect measurement of DNA damage. Soon after the occurrence of a DNA double-strand break (DSB), the formation of γ-H2AX histone variants is to be expected. This review is focused on the potential use of the γ-H2AX foci assay in assessing the genotoxicity of environmental contaminants including cytostatic pharmaceuticals, since standard methods may not be sensitive enough to detect the damaging effect of low environmental concentrations of such drugs. These compounds are constantly released into the environment, potentially representing a threat to water quality, aquatic organisms, and, ultimately, human health. Our review of the literature revealed that this method could be used in the biomonitoring and risk assessment of aquatic systems affected by wastewater from the production, usage, and disposal of cytostatic pharmaceuticals. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Maintenance of genome stability in plants: repairing DNA double strand breaks and chromatin structure stability

    Directory of Open Access Journals (Sweden)

    Sujit eRoy

    2014-09-01

    Full Text Available Plant cells are subject to high levels of DNA damage resulting from plant’s obligatory dependence on sunlight and the associated exposure to environmental stresses like solar UV radiation, high soil salinity, drought, chilling injury and other air and soil pollutants including heavy metals and metabolic byproducts from endogenous processes. The irreversible DNA damages, generated by the environmental and genotoxic stresses affect plant growth and development, reproduction and crop productivity. Thus, for maintaining genome stability, plants have developed an extensive array of mechanisms for the detection and repair of DNA damages. This review will focus recent advances in our understanding of mechanisms regulating plant genome stability in the context of repairing of double stand breaks and chromatin structure maintenance.

  4. Twist-Bend Coupling and the Torsional Response of Double-Stranded DNA

    Science.gov (United States)

    Nomidis, Stefanos K.; Kriegel, Franziska; Vanderlinden, Willem; Lipfert, Jan; Carlon, Enrico

    2017-05-01

    Recent magnetic tweezers experiments have reported systematic deviations of the twist response of double-stranded DNA from the predictions of the twistable wormlike chain model. Here we show, by means of analytical results and computer simulations, that these discrepancies can be resolved if a coupling between twist and bend is introduced. We obtain an estimate of 40 ±10 nm for the twist-bend coupling constant. Our simulations are in good agreement with high-resolution, magnetic-tweezers torque data. Although the existence of twist-bend coupling was predicted long ago [J. Marko and E. Siggia, Macromolecules 27, 981 (1994), 10.1021/ma00082a015], its effects on the mechanical properties of DNA have been so far largely unexplored. We expect that this coupling plays an important role in several aspects of DNA statics and dynamics.

  5. Double nanohole optical tweezers visualize protein p53 suppressing unzipping of single DNA-hairpins.

    Science.gov (United States)

    Kotnala, Abhay; Gordon, Reuven

    2014-06-01

    Here we report on the use of double-nanohole (DNH) optical tweezers as a label-free and free-solution single-molecule probe for protein-DNA interactions. Using this approach, we demonstrate the unzipping of individual 10 base pair DNA-hairpins, and quantify how tumor suppressor p53 protein delays the unzipping. From the Arrhenius behavior, we find the energy barrier to unzipping introduced by p53 to be 2 × 10(-20) J, whereas cys135ser mutant p53 does not show suppression of unzipping, which gives clues to its functional inability to suppress tumor growth. This transformative approach to single molecule analysis allows for ultra-sensitive detection and quantification of protein-DNA interactions to revolutionize the fight against genetic diseases.

  6. Study on the adsorption of DNA on the layered double hydroxides (LDHs)

    Science.gov (United States)

    Li, Bin; Wu, Pingxiao; Ruan, Bo; Liu, Paiyu; Zhu, Nengwu

    2014-03-01

    Four kinds of layered double hydroxides (LDHs) were prepared by chemical coprecipitation method and used as DNA adsorbents. Multiple characterization tools such as power X-ray diffraction (XRD), Fourier transform infrared (FTIR) spectroscopy and Standard electronic modules (SEM) were employed to characterize the LDHs. By examining the effect of initial concentration, solution pH, adsorption experiments were carried out to investigate the adsorption capacities of LDHs for DNA. The results revealed that the LDHs with Mg/Al = 3 had higher ability on adsorbing the DNA and were not affected by pH values. The LDHs exhibited excellent adsorption properties and completely adsorbed DNA within 2 h. The adsorption equilibrium data were fitted to the Langmuir and Freundlich models, showing that the Langmuir model which represented monolayer adsorption had better correlation with the adsorption linear equation. In addition, Circular dichroism (CD) spectrum, UV-vis spectorscopy and agarose gel electrophoresis revealed the integrity of DNA structure, suggesting that there had no damage on the DNA structure during the adsorption process.

  7. The conformation of double-stranded DNA inside bacteriophages depends on capsid size and shape.

    Science.gov (United States)

    Petrov, Anton S; Boz, Mustafa Burak; Harvey, Stephen C

    2007-11-01

    The packaging of double-stranded DNA into bacteriophages leads to the arrangement of the genetic material into highly-packed and ordered structures. Although modern experimental techniques reveal the most probable location of DNA inside viral capsids, the individual conformations of DNA are yet to be determined. In the current study we present the results of molecular dynamics simulations of the DNA packaging into several bacteriophages performed within the framework of a coarse-grained model. The final DNA conformations depend on the size and shape of the capsid, as well as the size of the protein portal, if any. In particular, isometric capsids with small or absent portals tend to form concentric spools, whereas the presence of a large portal favors coaxial spooling; slightly and highly elongated capsids result in folded and twisted toroidal conformations, respectively. The results of the simulations also suggest that the predominant factor in defining the global DNA arrangement inside bacteriophages is the minimization of the bending stress upon packaging.

  8. The role of DNA double-strand breaks in spontaneous homologous recombination in S. cerevisiae.

    Directory of Open Access Journals (Sweden)

    Gaëlle Lettier

    2006-11-01

    Full Text Available Homologous recombination (HR is a source of genomic instability and the loss of heterozygosity in mitotic cells. Since these events pose a severe health risk, it is important to understand the molecular events that cause spontaneous HR. In eukaryotes, high levels of HR are a normal feature of meiosis and result from the induction of a large number of DNA double-strand breaks (DSBs. By analogy, it is generally believed that the rare spontaneous mitotic HR events are due to repair of DNA DSBs that accidentally occur during mitotic growth. Here we provide the first direct evidence that most spontaneous mitotic HR in Saccharomyces cerevisiae is initiated by DNA lesions other than DSBs. Specifically, we describe a class of rad52 mutants that are fully proficient in inter- and intra-chromosomal mitotic HR, yet at the same time fail to repair DNA DSBs. The conclusions are drawn from genetic analyses, evaluation of the consequences of DSB repair failure at the DNA level, and examination of the cellular re-localization of Rad51 and mutant Rad52 proteins after introduction of specific DSBs. In further support of our conclusions, we show that, as in wild-type strains, UV-irradiation induces HR in these rad52 mutants, supporting the view that DNA nicks and single-stranded gaps, rather than DSBs, are major sources of spontaneous HR in mitotic yeast cells.

  9. G-quadruplex and i-motif are mutually exclusive in ILPR double-stranded DNA.

    Science.gov (United States)

    Dhakal, Soma; Yu, Zhongbo; Konik, Ryan; Cui, Yunxi; Koirala, Deepak; Mao, Hanbin

    2012-06-06

    G-quadruplex has demonstrated its biological functions in vivo. Although G-quadruplex in single-stranded DNA (ssDNA) has been well characterized, investigation of this species in double-stranded DNA (dsDNA) lags behind. Here we use chemical footprinting and laser-tweezers-based single-molecule approaches to demonstrate that a dsDNA fragment found in the insulin-linked polymorphic region (ILPR), 5'-(ACA GGGG TGT GGGG)2 TGT, can fold into a G-quadruplex at pH 7.4 with 100 mM K+, and an i-motif at pH 5.5 with 100 mM Li+. Surprisingly, under a condition that favors the formation of both G-quadruplex and i-motif (pH 5.5, 100 mM K+), a unique determination of change in the free energy of unfolding (ΔGunfold) by laser-tweezers experiments provides compelling evidence that only one species is present in each dsDNA. Under this condition, molecules containing G-quadruplex are more stable than those with i-motif. These two species have mechanical stabilities (rupture force≥17 pN) comparable to the stall force of RNA polymerases, which, from a mechanical perspective alone, could justify a regulatory mechanism for tetraplex structures in the expression of human insulin. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  10. Production of anti-double-stranded DNA antibodies in activated lymphocyte derived DNA induced lupus model was dependent on CD4+ T cells.

    Science.gov (United States)

    Wen, Z; Xu, L; Xu, W; Xiong, S

    2012-04-01

    Our previous study demonstrated that activated lymphocyte derived DNA (ALD-DNA) could function as an autoantigen to induce production of anti-double-stranded DNA (anti-dsDNA) antibodies in syngeneic BALB/c mice. Here we carefully evaluated the potential role of T cells in the induction of anti-dsDNA antibody. We demonstrated that ALD-DNA could effectively induce production of anti-dsDNA antibodies in vivo and in vitro. In contrast, ALD-DNA could not induce the generation of anti-dsDNA antibodies in nude mice. We further showed that in vivo depletion of CD3(+) T cells blocked the induction of anti-dsDNA antibodies in BALB/c mice. Notably, we demonstrated that CD4(+) but not CD8(+) T cells conferred ALD-DNA to induce anti-dsDNA antibodies. Finally, we demonstrated that adoptive transfer of CD4(+) T cells could rescue ALD-DNA induced anti-dsDNA antibodies in nude mice. Our results suggested that T helper cells were required for ALD-DNA to induce anti-dsDNA antibodies. These findings could further our understanding about the immunogenic properties of DNA and throw new light on SLE pathogenesis.

  11. In vivo expression of a single viral DNA-binding protein generates systemic lupus erythematosus-related autoimmunity to double-stranded DNA and histones.

    Science.gov (United States)

    Moens, U; Seternes, O M; Hey, A W; Silsand, Y; Traavik, T; Johansen, B; Rekvig, O P

    1995-01-01

    Although the origin of autoimmune antibodies to double-stranded DNA is not known, the variable-region structures of such antibodies indicate that they are produced in response to antigen-selective stimulation. In accordance with this, results from experiments using artificial complexes of DNA and DNA-binding polypeptides for immunizations have indicated that DNA may induce these antibodies. Hence, the immunogenicity of DNA in vivo may depend upon other structures or processes that may render DNA immunogenic. We report that in vivo expression of a single DNA-binding protein, the polyoma virus T antigen, is sufficient to initiate production of anti-double-stranded DNA and anti-histone antibodies but not a panel of other autoantigens. Expression of a mutant, non-DNA-binding T antigen did result in strong production of antibodies to the T antigen, but only borderline levels of antibodies to DNA and no detectable antibodies to histones. Nonexpressing plasmid DNA containing the complete cDNA sequence for T antigen did not evoke such immune responses, indicating that DNA by itself is not immunogenic in vivo. The results represent a conceptual advance in understanding a potential molecular basis for initiation of autoimmunity in systemic lupus erythematosus. PMID:8618908

  12. Evolution of DNA polymerases: an inactivated polymerase-exonuclease module in Pol ε and a chimeric origin of eukaryotic polymerases from two classes of archaeal ancestors

    Directory of Open Access Journals (Sweden)

    Pavlov Youri I

    2009-03-01

    Full Text Available Abstract Background Evolution of DNA polymerases, the key enzymes of DNA replication and repair, is central to any reconstruction of the history of cellular life. However, the details of the evolutionary relationships between DNA polymerases of archaea and eukaryotes remain unresolved. Results We performed a comparative analysis of archaeal, eukaryotic, and bacterial B-family DNA polymerases, which are the main replicative polymerases in archaea and eukaryotes, combined with an analysis of domain architectures. Surprisingly, we found that eukaryotic Polymerase ε consists of two tandem exonuclease-polymerase modules, the active N-terminal module and a C-terminal module in which both enzymatic domains are inactivated. The two modules are only distantly related to each other, an observation that suggests the possibility that Pol ε evolved as a result of insertion and subsequent inactivation of a distinct polymerase, possibly, of bacterial descent, upstream of the C-terminal Zn-fingers, rather than by tandem duplication. The presence of an inactivated exonuclease-polymerase module in Pol ε parallels a similar inactivation of both enzymatic domains in a distinct family of archaeal B-family polymerases. The results of phylogenetic analysis indicate that eukaryotic B-family polymerases, most likely, originate from two distantly related archaeal B-family polymerases, one form giving rise to Pol ε, and the other one to the common ancestor of Pol α, Pol δ, and Pol ζ. The C-terminal Zn-fingers that are present in all eukaryotic B-family polymerases, unexpectedly, are homologous to the Zn-finger of archaeal D-family DNA polymerases that are otherwise unrelated to the B family. The Zn-finger of Polε shows a markedly greater similarity to the counterpart in archaeal PolD than the Zn-fingers of other eukaryotic B-family polymerases. Conclusion Evolution of eukaryotic DNA polymerases seems to have involved previously unnoticed complex events. We

  13. Evolution of DNA polymerases: an inactivated polymerase-exonuclease module in Pol ε and a chimeric origin of eukaryotic polymerases from two classes of archaeal ancestors

    Science.gov (United States)

    Tahirov, Tahir H; Makarova, Kira S; Rogozin, Igor B; Pavlov, Youri I; Koonin, Eugene V

    2009-01-01

    Background Evolution of DNA polymerases, the key enzymes of DNA replication and repair, is central to any reconstruction of the history of cellular life. However, the details of the evolutionary relationships between DNA polymerases of archaea and eukaryotes remain unresolved. Results We performed a comparative analysis of archaeal, eukaryotic, and bacterial B-family DNA polymerases, which are the main replicative polymerases in archaea and eukaryotes, combined with an analysis of domain architectures. Surprisingly, we found that eukaryotic Polymerase ε consists of two tandem exonuclease-polymerase modules, the active N-terminal module and a C-terminal module in which both enzymatic domains are inactivated. The two modules are only distantly related to each other, an observation that suggests the possibility that Pol ε evolved as a result of insertion and subsequent inactivation of a distinct polymerase, possibly, of bacterial descent, upstream of the C-terminal Zn-fingers, rather than by tandem duplication. The presence of an inactivated exonuclease-polymerase module in Pol ε parallels a similar inactivation of both enzymatic domains in a distinct family of archaeal B-family polymerases. The results of phylogenetic analysis indicate that eukaryotic B-family polymerases, most likely, originate from two distantly related archaeal B-family polymerases, one form giving rise to Pol ε, and the other one to the common ancestor of Pol α, Pol δ, and Pol ζ. The C-terminal Zn-fingers that are present in all eukaryotic B-family polymerases, unexpectedly, are homologous to the Zn-finger of archaeal D-family DNA polymerases that are otherwise unrelated to the B family. The Zn-finger of Polε shows a markedly greater similarity to the counterpart in archaeal PolD than the Zn-fingers of other eukaryotic B-family polymerases. Conclusion Evolution of eukaryotic DNA polymerases seems to have involved previously unnoticed complex events. We hypothesize that the archaeal

  14. Superior protection conferred by inactivated whole virus vaccine over subunit and DNA vaccines against salmonid alphavirus infection in Atlantic salmon (Salmo salar L.).

    Science.gov (United States)

    Xu, Cheng; Mutoloki, Stephen; Evensen, Øystein

    2012-06-06

    Salmonid alphavirus 3 (SAV-3) is an emerging pathogen in Norwegian salmon farming and causes severe annual losses. We studied the immunogenicity and protective ability of subunit and DNA vaccines based on E1 and E2 spike proteins of salmonid alphavirus subtype 3 (SAV-3), and compared these to an experimental inactivated, whole virus (IWV) vaccine in Atlantic salmon. The antigens were delivered as water-in-oil emulsions for the subunit and inactivated vaccines and non-formulated for the DNA vaccines. The IWV and the E2 subunit prime-boost groups had circulating neutralizing antibodies at challenge, correlating with high protection against lethal challenge and 3-log(10) reduction of virus titer in heart for the IWV group. Prime-boost with E1 subunit vaccine also conferred significant protection against mortality, but did not correlate with neutralizing antibody levels. Protection against pathology in internal organs was only seen for the IWV group. Prime-boost with E1 and E2 DNA vaccines showed marginal protection in terms of reduction of viral replication in target organs and protection against mortality was not different from controls. The IWV group showed significant upregulation of IFNγ and IL2 mRNA expression at 4 weeks post challenge possibly indicating that other mechanisms in addition to antibody responses play a role in mediating protection against infection. This is the first report comparing the immunogenicity and protection against mortality for IWV vaccines and spike protein subunit and DNA vaccines against salmonid alphavirus infection in Atlantic salmon. The IWV vaccine has superior immunogenicity over sub-unit and DNA vaccines.

  15. Processing of 3'-Phosphoglycolate-Terminated DNA Double-StrandBreaks by Artemis Nuclease

    Energy Technology Data Exchange (ETDEWEB)

    Povrik, Lawrence F.; Zhou, Tong; Zhou, Ruizhe; Cowan, Morton J.; Yannone, Steven M.

    2005-10-01

    The Artemis nuclease is required for V(D)J recombination and for repair of an as yet undefined subset of radiation-induced DNA double-strand breaks. To assess the possibility that Artemis functions on oxidatively modified double-strand break termini, its activity toward model DNA substrates, bearing either 3{prime}-hydroxyl or 3{prime}-phosphoglycolate moieties, was examined. A 3{prime}-phosphoglycolate had little effect on Artemis-mediated trimming of long 3{prime} overhangs (>9 nucleotides), which were efficiently trimmed to 4-5 nucleotides. However, 3{prime}-phosphoglycolates on overhangs of 4-5 bases promoted selective Artemis-mediated trimming of a single 3{prime}-terminal nucleotide, while at least 2 nucleotides were trimmed from identical hydroxyl-terminated substrates. Artemis also efficiently removed a single nucleotide from a phosphoglycolate-terminated 3-base 3{prime} overhang, while leaving an analogous hydroxyl-terminated overhang largely intact. Such removal was dependent upon Ku, DNA-dependent protein kinase, and ATP. Together, these data suggest that Artemis-mediated cleavage of 3{prime} overhangs requires a minimum of 2 nucleotides, or a nucleotide plus a phosphoglycolate, 3{prime} to the cleavage site. Shorter 3{prime}-phosphoglycolate-terminated overhangs and blunt ends were also processed by Artemis, but much less efficiently. Consistent with the in vitro substrate specificity of Artemis, human cells lacking Artemis exhibited hypersensitivity to X-rays, bleomycin and neocarzinostatin, which all induce 3{prime}-phosphoglycolate-terminated double-strand breaks. Collectively, these results suggest that 3{prime}-phosphoglycolate termini and/or specific classes of DNA ends that arise from such blocked termini are relevant Artemis substrates in vivo.

  16. Concomitant inactivation of the p53- and pRB- functional pathways predicts resistance to DNA damaging drugs in breast cancer in vivo.

    Science.gov (United States)

    Knappskog, Stian; Berge, Elisabet O; Chrisanthar, Ranjan; Geisler, Stephanie; Staalesen, Vidar; Leirvaag, Beryl; Yndestad, Synnøve; de Faveri, Elise; Karlsen, Bård O; Wedge, David C; Akslen, Lars A; Lilleng, Peer K; Løkkevik, Erik; Lundgren, Steinar; Østenstad, Bjørn; Risberg, Terje; Mjaaland, Ingvild; Aas, Turid; Lønning, Per E

    2015-10-01

    Chemoresistance is the main obstacle to cancer cure. Contrasting studies focusing on single gene mutations, we hypothesize chemoresistance to be due to inactivation of key pathways affecting cellular mechanisms such as apoptosis, senescence, or DNA repair. In support of this hypothesis, we have previously shown inactivation of either TP53 or its key activators CHK2 and ATM to predict resistance to DNA damaging drugs in breast cancer better than TP53 mutations alone. Further, we hypothesized that redundant pathway(s) may compensate for loss of p53-pathway signaling and that these are inactivated as well in resistant tumour cells. Here, we assessed genetic alterations of the retinoblastoma gene (RB1) and its key regulators: Cyclin D and E as well as their inhibitors p16 and p27. In an exploratory cohort of 69 patients selected from two prospective studies treated with either doxorubicin monotherapy or 5-FU and mitomycin for locally advanced breast cancers, we found defects in the pRB-pathway to be associated with therapy resistance (p-values ranging from 0.001 to 0.094, depending on the cut-off value applied to p27 expression levels). Although statistically weaker, we observed confirmatory associations in a validation cohort from another prospective study (n = 107 patients treated with neoadjuvant epirubicin monotherapy; p-values ranging from 7.0 × 10(-4) to 0.001 in the combined data sets). Importantly, inactivation of the p53-and the pRB-pathways in concert predicted resistance to therapy more strongly than each of the two pathways assessed individually (exploratory cohort: p-values ranging from 3.9 × 10(-6) to 7.5 × 10(-3) depending on cut-off values applied to ATM and p27 mRNA expression levels). Again, similar findings were confirmed in the validation cohort, with p-values ranging from 6.0 × 10(-7) to 6.5 × 10(-5) in the combined data sets. Our findings strongly indicate that concomitant inactivation of the p53- and pRB- pathways predict

  17. Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Nigel C. Brissett

    2013-11-01

    Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

  18. Electrochemical Study on the Interaction of Irinotecan with Calf Thymus Double Stranded DNA

    Institute of Scientific and Technical Information of China (English)

    Hajian, Reza; Huat, Tan Guan

    2012-01-01

    Voltammetric behavior of Irinotecan (CPT-11) was studied in a phosphate buffer (0.002 mol.L^-1, pH 7.5) solution at the hanging mercury drop electrode (HMDE) using cyclic voltammetry (CV). CPT-11 showed two irreversible cathodic peaks at - 1.01 V and - 1.09 V which involved two electrons and two protons in each reduction step. In addition, the interaction of Irinotecan with double-stranded calf thymus DNA (ds-DNA) was studied by CV at the HMDE employing an irreversible electrochemical equation. As a result of the reaction with ds-DNA, the reduc- tion peaks related to CPT-11 were shifted in a negative direction and the peak currents were decreased. The diffu- sion coefficients of CPT- 11 in the absence (Dr) and presence (Db) of ds-DNA were calculated as 2.8 ×10 5 cm2.s^- 1 and 1.6 × 10^-5 cm2·s^-1 respectively. The binding constant (K=1.0×10^4 L·mol^-1), and binding site size (s=0.60) of CPT-11 interacting with ds-DNA were obtained simultaneously by non-linear fit analysis. The results demon strate that the main interaction mode of CPT-11 with ds-DNA is electrostatic.

  19. Sp1 facilitates DNA double-strand break repair through a nontranscriptional mechanism.

    Science.gov (United States)

    Beishline, Kate; Kelly, Crystal M; Olofsson, Beatrix A; Koduri, Sravanthi; Emrich, Jacqueline; Greenberg, Roger A; Azizkhan-Clifford, Jane

    2012-09-01

    Sp1 is a ubiquitously expressed transcription factor that is phosphorylated by ataxia telangiectasia mutated kinase (ATM) in response to ionizing radiation and H(2)O(2). Here, we show by indirect immunofluorescence that Sp1 phosphorylated on serine 101 (pSp1) localizes to ionizing radiation-induced foci with phosphorylated histone variant γH2Ax and members of the MRN (Mre11, Rad50, and Nbs1) complex. More precise analysis of occupancy of DNA double-strand breaks (DSBs) by chromatin immunoprecipitation (ChIP) shows that Sp1, like Nbs1, resides within 200 bp of DSBs. Using laser microirradiation of cells, we demonstrate that pSp1 is present at DNA DSBs by 7.5 min after induction of damage and remains at the break site for at least 8 h. Depletion of Sp1 inhibits repair of site-specific DNA breaks, and the N-terminal 182-amino-acid peptide, which contains targets of ATM kinase but lacks the zinc finger DNA binding domain, is phosphorylated, localizes to DSBs, and rescues the repair defect resulting from Sp1 depletion. Together, these data demonstrate that Sp1 is rapidly recruited to the region immediately adjacent to sites of DNA DSBs and is required for DSB repair, through a mechanism independent of its sequence-directed transcriptional effects.

  20. Thermodynamics for the Formation of Double-Stranded DNA-Single-Walled Carbon Nanotube Hybrids.

    Science.gov (United States)

    Shiraki, Tomohiro; Tsuzuki, Akiko; Toshimitsu, Fumiyuki; Nakashima, Naotoshi

    2016-03-24

    For the first time, the thermodynamics are described for the formation of double-stranded DNA (ds-DNA)-single-walled carbon nanotube (SWNT) hybrids. This treatment is applied to the exchange reaction of sodium cholate (SC) molecules on SWNTs and the ds-DNAs d(A)20 -d(T)20 and nuclear factor (NF)-κB decoy. UV/Vis/near-IR spectroscopy with temperature variations was used for analyzing the exchange reaction on the SWNTs with four different chiralities: (n,m)=(8,3), (6,5), (7,5), and (8,6). Single-stranded DNAs (ss-DNAs), including d(A)20 and d(T)20, are also used for comparison. The d(A)20-d(T)20 shows a drastic change in its thermodynamic parameters around the melting temperature (Tm ) of the DNA oligomer. No such Tm dependency was measured, owing to high Tm in the NF-κB decoy DNA and no Tm in the ss-DNA.

  1. TRF2 is required for repair of nontelomeric DNA double-strand breaks by homologous recombination

    Science.gov (United States)

    Mao, Zhiyong; Seluanov, Andrei; Jiang, Ying; Gorbunova, Vera

    2007-01-01

    TRF2 (telomeric repeat binding factor 2) is an essential component of the telomeric cap, where it forms and stabilizes the T-loop junctions. TRF2 forms the T-loops by stimulating strand invasion of the 3′ overhang into duplex DNA. TRF2 also has been shown to localize to nontelomeric DNA double-strand breaks, but its functional role in DNA repair has not been examined. Here, we present evidence that TRF2 is involved in homologous recombination (HR) repair of nontelomeric double-strand breaks. Depletion of TRF2 strongly inhibited HR and delayed the formation of Rad51 foci after γ-irradiation, whereas overexpression of TRF2 stimulated HR. Depletion of TRF2 had no effect on nonhomologous end-joining, and overexpression of TRF2 inhibited nonhomologous end-joining. We propose, based on our results and on the ability of TRF2 to mediate strand invasion, that TRF2 plays an essential role in HR by facilitating the formation of early recombination intermediates. PMID:17670947

  2. Effect of pH and Salt on Adsorption of Double-Stranded DNA on Graphene Oxide.

    Science.gov (United States)

    Kim, Seyeon; Park, Chanoong; Gang, Jongback

    2015-10-01

    Graphene oxide (GO) has a large surface-to-volume ratio and hydrophobic hexagonal rings that can interact with biomolecules. Single-stranded DNA adsorbs strongly to the surface of GO via hydrophobic interactions. GO has been used in optical biosensors and biomedical platforms for the detection of DNA, proteins, and small molecules. This study was designed to measure the adsorption of double-stranded DNA (dsDNA) onto GO according to DNA length, salt concentration, and pH of the reaction. Results showed that dsDNA molecules were adsorbed progressively as the pH changed from 6.0 to 4.0. At high pH, dsDNA adsorption was enhanced by the presence of MgCl2 rather than NaCl. Desorption of DNA from GO, with triton X-100 led to the rapid release of DNA from GO in the presence of MgCl2.

  3. CpG DNA assists the whole inactivated H9N2 influenza virus in crossing the intestinal epithelial barriers via transepithelial uptake of dendritic cell dendrites.

    Science.gov (United States)

    Yin, Y; Qin, T; Wang, X; Lin, J; Yu, Q; Yang, Q

    2015-07-01

    Intestinal mucosa remains a pivotal barrier for the oral vaccine absorption of H9N2 whole inactivated influenza virus (WIV). However, CpG DNA, as an adjuvant, can effectively improve relevant mucosal and systemic immunity. The downstream mechanism is well confirmed, yet the evidence of CpG DNA assisting H9N2 WIV in transepithelial delivery is lacking. Here, we reported both in vitro and in vivo that CpG DNA combined with H9N2 WIV was capable of recruiting additional dendritic cells (DCs) to the intestinal epithelial cells (ECs) to form transepithelial dendrites (TEDs) for luminal viral uptake. Both CD103(+) and CD103(-) DCs participated in this process. The engagement of the chemokine CCL20 from the apical ECs and the DCs drove DC recruitment and TED formation. Virus-loaded CD103(+) but not CD103(-) DCs also quickly migrated into mesenteric lymph nodes within 2 h. Moreover, the mechanism of CpG DNA was independent of epithelial transcytosis and disruption of the epithelial barriers. Finally, the subsequent phenotypic and functional maturation of DCs was also enhanced. Our findings indicated that CpG DNA improved the delivery of H9N2 WIV via TEDs of intestinal DCs, and this may be an important mechanism for downstream effective antigen-specific immune responses.

  4. Angular distributions in the double ionization of DNA bases by electron impact

    Science.gov (United States)

    Khelladi, M. F.; Mansouri, A.; Dal Cappello, C.; Charpentier, I.; Hervieux, P. A.; Ruiz-Lopez, M. F.; Roy, A. C.

    2016-11-01

    Ab initio calculations of the five-fold differential cross sections for electron-impact double ionization of thymine, cytosine, adenine and guanine are performed in the first Born approximation for an incident energy close to 5500 eV. The wavefunctions of the DNA bases are constructed using the multi-center wave functions from the Gaussian 03 program. These multi-center wave functions are converted into single-center expansions of Slater-type functions. For the final state, the two ejected electrons are described by two Coulomb wave functions. The electron-electron repulsion between the two ejected electrons is also taken into account. Mechanisms of the double ionization are discussed for each case and the best choices of the kinematical parameters are determined for next experiments.

  5. The structure-specific endonuclease Mus81-Eme1 promotes conversion of interstrand DNA crosslinks into double-strands breaks

    NARCIS (Netherlands)

    K. Hanada (Katsuhiro); M. Budzowska (Magdalena); M. Modesti (Mauro); A. Maas (Alex); C. Wyman (Claire); J. Essers (Jeroen); R. Kanaar (Roland)

    2006-01-01

    textabstractRepair of interstrand crosslinks (ICLs) requires multiple-strand incisions to separate the two covalently attached strands of DNA. It is unclear how these incisions are generated. DNA double-strand breaks (DSBs) have been identified as intermediates in ICL repair, but enzymes responsible

  6. Detection and repair of ionizing radiation induced DNA double strand breaks: new developments in non-homologous end joining

    OpenAIRE

    Wang, Chen; Lees-Miller, Susan P.

    2013-01-01

    DNA double-strand breaks (DSBs) are considered the most cytotoxic form of DNA damage. In human cells, the major pathway for the repair of ionizing radiation (IR)-induced DSBs is non-homologous end joining (NHEJ). Here we discuss recent developments in our understanding of the mechanism of NHEJ, the proteins involved and its regulation.

  7. Inactivation of enveloped virus by laser-driven protein aggregation.

    Science.gov (United States)

    Tsen, Shaw-Wei D; Chapa, Travis; Beatty, Wandy; Tsen, Kong-Thon; Yu, Dong; Achilefu, Samuel

    2012-12-01

    Ultrafast lasers in the visible and near-infrared range have emerged as a potential new method for pathogen reduction of blood products and pharmaceuticals. However, the mechanism of enveloped virus inactivation by this method is unknown. We report the inactivation as well as the molecular and structural effects caused by visible (425 nm) femtosecond laser irradiation on murine cytomegalovirus (MCMV), an enveloped, double-stranded DNA virus. Our results show that laser irradiation (1) caused a 5-log reduction in MCMV titer, (2) did not cause significant changes to the global structure of MCMV virions including membrane and capsid, as assessed by electron microscopy, (3) produced no evidence of double-strand breaks or crosslinking in MCMV genomic DNA, and (4) caused selective aggregation of viral capsid and tegument proteins. We propose a model in which ultrafast laser irradiation induces partial unfolding of viral proteins by disrupting hydrogen bonds and/or hydrophobic interactions, leading to aggregation of closely associated viral proteins and inactivation of the virus. These results provide new insight into the inactivation of enveloped viruses by visible femtosecond lasers at the molecular level, and help pave the way for the development of a new ultrafast laser technology for pathogen reduction.

  8. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  9. DNA double strand break repair, chromosome synapsis and transcriptional silencing in meiosis.

    Science.gov (United States)

    Inagaki, Akiko; Schoenmakers, Sam; Baarends, Willy M

    2010-05-16

    Chromosome pairing and synapsis during meiotic prophase requires the formation and repair of DNA double-strand breaks (DSBs) by the topoisomerase-like enzyme SPO11. Chromosomes, or chromosomal regions, that lack a pairing partner, such as the largely heterologous X and Y chromosomes, show delayed meiotic DSB repair and are transcriptionally silenced. Herein, we review meiosis-specific aspects of DSB repair in relation to homology recognition and meiotic silencing of heterologous regions. We propose a dynamic interplay between progression of synapsis and persistent meiotic DSBs. Signaling from these persistent breaks could inhibit heterologous synapsis and stimulate meiotic silencing of the X and Y chromosomes.

  10. Ago2 facilitates Rad51 recruitment and DNA double-strand break repair by homologous recombination

    DEFF Research Database (Denmark)

    Gao, Min; Wei, Wei; Li, Ming Hua

    2014-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic lesions and pose a major threat to genome stability if not properly repaired. We and others have previously shown that a class of DSB-induced small RNAs (diRNAs) is produced from sequences around DSB sites. DiRNAs are associated with Argonaute...... (Ago) proteins and play an important role in DSB repair, though the mechanism through which they act remains unclear. Here, we report that the role of diRNAs in DSB repair is restricted to repair by homologous recombination (HR) and that it specifically relies on the effector protein Ago2 in mammalian...

  11. Tracking of Single Quantum Dot Labeled EcoRV Sliding along DNA Manipulated by Double Optical Tweezers

    OpenAIRE

    Biebricher, Andreas; Wende, Wolfgang; Escudé, Christophe; Pingoud, Alfred; Desbiolles, Pierre

    2009-01-01

    Fluorescence microscopy provides a powerful method to directly observe single enzymes moving along a DNA held in an extended conformation. In this work, we present results from single EcoRV enzymes labeled with quantum dots which interact with DNA manipulated by double optical tweezers. The application of quantum dots facilitated accurate enzyme tracking without photobleaching whereas the tweezers allowed us to precisely control the DNA extension. The labeling did not affect the biochemical a...

  12. The involvement of human RECQL4 in DNA double-strand break repair

    DEFF Research Database (Denmark)

    Singh, Dharmendra Kumar; Karmakar, Parimal; Aamann, Maria Diget

    2010-01-01

    Rothmund-Thomson syndrome (RTS) is an autosomal recessive hereditary disorder associated with mutation in RECQL4 gene, a member of the human RecQ helicases. The disease is characterized by genomic instability, skeletal abnormalities and predisposition to malignant tumors, especially osteosarcomas....... The precise role of RECQL4 in cellular pathways is largely unknown; however, recent evidence suggests its involvement in multiple DNA metabolic pathways. This study investigates the roles of RECQL4 in DNA double-strand break (DSB) repair. The results show that RECQL4-deficient fibroblasts are moderately...... sensitive to gamma-irradiation and accumulate more gammaH2AX and 53BP1 foci than control fibroblasts. This is suggestive of defects in efficient repair of DSB's in the RECQL4-deficient fibroblasts. Real time imaging of live cells using laser confocal microscopy shows that RECQL4 is recruited early to laser...

  13. SCAI promotes DNA double-strand break repair in distinct chromosomal contexts

    DEFF Research Database (Denmark)

    Hansen, Rebecca Kring; Mund, Andreas; Poulsen, Sara Lund;

    2016-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions, whose accurate repair by non-homologous end-joining (NHEJ) or homologous recombination (HR) is crucial for genome integrity and is strongly influenced by the local chromatin environment. Here, we identify SCAI (suppressor of cancer...... cell invasion) as a 53BP1-interacting chromatin-associated protein that promotes the functionality of several DSB repair pathways in mammalian cells. SCAI undergoes prominent enrichment at DSB sites through dual mechanisms involving 53BP1-dependent recruitment to DSB-surrounding chromatin and 53BP1......-independent accumulation at resected DSBs. Cells lacking SCAI display reduced DSB repair capacity, hypersensitivity to DSB-inflicting agents and genome instability. We demonstrate that SCAI is a mediator of 53BP1-dependent repair of heterochromatin-associated DSBs, facilitating ATM kinase signalling at DSBs...

  14. The ubiquitin- and SUMO-dependent signaling response to DNA double-strand breaks

    DEFF Research Database (Denmark)

    Bekker-Jensen, Simon; Mailand, Niels

    2011-01-01

    DNA double-strand breaks (DSBs) represent the most destructive type of chromosomal lesion and trigger rapid chromatin restructuring accompanied by accumulation of proteins in the vicinity of the DSB. Non-proteolytic ubiquitylation of chromatin surrounding DSBs, mediated by the RNF8/RNF168 ubiquitin...... ligase cascade, has emerged as a key mechanism for restoration of genome integrity by licensing the DSB-modified chromatin to concentrate genome caretaker proteins such as 53BP1 and BRCA1 near the lesions. In parallel, SUMOylation of upstream DSB regulators is also required for execution...... of this ubiquitin-dependent chromatin response, but its molecular basis is currently unclear. Here, we discuss recent insights into how ubiquitin- and SUMO-dependent signaling processes cooperate to orchestrate protein interactions with sites of DNA damage to facilitate DSB repair....

  15. Monitoring homology search during DNA double-strand break repair in vivo.

    Science.gov (United States)

    Renkawitz, Jörg; Lademann, Claudio A; Kalocsay, Marian; Jentsch, Stefan

    2013-04-25

    Homologous recombination (HR) is crucial for genetic exchange and accurate repair of DNA double-strand breaks and is pivotal for genome integrity. HR uses homologous sequences for repair, but how homology search, the exploration of the genome for homologous DNA sequences, is conducted in the nucleus remains poorly understood. Here, we use time-resolved chromatin immunoprecipitations of repair proteins to monitor homology search in vivo. We found that homology search proceeds by a probing mechanism, which commences around the break and samples preferentially on the broken chromosome. However, elements thought to instruct chromosome loops mediate homology search shortcuts, and centromeres, which cluster within the nucleus, may facilitate homology search on other chromosomes. Our study thus reveals crucial parameters for homology search in vivo and emphasizes the importance of linear distance, chromosome architecture, and proximity for recombination efficiency. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Molecular dynamics simulations of double-stranded DNA in an explicit solvent model with the zero-dipole summation method.

    Directory of Open Access Journals (Sweden)

    Takamasa Arakawa

    Full Text Available Molecular dynamics (MD simulations of a double-stranded DNA with explicit water and small ions were performed with the zero-dipole summation (ZD method, which was recently developed as one of the non-Ewald methods. Double-stranded DNA is highly charged and polar, with phosphate groups in its backbone and their counterions, and thus precise treatment for the long-range electrostatic interactions is always required to maintain the stable and native double-stranded form. A simple truncation method deforms it profoundly. On the contrary, the ZD method, which considers the neutralities of charges and dipoles in a truncated subset, well reproduced the electrostatic energies of the DNA system calculated by the Ewald method. The MD simulations using the ZD method provided a stable DNA system, with similar structures and dynamic properties to those produced by the conventional Particle mesh Ewald method.

  17. Deletion-bias in DNA double-strand break repair differentially contributes to plant genome shrinkage.

    Science.gov (United States)

    Vu, Giang T H; Cao, Hieu X; Reiss, Bernd; Schubert, Ingo

    2017-02-28

    In order to prevent genome instability, cells need to be protected by a number of repair mechanisms, including DNA double-strand break (DSB) repair. The extent to which DSB repair, biased towards deletions or insertions, contributes to evolutionary diversification of genome size is still under debate. We analyzed mutation spectra in Arabidopsis thaliana and in barley (Hordeum vulgare) by PacBio sequencing of three DSB-targeted loci each, uncovering repair via gene conversion, single strand annealing (SSA) or nonhomologous end-joining (NHEJ). Furthermore, phylogenomic comparisons between A. thaliana and two related species were used to detect naturally occurring deletions during Arabidopsis evolution. Arabidopsis thaliana revealed significantly more and larger deletions after DSB repair than barley, and barley displayed more and larger insertions. Arabidopsis displayed a clear net loss of DNA after DSB repair, mainly via SSA and NHEJ. Barley revealed a very weak net loss of DNA, apparently due to less active break-end resection and easier copying of template sequences into breaks. Comparative phylogenomics revealed several footprints of SSA in the A. thaliana genome. Quantitative assessment of DNA gain and loss through DSB repair processes suggests deletion-biased DSB repair causing ongoing genome shrinking in A. thaliana, whereas genome size in barley remains nearly constant.

  18. DNA double strand breaks and Hsp70 expression in proton irradiated living cells

    Energy Technology Data Exchange (ETDEWEB)

    Fiedler, Anja [Institute for Experimental Physics II, University of Leipzig (Germany) and Faculty of Biology, Pharmacy and Psychology, University of Leipzig (Germany)]. E-mail: afiedler@uni-leipzig.de; Reinert, Tilo [Institute for Experimental Physics II, University of Leipzig (Germany); Tanner, Judith [Clinic and Polyclinic for Radiation Oncology, University of Halle-Wittenberg (Germany); Butz, Tilman [Institute for Experimental Physics II, University of Leipzig (Germany)

    2007-07-15

    DNA double strand breaks (DSBs) in living cells can be directly provoked by ionising radiation. DSBs can be visualized by immunostaining the phosphorylated histone {gamma}H2AX. Our concern was to test the feasibility of {gamma}H2AX staining for a direct visualization of single proton hits. If single protons produce detectable foci, DNA DSBs could be used as 'biological track detectors' for protons. Ionising radiation can also damage proteins indirectly by inducing free radicals. Heat shock proteins (Hsp) help to refold or even degrade the damaged proteins. The level of the most famous heat shock protein Hsp70 is increased by ionising radiation. We investigated the expression of {gamma}H2AX and Hsp70 after cross and line patterned irradiation with counted numbers of 2.25 MeV protons on primary human skin fibroblasts. The proton induced DSBs appear more delocalised than it was expected by the ion hit accuracy. Cooling the cells before the irradiation reduces the delocalisation of DNA DSBs, which is probably caused by the reduced diffusion of DNA damaging agents. Proton irradiation seems to provoke protein damages mainly in the cytoplasm indicated by cytoplasmic Hsp70 aggregates. On the contrary, in control heat shocked cells the Hsp70 was predominantly localized in the cell nucleus. However, the irradiated area could not be recognized, all cells on the Si{sub 3}N{sub 4} window showed a homogenous Hsp70 expression pattern.

  19. Activating Akt1 mutations alter DNA double strand break repair and radiosensitivity

    Science.gov (United States)

    Oeck, S.; Al-Refae, K.; Riffkin, H.; Wiel, G.; Handrick, R.; Klein, D.; Iliakis, G.; Jendrossek, V.

    2017-01-01

    The survival kinase Akt has clinical relevance to radioresistance. However, its contributions to the DNA damage response, DNA double strand break (DSB) repair and apoptosis remain poorly defined and often contradictory. We used a genetic approach to explore the consequences of genetic alterations of Akt1 for the cellular radiation response. While two activation-associated mutants with prominent nuclear access, the phospho-mimicking Akt1-TDSD and the clinically relevant PH-domain mutation Akt1-E17K, accelerated DSB repair and improved survival of irradiated Tramp-C1 murine prostate cancer cells and Akt1-knockout murine embryonic fibroblasts in vitro, the classical constitutively active membrane-targeted myrAkt1 mutant had the opposite effects. Interestingly, DNA-PKcs directly phosphorylated Akt1 at S473 in an in vitro kinase assay but not vice-versa. Pharmacological inhibition of DNA-PKcs or Akt restored radiosensitivity in tumour cells expressing Akt1-E17K or Akt1-TDSD. In conclusion, Akt1-mediated radioresistance depends on its activation state and nuclear localization and is accessible to pharmacologic inhibition. PMID:28209968

  20. Homologous recombination preferentially repairs heat-induced DNA double-strand breaks in mammalian cells.

    Science.gov (United States)

    Takahashi, Akihisa; Mori, Eiichiro; Nakagawa, Yosuke; Kajihara, Atsuhisa; Kirita, Tadaaki; Pittman, Douglas L; Hasegawa, Masatoshi; Ohnishi, Takeo

    2016-11-13

    Heat shock induces DNA double-strand breaks (DSBs), but the precise mechanism of repairing heat-induced damage is unclear. Here, we investigated the DNA repair pathways involved in cell death induced by heat shock. B02, a specific inhibitor of human RAD51 (homologous recombination; HR), and NU7026, a specific inhibitor of DNA-PK (non-homologous end-joining; NHEJ), were used for survival assays of human cancer cell lines with different p53-gene status. Mouse embryonic fibroblasts (MEFs) lacking Lig4 (NHEJ) and/or Rad54 (HR) were used for survival assays and a phosphorylated histone H2AX at Ser139 (γH2AX) assay. MEFs lacking Rad51d (HR) were used for survival assays. SPD8 cells were used to measure HR frequency after heat shock. Human cancer cells were more sensitive to heat shock in the presence of B02 despite their p53-gene status, and the effect of B02 on heat sensitivity was specific to the G2 phase. Rad54-deficient MEFs were sensitive to heat shock and showed prolonged γH2AX signals following heat shock. Rad51d-deficient MEFs were also sensitive to heat shock. Moreover, heat shock-stimulated cells had increased HR. The HR pathway plays an important role in the survival of mammalian cells against death induced by heat shock via the repair of heat-induced DNA DSBs.

  1. Accumulation of Ku70 at DNA double-strand breaks in living epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Koike, Manabu, E-mail: m_koike@nirs.go.jp [DNA Repair Gene Research, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Yutoku, Yasutomo [DNA Repair Gene Research, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Graduate School of Science, Chiba University, Yayoicho, Inage-ku, Chiba 263-8522 (Japan); Koike, Aki [DNA Repair Gene Research, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan)

    2011-10-15

    Ku70 and Ku80 play an essential role in the DNA double-strand break (DSB) repair pathway, i.e., nonhomologous DNA-end-joining (NHEJ). No accumulation mechanisms of Ku70 at DSBs have been clarified in detail, although the accumulation mechanism of Ku70 at DSBs plays key roles in regulating the NHEJ activity. Here, we show the essential domains for the accumulation and function of Ku70 at DSBs in living lung epithelial cells. Our results showed that EGFP-Ku70 accumulation at DSBs began immediately after irradiation. Our findings demonstrate that three domains of Ku70, i.e., the {alpha}/{beta}, DNA-binding, and Ku80-binding domains, but not the SAP domain, are necessary for the accumulation at or recognition of DSBs in the early stage after irradiation. Moreover, our findings demonstrate that the leucine at amino acid 385 of Ku70 in the Ku80-binding domain, but not the three target amino acids for acetylation in the DNA-binding domain, is involved in the localization and accumulation of Ku70 at DSBs. Furthermore, accumulations of XRCC4 and XLF, but not that of Artemis, at DSBs are dependent on the presence of Ku70. These findings suggest that Artemis can work in not only the Ku-dependent repair process, but also the Ku-independent process at DSBs in living epithelial cells.

