WorldWideScience

Sample records for inactivation dna double

  1. Effects of heavy ions on inactivation and DNA double strand breaks in Deinococcus radiodurans R1.

    Science.gov (United States)

    Zimmermann, H; Schafer, M; Schmitz, C; Bucker, H

    1994-10-01

    Inactivation and double strand break (dsb) induction after heavy ion irradiation were studied in stationary phase cells of the highly radiation resistant bacterium Deinococcus radiodurans R1. There is evidence that the radiation sensitivity of this bacterium is nearly independent on energy in the range of up to 15 MeV/u for lighter ions (Ar). The responses to dsb induction for charged particles show direct relationship between increasing radiation dose and residual intact DNA.

  2. DNA double strand breaks as the critical type of damage with regard to inactivation of cells through ionizing radiation

    International Nuclear Information System (INIS)

    Frankenberg, D.

    1985-01-01

    This report presents the results of an investigation into the effects of ionizing radiation on eukaryotic cells, aimed at revealing the molecular mechanisms leading to cell inactivation as a result of ionizing radiation. The quantitative determination of radiation-induced double strand breaks (DSB) is done via sedimentation of the DNA released from the cells in a neutral saccharose gradient in a preparative ultracentrifuge. The 'experimental mass spectrum' of DNA molecules thus obtained, the mean number of DSB per cell is calculated using a special computer program which simulates the stochastic induction of DSB in the DNA of non-irradiated cells and links the 'simulated' mass spectrum with the 'experimental' one on the basis of the least square fit. The experimental and theoretical studies with the eukaryote yeast on the whole allow insight into the relation between energy absorption and the inactivation of irradiated cells. (orig./MG) [de

  3. Induction of DNA double-strand breaks by ionizing radiation of different quality and their relevance for cell inactivation

    International Nuclear Information System (INIS)

    Kampf, G.

    1988-01-01

    By investigation of the production of DNA strand breaks and of DNA release from the nuclear membrane complex in Chinese hamster cells using different radiation qualities from 1 to 360 keV/μm, partly also under hypoxic conditions, and by relating the results to the induction of chromosome aberrations and to cell inactivation it has become possible to find connections between the induction of molecular lesions and the expression of this damage on the cellular level. From the studies follows that DNA pieces are cut off from the nuclear membrane complex by DNA double-strand breaks (DSB). The share and size of the released pieces depends on radiation dose and quality as well as on the oxygen conditions. The lesions can partly be repaired. In connection with the DSB rates the results of the DNA release studies led to the conclusion that the DNA in the cells must be organized in superstructure units (MASSUs) with a DNA mass of about 2 x 10 9 g/mol, which are associated to the nuclear membrane in attachment points. The numerical relations show that for a 37% survival probability about 90 DSB per genome are required with sparsely ionizing radiation; this number declines to about 40 by use of more densely ionizing radiation up to 150 keV/μm, and increases again with further rise of the ionization density. Hence, for cell inactivation not simply a certain number of DSB per cell is required but rather seems their cooperation within a small structure section of the DNA to be relevant. These critical structures are with high probability the MASSUs. An irrepairable release of DNA from such a structure unit can bring about a chromosome break detectable in the metaphase and finally lead to cell inactivation. DSB turned out to be the essential lethal events in bacteria as well. The relatively small differences to the eukaryotic cells in the position of the maximum of radiation sensitivity on the LET scale and in the lesion sensitivity towards DSB let suggest that a common critical

  4. Clustering of double strand break-containing chromosome domains is not inhibited by inactivation of major repair proteins

    International Nuclear Information System (INIS)

    Krawczyk, P. M.; Stap, C.; Van Oven, C.; Hoebe, R.; Aten, J. A.

    2006-01-01

    For efficient repair of DNA double strand breaks (DSBs) cells rely on a process that involves the Mre11/Rad50/Nbs1 complex, which may help to protect non-repaired DNA ends from separating until they can be rejoined by DNA repair proteins. It has been observed that as a secondary effect, this process can lead to unintended clustering of multiple, initially separate, DSB-containing chromosome domains. This work demonstrates that neither inactivation of the major repair proteins XRCC3 and the DNA-dependent protein kinase (DNA-PK) nor inhibition of DNA-PK by vanillin influences the aggregation of DSB-containing chromosome domains. (authors)

  5. Synthetic lethality between murine DNA repair factors XLF and DNA-PKcs is rescued by inactivation of Ku70

    DEFF Research Database (Denmark)

    Xing, Mengtan; Bjørås, Magnar; Daniel, Jeremy A

    2017-01-01

    DNA double-strand breaks (DSBs) are recognized and repaired by the Classical Non-Homologous End-Joining (C-NHEJ) and Homologous Recombination pathways. C-NHEJ includes the core Ku70 and Ku80 (or Ku86) heterodimer that binds DSBs and thus promotes recruitment of accessory downstream NHEJ factors XLF......, PAXX, DNA-PKcs, Artemis and other core subunits, XRCC4 and DNA Ligase 4 (Lig4). In the absence of core C-NHEJ factors, DNA repair can be performed by Alternative End-Joining, which likely depends on DNA Ligase 1 and DNA Ligase 3. Genetic inactivation of C-NHEJ factors, such as Ku70, Ku80, XLF, PAXX...... with severe apoptosis in the central nervous system. Here, we demonstrate that inactivation of the Ku70 gene rescues the synthetic lethality between XLF and DNA-PKcs, resulting in triple knockout mice that are indistinguishable from Ku70-deficient littermates by size or levels of genomic instability. Moreover...

  6. Fragmentation in DNA double-strand breaks

    International Nuclear Information System (INIS)

    Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

    2005-01-01

    DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

  7. Human norovirus inactivation in oysters by high hydrostatic pressure processing: A randomized double-blinded study

    Science.gov (United States)

    This randomized, double-blinded, clinical trial assessed the effect of high hydrostatic pressure processing (HPP) on genogroup I.1 human norovirus (HuNoV) inactivation in virus-seeded oysters when ingested by subjects. The safety and efficacy of HPP treatments were assessed in three study phases wi...

  8. Production of DNA strand breaks by ionizing radiation of different quality and their consequences for cell inactivation

    International Nuclear Information System (INIS)

    Kampf, G.

    1983-07-01

    The production of single- and double-strand breaks (DSB) in the DNA of Chinese hamster cells (V 79) was studied by use of 11 radiation qualities, with some also under hypoxic conditions. The aim was to find relations between the induction of lesions on the molecular level and the expression of this damage on the cellular level. The results suggest that release of DNA from the nuclear-membrane complex, induction of chromosome breaks, and cell inactivation are triggered by DSB. However, not simply a certain number of DSB in the DNA of the nucleus, but their cooperation within a small structural section of DNA is required for cell inactivation. Such sections may be the membrane-associated superstructure units. DSB produced under hypoxic conditions show a greater effectiveness than those produced under oxic conditions. The investigations with eukaryotic cells and bacteria suggest that not the entire DNA of all organisms but a structural unit common to them represents the critical target for radiation action. (author)

  9. Fluctuations in the DNA double helix

    Science.gov (United States)

    Peyrard, M.; López, S. C.; Angelov, D.

    2007-08-01

    DNA is not the static entity suggested by the famous double helix structure. It shows large fluctuational openings, in which the bases, which contain the genetic code, are temporarily open. Therefore it is an interesting system to study the effect of nonlinearity on the physical properties of a system. A simple model for DNA, at a mesoscopic scale, can be investigated by computer simulation, in the same spirit as the original work of Fermi, Pasta and Ulam. These calculations raise fundamental questions in statistical physics because they show a temporary breaking of equipartition of energy, regions with large amplitude fluctuations being able to coexist with regions where the fluctuations are very small, even when the model is studied in the canonical ensemble. This phenomenon can be related to nonlinear excitations in the model. The ability of the model to describe the actual properties of DNA is discussed by comparing theoretical and experimental results for the probability that base pairs open an a given temperature in specific DNA sequences. These studies give us indications on the proper description of the effect of the sequence in the mesoscopic model.

  10. Role of DNA damage in ultraviolet (313 nm) inactivation of yeasts Saccharomyces cerevisial

    International Nuclear Information System (INIS)

    Pospelov, M.E.; Ivanova, Eh.V.; Frajkin, G.Ya.

    1984-01-01

    Relative contribution of photoinhibition of cell respiration and DNA damage to lethal effect, caused by ultraviolet (UV) radiation of 313 m in certain yeast strains Saccharomyces cerevisiae, has been studied. It is shown that cell inactivation is mainly conditioned by DNA photodamage. When studying photoreactivation it has been established, that dimers of pyrimidine bases are the main lethal photoproducts, formed in DNA Under the effect of UV-radiation of 313 nm

  11. Inactivating UBE2M impacts the DNA damage response and genome integrity involving multiple cullin ligases.

    Directory of Open Access Journals (Sweden)

    Scott Cukras

    Full Text Available Protein neddylation is involved in a wide variety of cellular processes. Here we show that the DNA damage response is perturbed in cells inactivated with an E2 Nedd8 conjugating enzyme UBE2M, measured by RAD51 foci formation kinetics and cell based DNA repair assays. UBE2M knockdown increases DNA breakages and cellular sensitivity to DNA damaging agents, further suggesting heightened genomic instability and defective DNA repair activity. Investigating the downstream Cullin targets of UBE2M revealed that silencing of Cullin 1, 2, and 4 ligases incurred significant DNA damage. In particular, UBE2M knockdown, or defective neddylation of Cullin 2, leads to a blockade in the G1 to S progression and is associated with delayed S-phase dependent DNA damage response. Cullin 4 inactivation leads to an aberrantly high DNA damage response that is associated with increased DNA breakages and sensitivity of cells to DNA damaging agents, suggesting a DNA repair defect is associated. siRNA interrogation of key Cullin substrates show that CDT1, p21, and Claspin are involved in elevated DNA damage in the UBE2M knockdown cells. Therefore, UBE2M is required to maintain genome integrity by activating multiple Cullin ligases throughout the cell cycle.

  12. Inactivating UBE2M impacts the DNA damage response and genome integrity involving multiple cullin ligases.

    Science.gov (United States)

    Cukras, Scott; Morffy, Nicholas; Ohn, Takbum; Kee, Younghoon

    2014-01-01

    Protein neddylation is involved in a wide variety of cellular processes. Here we show that the DNA damage response is perturbed in cells inactivated with an E2 Nedd8 conjugating enzyme UBE2M, measured by RAD51 foci formation kinetics and cell based DNA repair assays. UBE2M knockdown increases DNA breakages and cellular sensitivity to DNA damaging agents, further suggesting heightened genomic instability and defective DNA repair activity. Investigating the downstream Cullin targets of UBE2M revealed that silencing of Cullin 1, 2, and 4 ligases incurred significant DNA damage. In particular, UBE2M knockdown, or defective neddylation of Cullin 2, leads to a blockade in the G1 to S progression and is associated with delayed S-phase dependent DNA damage response. Cullin 4 inactivation leads to an aberrantly high DNA damage response that is associated with increased DNA breakages and sensitivity of cells to DNA damaging agents, suggesting a DNA repair defect is associated. siRNA interrogation of key Cullin substrates show that CDT1, p21, and Claspin are involved in elevated DNA damage in the UBE2M knockdown cells. Therefore, UBE2M is required to maintain genome integrity by activating multiple Cullin ligases throughout the cell cycle.

  13. Microdosimetrical calculations of the rate of repairable DNA - double strand breaks based on a model for the interpretation of experiments with different doses and radiation qualities

    International Nuclear Information System (INIS)

    Rosemann, M.; Regel, K.

    1990-01-01

    When comparing various DNA injuries induced by radiation double breaks were shown to play peculiar role in subsequent cell changes such as inactivation, aberrations, mutations and transformations. However it was proved that significant part of radiation-induced double breaks could be repaied within cell. 3 refs

  14. Effect of temperature on DNA double helix: An insight from ...

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... We have carried out detailed MD simulations of DNA double ..... Wireframe representation of B-DNA crystal structures with PDB identifier (a) 1EHV, ..... nucleic acid structures, PhD thesis, University of Calcutta, Kolkata.

  15. DNA double-strand breaks & poptosis in the testis

    NARCIS (Netherlands)

    Hamer, Geert

    2003-01-01

    During spermatogenesis, DNA damage is a naturally occurring event. At a certain stage, during the first meiotic prophase, DNA breaks are endogenously induced and even required for meiotic recombination. We studied these DNA breaks but also used ionizing radiation (IR) to induce DNA double-strand

  16. Effect of temperature on DNA double helix: An insight from ...

    Indian Academy of Sciences (India)

    The three-dimensional structure of DNA contains various sequence-dependent structural information, which control many cellular processes in life, such as replication, transcription, DNA repair, etc. For the above functions, DNA double helices need to unwind or melt locally, which is different from terminal melting, as often ...

  17. The DnaA Cycle in Escherichia coli: Activation, Function and Inactivation of the Initiator Protein

    Directory of Open Access Journals (Sweden)

    Tsutomu Katayama

    2017-12-01

    Full Text Available This review summarizes the mechanisms of the initiator protein DnaA in replication initiation and its regulation in Escherichia coli. The chromosomal origin (oriC DNA is unwound by the replication initiation complex to allow loading of DnaB helicases and replisome formation. The initiation complex consists of the DnaA protein, DnaA-initiator-associating protein DiaA, integration host factor (IHF, and oriC, which contains a duplex-unwinding element (DUE and a DnaA-oligomerization region (DOR containing DnaA-binding sites (DnaA boxes and a single IHF-binding site that induces sharp DNA bending. DiaA binds to DnaA and stimulates DnaA assembly at the DOR. DnaA binds tightly to ATP and ADP. ATP-DnaA constructs functionally different sub-complexes at DOR, and the DUE-proximal DnaA sub-complex contains IHF and promotes DUE unwinding. The first part of this review presents the structures and mechanisms of oriC-DnaA complexes involved in the regulation of replication initiation. During the cell cycle, the level of ATP-DnaA level, the active form for initiation, is strictly regulated by multiple systems, resulting in timely replication initiation. After initiation, regulatory inactivation of DnaA (RIDA intervenes to reduce ATP-DnaA level by hydrolyzing the DnaA-bound ATP to ADP to yield ADP-DnaA, the inactive form. RIDA involves the binding of the DNA polymerase clamp on newly synthesized DNA to the DnaA-inactivator Hda protein. In datA-dependent DnaA-ATP hydrolysis (DDAH, binding of IHF at the chromosomal locus datA, which contains a cluster of DnaA boxes, results in further hydrolysis of DnaA-bound ATP. SeqA protein inhibits untimely initiation at oriC by binding to newly synthesized oriC DNA and represses dnaA transcription in a cell cycle dependent manner. To reinitiate DNA replication, ADP-DnaA forms oligomers at DnaA-reactivating sequences (DARS1 and DARS2, resulting in the dissociation of ADP and the release of nucleotide-free apo-DnaA, which then

  18. Lyn tyrosine kinase promotes silencing of ATM-dependent checkpoint signaling during recovery from DNA double-strand breaks

    International Nuclear Information System (INIS)

    Fukumoto, Yasunori; Kuki, Kazumasa; Morii, Mariko; Miura, Takahito; Honda, Takuya; Ishibashi, Kenichi; Hasegawa, Hitomi; Kubota, Sho; Ide, Yudai; Yamaguchi, Noritaka; Nakayama, Yuji; Yamaguchi, Naoto

    2014-01-01

    Highlights: • Inhibition of Src family kinases decreased γ-H2AX signal. • Inhibition of Src family increased ATM-dependent phosphorylation of Chk2 and Kap1. • shRNA-mediated knockdown of Lyn increased phosphorylation of Kap1 by ATM. • Ectopic expression of Src family kinase suppressed ATM-mediated Kap1 phosphorylation. • Src is involved in upstream signaling for inactivation of ATM signaling. - Abstract: DNA damage activates the DNA damage checkpoint and the DNA repair machinery. After initial activation of DNA damage responses, cells recover to their original states through completion of DNA repair and termination of checkpoint signaling. Currently, little is known about the process by which cells recover from the DNA damage checkpoint, a process called checkpoint recovery. Here, we show that Src family kinases promote inactivation of ataxia telangiectasia mutated (ATM)-dependent checkpoint signaling during recovery from DNA double-strand breaks. Inhibition of Src activity increased ATM-dependent phosphorylation of Chk2 and Kap1. Src inhibition increased ATM signaling both in G2 phase and during asynchronous growth. shRNA knockdown of Lyn increased ATM signaling. Src-dependent nuclear tyrosine phosphorylation suppressed ATM-mediated Kap1 phosphorylation. These results suggest that Src family kinases are involved in upstream signaling that leads to inactivation of the ATM-dependent DNA damage checkpoint

  19. Hda inactivation of DnaA is the predominant mechanism preventing hyperinitiation of Escherichia coli DNA replication.

    Science.gov (United States)

    Camara, Johanna E; Breier, Adam M; Brendler, Therese; Austin, Stuart; Cozzarelli, Nicholas R; Crooke, Elliott

    2005-08-01

    Initiation of DNA replication from the Escherichia coli chromosomal origin is highly regulated, assuring that replication occurs precisely once per cell cycle. Three mechanisms for regulation of replication initiation have been proposed: titration of free DnaA initiator protein by the datA locus, sequestration of newly replicated origins by SeqA protein and regulatory inactivation of DnaA (RIDA), in which active ATP-DnaA is converted to the inactive ADP-bound form. DNA microarray analyses showed that the level of initiation in rapidly growing cells that lack datA was indistinguishable from that in wild-type cells, and that the absence of SeqA protein caused only a modest increase in initiation, in agreement with flow-cytometry data. In contrast, cells lacking Hda overinitiated replication twofold, implicating RIDA as the predominant mechanism preventing extra initiation events in a cell cycle.

  20. Evidence for roles of the Escherichia coli Hda protein beyond regulatory inactivation of DnaA.

    Science.gov (United States)

    Baxter, Jamie C; Sutton, Mark D

    2012-08-01

    The ATP-bound form of the Escherichia coli DnaA protein binds 'DnaA boxes' present in the origin of replication (oriC) and operator sites of several genes, including dnaA, to co-ordinate their transcription with initiation of replication. The Hda protein, together with the β sliding clamp, stimulates the ATPase activity of DnaA via a process termed regulatory inactivation of DnaA (RIDA), to regulate the activity of DnaA in DNA replication. Here, we used the mutant dnaN159 strain, which expresses the β159 clamp protein, to gain insight into how the actions of Hda are co-ordinated with replication. Elevated expression of Hda impeded growth of the dnaN159 strain in a Pol II- and Pol IV-dependent manner, suggesting a role for Hda managing the actions of these Pols. In a wild-type strain, elevated levels of Hda conferred sensitivity to nitrofurazone, and suppressed the frequency of -1 frameshift mutations characteristic of Pol IV, while loss of hda conferred cold sensitivity. Using the dnaN159 strain, we identified 24 novel hda alleles, four of which supported E. coli viability despite their RIDA defect. Taken together, these findings suggest that although one or more Hda functions are essential for cell viability, RIDA may be dispensable. © 2012 Blackwell Publishing Ltd.

  1. Non-coding RNAs and epigenome: de novo DNA methylation, allelic exclusion and X-inactivation

    Directory of Open Access Journals (Sweden)

    V. A. Halytskiy

    2013-12-01

    Full Text Available Non-coding RNAs are widespread class of cell RNAs. They participate in many important processes in cells – signaling, posttranscriptional silencing, protein biosynthesis, splicing, maintenance of genome stability, telomere lengthening, X-inactivation. Nevertheless, activity of these RNAs is not restricted to posttranscriptional sphere, but cover also processes that change or maintain the epigenetic information. Non-coding RNAs can directly bind to the DNA targets and cause their repression through recruitment of DNA methyltransferases as well as chromatin modifying enzymes. Such events constitute molecular mechanism of the RNA-dependent DNA methylation. It is possible, that the RNA-DNA interaction is universal mechanism triggering DNA methylation de novo. Allelic exclusion can be also based on described mechanism. This phenomenon takes place, when non-coding RNA, which precursor is transcribed from one allele, triggers DNA methylation in all other alleles present in the cell. Note, that miRNA-mediated transcriptional silencing resembles allelic exclusion, because both miRNA gene and genes, which can be targeted by this miRNA, contain elements with the same sequences. It can be assumed that RNA-dependent DNA methylation and allelic exclusion originated with the purpose of counteracting the activity of mobile genetic elements. Probably, thinning and deregulation of the cellular non-coding RNA pattern allows reactivation of silent mobile genetic elements resulting in genome instability that leads to ageing and carcinogenesis. In the course of X-inactivation, DNA methylation and subsequent hete­rochromatinization of X chromosome can be triggered by direct hybridization of 5′-end of large non-coding RNA Xist with DNA targets in remote regions of the X chromosome.

  2. UV-LEDs Efficiently Inactivate DNA and RNA Coliphages

    Directory of Open Access Journals (Sweden)

    Alyaa M. Zyara

    2017-01-01

    Full Text Available UV-LEDs are a new method of disinfecting drinking water. Some viruses are very resistant to UV and the efficiency of UV-LEDs to disinfect them needs to be studied. Drinking water was disinfected with UV-LEDs after spiking the water with MS2 and four UV- and/or Cl-resistant coliphages belonging to RNA or DNA coliphages isolated from municipal wastewater. UV-LEDs operating at a wavelength of 270 nm for 2 min with 120 mW of irradiation caused 0.93–2.73 Log10-reductions of coliphages tested in a reactor of a 5.2 L volume. Irradiation time of 10 min in the same system increased the Log10-reductions to 4.30–5.16. Traditional mercury UV (Hg-UV lamp at a 254 nm wavelength caused 0.67–4.08 Log10-reductions in 2 min and 4.56–7.21 Log10-reductions in 10 min in 10 mL of water. All coliphages tested except MS2 achieved 4 Log10-reductions with UV-LEDs at a dose that corresponded to 70 mWs/cm2 using Hg-UV. Thus, UV-LEDs are a promising method of disinfecting UV- and/or Cl-resistant viruses.

  3. DNA-like double helix formed by peptide nucleic acid

    DEFF Research Database (Denmark)

    Wittung, P; Nielsen, Peter E.; Buchardt, O

    1994-01-01

    Although the importance of the nucleobases in the DNA double helix is well understood, the evolutionary significance of the deoxyribose phosphate backbone and the contribution of this chemical entity to the overall helical structure and stability of the double helix is not so clear. Peptide nucleic...

  4. Repair of the double-strand breaks produced by /sup 125/I disintegrations in the DNA of micrococcus radiodurans

    Energy Technology Data Exchange (ETDEWEB)

    Myers, D K [Atomic Energy of Canada Ltd., Chalk River, Ontario. Chalk River Nuclear Labs.

    1978-01-01

    Wild-type M. radiodurans and two radiosensitive mutants were used to study the lethal effects of /sup 125/I disintegrations in their DNA. The relative sensitivities of these three strains to inactivation by ..gamma..-radiation were reflected in their relative sensitivities to inactivation by /sup 125/I decay. The number of double-strand (ds) breaks in the DNA appeared to be similar at levels of ..gamma..-radiation and of /sup 125/I decay that reduced survival to 10%. All three strains of M. radiodurans rapidly repaired ds breaks produced in their DNA by either ..gamma..-radiation or /sup 125/I disintegrations. If one ds break per cell is a lethal event (Krisch. et al., 1975), cells of the three strains tested would die when they had left unrepaired one ds break out of an initial 45, 600 or 1800 ds breaks per single cell.

  5. Induction of protective immune responses in mice by double DNA ...

    African Journals Online (AJOL)

    Purpose: To investigate the efficacy of a double DNA vaccine encoding of Brucella melitensis omp31 gene and of Escherichia coli eae gene in inducing protective immune response in a mouse model. Methods: After performing PCR assays and cloning both the eae and omp31 genes, the generated DNA vaccines were ...

  6. A structural basis for the regulatory inactivation of DnaA.

    Science.gov (United States)

    Xu, Qingping; McMullan, Daniel; Abdubek, Polat; Astakhova, Tamara; Carlton, Dennis; Chen, Connie; Chiu, Hsiu-Ju; Clayton, Thomas; Das, Debanu; Deller, Marc C; Duan, Lian; Elsliger, Marc-Andre; Feuerhelm, Julie; Hale, Joanna; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K; Johnson, Hope A; Klock, Heath E; Knuth, Mark W; Kozbial, Piotr; Sri Krishna, S; Kumar, Abhinav; Marciano, David; Miller, Mitchell D; Morse, Andrew T; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Oommachen, Silvya; Paulsen, Jessica; Puckett, Christina; Reyes, Ron; Rife, Christopher L; Sefcovic, Natasha; Trame, Christine; van den Bedem, Henry; Weekes, Dana; Hodgson, Keith O; Wooley, John; Deacon, Ashley M; Godzik, Adam; Lesley, Scott A; Wilson, Ian A

    2009-01-16

    Regulatory inactivation of DnaA is dependent on Hda (homologous to DnaA), a protein homologous to the AAA+ (ATPases associated with diverse cellular activities) ATPase region of the replication initiator DnaA. When bound to the sliding clamp loaded onto duplex DNA, Hda can stimulate the transformation of active DnaA-ATP into inactive DnaA-ADP. The crystal structure of Hda from Shewanella amazonensis SB2B at 1.75 A resolution reveals that Hda resembles typical AAA+ ATPases. The arrangement of the two subdomains in Hda (residues 1-174 and 175-241) differs dramatically from that of DnaA. A CDP molecule anchors the Hda domains in a conformation that promotes dimer formation. The Hda dimer adopts a novel oligomeric assembly for AAA+ proteins in which the arginine finger, crucial for ATP hydrolysis, is fully exposed and available to hydrolyze DnaA-ATP through a typical AAA+ type of mechanism. The sliding clamp binding motifs at the N-terminus of each Hda monomer are partially buried and combine to form an antiparallel beta-sheet at the dimer interface. The inaccessibility of the clamp binding motifs in the CDP-bound structure of Hda suggests that conformational changes are required for Hda to form a functional complex with the clamp. Thus, the CDP-bound Hda dimer likely represents an inactive form of Hda.

  7. Activation of a yeast replication origin near a double-stranded DNA break.

    Science.gov (United States)

    Raghuraman, M K; Brewer, B J; Fangman, W L

    1994-03-01

    Irradiation in the G1 phase of the cell cycle delays the onset of DNA synthesis and transiently inhibits the activation of replication origins in mammalian cells. It has been suggested that this inhibition is the result of the loss of torsional tension in the DNA after it has been damaged. Because irradiation causes DNA damage at an undefined number of nonspecific sites in the genome, it is not known how cells respond to limited DNA damage, and how replication origins in the immediate vicinity of a damage site would behave. Using the sequence-specific HO endonuclease, we have created a defined double-stranded DNA break in a centromeric plasmid in G1-arrested cells of the yeast Saccharomyces cerevisiae. We show that replication does initiate at the origin on the cut plasmid, and that the plasmid replicates early in the S phase after linearization in vivo. These observations suggest that relaxation of a supercoiled DNA domain in yeast need not inactivate replication origins within that domain. Furthermore, these observations rule out the possibility that the late replication context associated with chromosomal termini is a consequence of DNA ends.

  8. Photosensitized inactivation of DNA by monochromatic 334-nm radiation in the presence of 2-thiouracil: genetic activity and backbone breaks

    International Nuclear Information System (INIS)

    Peak, M.J.; Ito, A.; Peak, J.G.; Foote, C.S.

    1988-01-01

    Monochromatic 334-nm radiation delivered under aerobic conditions inactivates the genetic activity (ability to transform auxotrophic recipient cells to nutritional prototrophy) of isolated transforming Bacillus subtilis DNA. The presence of superoxide dismutase (SOD), catalase, and mannitol reduces the 334-nm inactivation. The rate of inactivation of the genetic activity by 334-nm radiation is enhanced fivefold by the sensitizer 2-thiouracil (s 2 Ura). This enhancement is substantially reversed when the irradiations are performed in the presence of mannitol, and, to a lesser extent, SOD. Catalase slightly reduces the s 2 Ura enhancement of 334-nm inactivation of transforming activity. Backbone breaks induced in the same DNA by aerobic 334-nm radiation were also enhanced markedly by the presence of s 2 Ura; this enhancement was reversed by the presence of mannitol and, to a lesser extent, SOD during irradiation. Catalase had no effect upon s 2 Ura-enhanced, 334-nm-induced SSBs. Whereas DNA breakage may be responsible for a portion of the inactivation of the DNA by the photosensitized reaction between s 2 Ura and 334-nm radiation, it is not the only inactivating lesion, because the yield of SSBs per lethal hit per unit length of DNA is not constant for all the irradiation conditions studied. (author)

  9. The Modular Construction of DNA Double Helix

    Indian Academy of Sciences (India)

    discovery, DNA structure has been able to disseminate knowl- edge of key ... band a. This procedure would place segment a, overlapping with d. Glue securely a ... Because of alignment problems, unless great care is taken, the modules do ...

  10. Molecular mechanism of DNA replication-coupled inactivation of the initiator protein in Escherichia coli: interaction of DnaA with the sliding clamp-loaded DNA and the sliding clamp-Hda complex.

    Science.gov (United States)

    Su'etsugu, Masayuki; Takata, Makoto; Kubota, Toshio; Matsuda, Yusaku; Katayama, Tsutomu

    2004-06-01

    In Escherichia coli, the ATP-DnaA protein initiates chromosomal replication. After the DNA polymerase III holoenzyme is loaded on to DNA, DnaA-bound ATP is hydrolysed in a manner depending on Hda protein and the DNA-loaded form of the DNA polymerase III sliding clamp subunit, which yields ADP-DnaA, an inactivated form for initiation. This regulatory DnaA-inactivation represses extra initiation events. In this study, in vitro replication intermediates and structured DNA mimicking replicational intermediates were first used to identify structural prerequisites in the process of DnaA-ATP hydrolysis. Unlike duplex DNA loaded with sliding clamps, primer RNA-DNA heteroduplexes loaded with clamps were not associated with DnaA-ATP hydrolysis, and duplex DNA provided in trans did not rescue this defect. At least 40-bp duplex DNA is competent for the DnaA-ATP hydrolysis when a single clamp was loaded. The DnaA-ATP hydrolysis was inhibited when ATP-DnaA was tightly bound to a DnaA box-bearing oligonucleotide. These results imply that the DnaA-ATP hydrolysis involves the direct interaction of ATP-DnaA with duplex DNA flanking the sliding clamp. Furthermore, Hda protein formed a stable complex with the sliding clamp. Based on these, we suggest a mechanical basis in the DnaA-inactivation that ATP-DnaA interacts with the Hda-clamp complex with the aid of DNA binding. Copyright Blackwell Publishing Limited

  11. A model for the induction of DNA damages and their evolution into cell clonogenic inactivation

    International Nuclear Information System (INIS)

    Yamaguchi, Hiroshi; Ohara, Hiroshi; Waker, A.J.

    2006-01-01

    The dependence of the initial production of DNA damages on radiation quality was examined by using a proposed new model on the basis of target theory. For the estimation of DNA damage-production by different radiation qualities, five possible modes of radiation action, including both direct and indirect effects, were assumed inside a target the molecular structure of which was defined to consist of 10 base-pairs of DNA surrounded by water molecules. The induction of DNA damage was modeled on the basis of comparisons between the primary ionization mean free path and the distance between pairs of ionized atoms, such distance being characteristic on the mode of radiation action. The OH radicals per average energy to produce an ion pair on the nanosecond time scale was estimated and used for indirect action. Assuming a relation between estimated yields of DNA damages and experimental inactivation cross sections for AT-cells, the present model enabled the quantitative reproduction of experimental results for AT-cell killing under aerobic or hypoxic conditions. The results suggest a higher order organization of DNA in a way that there will be at least two types of water environment, one filling half the space surrounding DNA with a depth of 3.7-4.3 nm and the other filling all space with a depth 4.6-4.9 nm. (author)

  12. Oxygen-independent inactivation of Haemophilus influenzae transforming DNA by monochromatic radiation: action spectrum, effect of histidine and repair

    Energy Technology Data Exchange (ETDEWEB)

    Cabrera-Juarez, E; Setlow, J K; Swenson, P A; Peak, M J

    1976-01-01

    The action spectrum for the oxygen-independent inactivation of native transforming DNA from Haemophilus influenzae with near-uv radiation revealed a shoulder beginning at 334 and extending to 460 nm. The presence of 0.2 M histidine during irradiation produced a small increase in inactivation at 254, 290 and 313 nm, a large increase at 334 nm and a decrease in inactivation at 365, 405, and 460 nm. Photoreactivation did not reverse the DNA damage produced at pH 7.0 at 334, 365, 405 and 460 nm, but did reactivate the DNA after irradiation at 254, 290 and 313 nm. The inactivation of DNA irradiated at 254, 290 and 313 nm was considerably greater when the transforming ability was assayed in an excision-defective mutant compared with the wild type, although DNA irradiated at 334, 365, 405 and 460 nm showed smaller differences. These results suggest that the oxygen-independent inactivation of H. influenzae DNA at pH 7 by irradiation at 334, 365, 405 and 460 nm is caused by lesions other than pyrimidine dimers.

  13. Flexible DNA Path in the MCM Double Hexamer Loaded on DNA.

    Science.gov (United States)

    Hizume, Kohji; Kominami, Hiroaki; Kobayashi, Kei; Yamada, Hirofumi; Araki, Hiroyuki

    2017-05-16

    The formation of the pre-replicative complex (pre-RC) during the G1 phase, which is also called the licensing of DNA replication, is the initial and essential step of faithful DNA replication during the subsequent S phase. It is widely accepted that in the pre-RC, double-stranded DNA passes through the holes of two ring-shaped minichromosome maintenance (MCM) 2-7 hexamers; however, the spatial organization of the DNA and proteins involved in pre-RC formation is unclear. Here we reconstituted the pre-RC from purified DNA and proteins and visualized the complex using atomic force microscopy (AFM). AFM revealed that the MCM double hexamers formed elliptical particles on DNA. Analysis of the angle of binding of DNA to the MCM double hexamer suggests that the DNA does not completely pass through both holes of the MCM hexamers, possibly because the DNA exited from the gap between Mcm2 and Mcm5. A DNA loop fastened by the MCM double hexamer was detected in pre-RC samples reconstituted from purified proteins as well as those purified from yeast cells, suggesting a higher-order architecture of the loaded MCM hexamers and DNA strands.