  2. The MRE11 GAR motif regulates DNA double-strand break processing and ATR activation

    Institute of Scientific and Technical Information of China (English)

    Zhenbao Yu; Gillian Vogel; Yan Coulombe; Danielle Dubeau; Elizabeth Spehalski; Josée Hébert; David O Ferguson; Jean Yves Masson; Stéphane Richard

    2012-01-01

    The MRE11/RAD50/NBS1 complex is the primary sensor rapidly recruited to DNA double-strand breaks (DSBs).MRE11 is known to be arginine methylated by PRMT1 within its glycine-arginine-rich (GAR) motif.In this study,we report a mouse knock-in allele of Mre11 that substitutes the arginines with lysines in the GAR motif and generates the MRE11RK protein devoid of methylated arginines.The Mre11RK/RK mice were hypersensitive to γ-irradiation (IR) and the cells from these mice displayed cell cycle checkpoint defects and chromosome instability.Moreover,the Mre11RK/RK MEFs exhibited ATR/CHK1 signaling defects and impairment in the recruitment of RPA and RAD51 to the damaged sites.The MRKRN complex formed and localized to the sites of DNA damage and normally activated the ATM pathway in response to IR.The MRKRN complex exhibited exonuclease and DNA-binding defects in vitro responsible for the impaired DNA end resection and ATR activation observed in vivo in response to IR.Our findings provide genetic evidence for the critical role of the MRE11 GAR motif in DSB repair,and demonstrate a mechanistic link between post-translational modifications at the MRE11 GAR motif and DSB processing,as well as the ATR/CHK1 checkpoint signaling.

  3. Analysis of DNA double-strand break repair pathways in mice

    Energy Technology Data Exchange (ETDEWEB)

    Brugmans, Linda [Department of Cell Biology and Genetics, Erasmus MC, Dr. Molewaterplein 50, PO Box 1738, Rotterdam 3015GE (Netherlands); Kanaar, Roland [Department of Cell Biology and Genetics, Erasmus MC, Dr. Molewaterplein 50, PO Box 1738, Rotterdam 3015GE (Netherlands); Department of Radiation Oncology, Erasmus MC, PO Box 1738, 3000 DR Rotterdam (Netherlands); Essers, Jeroen [Department of Cell Biology and Genetics, Erasmus MC, Dr. Molewaterplein 50, PO Box 1738, Rotterdam 3015GE (Netherlands) and Department of Radiation Oncology, Erasmus MC, PO Box 1738, 3000 DR Rotterdam (Netherlands)]. E-mail: j.essers@erasmusmc.nl

    2007-01-03

    During the last years significant new insights have been gained into the mechanism and biological relevance of DNA double-strand break (DSB) repair in relation to genome stability. DSBs are a highly toxic DNA lesion, because they can lead to chromosome fragmentation, loss and translocations, eventually resulting in cancer. DSBs can be induced by cellular processes such as V(D)J recombination or DNA replication. They can also be introduced by exogenous agents DNA damaging agents such as ionizing radiation or mitomycin C. During evolution several pathways have evolved for the repair of these DSBs. The most important DSB repair mechanisms in mammalian cells are nonhomologous end-joining and homologous recombination. By using an undamaged repair template, homologous recombination ensures accurate DSB repair, whereas the untemplated nonhomologous end-joining pathway does not. Although both pathways are active in mammals, the relative contribution of the two repair pathways to genome stability differs in the different cell types. Given the potential differences in repair fidelity, it is of interest to determine the relative contribution of homologous recombination and nonhomologous end-joining to DSB repair. In this review, we focus on the biological relevance of DSB repair in mammalian cells and the potential overlap between nonhomologous end-joining and homologous recombination in different tissues.

  4. Phosphorylation of Ku dictates DNA double-strand break (DSB) repair pathway choice in S phase.

    Science.gov (United States)

    Lee, Kyung-Jong; Saha, Janapriya; Sun, Jingxin; Fattah, Kazi R; Wang, Shu-Chi; Jakob, Burkhard; Chi, Linfeng; Wang, Shih-Ya; Taucher-Scholz, Gisela; Davis, Anthony J; Chen, David J

    2016-02-29

    Multiple DNA double-strand break (DSB) repair pathways are active in S phase of the cell cycle; however, DSBs are primarily repaired by homologous recombination (HR) in this cell cycle phase. As the non-homologous end-joining (NHEJ) factor, Ku70/80 (Ku), is quickly recruited to DSBs in S phase, we hypothesized that an orchestrated mechanism modulates pathway choice between HR and NHEJ via displacement of the Ku heterodimer from DSBs to allow HR. Here, we provide evidence that phosphorylation at a cluster of sites in the junction of the pillar and bridge regions of Ku70 mediates the dissociation of Ku from DSBs. Mimicking phosphorylation at these sites reduces Ku's affinity for DSB ends, suggesting that phosphorylation of Ku70 induces a conformational change responsible for the dissociation of the Ku heterodimer from DNA ends. Ablating phosphorylation of Ku70 leads to the sustained retention of Ku at DSBs, resulting in a significant decrease in DNA end resection and HR, specifically in S phase. This decrease in HR is specific as these phosphorylation sites are not required for NHEJ. Our results demonstrate that the phosphorylation-mediated dissociation of Ku70/80 from DSBs frees DNA ends, allowing the initiation of HR in S phase and providing a mechanism of DSB repair pathway choice in mammalian cells.

  5. True Lies: The Double Life of the Nucleotide Excision Repair Factors in Transcription and DNA Repair

    Directory of Open Access Journals (Sweden)

    Nicolas Le May

    2010-01-01

    Full Text Available Nucleotide excision repair (NER is a major DNA repair pathway in eukaryotic cells. NER removes structurally diverse lesions such as pyrimidine dimers, arising upon UV irradiation or bulky chemical adducts, arising upon exposure to carcinogens and some chemotherapeutic drugs. NER defects lead to three genetic disorders that result in predisposition to cancers, accelerated aging, neurological and developmental defects. During NER, more than 30 polypeptides cooperate to recognize, incise, and excise a damaged oligonucleotide from the genomic DNA. Recent papers reveal an additional and unexpected role for the NER factors. In the absence of a genotoxic attack, the promoters of RNA polymerases I- and II-dependent genes recruit XPA, XPC, XPG, and XPF to initiate gene expression. A model that includes the growth arrest and DNA damage 45α protein (Gadd45α and the NER factors, in order to maintain the promoter of active genes under a hypomethylated state, has been proposed but remains controversial. This paper focuses on the double life of the NER factors in DNA repair and transcription and describes the possible roles of these factors in the RNA synthesis process.

  6. Importance of the efficiency of double-stranded DNA formation in cDNA synthesis for the imprecision of microarray expression analysis.

    Science.gov (United States)

    Thormar, Hans G; Gudmundsson, Bjarki; Eiriksdottir, Freyja; Kil, Siyoen; Gunnarsson, Gudmundur H; Magnusson, Magnus Karl; Hsu, Jason C; Jonsson, Jon J

    2013-04-01

    The causes of imprecision in microarray expression analysis are poorly understood, limiting the use of this technology in molecular diagnostics. Two-dimensional strandness-dependent electrophoresis (2D-SDE) separates nucleic acid molecules on the basis of length and strandness, i.e., double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), and RNA·DNA hybrids. We used 2D-SDE to measure the efficiency of cDNA synthesis and its importance for the imprecision of an in vitro transcription-based microarray expression analysis. The relative amount of double-stranded cDNA formed in replicate experiments that used the same RNA sample template was highly variable, ranging between 0% and 72% of the total DNA. Microarray experiments showed an inverse relationship between the difference between sample pairs in probe variance and the relative amount of dsDNA. Approximately 15% of probes showed between-sample variation (P cDNA synthesized can be an important component of the imprecision in T7 RNA polymerase-based microarray expression analysis. © 2013 American Association for Clinical Chemistry

  7. Coordinateendonucleolytic 5' and 3' trimming of terminally blocked blunt DNA double-strand break ends by Artemis nuclease and DNA-dependent protein kinase

    Energy Technology Data Exchange (ETDEWEB)

    Povirk, Lawrence; Yannone, Steven M.; Khan, Imran S.; Zhou, Rui-Zhe; Zhou, Tong; Valerie, Kristoffer; F., Lawrence

    2008-02-18

    Previous work showed that, in the presence of DNA-PK, Artemis slowly trims 3'-phosphoglycolate-terminated blunt ends. To examine the trimming reaction in more detail, long internally labeled DNA substrates were treated with Artemis. In the absence of DNA-PK, Artemis catalyzed extensive 5' {yields} 3' exonucleolytic resection of double-stranded DNA. This resection required a 5'-phosphate but did not require ATP, and was accompanied by endonucleolytic cleavage of the resulting 3' overhang. In the presence of DNA-PK, Artemis-mediated trimming was more limited, was ATP-dependent, and did not require a 5'-phosphate. For a blunt end with either a 3'-phosphoglycolate or 3'-hydroxyl terminus, endonucleolytic trimming of 2-4 nucleotides from the 3'-terminal strand was accompanied by trimming of 6 nucleotides from the 5'-terminal strand. The results suggest that autophosphorylated DNA-PK suppresses the exonuclease activity of Artemis toward blunt-ended DNA, and promotes slow and limited endonucleolytic trimming of the 5'-terminal strand, resulting in short 3' overhangs that are trimmed endonucleolytically. Thus, Artemis and DNA-PK can convert terminally blocked DNA ends of diverse geometry and chemical structure to a form suitable for polymerase mediated patching and ligation, with minimal loss of terminal sequence. Such processing could account for the very small deletions often found at DNA double-strand break repair sites.

  8. Lethal effects of /sup 32/P decay on transfecting activity of Bacillus subtillis phage phie DNA

    Energy Technology Data Exchange (ETDEWEB)

    Loveday, K.S.

    1979-07-15

    Disintegration of /sup 32/P present in the DNA of Bacillus subtilis phage phie (a phage containing double-strand DNA) results in the loss of viability of intact phage as well as transfecting activity of isolated DNA. Only 1/12 of the /sup 32/P disintegrations per phage DNA equivalent inactivities the intact phage while nearly every disintegration inactivates the transfecting DNA. This result provides evidence for a single-strand intermediate in the transfection of B. subtilis by phie DNA.

  9. Global force-torque phase diagram for the DNA double helix: Structural transitions, triple points, and collapsed plectonemes

    Science.gov (United States)

    Marko, John F.; Neukirch, Sébastien

    2013-12-01

    We present a free energy model for structural transitions of the DNA double helix driven by tensile and torsional stress. Our model is coarse grained and is based on semiflexible polymer descriptions of B-DNA, underwound L-DNA, and highly overwound P-DNA. The statistical-mechanical model of plectonemic supercoiling previously developed for B-DNA is applied to semiflexible polymer models of P- and L-DNA to obtain a model of DNA structural transitions in quantitative accord with experiment. We identify two distinct plectonemic states, one "inflated" by electrostatic repulsion and thermal fluctuations and the other "collapsed," with the two double helices inside the supercoils driven to close contact. We find that supercoiled B and L are stable only in the inflated form, while supercoiled P is always collapsed. We also predict the behavior and experimental signatures of highly underwound "Q"-DNA, the left-handed analog of P-DNA; as for P, supercoiled Q is always collapsed. Overstretched "S"-DNA and strand-separated "stress-melted" DNA are also included in our model, allowing prediction of a global phase diagram for forces up to 1000 pN and torques between ±60 pN nm, or, in terms of linking number density, from σ =-5 to +3.

  10. Global force-torque phase diagram for the DNA double helix: structural transitions, triple points, and collapsed plectonemes.

    Science.gov (United States)

    Marko, John F; Neukirch, Sébastien

    2013-12-01

    We present a free energy model for structural transitions of the DNA double helix driven by tensile and torsional stress. Our model is coarse grained and is based on semiflexible polymer descriptions of B-DNA, underwound L-DNA, and highly overwound P-DNA. The statistical-mechanical model of plectonemic supercoiling previously developed for B-DNA is applied to semiflexible polymer models of P- and L-DNA to obtain a model of DNA structural transitions in quantitative accord with experiment. We identify two distinct plectonemic states, one "inflated" by electrostatic repulsion and thermal fluctuations and the other "collapsed," with the two double helices inside the supercoils driven to close contact. We find that supercoiled B and L are stable only in the inflated form, while supercoiled P is always collapsed. We also predict the behavior and experimental signatures of highly underwound "Q"-DNA, the left-handed analog of P-DNA; as for P, supercoiled Q is always collapsed. Overstretched "S"-DNA and strand-separated "stress-melted" DNA are also included in our model, allowing prediction of a global phase diagram for forces up to 1000 pN and torques between ±60 pN nm, or, in terms of linking number density, from σ=-5 to +3.

  11. Protection against {sup 131}I-induced Double Strand DNA Breaks in Thyroid Cells

    Energy Technology Data Exchange (ETDEWEB)

    Hershman, J.M.; Okunyan, A.; Cannon, S.; Hogen, V. [Endocrinology, UCLA-VA, Los Angeles (United States); Rivina, Y. [Radiation Biology, UCLA, Los Angeles (United States)

    2012-07-01

    Radioiodine-131 (I{sup 131}) released from nuclear reactor accidents has dramatically increased the incidence of papillary thyroid cancer in exposed individuals, especially young children. The accepted measure for prevention of radiation-induced thyroid cancer is potassium iodide tablets that contain 100 mg iodide taken daily to block thyroid uptake of I{sup 131}. The deposition of ionizing radiation in cells results in double-strand DNA breaks (DSB) at fragile sites, and this early event can generate oncogenic rearrangements that eventually cause the cancer. We have developed a thyroid cell model to quantify the mitogenic effect of I{sup 131}. I{sup 131} causes double strand DNA breaks in FRTL-5 cells detected by 53BP1 or gamma H2AX and had no effect on cells that do not transport iodide. Perchlorate, iodide, and thiocyanate protect against DSB induced by I{sup 131}. Preincubation with the anion or radioprotective compounds prevents DSB; delayed addition of the anion is much less effective. These data provide a basis for studies of radioprotection against DSB induced by I{sup 131} in animals in order to refine the prevention of thyroid cancer resulting from nuclear fallout

  12. Molecular Renormalization Group Coarse-Graining of Polymer Chains: Application to Double-Stranded DNA

    Science.gov (United States)

    Savelyev, Alexey; Papoian, Garegin A.

    2009-01-01

    Coarse-graining of atomistic force fields allows us to investigate complex biological problems, occurring at long timescales and large length scales. In this work, we have developed an accurate coarse-grained model for double-stranded DNA chain, derived systematically from atomistic simulations. Our approach is based on matching correlators obtained from atomistic and coarse-grained simulations, for observables that explicitly enter the coarse-grained Hamiltonian. We show that this requirement leads to equivalency of the corresponding partition functions, resulting in a one-step renormalization. Compared to prior works exploiting similar ideas, the main novelty of this work is the introduction of a highly compact set of Hamiltonian basis functions, based on molecular interaction potentials. We demonstrate that such compactification allows us to reproduce many-body effects, generated by one-step renormalization, at low computational cost. In addition, compact Hamiltonians greatly increase the likelihood of finding unique solutions for the coarse-grained force-field parameter values. By successfully applying our molecular renormalization group coarse-graining technique to double-stranded DNA, we solved, for the first time, a long-standing problem in coarse-graining polymer systems, namely, how to accurately capture the correlations among various polymeric degrees of freedom. Excellent agreement is found among atomistic and coarse-grained distribution functions for various structural observables, including those not included in the Hamiltonian. We also suggest higher-order generalization of this method, which may allow capturing more subtle correlations in biopolymer dynamics. PMID:19450476

  13. Cascade of chromosomal rearrangements caused by a heterogeneous T-DNA integration supports the double-strand break repair model for T-DNA integration.

    Science.gov (United States)

    Hu, Yufei; Chen, Zhiyu; Zhuang, Chuxiong; Huang, Jilei

    2017-02-28

    Transferred DNA (T-DNA) from Agrobacterium tumefaciens can be integrated into the plant genome. The double-strand break repair (DSBR) pathway is a major model for T-DNA integration. From this model, we expect that two ends of a T-DNA molecule would invade into a single DNA double-strand break (DSB) or independent DSBs in the plant genome. We call the later phenomenon a heterogeneous T-DNA integration which has never been observed. In this work, we demonstrated it in an Arabidopsis T-DNA insertion mutant seb19. To resolve the chromosomal structural changes caused by T-DNA integration at both the nucleotide and chromosome levels, we performed inverse PCR, genome resequencing, fluorescence in situ hybridization and linkage analysis. We found, in seb19, a single T-DNA connected two different chromosomal loci and caused complex chromosomal rearrangements. The specific break-junction pattern in seb19 is consistent with the result of heterogeneous T-DNA integration but not of recombination between two T-DNA insertions. We demonstrated that, in seb19, heterogeneous T-DNA integration evoked a cascade of incorrect repair of seven DSBs on chromosome 4 and 5, and then produced translocation, inversion, duplication and deletion. Heterogeneous T-DNA integration supports the DSBR model and suggests that two ends of a T-DNA molecule could be integrated into the plant genome independently. Our results also show a new origin of chromosomal abnormalities. This article is protected by copyright. All rights reserved.

  14. Mutator Phenotype and DNA Double-Strand Break Repair in BLM Helicase-Deficient Human Cells

    Science.gov (United States)

    Suzuki, Tetsuya; Yasui, Manabu

    2016-01-01

    Bloom syndrome (BS), an autosomal recessive disorder of the BLM gene, predisposes sufferers to various cancers. To investigate the mutator phenotype and genetic consequences of DNA double-strand breaks (DSBs) in BS cells, we developed BLM helicase-deficient human cells by disrupting the BLM gene. Cells with a loss of heterozygosity (LOH) due to homologous recombination (HR) or nonhomologous end joining (NHEJ) can be restored with or without site-directed DSB induction. BLM cells exhibited a high frequency of spontaneous interallelic HR with crossover, but noncrossover events with long-tract gene conversions also occurred. Despite the highly interallelic HR events, BLM cells predominantly produced hemizygous LOH by spontaneous deletion. These phenotypes manifested during repair of DSBs. Both NHEJ and HR appropriately repaired DSBs in BLM cells, resulting in hemizygous and homozygous LOHs, respectively. However, the magnitude of the LOH was exacerbated in BLM cells, as evidenced by large deletions and long-tract gene conversions with crossover. BLM helicase suppresses the elongation of branch migration and crossover of double Holliday junctions (HJs) during HR repair, and a deficiency in this enzyme causes collapse, abnormal elongation, and/or preferable resolution to crossover of double HJs, resulting in a large-scale LOH. This mechanism underlies the predisposition for cancer in BS. PMID:27601585

  15. Mutator Phenotype and DNA Double-Strand Break Repair in BLM Helicase-Deficient Human Cells.

    Science.gov (United States)

    Suzuki, Tetsuya; Yasui, Manabu; Honma, Masamitsu

    2016-12-01

    Bloom syndrome (BS), an autosomal recessive disorder of the BLM gene, predisposes sufferers to various cancers. To investigate the mutator phenotype and genetic consequences of DNA double-strand breaks (DSBs) in BS cells, we developed BLM helicase-deficient human cells by disrupting the BLM gene. Cells with a loss of heterozygosity (LOH) due to homologous recombination (HR) or nonhomologous end joining (NHEJ) can be restored with or without site-directed DSB induction. BLM cells exhibited a high frequency of spontaneous interallelic HR with crossover, but noncrossover events with long-tract gene conversions also occurred. Despite the highly interallelic HR events, BLM cells predominantly produced hemizygous LOH by spontaneous deletion. These phenotypes manifested during repair of DSBs. Both NHEJ and HR appropriately repaired DSBs in BLM cells, resulting in hemizygous and homozygous LOHs, respectively. However, the magnitude of the LOH was exacerbated in BLM cells, as evidenced by large deletions and long-tract gene conversions with crossover. BLM helicase suppresses the elongation of branch migration and crossover of double Holliday junctions (HJs) during HR repair, and a deficiency in this enzyme causes collapse, abnormal elongation, and/or preferable resolution to crossover of double HJs, resulting in a large-scale LOH. This mechanism underlies the predisposition for cancer in BS. Copyright © 2016 Suzuki et al.

  16. Hypermutability of damaged single-strand DNA formed at double-strand breaks and uncapped telomeres in yeast Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Yong Yang

    2008-11-01

    Full Text Available The major DNA repair pathways operate on damage in double-strand DNA because they use the intact strand as a template after damage removal. Therefore, lesions in transient single-strand stretches of chromosomal DNA are expected to be especially threatening to genome stability. To test this hypothesis, we designed systems in budding yeast that could generate many kilobases of persistent single-strand DNA next to double-strand breaks or uncapped telomeres. The systems allowed controlled restoration to the double-strand state after applying DNA damage. We found that lesions induced by UV-light and methyl methanesulfonate can be tolerated in long single-strand regions and are hypermutagenic. The hypermutability required PCNA monoubiquitination and was largely attributable to translesion synthesis by the error-prone DNA polymerase zeta. In support of multiple lesions in single-strand DNA being a source of hypermutability, analysis of the UV-induced mutants revealed strong strand-specific bias and unexpectedly high frequency of alleles with widely separated multiple mutations scattered over several kilobases. Hypermutability and multiple mutations associated with lesions in transient stretches of long single-strand DNA may be a source of carcinogenesis and provide selective advantage in adaptive evolution.

  17. Hypermutability of Damaged Single-Strand DNA Formed at Double-Strand Breaks and Uncapped Telomeres in Yeast Saccharomyces cerevisiae

    Science.gov (United States)

    Yang, Yong; Sterling, Joan; Storici, Francesca; Resnick, Michael A.; Gordenin, Dmitry A.

    2008-01-01

    The major DNA repair pathways operate on damage in double-strand DNA because they use the intact strand as a template after damage removal. Therefore, lesions in transient single-strand stretches of chromosomal DNA are expected to be especially threatening to genome stability. To test this hypothesis, we designed systems in budding yeast that could generate many kilobases of persistent single-strand DNA next to double-strand breaks or uncapped telomeres. The systems allowed controlled restoration to the double-strand state after applying DNA damage. We found that lesions induced by UV-light and methyl methanesulfonate can be tolerated in long single-strand regions and are hypermutagenic. The hypermutability required PCNA monoubiquitination and was largely attributable to translesion synthesis by the error-prone DNA polymerase ζ. In support of multiple lesions in single-strand DNA being a source of hypermutability, analysis of the UV-induced mutants revealed strong strand-specific bias and unexpectedly high frequency of alleles with widely separated multiple mutations scattered over several kilobases. Hypermutability and multiple mutations associated with lesions in transient stretches of long single-strand DNA may be a source of carcinogenesis and provide selective advantage in adaptive evolution. PMID:19023402

  18. Analytical approaches for clarification of DNA-double decker phthalocyanine binding mechanism: As an alternative anticancer chemotherapeutic

    Science.gov (United States)

    Bağda, Esra; Yabaş, Ebru; Bağda, Efkan

    2017-02-01

    In the present study a novel water soluble double-decker phthalocyanine was synthesized and calf thymus DNA interaction of the synthesized double-decker phthalocyanine was investigated. 5-(3-pyridyl)-1,3,4-oxadiazole substituted phthalonitrile 1 was prepared by a nucleophilic displacement reaction of 4-nitrophthalonitrile with 5-(3-pyridyl)-1,3,4-oxadiazole-2-thiol. Lutetium(III) double-decker phthalocyanine 2 was prepared by cyclotetramerization of compound 1. Water soluble lutetium(III) double-decker phthalocyanine 3 was prepared with quaternarization of compound 2. The synthesized double-decker phthalocyanine and calf thymus DNA interaction was investigated with UV-vis titrimetric methods, gel electrophoresis, and viscosity measurements. The fluorometric ethidium bromide replacement assay was conducted to clarify the binding mode of water soluble double-decker phthalocyanine. The thermodynamic parameters for interaction, K, ΔG0, ΔH0 and ΔS0 were calculated between the temperature ranges of 25 °C-75 °C. To the best of our knowledge, this is the first study about a double-decker phthalocyanine and DNA interaction.

  19. DnaC inactivation in Escherichia coli K-12 induces the SOS response and expression of nucleotide biosynthesis genes

    DEFF Research Database (Denmark)

    Løbner-Olesen, Anders; Slominska-Wojewodzka, Monika; Hansen, Flemming G.;

    2008-01-01

    Background: Initiation of chromosome replication in E. coli requires the DnaA and DnaC proteins and conditionally-lethal dnaA and dnaC mutants are often used to synchronize cell populations. Methodology/Principal Findings: DNA microarrays were used to measure mRNA steady-state levels in initiatio......C genes was increased at the non-permissive temperature in the respective mutant strains indicating auto-regulation of both genes. Induction of the SOS regulon was observed in dnaC2 cells at 38 degrees C and 42 degrees C. Flow cytometric analysis revealed that dnaC2 mutant cells at non......-permissive temperature had completed the early stages of chromosome replication initiation. Conclusion/Significance: We suggest that in dnaC2 cells the SOS response is triggered by persistent open-complex formation at oriC and/or by arrested forks that require DnaC for replication restart....

  20. DNA Double Strand Break Response and Limited Repair Capacity in Mouse Elongated Spermatids

    Directory of Open Access Journals (Sweden)

    Emad A. Ahmed

    2015-12-01

    Full Text Available Spermatids are extremely sensitive to genotoxic exposures since during spermiogenesis only error-prone non homologous end joining (NHEJ repair pathways are available. Hence, genomic damage may accumulate in sperm and be transmitted to the zygote. Indirect, delayed DNA fragmentation and lesions associated with apoptotic-like processes have been observed during spermatid elongation, 27 days after irradiation. The proliferating spermatogonia and early meiotic prophase cells have been suggested to retain a memory of a radiation insult leading later to this delayed fragmentation. Here, we used meiotic spread preparations to localize phosphorylate histone H2 variant (γ-H2AX foci marking DNA double strand breaks (DSBs in elongated spermatids. This technique enabled us to determine the background level of DSB foci in elongated spermatids of RAD54/RAD54B double knockout (dko mice, severe combined immunodeficiency SCID mice, and poly adenosine diphosphate (ADP-ribose polymerase 1 (PARP1 inhibitor (DPQ-treated mice to compare them with the appropriate wild type controls. The repair kinetics data and the protein expression patterns observed indicate that the conventional NHEJ repair pathway is not available for elongated spermatids to repair the programmed and the IR-induced DSBs, reflecting the limited repair capacity of these cells. However, although elongated spermatids express the proteins of the alternative NHEJ, PARP1-inhibition had no effect on the repair kinetics after IR, suggesting that DNA damage may be passed onto sperm. Finally, our genetic mutant analysis suggests that an incomplete or defective meiotic recombinational repair of Spo11-induced DSBs may lead to a carry-over of the DSB damage or induce a delayed nuclear fragmentation during the sensitive programmed chromatin remodeling occurring in elongated spermatids.

  1. Non-histone chromosomal proteins HMG1 and 2 enhance ligation reaction of DNA double-strand breaks.

    Science.gov (United States)

    Nagaki, S; Yamamoto, M; Yumoto, Y; Shirakawa, H; Yoshida, M; Teraoka, H

    1998-05-08

    DNA ligase IV in a complex with XRCC4 is responsible for DNA end-joining in repair of DNA double-strand breaks (DSB) and V(D)J recombination. We found that non-histone chromosomal high mobility group (HMG) proteins 1 and 2 enhanced the ligation of linearized pUC119 DNA with DNA ligase IV from rat liver nuclear extract. Intra-molecular and inter-molecular ligations of cohesive-ended and blunt-ended DNA were markedly stimulated by HMG1 and 2. Recombinant HMG2-domain A, B, and (A + B) polypeptides were similarly, but non-identically, effective for the stimulation of DSB ligation reaction. Ligation of single-strand breaks (nicks) was only slightly activated by the HMG proteins. The DNA end-binding Ku protein singly or in combination with the catalytic component of DNA-dependent protein kinase (DNA-PK) as the DNA-PK holoenzyme was ineffective for the ligation of linearized pUC119 DNA. Although the stimulatory effect of HMG1 and 2 on ligation of DSB in vitro was not specific to DNA ligase IV, these results suggest that HMG1 and 2 are involved in the final ligation step in DNA end-joining processes of DSB repair and V(D)J recombination.

  2. Simple Elastic Network Models for Exhaustive Analysis of Long Double-Stranded DNA Dynamics with Sequence Geometry Dependence.

    Directory of Open Access Journals (Sweden)

    Shuhei Isami

    Full Text Available Simple elastic network models of DNA were developed to reveal the structure-dynamics relationships for several nucleotide sequences. First, we propose a simple all-atom elastic network model of DNA that can explain the profiles of temperature factors for several crystal structures of DNA. Second, we propose a coarse-grained elastic network model of DNA, where each nucleotide is described only by one node. This model could effectively reproduce the detailed dynamics obtained with the all-atom elastic network model according to the sequence-dependent geometry. Through normal-mode analysis for the coarse-grained elastic network model, we exhaustively analyzed the dynamic features of a large number of long DNA sequences, approximately ∼150 bp in length. These analyses revealed positive correlations between the nucleosome-forming abilities and the inter-strand fluctuation strength of double-stranded DNA for several DNA sequences.

  3. Simple Elastic Network Models for Exhaustive Analysis of Long Double-Stranded DNA Dynamics with Sequence Geometry Dependence

    CERN Document Server

    Isami, Shuhei; Nishimori, Hiraku; Awazu, Akinori

    2015-01-01

    Simple elastic network models of DNA were developed to reveal the structure-dynamics relationships for several nucleotide sequences. First, we propose a simple all-atom elastic network model of DNA that can explain the profiles of temperature factors for several crystal structures of DNA. Second, we propose a coarse-grained elastic network model of DNA, where each nucleotide is described only by one node. This model could effectively reproduce the detailed dynamics obtained with the all-atom elastic network model according to the sequence-dependent geometry. Through normal-mode analysis for the coarse-grained elastic network model, we exhaustively analyzed the dynamic features of a large number of long DNA sequences, approximately $\\sim 150$ bp in length. These analyses revealed positive correlations between the nucleosome-forming abilities and the inter-strand fluctuation strength of double-stranded DNA for several DNA sequences.

  4. Zinc Finger Nuclease induced DNA double stranded breaks and rearrangements in MLL

    Energy Technology Data Exchange (ETDEWEB)

    Do, To Uyen [Graduate Group in Immunology, University of California Davis, Davis, CA 95616 (United States); Department of Radiation Oncology, University of California Davis, Sacramento CA 95817 (United States); Ho, Bay; Shih, Shyh-Jen [Department of Radiation Oncology, University of California Davis, Sacramento CA 95817 (United States); Vaughan, Andrew, E-mail: Andrew.vaughan@ucdmc.ucdavis.edu [Graduate Group in Immunology, University of California Davis, Davis, CA 95616 (United States); Department of Radiation Oncology, University of California Davis, Sacramento CA 95817 (United States)

    2012-12-15

    Highlights: ► A Zinc Finger Nuclease (ZFN) targeting a leukemogenic hot spot for rearrangement in MLL is created. ► The novel ZFN efficiently cleaves MLL exon 13. ► Despite MLL cleavage and evidence of mis-repair, no leukemogenic translocations were produced. ► MLL cleavage alone is insufficient to generate leukemogenic translocations. - Abstract: Radiation treatment or chemotherapy has been linked with a higher risk of secondary cancers such as therapy related Acute Myeloid Leukemia (tAML). Several of these cancers have been shown to be correlated to the introduction of double stranded breaks (DSB) and rearrangements within the Mixed Lineage Leukemia (MLL) gene. We used Zinc Finger Nucleases (ZFNs) to introduce precise cuts within MLL to examine how a single DNA DSB might lead to chromosomal rearrangements. A ZFN targeting exon 13 within the Breakpoint Cluster Region of MLL was transiently expressed in a human lymphoblast cell line originating from a CML patient. Although FISH analysis showed ZFN DSB at this region increased the rate of MLL fragmentation, we were unable to detect leukemogenic rearrangements or translocations via inverse PCR. Interestingly, gene fragmentation as well as small interstitial deletions, insertions and base substitutions increased with the inhibition of DNA-PK, suggesting repair of this particular DSB is linked to non-homologous end joining (NHEJ). Although mis-repair of DSBs may be necessary for the initiation of leukemogenic translocations, a MLL targeted DNA break alone is insufficient.

  5. Sequence dependency of canonical base pair opening in the DNA double helix.

    Science.gov (United States)

    Lindahl, Viveca; Villa, Alessandra; Hess, Berk

    2017-04-01

    The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair.

  6. Fine-tuning the ubiquitin code at DNA double-strand breaks: deubiquitinating enzymes at work

    Directory of Open Access Journals (Sweden)

    Elisabetta eCitterio

    2015-09-01

    Full Text Available Ubiquitination is a reversible protein modification broadly implicated in cellular functions. Signaling processes mediated by ubiquitin are crucial for the cellular response to DNA double-strand breaks (DSBs, one of the most dangerous types of DNA lesions. In particular, the DSB response critically relies on active ubiquitination by the RNF8 and RNF168 ubiquitin ligases at the chromatin, which is essential for proper DSB signaling and repair. How this pathway is fine-tuned and what the functional consequences are of its deregulation for genome integrity and tissue homeostasis are subject of intense investigation. One important regulatory mechanism is by reversal of substrate ubiquitination through the activity of specific deubiquitinating enzymes (DUBs, as supported by the implication of a growing number of DUBs in DNA damage response (DDR processes. Here, we discuss the current knowledge of how ubiquitin-mediated signaling at DSBs is controlled by deubiquitinating enzymes, with main focus on DUBs targeting histone H2A and on their recent implication in stem cell biology and cancer.

  7. Polymers modified with double-tailed fluorous compounds for efficient DNA and siRNA delivery.

    Science.gov (United States)

    He, Bingwei; Wang, Yitong; Shao, Naimin; Chang, Hong; Cheng, Yiyun

    2015-08-01

    Cationic polymers are widely used as gene carriers, however, these polymers are usually associated with low transfection efficacy and non-negligible toxicity. Fluorination on polymers significantly improves their performances in gene delivery, but a high density of fluorous chains must be conjugated on a single polymer. Here we present a new strategy to construct fluorinated polymers with minimal fluorous chains for efficient DNA and siRNA delivery. A double-tailed fluorous compound 2-chloro-4,6-bis[(perfluorohexyl)propyloxy]-1,3,5-triazine (CBT) was conjugated on dendrimers of different generations and low molecular weight polyethylenimine via a facile synthesis. The yielding products with average numbers of 1-2 conjugated CBT moieties showed much improved EGFP and luciferase transfection efficacy compared to unmodified polymers. In addition, these polymers show high siRNA delivery efficacy on different cell lines. Among the synthesized polymers, generation 1 (G1) dendrimer modified with an average number of 1.9 CBT moieties (G1-CBT1.9) shows the highest efficacy when delivering both DNA and siRNA and its efficacy approaches that of Lipofectamine 2000. G1-CBT1.9 also shows efficient gene silencing in vivo. All of the CBT-modified polymers exhibit minimal toxicity on the cells at their optimal transfection conditions. This study provides a new strategy to design efficient fluorous polymers for DNA and siRNA delivery.

  8. Immunofluorescent Detection of DNA Double Strand Breaks induced by High-LET Radiation

    Science.gov (United States)

    Cucinotta, Francis A.; Wu, Honglu; Desai, Nirav

    2004-01-01

    Within cell nuclei, traversing charged heavy ion particles lead to the accumulation of proteins related to DNA lesions and repair along the ion trajectories. Irradiation using a standard geometric setup with the beam path perpendicular to the cell monolayer generates discrete foci of several proteins known to localize at sites of DNA double strand breaks (DSBs). One such molecule is the histone protein H2AX (gamma-H2AX), which gets rapidly phosphorylated in response to ionizing radiation. Here we present data obtained with a modified irradiation geometry characterized by a beam path parallel to a monolayer of human fibroblast cells. This new irradiation geometry leads to the formation of gamma-H2AX aggregates in the shape of streaks stretching over several micrometers in the x/y plane, thus enabling the analysis of the fluorescence distributions along the particle trajectories. Qualitative analysis of these distributions presented insights into the DNA repair kinetics along the primary track structure and visualization of possible chromatin movement. We also present evidence of colocalization of gamma-H2AX with several other proteins in responses to ionizing radiation exposure. Analysis of gamma-H2AX has the potential to provide useful information on human cell responses to high LET radiation after exposure to space-like radiation.

  9. No evidence for DNA double-strand breaks caused by endodontic sealers.

    Science.gov (United States)

    Van Landuyt, Kirsten L; Geebelen, Benjamin; Shehata, Mostafa; Furche, Silja L; Durner, Jürgen; Van Meerbeek, Bart; Hickel, Reinhard; Reichl, Franz X

    2012-05-01

    On extrusion, endodontic sealers might come into close contact with the periapical tissues for long periods. The objective of this study was to test possible mutagenicity of resin-based endodontic sealers by evaluating their potential to induce DNA double-strand breaks (DSBs). Human gingival fibroblasts were exposed to subtoxic concentrations of eluates from 1 epoxy resin-based endodontic sealer (AH Plus Jet) and 2 methacrylate-based endodontic sealers (EndoRez and Real Seal). As control, Calcicur, a Ca(OH)(2)-based sealer, was used. The γ-H2AX immunofluorescence assay was used to microscopically detect DNA DSBs, and a custom algorithm was developed to quantify them. The cytotoxicity of the 24-hour eluates could be ranked in the following order: AH Plus Jet > Real Seal > EndoRez > Calcicur. The γ-H2AX assay revealed that 1.3%-4.3% of the cell nucleus was occupied by foci when the cells were exposed to the eluates of the endodontic sealers. This was not significantly different from the negative control group in which the cells had been exposed to medium (2.1%). No indications for increased risk of genotoxicity of resin-based root canal sealers caused by the induction of DNA DSBs were found in this study. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  10. Ataxia telangiectasia mutated activation by transcription- and topoisomerase I-induced DNA double-strand breaks.

    Science.gov (United States)

    Sordet, Olivier; Redon, Christophe E; Guirouilh-Barbat, Josée; Smith, Susan; Solier, Stéphanie; Douarre, Céline; Conti, Chiara; Nakamura, Asako J; Das, Benu B; Nicolas, Estelle; Kohn, Kurt W; Bonner, William M; Pommier, Yves

    2009-08-01

    Ataxia telangiectasia mutated (ATM), the deficiency of which causes a severe neurodegenerative disease, is a crucial mediator for the DNA damage response (DDR). As neurons have high rates of transcription that require topoisomerase I (TOP1), we investigated whether TOP1 cleavage complexes (TOP1cc)-which are potent transcription-blocking lesions-also produce transcription-dependent DNA double-strand breaks (DSBs) with ATM activation. We show the induction of DSBs and DDR activation in post-mitotic primary neurons and lymphocytes treated with camptothecin, with the induction of nuclear DDR foci containing activated ATM, gamma-H2AX (phosphorylated histone H2AX), activated CHK2 (checkpoint kinase 2), MDC1 (mediator of DNA damage checkpoint 1) and 53BP1 (p53 binding protein 1). The DSB-ATM-DDR pathway was suppressed by inhibiting transcription and gamma-H2AX signals were reduced by RNase H1 transfection, which removes transcription-mediated R-loops. Thus, we propose that Top1cc produce transcription arrests with R-loop formation and generate DSBs that activate ATM in post-mitotic cells.

  11. Regulated restriction endonuclease expression: A novel, radiomimetic model of DNA double strand break induction

    Energy Technology Data Exchange (ETDEWEB)

    Radany, E.H.; Pu, A.T. [Univ. of Michigan School of Medicine, Ann Arbor, MI (United States)

    1997-10-01

    Exposure of mammalian cells to ionizing radiations (IR) produces a plethora of damages in DNA and non-DNA targets. Although DNA double strand breaks (DSB) are thought to be the critical lesion generated by IR with respect to conventional cytotoxicity, it is clear that signaling events regulating cellular responses to IR arise from multiple other lesions in addition to these. The authors are interested in identifying cellular signaling events that derive from DSB specifically, as well as the distal effects (e.g., repair, apoptosis, cell cycle delay) of such signaling. Although electroporation of restriction enzymes might afford an approach to such studies, serious concerns would be raised by the non-uniformity of enzyme transfer and general disruption of the intracellular environment (with the possibility of associated signaling processes) when using this method. The authors have established a radiomimetic model for DSB induction, based upon expression of a hybrid steroid hormone receptor: this system is subject to tight, rapid postranslational regulation of endonuclease activity via addition or withdrawl of the cognate hormone ligand. In preliminary experiments, The authors have demonstrated ligand dose and exposure time-dependent cytotoxicity and DSB induction (the latter assayed by PFGE). Cytogenetic characterization of this system, as well as studies of the interaction between enzyme- and IR-generated DSB are in progress. RNA differential display and subtractive enrichment cloning approaches will ultimately be used to identify genes whose expression changes as a consequence of isolated DSB induction.

  12. Electromagnetic and optical characteristics of Nb5+-doped double-crossover and salmon DNA thin films

    Science.gov (United States)

    Babu Mitta, Sekhar; Reddy Dugasani, Sreekantha; Jung, Soon-Gil; Vellampatti, Srivithya; Park, Tuson; Park, Sung Ha

    2017-10-01

    We report the fabrication and physical characteristics of niobium ion (Nb5+)-doped double-crossover DNA (DX-DNA) and salmon DNA (SDNA) thin films. Different concentrations of Nb5+ ([Nb5+]) are coordinated into the DNA molecules, and the thin films are fabricated via substrate-assisted growth (DX-DNA) and drop-casting (SDNA) on oxygen plasma treated substrates. We conducted atomic force microscopy to estimate the optimum concentration of Nb5+ ([Nb5+]O = 0.08 mM) in Nb5+-doped DX-DNA thin films, up to which the DX-DNA lattices maintain their structures without deformation. X-ray photoelectron spectroscopy (XPS) was performed to probe the chemical nature of the intercalated Nb5+ in the SDNA thin films. The change in peak intensities and the shift in binding energy were witnessed in XPS spectra to explicate the binding and charge transfer mechanisms between Nb5+ and SDNA molecules. UV-visible, Raman, and photoluminescence (PL) spectra were measured to determine the optical properties and thus investigate the binding modes, Nb5+ coordination sites in Nb5+-doped SDNA thin films, and energy transfer mechanisms, respectively. As [Nb5+] increases, the absorbance peak intensities monotonically increase until ∼[Nb5+]O and then decrease. However, from the Raman measurements, the peak intensities gradually decrease with an increase in [Nb5+] to reveal the binding mechanism and binding sites of metal ions in the SDNA molecules. From the PL, we observe the emission intensities to reduce them at up to ∼[Nb5+]O and then increase after that, expecting the energy transfer between the Nb5+ and SDNA molecules. The current–voltage measurement shows a significant increase in the current observed as [Nb5+] increases in the SDNA thin films when compared to that of pristine SDNA thin films. Finally, we investigate the temperature dependent magnetization in which the Nb5+-doped SDNA thin films reveal weak ferromagnetism due to the existence of tiny magnetic dipoles in the Nb5+-doped

  13. Deregulation of DNA double-strand break repair in multiple myeloma: implications for genome stability.

    Directory of Open Access Journals (Sweden)

    Ana B Herrero

    Full Text Available Multiple myeloma (MM is a hematological malignancy characterized by frequent chromosome abnormalities. However, the molecular basis for this genome instability remains unknown. Since both impaired and hyperactive double strand break (DSB repair pathways can result in DNA rearrangements, we investigated the functionality of DSB repair in MM cells. Repair kinetics of ionizing-radiation (IR-induced DSBs was similar in MM and normal control lymphoblastoid cell lines, as revealed by the comet assay. However, four out of seven MM cell lines analyzed exhibited a subset of persistent DSBs, marked by γ-H2AX and Rad51 foci that elicited a prolonged G2/M DNA damage checkpoint activation and hypersensitivity to IR, especially in the presence of checkpoint inhibitors. An analysis of the proteins involved in DSB repair in MM cells revealed upregulation of DNA-PKcs, Artemis and XRCC4, that participate in non-homologous end joining (NHEJ, and Rad51, involved in homologous recombination (HR. Accordingly, activity of both NHEJ and HR were elevated in MM cells compared to controls, as determined by in vivo functional assays. Interestingly, levels of proteins involved in a highly mutagenic, translocation-promoting, alternative NHEJ subpathway (Alt-NHEJ were also increased in all MM cell lines, with the Alt-NHEJ protein DNA ligase IIIα, also overexpressed in several plasma cell samples isolated from MM patients. Overactivation of the Alt-NHEJ pathway was revealed in MM cells by larger deletions and higher sequence microhomology at repair junctions, which were reduced by chemical inhibition of the pathway. Taken together, our results uncover a deregulated DSB repair in MM that might underlie the characteristic genome instability of the disease, and could be therapeutically exploited.

  14. Boric Acid Reduces the Formation of DNA Double Strand Breaks and Accelerates Wound Healing Process.

    Science.gov (United States)

    Tepedelen, Burcu Erbaykent; Soya, Elif; Korkmaz, Mehmet

    2016-12-01

    Boron is absorbed by the digestive and respiratory system, and it was considered that it is converted to boric acid (BA), which was distributed to all tissues above 90 %. The biochemical essentiality of boron element is caused by boric acid because it affects the activity of several enzymes involved in the metabolism. DNA damage repair mechanisms and oxidative stress regulation is quite important in the transition stage from normal to cancerous cells; thus, this study was conducted to investigate the protective effect of boric acid on DNA damage and wound healing in human epithelial cell line. For this purpose, the amount of DNA damage occurred with irinotecan (CPT-11), etoposide (ETP), doxorubicin (Doxo), and H2O2 was determined by immunofluorescence through phosphorylation of H2AX((Ser139)) and pATM((Ser1981)) in the absence and presence of BA. Moreover, the effect of BA on wound healing has been investigated in epithelial cells treated with these agents. Our results demonstrated that H2AX((Ser139)) foci numbers were significantly decreased in the presence of BA while wound healing was accelerated by BA compared to that in the control and only drug-treated cells. Eventually, the results indicate that BA reduced the formation of DNA double strand breaks caused by agents as well as improving the wound healing process. Therefore, we suggest that boric acid has important therapeutical effectiveness and may be used in the treatment of inflammatory diseases where oxidative stress and wound healing process plays an important role.

  15. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  16. Molecular detection of bacterial pathogens using microparticle enhanced double-stranded DNA probes.

    Science.gov (United States)

    Riahi, Reza; Mach, Kathleen E; Mohan, Ruchika; Liao, Joseph C; Wong, Pak Kin

    2011-08-15

    Rapid, specific, and sensitive detection of bacterial pathogens is essential toward clinical management of infectious diseases. Traditional approaches for pathogen detection, however, often require time-intensive bacterial culture and amplification procedures. Herein, a microparticle enhanced double-stranded DNA probe is demonstrated for rapid species-specific detection of bacterial 16S rRNA. In this molecular assay, the binding of the target sequence to the fluorophore conjugated probe thermodynamically displaces the quencher probe and allows the fluorophore to fluoresce. By incorporation of streptavidin-coated microparticles to localize the biotinylated probes, the sensitivity of the assay can be improved by 3 orders of magnitude. The limit of detection of the assay is as few as eight bacteria without target amplification and is highly specific against other common pathogens. Its applicability toward clinical diagnostics is demonstrated by directly identifying bacterial pathogens in urine samples from patients with urinary tract infections.

  17. Transcriptionally active chromatin recruits homologous recombination at DNA double-strand breaks.

    Science.gov (United States)

    Aymard, François; Bugler, Beatrix; Schmidt, Christine K; Guillou, Emmanuelle; Caron, Pierre; Briois, Sébastien; Iacovoni, Jason S; Daburon, Virginie; Miller, Kyle M; Jackson, Stephen P; Legube, Gaëlle

    2014-04-01

    Although both homologous recombination (HR) and nonhomologous end joining can repair DNA double-strand breaks (DSBs), the mechanisms by which one of these pathways is chosen over the other remain unclear. Here we show that transcriptionally active chromatin is preferentially repaired by HR. Using chromatin immunoprecipitation-sequencing (ChIP-seq) to analyze repair of multiple DSBs induced throughout the human genome, we identify an HR-prone subset of DSBs that recruit the HR protein RAD51, undergo resection and rely on RAD51 for efficient repair. These DSBs are located in actively transcribed genes and are targeted to HR repair via the transcription elongation-associated mark trimethylated histone H3 K36. Concordantly, depletion of SETD2, the main H3 K36 trimethyltransferase, severely impedes HR at such DSBs. Our study thereby demonstrates a primary role in DSB repair of the chromatin context in which a break occurs.