  14. Nucleic Acid Analogue Induced Transcription of Double Stranded DNA

    DEFF Research Database (Denmark)

    1998-01-01

    RNA is transcribed from a double stranded DNA template by forming a complex by hybridizing to the template at a desired transcription initiation site one or more oligonucleic acid analogues of the PNA type capable of forming a transcription initiation site with the DNA and exposing the complex...... to the action of a DNA dependant RNA polymerase in the presence of nucleoside triphosphates. Equal length transcripts may be obtained by placing a block to transcription downstream from the initiation site or by cutting the template at such a selected location. The initiation site is formed by displacement...... of one strand of the DNA locally by the PNA hybridization....

  15. Inactivation of DNA mismatch repair by variants of uncertain significance in the PMS2 gene.

    Science.gov (United States)

    Drost, Mark; Koppejan, Hester; de Wind, Niels

    2013-11-01

    Lynch syndrome (LS) is a common cancer predisposition caused by an inactivating mutation in one of four DNA mismatch repair (MMR) genes. Frequently a variant of uncertain significance (VUS), rather than an obviously pathogenic mutation, is identified in one of these genes. The inability to define pathogenicity of such variants precludes targeted healthcare. Here, we have modified a cell-free assay to test VUS in the MMR gene PMS2 for functional activity. We have analyzed nearly all VUS in PMS2 found thus far and describe loss of MMR activity for five, suggesting the applicability of the assay for diagnosis of LS. © 2013 WILEY PERIODICALS, INC.

  16. DnaA protein DNA-binding domain binds to Hda protein to promote inter-AAA+ domain interaction involved in regulatory inactivation of DnaA.

    Science.gov (United States)

    Keyamura, Kenji; Katayama, Tsutomu

    2011-08-19

    Chromosomal replication is initiated from the replication origin oriC in Escherichia coli by the active ATP-bound form of DnaA protein. The regulatory inactivation of DnaA (RIDA) system, a complex of the ADP-bound Hda and the DNA-loaded replicase clamp, represses extra initiations by facilitating DnaA-bound ATP hydrolysis, yielding the inactive ADP-bound form of DnaA. However, the mechanisms involved in promoting the DnaA-Hda interaction have not been determined except for the involvement of an interaction between the AAA+ domains of the two. This study revealed that DnaA Leu-422 and Pro-423 residues within DnaA domain IV, including a typical DNA-binding HTH motif, are specifically required for RIDA-dependent ATP hydrolysis in vitro and that these residues support efficient interaction with the DNA-loaded clamp·Hda complex and with Hda in vitro. Consistently, substitutions of these residues caused accumulation of ATP-bound DnaA in vivo and oriC-dependent inhibition of cell growth. Leu-422 plays a more important role in these activities than Pro-423. By contrast, neither of these residues is crucial for DNA replication from oriC, although they are highly conserved in DnaA orthologues. Structural analysis of a DnaA·Hda complex model suggested that these residues make contact with residues in the vicinity of the Hda AAA+ sensor I that participates in formation of a nucleotide-interacting surface. Together, the results show that functional DnaA-Hda interactions require a second interaction site within DnaA domain IV in addition to the AAA+ domain and suggest that these interactions are crucial for the formation of RIDA complexes that are active for DnaA-ATP hydrolysis.

  17. DnaA Protein DNA-binding Domain Binds to Hda Protein to Promote Inter-AAA+ Domain Interaction Involved in Regulatory Inactivation of DnaA*

    Science.gov (United States)

    Keyamura, Kenji; Katayama, Tsutomu

    2011-01-01

    Chromosomal replication is initiated from the replication origin oriC in Escherichia coli by the active ATP-bound form of DnaA protein. The regulatory inactivation of DnaA (RIDA) system, a complex of the ADP-bound Hda and the DNA-loaded replicase clamp, represses extra initiations by facilitating DnaA-bound ATP hydrolysis, yielding the inactive ADP-bound form of DnaA. However, the mechanisms involved in promoting the DnaA-Hda interaction have not been determined except for the involvement of an interaction between the AAA+ domains of the two. This study revealed that DnaA Leu-422 and Pro-423 residues within DnaA domain IV, including a typical DNA-binding HTH motif, are specifically required for RIDA-dependent ATP hydrolysis in vitro and that these residues support efficient interaction with the DNA-loaded clamp·Hda complex and with Hda in vitro. Consistently, substitutions of these residues caused accumulation of ATP-bound DnaA in vivo and oriC-dependent inhibition of cell growth. Leu-422 plays a more important role in these activities than Pro-423. By contrast, neither of these residues is crucial for DNA replication from oriC, although they are highly conserved in DnaA orthologues. Structural analysis of a DnaA·Hda complex model suggested that these residues make contact with residues in the vicinity of the Hda AAA+ sensor I that participates in formation of a nucleotide-interacting surface. Together, the results show that functional DnaA-Hda interactions require a second interaction site within DnaA domain IV in addition to the AAA+ domain and suggest that these interactions are crucial for the formation of RIDA complexes that are active for DnaA-ATP hydrolysis. PMID:21708944

  18. Discrete instability in the DNA double helix

    International Nuclear Information System (INIS)

    Tabi, Conrad Bertrand; Mohamadou, Alidou; Kofane, Timoleon Crepin

    2009-06-01

    Modulational instability (MI) is explored in the framework of the base-rotor model of DNA dynamics. We show in fact that, the helicoidal coupling introduced in the spin model of DNA reduces the system to a modified discrete sine-Gordon (sG) equation. The MI criterion is thus modified and displays interesting features because of the helicoidal coupling. This is confirmed in the numerical analysis where a critical value of the helicoidal coupling constant is derived. In the simulations, we have found that a train of pulses are generated when the lattice is subjected to MI, in agreement with analytical results obtained in a modified discrete sG equation. Also, the competitive effects of the harmonic longitudinal and helicoidal constants on the dynamics of the system are notably pointed out. In the same way, it is shown that MI can lead to energy localization which is high for some values of the helicoidal coupling constant. (author)

  19. 75 FR 62820 - Screening Framework Guidance for Providers of Synthetic Double-Stranded DNA

    Science.gov (United States)

    2010-10-13

    ... Providers of Synthetic Double- Stranded DNA AGENCY: Department of Health and Human Services, Office of the.... Government has developed Guidance that provides a framework for screening synthetic double-stranded DNA (dsDNA). This document, the Screening Framework Guidance for Providers of Synthetic Double-Stranded DNA...

  20. Extreme bendability of DNA double helix due to bending asymmetry

    NARCIS (Netherlands)

    Salari, H.; Eslami-Mossallam, B.; Nederi, S.; Ejtehadi, M.R.

    2015-01-01

    Experimental data of the DNA cyclization (J-factor) at short length scales exceed the theoretical expectation based on the wormlike chain (WLC) model by several orders of magnitude. Here, we propose that asymmetric bending rigidity of the double helix in the groove direction can be responsible for

  1. Autophosphorylation of DNA-PKCS regulates its dynamics at DNA double-strand breaks.

    Science.gov (United States)

    Uematsu, Naoya; Weterings, Eric; Yano, Ken-ichi; Morotomi-Yano, Keiko; Jakob, Burkhard; Taucher-Scholz, Gisela; Mari, Pierre-Olivier; van Gent, Dik C; Chen, Benjamin P C; Chen, David J

    2007-04-23

    The DNA-dependent protein kinase catalytic subunit (DNA-PK(CS)) plays an important role during the repair of DNA double-strand breaks (DSBs). It is recruited to DNA ends in the early stages of the nonhomologous end-joining (NHEJ) process, which mediates DSB repair. To study DNA-PK(CS) recruitment in vivo, we used a laser system to introduce DSBs in a specified region of the cell nucleus. We show that DNA-PK(CS) accumulates at DSB sites in a Ku80-dependent manner, and that neither the kinase activity nor the phosphorylation status of DNA-PK(CS) influences its initial accumulation. However, impairment of both of these functions results in deficient DSB repair and the maintained presence of DNA-PK(CS) at unrepaired DSBs. The use of photobleaching techniques allowed us to determine that the kinase activity and phosphorylation status of DNA-PK(CS) influence the stability of its binding to DNA ends. We suggest a model in which DNA-PK(CS) phosphorylation/autophosphorylation facilitates NHEJ by destabilizing the interaction of DNA-PK(CS) with the DNA ends.

  2. Randomized, double-blinded clinical trial for human norovirus inactivation in oysters by high hydrostatic pressure processing.

    Science.gov (United States)

    Leon, Juan S; Kingsley, David H; Montes, Julia S; Richards, Gary P; Lyon, G Marshall; Abdulhafid, Gwen M; Seitz, Scot R; Fernandez, Marina L; Teunis, Peter F; Flick, George J; Moe, Christine L

    2011-08-01

    Contamination of oysters with human noroviruses (HuNoV) constitutes a human health risk and may lead to severe economic losses in the shellfish industry. There is a need to identify a technology that can inactivate HuNoV in oysters. In this study, we conducted a randomized, double-blinded clinical trial to assess the effect of high hydrostatic pressure processing (HPP) on Norwalk virus (HuNoV genogroup I.1) inactivation in virus-seeded oysters ingested by subjects. Forty-four healthy, positive-secretor adults were divided into three study phases. Subjects in each phase were randomized into control and intervention groups. Subjects received Norwalk virus (8FIIb, 1.0 × 10(4) genomic equivalent copies) in artificially seeded oysters with or without HPP treatment (400 MPa at 25°C, 600 MPa at 6°C, or 400 MPa at 6°C for 5 min). HPP at 600 MPa, but not 400 MPa (at 6° or 25°C), completely inactivated HuNoV in seeded oysters and resulted in no HuNoV infection among these subjects, as determined by reverse transcription-PCR detection of HuNoV RNA in subjects' stool or vomitus samples. Interestingly, a white blood cell (granulocyte) shift was identified in 92% of the infected subjects and was significantly associated with infection (P = 0.0014). In summary, these data suggest that HPP is effective at inactivating HuNoV in contaminated whole oysters and suggest a potential intervention to inactivate infectious HuNoV in oysters for the commercial shellfish industry.

  3. Targeting abnormal DNA double strand break repair in cancer

    OpenAIRE

    Rassool, Feyruz V.; Tomkinson, Alan E.

    2010-01-01

    A major challenge in cancer treatment is the development of therapies that target cancer cells with little or no toxicity to normal tissues and cells. Alterations in DNA double strand break (DSB) repair in cancer cells include both elevated and reduced levels of key repair proteins and changes in the relative contributions of the various DSB repair pathways. These differences can result in increased sensitivity to DSB-inducing agents and increased genomic instability. The development of agent...

  4. The DnaA N-terminal domain interacts with Hda to facilitate replicase clamp-mediated inactivation of DnaA.

    Science.gov (United States)

    Su'etsugu, Masayuki; Harada, Yuji; Keyamura, Kenji; Matsunaga, Chika; Kasho, Kazutoshi; Abe, Yoshito; Ueda, Tadashi; Katayama, Tsutomu

    2013-12-01

    DnaA activity for replication initiation of the Escherichia coli chromosome is negatively regulated by feedback from the DNA-loaded form of the replicase clamp. In this process, called RIDA (regulatory inactivation of DnaA), ATP-bound DnaA transiently assembles into a complex consisting of Hda and the DNA-clamp, which promotes inter-AAA+ domain association between Hda and DnaA and stimulates hydrolysis of DnaA-bound ATP, producing inactive ADP-DnaA. Using a truncated DnaA mutant, we previously demonstrated that the DnaA N-terminal domain is involved in RIDA. However, the precise role of the N-terminal domain in RIDA has remained largely unclear. Here, we used an in vitro reconstituted system to demonstrate that the Asn-44 residue in the N-terminal domain of DnaA is crucial for RIDA but not for replication initiation. Moreover, an assay termed PDAX (pull-down after cross-linking) revealed an unstable interaction between a DnaA-N44A mutant and Hda. In vivo, this mutant exhibited an increase in the cellular level of ATP-bound DnaA. These results establish a model in which interaction between DnaA Asn-44 and Hda stabilizes the association between the AAA+ domains of DnaA and Hda to facilitate DnaA-ATP hydrolysis during RIDA. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

  5. Acute inactivation of the replicative helicase in human cells triggers MCM8-9-dependent DNA synthesis

    DEFF Research Database (Denmark)

    Natsume, Toyoaki; Nishimura, Kohei; Minocherhomji, Sheroy

    2017-01-01

    stemming from replisome dissociation during DNA replication perturbation, we used a degron-based system for inducible proteolysis of a subunit of the replicative helicase. We show that MCM2-depleted cells activate a DNA damage response pathway and generate replication-associated DNA double-strand breaks...

  6. Inactivation of Pol θ and C-NHEJ eliminates off-target integration of exogenous DNA.

    Science.gov (United States)

    Zelensky, Alex N; Schimmel, Joost; Kool, Hanneke; Kanaar, Roland; Tijsterman, Marcel

    2017-07-07

    Off-target or random integration of exogenous DNA hampers precise genomic engineering and presents a safety risk in clinical gene therapy strategies. Genetic definition of random integration has been lacking for decades. Here, we show that the A-family DNA polymerase θ (Pol θ) promotes random integration, while canonical non-homologous DNA end joining plays a secondary role; cells double deficient for polymerase θ and canonical non-homologous DNA end joining are devoid of any integration events, demonstrating that these two mechanisms define random integration. In contrast, homologous recombination is not reduced in these cells and gene targeting is improved to 100% efficiency. Such complete reversal of integration outcome, from predominately random integration to exclusively gene targeting, provides a rational way forward to improve the efficacy and safety of DNA delivery and gene correction approaches.Random off-target integration events can impair precise gene targeting and poses a safety risk for gene therapy. Here the authors show that repression of polymerase θ and classical non-homologous recombination eliminates random integration.

  7. Accelerated heavy ions induced DNA double-strand breaks in yeast cells

    International Nuclear Information System (INIS)

    Akpa, T.C.

    1993-01-01

    Yeast cells of strain cerevisiae, were irradiated with monoenergetic heavy ions, X-rays and α particles and assayed for DNA double-strand breaks and cell survival. The method of neutral sucrose gradient velocity sedimentation was used for all heavy-ion experiments because it is a well established technique.The method of pulsed-field gel electrophoresis was used for X-rays, α particles and argon ions. Results show that within the range of LET of the particles used (300 - 10 5 KeV/μm) the induction cross-section for DNA double-strand break is constant between 300 and around 7000 KeV/μm and increases at higher LET values. The inactivation cross-section follow the same trend. The DSB-induction and inactivation cross-section was shown to be linearly related with a slope of (1.01±0.15)/109 gmol-i. The RBE for DSB -induced decreases with LET and tails off at high LET values also. These results when compared with results from literature shows that the trend of induction is first monotonic rise of rate of DSB-induction up to 100keV/μm, followed by a plateau and a further rise which is due to increased effect of energetic γ-rays formed as shown for survival studies and predicted is possible to separate the cell DNA contents into 13 to 15 chromosome bands. The relative decrease in DNA content of the first band as determined by ethidium bromide-UV fluorescence decreases exponentially. The cross-section for DSB-induction determined by this method are (9.8±0.01)dsb/10 12 gmol - 1 Gy - 1, for 80 kV X-rays in haploid 211 yeast strain; (0.04+0.003)dsb/109gmol - 1μm 2 for Am-radioisotope α particles in haploid cells, (0.184±0.034) dsb/10 9 gmol - 1μm 2 in diploid 211*B cells and (0.55±0.04) dsb/10 9 gmol - 1μm 2 for 7MeV Argon ion in the diploid cells. The values are comparable to those obtained with velocity sedimentation technique. However, the reason for the low value obtained for a particle induced DSB in haploid cells is not clear

  8. Induction of double-strand breaks in DNA of prokaryotes and eukaryotes and their repair. 1. Application of elastoviscosimetry for studying double-strand breaks in DNA of Escherichia coli induced by. gamma. -irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Bresler, S E; Noskin, L A; Suslov, A V [AN SSSR, Leningrad. Inst. Yadernoj Fiziki

    1980-11-01

    It is shown that the method of elastoviscosimetry gives a possibility to record the formation of DNA double-strand breaks in Escherichia coli cells induced by ..gamma.. irradiation at doses close to D/sub 37/. The dependence of changes of elastoviscosity parameter on the dose (tau/sub 0/) passes through the maximum. It is shown that the ascending section of this curve (at minimum ..gamma.. irradiation doses) characterizes the relaxation process of the superspiralised chromosome in nucleotide of the E. coli. This relaxation is observed due to ..gamma.. induced damages which are not double-strand breaks. By the maximum position one can judge on a dose yield of the first DNA double-strand break, the descending part of the dose curve describes the kinetics of accumulation of breaks with the dose increase. The analysis of the data obtained gives the possibility to come to the conclusion that when applying a usual technique of irradiation and lysis of cells not providing for special measures on inhibition of endo-and exonuclease activity in ..gamma.. irradiated cells, the dose yield of double-strand breaks noticeably increases (by 4.2 times). In the case of an essential, though incomplete, inhibition of nuclease activities in ..gamma.. irradiated cells the dose yield of breaks approximately corresponds to the dose curve of inactivation of these cells (D/sub 37/12.5+-3.0 krad, the first double-strand break -at 14.5+-2.4 krad).