  18. Have a break: determinants of meiotic DNA double strand break (DSB) formation and processing in plants.

    Science.gov (United States)

    Edlinger, Bernd; Schlögelhofer, Peter

    2011-03-01

    Meiosis is an essential process for sexually reproducing organisms, leading to the formation of specialized generative cells. This review intends to highlight current knowledge of early events during meiosis derived from various model organisms, including plants. It will particularly focus on cis- and trans-requirements of meiotic DNA double strand break (DSB) formation, a hallmark event during meiosis and a prerequisite for recombination of genetic traits. Proteins involved in DSB formation in different organisms, emphasizing the known factors from plants, will be introduced and their functions outlined. Recent technical advances in DSB detection and meiotic recombination analysis will be reviewed, as these new tools now allow analysis of early meiotic recombination in plants with incredible accuracy. To anticipate future directions in plant meiosis research, unpublished results will be included wherever possible.

  19. Constitutional Chromothripsis Rearrangements Involve Clustered Double-Stranded DNA Breaks and Nonhomologous Repair Mechanisms

    Directory of Open Access Journals (Sweden)

    Wigard P. Kloosterman

    2012-06-01

    Full Text Available Chromothripsis represents a novel phenomenon in the structural variation landscape of cancer genomes. Here, we analyze the genomes of ten patients with congenital disease who were preselected to carry complex chromosomal rearrangements with more than two breakpoints. The rearrangements displayed unanticipated complexity resembling chromothripsis. We find that eight of them contain hallmarks of multiple clustered double-stranded DNA breaks (DSBs on one or more chromosomes. In addition, nucleotide resolution analysis of 98 breakpoint junctions indicates that break repair involves nonhomologous or microhomology-mediated end joining. We observed that these eight rearrangements are balanced or contain sporadic deletions ranging in size between a few hundred base pairs and several megabases. The two remaining complex rearrangements did not display signs of DSBs and contain duplications, indicative of rearrangement processes involving template switching. Our work provides detailed insight into the characteristics of chromothripsis and supports a role for clustered DSBs driving some constitutional chromothripsis rearrangements.

  20. Excess single-stranded DNA inhibits meiotic double-strand break repair.

    Directory of Open Access Journals (Sweden)

    Rebecca Johnson

    2007-11-01

    Full Text Available During meiosis, self-inflicted DNA double-strand breaks (DSBs are created by the protein Spo11 and repaired by homologous recombination leading to gene conversions and crossovers. Crossover formation is vital for the segregation of homologous chromosomes during the first meiotic division and requires the RecA orthologue, Dmc1. We analyzed repair during meiosis of site-specific DSBs created by another nuclease, VMA1-derived endonuclease (VDE, in cells lacking Dmc1 strand-exchange protein. Turnover and resection of the VDE-DSBs was assessed in two different reporter cassettes that can repair using flanking direct repeat sequences, thereby obviating the need for a Dmc1-dependent DNA strand invasion step. Access of the single-strand binding complex replication protein A, which is normally used in all modes of DSB repair, was checked in chromatin immunoprecipitation experiments, using antibody against Rfa1. Repair of the VDE-DSBs was severely inhibited in dmc1Delta cells, a defect that was associated with a reduction in the long tract resection required to initiate single-strand annealing between the flanking repeat sequences. Mutants that either reduce Spo11-DSB formation or abolish resection at Spo11-DSBs rescued the repair block. We also found that a replication protein A component, Rfa1, does not accumulate to expected levels at unrepaired single-stranded DNA (ssDNA in dmc1Delta cells. The requirement of Dmc1 for VDE-DSB repair using flanking repeats appears to be caused by the accumulation of large quantities of ssDNA that accumulate at Spo11-DSBs when Dmc1 is absent. We propose that these resected DSBs sequester both resection machinery and ssDNA binding proteins, which in wild-type cells would normally be recycled as Spo11-DSBs repair. The implication is that repair proteins are in limited supply, and this could reflect an underlying mechanism for regulating DSB repair in wild-type cells, providing protection from potentially harmful effects

  1. DNA double strand break repair enzymes function at multiple steps in retroviral infection

    Directory of Open Access Journals (Sweden)

    Agematsu Kazunaga

    2009-12-01

    Full Text Available Abstract Background DNA double strand break (DSB repair enzymes are thought to be necessary for retroviral infection, especially for the post-integration repair and circularization of viral cDNA. However, the detailed roles of DSB repair enzymes in retroviral infection remain to be elucidated. Results A GFP reporter assay showed that the infectivity of an HIV-based vector decreased in ATM- and DNA-PKcs-deficient cells when compared with their complemented cells, while that of an MLV-based vector was diminished in Mre11- and DNA-PKcs-deficient cells. By using a method based on inverse- and Alu-PCR, we analyzed sequences around 3' HIV-1 integration sites in ATM-, Mre11- and NBS1- deficient cells. Increased abnormal junctions between the HIV-1 provirus and the host DNA were found in these mutant cell lines compared to the complemented cell lines and control MRC5SV cells. The abnormal junctions contained two types of insertions: 1 GT dinucleotides, which are normally removed by integrase during integration, and 2 inserted nucleotides of unknown origin. Artemis-deficient cells also showed such abnormalities. In Mre11-deficient cells, part of a primer binding site sequence was also detected. The 5' host-virus junctions in the mutant cells also contained these types of abnormal nucleotides. Moreover, the host-virus junctions of the MLV provirus showed similar abnormalities. These findings suggest that DSB repair enzymes play roles in the 3'-processing reaction and protection of the ends of viral DNA after reverse transcription. We also identified both 5' and 3' junctional sequences of the same provirus by inverse PCR and found that only the 3' junctions were abnormal with aberrant short repeats, indicating that the integration step was partially impaired in these cells. Furthermore, the conserved base preferences around HIV-1 integration sites were partially altered in ATM-deficient cells. Conclusions These results suggest that DSB repair enzymes are

  2. DNA double-strand break repair: a theoretical framework and its application.

    Science.gov (United States)

    Murray, Philip J; Cornelissen, Bart; Vallis, Katherine A; Chapman, S Jon

    2016-01-01

    DNA double-strand breaks (DSBs) are formed as a result of genotoxic insults, such as exogenous ionizing radiation, and are among the most serious types of DNA damage. One of the earliest molecular responses following DSB formation is the phosphorylation of the histone H2AX, giving rise to γH2AX. Many copies of γH2AX are generated at DSBs and can be detected in vitro as foci using well-established immuno-histochemical methods. It has previously been shown that anti-γH2AX antibodies, modified by the addition of the cell-penetrating peptide TAT and a fluorescent or radionuclide label, can be used to visualize and quantify DSBs in vivo. Moreover, when labelled with a high amount of the short-range, Auger electron-emitting radioisotope, (111)In, the amount of DNA damage within a cell can be increased, leading to cell death. In this report, we develop a mathematical model that describes how molecular processes at individual sites of DNA damage give rise to quantifiable foci. Equations that describe stochastic mean behaviours at individual DSB sites are derived and parametrized using population-scale, time-series measurements from two different cancer cell lines. The model is used to examine two case studies in which the introduction of an antibody (anti-γH2AX-TAT) that targets a key component in the DSB repair pathway influences system behaviour. We investigate: (i) how the interaction between anti-γH2AX-TAT and γH2AX effects the kinetics of H2AX phosphorylation and DSB repair and (ii) model behaviour when the anti-γH2AX antibody is labelled with Auger electron-emitting (111)In and can thus instigate additional DNA damage. This work supports the conclusion that DSB kinetics are largely unaffected by the introduction of the anti-γH2AX antibody, a result that has been validated experimentally, and hence the hypothesis that the use of anti-γH2AX antibody to quantify DSBs does not violate the image tracer principle. Moreover, it provides a novel model of DNA damage

  3. Synthetic lethal targeting of DNA double strand break repair deficient cells by human apurinic/apyrimidinic endonuclease (APE1) inhibitors

    OpenAIRE

    Sultana, Rebeka; McNeill, Daniel R.; Abbotts, Rachel; Mohammed, Mohammed Z.; Zdzienicka, Małgorzata Z.; Qutob, Haitham; Seedhouse, Claire; Charles A. Laughton; Fischer, Peter M.; Patel, Poulam M.; Wilson, David M.; Madhusudan, Srinivasan

    2012-01-01

    An apurinic/apyrimidinic (AP) site is an obligatory cytotoxic intermediate in DNA Base Excision Repair (BER) that is processed by human AP endonuclease 1 (APE1). APE1 is essential for BER and an emerging drug target in cancer. We have isolated novel small molecule inhibitors of APE1. In the current study we have investigated the ability of APE1 inhibitors to induce synthetic lethality in a panel of DNA double strand break (DSB) repair deficient and proficient cells; a) Chine...

  4. Study of Interaction between Red-tide Toxin, Domoic Acid and Double -stranded DNA by Capillary Zone Electrophoresis

    Institute of Scientific and Technical Information of China (English)

    Da Zhi LI; Xin Ya HE; Hui WANG; Li SUN; Bing Cheng LIN

    2004-01-01

    The interactions between amnesic red-tide toxin, domoic acid (DA) and 14mer double-stranded DNA (dsDNA with three kinds of sequences) were studied by capillary zone electrophoresis (CZE). For the dsDNA with a sequence of 5'-CCCCCTATACCCGC-3', the amount of free dsDNA decreases with the increase of added DA; and the signal of DA-dsDNA complex was observed. Meanwhile, the other two dsDNAs, 5'-(C)12GC-3' and 5'-(AT)7-3', the existence of DA could not lead to the change of dsDNA signal and indicated that there is no interaction between DA and these two dsDNAs.

  5. The structure-specific endonuclease Mus81 contributes to replication restart by generating double-strand DNA breaks.

    Science.gov (United States)

    Hanada, Katsuhiro; Budzowska, Magda; Davies, Sally L; van Drunen, Ellen; Onizawa, Hideo; Beverloo, H Berna; Maas, Alex; Essers, Jeroen; Hickson, Ian D; Kanaar, Roland

    2007-11-01

    Faithful duplication of the genome requires structure-specific endonucleases such as the RuvABC complex in Escherichia coli. These enzymes help to resolve problems at replication forks that have been disrupted by DNA damage in the template. Much less is known about the identities of these enzymes in mammalian cells. Mus81 is the catalytic component of a eukaryotic structure-specific endonuclease that preferentially cleaves branched DNA substrates reminiscent of replication and recombination intermediates. Here we explore the mechanisms by which Mus81 maintains chromosomal stability. We found that Mus81 is involved in the formation of double-strand DNA breaks in response to the inhibition of replication. Moreover, in the absence of chromosome processing by Mus81, recovery of stalled DNA replication forks is attenuated and chromosomal aberrations arise. We suggest that Mus81 suppresses chromosomal instability by converting potentially detrimental replication-associated DNA structures into intermediates that are more amenable to DNA repair.

  6. Double-stranded DNA breaks hidden in the neutral Comet assay suggest a role of the sperm nuclear matrix in DNA integrity maintenance.

    Science.gov (United States)

    Ribas-Maynou, J; Gawecka, J E; Benet, J; Ward, W S

    2014-04-01

    We used a mouse model in which sperm DNA damage was induced to understand the relationship of double-stranded DNA (dsDNA) breaks to sperm chromatin structure and to the Comet assay. Sperm chromatin fragmentation (SCF) produces dsDNA breaks located on the matrix attachment regions, between protamine toroids. In this model, epididymal sperm induced to undergo SCF can religate dsDNA breaks while vas deferens sperm cannot. Here, we demonstrated that the conventional neutral Comet assay underestimates the epididymal SCF breaks because the broken DNA ends remain attached to the nuclear matrix, causing the DNA to remain associated with the dispersion halo, and the Comet tails to be weak. Therefore, we term these hidden dsDNA breaks. When the Comet assay was modified to include an additional incubation with sodium dodecyl sulfate (SDS) and dithiothreitol (DTT) after the conventional lysis, thereby solubilizing the nuclear matrix, the broken DNA was released from the matrix, which resulted in a reduction of the sperm head halo and an increase in the Comet tail length, exposing the hidden dsDNA breaks. Conversely, SCF-induced vas deferens sperm had small halos and long tails with the conventional neutral Comet assay, suggesting that the broken DNA ends were not tethered to the nuclear matrix. These results suggest that the attachment to the nuclear matrix is crucial for the religation of SCF-induced DNA breaks in sperm. Our data suggest that the neutral Comet assay identifies only dsDNA breaks that are released from the nuclear matrix and that the addition of an SDS treatment can reveal these hidden dsDNA breaks.

  7. [Function of flow cytometry on the dosage of antibodies against double stranded DNA in systemic lupus erythematosus].

    Science.gov (United States)

    Ferrero, Paola V; Drenkard, Cristina; Collino, César; Cabral, María José; Gamron, Susana; Barberis, Gloria; Onetti, Carlos M; Menso de Ezcurra, Emilia M

    2005-01-01

    Among the diverse number of antibodies observed in systemic lupus erythematosus, antibodies against double stranded DNA (anti-dsDNA) represent important serologic markers for the disease diagnosis and the follow-up of the disease activity. To evaluate the role of a new quantitative methodology to detect antibodies against double stranded DNA in systemic lupus erythematosus and its association with the disease activity. The performance of the indirect immunofluorescence flow cytometry with Crithidia luciliae as substrate was compared with the Crithidia luciliae indirect immunofluorescence assay and the ELISA technique in order to detect antibodies against double stranded DNA in 54 sera from 47 patient with systemic lupus erythematosus and 100 sera from normal controls. The new method showed a sensitivity of 78% and a specificity of 81% when the Crithidia luciliae indirect immunofluorescence assay was the gold standard. Compared with the ELISA technique, the flow cytometry showed a sensitivity of 78% and a specificity of 86%. No correlation was found among antibodies against double stranded DNA values detected with flow cytometry and the MEX-SLEDAI activity scores. However, the flow cytometry showed a sensitivity of 70% and a specificity of 42% to distinguish patients with systemic lupus erythematosus with and without activity (MEX-SLEDAI score > or = 5). The Rho intra-observer coefficient was 0.61 (p < 0.0001). In spite of the fact that this new method might represent an interesting advance for antibodies against double stranded DNA quantitative testing, a clear superiority does not emerge when it was compared with more traditional assays. Difficulties related with its reproducibility might represent a limitation in the routine use of this new method.

  8. Poly(ADP-ribose polymerase (PARP-1 is not involved in DNA double-strand break recovery

    Directory of Open Access Journals (Sweden)

    Fernet Marie

    2003-07-01

    Full Text Available Abstract Background The cytotoxicity and the rejoining of DNA double-strand breaks induced by γ-rays, H2O2 and neocarzinostatin, were investigated in normal and PARP-1 knockout mouse 3T3 fibroblasts to determine the role of poly(ADP-ribose polymerase (PARP-1 in DNA double-strand break repair. Results PARP-1-/- were considerably more sensitive than PARP-1+/+ 3T3s to induced cell kill by γ-rays and H2O2. However, the two cell lines did not show any significant difference in the susceptibility to neocarzinostatin below 1.5 nM drug. Restoration of PARP-1 expression in PARP-1-/- 3T3s by retroviral transfection of the full PARP-1 cDNA did not induce any change in neocarzinostatin response. Moreover the incidence and the rejoining kinetics of neocarzinostatin-induced DNA double-strand breaks were identical in PARP-1+/+ and PARP-1-/- 3T3s. Poly(ADP-ribose synthesis following γ-rays and H2O2 was observed in PARP-1-proficient cells only. In contrast neocarzinostatin, even at supra-lethal concentration, was unable to initiate PARP-1 activation yet it induced H2AX histone phosphorylation in both PARP1+/+ and PARP-1-/- 3T3s as efficiently as γ-rays and H2O2. Conclusions The results show that PARP-1 is not a major determinant of DNA double-strand break recovery with either strand break rejoining or cell survival as an endpoint. Even though both PARP-1 and ATM activation are major determinants of the cell response to γ-rays and H2O2, data suggest that PARP-1-dependent poly(ADP-ribose synthesis and ATM-dependent H2AX phosphorylation, are not inter-related in the repair pathway of neocarzinostatin-induced DNA double-strand breaks.

  9. Cohesin protects genes against γH2AX Induced by DNA double-strand breaks.

    Directory of Open Access Journals (Sweden)

    Pierre Caron

    2012-01-01

    Full Text Available Chromatin undergoes major remodeling around DNA double-strand breaks (DSB to promote repair and DNA damage response (DDR activation. We recently reported a high-resolution map of γH2AX around multiple breaks on the human genome, using a new cell-based DSB inducible system. In an attempt to further characterize the chromatin landscape induced around DSBs, we now report the profile of SMC3, a subunit of the cohesin complex, previously characterized as required for repair by homologous recombination. We found that recruitment of cohesin is moderate and restricted to the immediate vicinity of DSBs in human cells. In addition, we show that cohesin controls γH2AX distribution within domains. Indeed, as we reported previously for transcription, cohesin binding antagonizes γH2AX spreading. Remarkably, depletion of cohesin leads to an increase of γH2AX at cohesin-bound genes, associated with a decrease in their expression level after DSB induction. We propose that, in agreement with their function in chromosome architecture, cohesin could also help to isolate active genes from some chromatin remodelling and modifications such as the ones that occur when a DSB is detected on the genome.

  10. Radiation dose determines the method for quantification of DNA double strand breaks

    Energy Technology Data Exchange (ETDEWEB)

    Bulat, Tanja; Keta, Olitija; Korićanac, Lela; Žakula, Jelena; Petrović, Ivan; Ristić-Fira, Aleksandra [University of Belgrade, Vinča Institute of Nuclear Sciences, Belgrade (Serbia); Todorović, Danijela, E-mail: dtodorovic@medf.kg.ac.rs [University of Kragujevac, Faculty of Medical Sciences, Kragujevac (Serbia)

    2016-03-15

    Ionizing radiation induces DNA double strand breaks (DSBs) that trigger phosphorylation of the histone protein H2AX (γH2AX). Immunofluorescent staining visualizes formation of γH2AX foci, allowing their quantification. This method, as opposed to Western blot assay and Flow cytometry, provides more accurate analysis, by showing exact position and intensity of fluorescent signal in each single cell. In practice there are problems in quantification of γH2AX. This paper is based on two issues: the determination of which technique should be applied concerning the radiation dose, and how to analyze fluorescent microscopy images obtained by different microscopes. HTB140 melanoma cells were exposed to γ-rays, in the dose range from 1 to 16 Gy. Radiation effects on the DNA level were analyzed at different time intervals after irradiation by Western blot analysis and immunofluorescence microscopy. Immunochemically stained cells were visualized with two types of microscopes: AxioVision (Zeiss, Germany) microscope, comprising an ApoTome software, and AxioImagerA1 microscope (Zeiss, Germany). Obtained results show that the level of γH2AX is time and dose dependent. Immunofluorescence microscopy provided better detection of DSBs for lower irradiation doses, while Western blot analysis was more reliable for higher irradiation doses. AxioVision microscope containing ApoTome software was more suitable for the detection of γH2AX foci. (author)

  11. DNA double-strand breaks alter the spatial arrangement of homologous loci in plant cells.

    Science.gov (United States)

    Hirakawa, Takeshi; Katagiri, Yohei; Ando, Tadashi; Matsunaga, Sachihiro

    2015-06-05

    Chromatin dynamics and arrangement are involved in many biological processes in nuclei of eukaryotes including plants. Plants have to respond rapidly to various environmental stimuli to achieve growth and development because they cannot move. It is assumed that the alteration of chromatin dynamics and arrangement support the response to these stimuli; however, there is little information in plants. In this study, we investigated the chromatin dynamics and arrangement with DNA damage in Arabidopsis thaliana by live-cell imaging with the lacO/LacI-EGFP system and simulation analysis. It was revealed that homologous loci kept a constant distance in nuclei of A. thaliana roots in general growth. We also found that DNA double-strand breaks (DSBs) induce the approach of the homologous loci with γ-irradiation. Furthermore, AtRAD54, which performs an important role in the homologous recombination repair pathway, was involved in the pairing of homologous loci with γ-irradiation. These results suggest that homologous loci approach each other to repair DSBs, and AtRAD54 mediates these phenomena.

  12. Radiation dose determines the method for quantification of DNA double strand breaks

    Directory of Open Access Journals (Sweden)

    TANJA BULAT

    2016-03-01

    Full Text Available ABSTRACT Ionizing radiation induces DNA double strand breaks (DSBs that trigger phosphorylation of the histone protein H2AX (γH2AX. Immunofluorescent staining visualizes formation of γH2AX foci, allowing their quantification. This method, as opposed to Western blot assay and Flow cytometry, provides more accurate analysis, by showing exact position and intensity of fluorescent signal in each single cell. In practice there are problems in quantification of γH2AX. This paper is based on two issues: the determination of which technique should be applied concerning the radiation dose, and how to analyze fluorescent microscopy images obtained by different microscopes. HTB140 melanoma cells were exposed to γ-rays, in the dose range from 1 to 16 Gy. Radiation effects on the DNA level were analyzed at different time intervals after irradiation by Western blot analysis and immunofluorescence microscopy. Immunochemically stained cells were visualized with two types of microscopes: AxioVision (Zeiss, Germany microscope, comprising an ApoTome software, and AxioImagerA1 microscope (Zeiss, Germany. Obtained results show that the level of γH2AX is time and dose dependent. Immunofluorescence microscopy provided better detection of DSBs for lower irradiation doses, while Western blot analysis was more reliable for higher irradiation doses. AxioVision microscope containing ApoTome software was more suitable for the detection of γH2AX foci.

  13. Characteristics of {gamma}-H2AX foci at DNA double-strand breaks sites

    Energy Technology Data Exchange (ETDEWEB)

    Pilch, D.R.; Sedelnikova, O.A.; Redon, C. [National Cancer Institute, National Institutes of Health, Lab. of Molecular Pharmacology, Bethesda, Maryland (United States); Celeste, A.; Nussenzweig, A. [National Cancer Institute, National Institutes of Health, Experimental Immunology Branch, Bethesda, Maryland (United States); Bonner, W.M. [National Cancer Institute, National Institutes of Health, Lab. of Molecular Pharmacology, Bethesda, Maryland (United States)

    2003-06-01

    Phosphorylated H2AX ({gamma}-H2AX) is essential to the efficient recognition and (or) repair of DNA double strand breaks (DSBs), and many molecules, often thousands, of H2AX become rapidly phosphorylated at the site of each nascent DSB. An antibody to {gamma}-H2AX reveals that this highly amplified process generates nuclear foci. The phosphorylation site is a serine four residues from the C-terminus which has been evolutionarily conserved in organisms from giardia intestinalis to humans. Mice and yeast lacking the conserved serine residue demonstrate a variety of defects in DNA DSB processing. H2AX{sup {delta}}{sup /{delta}} mice are smaller, sensitive to ionizing radiation, defective in class switch recombination and spermatogenesis while cells from the mice demonstrate substantially increased numbers of genomic defects. {gamma}-H2AX foci formation is a sensitive biological dosimeter and presents new and exciting opportunities to understand important biological processes, human diseases, and individual variations in radiation sensitivity. These potentialities demonstrate the importance of understanding the parameters and functions of {gamma}-H2AX formation. (author)

  14. [Double-strand DNA breaks induction and repair in human blood lymphocytes irradiated with adapting dose].

    Science.gov (United States)

    Osipov, A N; Lizunova, E Iu; Vorob'eva, N Iu; Pelevina, I I

    2009-01-01

    Using a DNA-comet assay was shown that irradiation of human blood lymphocytes at G1 cell cycle with a low conditioning dose (5 cGy) induces an adaptive response (AR) manifested in reduction of the double-strand DNA (DSB) amount induced by challenging dose at 10 Gy. 24 h after conditioning irradiation (48 h after PHA addition) in cells irradiated at both conditioning and challenging doses a relative DBS amount was approximately 24% less in comparison to versus a control irradiated at challenging dose only. 48 h after adapting irradiation this index increased to approximately 35%, while 72 h after was decreased to approximately 29%. AR observed by us during 72 h after its induction did not accompanied by statistically significant changes in DBS repair enhancing. It is possible to assume that basic role in AR forming in lymphocytes under experimental conditions used by us playing the processes preventing radiation-induced DBS formation (antioxidant defense system activation, chromatin conformation changes ets).

  15. DNA double-strand breaks induced along the trajectory of particles

    Science.gov (United States)

    Cho, I. C.; Niu, H.; Chen, C. H.; Yu, Y. C.; Hsu, C. H.

    2011-12-01

    It is well-known that the DNA damage caused by charged particles considerably differs from damage due to electromagnetic radiation. In the case of irradiation by charged particles the DNA lesions are more complex and clustered. Such clustered damage is presumed difficult to be repaired, and is potentially lethal. In this study, we utilize a 90°-scattering system and related imaging techniques to investigate the accumulation of γ-H2AX along the trajectory of charged particles. By immunostaining the γ-H2AX protein, optical images of corresponding double strand breaks were observed using a high resolution confocal microscope. We demonstrate the difference in the accumulation of γ-H2AX from irradiation by 1 MeV protons and that of 150 keV X-rays. The acquired images were arranged and reconstructed into a 3D image using ImageJ software. We discovered that the γ-H2AX foci, following irradiation by protons, have a tendency to extend in the beam direction, while those from X-ray irradiation tend to be smaller and more randomly distributed. These results can be explained by the physical model of energy deposition.

  16. DNA Double Strand Break Repair and its Association with Inherited Predispositions to Breast Cancer

    Directory of Open Access Journals (Sweden)

    Scott Rodney J

    2004-02-01

    Full Text Available Abstract Mutations in BRCA1 account for the majority of familial aggregations of early onset breast and ovarian cancer (~70% and about 1/5 of all early onset breast cancer families; in contrast, mutations in BRCA2 account for a smaller proportion of breast/ovarian cancer families and a similar proportion of early onset breast cancer families. BRCA2 has also been shown to be associated with a much more pleiotropic disease spectrum compared to BRCA1. Since the identification of both BRCA1 and BRCA2 investigations into the functions of these genes have revealed that both are associated with the maintenance of genomic integrity via their apparent roles in cellular response to DNA damage, especially their involvement in the process of double strand DNA break repair. This review will focus on the specific roles of both genes and how functional differences may account for the diverse clinical findings observed between families that harbour BRCA1 or BRCA2 mutations.

  17. The Heterochromatic Barrier to DNA Double Strand Break Repair: How to Get the Entry Visa

    Directory of Open Access Journals (Sweden)

    Aaron A. Goodarzi

    2012-09-01

    Full Text Available Over recent decades, a deep understanding of pathways that repair DNA double strand breaks (DSB has been gained from biochemical, structural, biophysical and cellular studies. DNA non-homologous end-joining (NHEJ and homologous recombination (HR represent the two major DSB repair pathways, and both processes are now well understood. Recent work has demonstrated that the chromatin environment at a DSB significantly impacts upon DSB repair and that, moreover, dramatic modifications arise in the chromatin surrounding a DSB. Chromatin is broadly divided into open, transcriptionally active, euchromatin (EC and highly compacted, transcriptionally inert, heterochromatin (HC, although these represent extremes of a spectrum. The HC superstructure restricts both DSB repair and damage response signaling. Moreover, DSBs within HC (HC-DSBs are rapidly relocalized to the EC-HC interface. The damage response protein kinase, ataxia telangiectasia mutated (ATM, is required for HC-DSB repair but is dispensable for the relocalization of HC-DSBs. It has been proposed that ATM signaling enhances HC relaxation in the DSB vicinity and that this is a prerequisite for HC-DSB repair. Hence, ATM is essential for repair of HC-DSBs. Here, we discuss how HC impacts upon the response to DSBs and how ATM overcomes the barrier that HC poses to repair.

  18. Influence of intra-molecular flexibility on the elastic property of double-stranded DNA film on a substrate

    Science.gov (United States)

    Wu, Jun-Zheng; Meng, Wei-Lie; Tang, Heng-Song; Zhang, Neng-Hui

    2017-05-01

    DNA film self-assembled or nanografted on a substrate, as a kind of soft matter, consists of fixed DNA chains endowed with negative charges and an aqueous solution full of cations, anions and water molecules. Their thermal/electrical/mechanical properties are closely related to the complex biodetection signals in nano-/micro-scale biosensors and other new genome technologies. This makes it important to properly characterize these properties. In this paper, the effect of flexible micro-scale configurations on the elastic moduli of DNA films is investigated. First, illuminated by Qiu’s sphere model, an alternative bead-chain model in terms of the Yukawa potential is presented for flexible intra-DNA configurations to describe interactions between DNA fragments. The effective charges of coarse-grained DNA beads could be derived, in which the empirical parameters are identified by curve fitting with Qiu’s experimental data. Second, the updated mesoscopic bead-chain model and the thought experiment of a continuum compression bar are used to compare the elastic moduli of double-stranded DNA (dsDNA) films prepared by self-assembling and nanografting techniques. Configurational sampling is achieved via Monte Carlo simulation. Our predictions quantitatively or qualitatively agree well with the relevant experiments on the effective charge of dsDNA from low to moderate monovalent counterion concentration, immobilization deflection of single-stranded DNA (ssDNA) or dsDNA microcantilever with the variation of salt concentration, and elastic modulus of ssDNA film in the air. The results reveal that different solution environment stimulates the diverse mechanical properties of dsDNA film on a substrate, and the end effect (i.e. terminal group effect) makes self-assembling dsDNA film stiffer in the sense of the same average packing density.

  19. Acute inactivation of the replicative helicase in human cells triggers MCM8-9-dependent DNA synthesis

    DEFF Research Database (Denmark)

    Natsume, Toyoaki; Nishimura, Kohei; Minocherhomji, Sheroy

    2017-01-01

    (DSBs). Remarkably, these cells maintain some DNA synthesis in the absence of MCM2, and this requires the MCM8-9 complex, a paralog of the MCM2-7 replicative helicase. We show that MCM8-9 functions in a homologous recombination-based pathway downstream from RAD51, which is promoted by DSB induction....... This RAD51/MCM8-9 axis is distinct from the recently described RAD52-dependent DNA synthesis pathway that operates in early mitosis at common fragile sites. We propose that stalled replication forks can be restarted in S phase via homologous recombination using MCM8-9 as an alternative replicative helicase....

  20. Sequence dependency of canonical base pair opening in the DNA double helix.

    Directory of Open Access Journals (Sweden)

    Viveca Lindahl

    2017-04-01

    Full Text Available The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair.

  1. Chromatin modification and NBS1: their relationship in DNA double-strand break repair.

    Science.gov (United States)

    Saito, Yuichiro; Zhou, Hui; Kobayashi, Junya

    2016-01-01

    The importance of chromatin modification, including histone modification and chromatin remodeling, for DNA double-strand break (DSB) repair, as well as transcription and replication, has been elucidated. Phosphorylation of H2AX to γ-H2AX is one of the first responses following DSB detection, and this histone modification is important for the DSB damage response by triggering several events, including the accumulation of DNA damage response-related proteins and subsequent homologous recombination (HR) repair. The roles of other histone modifications such as acetylation, methylation and ubiquitination have also been recently clarified, particularly in the context of HR repair. NBS1 is a multifunctional protein that is involved in various DNA damage responses. Its recently identified binding partner RNF20 is an E3 ubiquitin ligase that facilitates the monoubiquitination of histone H2B, a process that is crucial for recruitment of the chromatin remodeler SNF2h to DSB damage sites. Evidence suggests that SNF2h functions in HR repair, probably through regulation of end-resection. Moreover, several recent reports have indicated that SNF2h can function in HR repair pathways as a histone remodeler and that other known histone remodelers can also participate in DSB damage responses. On the other hand, information about the roles of such chromatin modifications and NBS1 in non-homologous end joining (NHEJ) repair of DSBs and stalled fork-related damage responses is very limited; therefore, these aspects and processes need to be further studied to advance our understanding of the mechanisms and molecular players involved.

  2. A DNA double-strand break kinetic rejoining model based on the local effect model.

    Science.gov (United States)

    Tommasino, F; Friedrich, T; Scholz, U; Taucher-Scholz, G; Durante, M; Scholz, M

    2013-11-01

    We report here on a DNA double-strand break (DSB) kinetic rejoining model applicable to a wide range of radiation qualities based on the DNA damage pattern predicted by the local effect model (LEM). In the LEM this pattern is derived from the SSB and DSB yields after photon irradiation in combination with an amorphous track structure approach. Together with the assumption of a giant-loop organization to describe the higher order chromatin structure this allows the definition of two different classes of DSB. These classes are defined by the level of clustering on a micrometer scale, i.e., "isolated DSB" (iDSB) are characterized by a single DSB in a giant loop and "clustered DSB" (cDSB) by two or more DSB in a loop. Clustered DSB are assumed to represent a more difficult challenge for the cell repair machinery compared to isolated DSB, and we thus hypothesize here that the fraction of isolated DSB can be identified with the fast component of rejoining, whereas clustered DSB are identified with the slow component of rejoining. The resulting predicted bi-exponential decay functions nicely reproduce the experimental curves of DSB rejoining over time obtained by means of gel electrophoresis elution techniques as reported by different labs, involving different cell types and a wide spectrum of radiation qualities. New experimental data are also presented aimed at investigating the effects of the same ion species accelerated at different energies. The results presented here further support the relevance of the proposed two classes of DSB as a basis for understanding cell response to ion irradiation. Importantly the density of DSB within DNA giant loops of around 2 Mbp size, i.e., on a micrometer scale, is identified as a key parameter for the description of radiation effectiveness.

  3. Dynamics of a double-stranded DNA segment in a shear flow

    Science.gov (United States)

    Panja, Debabrata; Barkema, Gerard T.; van Leeuwen, J. M. J.

    2016-04-01

    We study the dynamics of a double-stranded DNA (dsDNA) segment, as a semiflexible polymer, in a shear flow, the strength of which is customarily expressed in terms of the dimensionless Weissenberg number Wi. Polymer chains in shear flows are well known to undergo tumbling motion. When the chain lengths are much smaller than the persistence length, one expects a (semiflexible) chain to tumble as a rigid rod. At low Wi, a polymer segment shorter than the persistence length does indeed tumble as a rigid rod. However, for higher Wi the chain does not tumble as a rigid rod, even if the polymer segment is shorter than the persistence length. In particular, from time to time the polymer segment may assume a buckled form, a phenomenon commonly known as Euler buckling. Using a bead-spring Hamiltonian model for extensible dsDNA fragments, we first analyze Euler buckling in terms of the oriented deterministic state (ODS), which is obtained as the steady-state solution of the dynamical equations by turning off the stochastic (thermal) forces at a fixed orientation of the chain. The ODS exhibits symmetry breaking at a critical Weissenberg number Wic, analogous to a pitchfork bifurcation in dynamical systems. We then follow up the analysis with simulations and demonstrate symmetry breaking in computer experiments, characterized by a unimodal to bimodal transformation of the probability distribution of the second Rouse mode with increasing Wi. Our simulations reveal that shear can cause strong deformation for a chain that is shorter than its persistence length, similar to recent experimental observations.

  4. Mouse RAD54 Affects DNA Double-Strand Break Repair and Sister Chromatid Exchange

    Science.gov (United States)

    Dronkert, Mies L. G.; Beverloo, H. Berna; Johnson, Roger D.; Hoeijmakers, Jan H. J.; Jasin, Maria; Kanaar, Roland

    2000-01-01

    Cells can achieve error-free repair of DNA double-strand breaks (DSBs) by homologous recombination through gene conversion with or without crossover. In contrast, an alternative homology-dependent DSB repair pathway, single-strand annealing (SSA), results in deletions. In this study, we analyzed the effect of mRAD54, a gene involved in homologous recombination, on the repair of a site-specific I-SceI-induced DSB located in a repeated DNA sequence in the genome of mouse embryonic stem cells. We used six isogenic cell lines differing solely in the orientation of the repeats. The combination of the three recombination-test substrates used discriminated among SSA, intrachromatid gene conversion, and sister chromatid gene conversion. DSB repair was most efficient for the substrate that allowed recovery of SSA events. Gene conversion with crossover, indistinguishable from long tract gene conversion, preferentially involved the sister chromatid rather than the repeat on the same chromatid. Comparing DSB repair in mRAD54 wild-type and knockout cells revealed direct evidence for a role of mRAD54 in DSB repair. The substrate measuring SSA showed an increased efficiency of DSB repair in the absence of mRAD54. The substrate measuring sister chromatid gene conversion showed a decrease in gene conversion with and without crossover. Consistent with this observation, DNA damage-induced sister chromatid exchange was reduced in mRAD54-deficient cells. Our results suggest that mRAD54 promotes gene conversion with predominant use of the sister chromatid as the repair template at the expense of error-prone SSA. PMID:10757799

  5. Increased frequency of asynapsis and associated meiotic silencing of heterologous chromatin in the presence of irradiation-induced extra DNA double strand breaks.

    Science.gov (United States)

    Schoenmakers, Sam; Wassenaar, Evelyne; van Cappellen, Wiggert A; Derijck, Alwin A; de Boer, Peter; Laven, Joop S E; Grootegoed, J Anton; Baarends, Willy M

    2008-05-01

    In meiotic prophase of male placental mammals, the heterologous X and Y chromosomes remain largely unsynapsed, which activates meiotic sex chromosome inactivation (MSCI), leading to formation of the transcriptionally silenced XY body. MSCI is most likely related to meiotic silencing of unsynapsed chromatin (MSUC), a mechanism that can silence autosomal unsynapsed chromatin. However, heterologous synapsis and escape from silencing also occur. In mammalian species, formation of DNA double strand breaks (DSBs) during leptotene precedes meiotic chromosome pairing. These DSBs are essential to achieve full synapsis of homologous chromosomes. We generated 25% extra meiotic DSBs by whole body irradiation of mice. This leads to a significant increase in meiotic recombination frequency. In mice carrying translocation chromosomes with synaptic problems, we observed an approximately 35% increase in asynapsis and MSUC of the nonhomologous region in the smallest chromosome pair following irradiation. However, the same nonhomologous region in the largest chromosome pair, shows complete synapsis and escape from MSUC in almost 100% of the nuclei, irrespective of exposure to irradiation. We propose that prevention of synapsis and associated activation of MSUC is linked to the presence of unrepaired meiotic DSBs in the nonhomologous region. Also, spreading of synaptonemal complex formation from regions of homology may act as an opposing force, and drive heterologous synapsis.

  6. CtIP-BRCA1 modulates the choice of DNA double-strand break repair pathway throughout the cell cycle

    OpenAIRE

    Yun, Maximina H.; Hiom, Kevin

    2009-01-01

    The repair of DNA double-strand breaks (DSB) is tightly regulated during the cell cycle. In G1 phase, the absence of a sister chromatid means that repair of DSB occurs through non-homologous end-joining (NHEJ) or microhomology-mediated end-joining (MMEJ)1. These pathways often involve loss of DNA sequences at the break site and are therefore error-prone. In late S and G2 phases, even though DNA end-joining pathways remain functional2, there is an increase in repair of DSB by homologous recomb...

  7. What Reading "The Double Helix" and "The Dark Lady of DNA" Can Teach Students (and Their Teachers) about Science

    Science.gov (United States)

    Othman, Jazilah Bte

    2008-01-01

    Very often science is taught in schools devoid of the people and events behind the research. Yet there is much that can be discovered about the nature of science when we examine the lives of scientists. Recently I read James Watson's "The Double Helix" and Brenda Maddox's biography of Rosalind Franklin, "Rosalind Franklin The Dark Lady of DNA." It…

  8. Epigenetic inactivation of the CpG demethylase TET1 as a DNA methylation feedback loop in human cancers

    Science.gov (United States)

    Li, Lili; Li, Chen; Mao, Haitao; Du, Zhenfang; Chan, Wai Yee; Murray, Paul; Luo, Bing; Chan, Anthony TC; Mok, Tony SK; Chan, Francis KL; Ambinder, Richard F; Tao, Qian

    2016-01-01

    Promoter CpG methylation is a fundamental regulatory process of gene expression. TET proteins are active CpG demethylases converting 5-methylcytosine to 5-hydroxymethylcytosine, with loss of 5 hmC as an epigenetic hallmark of cancers, indicating critical roles of TET proteins in epigenetic tumorigenesis. Through analysis of tumor methylomes, we discovered TET1 as a methylated target, and further confirmed its frequent downregulation/methylation in cell lines and primary tumors of multiple carcinomas and lymphomas, including nasopharyngeal, esophageal, gastric, colorectal, renal, breast and cervical carcinomas, as well as non-Hodgkin, Hodgkin and nasal natural killer/T-cell lymphomas, although all three TET family genes are ubiquitously expressed in normal tissues. Ectopic expression of TET1 catalytic domain suppressed colony formation and induced apoptosis of tumor cells of multiple tissue types, supporting its role as a broad bona fide tumor suppressor. Furthermore, TET1 catalytic domain possessed demethylase activity in cancer cells, being able to inhibit the CpG methylation of tumor suppressor gene (TSG) promoters and reactivate their expression, such as SLIT2, ZNF382 and HOXA9. As only infrequent mutations of TET1 have been reported, compared to TET2, epigenetic silencing therefore appears to be the dominant mechanism for TET1 inactivation in cancers, which also forms a feedback loop of CpG methylation during tumorigenesis. PMID:27225590

  9. Laser-induced fluorescence resonance energy transfer for analysis of the quality of a DNA double helix

    Science.gov (United States)

    Bregadze, V. G.; Melikishvili, Z. G.; Giorgadze, T. G.; Khutsishvili, I. G.; Khuskivadze, T. B.; Jaliashvili, Z. V.; Sigua, K. I.

    2016-11-01

    The goal of this work is to use the method of the laser-induced fluorescence resonance energy transfer (FRET) of electronic excitation in a donor-acceptor pair of intercalators, (acridine orange (AO) as a donor and ethidium bromide (EB) as an acceptor), for the quantitative analysis of the quality of a DNA double helix. This approach obtains a visual picture of the defects of the genetic apparatus of tissue cells, particularly those of skin cells in real time and it can be used for the diagnosis of skin diseases and also in cosmetology. Transition metal (TM) ions such as Cu(II), Cu(I), Ag(I), silver nanoparticles (AgNPs), photo- and thermo effects were used to cause double helix defects in DNA. The concentration of DNA sites after exposure to Cu(II), Cu(I), Ag(I) ions, AgNPs impact, as well as laser irradiation (λ  =  457 nm) and temperature, which are applicable for intercalation, were estimated in relative units. The nanoscale FRET method enables the estimation of the concentration of double helix areas with high stability, applicable for intercalation in DNA after it was subjected to stress effect. It provides the opportunity to compare DNA-s of (1) different origin; (2) with various degrees of damage; (3) being in various functional states.

  10. Local thermodynamics of the water molecules around single- and double-stranded DNA studied by grid inhomogeneous solvation theory

    Science.gov (United States)

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2016-09-01

    Thermodynamic properties of water molecules around single- and double-stranded DNAs (ssDNAs and dsDNAs) with different sequences were investigated using grid inhomogeneous solvation theory. Free energies of water molecules solvating the minor groove of dsDNAs are lower than those near ssDNAs, while water molecules should be released during the formation of dsDNA. Free energies of water molecules around dsDNA are lower than those around ssDNA even in the second and third hydration shells. Our findings will help to clarify the role of water molecules in the formation of dsDNA from ssDNAs, thus facilitating the designs of drugs or nanomaterials using DNA.

  11. Toxicity of perfluorooctane sulfonate and perfluorooctanoic acid to Escherichia coli: Membrane disruption, oxidative stress, and DNA damage induced cell inactivation and/or death.

    Science.gov (United States)

    Liu, Gesheng; Zhang, Shuai; Yang, Kun; Zhu, Lizhong; Lin, Daohui

    2016-07-01

    Perfluorooctane sulfonate (PFOS) and perfluorooctanoic acid (PFOA) are two widely used polyfluorinated compounds (PFCs) and are persistent in the environment. This study for the first time systematically investigated their toxicities and the underlying mechanisms to Escherichia coli. Much higher toxicity was observed for PFOA than PFOS, with the 3 h half growth inhibition concentrations (IC50) determined to be 10.6 ± 1.0 and 374 ± 3 mg L(-1), respectively, while the bacterial accumulation of PFOS was much greater than that of PFOA. The PFC exposures disrupted cell membranes as evidenced by the dose-dependent variations of cell structures (by transmission electron microscopy observations), surface properties (electronegativity, hydrophobicity, and membrane fluidity), and membrane compositions (by gas chromatogram and Fourier transform infrared spectroscopy analyses). The increases in the contents of intracellular reactive oxygen species (ROS) and malondialdehyde and the activity of superoxide dismutase indicated the increment of oxidative stress induced by the PFCs in the bacterial cells. The fact that the cell growth inhibition was mitigated by the addition of ROS scavenger (N-acetyl cysteine) further evidenced the important role of oxidative damage in the toxicities of PFOS and PFOA. Eighteen genes involved in cell division, membrane instability, oxidative stress, and DNA damage of the exposed cells were up or down expressed, indicating the DNA damage by the PFCs. The toxicities of PFOS and PFOA to E. coli were therefore ascribed to the membrane disruption, oxidative stress, and DNA damage induced cell inactivation and/or death. The difference in the bactericidal effect between PFOS and PFOA was supposed to be related to their different dominating toxicity mechanisms, i.e., membrane disruption and oxidative damage, respectively. The outcomes will shed new light on the assessment of ecological effects of PFCs.

  12. Replication independent DNA double-strand break retention may prevent genomic instability

    Directory of Open Access Journals (Sweden)

    Pornthanakasem Wichai

    2010-03-01

    Full Text Available Abstract Background Global hypomethylation and genomic instability are cardinal features of cancers. Recently, we established a method for the detection of DNA methylation levels at sites close to endogenous DNA double strand breaks (EDSBs, and found that those sites have a higher level of methylation than the rest of the genome. Interestingly, the most significant differences between EDSBs and genomes were observed when cells were cultured in the absence of serum. DNA methylation levels on each genomic location are different. Therefore, there are more replication-independent EDSBs (RIND-EDSBs located in methylated genomic regions. Moreover, methylated and unmethylated RIND-EDSBs are differentially processed. Euchromatins respond rapidly to DSBs induced by irradiation with the phosphorylation of H2AX, γ-H2AX, and these initiate the DSB repair process. During G0, most DSBs are repaired by non-homologous end-joining repair (NHEJ, mediated by at least two distinct pathways; the Ku-mediated and the ataxia telangiectasia-mutated (ATM-mediated. The ATM-mediated pathway is more precise. Here we explored how cells process methylated RIND-EDSBs and if RIND-EDSBs play a role in global hypomethylation-induced genomic instability. Results We observed a significant number of methylated RIND-EDSBs that are retained within deacetylated chromatin and free from an immediate cellular response to DSBs, the γ-H2AX. When cells were treated with tricostatin A (TSA and the histones became hyperacetylated, the amount of γ-H2AX-bound DNA increased and the retained RIND-EDSBs were rapidly repaired. When NHEJ was simultaneously inhibited in TSA-treated cells, more EDSBs were detected. Without TSA, a sporadic increase in unmethylated RIND-EDSBs could be observed when Ku-mediated NHEJ was inhibited. Finally, a remarkable increase in RIND-EDSB methylation levels was observed when cells were depleted of ATM, but not of Ku86 and RAD51. Conclusions Methylated RIND-EDSBs are

  13. Parp1-XRCC1 and the repair of DNA double strand breaks in mouse round spermatids

    Energy Technology Data Exchange (ETDEWEB)

    Ahmed, Emad A. [Department of Endocrinology and Metabolism, Faculty of Science, Utrecht University, Padualaan 8, 3584 CH Utrecht (Netherlands); Boer, Peter de [Department of Obstetrics and Gynaecology, Radboud University Nijmegen Medical Centre, 6500 HB Nijmegen (Netherlands); Philippens, Marielle E.P.; Kal, Henk B. [Department of Radiotherapy, University Medical Center Utrecht, Heidelberglaan 100, 3584 CX Utrecht (Netherlands); Rooij, Dirk G. de, E-mail: d.g.derooij@uu.nl [Department of Endocrinology and Metabolism, Faculty of Science, Utrecht University, Padualaan 8, 3584 CH Utrecht (Netherlands); Center for Reproductive Medicine, Academic Medical Center, University of Amsterdam, 1105 AZ Amsterdam (Netherlands)

    2010-01-05

    The repair of DNA double strand breaks (DSBs) in male germ cells is slower and differently regulated compared to that in somatic cells. Round spermatids show DSB repair and are radioresistant to apoptosis induction. Mutation induction studies using ionizing irradiation, indicated a high frequency of chromosome aberrations (CA) in the next generation. Since they are in a G1 comparable stage of the cell cycle, haploid spermatids are expected to repair DSBs by the non-homologous end-joining pathway (NHEJ). However, immunohistochemical evidence indicates that not all components of the classical NHEJ pathway are available since the presence of DNA-PKcs cannot be shown. Here, we demonstrate that round spermatids, as well as most other types of male germ cells express both Parp1 and XRCC1. Therefore, we have determined whether the alternative Parp1/XRCC1 dependent NHEJ pathway is active in these nuclei and also have tested for classical NHEJ activity by a genetic method. To evaluate DSB repair in SCID mice, deficient for DNA-PKcs, and to study the involvement of the Parp1/XRCC1 dependent NHEJ pathway in round spermatids, the loss of {gamma}-H2AX foci after irradiation has been determined in nucleus spreads of round spermatids of SCID mice and in nucleus spreads and histological sections of Parp1-inhibited mice and their respective controls. Results show that around half of the breaks in randomly selected round spermatids are repaired between 1 and 8 h after irradiation. The repair of 16% of the induced DSBs requires DNA-PKcs and 21% Parp1. Foci numbers in the Parp1-inhibited testes tend to be higher in spermatids of all epithelial stages reaching significance in stages I-III which indicates an active Parp1/XRCC1 pathway in round spermatids and a decreased repair capacity in later round spermatid stages. In Parp1-inhibited SCID mice only 14.5% of the breaks were repaired 8 h after irradiation indicating additivity of the two NHEJ pathways in round spermatids.

  14. Binding of synthetic double-stranded DNA by serum from patients with systemic lupus erythematosus: correlation with renal histology.

    Science.gov (United States)

    Steinman, C R; Grishman, E; Spiera, H; Deesomochok, U

    1977-03-01

    Detection of antibody to double-stranded DNA by direct binding assays has proved useful in clinical management of patients with systemic lupus erythematosus (SLE). Recent confusion regarding specificity of these antibodies for SLE appears to be due, at least in part, to contamination of natural DNA preparations with nondouble-stranded DNA antigens. Measurement of binding of a synthetic, self-complementary DNA copolymer (dAT) rather than of natural DNA (KB) has been shown to obviate some of these difficulties, apparently because of freedom of dAT from nondouble-stranded DNA antigens. Among the advantages found in this way was a higher degree of specificity of antibodies to double-stranded DNA for clinically-judged active lupus nephritis than had been suspected. Since activity of nephritis is difficult to assess clinically, histologic data were sought to confirm these observations. Thirty-two kidney specimens were examined by light and/or electron microscopy. The degree of histologic activity and the amount and location of glomerular electron-dense deposits were semiquantitated blindly. The binding of both dAT and KB DNA was measured by the ammonium sulfate method. Correlation with the amount of electron-defense deposits was highly significant for dAT binding and somewhat less so for KB DNA binding as determined by both parametric and nonparametric statistical methods. Significant correlation with histologic activity was found for dAT but not KB DNA binding. These results are consistent with previous data and suggest that dAT binding may provide a useful, noninvasive means of clinically assessing both nephritis activity and the intensity of glomerular immune-complex deposition as reflected by the amount of electron-dense deposits. If it can be confirmed that the latter provides long-term prognostic information, then dAT binding (and perhaps its reponse to therapy) may also prove of value in this regard.

  15. RSC facilitates Rad59-dependent homologous recombination between sister chromatids by promoting cohesin loading at DNA double-strand breaks.

    Science.gov (United States)

    Oum, Ji-Hyun; Seong, Changhyun; Kwon, Youngho; Ji, Jae-Hoon; Sid, Amy; Ramakrishnan, Sreejith; Ira, Grzegorz; Malkova, Anna; Sung, Patrick; Lee, Sang Eun; Shim, Eun Yong

    2011-10-01

    Homologous recombination repairs DNA double-strand breaks by searching for, invading, and copying information from a homologous template, typically the homologous chromosome or sister chromatid. Tight wrapping of DNA around histone octamers, however, impedes access of repair proteins to DNA damage. To facilitate DNA repair, modifications of histones and energy-dependent remodeling of chromatin are required, but the precise mechanisms by which chromatin modification and remodeling enzymes contribute to homologous DNA repair are unknown. Here we have systematically assessed the role of budding yeast RSC (remodel structure of chromatin), an abundant, ATP-dependent chromatin-remodeling complex, in the cellular response to spontaneous and induced DNA damage. RSC physically interacts with the recombination protein Rad59 and functions in homologous recombination. Multiple recombination assays revealed that RSC is uniquely required for recombination between sister chromatids by virtue of its ability to recruit cohesin at DNA breaks and thereby promoting sister chromatid cohesion. This study provides molecular insights into how chromatin remodeling contributes to DNA repair and maintenance of chromatin fidelity in the face of DNA damage.

  16. DNA association-enhanced physical stability of catanionic vesicles composed of ion pair amphiphile with double-chain cationic surfactant.

    Science.gov (United States)

    Lee, Jung; Chang, Chien-Hsiang

    2014-09-01

    Physical stability control of vesicle/DNA complexes is a key issue for the development of catanionic vesicles composed of ion pair amphiphile (IPA) as DNA carriers. In this work, physical stability characteristics of the complexes of DNA with positively charged catanionic vesicles composed of an IPA and a double-chain cationic surfactant, dihexadecyldimethylammonium bromide (DHDAB), were explored. It was found that in water, the mixed IPA/DHDAB catanionic vesicles became stable when the mole fraction of DHDAB (xDHDAB) was increased up to 0.5. The improved physical stability of the vesicles with a high xDHDAB could be related to the enhanced electrostatic interaction between the vesicles. When the catanionic vesicles interacted with DNA, excellent physical stability was detected for the vesicle/DNA complexes especially with a high xDHDAB. However, this could not be fully explained by the electrostatic interaction effect, and the role of molecular packing within the vesicular bilayers was apparently important. The corresponding Langmuir monolayer study demonstrated that the molecular packing of mixed IPA/DHDAB layers became ordered with DNA association due to inhibited desorption of the positively charged moiety of the IPA. Moreover, the DNA association-induced improvement in the molecular packing of the mixed IPA/DHDAB layers became pronounced with increased xDHDAB. The results imply that one can fabricate catanionic vesicle/DNA complexes with excellent physical stability through the improved molecular packing in the IPA vesicular bilayers with DHDAB addition and DNA association.

  17. DNA double-strand breaks caused by new and contemporary endodontic sealers.

    Science.gov (United States)

    Eldeniz, A U; Shehata, M; Högg, C; Reichl, F X

    2016-12-01

    To investigate the cytotoxicity and genotoxicity of a new silicate-based BioRoot RCS(®) sealer in comparison with contemporary sealers. A periodontal ligament cell line using lentiviral gene transfer of human telomerase reverse transcriptase (hTERT) was used and exposed to subtoxic concentrations of 24-h eluates from two epoxy resin-based (AH Plus Jet(®) and Acroseal(®) ), four various methacrylate-based endodontic sealers (EndoREZ(®) , RealSeal(®) , RealSeal SE(®) and Hybrid Root SEAL(®) ) and three silicate-based sealers (BioRoot RCS(®) , iRootSP(®) and MTA Fillapex(®) ). The XTT-based cell viability assay was used for cytotoxicity screening of materials. The γ-H2AX assay was used for genotoxicity screening. In the γ-H2AX immunofluorescence assay, PDL-hTERT cells were exposed to eluates of the substances for 6 h and DNA double-strand breaks (DSB) were detected microscopically. Induced foci represented DSBs, which can induce ATM-dependent phosphorylation of the histone H2AX. The statistical significance of the differences between the experimental groups was compared using the Student's t-test (P cytotoxicity of the 24-h eluates could be ranked in the following order: Hybrid Root SEAL(®) >RealSeal(®) >Acroseal(®) >RealSeal SE(®) ≥ AH Plus Jet(®) > EndoREZ(®) >MTA Fillapex(®) > iRoot SP(®) >BioRoot RCS(®) . In negative controls (cells which received medium only) 4.08 ± 0.53 DSB foci (mean ± SEM) whilst in positive controls 10.76 ± 4.05 DSB foci/cell were found. BioRoot RCS(®) and RealSeal SE(®) exhibited significant differences in foci formation at 1/3 EC50 compared with their 1/10 EC50 concentration (P AH Plus Jet(®) , Acroseal(®) , RealSeal(®) and MTA Fillapex(®) sealers were not significantly different when compared with the medium control (P Root SEAL(®) demonstrated more toxicity and DNA double-strand breaks when compared with other resin- and silicate-based root canal sealers. © 2015 International Endodontic Journal

  18. Female meiotic sex chromosome inactivation in chicken.

    Science.gov (United States)

    Schoenmakers, Sam; Wassenaar, Evelyne; Hoogerbrugge, Jos W; Laven, Joop S E; Grootegoed, J Anton; Baarends, Willy M

    2009-05-01

    During meiotic prophase in male mammals, the heterologous X and Y chromosomes remain largely unsynapsed, and meiotic sex chromosome inactivation (MSCI) leads to formation of the transcriptionally silenced XY body. In birds, the heterogametic sex is female, carrying Z and W chromosomes (ZW), whereas males have the homogametic ZZ constitution. During chicken oogenesis, the heterologous ZW pair reaches a state of complete heterologous synapsis, and this might enable maintenance of transcription of Z- and W chromosomal genes during meiotic prophase. Herein, we show that the ZW pair is transiently silenced, from early pachytene to early diplotene using immunocytochemistry and gene expression analyses. We propose that ZW inactivation is most likely achieved via spreading of heterochromatin from the W on the Z chromosome. Also, persistent meiotic DNA double-strand breaks (DSBs) may contribute to silencing of Z. Surprisingly, gammaH2AX, a marker of DSBs, and also the earliest histone modification that is associated with XY body formation in mammalian and marsupial spermatocytes, does not cover the ZW during the synapsed stage. However, when the ZW pair starts to desynapse, a second wave of gammaH2AX accumulates on the unsynapsed regions of Z, which also show a reappearance of the DSB repair protein RAD51. This indicates that repair of meiotic DSBs on the heterologous part of Z is postponed until late pachytene/diplotene, possibly to avoid recombination with regions on the heterologously synapsed W chromosome. Two days after entering diplotene, the Z looses gammaH2AX and shows reactivation. This is the first report of meiotic sex chromosome inactivation in a species with female heterogamety, providing evidence that this mechanism is not specific to spermatogenesis. It also indicates the presence of an evolutionary force that drives meiotic sex chromosome inactivation independent of the final achievement of synapsis.

  19. Female meiotic sex chromosome inactivation in chicken.

    Directory of Open Access Journals (Sweden)

    Sam Schoenmakers

    2009-05-01

    Full Text Available During meiotic prophase in male mammals, the heterologous X and Y chromosomes remain largely unsynapsed, and meiotic sex chromosome inactivation (MSCI leads to formation of the transcriptionally silenced XY body. In birds, the heterogametic sex is female, carrying Z and W chromosomes (ZW, whereas males have the homogametic ZZ constitution. During chicken oogenesis, the heterologous ZW pair reaches a state of complete heterologous synapsis, and this might enable maintenance of transcription of Z- and W chromosomal genes during meiotic prophase. Herein, we show that the ZW pair is transiently silenced, from early pachytene to early diplotene using immunocytochemistry and gene expression analyses. We propose that ZW inactivation is most likely achieved via spreading of heterochromatin from the W on the Z chromosome. Also, persistent meiotic DNA double-strand breaks (DSBs may contribute to silencing of Z. Surprisingly, gammaH2AX, a marker of DSBs, and also the earliest histone modification that is associated with XY body formation in mammalian and marsupial spermatocytes, does not cover the ZW during the synapsed stage. However, when the ZW pair starts to desynapse, a second wave of gammaH2AX accumulates on the unsynapsed regions of Z, which also show a reappearance of the DSB repair protein RAD51. This indicates that repair of meiotic DSBs on the heterologous part of Z is postponed until late pachytene/diplotene, possibly to avoid recombination with regions on the heterologously synapsed W chromosome. Two days after entering diplotene, the Z looses gammaH2AX and shows reactivation. This is the first report of meiotic sex chromosome inactivation in a species with female heterogamety, providing evidence that this mechanism is not specific to spermatogenesis. It also indicates the presence of an evolutionary force that drives meiotic sex chromosome inactivation independent of the final achievement of synapsis.

  20. Mixed ligand copper(II) dicarboxylate complexes: the role of co-ligand hydrophobicity in DNA binding, double-strand DNA cleavage, protein binding and cytotoxicity.

    Science.gov (United States)

    Loganathan, Rangasamy; Ramakrishnan, Sethu; Ganeshpandian, Mani; Bhuvanesh, Nattamai S P; Palaniandavar, Mallayan; Riyasdeen, Anvarbatcha; Akbarsha, Mohamad Abdulkadhar

    2015-06-14

    A few water soluble mixed ligand copper(ii) complexes of the type [Cu(bimda)(diimine)] , where bimda is N-benzyliminodiacetic acid and diimine is 2,2'-bipyridine (bpy, ) or 1,10-phenanthroline (phen, ) or 5,6-dimethyl-1,10-phenanthroline (5,6-dmp, ) or 3,4,7,8-tetramethyl-1,10-phenanthroline (3,4,7,8-tmp, ) and dipyrido[3,2-d: 2',3'-f]quinoxaline (dpq, ), have been successfully isolated and characterized by elemental analysis and other spectral techniques. The coordination geometry around copper(ii) in is described as distorted square based pyramidal while that in is described as square pyramidal. Absorption spectral titrations and competitive DNA binding studies reveal that the intrinsic DNA binding affinity of the complexes depends upon the diimine co-ligand, dpq () > 3,4,7,8-tmp () > 5,6-dmp () > phen () > bpy (). The phen and dpq co-ligands are involved in the π-stacking interaction with DNA base pairs while the 3,4,7,8-tmp/5,6-dmp and bpy co-ligands are involved in respectively hydrophobic and surface mode of binding with DNA. The small enhancement in the relative viscosity of DNA upon binding to supports the DNA binding modes proposed. Interestingly, and are selective in exhibiting a positive induced CD band (ICD) upon binding to DNA suggesting that they induce B to A conformational change. In contrast, and show CD responses which reveal their involvement in strong DNA binding. The complexes are unique in displaying prominent double-strand DNA cleavage while effects only single-strand DNA cleavage, and their ability to cleave DNA in the absence of an activator varies as > > > > . Also, all the complexes exhibit oxidative double-strand DNA cleavage activity in the presence of ascorbic acid, which varies as > > > > . The ability of the complexes to bind and cleave the protein BSA varies in the order > > > > . Interestingly, and cleave the protein non-specifically in the presence of H2O2 as an activator suggesting that they can act also as chemical proteases

  1. The DNA Damage-Binding Protein XPC Is a Frequent Target for Inactivation in Squamous Cell Carcinomas

    OpenAIRE

    de Feraudy, Sebastien; Ridd, Katie; Richards, Lauren M.; Kwok, Pui-Yan; Revet, Ingrid; Oh, Dennis; Feeney, Luzviminda; Cleaver, James E.

    2010-01-01

    XPC, the main damage-recognition protein responsible for nucleotide excision repair of UVB damage to DNA, is lost or mutated in xeroderma pigmentosum group C (XP-C), a rare inherited disease characterized by high incidence and early onset of non-melanoma and melanoma skin cancers. The high incidence of skin cancers in XP-C patients suggests that loss of expression of XPC protein might also provide a selective advantage for initiation and progression of similar cancers in non XP-C patients in ...

  2. Elucidaton of DNA methylation changes in response to ionizng radiation induced double strand breaks

    Energy Technology Data Exchange (ETDEWEB)

    Herrlitz, Maren Linda

    2014-07-04

    would be an effect of overexpression or be indicative of a possible function in these nuclear subcompartments is yet to be elucidated. Additionally, by using flow cytometry analysis, exposure to IR and concomitant overexpression of TET2CD-GFP strongly induced 5hmC formation, therefore suggesting a function of TET2 in response to irradiation. Recruitment analysis showed that the TET2 catalytic domain was recruited to UV laser-induced but not X-rays- or heavy ion-induced damage sites. Endogenous TET2, which was analyzed in high TET2 expressing human fibroblasts, was recruited to damage sites after irradiation with heavy ions or X-rays. As 5hmC is the direct product of the catalytic activity of TET enzymes, local 5hmC formation and abundance at damage sites was investigated. It was observed that 5hmC accumulated at heavy ion- as well as X-ray-induced DNA double strand breaks (DSBs). In addition, investigating 5hmC foci over time after irradiation with X-rays revealed that 5hmC formation and kinetics is similar to that of γH2AX foci, whereby every 5hmC focus co-localized with γH2AX. However, this did not hold true for all γH2AX foci, whose total number was always higher than that of 5hmC. Furthermore, 5hmC (and γH2AX) foci formation was almost unaffected by the inhibition of DNA-PKcs' enzymatic activity. Conversely, 5hmC and γH2AX foci persistence was significantly delayed after DNA-PKcs inhibition. Results obtained in this thesis show that DNA methylation changes (5hmC formation) take place within the time frame of one replication cycle after exposure to IR and that these changes can be observed at sites of DSBs. 5hmC at DSBs might be formed by the oxidative function of TET2, which was shown to be recruited to DSBs. However, involvement of the other TET enzymes in 5hmC production cannot be excluded. Therefore, these results suggest a role of 5hmC in the response to IR induced DSBs, whereby the here presented data suggest that the fast, radiation induced

  3. DNA Methylation and Gene Expression Profiling of Ewing Sarcoma Primary Tumors Reveal Genes That Are Potential Targets of Epigenetic Inactivation

    Directory of Open Access Journals (Sweden)

    Nikul Patel

    2012-01-01

    Full Text Available The role of aberrant DNA methylation in Ewing sarcoma is not completely understood. The methylation status of 503 genes in 52 formalin-fixed paraffin-embedded EWS tumors and 3 EWS cell lines was compared to human mesenchymal stem cell primary cultures (hMSCs using bead chip methylation analysis. Relative expression of methylated genes was assessed in 5-Aza-2-deoxycytidine-(5-AZA-treated EWS cell lines and in a cohort of primary EWS samples and hMSCs by gene expression and quantitative RT-PCR. 129 genes demonstrated statistically significant hypermethylation in EWS tumors compared to hMSCs. Thirty-six genes were profoundly methylated in EWS and unmethylated in hMSCs. 5-AZA treatment of EWS cell lines resulted in upregulation of expression of hundreds of genes including 162 that were increased by at least 2-fold. The expression of 19 of 36 candidate hypermethylated genes was increased following 5-AZA. Analysis of gene expression from an independent cohort of tumors confirmed decreased expression of six of nineteen hypermethylated genes (AXL, COL1A1, CYP1B1, LYN, SERPINE1, and VCAN. Comparing gene expression and DNA methylation analyses proved to be an effective way to identify genes epigenetically regulated in EWS. Further investigation is ongoing to elucidate the role of these epigenetic alterations in EWS pathogenesis.

  4. The contribution of alu elements to mutagenic DNA double-strand break repair.

    Directory of Open Access Journals (Sweden)

    Maria E Morales

    2015-03-01

    Full Text Available Alu elements make up the largest family of human mobile elements, numbering 1.1 million copies and comprising 11% of the human genome. As a consequence of evolution and genetic drift, Alu elements of various sequence divergence exist throughout the human genome. Alu/Alu recombination has been shown to cause approximately 0.5% of new human genetic diseases and contribute to extensive genomic structural variation. To begin understanding the molecular mechanisms leading to these rearrangements in mammalian cells, we constructed Alu/Alu recombination reporter cell lines containing Alu elements ranging in sequence divergence from 0%-30% that allow detection of both Alu/Alu recombination and large non-homologous end joining (NHEJ deletions that range from 1.0 to 1.9 kb in size. Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DNA double-strand break (DSB repair. Further reduction in recombination was observed in a sequence divergence-dependent manner for diverged Alu/Alu recombination constructs with up to 10% sequence divergence. With greater levels of sequence divergence (15%-30%, we observed a significant increase in DSB repair due to a shift from Alu/Alu recombination to variable-length NHEJ which removes sequence between the two Alu elements. This increase in NHEJ deletions depends on the presence of Alu sequence homeology (similar but not identical sequences. Analysis of recombination products revealed that Alu/Alu recombination junctions occur more frequently in the first 100 bp of the Alu element within our reporter assay, just as they do in genomic Alu/Alu recombination events. This is the first extensive study characterizing the influence of Alu element sequence divergence on DNA repair, which will inform predictions regarding the effect of Alu element sequence

  5. Nuclear DNA C-values in 30 species double the familial representation in pteridophytes.

    Science.gov (United States)

    Obermayer, Renate; Leitch, Ilia J; Hanson, Lynda; Bennett, Michael D

    2002-08-01

    Nuclear DNA C-values and genome size are important biodiversity characters with fundamental biological significance. Yet C-value data for pteridophytes, a diverse group of vascular plants with approx. 9000 extant species, remain scarce. A recent survey by Bennett and Leitch (2001, Annals of Botany 87: 335-345) found that C-values were reported for only 48 pteridophyte species. To improve phylogenetic representation in this group and to check previously reported estimates, C-values for 30 taxa in 17 families were measured using flow cytometry for all but one species. This technique proved generally applicable, but the ease with which C-value data were generated varied greatly between materials. Comparing the new data with those previously published revealed several large discrepancies. After discounting doubtful data, C-values for 62 pteridophyte species remained acceptable for analysis. The present work has increased the number of such species' C-values by 93 %, and more than doubled the number of families represented (from 10 to 21). Analysis shows that pteridophyte C-values vary approx. 450-fold, from 0-16 pg in Selaginella kraussiana to 72.7 pg in Psilotum nudum var. gasa. Superimposing C-value data onto a robust phylogeny of pteridophytes suggests some possible trends in C-value evolution and highlights areas for future work.

  6. Interference in DNA replication can cause mitotic chromosomal breakage unassociated with double-strand breaks.

    Directory of Open Access Journals (Sweden)

    Mari Fujita

    Full Text Available Morphological analysis of mitotic chromosomes is used to detect mutagenic chemical compounds and to estimate the dose of ionizing radiation to be administered. It has long been believed that chromosomal breaks are always associated with double-strand breaks (DSBs. We here provide compelling evidence against this canonical theory. We employed a genetic approach using two cell lines, chicken DT40 and human Nalm-6. We measured the number of chromosomal breaks induced by three replication-blocking agents (aphidicolin, 5-fluorouracil, and hydroxyurea in DSB-repair-proficient wild-type cells and cells deficient in both homologous recombination and nonhomologous end-joining (the two major DSB-repair pathways. Exposure of cells to the three replication-blocking agents for at least two cell cycles resulted in comparable numbers of chromosomal breaks for RAD54(-/-/KU70(-/- DT40 clones and wild-type cells. Likewise, the numbers of chromosomal breaks induced in RAD54(-/-/LIG4(-/- Nalm-6 clones and wild-type cells were also comparable. These data indicate that the replication-blocking agents can cause chromosomal breaks unassociated with DSBs. In contrast with DSB-repair-deficient cells, chicken DT40 cells deficient in PIF1 or ATRIP, which molecules contribute to the completion of DNA replication, displayed higher numbers of mitotic chromosomal breaks induced by aphidicolin than did wild-type cells, suggesting that single-strand gaps left unreplicated may result in mitotic chromosomal breaks.

  7. Using carbon nanotubes to induce micronuclei and double strand breaks of the DNA in human cells

    Energy Technology Data Exchange (ETDEWEB)

    Cveticanin, Jelena; Joksic, Gordana; Leskovac, Andreja; Petrovic, Sandra; Sobot, Ana Valenta; Neskovic, Olivera, E-mail: oliveran@vinca.rs [Vinca Institute of Nuclear Sciences, PO Box 522, Belgrade (Serbia)

    2010-01-08

    Carbon nanotubes are unique one-dimensional macromolecules with promising applications in biology and medicine. Since their toxicity is still under debate, here we present a study investigating the genotoxic properties of purified single wall carbon nanotubes (SWCNTs), multiwall carbon nanotubes (MWCNTs), and amide functionalized purified SWCNTs on cultured human lymphocytes employing cytokinesis block micronucleus assay and enumeration of {gamma}H2AX foci as a measure of double strand breaks (DSBs) of the DNA in normal human fibroblasts. SWCNTs induce micronuclei (MN) formation in lymphocytes and decrease the proliferation potential (CBPI) of cells. In a fibroblast cell line the same dose of SWCNTs induces {gamma}H2AX foci 2.7-fold higher than in a control. Amide functionalized purified SWCNTs behave differently: they do not disturb the cell proliferation potential of harvested lymphocytes, but induce micronuclei to a higher extent than SWCNTs. When applied on fibroblasts, amide functionalized SWCNTs also induce {gamma}H2AX foci, 3.18-fold higher than the control. The cellular effects of MWCNTs display the broad spectrum of clastogenic properties seen as the highest incidence of induced lymphocyte micronuclei and anaphase bridges among nuclei in binucleated cells. Surprisingly, the incidence of induced {gamma}H2AX foci was not as high as was expected by the micronucleus test, which indicates that MWCNTs act as clastogen and aneugen agents simultaneously. Biological endpoints investigated in this study indicate a close relationship between the electrochemical properties of carbon nanotubes and observed genotoxicity.

  8. Telmisartan Induces Growth Inhibition, DNA Double-Strand Breaks and Apoptosis in Human Endometrial Cancer Cells

    Science.gov (United States)

    Koyama, Naoko; Nishida, Yoshihiro; Ishii, Terukazu; Yoshida, Toshie; Furukawa, Yuichi; Narahara, Hisashi

    2014-01-01

    Telmisartan, an angiotensin II receptor type 1 blocker, is often used as an antihypertension drug, and it has also been characterized as a peroxisome proliferator-activated receptor-gamma (PPARγ) ligand. The purpose of this study was to elucidate the antitumor effects of telmisartan on endometrial cancer cells. We treated three endometrial cancer cell lines with various concentrations of telmisartan, and we investigated the effects of the telmisartan on the cell proliferation, apoptosis, and their related measurements in vitro. We also administered telmisartan to nude mice with experimental tumors to determine its in vivo effects and toxicity. All three endometrial cancer cell lines were sensitive to the growth-inhibitory effect of telmisartan. The induction of apoptosis was confirmed in concert with the altered expression of genes and proteins related to the apoptosis. We also observed that DNA double-strand breaks (DSBs) were induced in HHUA (human endometrial cancer) cells by telmisartan treatment. In addition, experiments in nude mice showed that telmisartan significantly inhibited human endometrial tumor growth, without toxic side effects. Our results suggest that telmisartan might be a new therapeutic option for the treatment of endometrial cancers. PMID:24667764

  9. Relative biological effectiveness for photons: implication of complex DNA double-strand breaks as critical lesions

    Science.gov (United States)

    Liang, Ying; Fu, Qibin; Wang, Xudong; Liu, Feng; Yang, Gen; Luo, Chunxiong; Ouyang, Qi; Wang, Yugang

    2017-03-01

    Current knowledge in radiobiology ascribes the adverse biological effects of ionizing radiation primarily to the induction of DNA double-strand breaks (DSBs), which is supposed to be potentially lethal and may be converted to lethal damage due to misrepair. Soft and ultrasoft x-rays have been found to bear elevated biological effectiveness for cell killing compared with conventional x-rays or 60Co γ-rays. This phenomenon is qualitatively interpreted as the increased level of DSB induction for low energy photons, however, a thorough quantitative reasoning is lacking. Here, we systematically compared the relative biological effectiveness (RBE) with relative DSB induction for photons from several hundreds of eV up to MeV. Although there is an approximate two-fold increase in the yields of DSB for low energy photons found in our calculation and a large number of experimental measurements, it is far from enough to account for the three- to four-fold increase in RBE. Further theoretical investigations show that DSB complexity (additional single-strand breaks and base damage within 10 base pairs) increases notably for low energy photons, which largely reconciles the discrepancy between RBE and DSB induction. Our theoretical results are in line with accumulating experimental evidence that complex DSBs are refractory to repair machinery and may contribute predominantly to the formation of lethal damage.

  10. Double-strand breaks associated with repetitive DNA can reshape the genome

    Science.gov (United States)

    Argueso, Juan Lucas; Westmoreland, James; Mieczkowski, Piotr A.; Gawel, Malgorzata; Petes, Thomas D.; Resnick, Michael A.

    2008-01-01

    Ionizing radiation is an established source of chromosome aberrations (CAs). Although double-strand breaks (DSBs) are implicated in radiation-induced and other CAs, the underlying mechanisms are poorly understood. Here, we show that, although the vast majority of randomly induced DSBs in G2 diploid yeast cells are repaired efficiently through homologous recombination (HR) between sister chromatids or homologous chromosomes, ≈2% of all DSBs give rise to CAs. Complete molecular analysis of the genome revealed that nearly all of the CAs resulted from HR between nonallelic repetitive elements, primarily Ty retrotransposons. Nonhomologous end-joining (NHEJ) accounted for few, if any, of the CAs. We conclude that only those DSBs that fall at the 3–5% of the genome composed of repetitive DNA elements are efficient at generating rearrangements with dispersed small repeats across the genome, whereas DSBs in unique sequences are confined to recombinational repair between the large regions of homology contained in sister chromatids or homologous chromosomes. Because repeat-associated DSBs can efficiently lead to CAs and reshape the genome, they could be a rich source of evolutionary change. PMID:18701715

  11. ERCC1-XPF endonuclease facilitates DNA double-strand break repair.

    Science.gov (United States)

    Ahmad, Anwaar; Robinson, Andria Rasile; Duensing, Anette; van Drunen, Ellen; Beverloo, H Berna; Weisberg, David B; Hasty, Paul; Hoeijmakers, Jan H J; Niedernhofer, Laura J

    2008-08-01

    ERCC1-XPF endonuclease is required for nucleotide excision repair (NER) of helix-distorting DNA lesions. However, mutations in ERCC1 or XPF in humans or mice cause a more severe phenotype than absence of NER, prompting a search for novel repair activities of the nuclease. In Saccharomyces cerevisiae, orthologs of ERCC1-XPF (Rad10-Rad1) participate in the repair of double-strand breaks (DSBs). Rad10-Rad1 contributes to two error-prone DSB repair pathways: microhomology-mediated end joining (a Ku86-independent mechanism) and single-strand annealing. To determine if ERCC1-XPF participates in DSB repair in mammals, mutant cells and mice were screened for sensitivity to gamma irradiation. ERCC1-XPF-deficient fibroblasts were hypersensitive to gamma irradiation, and gammaH2AX foci, a marker of DSBs, persisted in irradiated mutant cells, consistent with a defect in DSB repair. Mutant mice were also hypersensitive to irradiation, establishing an essential role for ERCC1-XPF in protecting against DSBs in vivo. Mice defective in both ERCC1-XPF and Ku86 were not viable. However, Ercc1(-/-) Ku86(-/-) fibroblasts were hypersensitive to gamma irradiation compared to single mutants and accumulated significantly greater chromosomal aberrations. Finally, in vitro repair of DSBs with 3' overhangs led to large deletions in the absence of ERCC1-XPF. These data support the conclusion that, as in yeast, ERCC1-XPF facilitates DSB repair via an end-joining mechanism that is Ku86 independent.

  12. Dissimilar Kinetic Behavior of Electrically Manipulated Single- and Double-Stranded DNA Tethered to a Gold Surface

    Science.gov (United States)

    Rant, Ulrich; Arinaga, Kenji; Tornow, Marc; Kim, Yong Woon; Netz, Roland R.; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard

    2006-01-01

    We report on the electrical manipulation of single- and double-stranded oligodeoxynucleotides that are end tethered to gold surfaces in electrolyte solution. The response to alternating repulsive and attractive electric surface fields is studied by time-resolved fluorescence measurements, revealing markedly distinct dynamics for the flexible single-stranded and stiff double-stranded DNA, respectively. Hydrodynamic simulations rationalize this finding and disclose two different kinetic mechanisms: stiff polymers undergo rotation around the anchoring pivot point; flexible polymers, on the other hand, are pulled onto the attracting surface segment by segment. PMID:16473909

  13. Effects of Breast Shielding during Heart Imaging on DNA Double-Strand-Break Levels: A Prospective Randomized Controlled Trial.

    Science.gov (United States)

    Cheezum, Michael K; Redon, Christophe E; Burrell, Allison S; Kaviratne, Anthony S; Bindeman, Jody; Maeda, Daisuke; Balmakhtar, Houria; Pezel, Ashly; Wisniewski, Piotr; Delacruz, Panfilo; Nguyen, Binh; Bonner, William M; Villines, Todd C

    2016-10-01

    Purpose To examine the effect of breast shielding on blood lymphocyte deoxyribonucleic acid (DNA) double-strand-break levels resulting from in vivo radiation and ex vivo radiation at breast-tissue level, and the effect of breast shielding on image quality. Materials and Methods The study was approved by institutional review and commpliant with HIPAA guidelines. Adult women who underwent 64-section coronary computed tomographic (CT) angiography and who provided informed consent were prospectively randomized to the use (n = 50) or absence (n = 51) of bismuth breast shields. Peripheral blood samples were obtained before and 30 minutes after in vivo radiation during CT angiography to compare DNA double-strand-break levels by γ-H2AX immunofluorescence in blood lymphocytes. To estimate DNA double-strand-break induction at breast-tissue level, a blood sample was taped to the sternum for ex vivo radiation with or without shielding. Data were analyzed by linear regression and independent sample t tests. Results Breast shielding had no effect on DNA double-strand-break levels from ex vivo radiation of blood samples under shields at breast-tissue level (unadjusted regression: β = .08; P = .43 versus no shielding), or in vivo radiation of circulating lymphocytes (β = -.07; P = .50). Predictors of increased DNA double-strand-break levels included total radiation dose, increasing tube potential, and tube current (P radiation exposures (median, 3.4 mSv), breast shielding yielded a 33% increase in image noise and 19% decrease in the rate of excellent quality ratings. Conclusion Among women who underwent coronary CT angiography, breast shielding had no effect on DNA double-strand-break levels in blood lymphocytes exposed to in vivo radiation, or ex vivo radiation at breast-tissue level. At present relatively low radiation exposures, breast shielding contributed to an increase in image noise and a decline in image quality. The findings support efforts to minimize radiation by

  14. Up-regulation of WRN and DNA ligase IIIalpha in chronic myeloid leukemia: consequences for the repair of DNA double-strand breaks.

    Science.gov (United States)

    Sallmyr, Annahita; Tomkinson, Alan E; Rassool, Feyruz V

    2008-08-15

    Expression of oncogenic BCR-ABL in chronic myeloid leukemia (CML) results in increased reactive oxygen species (ROS) that in turn cause increased DNA damage, including DNA double-strand breaks (DSBs). We have previously shown increased error-prone repair of DSBs by nonhomologous end-joining (NHEJ) in CML cells. Recent reports have identified alternative NHEJ pathways that are highly error prone, prompting us to examine the role of the alternative NHEJ pathways in BCR-ABL-positive CML. Importantly, we show that key proteins in the major NHEJ pathway, Artemis and DNA ligase IV, are down-regulated, whereas DNA ligase IIIalpha, and the protein deleted in Werner syndrome, WRN, are up-regulated. DNA ligase IIIalpha and WRN form a complex that is recruited to DSBs in CML cells. Furthermore, "knockdown" of either DNA ligase IIIalpha or WRN leads to increased accumulation of unrepaired DSBs, demonstrating that they contribute to the repair of DSBs. These results indicate that altered DSB repair in CML cells is caused by the increased activity of an alternative NHEJ repair pathway, involving DNA ligase IIIalpha and WRN. We suggest that, although the repair of ROS-induced DSBs by this pathway contributes to the survival of CML cells, the resultant genomic instability drives disease progression.

  15. Loss of the catalytic subunit of the DNA-dependent protein kinase in DNA double-strand-break-repair mutant mammalian cells.

    Science.gov (United States)

    Peterson, S R; Kurimasa, A; Oshimura, M; Dynan, W S; Bradbury, E M; Chen, D J

    1995-04-11

    The DNA-dependent protein kinase (DNA-PK) consists of three polypeptide components: Ku-70, Ku-80, and an approximately 350-kDa catalytic subunit (p350). The gene encoding the Ku-80 subunit is identical to the x-ray-sensitive group 5 complementing gene XRCC5. Expression of the Ku-80 cDNA rescues both DNA double-strand break (DSB) repair and V(D)J recombination in group 5 mutant cells. The involvement of Ku-80 in these processes suggests that the underlying defect in these mutant cells may be disruption of the DNA-PK holoenzyme. In this report we show that the p350 kinase subunit is deleted in cells derived from the severe combined immunodeficiency mouse and in the Chinese hamster ovary cell line V-3, both of which are defective in DSB repair and V(D)J recombination. A centromeric fragment of human chromosome 8 that complements the scid defect also restores p350 protein expression and rescues in vitro DNA-PK activity. These data suggest the scid gene may encode the p350 protein or regulate its expression and are consistent with a model whereby DNA-PK is a critical component of the DSB-repair pathway.

  16. Loss of the catalytic subunit of the DNA-dependent protein kinase in DNA double-strand-break-repair mutant mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Peterson, S.R. [Los Alamos National Lab., NM (United States)]|[Tottori Univ., Yonago (Japan); Kurimasa, Akihiro; Oshimura, Mitsuo [Tottori Univ., Yonago (Japan); Dynan, W.S. [Univ. of Colorado, Boulder, CO (United States); Bradbury, E.M. [Los Alamos National Lab., NM (United States)]|[Univ. of California, Davis, CA (United States); Chen, D.J. [Los Alamos National Lab., NM (United States)

    1995-04-11

    The DNA-dependent protein kinase (DNA-PK) consists of three polypeptide components: Ku-70, Ku-80, and an {approx}350-kDa catalytic subunit (p350). The gene encoding the Ku-80 subunit is identical to the x-ray-sensitive group 5 complementing gene XRCC5. Expression of the Ku-80 cDNA rescues both DNA double-strand break (DSB) repair and V(D)J recombination in group 5 mutant cells. The involvement of Ku-80 in these processes suggests that the underlying defect in these mutant cells may be disruption of the DNA-PK holoenzyme. In this report we show that the p350 kinase subunit is deleted in cells derived from the severe combined immunodeficiency mouse and in the Chinese hamster ovary cell line V-3, both of which are defective in DSB repair and V(D)J recombination. A centromeric fragment of human chromosome 8 that complements the scid defect also restores p350 protein expression and rescues in vitro DNA-PK activity. These data suggest the scid gene may encode the p350 protein or regulate its expression and are consistent with a model whereby DNA-PK is a critical component of the DSB-repair pathway. 38 refs., 3 figs.

  17. Positive regulation of DNA double strand break repair activity during differentiation of long life span cells: the example of adipogenesis.

    Directory of Open Access Journals (Sweden)

    Aline Meulle

    Full Text Available Little information is available on the ability of terminally differentiated cells to efficiently repair DNA double strand breaks (DSBs, and one might reasonably speculate that efficient DNA repair of these threatening DNA lesions, is needed in cells of long life span with no or limited regeneration from precursor. Few tissues are available besides neurons that allow the study of DNA DSBs repair activity in very long-lived cells. Adipocytes represent a suitable model since it is generally admitted that there is a very slow turnover of adipocytes in adult. Using both Pulse Field Gel Electrophoresis (PFGE and the disappearance of the phosphorylated form of the histone variant H2AX, we demonstrated that the ability to repair DSBs is increased during adipocyte differentiation using the murine pre-adipocyte cell line, 3T3F442A. In mammalian cells, DSBs are mainly repaired by the non-homologous end-joining pathway (NHEJ that relies on the DNA dependent protein kinase (DNA-PK activity. During the first 24 h following the commitment into adipogenesis, we show an increase in the expression and activity of the catalytic sub-unit of the DNA-PK complex, DNA-PKcs. The increased in DNA DSBs repair activity observed in adipocytes was due to the increase in DNA-PK activity as shown by the use of DNA-PK inhibitor or sub-clones of 3T3F442A deficient in DNA-PKcs using long term RNA interference. Interestingly, the up-regulation of DNA-PK does not regulate the differentiation program itself. Finally, similar positive regulation of DNA-PKcs expression and activity was observed during differentiation of primary culture of pre-adipocytes isolated from human sub-cutaneous adipose tissue. Our results show that DNA DSBs repair activity is up regulated during the early commitment into adipogenesis due to an up-regulation of DNA-PK expression and activity. In opposition to the general view that DNA DSBs repair is decreased during differentiation, our results demonstrate

  18. Repair on the go: E. coli maintains a high proliferation rate while repairing a chronic DNA double-strand break.

    Directory of Open Access Journals (Sweden)

    Elise Darmon

    Full Text Available DNA damage checkpoints exist to promote cell survival and the faithful inheritance of genetic information. It is thought that one function of such checkpoints is to ensure that cell division does not occur before DNA damage is repaired. However, in unicellular organisms, rapid cell multiplication confers a powerful selective advantage, leading to a dilemma. Is the activation of a DNA damage checkpoint compatible with rapid cell multiplication? By uncoupling the initiation of DNA replication from cell division, the Escherichia coli cell cycle offers a solution to this dilemma. Here, we show that a DNA double-strand break, which occurs once per replication cycle, induces the SOS response. This SOS induction is needed for cell survival due to a requirement for an elevated level of expression of the RecA protein. Cell division is delayed, leading to an increase in average cell length but with no detectable consequence on mutagenesis and little effect on growth rate and viability. The increase in cell length caused by chronic DNA double-strand break repair comprises three components: two types of increase in the unit cell size, one independent of SfiA and SlmA, the other dependent of the presence of SfiA and the absence of SlmA, and a filamentation component that is dependent on the presence of either SfiA or SlmA. These results imply that chronic checkpoint induction in E. coli is compatible with rapid cell multiplication. Therefore, under conditions of chronic low-level DNA damage, the SOS checkpoint operates seamlessly in a cell cycle where the initiation of DNA replication is uncoupled from cell division.

  19. Microbial pathogens trigger host DNA double-strand breaks whose abundance is reduced by plant defense responses.

    Directory of Open Access Journals (Sweden)

    Junqi Song

    2014-04-01

    Full Text Available Immune responses and DNA damage repair are two fundamental processes that have been characterized extensively, but the links between them remain largely unknown. We report that multiple bacterial, fungal and oomycete plant pathogen species induce double-strand breaks (DSBs in host plant DNA. DNA damage detected by histone γ-H2AX abundance or DNA comet assays arose hours before the disease-associated necrosis caused by virulent Pseudomonas syringae pv. tomato. Necrosis-inducing paraquat did not cause detectable DSBs at similar stages after application. Non-pathogenic E. coli and Pseudomonas fluorescens bacteria also did not induce DSBs. Elevation of reactive oxygen species (ROS is common during plant immune responses, ROS are known DNA damaging agents, and the infection-induced host ROS burst has been implicated as a cause of host DNA damage in animal studies. However, we found that DSB formation in Arabidopsis in response to P. syringae infection still occurs in the absence of the infection-associated oxidative burst mediated by AtrbohD and AtrbohF. Plant MAMP receptor stimulation or application of defense-activating salicylic acid or jasmonic acid failed to induce a detectable level of DSBs in the absence of introduced pathogens, further suggesting that pathogen activities beyond host defense activation cause infection-induced DNA damage. The abundance of infection-induced DSBs was reduced by salicylic acid and NPR1-mediated defenses, and by certain R gene-mediated defenses. Infection-induced formation of γ-H2AX still occurred in Arabidopsis atr/atm double mutants, suggesting the presence of an alternative mediator of pathogen-induced H2AX phosphorylation. In summary, pathogenic microorganisms can induce plant DNA damage. Plant defense mechanisms help to suppress rather than promote this damage, thereby contributing to the maintenance of genome integrity in somatic tissues.

  20. Detection of DNA double-strand breaks and chromosome translocations using ligation-mediated PCR and inverse PCR.

    Science.gov (United States)

    Singh, Sheetal; Shih, Shyh-Jen; Vaughan, Andrew T M

    2014-01-01

    Current techniques for examining the global creation and repair of DNA double-strand breaks are restricted in their sensitivity, and such techniques mask any site-dependent variations in breakage and repair rate or fidelity. We present here a system for analyzing the fate of documented DNA breaks, using the MLL gene as an example, through application of ligation-mediated PCR. Here, a simple asymmetric double-stranded DNA adapter molecule is ligated to experimentally induced DNA breaks and subjected to seminested PCR using adapter- and gene-specific primers. The rate of appearance and loss of specific PCR products allows detection of both the break and its repair. Using the additional technique of inverse PCR, the presence of misrepaired products (translocations) can be detected at the same site, providing information on the fidelity of the ligation reaction in intact cells. Such techniques may be adapted for the analysis of DNA breaks and rearrangements introduced into any identifiable genomic location. We have also applied parallel sequencing for the high-throughput analysis of inverse PCR products to facilitate the unbiased recording of all rearrangements located at a specific genomic location.

  1. Dynamic DNA Nanotubes: Reversible Switching between Single and Double-Stranded Forms, and Effect of Base Deletions.

    Science.gov (United States)

    Rahbani, Janane F; Hariri, Amani A; Cosa, Gonzalo; Sleiman, Hanadi F

    2015-12-22

    DNA nanotubes hold great potential as drug delivery vehicles and as programmable templates for the organization of materials and biomolecules. Existing methods for their construction produce assemblies that are entirely double-stranded and rigid, and thus have limited intrinsic dynamic character, or they rely on chemically modified and ligated DNA structures. Here, we report a simple and efficient synthesis of DNA nanotubes from 11 short unmodified strands, and the study of their dynamic behavior by atomic force microscopy and in situ single molecule fluorescence microscopy. This method allows the programmable introduction of DNA structural changes within the repeat units of the tubes. We generate and study fully double-stranded nanotubes, and convert them to nanotubes with one, two and three single-stranded sides, using strand displacement strategies. The nanotubes can be reversibly switched between these forms without compromising their stability and micron-scale lengths. We then site-specifically introduce DNA strands that shorten two sides of the nanotubes, while keeping the length of the third side. The nanotubes undergo bending with increased length mismatch between their sides, until the distortion is significant enough to shorten them, as measured by AFM and single-molecule fluorescence photobleaching experiments. The method presented here produces dynamic and robust nanotubes that can potentially behave as actuators, and allows their site-specific addressability while using a minimal number of component strands.

  2. Solving large double digestion problems for DNA restriction mapping by using branch-and-bound integer linear programming.

    Science.gov (United States)

    Wu, Z; Zhang, Y

    2008-01-01

    The double digestion problem for DNA restriction mapping has been proved to be NP-complete and intractable if the numbers of the DNA fragments become large. Several approaches to the problem have been tested and proved to be effective only for small problems. In this paper, we formulate the problem as a mixed-integer linear program (MIP) by following (Waterman, 1995) in a slightly different form. With this formulation and using state-of-the-art integer programming techniques, we can solve randomly generated problems whose search space sizes are many-magnitude larger than previously reported testing sizes.

  3. Do chromatin changes around a nascent double strand DNA break spread spherically into linearly non-adjacent chromatin?

    OpenAIRE

    Savic, Velibor

    2013-01-01

    In the last decade, a lot has been done in elucidating the sequence of events that occur at the nascent double strand DNA break. Nevertheless, the overall structure formed by the DNA damage response (DDR) factors around the break site, the repair focus, remains poorly understood. Although most of the data presented so far only address events that occur in chromatin in cis around the break, there are strong indications that in mammalian systems it may also occur in trans, analogous to the rece...