  9. Induction of double-strand breaks in DNA of prokaryotes and eukaryotes and their repair. 1. Application of elastoviscosimetry for studying double-strand breaks in DNA of Escherichia coli induced by γ-irradiation

    International Nuclear Information System (INIS)

    Bresler, S.E.; Noskin, L.A.; Suslov, A.V.

    1980-01-01

    It is shown that the method of elastoviscosimetry gives a possibility to record the formation of DNA double-strand breaks in Escherichia coli cells induced by γ irradiation at doses close to D 37 . The dependence of changes of elastoviscosity parameter on the dose (tau 0 ) passes through the maximum. It is shown that the ascending section of this curve (at minimum γ irradiation doses) characterizes the relaxation process of the superspiralised chromosome in nucleotide of the E. coli. This relaxation is observed due to γ induced damages which are not double-strand breaks. By the maximum position one can judge on a dose yield of the first DNA double-strand break, the descending part of the dose curve describes the kinetics of accumulation of breaks with the dose increase. The analysis of the data obtained gives the possibility to come to the conclusion that when applying a usual technique of irradiation and lysis of cells not providing for special measures on inhibition of endo-and exonuclease activity in γ irradiated cells, the dose yield of double-strand breaks noticeably increases (by 4.2 times). In the case of an essential, though incomplete, inhibition of nuclease activities in γ irradiated cells the dose yield of breaks approximately corresponds to the dose curve of inactivation of these cells (D 37 12.5+-3.0 krad, the first double-strand break -at 14.5+-2.4 krad)

  10. An empirical model for the induction of double strand breaks in DNA by the indirect' action of ionising radiation

    International Nuclear Information System (INIS)

    Watt, D.E.; Hill, S.J.A.

    1994-01-01

    For calculation of radiation effects at low doses near environmental levels it is necessary to model both ''direct'' and ''indirect'' effects along single charged particle tracks in the equilibrium spectrum generated by the radiation field. The modelling approach used here to determine the ''indirect'' contribution to the damage to the DNA in mammalian cells is first to study the transition of damage from the solid to liquid phases at different concentrations of enzyme targets (known to be inactivated by single target, single hit kinetics). The respective contributions from direct and indirect action can then be separated. Results obtained in this laboratory for the inactivation of dihydroorotate dehydrogenase have been supplemented by data taken from the literature. A simple model of the radiation action has been derived. It succeeds in correlating all the data within the range of concentrations, radical scavenger, and LET used. From the results, information is obtained on the role of the dose rate; on diffusion lengths, on the type of radical predominantly responsible (OH·) for the inactivation and on scavenging of radicals. Since water radicals are thought to be the main cause of indirect damage in mammalian cells it is a simple step to deduce from the enzyme results the probability of induction of single and double strand breaks in the DNA by making the assumption that basically the same radical kinetics are involved and then applying Poisson probabilities. (author)

  11. DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair

    Directory of Open Access Journals (Sweden)

    Elisa Mentegari

    2016-08-01

    Full Text Available DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell’s genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy.

  12. DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair.

    Science.gov (United States)

    Mentegari, Elisa; Kissova, Miroslava; Bavagnoli, Laura; Maga, Giovanni; Crespan, Emmanuele

    2016-08-31

    DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell's genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy.

  13. Hda-mediated inactivation of the DnaA protein and dnaA gene autoregulation act in concert to ensure homeostatic maintenance of the Escherichia coli chromosome.

    Science.gov (United States)

    Riber, Leise; Olsson, Jan A; Jensen, Rasmus B; Skovgaard, Ole; Dasgupta, Santanu; Marinus, Martin G; Løbner-Olesen, Anders

    2006-08-01

    Initiation of DNA replication in Eschericia coli requires the ATP-bound form of the DnaA protein. The conversion of DnaA-ATP to DnaA-ADP is facilitated by a complex of DnaA, Hda (homologous to DnaA), and DNA-loaded beta-clamp proteins in a process termed RIDA (regulatory inactivation of DnaA). Hda-deficient cells initiate replication at each origin mainly once per cell cycle, and the rare reinitiation events never coincide with the end of the origin sequestration period. Therefore, RIDA is not the predominant mechanism to prevent immediate reinitiation from oriC. The cellular level of Hda correlated directly with dnaA gene expression such that Hda deficiency led to reduced dnaA gene expression, and overproduction of Hda led to DnaA overproduction. Hda-deficient cells were very sensitive to variations in the cellular level of DnaA, and DnaA overproduction led to uncontrolled initiation of replication from oriC, causing severe growth retardation or cell death. Based on these observations, we propose that both RIDA and dnaA gene autoregulation are required as homeostatic mechanisms to ensure that initiation of replication occurs at the same time relative to cell mass in each cell cycle.

  14. Role of DNA-PK in cellular responses to DNA double-strand breaks

    International Nuclear Information System (INIS)

    Chen, D.J.

    2003-01-01

    DNA double-strand breaks (DSBs) are probably the most dangerous of the many different types of DNA damage that occur within the cell. DSBs are generated by exogenous agents such as ionizing radiation (IR) or by endogenously generated reactive oxygen species and occur as intermediates during meiotic and V(D)J recombination. The repair of DSBs is of paramount importance to the cell as misrepair of DSBs can lead to cell death or promote tumorigenesis. In eukaryotes there exists two distinct mechanisms for DNA DSB repair: homologous recombination (HR) and non-homologous end joining (NHEJ). In mammalian cells, however, it is clear that nonhomologous repair of DSBs is highly active and plays a major role in conferring radiation resistance to the cell. The NHEJ machinery minimally consists of the DNA-dependent Protein Kinase (DNA-PK) and a complex of XRCC4 and DNA Ligase IV. The DNA-PK complex is composed of a 470 kDa catalytic subunit (DNA-PKcs), and the heterodimeric Ku70 and Ku80 DNA end-binding complex. DNA-PKcs is a PI-3 kinase with homology to ATM and ATR in its C-terminal kinase domain. The DNA-PK complex protects and tethers the ends, and directs assembly and, perhaps, the activation of other NHEJ proteins. We have previously demonstrated that the kinase activity of DNA-PK is essential for DNA DSB repair and V(D)J recombination. It is, therefore, of immense interest to determine the in vivo targets of DNA-PKcs and the mechanisms by which phosphorylation of these targets modulates NHEJ. Recent studies have resulted in the identification of a number of protein targets that are phosphorylated by and/or interact with DNA-PKcs. Our laboratory has recently identified autophosphorylation site(s) on DNA-PKcs. We find that phosphorylation at these sites in vivo is an early and essential response to DSBs and demonstrate, for the first time, the localization of DNA-PKcs to the sites of DNA damage in vivo. Furthermore, mutation of these phosphorylation sites in mammalian

  15. Current topics in DNA double-strand break repair

    International Nuclear Information System (INIS)

    Kobayashi, Junya; Takata, Minoru; Iwabuchi, Kuniyoshi; Miyagawa, Kiyoshi; Sonoda, Eiichiro; Suzuki, Keiji; Tauchi, Hiroshi

    2008-01-01

    DNA double strand break (DSB) is one of the most critical types of damage which is induced by ionizing radiation. In this review, we summarize current progress in investigations on the function of DSB repair-related proteins. We focused on recent findings in the analysis of the function of proteins such as 53BP1, histone H2AX, Mus81-Eme1, Fanc complex, and UBC13, which are found to be related to homologous recombination repair or to non-homologous end joining. In addition to the function of these proteins in DSB repair, the biological function of nuclear foci formation following DSB induction is discussed. (author)

  16. Alpha-momorcharin: a ribosome-inactivating protein from Momordica charantia, possessing DNA cleavage properties.

    Science.gov (United States)

    Wang, Shuzhen; Zheng, Yinzhen; Yan, Junjie; Zhu, Zhixuan; Wu, Zhihua; Ding, Yi

    2013-11-01

    Ribosome-inactivating proteins (RIPs) function to inhibit protein synthesis through the removal of specific adenine residues from eukaryotic ribosomal RNA and rending the 60S subunit unable to bind elongation factor 2. They have received much attention in biological and biomedical research due to their unique activities toward tumor cells, as well as the important roles in plant defense. Alpha-momorcharin (α-MC), a member of the type I family of RIPs, is rich in the seeds of Momordica charantia L. Previous studies demonstrated that α-MC is an effective antifungal and antibacterial protein. In this study, a detailed analysis of the DNase-like activity of α-MC was conducted. Results showed that the DNase-like activity toward plasmid DNA was time-dependent, temperature-related, and pH-stable. Moreover, a requirement for divalent metal ions in the catalytic domain of α-MC was confirmed. Additionally, Tyr(93) was found to be a critical residue for the DNase-like activity, while Tyr(134), Glu(183), Arg(186), and Trp(215) were activity-related residues. This study on the chemico-physical properties and mechanism of action of α-MC will improve its utilization in scientific research, as well as its potential industrial uses. These results may also assist in the characterization and elucidation of the DNase-like enzymatic properties of other RIPs.

  17. Detection of heavy ion induced DNA double-strand breaks using static-field gel electrophoresis

    International Nuclear Information System (INIS)

    Taucher-Scholz, G.; Heilmann, J.; Schneider, G.; Kraft, G.

    1994-11-01

    Radiation induced DNA double-strand breaks (DSBs) were measured in Chinese hamster ovary cells (CHO-K1) using an experimental protocol involving static-field gel electrophoresis following exposure to various accelerated ions. Dose-effect curves were set up and relative biological efficiencies (RBEs) for DSB induction were determined for different radiation qualities. RBEs around 1 were obtained for low energy deuterons (6-7 keV/μm), while for high energy oxygen ions (20 keV/μm) an RBE value slightly greater than 1 was determined. Low energetic oxygen ions (LET ∼ 250 keV/μm) were found to show RBEs substantially below unity, and for higher LET particles (≥ 250 keV/μm) RBEs for DSB induction were generally found to be smaller than 1. The data presented here are in line with the generally accepted view that not induced DSBs, but misrepaired or unrepaired DNA-lesions are related to cellular inactivation. (orig.)

  18. Mycobacteria exploit three genetically distinct DNA double-strand break repair pathways.

    Science.gov (United States)

    Gupta, Richa; Barkan, Daniel; Redelman-Sidi, Gil; Shuman, Stewart; Glickman, Michael S

    2011-01-01

    Bacterial pathogens rely on their DNA repair pathways to resist genomic damage inflicted by the host. DNA double-strand breaks (DSBs) are especially threatening to bacterial viability. DSB repair by homologous recombination (HR) requires nucleases that resect DSB ends and a strand exchange protein that facilitates homology search. RecBCD and RecA perform these functions in Escherichia coli and constitute the major pathway of error-free DSB repair. Mycobacteria, including the human pathogen M. tuberculosis, elaborate an additional error-prone pathway of DSB repair via non-homologous end-joining (NHEJ) catalysed by Ku and DNA ligase D (LigD). Little is known about the relative contributions of HR and NHEJ to mycobacterial chromosome repair, the factors that dictate pathway choice, or the existence of additional DSB repair pathways. Here we demonstrate that Mycobacterium smegmatis has three DSB repair pathway options: HR, NHEJ and a novel mechanism of single-strand annealing (SSA). Inactivation of NHEJ or SSA is compensated by elevated HR. We find that mycobacterial RecBCD does not participate in HR or confer resistance to ionizing radiation (IR), but is required for the RecA-independent SSA pathway. In contrast, the mycobacterial helicase-nuclease AdnAB participates in the RecA-dependent HR pathway, and is a major determinant of resistance to IR and oxidative DNA damage. These findings reveal distinctive features of mycobacterial DSB repair, most notably the dedication of the RecBCD and AdnAB helicase-nuclease machines to distinct repair pathways. © 2010 Blackwell Publishing Ltd.

  19. Repair of DNA double-strand breaks and cell killing by charged particles

    Science.gov (United States)

    Eguchi-Kasai, K.; Murakami, M.; Itsukaichi, H.; Fukutsu, K.; Yatagai, F.; Kanai, T.; Ohara, H.; Sato, K.

    It has been suggested that it is not simple double-strand breaks (dsb) but the non-reparable breaks which correlate well with the high biological effectiveness of high LET radiations for cell killing. We have compared the effects of charged particles on cell death in 3 pairs of cell lines which are normal or defective in the repair of DNA dsbs. For the cell lines SL3-147, M10, and SX10 which are deficient in DNA dsb repair, RBE values were close to unity for cell killing induced by charged particles with linear energy transfer (LET) up to 200 keV/mum and were even smaller than unity for the LET region greater than 300 keV/mum. The inactivation cross section (ICS) increased with LET for all 3 pairs. The ICS of dsb repair deficient mutants was always larger than that of their parents for all the LET ranges, but with increasing LET the difference in ICS between the mutant and its parent became smaller. Since a small difference in ICS remained at LET of about 300 keV/mum, dsb repair may still take place at this high LET, even if its role is apparently small. These results suggest that the DNA repair system does not play a major role in protection against the attack of high LET radiations and that a main cause of cell death is non-reparable dsb which are produced at a higher yield compared with low LET radiations. No correlation was observed between DNA content or nuclear area and ICS.

  20. Radiation induced DNA double-strand breaks in radiology; Strahleninduzierte DNA-Doppelstrangbrueche in der Radiologie

    Energy Technology Data Exchange (ETDEWEB)

    Kuefner, M.A. [Dornbirn Hospital (Austria). Dept. of Radiology; Brand, M.; Engert, C.; Uder, M. [Erlangen University Hospital (Germany). Dept. of Radiology; Schwab, S.A. [Radiologis, Oberasbach (Germany)

    2015-10-15

    Shortly after the discovery of X-rays, their damaging effect on biological tissues was observed. The determination of radiation exposure in diagnostic and interventional radiology is usually based on physical measurements or mathematical algorithms with standardized dose simulations. γ-H2AX immunofluorescence microscopy is a reliable and sensitive method for the quantification of radiation induced DNA double-strand breaks (DSB) in blood lymphocytes. The detectable amount of these DNA damages correlates well with the dose received. However, the biological radiation damage depends not only on dose but also on other individual factors like radiation sensitivity and DNA repair capacity. Iodinated contrast agents can enhance the x-ray induced DNA damage level. After their induction DSB are quickly repaired. A protective effect of antioxidants has been postulated in experimental studies. This review explains the principle of the γ-H2AX technique and provides an overview on studies evaluating DSB in radiologic examinations.

  1. COMPARISON OF UV INACTIVATION OF SPORES OF THREE ENCEPHALITOZOON SPECIES WITH THAT OF SPORES OF TWO DNA REPAIR-DEFICIENT BACILLUS SUBTILIS BIODOSIMETRY STRAINS

    Science.gov (United States)

    The sensitivity of three Encephalitozoon spp. to ultraviolet (UV) inactivation was determined. Encephalitozoon intestinalis is a contaminant listed on the USEPA's 1998 Contaminant Candidate List (CCL). Also, use of DNA repair deficient strains of Bacillus subtilis were evaluat...

  2. The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

    Science.gov (United States)

    Leem, S H; Ropp, P A; Sugino, A

    1994-08-11

    We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in DNA metabolism. The deletion strains did not exhibit UV-sensitivity. However, they did show weak sensitivity to MMS-treatment and exhibited a hyper-recombination phenotype when intragenic recombination was measured during meiosis. Furthermore, MAT alpha pol4 delta segregants had a higher frequency of illegitimate mating with a MAT alpha tester strain than that of wild-type cells. These results suggest that DNA polymerase IV participates in a double-strand break repair pathway. A 3.2kb of the POL4 transcript was weakly expressed in mitotically growing cells. During meiosis, a 2.2 kb POL4 transcript was greatly induced, while the 3.2 kb transcript stayed at constant levels. This induction was delayed in a swi4 delta strain during meiosis, while no effect was observed in a swi6 delta strain.

  3. Double-Strand DNA Break Repair in Mycobacteria.

    Science.gov (United States)

    Glickman, Michael S

    2014-10-01

    Discontinuity of both strands of the chromosome is a lethal event in all living organisms because it compromises chromosome replication. As such, a diversity of DNA repair systems has evolved to repair double-strand DNA breaks (DSBs). In part, this diversity of DSB repair systems has evolved to repair breaks that arise in diverse physiologic circumstances or sequence contexts, including cellular states of nonreplication or breaks that arise between repeats. Mycobacteria elaborate a set of three genetically distinct DNA repair pathways: homologous recombination, nonhomologous end joining, and single-strand annealing. As such, mycobacterial DSB repair diverges substantially from the standard model of prokaryotic DSB repair and represents an attractive new model system. In addition, the presence in mycobacteria of a DSB repair system that can repair DSBs in nonreplicating cells (nonhomologous end joining) or when DSBs arise between repeats (single-strand annealing) has clear potential relevance to Mycobacterium tuberculosis pathogenesis, although the exact role of these systems in M. tuberculosis pathogenesis is still being elucidated. In this article we will review the genetics of mycobacterial DSB repair systems, focusing on recent insights.

  4. DNA double strand break repair in a radioresistant cell line

    International Nuclear Information System (INIS)

    Koval, T.M.; Kazmar, E.R.