  4. [Effect of single-stranded and double-stranded breaks on the melting temperature of phage T2 DNA].

    Science.gov (United States)

    Iurgaĭtis, A P; Lazurkin, Iu S; Bannikov, Iu A

    1979-01-01

    The effect of single- and double-stranded breaks in DNA phage T2, on the melting temperature of this DNA in the 0,05 M SSC solution, was investigated. The number of cleavages per 1000 nucleotide pairs varied in the range of 0 to 10. It is shown that single- and double-stranded breaks affect the melting temperature with approximately (within 20%) the same efficiency. The relationship between the melting temperature shift (delta Tm) and the number of cleavages is non-linear. The magnitude of the effect is characterized by delta Tm of 2 +/- 0.4 degrees C for the average inter-cleavage distance of 200 base pairs. It is shown that the observed melting curves are non-equilibrium ones, which is probably due to the fact that the effect of cleavages on the melting temperature is largely results from the complete and practically irreversible separation of strands.

  5. Antibiotic resistance in Pseudomonas aeruginosa strains with increased mutation frequency due to inactivation of the DNA oxidative repair system

    DEFF Research Database (Denmark)

    Mandsberg, Lotte F; Ciofu, Oana; Kirkby, N

    2009-01-01

    and antibiotic resistance. We have constructed and characterized mutT, mutY, and mutM mutants in P. aeruginosa strain PAO1. The mutT and mutY mutants showed 28- and 7.5-fold increases in mutation frequencies, respectively, over that for PAO1. These mutators had more oxidative DNA damage (higher levels of 7......,8-dihydro-8-oxodeoxyguanosine) than PAO1 after exposure to PMNs, and they developed resistance to antibiotics more frequently. The mechanisms of resistance were increased β-lactamase production and overexpression of the MexCD-OprJ efflux-pump. Mutations in either the mutT or the mutY gene were found...... in resistant HP clinical isolates from patients with CF, and complementation with wild-type genes reverted the phenotype. In conclusion, oxidative stress might be involved in the development of resistance to antibiotics. We therefore suggest the possible use of antioxidants for CF patients to prevent...

  6. Effect of live and inactivated Lactobacillus rhamnosus GG on experimentally induced rhinovirus colds: randomised, double blind, placebo-controlled pilot trial.

    Science.gov (United States)

    Kumpu, M; Kekkonen, R A; Korpela, R; Tynkkynen, S; Järvenpää, S; Kautiainen, H; Allen, E K; Hendley, J O; Pitkäranta, A; Winther, B

    2015-01-01

    The aim of this work was to investigate the usability of an experimental rhinovirus model in probiotic trials aiming to assess effectiveness in viral infections, and to provide preliminary data of live and inactivated probiotic Lactobacillus rhamnosus GG for larger-scale trials utilising the model. 59 subjects were randomised to receive 100 ml of fruit juice supplemented with 10(9) cfu of live or heat-inactivated (by spray-drying) L. rhamnosus GG or control juice daily for six weeks. After three weeks subjects were intranasally inoculated with experimental rhinovirus. Infection rate (at least one positive culture for challenge virus on five days following inoculation or at least four-fold rise in antibody response to challenge virus) was 14/19 in the group receiving live probiotic strain and 18/20 both in the group receiving heat-inactivated probiotic strain and in the control group (P=0.36). The occurrence and severity of cold symptoms on the five days following the inoculation was lowest in the group receiving live probiotic strain (P=0.45). This trial was the first one dedicated to the investigation of the effect of probiotics using the experimental rhinovirus model. The model showed potential for demonstration of efficacy of probiotics in controlled respiratory viral infections. Occurrence and severity of cold symptoms and number of subjects with rhinovirus infection was lowest in the group receiving live L. rhamnosus GG, but differences were not statistically significant. Further large-scale studies are needed to demonstrate the efficacy of L. rhamnosus GG in respiratory infections.

  7. DNA priming prior to inactivated influenza A(H5N1) vaccination expands the antibody epitope repertoire and increases affinity maturation in a boost-interval-dependent manner in adults.

    Science.gov (United States)

    Khurana, Surender; Wu, Jian; Dimitrova, Milena; King, Lisa R; Manischewitz, Jody; Graham, Barney S; Ledgerwood, Julie E; Golding, Hana

    2013-08-01

    DNA priming improves the response to inactivated influenza A(H5N1) vaccination. We compared the immunogenicity of an H5 DNA prime (using strain A/Indonesia/5/2005) followed by an H5N1 monovalent inactivated vaccine boost at 4, 8, 12, 16, or 24 weeks to that of 2 doses of H5N1 monovalent inactivated vaccine in adults. Antibody epitope repertoires were elucidated by genome-fragment phage-display library analysis, and antibody avidities for HA1 and HA2 domains were measured by surface plasmon resonance. H5 DNA priming expanded the H5-specific antibody epitope repertoire and enhanced antibody avidity to the HA1 (but not the HA2) domain in an interval-dependent manner. Enhanced HA1 binding and avidity after an interval of ≥12 weeks between prime and boost correlated with improved neutralization of homologous and heterologous H5N1 strains. Clinical trials registration NCT01086657.

  8. Iodination as a probe for small regions of disrupted secondary structure in double-stranded DNA

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank; Nes, Ingolf F.; Wells, Robert D.

    1976-01-01

    Conditions were established where the thallium-catalyzed iodination of random coil DNA proceeded 100–200 times faster than for native DNA. This reaction was explored as a probe for localized regions of disrupted base pairs in duplex DNA. A heteroduplex was constructed between DNA fragments produced......, if they existed within an otherwise helical DNA fragment 789 base pairs long. Iodination studies were performed on superhelical SV40 DNA and on linear plac DNA. Analysis of the relative amount of iodine in restriction endonuclease fragments of these DNAs revealed the absence of localized single-stranded regions....

  9. Correlativity study between expression of DNA double-strand break repair protein and radiosensitivity of tumor cells

    Institute of Scientific and Technical Information of China (English)

    Liang ZHUANG; Shiying YU; Xiaoyuan HUANG; Yang CAO; Huihua XIONG

    2009-01-01

    DNA double-strand break (DSB) is generally regarded as the most lethal of all DNA lesions after radiation. KuS0, DNA-PK catalytic subunit (DNA-PKcs) and ataxia telangiectasia mutated (ATM) proteins are major DSB repair proteins. In this study, survival fraction at 2Gy (SF2) values of eight human tumor cell lines (including four human cervical carcinoma cell lines HeLa, SiHa, C33A, Caski, three human breast carcinoma cell lines MCF-7, MDA-MB-231, MDA-MB-453, and one human lung carcinoma cell line A549) were acquired by clone formation assay, and western blot was applied to detect the expressions of Ku80, DNA-PKcs and ATM protein. The correlativity of protein expression with SF2 value was analyzed by Pearson linear correlation analysis. We found that the expression of the same protein in different cell lines and the expression of three proteins in the same cell line had a significant difference. The SF2 values were also different in eight tumor cell lines and there was a positive correlativity between the expression of DNA-PKcs and SF2 (r=0.723, P =0.043), but Ku80 and ATM expression had no correlation with SF2 (P>0.05). These findings suggest that the expression level of DNA-PKcs protein can be an indicator for predicting the radiosensitivity of tumor cells.

  10. DNA ligase IV and artemis act cooperatively to suppress homologous recombination in human cells: implications for DNA double-strand break repair.

    Science.gov (United States)

    Kurosawa, Aya; Saito, Shinta; So, Sairei; Hashimoto, Mitsumasa; Iwabuchi, Kuniyoshi; Watabe, Haruka; Adachi, Noritaka

    2013-01-01

    Nonhomologous end-joining (NHEJ) and homologous recombination (HR) are two major pathways for repairing DNA double-strand breaks (DSBs); however, their respective roles in human somatic cells remain to be elucidated. Here we show using a series of human gene-knockout cell lines that NHEJ repairs nearly all of the topoisomerase II- and low-dose radiation-induced DNA damage, while it negatively affects survival of cells harbouring replication-associated DSBs. Intriguingly, we find that loss of DNA ligase IV, a critical NHEJ ligase, and Artemis, an NHEJ factor with endonuclease activity, independently contribute to increased resistance to replication-associated DSBs. We also show that loss of Artemis alleviates hypersensitivity of DNA ligase IV-null cells to low-dose radiation- and topoisomerase II-induced DSBs. Finally, we demonstrate that Artemis-null human cells display increased gene-targeting efficiencies, particularly in the absence of DNA ligase IV. Collectively, these data suggest that DNA ligase IV and Artemis act cooperatively to promote NHEJ, thereby suppressing HR. Our results point to the possibility that HR can only operate on accidental DSBs when NHEJ is missing or abortive, and Artemis may be involved in pathway switching from incomplete NHEJ to HR.

  11. DNA ligase IV and artemis act cooperatively to suppress homologous recombination in human cells: implications for DNA double-strand break repair.

    Directory of Open Access Journals (Sweden)

    Aya Kurosawa

    Full Text Available Nonhomologous end-joining (NHEJ and homologous recombination (HR are two major pathways for repairing DNA double-strand breaks (DSBs; however, their respective roles in human somatic cells remain to be elucidated. Here we show using a series of human gene-knockout cell lines that NHEJ repairs nearly all of the topoisomerase II- and low-dose radiation-induced DNA damage, while it negatively affects survival of cells harbouring replication-associated DSBs. Intriguingly, we find that loss of DNA ligase IV, a critical NHEJ ligase, and Artemis, an NHEJ factor with endonuclease activity, independently contribute to increased resistance to replication-associated DSBs. We also show that loss of Artemis alleviates hypersensitivity of DNA ligase IV-null cells to low-dose radiation- and topoisomerase II-induced DSBs. Finally, we demonstrate that Artemis-null human cells display increased gene-targeting efficiencies, particularly in the absence of DNA ligase IV. Collectively, these data suggest that DNA ligase IV and Artemis act cooperatively to promote NHEJ, thereby suppressing HR. Our results point to the possibility that HR can only operate on accidental DSBs when NHEJ is missing or abortive, and Artemis may be involved in pathway switching from incomplete NHEJ to HR.

  12. DNA double strand break (DSB) induction and cell survival in iodine-enhanced computed tomography (CT)

    Science.gov (United States)

    Streitmatter, Seth W.; Stewart, Robert D.; Jenkins, Peter A.; Jevremovic, Tatjana

    2017-08-01

    A multi-scale Monte Carlo model is proposed to assess the dosimetric and biological impact of iodine-based contrast agents commonly used in computed tomography. As presented, the model integrates the general purpose MCNP6 code system for larger-scale radiation transport and dose assessment with the Monte Carlo damage simulation to determine the sub-cellular characteristics and spatial distribution of initial DNA damage. The repair-misrepair-fixation model is then used to relate DNA double strand break (DSB) induction to reproductive cell death. Comparisons of measured and modeled changes in reproductive cell survival for ultrasoft characteristic k-shell x-rays (0.25-4.55 keV) up to orthovoltage (200-500 kVp) x-rays indicate that the relative biological effectiveness (RBE) for DSB induction is within a few percent of the RBE for cell survival. Because of the very short range of secondary electrons produced by low energy x-ray interactions with contrast agents, the concentration and subcellular distribution of iodine within and near cellular targets have a significant impact on the estimated absorbed dose and number of DSB produced in the cell nucleus. For some plausible models of the cell-level distribution of contrast agent, the model predicts an increase in RBE-weighted dose (RWD) for the endpoint of DSB induction of 1.22-1.40 for a 5-10 mg ml-1 iodine concentration in blood compared to an RWD increase of 1.07  ±  0.19 from a recent clinical trial. The modeled RWD of 2.58  ±  0.03 is also in good agreement with the measured RWD of 2.3  ±  0.5 for an iodine concentration of 50 mg ml-1 relative to no iodine. The good agreement between modeled and measured DSB and cell survival estimates provides some confidence that the presented model can be used to accurately assess biological dose for other concentrations of the same or different contrast agents.

  13. A novel, topologically constrained DNA molecule containing a double Holliday junction: design, synthesis, and initial biochemical characterization.

    Science.gov (United States)

    Plank, Jody L; Hsieh, Tao-shih

    2006-06-23

    The double Holliday junction (dHJ) is a central intermediate to homologous recombination, but biochemical analysis of the metabolism of this structure has been hindered by the lack of a substrate that adequately replicates the endogenous structure. We have synthesized a novel dHJ substrate that consists of two small, double stranded DNA circles conjoined by two Holliday junctions (HJs). Its biochemical synthesis is based on the production of two pairs of single stranded circles from phagemids, followed by their sequential annealing with reverse gyrase. The sequence between the two HJs is identical on both strands, allowing the HJs to migrate without the generation of unpaired regions of DNA, whereas the distance between the HJs is on the order of gene conversion tracts thus far measured in Drosophila and mouse model systems. The structure of this substrate also provides similar topological constraint as would occur in an endogenous dHJ. Digestion of the dHJ substrate by T7 endonuclease I resolves the substrate into crossover and non-crossover products, as predicted by the Szostak model of double strand break repair. This substrate will greatly facilitate the examination of the mechanism of resolution of double Holliday junctions.

  14. Direct measurement of the intermolecular forces between counterion-condensed DNA double helices. Evidence for long range attractive hydration forces.

    Science.gov (United States)

    Rau, D C; Parsegian, V A

    1992-01-01

    Rather than acting by modifying van der Waals or electrostatic double layer interactions or by directly bridging neighboring molecules, polyvalent ligands bound to DNA double helices appear to act by reconfiguring the water between macromolecular surfaces to create attractive long range hydration forces. We have reached this conclusion by directly measuring the repulsive forces between parallel B-form DNA double helices pushed together from the separations at which they have self organized into hexagonal arrays of parallel rods. For all of the wide variety of "condensing agents" from divalent Mn to polymeric protamines, the resulting intermolecular force varies exponentially with a decay rate of 1.4-1.5 A, exactly one-half that seen previously for hydration repulsion. Such behavior qualitatively contradicts the predictions of all electrostatic double layer and van der Waals force potentials previously suggested. It fits remarkably well with the idea, developed and tested here, that multivalent counterion adsorption reorganizes the water at discrete sites complementary to unadsorbed sites on the apposing surface. The measured strength and range of these attractive forces together with their apparent specificity suggest the presence of a previously unexpected force in molecular organization.

  15. Human RECQ1 interacts with Ku70/80 and modulates DNA end-joining of double-strand breaks.

    Directory of Open Access Journals (Sweden)

    Swetha Parvathaneni

    Full Text Available Genomic instability is a known precursor to cancer and aging. The RecQ helicases are a highly conserved family of DNA-unwinding enzymes that play key roles in maintaining genome stability in all living organisms. Human RecQ homologs include RECQ1, BLM, WRN, RECQ4, and RECQ5β, three of which have been linked to diseases with elevated risk of cancer and growth defects (Bloom Syndrome and Rothmund-Thomson Syndrome or premature aging (Werner Syndrome. RECQ1, the first RecQ helicase discovered and the most abundant in human cells, is the least well understood of the five human RecQ homologs. We have previously described that knockout of RECQ1 in mice or knockdown of its expression in human cells results in elevated frequency of spontaneous sister chromatid exchanges, chromosomal instability, increased load of DNA damage and heightened sensitivity to ionizing radiation. We have now obtained evidence implicating RECQ1 in the nonhomologous end-joining pathway of DNA double-strand break repair. We show that RECQ1 interacts directly with the Ku70/80 subunit of the DNA-PK complex, and depletion of RECQ1 results in reduced end-joining in cell free extracts. In vitro, RECQ1 binds and unwinds the Ku70/80-bound partial duplex DNA substrate efficiently. Linear DNA is co-bound by RECQ1 and Ku70/80, and DNA binding by Ku70/80 is modulated by RECQ1. Collectively, these results provide the first evidence for an interaction of RECQ1 with Ku70/80 and a role of the human RecQ helicase in double-strand break repair through nonhomologous end-joining.

  16. Repair at single targeted DNA double-strand breaks in pluripotent and differentiated human cells.

    Directory of Open Access Journals (Sweden)

    Hua Fung

    Full Text Available Differences in ex vivo cell culture conditions can drastically affect stem cell physiology. We sought to establish an assay for measuring the effects of chemical, environmental, and genetic manipulations on the precision of repair at a single DNA double-strand break (DSB in pluripotent and somatic human cells. DSBs in mammalian cells are primarily repaired by either homologous recombination (HR or nonhomologous end-joining (NHEJ. For the most part, previous studies of DSB repair in human cells have utilized nonspecific clastogens like ionizing radiation, which are highly nonphysiologic, or assayed repair at randomly integrated reporters. Measuring repair after random integration is potentially confounded by locus-specific effects on the efficiency and precision of repair. We show that the frequency of HR at a single DSB differs up to 20-fold between otherwise isogenic human embryonic stem cells (hESCs based on the site of the DSB within the genome. To overcome locus-specific effects on DSB repair, we used zinc finger nucleases to efficiently target a DSB repair reporter to a safe-harbor locus in hESCs and a panel of somatic human cell lines. We demonstrate that repair at a targeted DSB is highly precise in hESCs, compared to either the somatic human cells or murine embryonic stem cells. Differentiation of hESCs harboring the targeted reporter into astrocytes reduces both the efficiency and precision of repair. Thus, the phenotype of repair at a single DSB can differ based on either the site of damage within the genome or the stage of cellular differentiation. Our approach to single DSB analysis has broad utility for defining the effects of genetic and environmental modifications on repair precision in pluripotent cells and their differentiated progeny.

  17. Preferential repair of DNA double-strand break at the active gene in vivo.

    Science.gov (United States)

    Chaurasia, Priyasri; Sen, Rwik; Pandita, Tej K; Bhaumik, Sukesh R

    2012-10-19

    Previous studies have demonstrated transcription-coupled nucleotide/base excision repair. We report here for the first time that DNA double-strand break (DSB) repair is also coupled to transcription. We generated a yeast strain by introducing a homing (Ho) endonuclease cut site followed by a nucleotide sequence for multiple Myc epitopes at the 3' end of the coding sequence of a highly active gene, ADH1. This yeast strain also contains the Ho cut site at the nearly silent or poorly active mating type α (MATα) locus and expresses Ho endonuclease under the galactose-inducible GAL1 promoter. Using this strain, DSBs were generated at the ADH1 and MATα loci in galactose-containing growth medium that induced HO expression. Subsequently, yeast cells were transferred to dextrose-containing growth medium to stop HO expression, and the DSB repair was monitored at the ADH1 and MATα loci by PCR, using the primer pairs flanking the Ho cut sites. Our results revealed a faster DSB repair at the highly active ADH1 than that at the nearly silent MATα locus, hence implicating a transcription-coupled DSB repair at the active gene in vivo. Subsequently, we extended this study to another gene, PHO5 (carrying the Ho cut site at its coding sequence), under transcriptionally active and inactive growth conditions. We found a fast DSB repair at the active PHO5 gene in comparison to its inactive state. Collectively, our results demonstrate a preferential DSB repair at the active gene, thus supporting transcription-coupled DSB repair in living cells.

  18. ERCC1-XPF Endonuclease Facilitates DNA Double-Strand Break Repair▿ †

    Science.gov (United States)

    Ahmad, Anwaar; Robinson, Andria Rasile; Duensing, Anette; van Drunen, Ellen; Beverloo, H. Berna; Weisberg, David B.; Hasty, Paul; Hoeijmakers, Jan H. J.; Niedernhofer, Laura J.

    2008-01-01

    ERCC1-XPF endonuclease is required for nucleotide excision repair (NER) of helix-distorting DNA lesions. However, mutations in ERCC1 or XPF in humans or mice cause a more severe phenotype than absence of NER, prompting a search for novel repair activities of the nuclease. In Saccharomyces cerevisiae, orthologs of ERCC1-XPF (Rad10-Rad1) participate in the repair of double-strand breaks (DSBs). Rad10-Rad1 contributes to two error-prone DSB repair pathways: microhomology-mediated end joining (a Ku86-independent mechanism) and single-strand annealing. To determine if ERCC1-XPF participates in DSB repair in mammals, mutant cells and mice were screened for sensitivity to gamma irradiation. ERCC1-XPF-deficient fibroblasts were hypersensitive to gamma irradiation, and γH2AX foci, a marker of DSBs, persisted in irradiated mutant cells, consistent with a defect in DSB repair. Mutant mice were also hypersensitive to irradiation, establishing an essential role for ERCC1-XPF in protecting against DSBs in vivo. Mice defective in both ERCC1-XPF and Ku86 were not viable. However, Ercc1−/− Ku86−/− fibroblasts were hypersensitive to gamma irradiation compared to single mutants and accumulated significantly greater chromosomal aberrations. Finally, in vitro repair of DSBs with 3′ overhangs led to large deletions in the absence of ERCC1-XPF. These data support the conclusion that, as in yeast, ERCC1-XPF facilitates DSB repair via an end-joining mechanism that is Ku86 independent. PMID:18541667

  19. Beyond repair foci: DNA double-strand break repair in euchromatic and heterochromatic compartments analyzed by transmission electron microscopy.

    Directory of Open Access Journals (Sweden)

    Yvonne Lorat

    Full Text Available PURPOSE: DNA double-strand breaks (DSBs generated by ionizing radiation pose a serious threat to the preservation of genetic and epigenetic information. The known importance of local chromatin configuration in DSB repair raises the question of whether breaks in different chromatin environments are recognized and repaired by the same repair machinery and with similar efficiency. An essential step in DSB processing by non-homologous end joining is the high-affinity binding of Ku70-Ku80 and DNA-PKcs to double-stranded DNA ends that holds the ends in physical proximity for subsequent repair. METHODS AND MATERIALS: Using transmission electron microscopy to localize gold-labeled pKu70 and pDNA-PKcs within nuclear ultrastructure, we monitored the formation and repair of actual DSBs within euchromatin (electron-lucent and heterochromatin (electron-dense in cortical neurons of irradiated mouse brain. RESULTS: While DNA lesions in euchromatin (characterized by two pKu70-gold beads, reflecting the Ku70-Ku80 heterodimer are promptly sensed and rejoined, DNA packaging in heterochromatin appears to retard DSB processing, due to the time needed to unravel higher-order chromatin structures. Complex pKu70-clusters formed in heterochromatin (consisting of 4 or ≥ 6 gold beads may represent multiple breaks in close proximity caused by ionizing radiation of highly-compacted DNA. All pKu70-clusters disappeared within 72 hours post-irradiation, indicating efficient DSB rejoining. However, persistent 53BP1 clusters in heterochromatin (comprising ≥ 10 gold beads, occasionally co-localizing with γH2AX, but not pKu70 or pDNA-PKcs, may reflect incomplete or incorrect restoration of chromatin structure rather than persistently unrepaired DNA damage. DISCUSSION: Higher-order organization of chromatin determines the accessibility of DNA lesions to repair complexes, defining how readily DSBs are detected and processed. DNA lesions in heterochromatin appear to be more

  20. Label-Free and Separation-Free Atomic Fluorescence Spectrometry-Based Bioassay: Sensitive Determination of Single-Strand DNA, Protein, and Double-Strand DNA.

    Science.gov (United States)

    Chen, Piaopiao; Wu, Peng; Chen, Junbo; Yang, Peng; Zhang, Xinfeng; Zheng, Chengbin; Hou, Xiandeng

    2016-02-16

    Based on selective and sensitive determination of Hg(2+) released from mercury complex by cold vapor generation (CVG) atomic fluorescence spectrometry (AFS) using SnCl2 as a reductant, a novel label-free and separation-free strategy was proposed for DNA and protein bioassay. To construct the DNA bioassay platform, an Hg(2+)-mediated molecular beacon (hairpin) without labeling but possessing several thymine (T) bases at both ends was employed as the probe. It is well-known that Hg(2+) could trigger the formation of the hairpin structure through T-Hg(2+)-T connection. In the presence of a specific target, the hairpin structure could be broken and the captured Hg(2+) was released. Interestingly, it was found that SnCl2 could selectively reduce only free Hg(2+) to Hg(0) vapor in the presence of T-Hg(2+)-T complex, which could be separated from sample matrices for sensitive AFS detection. Three different types of analyte, namely, single-strand DNA (ssDNA), protein, and double-strand DNA (dsDNA), were investigated as the target analytes. Under the optimized conditions, this bioassay provided high sensitivity for ssDNA, protein, and dsDNA determination with the limits of detection as low as 0.2, 0.08, and 0.3 nM and the linear dynamic ranges of 10-150, 5-175, and 1-250 nM, respectively. The analytical performance for these analytes compares favorably with those by previously reported methods, demonstrating the potential usefulness and versatility of this new AFS-based bioassay. Moreover, the bioassay retains advantages of simplicity, cost-effectiveness, and sensitivity compared to most of the conventional methods.

  1. Single nucleotide-level mapping of DNA double-strand breaks in human HEK293T cells

    Directory of Open Access Journals (Sweden)

    Bernard J. Pope

    2017-03-01

    Full Text Available Constitutional biological processes involve the generation of DNA double-strand breaks (DSBs. The production of such breaks and their subsequent resolution are also highly relevant to neurodegenerative diseases and cancer, in which extensive DNA fragmentation has been described Stephens et al. (2011, Blondet et al. (2001. Tchurikov et al. Tchurikov et al. (2011, 2013 have reported previously that frequent sites of DSBs occur in chromosomal domains involved in the co-ordinated expression of genes. This group report that hot spots of DSBs in human HEK293T cells often coincide with H3K4me3 marks, associated with active transcription Kravatsky et al. (2015 and that frequent sites of DNA double-strand breakage are likely to be relevant to cancer genomics Tchurikov et al. (2013, 2016 . Recently, they applied a RAFT (rapid amplification of forum termini protocol that selects for blunt-ended DSB sites and mapped these to the human genome within defined co-ordinate ‘windows’. In this paper, we re-analyse public RAFT data to derive sites of DSBs at the single-nucleotide level across the built genome for human HEK293T cells (https://figshare.com/s/35220b2b79eaaaf64ed8. This refined mapping, combined with accessory ENCODE data tracks and ribosomal DNA-related sequence annotations, will likely be of value for the design of clinically relevant targeted assays such as those for cancer susceptibility, diagnosis, treatment-matching and prognostication.

  2. Smc5–Smc6 mediate DNA double-strand-break repair by promoting sister-chromatid recombination

    Science.gov (United States)

    De Piccoli, Giacomo; Cortes-Ledesma, Felipe; Ira, Gregory; Torres-Rosell, Jordi; Uhle, Stefan; Farmer, Sarah; Hwang, Ji-Young; Machin, Felix; Ceschia, Audrey; McAleenan, Alexandra; Cordon-Preciado, Violeta; Clemente-Blanco, Andrés; Vilella-Mitjana, Felip; Ullal, Pranav; Jarmuz, Adam; Leitao, Beatriz; Bressan, Debra; Dotiwala, Farokh; Papusha, Alma; Zhao, Xiaolan; Myung, Kyungjae; Haber, James E.; Aguilera, Andrés; Aragón, Luis

    2015-01-01

    DNA double-strand breaks (DSB) can arise during DNA replication, or after exposure to DNA-damaging agents, and their correct repair is fundamental for cell survival and genomic stability. Here, we show that the Smc5–Smc6 complex is recruited to DSBs de novo to support their repair by homologous recombination between sister chromatids. In addition, we demonstrate that Smc5–Smc6 is necessary to suppress gross chromosomal rearrangements. Our findings show that the Smc5–Smc6 complex is essential for genome stability as it promotes repair of DSBs by error-free sister-chromatid recombination (SCR), thereby suppressing inappropriate non-sister recombination events. PMID:16892052

  3. An in vitro DNA double-strand break repair assay based on end-joining of defined duplex oligonucleotides.

    Science.gov (United States)

    Datta, Kamal; Purkayastha, Shubhadeep; Neumann, Ronald D; Winters, Thomas A

    2012-01-01

    DNA double-strand breaks (DSBs) are caused by endogenous cellular processes such as oxidative metabolism, or by exogenous events like exposure to ionizing radiation or other genotoxic agents. Repair of these DSBs is essential for the maintenance of cellular genomic integrity. In human cells, and cells of other higher eukaryotes, DSBs are primarily repaired by the nonhomologous end-joining (NHEJ) DSB repair pathway. Most in vitro assays that have been designed to measure NHEJ activity employ linear plasmid DNA as end-joining substrates, and such assays have made significant contributions to our understanding of the biochemical mechanisms of NHEJ. Here we describe an in vitro end-joining assay employing linear oligonucleotides that has distinct advantages over plasmid-based assays for the study of structure-function relationships between the proteins of the NHEJ pathway and synthetic DNA end-joining substrates possessing predetermined DSB configurations and chemistries.

  4. Adaptation of the neutral bacterial comet assay to assess antimicrobial-mediated DNA double-strand breaks in Escherichia coli

    Science.gov (United States)

    SOLANKY, DIPESH; HAYDEL, SHELLEY E.

    2012-01-01

    This study aimed to determine the mechanism of action of a natural antibacterial clay mineral mixture, designated CB, by investigating the induction of DNA double-strand breaks (DSBs) in Escherichia coli. To quantify DNA damage upon exposure to soluble antimicrobial compounds, we modified a bacterial neutral comet assay, which primarily associates the general length of an electrophoresed chromosome, or comet, with the degree of DSB-associated DNA damage. To appropriately account for antimicrobial-mediated strand fragmentation, suitable control reactions consisting of exposures to water, ethanol, kanamycin, and bleomycin were developed and optimized for the assay. Bacterial exposure to the CB clay resulted in significantly longer comet lengths, compared to water and kanamycin exposures, suggesting that the induction of DNA DSBs contributes to the killing activity of this antibacterial clay mineral mixture. The comet assay protocol described herein provides a general technique for evaluating soluble antimicrobial-derived DNA damage and for comparing DNA fragmentation between experimental and control assays. PMID:22940101

  5. UV-inactivated vaccinia virus (VV) in a multi-envelope DNA-VV-protein (DVP) HIV-1 vaccine protects macaques from lethal challenge with heterologous SHIV

    Science.gov (United States)

    Jones, Bart G; Sealy, Robert E; Zhan, Xiaoyan; Freiden, Pamela J; Surman, Sherri L; Blanchard, James L.; Hurwitz, Julia L

    2012-01-01

    The pandemic of HIV-1 has continued for decades, yet there remains no licensed vaccine. Previous research has demonstrated the effectiveness of a multi-envelope, multi-vectored HIV-1 vaccine in a macaque-SHIV model, illustrating a potential means of combating HIV-1. Specifically, recombinant DNA, vaccinia virus (VV) and purified protein (DVP) delivery systems were used to vaccinate animals with dozens of antigenically-distinct HIV-1 envelopes for induction of immune breadth. The vaccinated animals controlled disease following challenge with a heterologous SHIV. This demonstration suggested that the antigenic cocktail vaccine strategy, which has succeeded in several other vaccine fields (e.g. pneumococcus), might also succeed against HIV-1. The strategy remains untested in an advanced clinical study, in part due to safety concerns associated with the use of replication-competent VV. To address this concern, we designed a macaque study in which psoralen/ultraviolet light-inactivated VV (UV VV) was substituted for replication-competent VV in the multi-envelope DVP protocol. Control animals received a vaccine encompassing no VV, or no vaccine. All VV vaccinated animals generated an immune response toward VV, and all vaccinated animals generated an immune response toward HIV-1 envelope. After challenge with heterologous SHIV 89.6P, animals that received replication-competent VV or UV VV experienced similar outcomes. They exhibited reduced peak viral loads, maintenance of CD4+ T cell counts and improved survival compared to control animals that received no VV or no vaccine; there were 0/15 deaths among all animals that received VV and 5/9 deaths among controls. Results define a practical means of improving VV safety, and encourage advancement of a promising multi-envelope DVP HIV-1 vaccine candidate. PMID:22425790

  6. Studies of interaction between safranine T and double helix DNA by spectral methods.

    Science.gov (United States)

    Cao, Y; He, X W

    1998-06-01

    In this paper, the DNA affinity properties of Safranine T (ST), which features a phenazinyl group, were studied. The studies indicated that ST could intercalate into the stack base pairs of DNA. Intrinsic binding constants obtained by different spectral methods were consistent within experimental errors. They were of the order of 10(4) M-1 in DNA base pairs, and the binding site size was about 7 in DNA base pairs. Studies of fluorescence quenching by anionic quenchers and melting temperature of DNA all supported the intercalative binding of ST with DNA. The experiments also showed that electrostatic binding played an important role in the interaction of ST with DNA. This research offers a new intercalation functional group to DNA-targeted drug design.

  7. Deficiency of double-strand DNA break repair does not impair Mycobacterium tuberculosis virulence in multiple animal models of infection.

    Science.gov (United States)

    Heaton, Brook E; Barkan, Daniel; Bongiorno, Paola; Karakousis, Petros C; Glickman, Michael S

    2014-08-01

    Mycobacterium tuberculosis persistence within its human host requires mechanisms to resist the effector molecules of host immunity, which exert their bactericidal effects through damaging pathogen proteins, membranes, and DNA. Substantial evidence indicates that bacterial pathogens, including M. tuberculosis, require DNA repair systems to repair the DNA damage inflicted by the host during infection, but the role of double-strand DNA break (DSB) repair systems is unclear. Double-strand DNA breaks are the most cytotoxic form of DNA damage and must be repaired for chromosome replication to proceed. M. tuberculosis elaborates three genetically distinct DSB repair systems: homologous recombination (HR), nonhomologous end joining (NHEJ), and single-strand annealing (SSA). NHEJ, which repairs DSBs in quiescent cells, may be particularly relevant to M. tuberculosis latency. However, very little information is available about the phenotype of DSB repair-deficient M. tuberculosis in animal models of infection. Here we tested M. tuberculosis strains lacking NHEJ (a Δku ΔligD strain), HR (a ΔrecA strain), or both (a ΔrecA Δku strain) in C57BL/6J mice, C3HeB/FeJ mice, guinea pigs, and a mouse hollow-fiber model of infection. We found no difference in bacterial load, histopathology, or host mortality between wild-type and DSB repair mutant strains in any model of infection. These results suggest that the animal models tested do not inflict DSBs on the mycobacterial chromosome, that other repair pathways can compensate for the loss of NHEJ and HR, or that DSB repair is not required for M. tuberculosis pathogenesis.

  8. Fine resolution mapping of double-strand break sites for human ribosomal DNA units

    OpenAIRE

    Pope, Bernard J; Khalid Mahmood; Chol-hee Jung; Park, Daniel J

    2016-01-01

    DNA breakage arises during a variety of biological processes, including transcription, replication and genome rearrangements. In the context of disease, extensive fragmentation of DNA has been described in cancer cells and during early stages of neurodegeneration (Stephens et al., 2011 Stephens et al. (2011) [5]; Blondet et al., 2001 Blondet et al. (2001) [1]). Stults et al. (2009) Stults et al. (2009) [6] reported that human rDNA gene clusters are hotspots for recombination and that rDNA res...

  9. JNK Phosphorylates SIRT6 to Stimulate DNA Double-Strand Break Repair in Response to Oxidative Stress by Recruiting PARP1 to DNA Breaks.

    Science.gov (United States)

    Van Meter, Michael; Simon, Matthew; Tombline, Gregory; May, Alfred; Morello, Timothy D; Hubbard, Basil P; Bredbenner, Katie; Park, Rosa; Sinclair, David A; Bohr, Vilhelm A; Gorbunova, Vera; Seluanov, Andrei

    2016-09-06

    The accumulation of damage caused by oxidative stress has been linked to aging and to the etiology of numerous age-related diseases. The longevity gene, sirtuin 6 (SIRT6), promotes genome stability by facilitating DNA repair, especially under oxidative stress conditions. Here we uncover the mechanism by which SIRT6 is activated by oxidative stress to promote DNA double-strand break (DSB) repair. We show that the stress-activated protein kinase, c-Jun N-terminal kinase (JNK), phosphorylates SIRT6 on serine 10 in response to oxidative stress. This post-translational modification facilitates the mobilization of SIRT6 to DNA damage sites and is required for efficient recruitment of poly (ADP-ribose) polymerase 1 (PARP1) to DNA break sites and for efficient repair of DSBs. Our results demonstrate a post-translational mechanism regulating SIRT6, and they provide the link between oxidative stress signaling and DNA repair pathways that may be critical for hormetic response and longevity assurance.

  10. JNK Phosphorylates SIRT6 to Stimulate DNA Double-Strand Break Repair in Response to Oxidative Stress by Recruiting PARP1 to DNA Breaks

    Directory of Open Access Journals (Sweden)

    Michael Van Meter

    2016-09-01

    Full Text Available The accumulation of damage caused by oxidative stress has been linked to aging and to the etiology of numerous age-related diseases. The longevity gene, sirtuin 6 (SIRT6, promotes genome stability by facilitating DNA repair, especially under oxidative stress conditions. Here we uncover the mechanism by which SIRT6 is activated by oxidative stress to promote DNA double-strand break (DSB repair. We show that the stress-activated protein kinase, c-Jun N-terminal kinase (JNK, phosphorylates SIRT6 on serine 10 in response to oxidative stress. This post-translational modification facilitates the mobilization of SIRT6 to DNA damage sites and is required for efficient recruitment of poly (ADP-ribose polymerase 1 (PARP1 to DNA break sites and for efficient repair of DSBs. Our results demonstrate a post-translational mechanism regulating SIRT6, and they provide the link between oxidative stress signaling and DNA repair pathways that may be critical for hormetic response and longevity assurance.

  11. The fluorophore 4',6-diamidino-2-phenylindole (DAPI) induces DNA folding in long double-stranded DNA.

    Science.gov (United States)

    Beccia, Maria Rosa; Biver, Tarita; Pardini, Alberto; Spinelli, Jacopo; Secco, Fernando; Venturini, Marcella; Busto Vázquez, Natalia; Lopez Cornejo, Maria Pilar; Martin Herrera, Victoria Isabel; Prado Gotor, Rafael

    2012-08-01

    DAPI (4',6-diamidino-2-phenylindole) is a widely used fluorescent dye, whose complicated binding features to DNAs and RNAs have been the object of debates and are still not fully understood. In this study, different approaches were employed, including binding equilibrium measurements (spectrofluorometry), melting experiments (spectrophotometry), viscometric measurements, circular dichroism, and T-jump kinetic analyses; all data concur in shedding light on the complex mechanistic aspects of the binding mode of DAPI to natural DNA. Conditions are found that induce the mode of the DAPI/DNA interaction to change from groove binding to intercalation. Moreover, it is observed, for the first time, that DAPI is able to induce the formation of a rather compact polymer-dye adduct under particular conditions. The results suggest that this form is a folded or coiled DNA structure stabilized by DAPI dye bridges.

  12. Dual roles for DNA polymerase theta in alternative end-joining repair of double-strand breaks in Drosophila.

    Directory of Open Access Journals (Sweden)

    Sze Ham Chan

    2010-07-01

    Full Text Available DNA double-strand breaks are repaired by multiple mechanisms that are roughly grouped into the categories of homology-directed repair and non-homologous end joining. End-joining repair can be further classified as either classical non-homologous end joining, which requires DNA ligase 4, or "alternative" end joining, which does not. Alternative end joining has been associated with genomic deletions and translocations, but its molecular mechanism(s are largely uncharacterized. Here, we report that Drosophila melanogaster DNA polymerase theta (pol theta, encoded by the mus308 gene and previously implicated in DNA interstrand crosslink repair, plays a crucial role in DNA ligase 4-independent alternative end joining. In the absence of pol theta, end joining is impaired and residual repair often creates large deletions flanking the break site. Analysis of break repair junctions from flies with mus308 separation-of-function alleles suggests that pol theta promotes the use of long microhomologies during alternative end joining and increases the likelihood of complex insertion events. Our results establish pol theta as a key protein in alternative end joining in Drosophila and suggest a potential mechanistic link between alternative end joining and interstrand crosslink repair.

  13. [Lethal effect after transmutation of 33P incorporated into bacteriophage S 13 and mechanisms of DNA double helix rupture].

    Science.gov (United States)

    Apelgot, S

    1980-04-01

    The experiments show the lethal effect of the beta decay of 33P incorporated in DNA of bacteriophage S 13. The lethal efficiency is high, 0.72 at 0 degrees C and 0.55 at--197 degrees C. The presence of a radical scavenger like AET has no influence. It was found previously that for such phages with single-stranded DNA, the lethal efficiency of 32P decay is unity, and that the lethal event is a DNA single-strand break, owing to the high energy of the nucleogenic 32S atom. As the recoil energy of the 33S atom is too low to account for such a break, it is suggested that the reorganization of the phosphate molecule into sulphate is able to bring about a DNA single-strand break with an efficiency as high as 0.7, at 0 degrees C. A model for the DNA double-strand-break produced by a transmutation processes is suggested.

  14. DNA double-strand braks serve as a major factor for the expression of Arabidopsis Argonaute 2

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Sung Beom; Chung, Moon Soo; Lee, Gun Woong; Chung, Byung Yeoup [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)

    2017-02-15

    Argonaute 2 (AtAGO2) is a well characterized effector protein in Arabidopsis for its functionalities associated with DNA double-strand break (DSB)-induced small RNAs (diRNAs) and for its inducible expression upon γ-irradiation. However, its transcriptional regulation depending on the recovery time after the irradiation and on the specific response to DSBs has been poorly understood. We analyzed the 1,313 bp promoter sequence of the AtAGO2 gene (1.3kb{sub pro}) to characterize the transcriptional regulation of AtAGO2 at various recovery times after γ-irradiation. A stable transformant harboring 1.3kbpro fused with GUS gene showed that the AtAGO2 is highly expressed in response to γ-irradiation, after which the expression of the gene is gradually decreased until 5 days of DNA damage recovery. We also confrm that the AtAGO2 expression patterns are similar to that of γ-irradiation after the treatments of radiomimetic genotoxins (bleomycin and zeocin). However, methyl methanesulfonate and mitomycin C, which are associated with the inhibition of DNA replication, do not induce the expression of the AtAGO2, suggesting that the expression of the AtAGO2 is closely related with DNA DSBs rather than DNA replication.

  15. Ligase I and ligase III mediate the DNA double-strand break ligation in alternative end-joining.

    Science.gov (United States)

    Lu, Guangqing; Duan, Jinzhi; Shu, Sheng; Wang, Xuxiang; Gao, Linlin; Guo, Jing; Zhang, Yu

    2016-02-02

    In eukaryotes, DNA double-strand breaks (DSBs), one of the most harmful types of DNA damage, are repaired by homologous repair (HR) and nonhomologous end-joining (NHEJ). Surprisingly, in cells deficient for core classic NHEJ factors such as DNA ligase IV (Lig4), substantial end-joining activities have been observed in various situations, suggesting the existence of alternative end-joining (A-EJ) activities. Several putative A-EJ factors have been proposed, although results are mostly controversial. By using a clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system, we generated mouse CH12F3 cell lines in which, in addition to Lig4, either Lig1 or nuclear Lig3, representing the cells containing a single DNA ligase (Lig3 or Lig1, respectively) in their nucleus, was completely ablated. Surprisingly, we found that both Lig1- and Lig3-containing complexes could efficiently catalyze A-EJ for class switching recombination (CSR) in the IgH locus and chromosomal deletions between DSBs generated by CRISPR/Cas9 in cis-chromosomes. However, only deletion of nuclear Lig3, but not Lig1, could significantly reduce the interchromosomal translocations in Lig4(-/-) cells, suggesting the unique role of Lig3 in catalyzing chromosome translocation. Additional sequence analysis of chromosome translocation junction microhomology revealed the specificity of different ligase-containing complexes. The data suggested the existence of multiple DNA ligase-containing complexes in A-EJ.

  16. Synthetic lethal targeting of DNA double strand break repair deficient cells by human apurinic/apyrimidinic endonuclease (APE1) inhibitors

    Science.gov (United States)

    Sultana, Rebeka; McNeill, Daniel R.; Abbotts, Rachel; Mohammed, Mohammed Z.; Zdzienicka, Małgorzata Z.; Qutob, Haitham; Seedhouse, Claire; Laughton, Charles A.; Fischer, Peter M.; Patel, Poulam M.; Wilson, David M.; Madhusudan, Srinivasan

    2013-01-01

    An apurinic/apyrimidinic (AP) site is an obligatory cytotoxic intermediate in DNA Base Excision Repair (BER) that is processed by human AP endonuclease 1 (APE1). APE1 is essential for BER and an emerging drug target in cancer. We have isolated novel small molecule inhibitors of APE1. In the current study we have investigated the ability of APE1 inhibitors to induce synthetic lethality in a panel of DNA double strand break (DSB) repair deficient and proficient cells; a) Chinese hamster (CH) cells: BRCA2 deficient (V-C8), ATM deficient (V-E5), wild type (V79) and BRCA2 revertant (V-C8(Rev1)). b) Human cancer cells: BRCA1 deficient (MDA-MB-436), BRCA1 proficient (MCF-7), BRCA2 deficient (CAPAN-1 and HeLa SilenciX cells), BRCA2 proficient (PANC1 and control SilenciX cells). We also tested synthetic lethality (SL) in CH ovary cells expressing a dominant–negative form of APE1 (E8 cells) using ATM inhibitors and DNA-PKcs inhibitors (DSB inhibitors). APE1 inhibitors are synthetically lethal in BRCA and ATM deficient cells. APE1 inhibition resulted in accumulation of DNA DSBs and G2/M cell cycle arrest. Synthetic lethality was also demonstrated in CH cells expressing a dominant–negative form of APE1 treated with ATM or DNA-PKcs inhibitors. We conclude that APE1 is a promising synthetic lethality target in cancer. PMID:22377908

  17. Post-irradiation chemical processing of DNA damage generates double-strand breaks in cells already engaged in repair

    Science.gov (United States)

    Singh, Satyendra K.; Wang, Minli; Staudt, Christian; Iliakis, George

    2011-01-01

    In cells exposed to ionizing radiation (IR), double-strand breaks (DSBs) form within clustered-damage sites from lesions disrupting the DNA sugar–phosphate backbone. It is commonly assumed that these DSBs form promptly and are immediately detected and processed by the cellular DNA damage response (DDR) apparatus. This assumption is questioned by the observation that after irradiation of naked DNA, a fraction of DSBs forms minutes to hours after exposure as a result of temperature dependent, chemical processing of labile sugar lesions. Excess DSBs also form when IR-exposed cells are processed at 50°C, but have been hitherto considered method-related artifact. Thus, it remains unknown whether DSBs actually develop in cells after IR exposure from chemically labile damage. Here, we show that irradiation of ‘naked’ or chromatin-organized mammalian DNA produces lesions, which evolve to DSBs and add to those promptly induced, after 8–24 h in vitro incubation at 37°C or 50°C. The conversion is more efficient in chromatin-associated DNA, completed within 1 h in cells and delayed in a reducing environment. We conclude that IR generates sugar lesions within clustered-damage sites contributing to DSB formation only after chemical processing, which occurs efficiently at 37°C. This subset of delayed DSBs may challenge DDR, may affect the perceived repair kinetics and requires further characterization. PMID:21745815

  18. I-SceI-mediated double-strand DNA breaks stimulate efficient gene targeting in the industrial fungus Trichoderma reesei.

    Science.gov (United States)

    Ouedraogo, Jean Paul; Arentshorst, Mark; Nikolaev, Igor; Barends, Sharief; Ram, Arthur F J

    2015-12-01

    Targeted integration of expression cassettes for enzyme production in industrial microorganisms is desirable especially when enzyme variants are screened for improved enzymatic properties. However, currently used methods for targeted integration are inefficient and result in low transformation frequencies. In this study, we expressed the Saccharomyces cerevisiae I-SceI meganuclease to generate double-strand breaks at a defined locus in the Trichoderma reesei genome. We showed that the double-strand DNA breaks mediated by I-SceI can be efficiently repaired when an exogenous DNA cassette flanked by regions homologous to the I-SceI landing locus was added during transformation. Transformation efficiencies increased approximately sixfold compared to control transformation. Analysis of the transformants obtained via I-SceI-mediated gene targeting showed that about two thirds of the transformants resulted from a homologous recombination event at the predetermined locus. Counter selection of the transformants for the loss of the pyrG marker upon integration of the DNA cassette showed that almost all of the clones contained the cassette at the predetermined locus. Analysis of independently obtained transformants using targeted integration of a glucoamylase expression cassette demonstrated that glucoamylase production among the transformants was high and showing limited variation. In conclusion, the gene targeting system developed in this study significantly increases transformation efficiency as well as homologous recombination efficiency and omits the use of Δku70 strains. It is also suitable for high-throughput screening of enzyme variants or gene libraries in T. reesei.

  19. Comparison of Immune Responses against FMD by a DNA Vaccine Encoding the FMDV/O/IRN/2007 VP1 Gene and the Conventional Inactivated Vaccine in an Animal Model

    Institute of Scientific and Technical Information of China (English)

    Farahnaz Motamedi Sedeh; Hoorieh Soleimanjahi; AmirReza Jalilian; Homayoon Mahravani

    2012-01-01

    Foot-and-mouth disease virus (FMDV) is highly contagious and responsible for huge outbreaks among cloven hoofed animals.The aim of the present study is to evaluate a plasmid DNA immunization system that expresses the FMDV/O/IRN/2007 VP1 gene and compare it with the conventional inactivated vaccine in an animal model.The VP1 gene was sub-cloned into the unique Kpn I and BamH I cloning sites of the pcDNA3.1+ and pEGFP-N1 vectors to construct the VP1 gene cassettes.The transfected BHKT7 cells with sub-cloned pEGFP-N1-VP1 vector expressed GFP-VP1 fusion protein and displayed more green fluorescence spots than the transfected BHKT7 cells with pEGFP-N1 vector,which solely expressed the GFP protein.Six mice groups were respectively immunized by the sub-cloned pcDNA3.1+-VP1 gene cassette as the DNA vaccine,DNA vaccine and PCMV-SPORT-GMCSF vector (as molecular adjuvant) together,conventional vaccine,PBS (as negative control),pcDNA3.1+ vector (as control group) and PCMV-SPORT vector that contained the GMCSF gene (as control group).Significant neutralizing antibody responses were induced in the mice which were immunized using plasmid vectors expressing the VP1 and GMCSF genes together,the DNA vaccine alone and the conventional inactivated vaccine (P<0.05).Co-administration of DNA vaccine and GMCSF gene improved neutralizing antibody response in comparison with administration of the DNA vaccine alone,but this response was the most for the conventional vaccine group.However,induction of humeral immunity response in the conventional vaccine group was more protective than for the DNA vaccine,but T-cell proliferation and IFN-γ concentration were the most in DNA vaccine with the GMCSF gene.Therefore the group that was vaccinated by DNA vaccine with the GMCSF gene,showed protective neutralizing antibody response and the most Th1 cellular immunity.

  20. Increased sister chromatid cohesion and DNA damage response factor localization at an enzyme-induced DNA double-strand break in vertebrate cells.

    LENUS (Irish Health Repository)

    Dodson, Helen

    2009-10-01

    The response to DNA damage in vertebrate cells involves successive recruitment of DNA signalling and repair factors. We used light microscopy to monitor the genetic dependencies of such localization to a single, induced DNA double strand break (DSB) in vertebrate cells. We used an inducible version of the rare-cutting I-SceI endonuclease to cut a chromosomally integrated I-SceI site beside a Tet operator array that was visualized by binding a Tet repressor-GFP fusion. Formation of gamma-H2AX foci at a single DSB was independent of ATM or Ku70. ATM-deficient cells showed normal kinetics of 53Bp1 recruitment to DSBs, but Rad51 localization was retarded. 53Bp1 and Rad51 foci formation at a single DSB was greatly reduced in H2AX-null DT40 cells. We also observed decreased inter-sister chromatid distances after DSB induction, suggesting that cohesin loading at DSBs causes elevated sister chromatid cohesion. Loss of ATM reduced DSB-induced cohesion, consistent with cohesin being an ATM target in the DSB response. These data show that the same genetic pathways control how cells respond to single DSBs and to multiple lesions induced by whole-cell DNA damage.

  1. Positive regulation of meiotic DNA double-strand break formation by activation of the DNA damage checkpoint kinase Mec1(ATR).

    Science.gov (United States)

    Gray, Stephen; Allison, Rachal M; Garcia, Valerie; Goldman, Alastair S H; Neale, Matthew J

    2013-07-31

    During meiosis, formation and repair of programmed DNA double-strand breaks (DSBs) create genetic exchange between homologous chromosomes-a process that is critical for reductional meiotic chromosome segregation and the production of genetically diverse sexually reproducing populations. Meiotic DSB formation is a complex process, requiring numerous proteins, of which Spo11 is the evolutionarily conserved catalytic subunit. Precisely how Spo11 and its accessory proteins function or are regulated is unclear. Here, we use Saccharomyces cerevisiae to reveal that meiotic DSB formation is modulated by the Mec1(ATR) branch of the DNA damage signalling cascade, promoting DSB formation when Spo11-mediated catalysis is compromised. Activation of the positive feedback pathway correlates with the formation of single-stranded DNA (ssDNA) recombination intermediates and activation of the downstream kinase, Mek1. We show that the requirement for checkpoint activation can be rescued by prolonging meiotic prophase by deleting the NDT80 transcription factor, and that even transient prophase arrest caused by Ndt80 depletion is sufficient to restore meiotic spore viability in checkpoint mutants. Our observations are unexpected given recent reports that the complementary kinase pathway Tel1(ATM) acts to inhibit DSB formation. We propose that such antagonistic regulation of DSB formation by Mec1 and Tel1 creates a regulatory mechanism, where the absolute frequency of DSBs is maintained at a level optimal for genetic exchange and efficient chromosome segregation.

  2. DNA-PK triggers histone ubiquitination and signaling in response to DNA double-strand breaks produced during the repair of transcription-blocking topoisomerase I lesions.

    Science.gov (United States)

    Cristini, Agnese; Park, Joon-Hyung; Capranico, Giovanni; Legube, Gaëlle; Favre, Gilles; Sordet, Olivier

    2016-02-18

    Although defective repair of DNA double-strand breaks (DSBs) leads to neurodegenerative diseases, the processes underlying their production and signaling in non-replicating cells are largely unknown. Stabilized topoisomerase I cleavage complexes (Top1cc) by natural compounds or common DNA alterations are transcription-blocking lesions whose repair depends primarily on Top1 proteolysis and excision by tyrosyl-DNA phosphodiesterase-1 (TDP1). We previously reported that stabilized Top1cc produce transcription-dependent DSBs that activate ATM in neurons. Here, we use camptothecin (CPT)-treated serum-starved quiescent cells to induce transcription-blocking Top1cc and show that those DSBs are generated during Top1cc repair from Top1 peptide-linked DNA single-strand breaks generated after Top1 proteolysis and before excision by TDP1. Following DSB induction, ATM activates DNA-PK whose inhibition suppresses H2AX and H2A ubiquitination and the later assembly of activated ATM into nuclear foci. Inhibition of DNA-PK also reduces Top1 ubiquitination and proteolysis as well as resumption of RNA synthesis suggesting that DSB signaling further enhances Top1cc repair. Finally, we show that co-transcriptional DSBs kill quiescent cells. Together, these new findings reveal that DSB production and signaling by transcription-blocking Top1 lesions impact on non-replicating cell fate and provide insights on the molecular pathogenesis of neurodegenerative diseases such as SCAN1 and AT syndromes, which are caused by TDP1 and ATM deficiency, respectively.

  3. 75 FR 62820 - Screening Framework Guidance for Providers of Synthetic Double-Stranded DNA

    Science.gov (United States)

    2010-10-13

    ... industrial development. One of the formal policy actions charged Federal Departments and Agencies to identify... research, biotechnology or requirement for DNA synthesis services). A customer that requests unusual...

  4. Induction of lupus-like renal damages by double stranded DNA derived from Trypanosoma equiperdum

    Institute of Scientific and Technical Information of China (English)

    XIA Yu-min; DING Guo-hua; XU Shi-zheng; JIANG Shan; YANG Hong-xia; XIONG La-yuan

    2006-01-01

    @@ Lupus nephritis is the most common visceral complication in the patients with systemic lupus erythematosus (SLE).1 It was evident that the anti-dsDNA antibodies were closely related to lupus nephritis, as seen in patients who had higher titers of serum anti-dsDNA antibodies had more severe renal lesions and even worse prognosis.2 So far it is still unknown how the dsDNA or anti-dsDNA antibody plays a role in the pathogenesis of lupus nephritis.

  5. ATM alters the otherwise robust chromatin mobility at sites of DNA double-strand breaks (DSBs in human cells.

    Directory of Open Access Journals (Sweden)

    Annabelle Becker

    Full Text Available Ionizing radiation induces DNA double strand breaks (DSBs which can lead to the formation of chromosome rearrangements through error prone repair. In mammalian cells the positional stability of chromatin contributes to the maintenance of genome integrity. DSBs exhibit only a small, submicron scale diffusive mobility, but a slight increase in the mobility of chromatin domains by the induction of DSBs might influence repair fidelity and the formation of translocations. The radiation-induced local DNA decondensation in the vicinity of DSBs is one factor potentially enhancing the mobility of DSB-containing chromatin domains. Therefore in this study we focus on the influence of different chromatin modifying proteins, known to be activated by the DNA damage response, on the mobility of DSBs. IRIF (ionizing radiation induced foci in U2OS cells stably expressing 53BP1-GFP were used as a surrogate marker of DSBs. Low angle charged particle irradiation, known to trigger a pronounced DNA decondensation, was used for the defined induction of linear tracks of IRIF. Our results show that movement of IRIF is independent of the investigated chromatin modifying proteins like ACF1 or PARP1 and PARG. Also depletion of proteins that tether DNA strands like MRE11 and cohesin did not alter IRIF dynamics significantly. Inhibition of ATM, a key component of DNA damage response signaling, resulted in a pronounced confinement of DSB mobility, which might be attributed to a diminished radiation induced decondensation. This confinement following ATM inhibition was confirmed using X-rays, proving that this effect is not restricted to densely ionizing radiation. In conclusion, repair sites of DSBs exhibit a limited mobility on a small spatial scale that is mainly unaffected by depletion of single remodeling or DNA tethering proteins. However, it relies on functional ATM kinase which is considered to influence the chromatin structure after irradiation.

  6. Identification and Characterization of Second-Generation Invader Locked Nucleic Acids (LNAs) for Mixed-Sequence Recognition of Double-Stranded DNA

    DEFF Research Database (Denmark)

    Sau, Sujay P; Madsen, Andreas S; Podbevsek, Peter;

    2013-01-01

    The development of synthetic agents that recognize double-stranded DNA (dsDNA) is a long-standing goal that is inspired by the promise for tools that detect, regulate, and modify genes. Progress has been made with triplex-forming oligonucleotides, peptide nucleic acids, and polyamides, but substa...

  7. Labeling of double-stranded DNA by ROX-dideoxycytosine triphosphate using terminal deoxynucleotidyl transferase and separation by capillary electrophoresis

    Energy Technology Data Exchange (ETDEWEB)

    Figeys, D.; Renborg, A.; Dovichi, N.J. (Univ. of Alberta, Edmonton, Alberta (Canada))

    1994-12-01

    Terminal transferase is used to add a single fluorescently labeled dideoxynucleotide to double-stranded DNA prepared by restriction endonuclease action on a bacteriophage. The product is separated by capillary electrophoresis with both hydroxypropylmethylcellulose and non-cross-linked polyacrylamide. The reaction products generate single peaks for each fragment with hydroxypropylmethylcellulose. However, the higher resolution separation produced by non-cross-linked polyacrylamide shows that the product contains two components for each restriction digest fragment. This labeling technique should be useful in restriction fragment length polymorphism studies. 9 refs., 2 figs.

  8. High-affinity triplex targeting of double stranded DNA using chemically modified peptide nucleic acid oligomers

    DEFF Research Database (Denmark)

    Hansen, Mads E; Bentin, Thomas; Nielsen, Peter E

    2009-01-01

    While sequence-selective dsDNA targeting by triplex forming oligonucleotides has been studied extensively, only very little is known about the properties of PNA-dsDNA triplexes-mainly due to the competing invasion process. Here we show that when appropriately modified using pseudoisocytosine subs...

  9. A strategy of tumor treatment in mice with doxorubicin-cyclophosphamide combination based on dendritic cell activation by human double-stranded DNA preparation

    OpenAIRE

    Alyamkina, Ekaterina A; Nikolin, Valeriy P; Popova, Nelly A.; Dolgova, Evgenia V; Proskurina, Anastasia S; Orishchenko, Konstantin E.; Efremov, Yaroslav R.; Chernykh, Elena R.; Ostanin, Alexandr A.; Sidorov, Sergey V; Ponomarenko, Dmitriy M.; Zagrebelniy, Stanislav N; Bogachev, Sergey S.; Shurdov, Mikhail A

    2010-01-01

    Background Immunization of mice with tumor homogenate after combined treatment with cyclophosphamide (CP) and double-stranded DNA (dsDNA) preparation is effective at inhibition of growth of tumor challenged after the treatment. It was assumed that this inhibition might be due to activation of the antigen-presenting cells. The purpose was to develop improved antitumor strategy using mice. We studied the combined action of cytostatics doxorubicin (Dox) plus CP with subsequent dsDNA preparation ...

  10. Editorial overview: Molecular and genetic bases of disease: the double life of DNA.

    Science.gov (United States)

    McMurray, Cynthia T; Vijg, Jan

    2014-06-01

    This issue of Current Opinions focuses on the dual role of DNA in life and death. In ancient Roman religion and myth, Janus is the god who looks both to the past and to the future. He guides the beginnings of life, its progression from one condition to another, and he foresees distant events. The analogy to DNA could not be stronger. Closely interacting with the environment, our basic genetics provides the origin of life, guides the quality of health with age, predicts disease, and ultimately foresees our end. A shared and deep interest with the origin of life has long prompted our desire to define aging, and, ultimately, to understand whether it can be reversed. In this special issue, the authors collectively review concepts of normative aging, DNA instability, DNA repair, the genetic contribution of age and diet to disease, and how the basic molecular transactions of DNA guide both the transitions to life as well as the transitions to death.

  11. Multiple-turnover cleavage of double-stranded DNA by sandwiched zinc-finger nuclease.

    Science.gov (United States)

    Mineta, Yusuke; Okamoto, Tomoyuki; Takenaka, Kosuke; Doi, Norio; Aoyama, Yasuhiro; Sera, Takashi

    2009-01-01

    To refine zinc-finger nuclease (ZFN) technology, we constructed a sandwiched ZFN, in which a DNA cleavage enzyme was sandwiched with two artificial zinc-finger proteins (AZPs). Because the sandwiched ZFN is designed to cleave the DNA between the two AZP-binding sites, the sandwiched ZFN is expected to bind preferentially to a DNA substrate rather than to cleavage products and thereby cleave it with multiple turnovers. To prove the concept, we sandwiched a staphylococcal nuclease (SNase), which cleaves DNA as a monomer, between two 3-finger AZPs. The AZP-sandwiched SNase cleaved large amounts of dsDNA site-specifically. Such multiple-turnover cleavage was not observed with control nucleases that possess a single AZP.

  12. Classical and alternative end-joining pathways for repair of lymphocyte-specific and general DNA double-strand breaks.

    Science.gov (United States)

    Boboila, Cristian; Alt, Frederick W; Schwer, Bjoern

    2012-01-01

    Classical nonhomologous end joining (C-NHEJ) is one of the two major known pathways for the repair of DNA double-strand breaks (DSBs) in mammalian cells. Our understanding of C-NHEJ has been derived, in significant part, through studies of programmed physiologic DNA DSBs formed during V(D)J recombination in the developing immune system. Studies of immunoglobulin heavy-chain (IgH) class-switch recombination (CSR) also have revealed that there is an "alternative" end-joining process (A-EJ) that can function, relatively robustly, in the repair of DSBs in activated mature B lymphocytes. This A-EJ process has also been implicated in the formation of oncogenic translocations found in lymphoid tumors. In this review, we discuss our current understanding of C-NHEJ and A-EJ in the context of V(D)J recombination, CSR, and the formation of chromosomal translocations. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Spectroscopic characterization of the interaction of phenosafranin and safranin O with double stranded, heat denatured and single stranded calf thymus DNA.

    Science.gov (United States)

    Saha, Ishita; Kumar, Gopinatha Suresh

    2011-01-01

    Interaction of phenosafranin and safranin O with double stranded, heat denatured and single stranded calf thymus DNA has been studied by fluorescence, absorbance and circular dichroic techniques. Binding to the double stranded and heat denatured DNA conformations induced strong quenching in the fluorescence spectra of both dyes. Linear Scatchard plots indicated the binding to be of one type and the affinity evaluated to be of the order of 10(5) M(-1) with double stranded and heat denatured DNAs. Fluorescence quenching was much weaker with the single stranded DNA and the binding affinity was one order lower. Ferrocyanide quenching studies revealed that the fluorescence emission of the dye molecules bound to the double stranded and heat denatured DNAs was quenched much less compared to that bound to the single stranded DNA. Further, there was significant emission polarization for the bound dyes and strong energy transfer from the DNA base pairs to the dye molecules indicating intercalative binding. Salt dependence of the binding phenomenon revealed that electrostatic forces have significant role in the binding process. The intercalation of these molecules to double stranded and heat denatured DNA and simple stacking to single strands was proved by these fluorescence techniques. Support to the fluorescence results have been derived from absorption and circular dichroic results. Phenosafranin was revealed to be a stronger binding species compared to safranin O.

  14. Extensive meiotic asynapsis in mice antagonises meiotic silencing of unsynapsed chromatin and consequently disrupts meiotic sex chromosome inactivation

    OpenAIRE

    Mahadevaiah, Shantha K.; Bourc'his, Déborah; Dirk G de Rooij; Bestor, Timothy H; James M A Turner; Burgoyne, Paul S

    2008-01-01

    Chromosome synapsis during zygotene is a prerequisite for the timely homologous recombinational repair of meiotic DNA double-strand breaks (DSBs). Unrepaired DSBs are thought to trigger apoptosis during midpachytene of male meiosis if synapsis fails. An early pachytene response to asynapsis is meiotic silencing of unsynapsed chromatin (MSUC), which, in normal males, silences the X and Y chromosomes (meiotic sex chromosome inactivation [MSCI]). In this study, we show that MSUC occurs in Spo11-...

  15. SU-E-T-241: Monte Carlo Simulation Study About the Prediction of Proton-Induced DNA Strand Breakage On the Double Helix Structure

    Energy Technology Data Exchange (ETDEWEB)

    Shin, J; Park, S; Jeong, J; Jeong, C [National Cancer Center, Goyang, Gyeonggi-do (Korea, Republic of); Lim, Y; Lee, S [National Cancer Center in Korea, Goyang, Gyeonggi-do (Korea, Republic of); SHIN, D [National Cancer Center, Goyangsi, Gyeonggi-do (Korea, Republic of); Incerti, S [Universite Bordeaux 1, CNRS.IN2P3, Centres d’Etudes Nucleaires de Bordeau, Gradignan, Gradignan (France)

    2014-06-01

    Purpose: In particle therapy and radiobiology, the investigation of mechanisms leading to the death of target cancer cells induced by ionising radiation is an active field of research. Recently, several studies based on Monte Carlo simulation codes have been initiated in order to simulate physical interactions of ionising particles at cellular scale and in DNA. Geant4-DNA is the one of them; it is an extension of the general purpose Geant4 Monte Carlo simulation toolkit for the simulation of physical interactions at sub-micrometre scale. In this study, we present Geant4-DNA Monte Carlo simulations for the prediction of DNA strand breakage using a geometrical modelling of DNA structure. Methods: For the simulation of DNA strand breakage, we developed a specific DNA geometrical structure. This structure consists of DNA components, such as the deoxynucleotide pairs, the DNA double helix, the nucleosomes and the chromatin fibre. Each component is made of water because the cross sections models currently available in Geant4-DNA for protons apply to liquid water only. Also, at the macroscopic-scale, protons were generated with various energies available for proton therapy at the National Cancer Center, obtained using validated proton beam simulations developed in previous studies. These multi-scale simulations were combined for the validation of Geant4-DNA in radiobiology. Results: In the double helix structure, the deposited energy in a strand allowed to determine direct DNA damage from physical interaction. In other words, the amount of dose and frequency of damage in microscopic geometries was related to direct radiobiological effect. Conclusion: In this report, we calculated the frequency of DNA strand breakage using Geant4- DNA physics processes for liquid water. This study is now on-going in order to develop geometries which use realistic DNA material, instead of liquid water. This will be tested as soon as cross sections for DNA material become available in Geant4

  16. Radiation Induced DNA Double Strand Break Studies of a Metal Sensitive Novel Bacterial Isolate from East Calcutta Wetland

    Directory of Open Access Journals (Sweden)

    Sanhita Chowdhury

    2009-01-01

    Full Text Available Problem statement: This study was an attempt to isolate anaerobic microbes with potential for DNA double strand break repair using methanogen specific medium (DSMZ 120 from East Calcutta Wetland in India. It also intended to verify the specificity of the medium for isolation of the desired family of microbe. Approach: Culture based technique was used to obtain the pure isolate that was further characterized in details. For double strand break repair studies, isolate was irradiated with different doses of 60Co gamma rays and its subsequent repair was observed using pulse field gel electrophoresis and asymmetric field inversion gel electrophoresis. Inhibitor was used to predict the mechanism of repair. Results: In this study we isolated and characterized a metal sensitive anaerobic microbial strain obtained using methanogen specific medium (DSMZ 120 from East Calcutta Wetland in India. The strain was one of the members of the group of uncultivated bacterium as evident from phylogenetic analysis, thus indicating the successful cultivation of an as yet uncultivable novel microbe (GenBank Acc. No. FJ 930097 and also the non-specific growth of microbes in prescribed medium. It was a Gram positive Bacilli, member of Fermicutes with optimum growth at 25°C and pH-7. The growth curve analysis showed a lag phase up to 24 h, log phase from 24-48 h, an early stationary phase from 96 h onwards. The strain could repair the DNA double strand break caused by irradiation with 60Co γ rays. The dose profile study revealed maximum repair at 60 Grays and thereafter a drop in repair ability with increase in irradiation dose. The time required for repair showed an essential incubation period of 4 h. The DNA polymerase inhibitor, Arabinose CTP inhibited the repair indicating the involvement of polymerase in the repair process and thus pointing towards homologous recombination as the underlying mechanism. Conclusion: In this study we were able to cultivate an as yet

  17. More efficient repair of DNA double-strand breaks in skeletal muscle stem cells compared to their committed progeny

    Directory of Open Access Journals (Sweden)

    Leyla Vahidi Ferdousi

    2014-11-01

    Full Text Available The loss of genome integrity in adult stem cells results in accelerated tissue aging and is possibly cancerogenic. Adult stem cells in different tissues appear to react robustly to DNA damage. We report that adult skeletal stem (satellite cells do not primarily respond to radiation-induced DNA double-strand breaks (DSBs via differentiation and exhibit less apoptosis compared to other myogenic cells. Satellite cells repair these DNA lesions more efficiently than their committed progeny. Importantly, non-proliferating satellite cells and post-mitotic nuclei in the fiber exhibit dramatically distinct repair efficiencies. Altogether, reduction of the repair capacity appears to be more a function of differentiation than of the proliferation status of the muscle cell. Notably, satellite cells retain a high efficiency of DSB repair also when isolated from the natural niche. Finally, we show that repair of DSB substrates is not only very efficient but, surprisingly, also very accurate in satellite cells and that accurate repair depends on the key non-homologous end-joining factor DNA-PKcs.

  18. Crystal Structure of E. coli RecE Protein Reveals a Toroidal Tetramer for Processing Double-Stranded DNA Breaks

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jinjin; Xing, Xu; Herr, Andrew B.; Bell, Charles E.; (OSU); (UCIN)

    2009-07-21

    Escherichia coli RecE protein is part of the classical RecET recombination system that has recently been used in powerful new methods for genetic engineering. RecE binds to free double-stranded DNA (dsDNA) ends and processively digests the 5{prime}-ended strand to form 5{prime}-mononucleotides and a 3{prime}-overhang that is a substrate for single strand annealing promoted by RecT. Here, we report the crystal structure of the C-terminal nuclease domain of RecE at 2.8 {angstrom} resolution. RecE forms a toroidal tetramer with a central tapered channel that is wide enough to bind dsDNA at one end, but is partially plugged at the other end by the C-terminal segment of the protein. Four narrow tunnels, one within each subunit of the tetramer, lead from the central channel to the four active sites, which lie about 15 {angstrom} from the channel. The structure, combined with mutational studies, suggests a mechanism in which dsDNA enters through the open end of the central channel, the 5{prime}-ended strand passes through a tunnel to access one of the four active sites, and the 3{prime}-ended strand passes through the plugged end of the channel at the back of the tetramer.

  19. Spindle Checkpoint Factors Bub1 and Bub2 Promote DNA Double-Strand Break Repair by Nonhomologous End Joining.

    Science.gov (United States)

    Jessulat, Matthew; Malty, Ramy H; Nguyen-Tran, Diem-Hang; Deineko, Viktor; Aoki, Hiroyuki; Vlasblom, James; Omidi, Katayoun; Jin, Ke; Minic, Zoran; Hooshyar, Mohsen; Burnside, Daniel; Samanfar, Bahram; Phanse, Sadhna; Freywald, Tanya; Prasad, Bhanu; Zhang, Zhaolei; Vizeacoumar, Franco; Krogan, Nevan J; Freywald, Andrew; Golshani, Ashkan; Babu, Mohan

    2015-07-01

    The nonhomologous end-joining (NHEJ) pathway is essential for the preservation of genome integrity, as it efficiently repairs DNA double-strand breaks (DSBs). Previous biochemical and genetic investigations have indicated that, despite the importance of this pathway, the entire complement of genes regulating NHEJ remains unknown. To address this, we employed a plasmid-based NHEJ DNA repair screen in budding yeast (Saccharomyces cerevisiae) using 369 putative nonessential DNA repair-related components as queries. Among the newly identified genes associated with NHEJ deficiency upon disruption are two spindle assembly checkpoint kinases, Bub1 and Bub2. Both observation of resulting phenotypes and chromatin immunoprecipitation demonstrated that Bub1 and -2, either alone or in combination with cell cycle regulators, are recruited near the DSB, where phosphorylated Rad53 or H2A accumulates. Large-scale proteomic analysis of Bub kinases phosphorylated in response to DNA damage identified previously unknown kinase substrates on Tel1 S/T-Q sites. Moreover, Bub1 NHEJ function appears to be conserved in mammalian cells. 53BP1, which influences DSB repair by NHEJ, colocalizes with human BUB1 and is recruited to the break sites. Thus, while Bub is not a core component of NHEJ machinery, our data support its dual role in mitotic exit and promotion of NHEJ repair in yeast and mammals. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  20. Organization and dynamics of the nonhomologous end-joining machinery during DNA double-strand break repair.

    Science.gov (United States)

    Reid, Dylan A; Keegan, Sarah; Leo-Macias, Alejandra; Watanabe, Go; Strande, Natasha T; Chang, Howard H; Oksuz, Betul Akgol; Fenyo, David; Lieber, Michael R; Ramsden, Dale A; Rothenberg, Eli

    2015-05-19

    Nonhomologous end-joining (NHEJ) is a major repair pathway for DNA double-strand breaks (DSBs), involving synapsis and ligation of the broken strands. We describe the use of in vivo and in vitro single-molecule methods to define the organization and interaction of NHEJ repair proteins at DSB ends. Super-resolution fluorescence microscopy allowed the precise visualization of XRCC4, XLF, and DNA ligase IV filaments adjacent to DSBs, which bridge the broken chromosome and direct rejoining. We show, by single-molecule FRET analysis of the Ku/XRCC4/XLF/DNA ligase IV NHEJ ligation complex, that end-to-end synapsis involves a dynamic positioning of the two ends relative to one another. Our observations form the basis of a new model for NHEJ that describes the mechanism whereby filament-forming proteins bridge DNA DSBs in vivo. In this scheme, the filaments at either end of the DSB interact dynamically to achieve optimal configuration and end-to-end positioning and ligation.

  1. Induction of DNA double-strand breaks in primary gingival fibroblasts by exposure to dental resin composites.

    Science.gov (United States)

    Urcan, Ebru; Scherthan, Harry; Styllou, Marianthi; Haertel, Uschi; Hickel, Reinhard; Reichl, Franz-Xaver

    2010-03-01

    Dental resin composites and their reactive monomers/co-monomers have been shown to elicit cytotoxic responses in human gingival fibroblasts (HGF), and their metabolic radical intermediates have the potential to attack the DNA backbone, which may induce DNA double-strand breaks (DSBs). In this study we have tested the cytotoxicity and induction of DSBs by the most common composite resin monomers/co-monomers: BisGMA, HEMA, TEGDMA, and UDMA in gingival fibroblasts using the sensitive gamma-H2AX DNA repair focus assay. Our results show increasing monomer cytotoxicities in the order of BisGMA>UDMA>TEGDMA>HEMA, an order that was also observed for their capacity to induce DSBs. BisGMA at the EC50 concentration of 0.09 mm evoked the highest rate of gamma-H2AX foci-formation that was 11-fold higher DNA DSBs as compared to the negative controls that ranged between 0.25 and 0.5gamma-H2AX foci/HGF cell. Our results for the first time show that exposure to dental resin monomers can induce DSBs in primary human oral cavity cells, which underscores their genotoxic capacity.

  2. Ubiquitin-specific protease 5 is required for the efficient repair of DNA double-strand breaks.

    Directory of Open Access Journals (Sweden)

    Satoshi Nakajima

    Full Text Available During the DNA damage response (DDR, ubiquitination plays an important role in the recruitment and regulation of repair proteins. However, little is known about elimination of the ubiquitination signal after repair is completed. Here we show that the ubiquitin-specific protease 5 (USP5, a deubiquitinating enzyme, is involved in the elimination of the ubiquitin signal from damaged sites and is required for efficient DNA double-strand break (DSB repair. Depletion of USP5 sensitizes cells to DNA damaging agents, produces DSBs, causes delayed disappearance of γH2AX foci after Bleocin treatment, and influences DSB repair efficiency in the homologous recombination pathway but not in the non-homologous end joining pathway. USP5 co-localizes to DSBs induced by laser micro-irradiation in a RAD18-dependent manner. Importantly, polyubiquitin chains at sites of DNA damage remained for longer periods in USP5-depleted cells. Our results show that disassembly of polyubiquitin chains by USP5 at sites of damage is important for efficient DSB repair.

  3. Development of novel visual-plus quantitative analysis systems for studying DNA double-strand break repairs in zebrafish.

    Science.gov (United States)

    Liu, Jingang; Gong, Lu; Chang, Changqing; Liu, Cong; Peng, Jinrong; Chen, Jun

    2012-09-20

    The use of reporter systems to analyze DNA double-strand break (DSB) repairs, based on the enhanced green fluorescent protein (EGFP) and meganuclease such as I-Sce I, is usually carried out with cell lines. In this study, we developed three visual-plus quantitative assay systems for homologous recombination (HR), non-homologous end joining (NHEJ) and single-strand annealing (SSA) DSB repair pathways at the organismal level in zebrafish embryos. To initiate DNA DSB repair, we used two I-Sce I recognition sites in opposite orientation rather than the usual single site. The NHEJ, HR and SSA repair pathways were separately triggered by the injection of three corresponding I-Sce I-cut constructions, and the repair of DNA lesion caused by I-Sce I could be tracked by EGFP expression in the embryos. Apart from monitoring the intensity of green fluorescence, the repair frequencies could also be precisely measured by quantitative real-time polymerase chain reaction (qPCR). Analysis of DNA sequences at the DSB sites showed that NHEJ was predominant among these three repair pathways in zebrafish embryos. Furthermore, while HR and SSA reporter systems could be effectively decreased by the knockdown of rad51 and rad52, respectively, NHEJ could only be impaired by the knockdown of ligaseIV (lig4) when the NHEJ construct was cut by I-Sce I in vivo. More interestingly, blocking NHEJ with lig4-MO increased the frequency of HR, but decreased the frequency of SSA. Our studies demonstrate that the major mechanisms used to repair DNA DSBs are conserved from zebrafish to mammal, and zebrafish provides an excellent model for studying and manipulating DNA DSB repair at the organismal level.

  4. Development of Novel Visual-Plus Quantitative Analysis Systems for Studying DNA Double-Strand Break Repairs in Zebrafish

    Institute of Scientific and Technical Information of China (English)

    Jingang Liu; Lu Gong; Changqing Chang; Cong Liu; Jinrong Peng; Jun Chen

    2012-01-01

    The use of reporter systems to analyze DNA double-strand break (DSB) repairs,based on the enhanced green fluorescent protein (EGFP) and meganuclease such as I-Sce Ⅰ,is usually carried out with cell lines.In this study,we developed three visual-plus quantitative assay systems for homologous recombination (HR),non-homologous end joining (NHEJ) and single-strand annealing (SSA) DSB repair pathways at the organismal level in zebrafish embryos.To initiate DNA DSB repair,we used two I-Sce Ⅰ recognition sites in opposite orientation rather than the usual single site.The NHEJ,HR and SSA repair pathways were separately triggered by the injection of three corresponding I-Sce I-cut constructions,and the repair of DNA lesion caused by I-Sce Ⅰ could be tracked by EGFP expression in the embryos.Apart from monitoring the intensity of green fluorescence,the repair frequencies could also be precisely measured by quantitative real-time polymerase chain reaction (qPCR).Analysis of DNA sequences at the DSB sites showed that NHEJ was predominant among these three repair pathways in zebrafish embryos.Furthermore,while HR and SSA reporter systems could be effectively decreased by the knockdown of rad51 and rad52,respectively,NHEJ could only be impaired by the knockdown of ligaseⅣ (lig4) when the NHEJ construct was cut by I-Sce Ⅰ in vivo.More interestingly,blocking NHEJ with lig4-MO increased the frequency of HR,but decreased the frequency of SSA.Our studies demonstrate that the major mechanisms used to repair DNA DSBs are conserved from zebrafish to mammal,and zebrafish provides an excellent model for studying and manipulating DNA DSB repair at the organismal level.

  5. Influence of reduced glutathione on end-joining of DNA double-strand breaks: Cytogenetical and molecular approach.

    Science.gov (United States)

    Ghoshal, Nitin; Sharma, Sheetal; Banerjee, Atanu; Kurkalang, Sillarine; Raghavan, Sathees C; Chatterjee, Anupam

    2017-01-01

    Radiation induced DNA double-strand breaks (DSB) are the major initial lesions whose misrejoining may lead to exchange aberrations. However, the role of glutathione (GSH), a major cellular thiol, in regulating cell's sensitivity to DNA damaging agents is not well understood. Influence of endogenous GSH on the efficiency of X-rays and bleomycin (Blem) induced DNA DSBs end-joining has been tested here cytogenetically, in human lymphocytes and Hct116 cells. In another approach, oligomeric DNA (75bp) containing 5'-compatible and non-compatible overhangs mimicking the endogenous DSB were for rejoining in presence of cell-free extracts from cells having different endogenous GSH levels. Frequency of aberrations, particularly exchange aberrations, was significantly increased when Blem was combined with radiation. The exchange aberration frequency was further enhanced when combined treatment was given at 4°C since DNA lesions are poorly repaired at 4°C so that a higher number of DNA breaks persist and interact when shifted from 4°C to 37°C. The exchange aberrations increased further when the combined treatment was given to Glutathione-ester (GE) pre-treated cells, indicating more frequent rejoining of DNA lesions in presence of higher cellular GSH. This is further supported by the drastic reduction in frequency of exchange aberrations but significant increase in incidences of deletions when combined treatment was given to GSH-depleted cells. End-joining efficiency of DNA DSBs with compatible ends was better than for non-compatible ends. End-joining efficiency of testicular and MCF7 cell extracts was better than that of lungs and Hct116 cells. Cell extract made from GE-treated MCF-7 cells provided more efficient end-joining than from untreated and GSH-depleted cells. However, direct addition of GSH to the cell-free extracts showed considerable reduction in end-joining efficiency. Present data indicate that higher endogenous GSH favours rejoining of DNA DSBs (both

  6. Local compression properties of double-stranded DNA based on a dynamic simulation

    CERN Document Server

    Lei, Xiaoling; Fang, Haiping

    2013-01-01

    The local mechanical properties of DNA are believed to play an important role in their biological functions and DNA-based nanomechanical devices. Using a simple sphere-tip compression system, the local radial mechanical properties of DNA are systematically studied by changing the tip size. The compression simulation results for the 16 nm diameter sphere tip are well consistent with the experimental results. With the diameter of the tip decreasing, the radial compressive elastic properties under external loads become sensitive to the tip size and the local DNA conformation. There appears a suddenly force break in the compression-force curve when the sphere size is less than or equal to 12 nm diameter. The analysis of the hydrogen bonds and base stacking interaction shows there is a local unwinding process occurs. During the local unwinding process, first the hydrogen bonds between complement base pairs are broken. With the compression aggregating, the local backbones in the compression center are unwound from ...

  7. Effect of Hydrophobic and Hydrophilic Surfaces on the Stability of Double-Stranded DNA.

    Science.gov (United States)

    Elder, Robert M; Pfaendtner, Jim; Jayaraman, Arthi

    2015-06-08

    DNA hybridization is the foundation for numerous technologies like DNA origami and DNA sensing/microarrays. Using molecular simulations, enhanced-sampling methods, and free-energy calculations, we show the effects of hydrophilic and hydrophobic surfaces on DNA hybridization. Hydrophilic surfaces compete with terminal bases' H-bonds but stabilize central base stacking. Hydrophobic surfaces strengthen terminal H-bonds but destabilize central base stacking. Regardless of surface chemistry, for terminal bases, melting proceeds through breaking H-bonds, followed by unstacking from the neighboring base. For central bases in bulk or near hydrophobic surfaces, melting proceeds by disruption of H-bonds, followed by unstacking, whereas on hydrophilic surfaces, unstacking from one neighboring base precedes complete disruption of the H-bonds, followed by unstacking from the second neighboring base. Kinetic barriers to melting and hybridization show that the central bases melt rapidly near hydrophobic surfaces, which can accelerate conformational searching and thereby accelerate folding into the desired conformation.

  8. In Vitro Expansion of Bone Marrow Derived Mesenchymal Stem Cells Alters DNA Double Strand Break Repair of Etoposide Induced DNA Damage

    Directory of Open Access Journals (Sweden)

    Ian Hare

    2016-01-01

    Full Text Available Mesenchymal stem cells (MSCs are of interest for use in diverse cellular therapies. Ex vivo expansion of MSCs intended for transplantation must result in generation of cells that maintain fidelity of critical functions. Previous investigations have identified genetic and phenotypic alterations of MSCs with in vitro passage, but little is known regarding how culturing influences the ability of MSCs to repair double strand DNA breaks (DSBs, the most severe of DNA lesions. To investigate the response to DSB stress with passage in vitro, primary human MSCs were exposed to etoposide (VP16 at various passages with subsequent evaluation of cellular damage responses and DNA repair. Passage number did not affect susceptibility to VP16 or the incidence and repair kinetics of DSBs. Nonhomologous end joining (NHEJ transcripts showed little alteration with VP16 exposure or passage; however, homologous recombination (HR transcripts were reduced following VP16 exposure with this decrease amplified as MSCs were passaged in vitro. Functional evaluations of NHEJ and HR showed that MSCs were unable to activate NHEJ repair following VP16 stress in cells after successive passage. These results indicate that ex vivo expansion of MSCs alters their ability to perform DSB repair, a necessary function for cells intended for transplantation.

  9. Evaluation of the neutral comet assay for detection of alpha-particle induced DNA-double-strand-breaks; Evaluation des Comet Assays bei neutralem pH zur Detektion von α-Partikel induzierten DNA-Doppelstrangbruechen

    Energy Technology Data Exchange (ETDEWEB)

    Hofbauer, Daniela

    2010-10-20

    Aim of this study was to differentiate DNA-double-strand-breaks from DNA-single-strand-breaks on a single cell level, using the comet assay after α- and γ-irradiation. Americium-241 was used as a alpha-irradiation-source, Caesium-137 was used for γ-irradiation. Because of technical problems with both the neutral and alkaline comet assay after irradiation of gastric cancer cells and human lymphocytes, no definite differentiation of DNA-damage was possible.

  10. Phase, current, absorbance, and photoluminescence of double and triple metal ion-doped synthetic and salmon DNA thin films

    Science.gov (United States)

    Chopade, Prathamesh; Reddy Dugasani, Sreekantha; Reddy Kesama, Mallikarjuna; Yoo, Sanghyun; Gnapareddy, Bramaramba; Lee, Yun Woo; Jeon, Sohee; Jeong, Jun-Ho; Park, Sung Ha

    2017-10-01

    We fabricated synthetic double-crossover (DX) DNA lattices and natural salmon DNA (SDNA) thin films, doped with 3 combinations of double divalent metal ions (M2+)-doped groups (Co2+–Ni2+, Cu2+–Co2+, and Cu2+–Ni2+) and single combination of a triple M2+-doped group (Cu2+–Ni2+–Co2+) at various concentrations of M2+ ([M2+]). We evaluated the optimum concentration of M2+ ([M2+]O) (the phase of M2+-doped DX DNA lattices changed from crystalline (up to ([M2+]O) to amorphous (above [M2+]O)) and measured the current, absorbance, and photoluminescent characteristics of multiple M2+-doped SDNA thin films. Phase transitions (visualized in phase diagrams theoretically as well as experimentally) from crystalline to amorphous for double (Co2+–Ni2+, Cu2+–Co2+, and Cu2+–Ni2+) and triple (Cu2+–Ni2+–Co2+) dopings occurred between 0.8 mM and 1.0 mM of Ni2+ at a fixed 0.5 mM of Co2+, between 0.6 mM and 0.8 mM of Co2+ at a fixed 3.0 mM of Cu2+, between 0.6 mM and 0.8 mM of Ni2+ at a fixed 3.0 mM of Cu2+, and between 0.6 mM and 0.8 mM of Co2+ at fixed 2.0 mM of Cu2+ and 0.8 mM of Ni2+, respectively. The overall behavior of the current and photoluminescence showed increments as increasing [M2+] up to [M2+]O, then decrements with further increasing [M2+]. On the other hand, absorbance at 260 nm showed the opposite behavior. Multiple M2+-doped DNA thin films can be used in specific devices and sensors with enhanced optoelectric characteristics and tunable multi-functionalities.

  11. Histone chaperone Anp32e removes H2A.Z from DNA double-strand breaks and promotes nucleosome reorganization and DNA repair.

    Science.gov (United States)

    Gursoy-Yuzugullu, Ozge; Ayrapetov, Marina K; Price, Brendan D

    2015-06-16

    The repair of DNA double-strand breaks (DSBs) requires open, flexible chromatin domains. The NuA4-Tip60 complex creates these flexible chromatin structures by exchanging histone H2A.Z onto nucleosomes and promoting acetylation of histone H4. Here, we demonstrate that the accumulation of H2A.Z on nucleosomes at DSBs is transient, and that rapid eviction of H2A.Z is required for DSB repair. Anp32e, an H2A.Z chaperone that interacts with the C-terminal docking domain of H2A.Z, is rapidly recruited to DSBs. Anp32e functions to remove H2A.Z from nucleosomes, so that H2A.Z levels return to basal within 10 min of DNA damage. Further, H2A.Z removal by Anp32e disrupts inhibitory interactions between the histone H4 tail and the nucleosome surface, facilitating increased acetylation of histone H4 following DNA damage. When H2A.Z removal by Anp32e is blocked, nucleosomes at DSBs retain elevated levels of H2A.Z, and assume a more stable, hypoacetylated conformation. Further, loss of Anp32e leads to increased CtIP-dependent end resection, accumulation of single-stranded DNA, and an increase in repair by the alternative nonhomologous end joining pathway. Exchange of H2A.Z onto the chromatin and subsequent rapid removal by Anp32e are therefore critical for creating open, acetylated nucleosome structures and for controlling end resection by CtIP. Dynamic modulation of H2A.Z exchange and removal by Anp32e reveals the importance of the nucleosome surface and nucleosome dynamics in processing the damaged chromatin template during DSB repair.

  12. Significance of enzyme linked immunosorbent assay (ELISA) for antibodies to double stranded and single stranded DNA in patients with lupus nephritis: correlation with severity of renal histology.

    Science.gov (United States)

    Okamura, M; Kanayama, Y; Amastu, K; Negoro, N; Kohda, S; Takeda, T; Inoue, T

    1993-01-01

    The correlation between renal histology and class specific (IgG and IgM) antibodies to double stranded DNA (dsDNA) and single stranded DNA (ssDNA) was studied by enzyme linked immunosorbent assay (ELISA) in 40 untreated patients with systemic lupus erythematosus (SLE). The levels of IgG antibodies to dsDNA were significantly higher in patients with World Health Organisation class IV nephritis than in those with class I, class II, or class III nephritis. IgG antibodies to ssDNA were higher in patients with class IV than in those with class II nephritis. IgG antibodies to dsDNA showed a close correlation with the histological activity score and the amount of electron dense deposit. IgG antibodies to ssDNA showed only a weak correlation with the renal histological activity score. IgM antibodies to dsDNA and IgM antibodies to ssDNA were not correlated with renal histological features. Patients with moderate to severe nephritis had a lower ratio of IgM antibodies to dsDNA to IgG antibodies to dsDNA than those with mild nephritis. These results indicate that the measurement of IgG antibodies to dsDNA is predictive in evaluating renal histological activity in patients with SLE.

  13. A Monomer of Pif1 Unwinds Double-Stranded DNA and It Is Regulated by the Nature of the Non-Translocating Strand at the 3'-End.

    Science.gov (United States)

    Singh, Saurabh P; Koc, Katrina N; Stodola, Joseph L; Galletto, Roberto

    2016-03-27

    Using a DNA polymerase coupled assay and FRET (Förster resonance energy transfer)-based helicase assays, in this work, we show that a monomer of Saccharomyces cerevisiae Pif1 can unwind dsDNA (double-stranded DNA). The helicase activity of a Pif1 monomer is modulated by the nature of the 3'-ssDNA (single-stranded DNA) tail of the substrate and its effect on a Pif1-dependent re-winding activity that is coupled to the opening of dsDNA. We propose that, in addition to the ssDNA site on the protein that interacts with the translocating strand, Pif1 has a second site that binds the 3'-ssDNA of the substrate. Interaction of DNA with this site modulates the degree to which re-winding counteracts unwinding. Depending on the nature of the 3'-tail and the length of the duplex DNA to be unwound, this activity is sufficiently strong to mask the helicase activity of a monomer. In excess Pif1 over the DNA, the Pif1-dependent re-winding of the opened DNA strongly limits unwinding, independent of the 3'-tail. We propose that, in this case, binding of DNA to the second site is precluded and modulation of the Pif1-dependent re-winding activity is largely lost.

  14. The RSC and INO80 chromatin-remodeling complexes in DNA double-strand break repair.

    Science.gov (United States)

    Chambers, Anna L; Downs, Jessica A

    2012-01-01

    In eukaryotes, DNA is packaged into chromatin and is therefore relatively inaccessible to DNA repair enzymes. In order to perform efficient DNA repair, ATP-dependent chromatin-remodeling enzymes are required to alter the chromatin structure near the site of damage to facilitate processing and allow access to repair enzymes. Two of the best-studied remodeling complexes involved in repair are RSC (Remodels the Structure of Chromatin) and INO80 from Saccharomyces cerevisiae, which are both conserved in higher eukaryotes. RSC is very rapidly recruited to breaks and mobilizes nucleosomes to promote phosphorylation of H2A S129 and resection. INO80 enrichment at a break occurs later and is dependent on phospho-S129 H2A. INO80 activity at the break site also facilitates resection. Consequently, both homologous recombination and nonhomologous end-joining are defective in rsc mutants, while subsets of these repair pathways are affected in ino80 mutants.