    1987-01-01

    TN-368 lepidopteran insect cells are on the order of 100 times more resistant to the lethal effects of ionizing radiation than cultured mammalian cells. DNA double strand breaks (DSB) are believed by many to be the critical molecular lesion leading to cell death. The authors therefore measured the rejoining of DSB in TN-368 and V79 Chinese hamster cells. Cells were irradiated on ice with /sup 137/Cs γ rays at a dose rate of 2.5 Gy/min, incubated for various periods of time, and assayed for DNA DSB using the method of neutral elution. The kinetics of DSB rejoining following a dose of 90.2 Gy are similar for both cell lines. Approximately 80% of the DSB are rejoined in both lines by 1 hr postirradiation. However, no further rejoining occurs in the TN-368 cells through at least 6 hr postirradiation, whereas 90% of the DSB are rejoined in the V79 cells by 2 hr postirradiation. Other studies (from 22.6 to 226 Gy) demonstrate that the amount of rejoining of DSB varies inversely with dose for the V79 cells but remains constant for the TN-368 cells. These findings do not support the hypothesis that unrejoined DNA DSB represent the major lesion resulting in cell death

  5. Ku recruits XLF to DNA double-strand breaks.

    Science.gov (United States)

    Yano, Ken-ichi; Morotomi-Yano, Keiko; Wang, Shih-Ya; Uematsu, Naoya; Lee, Kyung-Jong; Asaithamby, Aroumougame; Weterings, Eric; Chen, David J

    2008-01-01

    XRCC4-like factor (XLF)--also known as Cernunnos--has recently been shown to be involved in non-homologous end-joining (NHEJ), which is the main pathway for the repair of DNA double-strand breaks (DSBs) in mammalian cells. XLF is likely to enhance NHEJ by stimulating XRCC4-ligase IV-mediated joining of DSBs. Here, we report mechanistic details of XLF recruitment to DSBs. Live cell imaging combined with laser micro-irradiation showed that XLF is an early responder to DSBs and that Ku is essential for XLF recruitment to DSBs. Biochemical analysis showed that Ku-XLF interaction occurs on DNA and that Ku stimulates XLF binding to DNA. Unexpectedly, XRCC4 is dispensable for XLF recruitment to DSBs, although photobleaching analysis showed that XRCC4 stabilizes the binding of XLF to DSBs. Our observations showed the direct involvement of XLF in the dynamic assembly of the NHEJ machinery and provide mechanistic insights into DSB recognition.

  6. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA

    OpenAIRE

    Khodakov, Dmitriy A.; Khodakova, Anastasia S.; Huang, David M.; Linacre, Adrian; Ellis, Amanda V.

    2015-01-01

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within doubl...

  7. DNA aptamer functionalized gold nanostructures for molecular recognition and photothermal inactivation of methicillin-Resistant Staphylococcus aureus.

    Science.gov (United States)

    Ocsoy, Ismail; Yusufbeyoglu, Sadi; Yılmaz, Vedat; McLamore, Eric S; Ildız, Nilay; Ülgen, Ahmet

    2017-11-01

    In this work, we report the development of DNA aptamer-functionalized gold nanoparticles (Apt@Au NPs) and gold nanorods (Apt@Au NRs) for inactivation of Methicillin-resistant Staphylococcus aureus (MRSA) with targeted photothermal therapy (PTT). Although both Apt@Au NPs and Apt@Au NRs specifically bind to MRSA cells, Apt@Au NPs and Apt@Au NRs inactivated ∼5% and over 95% of the cells,respectively through PTT. This difference in inactivation was based on the relatively high longitudinal absorption of near-infrared (NIR) radiation and strong photothermal conversion capability for the Apt@Au NRs compared to the Apt@Au NPs. The Au NRs served as a nanoplatform for the loading of thiolated aptamer and also provided multivalent effects for increasing binding strength and affinity to MRSA. Our results indicate that the type of aptamer and the degree of multivalent effect(s) are important factors for MRSA inactivation efficiency in PTT. We show that the Apt@Au NRs are a very effective and promising nanosystem for specific cell recognition and in vitro PTT. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Prime-boost vaccination using DNA and whole inactivated virus vaccines provides limited protection against virulent feline immunodeficiency virus.

    Science.gov (United States)

    Dunham, Stephen P; Bruce, Jennifer; Klein, Dieter; Flynn, J Norman; Golder, Matthew C; MacDonald, Susan; Jarrett, Oswald; Neil, James C

    2006-11-30

    Protection against feline immunodeficiency virus (FIV) has been achieved using a variety of vaccines notably whole inactivated virus (WIV) and DNA. However protection against more virulent isolates, typical of those encountered in natural infections, has been difficult to achieve. In an attempt to improve protection against virulent FIV(GL8), we combined both DNA and WIV vaccines in a "prime-boost" approach. Thirty cats were divided into four groups receiving vaccinations and one unvaccinated control group. Following viral challenge, two vaccinated animals, one receiving DNA alone and one the prime-boost vaccine remained free of viraemia, whilst all controls became viraemic. Animals vaccinated with WIV showed apparent early enhancement of infection at 2 weeks post challenge (pc) with higher plasma viral RNA loads than control animals or cats immunised with DNA alone. Despite this, animals vaccinated with WIV or DNA alone showed significantly lower proviral loads in peripheral blood mononuclear cells and mesenteric lymph node cells, whilst those receiving the DNA-WIV prime-boost vaccine showed significantly lower proviral loads in PBMC, than control animals, at 35 weeks pc. Therefore both DNA and WIV vaccines conferred limited protection against viral challenge but the combination of WIV and DNA in a prime-boost approach appeared to offer no significant advantage over either vaccine alone.

  9. Mechanisms of DNA Packaging by Large Double-Stranded DNA Viruses

    Science.gov (United States)

    Rao, Venigalla B.; Feiss, Michael

    2016-01-01

    Translocation of viral double-stranded DNA (dsDNA) into the icosahedral prohead shell is catalyzed by TerL, a motor protein that has ATPase, endonuclease, and translocase activities. TerL, following endonucleolytic cleavage of immature viral DNA concatemer recognized by TerS, assembles into a pentameric ring motor on the prohead’s portal vertex and uses ATP hydrolysis energy for DNA translocation. TerL’s N-terminal ATPase is connected by a hinge to the C-terminal endonuclease. Inchworm models propose that modest domain motions accompanying ATP hydrolysis are amplified, through changes in electrostatic interactions, into larger movements of the C-terminal domain bound to DNA. In phage φ29, four of the five TerL subunits sequentially hydrolyze ATP, each powering translocation of 2.5 bp. After one viral genome is encapsidated, the internal pressure signals termination of packaging and ejection of the motor. Current focus is on the structures of packaging complexes and the dynamics of TerL during DNA packaging, endonuclease regulation, and motor mechanics. PMID:26958920

  10. The Human L1 Element Causes DNA Double-Strand Breaks in Breast Cancer

    Science.gov (United States)

    2006-08-01

    cancer is complex. However, defects in DNA repair genes in the double-strand break repair pathway are cancer predisposing. My lab has characterized...a new potentially important source of double-strand breaks (DSBs) in human cells and are interested in characterizing which DNA repair genes act on...this particular source of DNA damage. Selfish DNA accounts for 45% of the human genome. We have recently demonstrated that one particular selfish

  11. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    Science.gov (United States)

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

    2015-03-04

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  12. Cyclic perylene diimide: Selective ligand for tetraplex DNA binding over double stranded DNA.

    Science.gov (United States)

    Vasimalla, Suresh; Sato, Shinobu; Takenaka, Fuminori; Kurose, Yui; Takenaka, Shigeori

    2017-12-15

    Synthesized cyclic perylene diimide, cPDI, showed the binding constant of 6.3 × 10 6  M -1 with binding number of n = 2 with TA-core as a tetraplex DNA in 50 mM Tris-HCl buffer (pH = 7.4) containing 100 mM KCl using Schatchard analysis and showed a higher preference for tetraplex DNA than for double stranded DNA with over 10 3 times. CD spectra showed that TA-core induced its antiparallel conformation upon addition of cPDI in the absence or presence of K + or Na + ions. The cPDI inhibits the telomerase activity with IC 50 of 0.3 µM using TRAP assay which is potential anti-cancer drug with low side effect. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Torsional regulation of hRPA-induced unwinding of double-stranded DNA

    NARCIS (Netherlands)

    De Vlaminck, I.; Vidic, I.; Van Loenhout, M.T.J.; Kanaar, R.; Lebbink, J.H.G.; Dekker, C.

    2010-01-01

    All cellular single-stranded (ss) DNA is rapidly bound and stabilized by single stranded DNA-binding proteins (SSBs). Replication protein A, the main eukaryotic SSB, is able to unwind double-stranded (ds) DNA by binding and stabilizing transiently forming bubbles of ssDNA. Here, we study the

  14. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

    Science.gov (United States)

    Jette, Nicholas; Lees-Miller, Susan P.

    2015-01-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemistry, structure and function of DNA-PK, its roles in DNA double strand break repair and its newly described roles in mitosis and other cellular processes. PMID:25550082

  15. Protein kinase CK2 localizes to sites of DNA double-strand break regulating the cellular response to DNA damage

    Directory of Open Access Journals (Sweden)

    Olsen Birgitte B

    2012-03-01

    Full Text Available Abstract Background The DNA-dependent protein kinase (DNA-PK is a nuclear complex composed of a large catalytic subunit (DNA-PKcs and a heterodimeric DNA-targeting subunit Ku. DNA-PK is a major component of the non-homologous end-joining (NHEJ repair mechanism, which is activated in the presence of DNA double-strand breaks induced by ionizing radiation, reactive oxygen species and radiomimetic drugs. We have recently reported that down-regulation of protein kinase CK2 by siRNA interference results in enhanced cell death specifically in DNA-PKcs-proficient human glioblastoma cells, and this event is accompanied by decreased autophosphorylation of DNA-PKcs at S2056 and delayed repair of DNA double-strand breaks. Results In the present study, we show that CK2 co-localizes with phosphorylated histone H2AX to sites of DNA damage and while CK2 gene knockdown is associated with delayed DNA damage repair, its overexpression accelerates this process. We report for the first time evidence that lack of CK2 destabilizes the interaction of DNA-PKcs with DNA and with Ku80 at sites of genetic lesions. Furthermore, we show that CK2 regulates the phosphorylation levels of DNA-PKcs only in response to direct induction of DNA double-strand breaks. Conclusions Taken together, these results strongly indicate that CK2 plays a prominent role in NHEJ by facilitating and/or stabilizing the binding of DNA-PKcs and, possibly other repair proteins, to the DNA ends contributing to efficient DNA damage repair in mammalian cells.

  16. Colocalization of multiple DNA double-strand breaks at a single Rad52 repair centre

    DEFF Research Database (Denmark)

    Lisby, M.; Mortensen, Uffe Hasbro; Rothstein, R.

    2003-01-01

    DNA double-strand break repair (DSBR) is an essential process for preserving genomic integrity in all organisms. To investigate this process at the cellular level, we engineered a system of fluorescently marked DNA double-strand breaks (DSBs) in the yeast Saccharomyces cerevisiae to visualize in ...

  17. SIRT6 stabilizes DNA-dependent protein kinase at chromatin for DNA double-strand break repair

    DEFF Research Database (Denmark)

    McCord, Ronald A; Michishita, Eriko; Hong, Tao

    2009-01-01

    -PKcs) to chromatin in response to DNA damage and stabilizes DNA-PKcs at chromatin adjacent to an induced site-specific DSB. Abrogation of these SIRT6 activities leads to impaired resolution of DSBs. Together, these findings elucidate a mechanism whereby regulation of dynamic interaction of a DNA repair factor......-dependent protein kinase) and promotes DNA DSB repair. In response to DSBs, SIRT6 associates dynamically with chromatin and is necessary for an acute decrease in global cellular acetylation levels on histone H3 Lysine 9. Moreover, SIRT6 is required for mobilization of the DNA-PK catalytic subunit (DNA......, and SIRT6 knockout cells exhibit genomic instability and DNA damage hypersensitivity. However, the molecular mechanisms underlying these defects are not fully understood. Here, we show that SIRT6 forms a macromolecular complex with the DNA double-strand break (DSB) repair factor DNA-PK (DNA...

  18. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

    OpenAIRE

    Jette, Nicholas; Lees-Miller, Susan P.

    2014-01-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemi...

  19. Double strand breaks in DNA in vivo and in vitro after 60Co-γ-irradiation

    International Nuclear Information System (INIS)

    Huelsewede, J.W.

    1985-01-01

    The questions of what the correlation is between double strand breaks in DNA in the cell and lethal radiation damage and by means of which possible mechanisms DNA double strand breaks could occur were studied. E. coli served as test system. In addition to this the molecular weight of the DNA from irradiated E. coli as a function of the radiation dose under various conditions was measured. This data was compared on the one hand to the survival of the cell and on the other hand to the formation of DNA double strand breaks in an aqueous buffer system, which in its ionic characteristics was similar to cell fluids. (orig./MG) [de

  20. In vivo quantification of DNA double strand breaks

    International Nuclear Information System (INIS)

    Simonsson, M.; Qvarnstroem, F.; Turesson, I.; Johansson, K.-A.; Nyman, J.; Hermansson, I.; Oden, A.; Book, M.

    2003-01-01

    DNA double strand breaks (DSBs) can be introduced in the genome by exposure to exogenous agents such as ionising radiation and radio-mimetic chemicals. The biological importance of these breaks is significant even at low numbers. Inaccurate repair or lack of repair of a single DSB has the potential to kill a cell or lead to tumourigenesis. Thus the induction and repair of DSBs are crucial events in the onset of malignancies. Following the induction of DSBs, the core histone H2AX is rapidly phosphorylated at residue serine 139. This phosphorylated form of H2AX is referred to as gH2AX. Histones wrapped in megabase regions flanking these breaks are involved in this process, which results in the formation of discrete nuclear foci. It has previously been shown that a single DSB is sufficient to produce a detectable focus. So far there has been a lack of methods capable of measuring the amount of DSBs at clinically relevant quantities. Such a method would embrace a wide field of applications. It could be applied as a biological dosimeter when studying carcinogenic effects and provide the basis for an assay predicting individual radiosensitivity. We describe a measurement procedure that detects and quantifies small amounts of DSBs in vivo. This is accomplished using immunofluorescence detection of the molecular marker gH2AX. The gH2AX foci are quantified in histological sections using basic digital image analysis methods as the main component. In a primary assessment of the procedure we analysed the in vivo dose response of prostate cancer patients in clinical practice undergoing radiotherapy. Epidermal nucleated cells in skin biopsies taken 30 minutes following the first single dose delivered show linear dose response for low doses ranging from 0 - 1.2 Gy. The described procedure for double strand break quantification can detect dose changes as low as 0.18 Gy

  1. An isolated Hda-clamp complex is functional in the regulatory inactivation of DnaA and DNA replication.

    Science.gov (United States)

    Kawakami, Hironori; Su'etsugu, Masayuki; Katayama, Tsutomu

    2006-10-01

    In Escherichia coli, a complex consisting of Hda and the DNA-loaded clamp-subunit of the DNA polymerase III holoenzyme promotes hydrolysis of DnaA-ATP. The resultant ADP-DnaA is inactive for initiation of chromosomal DNA replication, thereby repressing excessive initiations. As the cellular content of the clamp is 10-100 times higher than that of Hda, most Hda molecules might be complexed with the clamp in vivo. Although Hda predominantly forms irregular aggregates when overexpressed, in the present study we found that co-overexpression of the clamp with Hda enhances Hda solubility dramatically and we efficiently isolated the Hda-clamp complex. A single molecule of the complex appears to consist of two Hda molecules and a single clamp. The complex is competent in DnaA-ATP hydrolysis and DNA replication in the presence of DNA and the clamp deficient subassembly of the DNA polymerase III holoenzyme (pol III*). These findings indicate that the clamp contained in the complex is loaded onto DNA through an interaction with the pol III* and that the Hda activity is preserved in these processes. The complex consisting of Hda and the DNA-unloaded clamp may play a specific role in a process proceeding to the DnaA-ATP hydrolysis in vivo.

  2. Study in regularities in the formation of double stranded DNA breaks in irradiated rat thymocytes

    International Nuclear Information System (INIS)

    Ivannik, B.P.; ProskuryakoV, S.Ya.; Ryabchenko, N.I.

    1979-01-01

    Using low-gradient viscosimetry of neutral detergent nuclear lysates a study was made of postradiation changes in the molecular weight of double-stranded DNA of thymocytes. It was established that 375 eV are needed for one double-stranded break to appear, and a dose of 1 rad is required for 0.275 double-stranded break to occur at the site of DNA with m.w. 10 12 dalton. The repair of double-stranded breaks is only observed when rats are exposed to a dose of 500 R. It is assumed that the absence of repair of double-stranded DNA breaks and the presence of secondary postradiation degradation of DNA are responsible for thymocyte death

  3. Enzymatic induction of DNA double-strand breaks in γ-irradiated Escherichia coli K-12

    International Nuclear Information System (INIS)

    Bonura, T.; Smith, K.C.; Kaplan, H.S.