  15. Ab initio determination of coarse-grained interactions in double stranded DNA

    Science.gov (United States)

    Hsu, Chia Wei; Fyta, Maria; Lakatos, Greg; Melchionna, Simone; Kaxiras, Efthimios

    2012-02-01

    We derive the coarse-grained interactions between DNA nucleotides from ab initio calculations using density functional theory (DFT). The interactions take into account the base and sequence specificity, and are decomposed into physically distinct contributions. The interactions energies calculated from DFT for a wide range of configurations are fitted to simple analytical expressions for use in the coarse-grained model, which reduces each nucleotide into two sites. This non-empirical model accurately yields structural properties of B-DNA even in extreme conditions, and predicts persistence length in excellent agreement with experiments. The model enables quantitative an efficient investigations of the dynamics of long DNA strands in various environments, making it possible to reach microsecond time scales and beyond.

  16. Ab initio determination of coarse-grained interactions in double-stranded DNA

    Science.gov (United States)

    Hsu, Chia Wei; Fyta, Maria; Lakatos, Greg; Melchionna, Simone; Kaxiras, Efthimios

    2012-09-01

    We derive the coarse-grained interactions between DNA nucleotides from ab initio total-energy calculations based on density functional theory (DFT). The interactions take into account base and sequence specificity, and are decomposed into physically distinct contributions that include hydrogen bonding, stacking interactions, backbone, and backbone-base interactions. The interaction energies of each contribution are calculated from DFT for a wide range of configurations and are fitted by simple analytical expressions for use in the coarse-grained model, which reduces each nucleotide into two sites. This model is not derived from experimental data, yet it successfully reproduces the stable B-DNA structure and gives good predictions for the persistence length. It may be used to realistically probe dynamics of DNA strands in various environments at the μs time scale and the μm length scale.

  17. Relationship between internal dosimetry and DNA double strand breaks in lymphocytes after radionuclide therapy; Zusammenhang zwischen physikalischer Dosimetrie und DNA Doppelstrangbruechen in Lymphozyten nach Radionuklidtherapie

    Energy Technology Data Exchange (ETDEWEB)

    Eberlein, Uta

    2015-09-30

    In radionuclide therapy radiopharmaceuticals are administered mostly systemically. Primarily, beta-emitters are used because of their short range in tissue. As a result the radiopharmaceutical distributes within the human body and accumulates in organs and target structures. Thus, the body is irradiated internally, in contrast to external irradiation in radiotherapy. The pattern of the activity distribution within the human body is determined by the physical and chemical properties of the radiopharmaceutical. Furthermore, the amount of activity and its accumulation in organs or tissues is essential for the calculation of the absorbed dose which defines the energy deposited in the body by ionizing radiation. During internal or external irradiation, patients are exposed to ionizing radiation which does not only destroy the malignant cells but also damages healthy tissue and cells. This is mainly caused by direct and indirect interaction of the radiation with the DNA which damages the DNA structure. Most frequently, there are single strand breaks and base damages. DNA double strand breaks (DSBs) are rare; nevertheless, they are the most critical lesions for cells as repairing the damage is difficult. Unrepaired or misrepaired DNA could cause mutations, chromosomal aberrations or lead to cell death. The formation of a DNA DSB in nuclear chromatin results in the rapid phosphorylation of the histone H2 variant H2AX, then called gamma-H2AX. Furthermore, DSBs also recruit the damage sensor 53BP1 to the chromatin surrounding the DSBs, which leads to 53BP1 and gamma-H2AX co-localization in the chromatin surrounding a DSB. By immunofluorescence staining with gamma-H2AX and 53BP1 antibodies those biomarkers can be addressed by microscopically visible DNA damage protein foci, this is also known as the DNA damage focus assay. With progression of DSB repair, gamma-H2AX and 53BP1 foci disappear. It is assumed that one focus corresponds to one DSB. Therefore, the number of foci per

  18. Replication-Dependent and Transcription-Dependent Mechanisms of DNA Double-Strand Break Induction by the Topoisomerase 2-Targeting Drug Etoposide

    OpenAIRE

    Margaret Tammaro; Peri Barr; Brett Ricci; Hong Yan

    2013-01-01

    Etoposide is a DNA topoisomerase 2-targeting drug widely used for the treatment of cancer. The cytoxicity of etoposide correlates with the generation of DNA double-strand breaks (DSBs), but the mechanism of how it induces DSBs in cells is still poorly understood. Catalytically, etoposide inhibits the re-ligation reaction of Top2 after it nicks the two strands of DNA, trapping it in a cleavable complex consisting of two Top2 subunits covalently linked to the 5' ends of DNA (Top2cc). Top2cc is ...

  19. Interleukin-9 Is Associated with Elevated Anti-Double-Stranded DNA Antibodies in Lupus-Prone Mice.

    Science.gov (United States)

    Yang, Ji; Li, Qiao; Yang, Xue; Li, Ming

    2015-04-15

    Interleukin (IL)-9, which is produced mainly by CD4(+) T cells, is implicated in mast cell-related allergic diseases, although its involvement in systemic lupus erythematosus (SLE) pathogenesis remains unclear. Thus, we investigated the presence of IL-9 in lupus-prone MRL/Mp-lpr/lpr (MRL/lpr) mice and examined the role of IL-9 in lupus pathogenesis. Increased levels of IL-9(+) lymphocytes were detected in the spleens and kidneys of MRL/lpr mice and increased IL-9 levels in the spleen correlated with PNA(+) germinal center (GC) cell expansion. The percentage of CD4(+)IL-9(+) (Th9) cells was increased in MRL/lpr mice and serum IL-9 levels were elevated and closely related to the production of antibodies against double-stranded DNA (dsDNA). IL-9 appears to promote B-cell proliferation and immunoglobulin production, which could be blocked by inhibition of signal transducer and activator of transcription 3 (STAT3). Treatment with neutralizing anti-IL-9 antibody in vivo decreased serum anti-dsDNA-antibody titers and alleviated lupus nephritis in MRL/lpr mice. Our findings indicate expansion of Th9 cells in lupus-prone MRL/lpr mice and the correlation of IL-9 with B-cell proliferation and autoantibody production. These findings suggest that IL-9 is a potential therapeutic target for SLE.

  20. Inhibition of proteasomal degradation of rpn4 impairs nonhomologous end-joining repair of DNA double-strand breaks.

    Directory of Open Access Journals (Sweden)

    Donghong Ju

    Full Text Available BACKGROUND: The proteasome homeostasis in Saccharomyces cerevisiae is regulated by a negative feedback circuit in which the transcription factor Rpn4 induces the proteasome genes and is rapidly degraded by the assembled proteasome. The integrity of the Rpn4-proteasome feedback loop is critical for cell viability under stressed conditions. We have demonstrated that inhibition of Rpn4 degradation sensitizes cells to DNA damage, particularly in response to high doses of DNA damaging agents. The underlying mechanism, however, remains unclear. METHODOLOGY/PRINCIPAL FINDINGS: Using yeast genetics and biochemical approach we show that inhibition of Rpn4 degradation displays a synthetic growth defect with deletion of the MEC1 checkpoint gene and sensitizes several checkpoint mutants to DNA damage. In addition, inhibition of Rpn4 degradation leads to a defect in repair of double-strand breaks (DSBs by nonhomologous end-joining (NHEJ. The expression levels of several key NHEJ genes are downregulated and the recruitment of Yku70 to a DSB is reduced by inhibition of Rpn4 degradation. We find that Rpn4 and the proteasome are recruited to a DSB, suggesting their direct participation in NHEJ. Inhibition of Rpn4 degradation may result in a concomitant delay of release of Rpn4 and the proteasome from a DSB. CONCLUSION/SIGNIFICANCE: This study provides the first evidence for the role of proteasomal degradation of Rpn4 in NHEJ.

  1. c-Myc directly regulates the transcription of the NBS1 gene involved in DNA double-strand break repair.

    Science.gov (United States)

    Chiang, Yu-Chi; Teng, Shu-Chun; Su, Yi-Ning; Hsieh, Fon-Jou; Wu, Kou-Juey

    2003-05-23

    The c-myc proto-oncogene encodes a ubiquitous transcription factor involved in the control of cell growth and implicated in inducing tumorigenesis. Understanding the function of c-Myc and its role in cancer depends upon the identification of c-Myc target genes. Nijmegen breakage syndrome (NBS) is a chromosomal-instability syndrome associated with cancer predisposition, radiosensitivity, and chromosomal instability. The NBS gene product, NBS1 (p95 or nibrin), is a part of the hMre11 complex, a central player associated with double-strand break (DSB) repair. NBS1 contains domains characteristic for proteins involved in DNA repair, recombination, and replication. Here we show that c-Myc directly activates NBS1. c-Myc-mediated induction of NBS1 gene transcription occurs in different tissues, is independent of cell proliferation, and is mediated by a c-Myc binding site in the intron 1 region of NBS1 gene. Overexpression of NBS1 in Rat1a cells increased cell proliferation. These results indicate that NBS1 is a direct transcriptional target of c-Myc and links the function of c-Myc to the regulation of DNA DSB repair pathway operating during DNA replication.

  2. High-resolution profiling of gammaH2AX around DNA double strand breaks in the mammalian genome.

    Science.gov (United States)

    Iacovoni, Jason S; Caron, Pierre; Lassadi, Imen; Nicolas, Estelle; Massip, Laurent; Trouche, Didier; Legube, Gaëlle

    2010-04-21

    Chromatin acts as a key regulator of DNA-related processes such as DNA damage repair. Although ChIP-chip is a powerful technique to provide high-resolution maps of protein-genome interactions, its use to study DNA double strand break (DSB) repair has been hindered by the limitations of the available damage induction methods. We have developed a human cell line that permits induction of multiple DSBs randomly distributed and unambiguously positioned within the genome. Using this system, we have generated the first genome-wide mapping of gammaH2AX around DSBs. We found that all DSBs trigger large gammaH2AX domains, which spread out from the DSB in a bidirectional, discontinuous and not necessarily symmetrical manner. The distribution of gammaH2AX within domains is influenced by gene transcription, as parallel mappings of RNA Polymerase II and strand-specific expression showed that gammaH2AX does not propagate on active genes. In addition, we showed that transcription is accurately maintained within gammaH2AX domains, indicating that mechanisms may exist to protect gene transcription from gammaH2AX spreading and from the chromatin rearrangements induced by DSBs.

  3. Tel1 and Rif2 Regulate MRX Functions in End-Tethering and Repair of DNA Double-Strand Breaks.

    Directory of Open Access Journals (Sweden)

    Corinne Cassani

    2016-02-01

    Full Text Available The cellular response to DNA double-strand breaks (DSBs is initiated by the MRX/MRN complex (Mre11-Rad50-Xrs2 in yeast; Mre11-Rad50-Nbs1 in mammals, which recruits the checkpoint kinase Tel1/ATM to DSBs. In Saccharomyces cerevisiae, the role of Tel1 at DSBs remains enigmatic, as tel1Δ cells do not show obvious hypersensitivity to DSB-inducing agents. By performing a synthetic phenotype screen, we isolated a rad50-V1269M allele that sensitizes tel1Δ cells to genotoxic agents. The MRV1269MX complex associates poorly to DNA ends, and its retention at DSBs is further reduced by the lack of Tel1. As a consequence, tel1Δ rad50-V1269M cells are severely defective both in keeping the DSB ends tethered to each other and in repairing a DSB by either homologous recombination (HR or nonhomologous end joining (NHEJ. These data indicate that Tel1 promotes MRX retention to DSBs and this function is important to allow proper MRX-DNA binding that is needed for end-tethering and DSB repair. The role of Tel1 in promoting MRX accumulation to DSBs is counteracted by Rif2, which is recruited to DSBs. We also found that Rif2 enhances ATP hydrolysis by MRX and attenuates MRX function in end-tethering, suggesting that Rif2 can regulate MRX activity at DSBs by modulating ATP-dependent conformational changes of Rad50.

  4. Xbp1-mediated histone H4 deacetylation contributes to DNA double-strand break repair in yeast

    Institute of Scientific and Technical Information of China (English)

    Ran Tao; Hua Chen; Chan Gao; Pcng Xue; Fuquan Yang; Jing-Dong J Han; Bing Zhou; Ye-Guang Chen

    2011-01-01

    Xbp1 has been shown to regulate the cell cycle as a transcriptional repressor in budding yeast Saccharomyces cerevisiae.In this study,we demonstrated that Xbp1 regulates DNA double-strand break (DSB) repair in S.cerevisiae.Xbp1 physically and genetically interacts with the histone deacetylase Rpd3 complex.Chromatin immunoprecipitation revealed that Xbp1 is required for efficient deacetylation of histone H4 flanking DSBs by the Rpd3 complex.Deletion of XBP1 leads to the delayed deacetylation of histone H4,which is coupled with increased nucleosome displacement,increased DNA end resection and decreased non-homologous end-joining (NHEJ).In response to DNA damage,Xbp1 is upregulated in a Mec1-Rad9-Rad53 checkpoint pathway-dependent manner and undergoes dephosphorylation.Cdk1,a central regulator of S.cerevisiae cell cycle,is responsible for Xbp1 phosphorylation at residues Ser146,Ser271 and Ser551.Substitution of these serine residues with alanine not only increases the association of Xbp1 with the Rpd3 complex and its recruitment to a DSB,but also promotes DSB repair.Together,our findings reveal a role for Xbp1 in DSB repair via NHEJ through regulation of histone H4 acetylation and nucleosome displacement in a positive feedback manner.

  5. Double-strand break damage and associated DNA repair genes predispose smokers to gene methylation

    OpenAIRE

    Leng, Shuguang; Stidley, Christine A.; Willink, Randy; Bernauer, Amanda; Do, Kieu; Picchi, Maria A.; Sheng, Xin; Frasco, Melissa, A.; Berg, David Van Den; Gilliland, Frank D.; Zima, Christopher; Crowell, Richard E.; Belinsky, Steven A.

    2008-01-01

    Gene promoter hypermethylation in sputum is a promising biomarker for predicting lung cancer. Identifying factors that predispose smokers to methylation of multiple gene promoters in the lung could impact strategies for early detection and chemoprevention. This study evaluated the hypothesis that double-strand break repair capacity and sequence variation in genes in this pathway are associated with a high methylation index in a cohort of current and former cancer-free smokers. A 50% reduction...

  6. Opening of DNA double strands by helicases. Active versus passive opening

    CERN Document Server

    Betterton, M D

    2002-01-01

    Helicase opening of double-stranded nucleic acids may be "active" (the helicase directly destabilizes the dsNA to promote opening) or "passive" (the helicase binds ssNA available due to a thermal fluctuation which opens part of the dsNA). We describe helicase opening of dsNA, based on helicases which bind single NA strands and move towards the double-stranded region, using a discrete ``hopping'' model. The interaction between the helicase and the junction where the double strand opens is characterized by an interaction potential. The form of the potential determines whether the opening is active or passive. We calculate the rate of passive opening for the helicase PcrA, and show that the rate increases when the opening is active. Finally, we examine how to choose the interaction potential to optimize the rate of strand separation. One important result is our finding that active opening can increase the unwinding rate by 7 fold compared to passive opening.

  7. Functional redundancy between DNA ligases I and III in DNA replication in vertebrate cells

    Science.gov (United States)

    Arakawa, Hiroshi; Bednar, Theresa; Wang, Minli; Paul, Katja; Mladenov, Emil; Bencsik-Theilen, Alena A.; Iliakis, George

    2012-01-01

    In eukaryotes, the three families of ATP-dependent DNA ligases are associated with specific functions in DNA metabolism. DNA ligase I (LigI) catalyzes Okazaki-fragment ligation at the replication fork and nucleotide excision repair (NER). DNA ligase IV (LigIV) mediates repair of DNA double strand breaks (DSB) via the canonical non-homologous end-joining (NHEJ) pathway. The evolutionary younger DNA ligase III (LigIII) is restricted to higher eukaryotes and has been associated with base excision (BER) and single strand break repair (SSBR). Here, using conditional knockout strategies for LIG3 and concomitant inactivation of the LIG1 and LIG4 genes, we show that in DT40 cells LigIII efficiently supports semi-conservative DNA replication. Our observations demonstrate a high functional versatility for the evolutionary new LigIII in DNA replication and mitochondrial metabolism, and suggest the presence of an alternative pathway for Okazaki fragment ligation. PMID:22127868

  8. ERCC1-XPF endonuclease facilitates DNA double-strand break repair

    NARCIS (Netherlands)

    R.A. Ahmad (Riris); A.R. Robinson (Andria Rasile); A. Duensing (Anette); E. van Drunen (Ellen); H.B. Beverloo (Berna); D.B. Weisberg (David); P. Hasty (Paul); J.H.J. Hoeijmakers (Jan); L.J. Niedernhofer (Laura)

    2008-01-01

    textabstractERCC1-XPF endonuclease is required for nucleotide excision repair (NER) of helix-distorting DNA lesions. However, mutations in ERCC1 or XPF in humans or mice cause a more severe phenotype than absence of NER, prompting a search for novel repair activities of the nuclease. In Saccharomyce

  9. The persistence length of double stranded DNA determined using dark field tethered particle motion

    NARCIS (Netherlands)

    Brinkers, S.; Dietrich, H.R.C.; De Groote, F.H.; Young, I.T.; Rieger, B.

    2009-01-01

    The wormlike chain model describes the micromechanics of semiflexible polymers by introducing the persistence length. We propose a method of measuring the persistence length of DNA in a controllable near-native environment. Using a dark field microscope, the projected positions of a gold nanoparticl

  10. Direct recognition of homology between double helices of DNA in Neurospora crassa

    Science.gov (United States)

    Gladyshev, Eugene; Kleckner, Nancy

    2014-01-01

    Chromosomal regions of identical or nearly identical DNA sequence can preferentially associate with one another in the apparent absence of DNA breakage. Molecular mechanism(s) underlying such homology-dependent pairing phenomena remain(s) unknown. Using Neurospora crassa repeat-induced point mutation (RIP) as a model system, we show that a pair of DNA segments can be recognized as homologous if they share triplets of base pairs arrayed with the matching periodicity of 11 or 12 base pairs. This pattern suggests direct interactions between slightly underwound co-aligned DNA duplexes engaging once per turn and over many consecutive turns. The process occurs in the absence of MEI3, the only RAD51/DMC1 protein in N. crassa, demonstrating independence from the canonical homology recognition pathway. A new perspective is thus provided for further analysis of the breakage-independent recognition of homology that underlies RIP and, potentially, other processes where sequence-specific pairing of intact chromosomes is involved. PMID:24699390

  11. Oncogenic ras-driven cancer cell vesiculation leads to emission of double-stranded DNA capable of interacting with target cells

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Tae Hoon; Chennakrishnaiah, Shilpa [Montreal Children’s Hospital, Research Institute of McGill University Health Centre, McGill University, Montreal, Quebec (Canada); Audemard, Eric [McGill University and Genome Quebec Innovation Centre, Montreal, Quebec (Canada); Montermini, Laura; Meehan, Brian [Montreal Children’s Hospital, Research Institute of McGill University Health Centre, McGill University, Montreal, Quebec (Canada); Rak, Janusz, E-mail: janusz.rak@mcgill.ca [Montreal Children’s Hospital, Research Institute of McGill University Health Centre, McGill University, Montreal, Quebec (Canada)

    2014-08-22

    Highlights: • Oncogenic H-ras stimulates emission of extracellular vesicles containing double-stranded DNA. • Vesicle-associated extracellular DNA contains mutant N-ras sequences. • Vesicles mediate intercellular transfer of mutant H-ras DNA to normal fibroblasts where it remains for several weeks. • Fibroblasts exposed to vesicles containing H-ras DNA exhibit increased proliferation. - Abstract: Cell free DNA is often regarded as a source of genetic cancer biomarkers, but the related mechanisms of DNA release, composition and biological activity remain unclear. Here we show that rat epithelial cell transformation by the human H-ras oncogene leads to an increase in production of small, exosomal-like extracellular vesicles by viable cancer cells. These EVs contain chromatin-associated double-stranded DNA fragments covering the entire host genome, including full-length H-ras. Oncogenic N-ras and SV40LT sequences were also found in EVs emitted from spontaneous mouse brain tumor cells. Disruption of acidic sphingomyelinase and the p53/Rb pathway did not block emission of EV-related oncogenic DNA. Exposure of non-transformed RAT-1 cells to EVs containing mutant H-ras DNA led to the uptake and retention of this material for an extended (30 days) but transient period of time, and stimulated cell proliferation. Thus, our study suggests that H-ras-mediated transformation stimulates vesicular emission of this histone-bound oncogene, which may interact with non-transformed cells.

  12. Orphan receptor TR3 enhances p53 transactivation and represses DNA double-strand break repair in hepatoma cells under ionizing radiation.

    Science.gov (United States)

    Zhao, Bi-xing; Chen, Hang-zi; Du, Xiao-dan; Luo, Jie; He, Jian-ping; Wang, Rong-hao; Wang, Yuan; Wu, Rong; Hou, Ru-rong; Hong, Ming; Wu, Qiao

    2011-08-01

    In response to ionizing radiation (IR)-induced DNA double-strand breaks (DSB), cells elicit an evolutionarily conserved checkpoint response that induces cell cycle arrest and either DNA repair or apoptosis, thereby maintaining genomic stability. DNA-dependent protein kinase (DNA-PK) is a central enzyme involved in DSB repair for mammalian cells that comprises a DNA-PK catalytic subunit and the Ku protein, which act as regulatory elements. DNA-PK also functions as a signaling molecule to selectively regulate p53-dependent apoptosis in response to IR. Herein, we demonstrate that the orphan nuclear receptor TR3 suppresses DSB repair by blocking Ku80 DNA-end binding activity and promoting DNA-PK-induced p53 activity in hepatoma cells. We find that TR3 interacts with Ku80 and inhibits its binding to DNA ends, which then suppresses DSB repair. Furthermore, TR3 is a phosphorylation substrate for DNA-PK and interacts with DNA-PK catalytic subunit in a Ku80-independent manner. Phosphorylated TR3, in turn, enhances DNA-PK-induced phosphorylation and p53 transcription activity, thereby enhancing IR-induced apoptosis in hepatoma cells. Together, our findings reveal novel functions for TR3, not only in DSB repair regulation but also in IR-induced hepatoma cell apoptosis, and they suggest that TR3 is a potential target for cancer radiotherapy.

  13. Chromosome thripsis by DNA double strand break clusters causes enhanced cell lethality, chromosomal translocations and 53BP1-recruitment.

    Science.gov (United States)

    Schipler, Agnes; Mladenova, Veronika; Soni, Aashish; Nikolov, Vladimir; Saha, Janapriya; Mladenov, Emil; Iliakis, George

    2016-09-19

    Chromosome translocations are hallmark of cancer and of radiation-induced cell killing, reflecting joining of incongruent DNA-ends that alter the genome. Translocation-formation requires DNA end-joining mechanisms and incompletely characterized, permissive chromatin conditions. We show that chromatin destabilization by clusters of DNA double-strand-breaks (DSBs) generated by the I-SceI meganuclease at multiple, appropriately engineered genomic sites, compromises c-NHEJ and markedly increases cell killing and translocation-formation compared to single-DSBs. Translocation-formation from DSB-clusters utilizes Parp1 activity, implicating alt-EJ in their formation. Immunofluorescence experiments show that single-DSBs and DSB-clusters uniformly provoke the formation of single γ-H2AX foci, suggesting similar activation of early DNA damage response (DDR). Live-cell imaging also shows similar single-focus recruitment of the early-response protein MDC1, to single-DSBs and DSB-clusters. Notably, the late DDR protein, 53BP1 shows in live-cell imaging strikingly stronger recruitment to DSB-clusters as compared to single-DSBs. This is the first report that chromatin thripsis, in the form of engineered DSB-clusters, compromises first-line DSB-repair pathways, allowing alt-EJ to function as rescuing-backup. DSB-cluster-formation is indirectly linked to the increased biological effectiveness of high ionization-density radiations, such as the alpha-particles emitted by radon gas or the heavy-ions utilized in cancer therapy. Our observations provide the first direct mechanistic explanation for this long-known effect.

  14. DNA repair in modeled microgravity: Double strand break rejoining activity in human lymphocytes irradiated with {gamma}-rays

    Energy Technology Data Exchange (ETDEWEB)

    Mognato, Maddalena, E-mail: maddalena.mognato@unipd.it [Dipartimento di Biologia, Universita di Padova, via U. Bassi 58 B, 35121 Padova (Italy); Girardi, Cristina; Fabris, Sonia [Dipartimento di Biologia, Universita di Padova, via U. Bassi 58 B, 35121 Padova (Italy); Celotti, Lucia [Dipartimento di Biologia, Universita di Padova, via U. Bassi 58 B, 35121 Padova (Italy); Laboratori Nazionali di Legnaro, INFN, Padova (Italy)

    2009-04-26

    Cell response to ionising radiation depends, besides on genetic and physiological features of the biological systems, on environmental conditions occurring during DNA repair. Many data showed that microgravity, experienced by astronauts during space flights or modeled on Earth, causes apoptosis, cytoskeletal alteration, cell growth inhibition, increased frequency of mutations and chromosome aberrations. In this study, we analysed the progression of the rejoining of double strand breaks (DSBs) in human peripheral blood lymphocytes (PBLs) irradiated with {gamma}-rays and incubated in static condition (1g) or in modeled microgravity (MMG). {gamma}-H2AX foci formation and disappearance, monitored during the repair incubation, showed that the kinetics of DSBs rejoining was different in the two gravity conditions. The fraction of foci-positive cells decreased slower in MMG than in 1g at 6 and 24 h after irradiation (P < 0.01) and the mean number of {gamma}-H2AX foci per nucleus was significantly higher in MMG than in 1g at the same time-points (P < 0.001). In the same samples we determined apoptotic level and the rate of DSB rejoining during post-irradiation incubation. A significant induction of apoptosis was observed in MMG at 24 h after irradiation (P < 0.001), whereas at shorter times the level of apoptosis was slightly higher in MMG respect to 1g. In accordance with the kinetics of {gamma}-H2AX foci, the slower rejoining of radiation-induced DSBs in MMG was observed by DNA fragmentation analyses during the repair incubation; the data of pulsed-field gel electrophoresis assay showed that the fraction of DNA released in the gel was significantly higher in PBL incubated in MMG after irradiation with respect to cells maintained in 1g. Our results provide evidences that MMG incubation during DNA repair delayed the rate of radiation-induced DSB rejoining, and increased, as a consequence, the genotoxic effects of ionising radiation.

  15. FBH1 co-operates with MUS81 in inducing DNA double-strand breaks and cell death following replication stress

    DEFF Research Database (Denmark)

    Fugger, Kasper; Chu, Wai Kit; Haahr, Peter

    2013-01-01

    The molecular events occurring following the disruption of DNA replication forks are poorly characterized, despite extensive use of replication inhibitors such as hydroxyurea in the treatment of malignancies. Here, we identify a key role for the FBH1 helicase in mediating DNA double-strand break...... formation following replication inhibition. We show that FBH1-deficient cells are resistant to killing by hydroxyurea, and exhibit impaired activation of the pro-apoptotic factor p53, consistent with decreased DNA double-strand break formation. Similar findings were obtained in murine ES cells carrying...... disrupted alleles of Fbh1. We also show that FBH1 through its helicase activity co-operates with the MUS81 nuclease in promoting the endonucleolytic DNA cleavage following prolonged replication stress. Accordingly, MUS81 and EME1-depleted cells show increased resistance to the cytotoxic effects...

  16. Safety and immunogenicity of a freeze-dried, Vero cell culture-derived, inactivated Japanese encephalitis vaccine (KD-287, ENCEVAC®) versus a mouse brain-derived inactivated Japanese encephalitis vaccine in children: a phase III, multicenter, double-blinded, randomized trial.

    Science.gov (United States)

    Yun, Ki Wook; Lee, Hoan Jong; Kang, Jin Han; Eun, Byung Wook; Kim, Yae-Jean; Kim, Kyung-Hyo; Kim, Nam Hee; Hong, Young Jin; Kim, Dong Ho; Kim, Hwang Min; Cha, Sung-Ho

    2015-01-08

    Although mouse brain-derived, inactivated Japanese encephalitis vaccines (JE-MBs) have been successfully used for a long time, potential rare neurological complications have prompted the development of a Vero cell culture-derived inactivated vaccine (JE-VC). In a phase III clinical study, we aimed to compare the safety and immunogenicity of a JE-VC, KD-287 with a JE-MB, JEV-GCC, in children. In this multicenter, double-blinded, randomized controlled trial, the study population consisted of 205 healthy Korean children aged 12-23 months. Each subject was subcutaneously vaccinated with either KD-287 or JEV-GCC twice at an interval of 2 weeks and then vaccinated once 12 months after the second vaccination. Neutralizing antibodies were measured by the plaque reduction neutralization test using the homologous and heterologous, as a post hoc analysis, challenge virus strains. The three-dose regimen of KD-287 showed a comparable safety profile with JEV-GCC except higher incidence of fever after the first dose (30.4% and 14.7%, respectively). Most of the fever was mild degree (61.3% and 66.7%, respectively). KD-287 fulfilled the non-inferiority criteria for seroconversion rate (SCR) and geometric mean titer (GMT) of the neutralizing antibody, which were the primary endpoints, at 4 weeks after the third vaccination (95% CI: -1.00, 3.10 for the SCR difference and 10.8, 17.6 for the GMT ratio). The SCRs of KD-287 were all 100% and the GMTs were higher in the KD-287 group than in the JEV-GCC group after the second vaccination and before and after the third vaccination (GMT ratio: 5.59, 20.13, and 13.79, respectively, p < 0.001 in all). GMTs were higher in the KD-287 group in the heterologous analysis also (GMT ratio: 4.05, 5.15, and 4.19, respectively, p < 0.001 in all). This study suggests that the KD-287, a JE-VC is as safe as and may be more effective than the licensed MB-derived vaccine. KD-287 could thus be useful as a second-generation vaccine and substitute

  17. X-ray-induced DNA double-strand breaks after angiographic examinations of different anatomic regions; Strahleninduzierte DNA-Doppelstrangbrueche nach Angiografien verschiedener Koerperregionen

    Energy Technology Data Exchange (ETDEWEB)

    Kuefner, M.A.; Schwab, S.A.; Azoulay, S.; Heckmann, M.; Heinrich, M.C.; Uder, M. [Universitaetsklinikum Erlangen (Germany). Radiologisches Inst.; Grudzenski, S.; Lobrich, M. [Technische Univ. Darmstadt (Germany). Strahlenbiologie und DNA-Reparatur

    2009-04-15

    Purpose: The aim of this study was to investigate DNA double-strand breaks (DSBs) in blood lymphocytes as markers of the biological radiation effects in angiography patients. Materials and Methods: The method is based on the phosphorylation of the histone variant H 2AX ({gamma}-H2AX) after formation of DSBs. Blood samples were collected before and up to 24 hours after exposure of 31 patients undergoing angiographies of different body regions. Blood lymphocytes were isolated, fixed, and stained with a specific {gamma}-H2AX antibody. Distinct foci representing DSBs were enumerated using fluorescence microscopy. Additional in-vitro experiments (10 - 100 mGy) were performed for evaluation of DBS repair. Results: 15 minutes after the end of fluoroscopy values between 0.01 and 1.50 DSBs per cell were obtained. The DNA damage level normalized to the dose area product was 0.099 (cardiac angiographies), 0.053 (abdominal angiographies), 0.023 (pelvic/leg angiographies) and 0.004 excess foci/cell/mGym{sup 2} (cerebrovascular angiographies). A linear correlation was found between {gamma}-H2AX foci levels and the dose area product (abdomen: R2 = 0.96; pelvis/legs: R2 = 0.71). In-vivo on average 46 % of DSBs disappeared within 1 hour and 70 % within 2.5 hours. Conclusion: {gamma}-H2AX immunofluorescence microscopy is a sensitive and reliable method for the determination of X-ray-induced DSBs during angiography. The DNA damage level depends on the dose, the exposed anatomic region, and the duration/fractionation of the X-ray exposure. (orig.)

  18. Aptamer Selection Express: A Rapid Single-Step Selection of Double-stranded DNA Capture Elements

    Science.gov (United States)

    2009-08-21

    always the last word Approved for public release; distribution unlimited Sensitivity of Aptamers for Detecting Bacillus thuringiensis Spores and...for public release; distribution unlimited ALISA approach: Quantum Dot DCE Assay for Shiga Toxin Compared to FITC Antibody Assay 0.000 0.240 0.480...w ith Shiga Toxin STJ-9 w ith BSA Antibody w ith Shiga Toxin Antibody w ith BSA (Kiel et al, SPIE 5617: 382-387, 2004) DCE=DNA Capture Element

  19. Contribution of DNA double-strand break repair gene XRCC3 genotypes to oral cancer susceptibility in Taiwan.

    Science.gov (United States)

    Tsai, Chia-Wen; Chang, Wen-Shin; Liu, Juhn-Cherng; Tsai, Ming-Hsui; Lin, Cheng-Chieh; Bau, Da-Tian

    2014-06-01

    The DNA repair gene X-ray repair cross complementing protein 3 (XRCC3) is thought to play a major role in double-strand break repair and in maintaining genomic stability. Very possibly, defective double-strand break repair of cells can lead to carcinogenesis. Therefore, a case-control study was performed to reveal the contribution of XRCC3 genotypes to individual oral cancer susceptibility. In this hospital-based research, the association of XRCC3 rs1799794, rs45603942, rs861530, rs3212057, rs1799796, rs861539, rs28903081 genotypes with oral cancer risk in a Taiwanese population was investigated. In total, 788 patients with oral cancer and 956 age- and gender-matched healthy controls were genotyped. The results showed that there was significant differential distribution among oral cancer and controls in the genotypic (p=0.001428) and allelic (p=0.0013) frequencies of XRCC3 rs861539. As for the other polymorphisms, there was no difference between case and control groups. In gene-lifestyle interaction analysis, we have provided the first evidence showing that there is an obvious joint effect of XRCC3 rs861539 genotype with individual areca chewing habits on oral cancer risk. In conclusion, the T allele of XRCC3 rs861539, which has an interaction with areca chewing habit in oral carcinogenesis, may be an early marker for oral cancer in Taiwanese.

  20. Investigation of Double-Band Electrophoretic Pattern of ITS-rDNA Region in Iranian Isolates of Leishmania Tropica

    Directory of Open Access Journals (Sweden)

    MA Ghatee

    2013-06-01

    Full Text Available Background: Leishmania tropica is a genetically divergent species. Amplification of entire internal tran­scribed spacer (ITS region of L. tropica isolates obtained from Bam district, one of the well known focus of anthroponotic cutaneous leishmaniasis ACL( in Iran, revealed a double-band pat­tern in agarose gel electrophoresis. This study explains how this pattern occurs.Methods: Twenty seven L. tropica smear preparations were collected from Bam district, south east Iran, and eight L. major and one L. infantum smear preparations were gathered from Shiraz, south west Iran. Furthermore one L. major and one L. infantum cultured standard strains were tested using entire ITS-PCR to survey their electrophoretic pattern. The ITS sequences of L. tropica, L. major, and L. infantum already deposited in GenBank were analyzed. Analysis of GenBank sequences of L. tropica revealed two groups of sequences based on length size, one group having a 100 bp gap. Therefore, a new re­verse primer namely LITS-MG was designed to exclude this gap in PCR products.Results: Whole ITS fragment amplification resulted in a double-band pattern in all L. tropica cases, while a sharp single band was observed for L. infantum and L. major isolates. This result was correspond­ing to the result obtained from in silico analysis of GenBank sequences. Use of LITS-MG primer was expectedly resulted in a single band including ITS1, 5.8s and partial ITS2 product for L. tropica which is appropriate for following molecular studies such as sequencing or restriction analysis.Conclusion: Sequences analysis of GenBank L. tropica sequences and following practical laboratory tests revealed at least two alleles in L. tropica which were confirmed in Bam isolates. This especial double-band pattern is because of a 100 bp fragment difference within ITS-rDNA alleles

  1. Inactivation Data.xlsx

    Data.gov (United States)

    U.S. Environmental Protection Agency — The data set is a spreadsheet that contains results of inactivation experiments that were conducted to to determine the effectiveness of chlorine in inactivating B....

  2. Assembly and function of DNA double-strand break repair foci in mammalian cells

    DEFF Research Database (Denmark)

    Bekker-Jensen, Simon; Mailand, Niels

    2010-01-01

    phosphorylation, ubiquitylation, SUMOylation, and acetylation. Over the last decade, insight into the identity of proteins residing in IRIF and the molecular underpinnings of their retention at these structures has been vastly expanded. Despite such advances, however, our understanding of the biological relevance...... of such DNA repair foci still remains limited. In this review, we focus on recent discoveries on the mechanisms that govern the formation of IRIF, and discuss the implications of such findings in light of our understanding of the physiological importance of these structures....

  3. Increased repair of {gamma}-induced DNA double-strand breaks at lower dose-rate in CHO cells

    Energy Technology Data Exchange (ETDEWEB)

    Boucher, D.; Hindo, J.; Averbeck, D. [Centre Universitaire d' Orsay, Inst. Curie-Section de Recherche, Orsay CEDEX (France)]. E-mail: dietrich.averbeck@curie.u-psud.fr

    2004-02-01

    DNA double-strand breaks (DSBs) are highly cell damaging. We asked whether for a given dose a longer irradiation time would be advantageous for the repair of DSBs. Varying the {gamma}-irradiation dose and its delivery time (0.05 Gy/min low dose-rate (LDR) compared with 3.5 Gy/min high dose-rate), confluent Chinese hamster ovary cells (CHO-K1) and Ku80 mutant cells (xrs-6) deficient in nonhomologous end-joining (NHEJ) were irradiated in agarose plugs at room temperature using a cesium-137 {gamma}-ray source. We used pulsed-field gel electrophoresis (PFGE) to measure DSBs in terms of the fraction of activity released (FAR). At LDR, one third of DSBs were repaired in CHO-K1 but not in xrs-6 cells, indicating the involvement of NHEJ in the repair of {gamma}-induced DSBs at a prolonged irradiation incubation time. To improve DSB measurements, we introduced in our PFGE protocol an antioxidant at the cell lysis step, thus avoiding free-radical side reactions on DNA and spurious DSBs. Addition of the metal chelator deferoxamine (DFO) decreased more efficiently the basal DSB level than did reduced glutathione (GSH), showing that measuring DSBs in the absence of DFO reduces precision and underestimates the role of NHEJ in the dose-rate effect on DSB yield. (author)

  4. Improving DNA double-strand repair inhibitor KU55933 therapeutic index in cancer radiotherapy using nanoparticle drug delivery

    Science.gov (United States)

    Tian, Xi; Lara, Haydee; Wagner, Kyle T.; Saripalli, Srinivas; Hyder, Syed Nabeel; Foote, Michael; Sethi, Manish; Wang, Edina; Caster, Joseph M.; Zhang, Longzhen; Wang, Andrew Z.

    2015-11-01

    Radiotherapy is a key component of cancer treatment. Because of its importance, there has been high interest in developing agents and strategies to further improve the therapeutic index of radiotherapy. DNA double-strand repair inhibitors (DSBRIs) are among the most promising agents to improve radiotherapy. However, their clinical translation has been limited by their potential toxicity to normal tissue. Recent advances in nanomedicine offer an opportunity to overcome this limitation. In this study, we aim to demonstrate the proof of principle by developing and evaluating nanoparticle (NP) formulations of KU55933, a DSBRI. We engineered a NP formulation of KU55933 using nanoprecipitation method with different lipid polymer nanoparticle formulation. NP KU55933 using PLGA formulation has the best loading efficacy as well as prolonged drug release profile. We demonstrated that NP KU55933 is a potent radiosensitizer in vitro using clonogenic assay and is more effective as a radiosensitizer than free KU55933 in vivo using mouse xenograft models of non-small cell lung cancer (NSCLC). Western blots and immunofluorescence showed NP KU55933 exhibited more prolonged inhibition of DNA repair pathway. In addition, NP KU55933 leads to lower skin toxicity than KU55933. Our study supports further investigations using NP to deliver DSBRIs to improve cancer radiotherapy treatment.

  5. DNA double-strand breaks, recombination and synapsis: the timing of meiosis differs in grasshoppers and flies

    Science.gov (United States)

    Viera, Alberto; Santos, Juan L; Page, Jesús; Parra, M Teresa; Calvente, Adela; Cifuentes, Marta; Gómez, Rocío; Lira, Renee; Suja, José A; Rufas, Julio S

    2004-01-01

    The temporal and functional relationships between DNA events of meiotic recombination and synaptonemal complex formation are a matter of discussion within the meiotic field. To analyse this subject in grasshoppers, organisms that have been considered as models for meiotic studies for many years, we have studied the localization of phosphorylated histone H2AX (γ-H2AX), which marks the sites of double-strand breaks (DSBs), in combination with localization of cohesin SMC3 and recombinase Rad51. We show that the loss of γ-H2AX staining is spatially and temporally linked to synapsis, and that in grasshoppers the initiation of recombination, produced as a consequence of DSB formation, precedes synapsis. This result supports the idea that grasshoppers display a pairing pathway that is not present in other insects such as Drosophila melanogaster, but is similar to those reported in yeast, mouse and Arabidopsis. In addition, we have observed the presence of γ-H2AX in the X chromosome from zygotene to late pachytene, indicating that the function of H2AX phosphorylation during grasshopper spermatogenesis is not restricted to the formation of γ-H2AX foci at DNA DSBs. PMID:15105829

  6. Small Rad51 and Dmc1 Complexes Often Co-occupy Both Ends of a Meiotic DNA Double Strand Break.

    Directory of Open Access Journals (Sweden)

    M Scott Brown

    2015-12-01

    Full Text Available The Eukaryotic RecA-like proteins Rad51 and Dmc1 cooperate during meiosis to promote recombination between homologous chromosomes by repairing programmed DNA double strand breaks (DSBs. Previous studies showed that Rad51 and Dmc1 form partially overlapping co-foci. Here we show these Rad51-Dmc1 co-foci are often arranged in pairs separated by distances of up to 400 nm. Paired co-foci remain prevalent when DSBs are dramatically reduced or when strand exchange or synapsis is blocked. Super-resolution dSTORM microscopy reveals that individual foci observed by conventional light microscopy are often composed of two or more substructures. The data support a model in which the two tracts of ssDNA formed by a single DSB separate from one another by distances of up to 400 nm, with both tracts often bound by one or more short (about 100 nt Rad51 filaments and also by one or more short Dmc1 filaments.

  7. Molecular Process Producing Oncogene Fusion in Lung Cancer Cells by Illegitimate Repair of DNA Double-Strand Breaks

    Directory of Open Access Journals (Sweden)

    Yoshitaka Seki

    2015-09-01

    Full Text Available Constitutive activation of oncogenes by fusion to partner genes, caused by chromosome translocation and inversion, is a critical genetic event driving lung carcinogenesis. Fusions of the tyrosine kinase genes ALK (anaplastic lymphoma kinase, ROS1 (c-ros oncogene 1, or RET (rearranged during transfection occur in 1%–5% of lung adenocarcinomas (LADCs and their products constitute therapeutic targets for kinase inhibitory drugs. Interestingly, ALK, RET, and ROS1 fusions occur preferentially in LADCs of never- and light-smokers, suggesting that the molecular mechanisms that cause these rearrangements are smoking-independent. In this study, using previously reported next generation LADC genome sequencing data of the breakpoint junction structures of chromosome rearrangements that cause oncogenic fusions in human cancer cells, we employed the structures of breakpoint junctions of ALK, RET, and ROS1 fusions in 41 LADC cases as “traces” to deduce the molecular processes of chromosome rearrangements caused by DNA double-strand breaks (DSBs and illegitimate joining. We found that gene fusion was produced by illegitimate repair of DSBs at unspecified sites in genomic regions of a few kb through DNA synthesis-dependent or -independent end-joining pathways, according to DSB type. This information will assist in the understanding of how oncogene fusions are generated and which etiological factors trigger them.

  8. The mutagenic potential of a single DNA double-strand break in a mammalian chromosome is not influenced by transcription.

    Science.gov (United States)

    Allen, Chris; Miller, Cheryl A; Nickoloff, Jac A

    2003-10-07

    In eukaryotes, DNA double-strand breaks (DSBs) are repaired by competing HR and non-homologous end-joining (NHEJ) pathways. DSB repair by HR is highly accurate, while NHEJ can result in deletions and insertions. Transcription enhances certain DNA repair pathways and spontaneous homologous recombination (HR). As a means to promote accurate repair in active genes, we thought it possible that the balance between HR and NHEJ would be shifted toward HR in highly transcribed regions. We tested this idea by examining products of DSB repair in integrated neo-direct repeats under conditions of low-level constitutive, or high-level induced transcription regulated by the dexamethasone (Dex)-responsive mouse mammary tumor virus (MMTV) promoter. DSBs were introduced into one copy of neo by expressing I-SceI nuclease, and DSB repair products were isolated and characterized with an efficient, non-selective assay. We found that transcription does not significantly change the relative frequencies of HR and NHEJ, the relative frequencies of sequence capture and gross chromosomal rearrangement, nor the average size of deletions. About one-third of DSB repair products showed large-scale rearrangements, indicating that a single DSB in a mammalian chromosome has significant mutagenic potential.

  9. p53 binding protein 1 foci as a biomarker of DNA double strand breaks induced by ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Ng, C.K.M.; Wong, M.Y.P.; Lam, R.K.K.; Ho, J.P.Y. [Department of Physics and Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon Tong (Hong Kong); Chiu, S.K. [Department of Biology and Chemistry, City University of Hong Kong, Tat Chee Avenue, Kowloon Tong (Hong Kong); Yu, K.N., E-mail: peter.yu@cityu.edu.hk [Department of Physics and Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon Tong (Hong Kong); State Key Laboratory in Marine Pollution, City University of Hong Kong, Tat Chee Avenue, Kowloon Tong (Hong Kong)

    2011-12-21

    Foci of p53 binding protein 1 (53 BP1) have been used as a biomarker of DNA double-strand breaks (DSBs) in cells induced by ionizing radiations. 53 BP1 was shown to relocalize into foci shortly after irradiation, with the number of foci closely paralleling the number of DNA DSBs. However, consensus on criteria in terms of the numbers of 53 BP1 foci to define cells damaged by direct irradiation or by bystander signals has not been reached, which is partly due to the presence of 53 BP1 also in normal cells. The objective of the present work was to study the changes in the distribution of cells with different numbers of 53 BP1 foci in a cell population after low-dose ionizing irradiation (<0.1 Gy) provided by alpha particles, with a view to propose feasible criteria for defining cells damaged by direct irradiation or by bystander signals. It was proposed that the change in the percentage of cells with 1-3 foci should be used for such purposes. The underlying reasons were discussed.

  10. Bridging of double-stranded breaks by the nonhomologous end-joining ligation complex is modulated by DNA end chemistry.

    Science.gov (United States)

    Reid, Dylan A; Conlin, Michael P; Yin, Yandong; Chang, Howard H; Watanabe, Go; Lieber, Michael R; Ramsden, Dale A; Rothenberg, Eli

    2017-02-28

    The nonhomologous end-joining (NHEJ) pathway is the primary repair pathway for DNA double strand breaks (DSBs) in humans. Repair is mediated by a core complex of NHEJ factors that includes a ligase (DNA Ligase IV; L4) that relies on juxtaposition of 3΄ hydroxyl and 5΄ phosphate termini of the strand breaks for catalysis. However, chromosome breaks arising from biological sources often have different end chemistries, and how these different end chemistries impact the way in which the core complex directs the necessary transitions from end pairing to ligation is not known. Here, using single-molecule FRET (smFRET), we show that prior to ligation, differences in end chemistry strongly modulate the bridging of broken ends by the NHEJ core complex. In particular, the 5΄ phosphate group is a recognition element for L4 and is critical for the ability of NHEJ factors to promote stable pairing of ends. Moreover, other chemical incompatibilities, including products of aborted ligation, are sufficient to disrupt end pairing. Based on these observations, we propose a mechanism for iterative repair of DSBs by NHEJ. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. DNA double-strand break repair: a tale of pathway choices

    Institute of Scientific and Technical Information of China (English)

    Jing Li; Xingzhi Xu

    2016-01-01

    Deoxyribonucleic acid double-strand breaks (DSBs) are cytotoxic lesions that must be repaired either through homologous recombination (HR) or non-homologous end-joining (NHEJ) pathways.DSB repair is critical for genome integrity,cellular homeostasis and also constitutes the biological foundation for radiotherapy and the majority of chemotherapy.The choice between HR and NHEJ is a complex yet not completely understood process that will entail more future efforts.Herein we review our current understandings about how the choice is made over an antagonizing balance between p53-binding protein 1 and breast cancer 1 in the context of cell cycle stages,downstream effects,and distinct chromosomal histone marks.These exciting areas of research will surely bring more mechanistic insights about DSB repair and be utilized in the clinical settings.