    1975-01-01

    The polA1 mutation increases the sensitivity of E. coli K-12 to killing by γ-irradiation in air by a factor of 2.9 and increases the yield of DNA double-strand breaks by a factor of 2.5. These additional DNA double-strand breaks appear to be due to the action of nucleases in the polA1 strain rather than to the rejoining of radiation-induced double-strand breaks in the pol + strain. This conclusion is based upon the observation that γ-irradiation at 3 0 did not affect the yield of DNA double-strand breaks in the pol + strain, but decreased the yield in the polA1 strain by a factor of 2.2. Irradiation of the polA1 strain at 3 0 followed by incubation at 3 0 for 20 min before plating resulted in approximately a 1.5-fold increase in the D 0 . The yield of DNA double-strand breaks was reduced by a factor of 1.5. The pol + strain, however, did not show the protective effect of the low temperature incubation upon either survival or DNA double-strand breakage. We suggest that the increased yield of DNA double-strand breaks in the polA 1 strain may be the result of the unsuccessful excision repair of ionizing radiation-induced dna base damage

  4. Double demonstration of oncogenic high risk human papilloma virus DNA and HPV-E7 protein in oral cancers.

    Science.gov (United States)

    Pannone, G; Santoro, A; Carinci, F; Bufo, P; Papagerakis, S M; Rubini, C; Campisi, G; Giovannelli, L; Contaldo, M; Serpico, R; Mazzotta, M; Lo Muzio, L

    2011-01-01

    Oncogenic HPVs are necessarily involved in cervical cancer but their role in oral carcinogenesis is debated. To detect HPV in oral cancer, 38 cases of formalin fixed-paraffin embedded OSCC were studied by both DNA genotyping (MY09/11 L1 consensus primers in combination with GP5-GP6 primer pair followed by sequencing) and immunohistochemistry (monoclonal Abs against capsid protein and HPV-E7 protein, K1H8 DAKO and clone 8C9 INVITROGEN, respectively). HPV-16 tonsil cancer was used as positive control. The overall prevalence of HPV infection in OSCCs was 10.5%. Amplification of DNA samples showed single HPV DNA infection in 3 cases (HPV16; HPV53; HPV70) and double infection in one case of cheek cancer (HPV31/HPV44). The overall HR-HPV prevalence was 7.5%. E-7 antigen was immunohistochemically detected in all HPV-positive cases. HPV+ OSCC cases showed an overall better outcome than HPV negative oral cancers, as evaluated by Kaplan-Meier curves. HPVs exert their oncogenic role after DNA integration, gene expression of E5, E6 and E7 loci and p53/pRb host proteins suppression. This study showed that HPV-E7 protein inactivating pRb is expressed in oral cancer cells infected by oncogenic HPV other than classical HR-HPV-16/18. Interestingly HPV-70, considered a low risk virus with no definite collocation in oncogenic type category, gives rise to the expression of HPV-E7 protein and inactivate pRb in oral cancer. HPV-70, as proved in current literature, is able to inactivates also p53 protein, promoting cell immortalization. HPV-53, classified as a possible high risk virus, expresses E7 protein in OSCC, contributing to oral carcinogenesis. We have identified among OSCCs, a subgroup characterized by HPV infection (10.5%). Finally, we have proved the oncogenic potential of some HPV virus types, not well known in literature.

  5. Role for Artemis nuclease in the repair of radiation-induced DNA double strand breaks by alternative end joining.

    Science.gov (United States)

    Moscariello, Mario; Wieloch, Radi; Kurosawa, Aya; Li, Fanghua; Adachi, Noritaka; Mladenov, Emil; Iliakis, George

    2015-07-01

    Exposure of cells to ionizing radiation or radiomimetic drugs generates DNA double-strand breaks that are processed either by homologous recombination repair (HRR), or by canonical, DNA-PKcs-dependent non-homologous end-joining (C-NHEJ). Chemical or genetic inactivation of factors involved in C-NHEJ or HRR, but also their local failure in repair proficient cells, promotes an alternative, error-prone end-joining pathway that serves as backup (A-EJ). There is evidence for the involvement of Artemis endonuclease, a protein deficient in a human radiosensitivity syndrome associated with severe immunodeficiency (RS-SCID), in the processing of subsets of DSBs by HRR or C-NHEJ. It is thought that within HRR or C-NHEJ Artemis processes DNA termini at complex DSBs. Whether Artemis has a role in A-EJ remains unknown. Here, we analyze using pulsed-field gel electrophoresis (PFGE) and specialized reporter assays, DSB repair in wild-type pre-B NALM-6 lymphocytes, as well as in their Artemis(-/-), DNA ligase 4(-/-) (LIG4(-/-)), and LIG4(-/-)/Artemis(-/-) double mutant counterparts, under conditions allowing evaluation of A-EJ. Our results substantiate the suggested roles of Artemis in C-NHEJ and HRR, but also demonstrate a role for the protein in A-EJ that is confirmed in Artemis deficient normal human fibroblasts. We conclude that Artemis is a nuclease participating in DSB repair by all major repair pathways. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. DNA Double-Strand Break Rejoining in Complex Normal Tissues

    International Nuclear Information System (INIS)

    Ruebe, Claudia E.; Dong, Xiaorong; Kuehne, Martin; Fricke, Andreas; Kaestner, Lars; Lipp, Peter; Ruebe, Christian

    2008-01-01

    Purpose: The clinical radiation responses of different organs vary widely and likely depend on the intrinsic radiosensitivities of their different cell populations. Double-strand breaks (DSBs) are the most deleterious form of DNA damage induced by ionizing radiation, and the cells' capacity to rejoin radiation-induced DSBs is known to affect their intrinsic radiosensitivity. To date, only little is known about the induction and processing of radiation-induced DSBs in complex normal tissues. Using an in vivo model with repair-proficient mice, the highly sensitive γH2AX immunofluorescence was established to investigate whether differences in DSB rejoining could account for the substantial differences in clinical radiosensitivity observed among normal tissues. Methods and Materials: After whole body irradiation of C57BL/6 mice (0.1, 0.5, 1.0, and 2.0 Gy), the formation and rejoining of DSBs was analyzed by enumerating γH2AX foci in various organs representative of both early-responding (small intestine) and late-responding (lung, brain, heart, kidney) tissues. Results: The linear dose correlation observed in all analyzed tissues indicated that γH2AX immunofluorescence allows for the accurate quantification of DSBs in complex organs. Strikingly, the various normal tissues exhibited identical kinetics for γH2AX foci loss, despite their clearly different clinical radiation responses. Conclusion: The identical kinetics of DSB rejoining measured in different organs suggest that tissue-specific differences in radiation responses are independent of DSB rejoining. This finding emphasizes the fundamental role of DSB repair in maintaining genomic integrity, thereby contributing to cellular viability and functionality and, thus, tissue homeostasis

  7. Balancing Pathways in DNA Double Strand Break Repair

    NARCIS (Netherlands)

    I. Brandsma (Inger)

    2016-01-01

    markdownabstractAll information a cell needs to live and survive is stored in the genomic DNA. Maintenance of an intact and uncompromised genome is of vital importance for cell survival. Damaged DNA can block transcription and replication, processes essential for cell viability. Persistent DNA

  8. Effect of oxygen on inactivation of biologically active DNA by γ rays in vitro: influence of metalloporphyrins and enzymatic DNA repair

    International Nuclear Information System (INIS)

    van Hemmen, J.J.; Meuling, W.J.A.; Bleichrodt, J.F.

    1978-01-01

    Biologically active DNA dissolved in a bacterial extract shows a higher sensitivity to γ rays under oxygen than under anoxic conditions. This oxygen effect depends on the presence of dialyzable, probably organometallic, compounds in the extract. Metalloporphyrins mimic these cellular components with regard to the effect of oxygen on DNA irradiated in vitro. Anoxic irradiation leads to less double-strand breaks in the DNA than irradiation under oxygen, but the oxygen effect in vitro is mainly due to nucleotide damage. No oxygen effect is observed when the biological activity of the irradiated DNA is assayed on spheroplasts of a bacterial strain carrying a uvrA mutation, i.e., a deficiency in the excision repair system, and the sensitivity of the DNA is almost equal to that found for irradiation under oxygen and assay on a repair-proficient strain. It may be concluded, therefore, that the oxygen effect observed with DNA in cellular extracts or in the presence of metalloporphyrins results from more efficient cellular repair of the otherwise lethal nucleotide damage inflicted under anoxic conditions. Comparison of the oxygen effect on DNA in vitro with the radiosensitization of bacterial cells by oxygen shows that in bacteria part of the radiation damage may be similar to that induced in DNA in vitro, but, in addition, the cells sustain another type of damage which is subjected to an oxygen effect but not to excision repair

  9. Studies of interaction between two alkaloids and double helix DNA

    International Nuclear Information System (INIS)

    Sun, Yantao; Peng, Tingting; Zhao, Lei; Jiang, Dayu; Cui, Yuncheng

    2014-01-01

    This article presents the study on the interaction of two alkaloids (matrine and evodiamine) and hs-DNA by absorption, fluorescence, circular dichroism (CD), DNA melting and viscosity experiments. The spectroscopic studies suggested that two alkaloids can bind to DNA through an intercalative mode. The viscosity measurement and thermal denaturation also indicated that two alkaloids can intercalate to DNA. The binding constants (K A ) and the number of binding sites (n) were determined. At the same time, some significant thermodynamic parameters of the binding of the alkaloids to DNA were obtained. Competitive binding studies revealed that alkaloids had an effect on ethidium bromide (EB) bound DNA. In addition, it was also proved that the fluorescence quenching was influenced by ionic strength. - Highlights: • Interaction between two alkaloids and DNA is studied by spectral methods. • The binding constant and the binding sites between two alkaloids and DNA are obtained. • There are a classical intercalative mode between alkaloids and DNA. • The binding of matrine with DNA is weaker than that of evodiamine. • It is important for us to understand the alkaloids–DNA interactions at a molecular level

  10. The logic of DNA replication in double-stranded DNA viruses: insights from global analysis of viral genomes.

    Science.gov (United States)

    Kazlauskas, Darius; Krupovic, Mart; Venclovas, Česlovas

    2016-06-02

    Genomic DNA replication is a complex process that involves multiple proteins. Cellular DNA replication systems are broadly classified into only two types, bacterial and archaeo-eukaryotic. In contrast, double-stranded (ds) DNA viruses feature a much broader diversity of DNA replication machineries. Viruses differ greatly in both completeness and composition of their sets of DNA replication proteins. In this study, we explored whether there are common patterns underlying this extreme diversity. We identified and analyzed all major functional groups of DNA replication proteins in all available proteomes of dsDNA viruses. Our results show that some proteins are common to viruses infecting all domains of life and likely represent components of the ancestral core set. These include B-family polymerases, SF3 helicases, archaeo-eukaryotic primases, clamps and clamp loaders of the archaeo-eukaryotic type, RNase H and ATP-dependent DNA ligases. We also discovered a clear correlation between genome size and self-sufficiency of viral DNA replication, the unanticipated dominance of replicative helicases and pervasive functional associations among certain groups of DNA replication proteins. Altogether, our results provide a comprehensive view on the diversity and evolution of replication systems in the DNA virome and uncover fundamental principles underlying the orchestration of viral DNA replication. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Effects of oxygen radical scavengers on the inactivation of SS phi X174 DNA by the semi-quinone free radical of the antitumor agent etoposide

    NARCIS (Netherlands)

    van Maanen, M.J.; Mans, D.R.A.; Lafleur, M.V.M.; Van Schaik, M A; de Vries, J; Vermeulen, N P; Retèl, J.; Lankelma, J

    1990-01-01

    We have studied the effects of oxygen radical scavengers on the inactivation of ss phi X174 DNA by the semi-quinone free radical of the antitumor agent etoposide (VP 16-213), which was generated from the ortho-quinone of etoposide at pH greater than or equal to 7.4. A semi-quinone free radical of

  12. Extracellular DNA and histones: double-edged swords in immunothrombosis.

    Science.gov (United States)

    Gould, T J; Lysov, Z; Liaw, P C

    2015-06-01

    The existence of extracellular DNA in human plasma, also known as cell-free DNA (cfDNA), was first described in the 1940s. In recent years, there has been a resurgence of interest in the functional significance of cfDNA, particularly in the context of neutrophil extracellular traps (NETs). cfDNA and histones are key components of NETs that aid in the host response to infection and inflammation. However, cfDNA and histones may also exert harmful effects by triggering coagulation, inflammation, and cell death and by impairing fibrinolysis. In this article, we will review the pathologic nature of cfDNA and histones in macrovascular and microvascular thrombosis, including venous thromboembolism, cancer, sepsis, and trauma. We will also discuss the prognostic value of cfDNA and histones in these disease states. Understanding the molecular and cellular pathways regulated by cfDNA and histones may provide novel insights to prevent pathological thrombus formation and vascular occlusion. © 2015 International Society on Thrombosis and Haemostasis.

  13. Visualization of DNA double-strand break repair: From molecules to cells

    NARCIS (Netherlands)

    Krawczyk, Przemek M.; Stap, Jan; Aten, Jacob A.

    2008-01-01

    DNA double-strand break (DSB) signaling and repair processes are positioned at the crossroad of nuclear pathways that regulate DNA replication, cell division, senescence and apoptosis. Importantly, errors in DSB repair may lead to lethal or potentially tumorigenic chromosome rearrangements.

  14. The role of DNA double-strand breaks in spontaneous homologous recombination in S. cerevisiae

    DEFF Research Database (Denmark)

    Lettier, Gaëlle; Feng, Q.; Mayolo, A.A. de

    2006-01-01

    of meiosis and result from the induction of a large number of DNA double-strand breaks (DSBs). By analogy, it is generally believed that the rare spontaneous mitotic HR events are due to repair of DNA DSBs that accidentally occur during mitotic growth. Here we provide the first direct evidence that most...

  15. The Ku Heterodimer and the Metabolism of Single-Ended DNA Double-Strand Breaks

    NARCIS (Netherlands)

    A. Balestrini (Alessia); D. Ristic (Dejan); I. Dionne (Isabelle); X.Z. Liu (Xiao); C. Wyman (Claire); R.J. Wellinger (Raymund); J.H.J. Petrini (John)

    2013-01-01

    textabstractSingle-ended double-strand breaks (DSBs) are a common form of spontaneous DNA break, generated when the replisome encounters a discontinuity in the DNA template. Given their prevalence, understanding the mechanisms governing the fate(s) of single-ended DSBs is important. We describe the

  16. Assembly and function of DNA double-strand break repair foci in mammalian cells

    DEFF Research Database (Denmark)

    Bekker-Jensen, Simon; Mailand, Niels

    2010-01-01

    DNA double-strand breaks (DSBs) are among the most cytotoxic types of DNA damage, which if left unrepaired can lead to mutations or gross chromosomal aberrations, and promote the onset of diseases associated with genomic instability such as cancer. One of the most discernible hallmarks...

  17. Chromatin mobility is increased at sites of DNA double-strand breaks

    NARCIS (Netherlands)

    Krawczyk, P. M.; Borovski, T.; Stap, J.; Cijsouw, T.; ten Cate, R.; Medema, J. P.; Kanaar, R.; Franken, N. A. P.; Aten, J. A.

    2012-01-01

    DNA double-strand breaks (DSBs) can efficiently kill cancer cells, but they can also produce unwanted chromosome rearrangements when DNA ends from different DSBs are erroneously joined. Movement of DSB-containing chromatin domains might facilitate these DSB interactions and promote the formation of

  18. Regulation of DNA double-strand break repair by ubiquitin and ubiquitin-like modifiers

    DEFF Research Database (Denmark)

    Schwertman, Petra; Bekker-Jensen, Simon; Mailand, Niels

    2016-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions. The swift recognition and faithful repair of such damage is crucial for the maintenance of genomic stability, as well as for cell and organismal fitness. Signalling by ubiquitin, SUMO and other ubiquitin-like modifiers (UBLs...

  19. De novo-engineered transcription activator-like effector (TALE) hybrid nuclease with novel DNA binding specificity creates double-strand breaks

    KAUST Repository

    Mahfouz, Magdy M.

    2011-01-24

    Site-specific and rare cutting nucleases are valuable tools for genome engineering. The generation of double-strand DNA breaks (DSBs) promotes homologous recombination in eukaryotes and can facilitate gene targeting, additions, deletions, and inactivation. Zinc finger nucleases have been used to generate DSBs and subsequently, for genome editing but with low efficiency and reproducibility. The transcription activator-like family of type III effectors (TALEs) contains a central domain of tandem repeats that could be engineered to bind specific DNA targets. Here, we report the generation of a Hax3-based hybrid TALE nuclease with a user-selected DNA binding specificity. We show that the engineered TALE nuclease can bind to its target sequence in vitro and that the homodimeric TALE nuclease can cleave double-stranded DNA in vitro if the DNA binding sites have the proper spacing and orientation. Transient expression assays in tobacco leaves suggest that the hybrid nuclease creates DSB in its target sequence, which is subsequently repaired by nonhomologous end-joining repair. Taken together, our data show the feasibility of engineering TALE-based hybrid nucleases capable of generating site-specific DSBs and the great potential for site-specific genome modification in plants and eukaryotes in general.

  20. Push back to respond better: regulatory inhibition of the DNA double-strand break response.

    Science.gov (United States)

    Panier, Stephanie; Durocher, Daniel

    2013-10-01

    Single DNA lesions such as DNA double-strand breaks (DSBs) can cause cell death or trigger genome rearrangements that have oncogenic potential, and so the pathways that mend and signal DNA damage must be highly sensitive but, at the same time, selective and reversible. When initiated, boundaries must be set to restrict the DSB response to the site of the lesion. The integration of positive and, crucially, negative control points involving post-translational modifications such as phosphorylation, ubiquitylation and acetylation is key for building fast, effective responses to DNA damage and for mitigating the impact of DNA lesions on genome integrity.