  12. Detailed analysis of the cell-inactivation mechanism by accelerated protons and light ions

    Energy Technology Data Exchange (ETDEWEB)

    Kundrat, Pavel [Institute of Physics, Academy of Sciences of the Czech Republic, Na Slovance 2, CZ-182 21 Praha 8 (Czech Republic)

    2006-03-07

    A detailed study of the biological effects of diverse quality radiations, addressing their biophysical interpretation, is presented. Published survival data for V79 cells irradiated by monoenergetic protons, helium-3, carbon and oxygen ions and for CHO cells irradiated by carbon ions have been analysed using the probabilistic two-stage model of cell inactivation. Three different classes of DNA damage formed by traversing particles have been distinguished, namely severe single-track lesions which might lead to cell inactivation directly, less severe lesions where cell inactivation is caused by their combinations and lesions of negligible severity that can be repaired easily. Probabilities of single ions forming these lesions have been assessed in dependence on their linear energy transfer (LET) values. Damage induction probabilities increase with atomic number and LET. While combined lesions play a crucial role at lower LET values, single-track damage dominates in high-LET regions. The yields of single-track lethal lesions for protons have been compared with Monte Carlo estimates of complex DNA lesions, indicating that lethal events correlate well with complex DNA double-strand breaks. The decrease in the single-track damage probability for protons of LET above approximately 30 keV {mu}m{sup -1}, suggested by limited experimental evidence, is discussed, together with the consequent differences in the mechanisms of biological effects between protons and heavier ions. Applications of the results in hadrontherapy treatment planning are outlined.

  13. Simple replication methods for producing nanoslits in thermoplastics and the transport dynamics of double-stranded DNA through these slits.

    Science.gov (United States)

    Chantiwas, Rattikan; Hupert, Mateusz L; Pullagurla, Swathi R; Balamurugan, Subramanian; Tamarit-López, Jesús; Park, Sunggook; Datta, Proyag; Goettert, Jost; Cho, Yoon-Kyoung; Soper, Steven A

    2010-12-01

    Mixed-scale nano- and microfluidic networks were fabricated in thermoplastics using simple and robust methods that did not require the use of sophisticated equipment to produce the nanostructures. High-precision micromilling (HPMM) and photolithography were used to generate mixed-scale molding tools that were subsequently used for producing fluidic networks into thermoplastics such as poly(methyl methacrylate), PMMA, cyclic olefin copolymer, COC, and polycarbonate, PC. Nanoslit arrays were imprinted into the polymer using a nanoimprinting tool, which was composed of an optical mask with patterns that were 2-7 µm in width and a depth defined by the Cr layer (100 nm), which was deposited onto glass. The device also contained a microchannel network that was hot embossed into the polymer substrate using a metal molding tool prepared via HPMM. The mixed-scale device could also be used as a master to produce a polymer stamp, which was made from polydimethylsiloxane, PDMS, and used to generate the mixed-scale fluidic network in a single step. Thermal fusion bonding of the cover plate to the substrate at a temperature below their respective T(g) was accomplished by oxygen plasma treatment of both the substrate and cover plate, which significantly reduced thermally induced structural deformation during assembly: ∼6% for PMMA and ∼9% for COC nanoslits. The electrokinetic transport properties of double-stranded DNA (dsDNA) through the polymeric nanoslits (PMMA and COC) were carried out. In these polymer devices, the dsDNA demonstrated a field-dependent electrophoretic mobility with intermittent transport dynamics. DNA mobilities were found to be 8.2 ± 0.7 × 10(-4) cm(2) V(-1) s(-1) and 7.6 ± 0.6 × 10(-4) cm(2) V(-1) s(-1) for PMMA and COC, respectively, at a field strength of 25 V cm(-1). The extension factors for λ-DNA were 0.46 in PMMA and 0.53 in COC for the nanoslits (2-6% standard deviation).

  14. Mobile phone radiofrequency exposure has no effect on DNA double strand breaks (DSB) in human lymphocytes.

    Science.gov (United States)

    Danese, Elisa; Lippi, Giuseppe; Buonocore, Ruggero; Benati, Marco; Bovo, Chiara; Bonaguri, Chiara; Salvagno, Gian Luca; Brocco, Giorgio; Roggenbuck, Dirk; Montagnana, Martina

    2017-07-01

    The use of mobile phones has been associated with an increased risk of developing certain type of cancer, especially in long term users. Therefore, this study was aimed to investigate the potential genotoxic effect of mobile phone radiofrequency exposure on human peripheral blood mononuclear cells in vitro. The study population consisted in 14 healthy volunteers. After collection of two whole blood samples, the former was placed in a plastic rack, 1 cm from the chassis of a commercial mobile phone (900 MHz carrier frequency), which was activated by a 30-min call. The second blood sample was instead maintained far from mobile phones or other RF sources. The influence of mobile phone RF on DNA integrity was assessed by analyzing γ-H2AX foci in lymphocytes using immunofluorescence staining kit on AKLIDES. No measure of γ-H2AX foci was significantly influenced by mobile phone RF exposure, nor mobile phone exposure was associated with significant risk of genetic damages in vitro (odds ratio comprised between 0.27 and 1.00). The results of this experimental study demonstrate that exposure of human lymphocytes to a conventional 900 MHz RF emitted by a commercial mobile phone for 30 min does not significantly impact DNA integrity.

  15. MeHg Developing Exposure Causes DNA Double-Strand Breaks and Elicits Cell Cycle Arrest in Spinal Cord Cells

    Directory of Open Access Journals (Sweden)

    Fabiana F. Ferreira

    2015-01-01

    Full Text Available The neurotoxicity caused by methylmercury (MeHg is well documented; however, the developmental neurotoxicity in spinal cord is still not fully understood. Here we investigated whether MeHg affects the spinal cord layers development. Chicken embryos at E3 were treated in ovo with 0.1 μg MeHg/50 μL saline solution and analyzed at E10. Thus, we performed immunostaining using anti-γ-H2A.X to recognize DNA double-strand breaks and antiphosphohistone H3, anti-p21, and anti-cyclin E to identify cells in proliferation and cell cycle proteins. Also, to identify neuronal cells, we used anti-NeuN and anti-βIII-tubulin antibodies. After the MeHg treatment, we observed the increase on γ-H2A.X in response to DNA damage. MeHg caused a decrease in the proliferating cells and in the thickness of spinal cord layers. Moreover, we verified that MeHg induced an increase in the number of p21-positive cells but did not change the cyclin E-positive cells. A significantly high number of TUNEL-positive cells indicating DNA fragmentation were observed in MeHg-treated embryos. Regarding the neuronal differentiation, MeHg induced a decrease in NeuN expression and did not change the expression of βIII-tubulin. These results showed that in ovo MeHg exposure alters spinal cord development by disturbing the cell proliferation and death, also interfering in early neuronal differentiation.

  16. Recognition, signaling, and repair of DNA double-strand breaks produced by ionizing radiation in mammalian cells: the molecular choreography.

    Science.gov (United States)

    Thompson, Larry H

    2012-01-01

    The faithful maintenance of chromosome continuity in human cells during DNA replication and repair is critical for preventing the conversion of normal diploid cells to an oncogenic state. The evolution of higher eukaryotic cells endowed them with a large genetic investment in the molecular machinery that ensures chromosome stability. In mammalian and other vertebrate cells, the elimination of double-strand breaks with minimal nucleotide sequence change involves the spatiotemporal orchestration of a seemingly endless number of proteins ranging in their action from the nucleotide level to nucleosome organization and chromosome architecture. DNA DSBs trigger a myriad of post-translational modifications that alter catalytic activities and the specificity of protein interactions: phosphorylation, acetylation, methylation, ubiquitylation, and SUMOylation, followed by the reversal of these changes as repair is completed. "Superfluous" protein recruitment to damage sites, functional redundancy, and alternative pathways ensure that DSB repair is extremely efficient, both quantitatively and qualitatively. This review strives to integrate the information about the molecular mechanisms of DSB repair that has emerged over the last two decades with a focus on DSBs produced by the prototype agent ionizing radiation (IR). The exponential growth of molecular studies, heavily driven by RNA knockdown technology, now reveals an outline of how many key protein players in genome stability and cancer biology perform their interwoven tasks, e.g. ATM, ATR, DNA-PK, Chk1, Chk2, PARP1/2/3, 53BP1, BRCA1, BRCA2, BLM, RAD51, and the MRE11-RAD50-NBS1 complex. Thus, the nature of the intricate coordination of repair processes with cell cycle progression is becoming apparent. This review also links molecular abnormalities to cellular pathology as much a possible and provides a framework of temporal relationships.

  17. MeHg Developing Exposure Causes DNA Double-Strand Breaks and Elicits Cell Cycle Arrest in Spinal Cord Cells

    Science.gov (United States)

    Ferreira, Fabiana F.; Ammar, Dib; Bourckhardt, Gilian F.; Kobus-Bianchini, Karoline; Müller, Yara M. R.; Nazari, Evelise M.

    2015-01-01

    The neurotoxicity caused by methylmercury (MeHg) is well documented; however, the developmental neurotoxicity in spinal cord is still not fully understood. Here we investigated whether MeHg affects the spinal cord layers development. Chicken embryos at E3 were treated in ovo with 0.1 μg MeHg/50 μL saline solution and analyzed at E10. Thus, we performed immunostaining using anti-γ-H2A.X to recognize DNA double-strand breaks and antiphosphohistone H3, anti-p21, and anti-cyclin E to identify cells in proliferation and cell cycle proteins. Also, to identify neuronal cells, we used anti-NeuN and anti-βIII-tubulin antibodies. After the MeHg treatment, we observed the increase on γ-H2A.X in response to DNA damage. MeHg caused a decrease in the proliferating cells and in the thickness of spinal cord layers. Moreover, we verified that MeHg induced an increase in the number of p21-positive cells but did not change the cyclin E-positive cells. A significantly high number of TUNEL-positive cells indicating DNA fragmentation were observed in MeHg-treated embryos. Regarding the neuronal differentiation, MeHg induced a decrease in NeuN expression and did not change the expression of βIII-tubulin. These results showed that in ovo MeHg exposure alters spinal cord development by disturbing the cell proliferation and death, also interfering in early neuronal differentiation. PMID:26793240

  18. DNA double-strand breaks as potential indicators for the biological effects of ionising radiation exposure from cardiac CT and conventional coronary angiography: a randomised, controlled study

    Energy Technology Data Exchange (ETDEWEB)

    Geisel, Dominik; Zimmermann, Elke; Rief, Matthias; Greupner, Johannes; Hamm, Bernd [Charite Medical School, Department of Radiology, Berlin (Germany); Laule, Michael; Knebel, Fabian [Charite Medical School, Department of Cardiology, Berlin (Germany); Dewey, Marc [Charite Medical School, Department of Radiology, Berlin (Germany); Charite, Institut fuer Radiologie, Berlin (Germany)

    2012-08-15

    To prospectively compare induced DNA double-strand breaks by cardiac computed tomography (CT) and conventional coronary angiography (CCA). 56 patients with suspected coronary artery disease were randomised to undergo either CCA or cardiac CT. DNA double-strand breaks were assessed in fluorescence microscopy of blood lymphocytes as indicators of the biological effects of radiation exposure. Radiation doses were estimated using dose-length product (DLP) and dose-area product (DAP) with conversion factors for CT and CCA, respectively. On average there were 0.12 {+-} 0.06 induced double-strand breaks per lymphocyte for CT and 0.29 {+-} 0.18 for diagnostic CCA (P < 0.001). This relative biological effect of ionising radiation from CCA was 1.9 times higher (P < 0.001) than the effective dose estimated by conversion factors would have suggested. The correlation between the biological effects and the estimated radiation doses was excellent for CT (r = 0.951, P < 0.001) and moderate to good for CCA (r = 0.862, P < 0.001). One day after radiation, a complete repair of double-strand breaks to background levels was found in both groups. Conversion factors may underestimate the relative biological effects of ionising radiation from CCA. DNA double-strand break assessment may provide a strategy for individualised assessments of radiation. (orig.)

  19. Feasibility of measuring radiation-induced DNA double strand breaks and their repair by pulsed field gel electrophoresis in freshly isolated cells from the mouse RIF-1 tumor

    NARCIS (Netherlands)

    vanWaarde, MAWH; vanAssen, AJ; Konings, AWT; Kampinga, HH

    1996-01-01

    Purpose: To examine the technical feasibility of pulsed field gel electrophoresis (PFGE) as a predictive assay for the radioresponsiveness of tumors. Induction and repair of DNA double strand breaks (DSBs) in a freshly prepared cell suspension from a RIF-1 tumor (irradiated ex vivo) was compared

  20. Gold Nanorods, DNA Origami, and Porous Silicon Nanoparticle-functionalized Biocompatible Double Emulsion for Versatile Targeted Therapeutics and Antibody Combination Therapy.

    Science.gov (United States)

    Kong, Feng; Zhang, Hongbo; Qu, Xiangmeng; Zhang, Xu; Chen, Dong; Ding, Ruihua; Mäkilä, Ermei; Salonen, Jarno; Santos, Hélder A; Hai, Mingtan

    2016-12-01

    Gold nanorods, DNA origami, and porous silicon nanoparticle-functionalized biocompatible double emulsion are developed for versatile molecular targeted therapeutics and antibody combination therapy. This advanced photothermal responsive all-in-one biocompatible platform can be easily formed with great therapeutics loading capacity for different cancer treatments with synergism and multidrug resistance inhibition, which has great potential in advancing biomedical applications.

  1. The deubiquitylating enzyme USP44 counteracts the DNA double-strand break response mediated by the RNF8 and RNF168 ubiquitin ligases

    DEFF Research Database (Denmark)

    Mosbech, Anna; Lukas, Claudia; Bekker-Jensen, Simon

    2013-01-01

    Protein recruitment to DNA double-strand breaks (DSBs) relies on ubiquitylation of the surrounding chromatin by the RING finger ubiquitin ligases RNF8 and RNF168. Flux through this pathway is opposed by several deubiquitylating enzymes (DUBs), including OTUB1 and USP3. By analyzing the effect...

  2. Condensin suppresses recombination and regulates double-strand break processing at the repetitive ribosomal DNA array to ensure proper chromosome segregation during meiosis in budding yeast

    Science.gov (United States)

    Li, Ping; Jin, Hui; Yu, Hong-Guo

    2014-01-01

    During meiosis, homologues are linked by crossover, which is required for bipolar chromosome orientation before chromosome segregation at anaphase I. The repetitive ribosomal DNA (rDNA) array, however, undergoes little or no meiotic recombination. Hyperrecombination can cause chromosome missegregation and rDNA copy number instability. We report here that condensin, a conserved protein complex required for chromosome organization, regulates double-strand break (DSB) formation and repair at the rDNA gene cluster during meiosis in budding yeast. Condensin is highly enriched at the rDNA region during prophase I, released at the prophase I/metaphase I transition, and reassociates with rDNA before anaphase I onset. We show that condensin plays a dual role in maintaining rDNA stability: it suppresses the formation of Spo11-mediated rDNA breaks, and it promotes DSB processing to ensure proper chromosome segregation. Condensin is unnecessary for the export of rDNA breaks outside the nucleolus but required for timely repair of meiotic DSBs. Our work reveals that condensin coordinates meiotic recombination with chromosome segregation at the repetitive rDNA sequence, thereby maintaining genome integrity. PMID:25103240

  3. Optimization of Neutral Comet Assay for studying DNA double-strand breaks in pea and wheat

    Directory of Open Access Journals (Sweden)

    Ivelina Nikolova

    2013-01-01

    Full Text Available This study describes an adaptation of the Comet assay under neutral conditions for mono- and dicotyledonous plants pea (Pisum sativum L. and wheat (Triticum aestivum L.. Modifications concern lysis and electrophoresis steps, respectively. Electrophoresis was carried out varying the intensity of the electric field. A linear relationship between the percentages of DNA in the tail from control background with alteration of intensity was found. Trypan blue dye exclusion test was used in order to determine the intactness of nuclear membrane of the isolated nuclei from both plant model systems. Assessment was conducted on non-irradiated and irradiated nuclei on a monolayer with three doses of UVC. It was found that the share of intact nuclei (trypan blue negative ones is about 95% in controls. Gradual dose-related increase of damaged nuclei was observed in both species, reaching statistical significance only at the higher dose applied.

  4. DNMT3A(R882H) mutant and Tet2 inactivation cooperate in the deregulation of DNA methylation control to induce lymphoid malignancies in mice

    DEFF Research Database (Denmark)

    Scourzic, L; Couronné, L; Pedersen, M T

    2016-01-01

    TEN-ELEVEN-TRANSLOCATION-2 (TET2) and DNA-METHYLTRANSFERASE-3A (DNMT3A), both encoding proteins involved in regulating DNA methylation, are mutated in hematological malignancies affecting both myeloid and lymphoid lineages. We previously reported an association of TET2 and DNMT3A mutations in pro...

  5. Inactivation of Caliciviruses

    Science.gov (United States)

    Nims, Raymond; Plavsic, Mark

    2013-01-01

    The Caliciviridae family of viruses contains clinically important human and animal pathogens, as well as vesivirus 2117, a known contaminant of biopharmaceutical manufacturing processes employing Chinese hamster cells. An extensive literature exists for inactivation of various animal caliciviruses, especially feline calicivirus and murine norovirus. The caliciviruses are susceptible to wet heat inactivation at temperatures in excess of 60 °C with contact times of 30 min or greater, to UV-C inactivation at fluence ≥30 mJ/cm2, to high pressure processing >200 MPa for >5 min at 4 °C, and to certain photodynamic inactivation approaches. The enteric caliciviruses (e.g.; noroviruses) display resistance to inactivation by low pH, while the non-enteric species (e.g.; feline calicivirus) are much more susceptible. The caliciviruses are inactivated by a variety of chemicals, including alcohols, oxidizing agents, aldehydes, and β-propiolactone. As with inactivation of viruses in general, inactivation of caliciviruses by the various approaches may be matrix-, temperature-, and/or contact time-dependent. The susceptibilities of the caliciviruses to the various physical and chemical inactivation approaches are generally similar to those displayed by other small, non-enveloped viruses, with the exception that the parvoviruses and circoviruses may require higher temperatures for inactivation, while these families appear to be more susceptible to UV-C inactivation than are the caliciviruses. PMID:24276023

  6. Inactivation of Caliciviruses

    Directory of Open Access Journals (Sweden)

    Raymond Nims

    2013-03-01

    Full Text Available The Caliciviridae family of viruses contains clinically important human and animal pathogens, as well as vesivirus 2117, a known contaminant of biopharmaceutical manufacturing processes employing Chinese hamster cells. An extensive literature exists for inactivation of various animal caliciviruses, especially feline calicivirus and murine norovirus. The caliciviruses are susceptible to wet heat inactivation at temperatures in excess of 60 °C with contact times of 30 min or greater, to UV-C inactivation at fluence ≥30 mJ/cm2, to high pressure processing >200 MPa for >5 min at 4 °C, and to certain photodynamic inactivation approaches. The enteric caliciviruses (e.g.; noroviruses display resistance to inactivation by low pH, while the non-enteric species (e.g.; feline calicivirus are much more susceptible. The caliciviruses are inactivated by a variety of chemicals, including alcohols, oxidizing agents, aldehydes, and β-propiolactone. As with inactivation of viruses in general, inactivation of caliciviruses by the various approaches may be matrix-, temperature-, and/or contact time-dependent. The susceptibilities of the caliciviruses to the various physical and chemical inactivation approaches are generally similar to those displayed by other small, non-enveloped viruses, with the exception that the parvoviruses and circoviruses may require higher temperatures for inactivation, while these families appear to be more susceptible to UV-C inactivation than are the caliciviruses.

  7. In vitro binding kinetics of DNA double strand break repair proteins Ku70/80 and DNA-PKcs quantified by fluorescence correlation spectroscopy and fluorescence cross-correlation spectroscopy

    Science.gov (United States)

    Abdisalaam, Salim; Chen, David J.; Alexandrakis, George

    2012-02-01

    DNA double-strand breaks (DSBs) are one of the most lethal types of DNA damage that occurs in eukaryotic cells. There are two distinct pathways of repairing DSBs, homologous recombination (HR) and non-homologous end joining (NHEJ). In the NHEJ repairing pathway, DSB recognition and repair initiation is directed by the interaction of DNAbinding subunit Ku70/80 heterodimer with the DNA-PK protein catalytic subunit (DNA-PKcs). Mutations in these proteins result in repair stalling and eventual DNA misrepair that may lead to genomic instability. Studying the binding kinetics of these repair proteins is therefore important for understanding the conditions under which DSB repair stalls. Currently open questions are, what is the minimum DNA length that this complex needs to get a foothold onto a DSB and how tightly does DNA-PKcs bind onto the DNA-Ku70/80 complex. Fluorescence Correlation Spectroscopy (FCS) and Fluorescence Cross-Correlation Spectroscopy (FCCS) techniques have the potential to give information about the binding kinetics of DNA-protein and protein-protein interactions at the single-molecule level. In this work, FCS/FCCS measurements were performed to explore the minimum DNA base-pair (bp) length that Ku70/80 needed as a foothold to bind effectively onto the tips of different lengths of double-stranded DNA (dsDNA) fragments that mimic DSBs. 25 bp, 33 bp and 50 bp of dsDNA were used for these experiments and binding was studied as a function of salt concentration in solution. It was found that the 25 bp binding was weak even at physiological salt concentrations while the dissociation constant (Kd) remained constant for 33 and 50 bp dsDNA strand lengths. These studies indicated that the minimum binding length for the Ku70/8 is in the vicinity of 25 bp. The specificity of binding of Ku70/80 was proven by competitive binding FCCS experiments between Cy5-labeled DNA, GFP-Ku70/80 and titrations of unlabeled Ku70/80. Finally, using FCCS it was possible to estimate

  8. Recognition of double-stranded DNA using energetically activated duplexes with interstrand zippers of 1-, 2-or 4-pyrenyl-functionalized O2 '-alkylated RNA monomers

    DEFF Research Database (Denmark)

    Karmakar, Saswata; Madsen, Andreas Stahl; Guenther, Dale C.

    2014-01-01

    Despite advances with triplex-forming oligonucleotides, peptide nucleic acids, polyamides and more recently engineered proteins, there remains an urgent need for synthetic ligands that enable specific recognition of double-stranded (ds) DNA to accelerate studies aiming at detecting, regulating...... and modifying genes. Invaders, i.e., energetically activated DNA duplexes with interstrand zipper arrangements of intercalator-functionalized nucleotides, are emerging as an attractive approach toward this goal. Here, we characterize and compare Invaders based on 1-, 2- and 4-pyrenyl-functionalized O2...... hairpins with single nucleotide fidelity. Intercalator-mediated unwinding and activation of the double-stranded probe, coupled with extraordinary stabilization of probe target duplexes (Delta T-m/modification up to +14.0 degrees C), provides the driving force for dsDNA recognition. In contrast, Z...

  9. DNA double-strand break induction in Ku80-deficient CHO cells following Boron Neutron Capture Reaction

    Directory of Open Access Journals (Sweden)

    Masunaga Shinichiro

    2011-09-01

    Full Text Available Abstract Background Boron neutron capture reaction (BNCR is based on irradiation of tumors after accumulation of boron compound. 10B captures neutrons and produces an alpha (4He particle and a recoiled lithium nucleus (7Li. These particles have the characteristics of high linear energy transfer (LET radiation and have marked biological effects. The purpose of this study is to verify that BNCR will increase cell killing and slow disappearance of repair protein-related foci to a greater extent in DNA repair-deficient cells than in wild-type cells. Methods Chinese hamster ovary (CHO-K1 cells and a DNA double-strand break (DSB repair deficient mutant derivative, xrs-5 (Ku80 deficient CHO mutant cells, were irradiated by thermal neutrons. The quantity of DNA-DSBs following BNCR was evaluated by measuring the phosphorylation of histone protein H2AX (gamma-H2AX and 53BP1 foci using immunofluorescence intensity. Results Two hours after neutron irradiation, the number of gamma-H2AX and 53BP1 foci in the CHO-K1 cells was decreased to 36.5-42.8% of the levels seen 30 min after irradiation. In contrast, two hours after irradiation, foci levels in the xrs-5 cells were 58.4-69.5% of those observed 30 min after irradiation. The number of gamma-H2AX foci in xrs-5 cells at 60-120 min after BNCT correlated with the cell killing effect of BNCR. However, in CHO-K1 cells, the RBE (relative biological effectiveness estimated by the number of foci following BNCR was increased depending on the repair time and was not always correlated with the RBE of cytotoxicity. Conclusion Mutant xrs-5 cells show extreme sensitivity to ionizing radiation, because xrs-5 cells lack functional Ku-protein. Our results suggest that the DNA-DSBs induced by BNCR were not well repaired in the Ku80 deficient cells. The RBE following BNCR of radio-sensitive mutant cells was not increased but was lower than that of radio-resistant cells. These results suggest that gamma-ray resistant cells have

  10. DNA single-strand breaks, double-strand breaks, and crosslinks in rat testicular germ cells: Measurements of their formation and repair by alkaline and neutral filter elution

    Energy Technology Data Exchange (ETDEWEB)

    Bradley, M.O.; Dysart, G. (Merck Institute for Therapeutic Research, West Point, PA (USA))

    1985-06-01

    This work describes a neutral and alkaline elution method for measuring DNA single-strand breaks (SSBs), DNA double-strand breaks (DSBs), and DNA-DNA crosslinks in rat testicular germ cells after treatments in vivo or in vitro with both chemical mutagens and gamma-irradiation. The methods depend upon the isolation of testicular germ cells by collagenase and trypsin digestion, followed by filtration and centrifugation. {sup 137}Cs irradiation induced both DNA SSBs and DSBs in germ cells held on ice in vitro. Irradiation of the whole animal indicated that both types of DNA breaks are induced in vivo and can be repaired. A number of germ cell mutagens induced either DNA SSBs, DSBs, or cross-links after in vivo and in vitro dosing. These chemicals included methyl methanesulfonate, ethyl methanesulfonate, ethyl nitrosourea, dibromochlorpropane, ethylene dibromide, triethylene melamine, and mitomycin C. These results suggest that the blood-testes barrier is relatively ineffective for these mutagens, which may explain in part their in vivo mutagenic potency. This assay should be a useful screen for detecting chemical attack upon male germ-cell DNA and thus, it should help in the assessment of the mutagenic risk of chemicals. In addition, this approach can be used to study the processes of SSB, DSB, and crosslink repair in DNA of male germ cells, either from all stages or specific stages of development.

  11. Ultraviolet irradiation and the mechanisms underlying its inactivation of infectious agents.

    Science.gov (United States)

    Cutler, Timothy D; Zimmerman, Jeffrey J

    2011-06-01

    We review the principles of ultraviolet (UV) irradiation, the inactivation of infectious agents by UV, and current applications for the control of microorganisms. In particular, wavelengths between 200 and 280 nm (germicidal UV) affect the double-bond stability of adjacent carbon atoms in molecules including pyrimidines, purines and flavin. Thus, UV inactivation of microorganisms results from the formation of dimers in RNA (uracil and cytosine) and DNA (thymine and cytosine). The classic application of UV irradiation is the inactivation of microorganisms in biological safety cabinets. In the food-processing industry, germicidal UV irradiation has shown potential for the surface disinfection of fresh-cut fruit and vegetables. UV treatment of water (potable and wastewater) is increasingly common because the process is effective against a wide range of microorganisms, overdose is not possible, chemical residues or by-products are avoided, and water quality is unaffected. UV has been used to reduce the concentration of airborne microorganisms in limited studies, but the technology will require further development if it is to gain wider application. For bioaerosols, the primary technical challenge is delivery of sufficient UV irradiation to large volumes of air, but the absence of UV inactivation constants for airborne pathogens under a range of environmental conditions (temperature, relative humidity) further compounds the problem.

  12. Identification of defective illegitimate recombinational repair of oxidatively-induced DNA double-strand breaks in ataxia-telangiectasia cells

    Science.gov (United States)

    Dar, M. E.; Winters, T. A.; Jorgensen, T. J.

    1997-01-01

    Ataxia-telangiectasia (A-T) is an autosomal-recessive lethal human disease. Homozygotes suffer from a number of neurological disorders, as well as very high cancer incidence. Heterozygotes may also have a higher than normal risk of cancer, particularly for the breast. The gene responsible for the disease (ATM) has been cloned, but its role in mechanisms of the disease remain unknown. Cellular A-T phenotypes, such as radiosensitivity and genomic instability, suggest that a deficiency in the repair of DNA double-strand breaks (DSBs) may be the primary defect; however, overall levels of DSB rejoining appear normal. We used the shuttle vector, pZ189, containing an oxidatively-induced DSB, to compare the integrity of DSB rejoining in one normal and two A-T fibroblast cells lines. Mutation frequencies were two-fold higher in A-T cells, and the mutational spectrum was different. The majority of the mutations found in all three cell lines were deletions (44-63%). The DNA sequence analysis indicated that 17 of the 17 plasmids with deletion mutations in normal cells occurred between short direct-repeat sequences (removing one of the repeats plus the intervening sequences), implicating illegitimate recombination in DSB rejoining. The combined data from both A-T cell lines showed that 21 of 24 deletions did not involve direct-repeats sequences, implicating a defect in the illegitimate recombination pathway. These findings suggest that the A-T gene product may either directly participate in illegitimate recombination or modulate the pathway. Regardless, this defect is likely to be important to a mechanistic understanding of this lethal disease.

  13. The telomeric protein TRF2 is critical for the protection of A549 cells from both telomere erosion and DNA double-strand breaks driven by salvicine.

    Science.gov (United States)

    Zhang, Yong-Wei; Zhang, Zhi-Xiang; Miao, Ze-Hong; Ding, Jian

    2008-03-01

    Telomere repeat binding factor 2 (TRF2) has been increasingly recognized to be involved in DNA damage response and telomere maintenance. Our previous report found that salvicine (SAL), a novel topoisomerase II poison, elicited DNA double-strand breaks and telomere erosion in separate experimental systems. However, it remains to be clarified whether they share a common response to these two events and in particular whether TRF2 is involved in this process. In this study, we found that SAL concurrently induced DNA double-strand breaks, telomeric DNA damage, and telomere erosion in lung carcinoma A549 cells. It was unexpected to find that SAL led to disruption of TRF2, independently of either its transcription or proteasome-mediated degradation. By overexpressing the full-length trf2 gene and transfecting TRF2 small interfering RNAs, we showed that TRF2 protein protected both telomeric and genomic DNA from the SAL-elicited events. It is noteworthy that although both the Ataxia-telangiectasia-mutated (ATM) and the ATM- and Rad3-related (ATR) kinases responded to the SAL-induced DNA damages, only ATR was essential for the telomere erosion. The study also showed that the activated ATR augmented the SAL-triggered TRF2 disruption, whereas TRF2 reduction in turn enhanced ATR function. All of these findings suggest the emerging significance of TRF2 protecting both telomeric DNA and genomic DNA on the one hand and reveal the mutual modulation between ATR and TRF2 in sensing DNA damage signaling during cancer development on the other hand.

  14. Alignment of Homologous Chromosomes and Effective Repair of Programmed DNA Double-Strand Breaks during Mouse Meiosis Require the Minichromosome Maintenance Domain Containing 2 (MCMDC2) Protein.

    Science.gov (United States)

    Finsterbusch, Friederike; Ravindranathan, Ramya; Dereli, Ihsan; Stanzione, Marcello; Tränkner, Daniel; Tóth, Attila

    2016-10-01

    Orderly chromosome segregation during the first meiotic division requires meiotic recombination to form crossovers between homologous chromosomes (homologues). Members of the minichromosome maintenance (MCM) helicase family have been implicated in meiotic recombination. In addition, they have roles in initiation of DNA replication, DNA mismatch repair and mitotic DNA double-strand break repair. Here, we addressed the function of MCMDC2, an atypical yet conserved MCM protein, whose function in vertebrates has not been reported. While we did not find an important role for MCMDC2 in mitotically dividing cells, our work revealed that MCMDC2 is essential for fertility in both sexes due to a crucial function in meiotic recombination. Meiotic recombination begins with the introduction of DNA double-strand breaks into the genome. DNA ends at break sites are resected. The resultant 3-prime single-stranded DNA overhangs recruit RAD51 and DMC1 recombinases that promote the invasion of homologous duplex DNAs by the resected DNA ends. Multiple strand invasions on each chromosome promote the alignment of homologous chromosomes, which is a prerequisite for inter-homologue crossover formation during meiosis. We found that although DNA ends at break sites were evidently resected, and they recruited RAD51 and DMC1 recombinases, these recombinases were ineffective in promoting alignment of homologous chromosomes in the absence of MCMDC2. Consequently, RAD51 and DMC1 foci, which are thought to mark early recombination intermediates, were abnormally persistent in Mcmdc2-/- meiocytes. Importantly, the strand invasion stabilizing MSH4 protein, which marks more advanced recombination intermediates, did not efficiently form foci in Mcmdc2-/- meiocytes. Thus, our work suggests that MCMDC2 plays an important role in either the formation, or the stabilization, of DNA strand invasion events that promote homologue alignment and provide the basis for inter-homologue crossover formation during

  15. Double strand breaks can initiate gene silencing and SIRT1-dependent onset of DNA methylation in an exogenous promoter CpG island.

    Directory of Open Access Journals (Sweden)

    Heather M O'Hagan

    2008-08-01

    Full Text Available Chronic exposure to inducers of DNA base oxidation and single and double strand breaks contribute to tumorigenesis. In addition to the genetic changes caused by this DNA damage, such tumors often contain epigenetically silenced genes with aberrant promoter region CpG island DNA hypermethylation. We herein explore the relationships between such DNA damage and epigenetic gene silencing using an experimental model in which we induce a defined double strand break in an exogenous promoter construct of the E-cadherin CpG island, which is frequently aberrantly DNA hypermethylated in epithelial cancers. Following the onset of repair of the break, we observe recruitment to the site of damage of key proteins involved in establishing and maintaining transcriptional repression, namely SIRT1, EZH2, DNMT1, and DNMT3B, and the appearance of the silencing histone modifications, hypoacetyl H4K16, H3K9me2 and me3, and H3K27me3. Although in most cells selected after the break, DNA repair occurs faithfully with preservation of activity of the promoter, a small percentage of the plated cells demonstrate induction of heritable silencing. The chromatin around the break site in such a silent clone is enriched for most of the above silent chromatin proteins and histone marks, and the region harbors the appearance of increasing DNA methylation in the CpG island of the promoter. During the acute break, SIRT1 appears to be required for the transient recruitment of DNMT3B and subsequent methylation of the promoter in the silent clones. Taken together, our data suggest that normal repair of a DNA break can occasionally cause heritable silencing of a CpG island-containing promoter by recruitment of proteins involved in silencing. Furthermore, with contribution of the stress-related protein SIRT1, the break can lead to the onset of aberrant CpG island DNA methylation, which is frequently associated with tight gene silencing in cancer.

  16. Effect of formaldehyde inactivation on poliovirus.

    Science.gov (United States)

    Wilton, Thomas; Dunn, Glynis; Eastwood, David; Minor, Philip D; Martin, Javier

    2014-10-01

    Inactivated polio vaccines, which have been used in many countries for more than 50 years, are produced by treating live poliovirus (PV) with formaldehyde. However, the molecular mechanisms underlying virus inactivation are not well understood. Infection by PV is initiated by virus binding to specific cell receptors, which results in viral particles undergoing sequential conformational changes that generate altered structural forms (135S and 80S particles) and leads to virus cell entry. We have analyzed the ability of inactivated PV to bind to the human poliovirus receptor (hPVR) using various techniques such as ultracentrifugation, fluorescence-activated cell sorting flow cytometry and real-time reverse transcription-PCR (RT-PCR). The results showed that although retaining the ability to bind to hPVR, inactivated PV bound less efficiently in comparison to live PV. We also found that inactivated PV showed resistance to structural conversion in vitro, as judged by measuring changes in antigenicity, the ability to bind to hPVR, and viral RNA release at high temperature. Furthermore, viral RNA from inactivated PV was shown to be modified, since cDNA yields obtained by RT-PCR amplification were severely reduced and no infectious virus was recovered after RNA transfection into susceptible cells. Importance: This study represents a novel insight into the molecular mechanisms responsible for poliovirus inactivation. We show that inactivation with formaldehyde has an effect on early steps of viral replication as it reduces the ability of PV to bind to hPVR, decreases the sensitivity of PV to convert to 135S particles, and abolishes the infectivity of its viral RNA. These changes are likely responsible for the loss of infectivity shown by PV following inactivation. Techniques used in this study represent new approaches for the characterization of inactivated PV products and could be useful in developing improved methods for the production and quality control testing of

  17. Transcription-associated processes cause DNA double-strand breaks and translocations in neural stem/progenitor cells.

    Science.gov (United States)

    Schwer, Bjoern; Wei, Pei-Chi; Chang, Amelia N; Kao, Jennifer; Du, Zhou; Meyers, Robin M; Alt, Frederick W

    2016-02-23

    High-throughput, genome-wide translocation sequencing (HTGTS) studies of activated B cells have revealed that DNA double-strand breaks (DSBs) capable of translocating to defined bait DSBs are enriched around the transcription start sites (TSSs) of active genes. We used the HTGTS approach to investigate whether a similar phenomenon occurs in primary neural stem/progenitor cells (NSPCs). We report that breakpoint junctions indeed are enriched around TSSs that were determined to be active by global run-on sequencing analyses of NSPCs. Comparative analyses of transcription profiles in NSPCs and B cells revealed that the great majority of TSS-proximal junctions occurred in genes commonly expressed in both cell types, possibly because this common set has higher transcription levels on average than genes transcribed in only one or the other cell type. In the latter context, among all actively transcribed genes containing translocation junctions in NSPCs, those with junctions located within 2 kb of the TSS show a significantly higher transcription rate on average than genes with junctions in the gene body located at distances greater than 2 kb from the TSS. Finally, analysis of repair junction signatures of TSS-associated translocations in wild-type versus classical nonhomologous end-joining (C-NHEJ)-deficient NSPCs reveals that both C-NHEJ and alternative end-joining pathways can generate translocations by joining TSS-proximal DSBs to DSBs on other chromosomes. Our studies show that the generation of transcription-associated DSBs is conserved across divergent cell types.

  18. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  19. Microsatellite DNA mutations in double-crested cormorants (Phalacrocorax auritus) associated with exposure to PAH-containing industrial air pollution.

    Science.gov (United States)

    King, L E; de Solla, S R; Small, J M; Sverko, E; Quinn, J S

    2014-10-01

    Hamilton Harbour, Ontario, Canada is one of the most polluted sites on the Great Lakes, and is subject to substantial airborne pollution due to emissions from both heavy industry and intense vehicle traffic. Mutagenic Polycyclic aromatic hydrocarbons (PAHs) are present at very high concentrations in the air and sediment of Hamilton Harbour. We used five variable DNA microsatellites to screen for mutations in 97 families of Double-crested Cormorants (Phalacrocorax auritus) from three wild colonies, two in Hamilton Harbour and one in cleaner northeastern Lake Erie. Mutations were identified in all five microsatellites at low frequencies, with the majority of mutations found in chicks from the Hamilton Harbour site closest to industrial sources of PAH contamination. Microsatellite mutation rates were 6-fold higher at the Hamilton Harbour site closest to the industrial sources of PAH contamination than the other Hamilton Harbour site, and both were higher than the reference colony. A Phase I metabolite of the PAH benzo[a]pyrene identified by LC-MS/MS in bile and liver from Hamilton Harbour cormorant chicks suggests that these cormorants are exposed to and metabolizing PAHs, highlighting their potential to have caused the observed mutations.

  20. A census of α-helical membrane proteins in double-stranded DNA viruses infecting bacteria and archaea.

    Science.gov (United States)

    Kristensen, David M; Saeed, Usman; Frishman, Dmitrij; Koonin, Eugene V

    2015-11-10

    Viruses are the most abundant and genetically diverse biological entities on earth, yet the repertoire of viral proteins remains poorly explored. As the number of sequenced virus genomes grows into the thousands, and the number of viral proteins into the hundreds of thousands, we report a systematic computational analysis of the point of first-contact between viruses and their hosts, namely viral transmembrane (TM) proteins. The complement of α-helical TM proteins in double-stranded DNA viruses infecting bacteria and archaea reveals large-scale trends that differ from those of their hosts. Viruses typically encode a substantially lower fraction of TM proteins than archaea or bacteria, with the notable exception of viruses with virions containing a lipid component such as a lipid envelope, internal lipid core, or inner membrane vesicle. Compared to bacteriophages, archaeal viruses are substantially enriched in membrane proteins. However, this feature is not always stable throughout the evolution of a viral lineage; for example, TM proteins are not part of the common heritage shared between Lipothrixviridae and Rudiviridae. In contrast to bacteria and archaea, viruses almost completely lack proteins with complicated membrane topologies composed of more than 4 TM segments, with the few detected exceptions being obvious cases of relatively recent horizontal transfer from the host. The dramatic differences between the membrane proteomes of cells and viruses stem from the fact that viruses do not depend on essential membranes for energy transformation, ion homeostasis, nutrient transport and signaling.

  1. Do Exogenous DNA Double-Strand Breaks Change Incomplete Synapsis and Chiasma Localization in the Grasshopper Stethophyma grossum?

    Science.gov (United States)

    2016-01-01

    Meiotic recombination occurs as a programmed event that initiates by the formation of DNA double-strand breaks (DSBs) that give rise to the formation of crossovers that are observed as chiasmata. Chiasmata are essential for the accurate chromosome segregation and the generation of new combinations of parental alleles. Some treatments that provoke exogenous DSBs also lead to alterations in the recombination pattern of some species in which full homologous synapsis is achieved at pachytene. We have carried out a similar approach in males of the grasshopper Stethophyma grossum, whose homologues show incomplete synapsis and proximal chiasma localization. After irradiating males with γ rays we have studied the distribution of both the histone variant γ-H2AX and the recombinase RAD51. These proteins are cytological markers of DSBs at early prophase I. We have inferred synaptonemal complex (SC) formation via identification of SMC3 and RAD 21 cohesin subunits. Whereas thick and thin SMC3 filaments would correspond to synapsed and unsynapsed regions, the presence of RAD21 is only restricted to synapsed regions. Results show that irradiated spermatocytes maintain restricted synapsis between homologues. However, the frequency and distribution of chiasmata in metaphase I bivalents is slightly changed and quadrivalents were also observed. These results could be related to the singular nuclear polarization displayed by the spermatocytes of this species. PMID:28005992

  2. Rtt107 phosphorylation promotes localisation to DNA double-stranded breaks (DSBs and recombinational repair between sister chromatids.

    Directory of Open Access Journals (Sweden)

    Pranav Ullal

    Full Text Available Efficient repair of DNA double-stranded breaks (DSB requires a coordinated response at the site of lesion. Nucleolytic resection commits repair towards homologous recombination, which preferentially occurs between sister chromatids. DSB resection promotes recruitment of the Mec1 checkpoint kinase to the break. Rtt107 is a target of Mec1 and serves as a scaffold during repair. Rtt107 plays an important role during rescue of damaged replication forks, however whether Rtt107 contributes to the repair of DSBs is unknown. Here we show that Rtt107 is recruited to DSBs induced by the HO endonuclease. Rtt107 phosphorylation by Mec1 and its interaction with the Smc5-Smc6 complex are both required for Rtt107 loading to breaks, while Rtt107 regulators Slx4 and Rtt101 are not. We demonstrate that Rtt107 has an effect on the efficiency of sister chromatid recombination (SCR and propose that its recruitment to DSBs, together with the Smc5-Smc6 complex is important for repair through the SCR pathway.

  3. Effects of Bacterial Inactivation Methods on Downstream Proteomic Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Andy; Merkley, Eric D.; Clowers, Brian H.; Hutchison, Janine R.; Kreuzer, Helen W.

    2015-05-01

    Inactivation of pathogenic microbial samples is often necessary for the protection of researchers and to comply with local and federal regulations. By its nature, biological inactivation causes changes to microbial samples, potentially affecting observed experimental results. While inactivation induced damage to materials such as DNA has been evaluated, the effect of various inactivation strategies on proteomic data, to our knowledge, has not been discussed. To this end, we inactivated samples of Yersinia pestis and Escherichia coli by autoclave, ethanol, or irradiation treatment to determine how inactivation changes liquid chromatography tandem mass spectrometry data quality as well as apparent protein content of cells. Proteomic datasets obtained from aliquots of samples inactivated by different methods were highly similar, with Pearson correlation coefficients ranging from 0.822 to 0.985 and 0.816 to 0.985 for E. coli and Y. pestis, respectively, suggesting that inactivation had only slight impacts on the set of proteins identified. In addition, spectral quality metrics such as distributions of various database search algorithm scores remained constant across inactivation methods, indicating that inactivation does not appreciably degrade spectral quality. Though overall changes resulting from inactivation were small, there were detectable trends. For example, one-sided Fischer exact tests determined that periplasmic proteins decrease in observed abundance after sample inactivation by autoclaving (α = 1.71x10-2 for E. coli, α = 4.97x10-4 for Y. pestis) and irradiation (α = 9.43x10-7 for E. coli, α = 1.21x10-5 for Y. pestis) when compared to controls that were not inactivated. Based on our data, if sample inactivation is necessary, we recommend inactivation with ethanol treatment with secondary preference given to irradiation.

  4. High incidence of HPV-associated head and neck cancers in FA deficient mice is associated with E7's induction of DNA damage through its inactivation of pocket proteins.

    Directory of Open Access Journals (Sweden)

    Jung Wook Park

    Full Text Available Fanconi anemia (FA patients are highly susceptible to solid tumors at multiple anatomical sites including head and neck region. A subset of head and neck cancers (HNCs is associated with 'high-risk' HPVs, particularly HPV16. However, the correlation between HPV oncogenes and cancers in FA patients is still unclear. We previously learned that FA deficiency in mice predisposes HPV16 E7 transgenic mice to HNCs. To address HPV16 E6's oncogenic potential under FA deficiency in HNCs, we utilized HPV16 E6-transgenic mice (K14E6 and HPV16 E6/E7-bi-transgenic mice (K14E6E7 on genetic backgrounds sufficient or deficient for one of the fanc genes, fancD2 and monitored their susceptibility to HNCs. K14E6 mice failed to develop tumor. However, E6 and fancD2-deficiency accelerated E7-driven tumor development in K14E6E7 mice. The increased tumor incidence was more correlated with E7-driven DNA damage than proliferation. We also found that deficiency of pocket proteins, pRb, p107, and p130 that are well-established targets of E7, could recapitulate E7's induction of DNA damage. Our findings support the hypothesis that E7 induces HPV-associated HNCs by promoting DNA damage through the inactivation of pocket proteins, which explains why a deficiency in DNA damage repair would increase susceptibility to E7-driven cancer. Our results further demonstrate the unexpected finding that FA deficiency does not predispose E6 transgenic mice to HNCs, indicating a specificity in the synergy between FA deficiency and HPV oncogenes in causing HNCs.

  5. Single pore translocation of folded, double-stranded, and tetra-stranded DNA through channel of bacteriophage phi29 DNA packaging motor.

    Science.gov (United States)

    Haque, Farzin; Wang, Shaoying; Stites, Chri