  1. A critical role for topoisomerase IIb and DNA double strand breaks in transcription.

    Science.gov (United States)

    Calderwood, Stuart K

    2016-05-26

    Recent studies have indicated a novel role for topoisomerase IIb in transcription. Transcription of heat shock genes, serum-induced immediate early genes and nuclear receptor-activated genes, each required DNA double strands generated by topoisomerase IIb. Such strand breaks seemed both necessary and sufficient for transcriptional activation. In addition, such transcription was associated with initiation of the DNA damage response pathways, including the activation of the enzymes: ataxia-telangiectasia mutated (ATM), DNA-dependent protein kinase and poly (ADP ribose) polymerase 1. DNA damage response signaling was involved both in transcription and in repair of DNA breaks generated by topoisomerase IIb.

  2. 49. Brazilian congress on genetics. DNA double helix. Abstracts

    International Nuclear Information System (INIS)

    2003-01-01

    Use of radioisotopes and ionizing radiations in genetics is presented. Several aspects related to men, animals, plants and microorganisms are reported highlighting biological radiation effects, evolution, mutagenesis and genetic engineering. Genetic mapping, gene mutations, genetic diversity, DNA hybridization, DNA sequencing, plant cultivation and plant grow are studied as well

  3. Induction of protective immune responses in mice by double DNA ...

    African Journals Online (AJOL)

    Keywords: Multiple DNA vaccine, Omp31 gene, Brucella melitensis, Eae gene, Escherichia ... Abstract, Chemical Abstracts, Embase, Index Copernicus, EBSCO, African .... a 1 % agarose gel in 1× TBE buffer, followed by ... manufacturer's protocol, the recombinant ..... Moreno S, Timon M. DNA vaccination: an immunological.

  4. Three methods to determine the yields of DNA double-strand breaks

    International Nuclear Information System (INIS)

    Erzgraeber, G.; Lapidus, I.L.

    1985-01-01

    A possibility of determining the yield of DNA double-strand breaks in cells of the Chinese hamster (V79-4) by finding the amount of DNA released as a result of breaks and by determining the relative sedimentation velocity of DNA-membrane complexes affected by ionizing radiations with different physical characteristics is discussed. Results of the analysis are compared with the data obtained by a traditional method of sedimentation in the neutral sucrose density gradient. Comparative characterization of the methods is discussed. The yields of DNA double-strand breaks determined by the suggested independent methods are in good agreement, which opens possibilities of studying induction and repair of double-strand breaks by means of simpler and more reliable methods

  5. [DNA extraction from decomposed tissue by double-digest and magnetic beads methods].

    Science.gov (United States)

    Yang, Dian; Liu, Chao; Liu, Hong

    2011-12-01

    To study the effect of the double-digest and magnetic beads method for DNA extraction from 3 types of decomposed tissues. DNA of cartilages, nails and joint capsule in 91 highly decomposed corpses which had not been extracted by common magnetic beads method, were prepared with the double-digest and magnetic beads methods, and quantified with Quantifiler kit, followed by amplification with Sinofiler kit or Minifiler kit. DNA concentration extracted from the 91 highly decomposed cartilages, nails and joint capsule samples was 0-0.225 ng/microL. Sixty-two samples whose DNA concentration were more than 0.020 ng/microL had obtained 9 or more STR loci successfully. The detection rate was 68.13%. The successful rate of STR genotyping for the 3 types of decomposed tissues can be significantly improved by the double-digest and magnetic beads methods.

  6. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  7. Deficiency of Double-Strand DNA Break Repair Does Not Impair Mycobacterium tuberculosis Virulence in Multiple Animal Models of Infection

    OpenAIRE

    Heaton, Brook E.; Barkan, Daniel; Bongiorno, Paola; Karakousis, Petros C.; Glickman, Michael S.

    2014-01-01

    Mycobacterium tuberculosis persistence within its human host requires mechanisms to resist the effector molecules of host immunity, which exert their bactericidal effects through damaging pathogen proteins, membranes, and DNA. Substantial evidence indicates that bacterial pathogens, including M. tuberculosis, require DNA repair systems to repair the DNA damage inflicted by the host during infection, but the role of double-strand DNA break (DSB) repair systems is unclear. Double-strand DNA bre...

  8. DNA Damage by Ionizing Radiation: Tandem Double Lesions by Charged Particles

    Science.gov (United States)

    Huo, Winifred M.; Chaban, Galina M.; Wang, Dunyou; Dateo, Christopher E.

    2005-01-01

    Oxidative damages by ionizing radiation are the source of radiation-induced carcinogenesis, damage to the central nervous system, lowering of the immune response, as well as other radiation-induced damages to human health. Monte Carlo track simulations and kinetic modeling of radiation damages to the DNA employ available molecular and cellular data to simulate the biological effect of high and low LET radiation io the DNA. While the simulations predict single and double strand breaks and base damages, so far all complex lesions are the result of stochastic coincidence from independent processes. Tandem double lesions have not yet been taken into account. Unlike the standard double lesions that are produced by two separate attacks by charged particles or radicals, tandem double lesions are produced by one single attack. The standard double lesions dominate at the high dosage regime. On the other hand, tandem double lesions do not depend on stochastic coincidences and become important at the low dosage regime of particular interest to NASA. Tandem double lesions by hydroxyl radical attack of guanine in isolated DNA have been reported at a dosage of radiation as low as 10 Gy. The formation of two tandem base lesions was found to be linear with the applied doses, a characteristic of tandem lesions. However, tandem double lesions from attack by a charged particle have not been reported.

  9. Targeting DNA double strand break repair with hyperthermia and DNA-PKcs inhibition to enhance the effect of radiation treatment.

    Science.gov (United States)

    van Oorschot, Bregje; Granata, Giovanna; Di Franco, Simone; Ten Cate, Rosemarie; Rodermond, Hans M; Todaro, Matilde; Medema, Jan Paul; Franken, Nicolaas A P

    2016-10-04

    Radiotherapy is based on the induction of lethal DNA damage, primarily DNA double-strand breaks (DSB). Efficient DSB repair via Non-Homologous End Joining or Homologous Recombination can therefore undermine the efficacy of radiotherapy. By suppressing DNA-DSB repair with hyperthermia (HT) and DNA-PKcs inhibitor NU7441 (DNA-PKcsi), we aim to enhance the effect of radiation.The sensitizing effect of HT for 1 hour at 42°C and DNA-PKcsi [1 μM] to radiation treatment was investigated in cervical and breast cancer cells, primary breast cancer sphere cells (BCSCs) enriched for cancer stem cells, and in an in vivo human tumor model. A significant radio-enhancement effect was observed for all cell types when DNA-PKcsi and HT were applied separately, and when both were combined, HT and DNA-PKcsi enhanced radio-sensitivity to an even greater extent. Strikingly, combined treatment resulted in significantly lower survival rates, 2 to 2.5 fold increase in apoptosis, more residual DNA-DSB 6 h post treatment and a G2-phase arrest. In addition, tumor growth analysis in vivo showed significant reduction in tumor growth and elevated caspase-3 activity when radiation was combined with HT and DNA-PKcsi compared to radiation alone. Importantly, no toxic side effects of HT or DNA-PKcsi were found.In conclusion, inhibiting DNA-DSB repair using HT and DNA-PKcsi before radiotherapy leads to enhanced cytotoxicity in cancer cells. This effect was even noticed in the more radio-resistant BCSCs, which are clearly sensitized by combined treatment. Therefore, the addition of HT and DNA-PKcsi to conventional radiotherapy is promising and might contribute to more efficient tumor control and patient outcome.

  10. Normal formation and repair of γ-radiation-induced single and double strand DNA breaks in Down syndrome fibroblasts

    International Nuclear Information System (INIS)

    Steiner, M.E.; Woods, W.G.

    1982-01-01

    Fibroblasts from patients with Down syndrome (Trisomy 21) were examined for repair capability of γ-radiation-induced single strand and double strand DNA breaks. Formation and repair of DNA breaks were determined by DNA alkaline and non-denaturing elution techniques. Down syndrome fibroblasts were found to repair single strand and double strand breaks as well as fibroblasts from normal controls. (orig.)

  11. DNA hybrids suggesting a recombination process repairing radiation-induced DNA double-strand breaks in Ehrlich Ascites tumor cells

    International Nuclear Information System (INIS)

    Barthel, H.R.

    1984-01-01

    The results presented suggest the possibility of repair of DNA double-strand breaks by recombination, at least in the S and G 2 -phases of the cell cycle, in mammalian cells. Further experiments with synchronized cell cultures will have to show whether this process may also occur in the G 1 -phase of the cell cycle. (orig./AJ) [de

  12. Targeted Inactivation of DNA Photolyase Genes in Medaka Fish (Oryzias latipes).

    Science.gov (United States)

    Ishikawa-Fujiwara, Tomoko; Shiraishi, Eri; Fujikawa, Yoshihiro; Mori, Toshio; Tsujimura, Tohru; Todo, Takeshi

    2017-01-01

    Proteins of the cryptochrome/photolyase family (CPF) exhibit sequence and structural conservation, but their functions are divergent. Photolyase is a DNA repair enzyme that catalyzes the light-dependent repair of ultraviolet (UV)-induced photoproducts, whereas cryptochrome acts as a photoreceptor or circadian clock protein. Two types of DNA photolyase exist: CPD photolyase, which repairs cyclobutane pyrimidine dimers (CPDs), and 6-4 photolyase, which repairs 6-4 pyrimidine-pyrimidone photoproducts (6-4PPs). Although the Cry-DASH protein is classified as a cryptochrome, it also has light-dependent DNA repair activity. To determine the significance of the three light-dependent repair enzymes in recovering from solar UV-induced DNA damage at the organismal level, we generated mutants in each gene in medaka using the CRISPR genome editing technique. The light-dependent repair activity of the mutants was examined in vitro in cultured cells and in vivo in skin tissue. Light-dependent repair of CPD was lost in the CPD photolyase-deficient mutant, whereas weak repair activity against 6-4PPs persisted in the 6-4 photolyase-deficient mutant. These results suggest the existence of a heretofore unknown 6-4PP repair pathway and thus improve our understanding of the mechanisms of defense against solar UV in vertebrates. © 2016 The Authors. Photochemistry and Photobiology published by Wiley Periodicals, Inc. on behalf of American Society for Photobiology.

  13. DNA priming for seasonal influenza vaccine: a phase 1b double-blind randomized clinical trial.

    Directory of Open Access Journals (Sweden)

    Julie E Ledgerwood

    Full Text Available The efficacy of current influenza vaccines is limited in vulnerable populations. DNA vaccines can be produced rapidly, and may offer a potential strategy to improve vaccine immunogenicity, indicated by studies with H5 influenza DNA vaccine prime followed by inactivated vaccine boost.Four sites enrolled healthy adults, randomized to receive 2011/12 seasonal influenza DNA vaccine prime (n=65 or phosphate buffered saline (PBS (n=66 administered intramuscularly with Biojector. All subjects received the 2012/13 seasonal inactivated influenza vaccine, trivalent (IIV3 36 weeks after the priming injection. Vaccine safety and tolerability was the primary objective and measurement of antibody response by hemagglutination inhibition (HAI was the secondary objective.The DNA vaccine prime-IIV3 boost regimen was safe and well tolerated. Significant differences in HAI responses between the DNA vaccine prime and the PBS prime groups were not detected in this study.While DNA priming significantly improved the response to a conventional monovalent H5 vaccine in a previous study, it was not effective in adults using seasonal influenza strains, possibly due to pre-existing immunity to the prime, unmatched prime and boost antigens, or the lengthy 36 week boost interval. Careful optimization of the DNA prime-IIV3 boost regimen as related to antigen matching, interval between vaccinations, and pre-existing immune responses to influenza is likely to be needed in further evaluations of this vaccine strategy. In particular, testing this concept in younger age groups with less prior exposure to seasonal influenza strains may be informative.ClinicalTrials.gov NCT01498718.

  14. Measurement of anti-double-stranded DNA antibodies in major immunoglobulin classes

    Energy Technology Data Exchange (ETDEWEB)

    Aotsuka, S; Okawa, M; Ikebe, K; Yokohari, R [Division of Clinical Immunology, Clinical Research Institute, National Medical Center Hospital, Shinjuku-ku, Tokyo, Japan

    1979-07-10

    A solid-phase radioimmunoassay for quantitating anti-double-stranded deoxyribonucleic acid antibodies (anti-dsDNA) in IgG, IgM and IgA classes has been devised. A distinct feature of the method is an application of polystyrene tubes coated with poly-L-lysine, through which dsDNA could be bound firmly to a solid phase. Studies on patients sera as well as normal sera revealed that anti-dsDNA was not qualitatively but quantitatively characteristic of systematic lupus erythematosus (SLE) and that IgG anti-dsDNA levels correlated well with the disease activity.

  15. The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

    OpenAIRE

    Leem, S H; Ropp, P A; Sugino, A

    1994-01-01

    We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in ...

  16. Repair and gamma radiation-induced single- and double-strand breaks in DNA of Escherichia coli

    International Nuclear Information System (INIS)

    Petrov, S.I.

    1981-01-01

    Studies in the kinetics of repair of γ-radiation-induced single- and double-strand breaks in DNA of E. coli cells showed that double-strand DNA breaks are rejoined by the following two ways. The first way is conditioned by repair of single-strand breaks and represents the repair of ''oblique'' double-strand breaks in DNA, whereas the second way is conditioned by functioning of the recombination mechanisms and, to all appearance, represents the repair of ''direct'' double-strand breaks in DNA

  17. X-ray induced DNA double strand break production and repair in mammalian cells as measured by neutral filter elution

    Energy Technology Data Exchange (ETDEWEB)

    Bradley, M O; Kohn, K W [National Institutes of Health, Bethesda, MD (USA)

    1979-10-01

    A neutral filter elution method was used for detecting DNA double strand breaks in mouse L1210 cells after X-ray. The assay detected the number of double strand breaks induced by as little as 1000 rad of X-ray. The rate of DNA elution through the filters under neutral conditions increased with X-ray dose. Certain conditions for deproteinization, pH, and filter type were shown to increase the assay's sensitivity. Hydrogen peroxide and Bleomycin also induced apparent DNA double strand breaks, although the ratios of double to single strand breaks varied from those produced by X-ray. The introduction of double strand cuts by HpA I restriction endonuclease in DNA lysed on filters resulted in a rapid rate of elution under neutral conditions, implying that the method can detect double strand breaks if they exist in the DNA. The eluted DNA banded with a double stranded DNA marker in cesium chloride. This evidence suggested that the assay detected DNA double strand breaks. L1210 cells were shown to rejoin most of the DNA double strand breaks induced by 5-10 krad of X-ray with a half-time of about 40 minutes. (author).

  18. Postreplicational formation and repair of DNA double-strand breaks in UV-irradiated Escherichia coli uvrB cells

    International Nuclear Information System (INIS)

    Wang, Tzuchien V.; Smith, K.C.

    1986-01-01

    The number of DNA double-strand breaks formed in UV-irradiated uvrB recF recB cells correlates with the number of unrepaired DNA daughter-strand gaps, and is dependent on DNA synthesis after UV-irradiation. These results are consistent with the model that the DNA double-strand breaks that are produced in UV-irradiated excision-deficient cells occur as the result of breaks in the parental DNA opposite unrepaired DNA daughter-strand gaps. By employing a temperature-sensitive recA200 mutation, we have devised an improved assay for studying the formation and repair of these DNA double-strand breaks. Possible mechanisms for the postreplication repair of DNA double-strand breaks are discussed. (Auth.)

  19. Building of RNA and DNA double helices into electron density

    Czech Academy of Sciences Publication Activity Database

    Pavelčík, F.; Schneider, Bohdan

    2008-01-01

    Roč. 64, č. 6 (2008), s. 620-626 ISSN 0907-4449 R&D Projects: GA MŠk LC512 Grant - others:VEGA(SK) 1/2333/05; NSF(US) DBI0110076 Institutional research plan: CEZ:AV0Z40550506 Keywords : RNA * double helix * x-ray crystallography Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.943, year: 2008

  20. On the linearity of the dose-effect relationship of DNA double strand breaks

    International Nuclear Information System (INIS)

    Chadwick, K.H.; Leenhouts, H.P.

    1994-01-01

    Most radiation biologists believe that DNA double-strand breaks are induced linearly with radiation dose for all types of radiation. Since 1985, with the advent of elution and gel electrophoresis techniques which permit the measurement of DNA double-strand breaks induced in mammalian cells at doses having radiobiological relevance, the true nature of the dose-effect relationship has been brought into some doubt. Many investigators measured curvilinear dose-effect relationships and a few found good correlations between the induction of the DNA double-strand breaks and cell survival. We approach the problem pragmatically by assuming that the induction of DNA double-strand breaks by 125 I Auger electron emitters incorporated into the DNA of the cells is a linear function of the number of 125 I decays, and by comparing the dose-effect relationship for sparsely ionizing radiation against this standard. The conclusion drawn that the curvilinear dose-effect relationships and the correlations with survival are real. (Author)

  1. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells.

    Science.gov (United States)

    Kostyuk, Svetlana; Smirnova, Tatiana; Kameneva, Larisa; Porokhovnik, Lev; Speranskij, Anatolij; Ershova, Elizaveta; Stukalov, Sergey; Izevskaya, Vera; Veiko, Natalia

    2015-01-01

    Cell free DNA (cfDNA) circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA) and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci). As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR), PCNA (FACS)) and antiapoptotic genes (BCL2 (RT-PCR and FACS), BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR)). Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs). Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR), in the level of fatty acid binding protein FABP4 (FACS analysis) and in the level of fat (Oil Red O). GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose-derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis.

  2. Wave Propagation of Coupled Modes in the DNA Double Helix

    International Nuclear Information System (INIS)

    Tabi, Conrad B.; Mohamadou, Alidou; Kofane, Timoleon C.

    2010-06-01

    The dynamics of waves propagating along the DNA molecule is described by the coupled nonlinear Schroedinger equations. We consider both the single and the coupled nonlinear excitation modes, and we discuss their biological implications. Furthermore, the characteristics of the coupled mode solution are discussed and we show that such a solution can describe the local opening observed within the transcription and the replication phenomena. (author)

  3. Double strand DNA breaks response in Huntington´s disease

    Czech Academy of Sciences Publication Activity Database

    Šolc, Petr; Valášek, Jan; Rausová, Petra; Juhásová, Jana; Juhás, Štefan; Motlík, Jan

    2015-01-01

    Roč. 78, Suppl 2 (2015), s. 15-15 ISSN 1210-7859. [Conference on Animal Models for neurodegenerative Diseases /3./. 08.11.2015-10.11.2015, Liblice] R&D Projects: GA MŠk ED2.1.00/03.0124; GA MŠk(CZ) 7F14308 Institutional support: RVO:67985904 Keywords : Huntington ´s disease * DNA damage * double strand DNA breaks Subject RIV: FH - Neurology

  4. Lithium Chloride Dependent Glycogen Synthase Kinase 3 Inactivation Links Oxidative DNA Damage, Hypertrophy and Senescence in Human Articular Chondrocytes and Reproduces Chondrocyte Phenotype of Obese Osteoarthritis Patients.

    Directory of Open Access Journals (Sweden)

    Serena Guidotti

    Full Text Available Recent evidence suggests that GSK3 activity is chondroprotective in osteoarthritis (OA, but at the same time, its inactivation has been proposed as an anti-inflammatory therapeutic option. Here we evaluated the extent of GSK3β inactivation in vivo in OA knee cartilage and the molecular events downstream GSK3β inactivation in vitro to assess their contribution to cell senescence and hypertrophy.In vivo level of phosphorylated GSK3β was analyzed in cartilage and oxidative damage was assessed by 8-oxo-deoxyguanosine staining. The in vitro effects of GSK3β inactivation (using either LiCl or SB216763 were evaluated on proliferating primary human chondrocytes by combined confocal microscopy analysis of Mitotracker staining and reactive oxygen species (ROS production (2',7'-dichlorofluorescin diacetate staining. Downstream effects on DNA damage and senescence were investigated by western blot (γH2AX, GADD45β and p21, flow cytometric analysis of cell cycle and light scattering properties, quantitative assessment of senescence associated β galactosidase activity, and PAS staining.In vivo chondrocytes from obese OA patients showed higher levels of phosphorylated GSK3β, oxidative damage and expression of GADD45β and p21, in comparison with chondrocytes of nonobese OA patients. LiCl mediated GSK3β inactivation in vitro resulted in increased mitochondrial ROS production, responsible for reduced cell proliferation, S phase transient arrest, and increase in cell senescence, size and granularity. Collectively, western blot data supported the occurrence of a DNA damage response leading to cellular senescence with increase in γH2AX, GADD45β and p21. Moreover, LiCl boosted 8-oxo-dG staining, expression of IKKα and MMP-10.In articular chondrocytes, GSK3β activity is required for the maintenance of proliferative potential and phenotype. Conversely, GSK3β inactivation, although preserving chondrocyte survival, results in functional impairment via

  5. Lithium Chloride Dependent Glycogen Synthase Kinase 3 Inactivation Links Oxidative DNA Damage, Hypertrophy and Senescence in Human Articular Chondrocytes and Reproduces Chondrocyte Phenotype of Obese Osteoarthritis Patients.

    Science.gov (United States)

    Guidotti, Serena; Minguzzi, Manuela; Platano, Daniela; Cattini, Luca; Trisolino, Giovanni; Mariani, Erminia; Borzì, Rosa Maria

    2015-01-01

    Recent evidence suggests that GSK3 activity is chondroprotective in osteoarthritis (OA), but at the same time, its inactivation has been proposed as an anti-inflammatory therapeutic option. Here we evaluated the extent of GSK3β inactivation in vivo in OA knee cartilage and the molecular events downstream GSK3β inactivation in vitro to assess their contribution to cell senescence and hypertrophy. In vivo level of phosphorylated GSK3β was analyzed in cartilage and oxidative damage was assessed by 8-oxo-deoxyguanosine staining. The in vitro effects of GSK3β inactivation (using either LiCl or SB216763) were evaluated on proliferating primary human chondrocytes by combined confocal microscopy analysis of Mitotracker staining and reactive oxygen species (ROS) production (2',7'-dichlorofluorescin diacetate staining). Downstream effects on DNA damage and senescence were investigated by western blot (γH2AX, GADD45β and p21), flow cytometric analysis of cell cycle and light scattering properties, quantitative assessment of senescence associated β galactosidase activity, and PAS staining. In vivo chondrocytes from obese OA patients showed higher levels of phosphorylated GSK3β, oxidative damage and expression of GADD45β and p21, in comparison with chondrocytes of nonobese OA patients. LiCl mediated GSK3β inactivation in vitro resulted in increased mitochondrial ROS production, responsible for reduced cell proliferation, S phase transient arrest, and increase in cell senescence, size and granularity. Collectively, western blot data supported the occurrence of a DNA damage response leading to cellular senescence with increase in γH2AX, GADD45β and p21. Moreover, LiCl boosted 8-oxo-dG staining, expression of IKKα and MMP-10. In articular chondrocytes, GSK3β activity is required for the maintenance of proliferative potential and phenotype. Conversely, GSK3β inactivation, although preserving chondrocyte survival, results in functional impairment via induction of

  6. What is DNA damage? Risk of double-strand break and its individual variation

    International Nuclear Information System (INIS)

    Hanaoka, Fumio

    2011-01-01

    The author discusses about the title subject in an aspect of possible spreading of Fukushima radioactive substances mainly in eastern north area of Japan where carcinogenic incidence may be increased as the ionizing radiation injures the gene (DNA). At first, explained is that cancer is a disease of genes with infinitive proliferation of cells, there are systems to prevent it by repairing the damaged DNA and by other mechanisms like exclusion of cells damaged too much or killing cancer cells with immunity, and individual difference of the repairing capability exists. DNA is always damaged even under ordinary living conditions by sunlight UV ray, cosmic radiation and chemicals externally and by active oxygen species and thermal water movement internally. Concomitantly, DNA damaged by many mechanisms like deletion, dimmer formation, chemical modification of bases, single and double strand breaks is always repaired by concerned enzymes. Double-strand damage by high-energy radiation like gamma ray is quite risky because its repair sometimes accompanies error as concerned enzymes are from more multiple genes. There are many syndromes derived from gene deficit of those repairing enzymes. The diseases concerned with repair of the double-strand damage teach that fetus and infant are more sensitive to radiation than adult as their young body cells are more actively synthesizing DNA, during which, if DNA is injured by radiation, risk of repairing error is higher as the double strand break more frequently occurs. It cannot be simply said that a certain radiation dose limit is generally permissible. There is an individual difference of radiation sensitivity and a possible method to find out an individual weak to radiation is the lymphocyte screening in vitro using anticancer bleomycin which breaks the double strand. (T.T.)

  7. Analysis of native cellular DNA after heavy ion irradiation: DNA double-strand breaks in CHO-K1 cells

    International Nuclear Information System (INIS)

    Heilmann, J.; Taucher-Scholz, G.; Kraft, G.

    1994-11-01

    A fast assay for the detection of DNA double-strand breaks was developed involving constant field gel electrophoresis (Taucher-Scholz et al., 1994) and densitometric scanning of agarose gels stained with ethidium bromide. With this technique, DSB induction was investigated after irradiation of CHO cells with carbon ions with LET values between 14 keV/μm and 400 keV/μm. In parallel, a computer code was developed to simulate both the principle of the electrophoretic detection of DNA double-strand breaks and the action of radiations of different ionization density. The results of the experiments and the calculations are presented here and compared with each other. (orig./HSI)

  8. ATM and checkpoint responses to DNA double strand breaks

    International Nuclear Information System (INIS)

    Khanna, K.K.

    2003-01-01

    DNA damage checkpoints can be classified into G1/S, intra-S and G2/M checkpoints, so named according to the cell cycle transitions that they regulate. DNA damage incurred during the G1 or G2 phase of the cell cycle leads to growth arrest at the G1/S and G2/M phase boundaries, respectively, whereas genotoxic stress during S phase results in the transient suppression of DNA synthesis. In mammals, ATM (ataxia-telangiectasia mutated) is a protein kinase that controls all checkpoint responses to DNA damage. ATM is a versatile kinase which uses various means to regulate a given checkpoint pathway. It has been shown to act upon several proteins within the same pathway, many times controlling several different modifications of the same protein or using several different targets to arrive at the same end point. Some of the ATM targets act as adaptors by recruiting additional substrates for ATM. ATM controls two types of responses in G1. The p53-dependent responses inhibit Cyclin/Cdk activity by transcriptional induction of p21, whereas p53-independent responses inhibit CDKs through degradation of Cdc25A to maintain CdK2 inhibitory phosphorylation. In regulating p53, ATM directly phosphorylates p53 on Ser15, which likely causes p53 transcriptional activation, concurrently activating other kinases that phosphorylate p53 at other sites such as Ser20, which reduces the ability of MDM2 to bind p53, thus promoting its stability. ATM further ensures p53 stability by phosphorylating MDM2. At least six ATM targets, namely CHK2, CHK1, NBS1, BRCA1, SMC1 and FANCD2, have been implicated in the control of S-phase checkpoint. Cdc25A is the downstream effector of CHK1 and CHK2, though the underlying mechanism for control of intra S-phase checkpoint by other targets remain obscure. G2 checkpoint prevents mitotic entry solely through inhibitory phosphorylation of Cdc2/Cdk1. Several ATM targets including CHK1, CHK2, BRCA1, MDC1 and p53BP1 have been implicated in the control of G2/M

  9. DN2 Thymocytes Activate a Specific Robust DNA Damage Response to Ionizing Radiation-Induced DNA Double-Strand Breaks

    Directory of Open Access Journals (Sweden)

    Irene Calvo-Asensio

    2018-06-01

    Full Text Available For successful bone marrow transplantation (BMT, a preconditioning regime involving chemo and radiotherapy is used that results in DNA damage to both hematopoietic and stromal elements. Following radiation exposure, it is well recognized that a single wave of host-derived thymocytes reconstitutes the irradiated thymus, with donor-derived thymocytes appearing about 7 days post BMT. Our previous studies have demonstrated that, in the presence of donor hematopoietic cells lacking T lineage potential, these host-derived thymocytes are able to generate a polyclonal cohort of functionally mature peripheral T cells numerically comprising ~25% of the peripheral T cell pool of euthymic mice. Importantly, we demonstrated that radioresistant CD44+ CD25+ CD117+ DN2 progenitors were responsible for this thymic auto-reconstitution. Until recently, the mechanisms underlying the radioresistance of DN2 progenitors were unknown. Herein, we have used the in vitro “Plastic Thymus” culture system to perform a detailed investigation of the mechanisms responsible for the high radioresistance of DN2 cells compared with radiosensitive hematopoietic stem cells. Our results indicate that several aspects of DN2 biology, such as (i rapid DNA damage response (DDR activation in response to ionizing radiation-induced DNA damage, (ii efficient repair of DNA double-strand breaks, and (iii induction of a protective G1/S checkpoint contribute to promoting DN2 cell survival post-irradiation. We have previously shown that hypoxia increases the radioresistance of bone marrow stromal cells in vitro, at least in part by enhancing their DNA double-strand break (DNA DSB repair capacity. Since the thymus is also a hypoxic environment, we investigated the potential effects of hypoxia on the DDR of DN2 thymocytes. Finally, we demonstrate for the first time that de novo DN2 thymocytes are able to rapidly repair DNA DSBs following thymic irradiation in vivo.

  10. SAMHD1 Sheds Moonlight on DNA Double-Strand Break Repair.

    Science.gov (United States)

    Cabello-Lobato, Maria Jose; Wang, Siyue; Schmidt, Christine Katrin

    2017-12-01

    SAMHD1 (sterile α motif and histidine (H) aspartate (D) domain-containing protein 1) is known for its antiviral activity of hydrolysing deoxynucleotides required for virus replication. Daddacha et al. identify a hydrolase-independent, moonlighting function of SAMHD1 that facilitates homologous recombination of DNA double-strand breaks (DSBs) by promoting recruitment of C-terminal binding protein interacting protein (CTIP), a DNA-end resection factor, to damaged DNA. These findings could benefit anticancer treatment. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. Mouse RAD54 affects DNA double-strand break repair and sister chromatid exchange

    NARCIS (Netherlands)

    H.B. Beverloo (Berna); R.D. Johnson (Roger); M. Jasin (Maria); R. Kanaar (Roland); J.H.J. Hoeijmakers (Jan); M.L.G. Dronkert (Mies)

    2000-01-01

    textabstractCells can achieve error-free repair of DNA double-strand breaks (DSBs) by homologous recombination through gene conversion with or without crossover. In contrast, an alternative homology-dependent DSB repair pathway, single-strand annealing (SSA), results in deletions. In this study, we

  12. Meta-analysis of DNA double-strand break response kinetics

    NARCIS (Netherlands)

    Kochan, Jakub A.; Desclos, Emilie C. B.; Bosch, Ruben; Meister, Luna; Vriend, Lianne E. M.; Attikum, Haico V.; Krawczyk, Przemek M.

    2017-01-01

    Most proteins involved in the DNA double-strand break response (DSBR) accumulate at the damage sites, where they perform functions related to damage signaling, chromatin remodeling and repair. Over the last two decades, studying the accumulation of many DSBR proteins provided information about their

  13. Different responses to muon implantation in single- and double-stranded DNA

    International Nuclear Information System (INIS)

    Hubbard, Penny L.; Tani, Akiko; Oganesyan, Vasily S.; Butt, Julea N.; Cottrell, Stephen P.; Jayasooriya, Upali A.

    2006-01-01

    A model-free analysis of the longitudinal muon spin relaxation of muons implanted into single- and double-stranded DNA samples is reported. These samples show distinctly different responses to implanted muons with discontinuities of the integrated asymmetries at temperatures where these molecules are likely to have onset of molecular and electron dynamics

  14. REV7 counteracts DNA double-strand break resection and affects PARP inhibition

    NARCIS (Netherlands)

    Xu, Guotai; Chapman, J. Ross; Brandsma, Inger; Yuan, Jingsong; Mistrik, Martin; Bouwman, Peter; Bartkova, Jirina; Gogola, Ewa; Warmerdam, Daniël; Barazas, Marco; Jaspers, Janneke E.; Watanabe, Kenji; Pieterse, Mark; Kersbergen, Ariena; Sol, Wendy; Celie, Patrick H. N.; Schouten, Philip C.; van den Broek, Bram; Salman, Ahmed; Nieuwland, Marja; de Rink, Iris; de Ronde, Jorma; Jalink, Kees; Boulton, Simon J.; Chen, Junjie; van Gent, Dik C.; Bartek, Jiri; Jonkers, Jos; Borst, Piet; Rottenberg, Sven

    2015-01-01

    Error-free repair of DNA double-strand breaks (DSBs) is achieved by homologous recombination (HR), and BRCA1 is an important factor for this repair pathway(1). In the absence of BRCA1-mediated HR, the administration of PARP inhibitors induces synthetic lethality of tumour cells of patients with

  15. DNA double-strand break rejoining in human follicular lymphoma and glioblastoma tumor cells

    NARCIS (Netherlands)

    Macann, AMJ; Britten, RA; Poppema, S; Pearcey, R; Rosenberg, E; Allalunis-Turner, MJ; Murray, D

    2000-01-01

    Follicle center cell lymphoma is among the most radioresponsive of human cancers. To assess whether this radioresponsiveness might be a result of a compromised ability of the tumor cells to accomplish the biologically-effective repair of DNA double-strand breaks (DSBs), we have measured i) the

  16. Multiple pathways of DNA double-strand break processing in a mutant Indian muntjac cell line

    International Nuclear Information System (INIS)

    Bouffler, S.D.; Jha, B.; Johnson, R.T.

    1990-01-01

    DNA break processing is compared in the Indian muntjac cell lines, SVM and DM. The initial frequencies and resealing of X-ray generated single- and double-strand breaks are similar in the two cell lines. Inhibiting the repair of UV damage leads to greater double-strand breakage in SVM than in DM, and some of these breaks are not repaired; however, repair-associated single-strand breakage and resealing are normal. Dimethylsulfate also induces excess double-strand breakage in SVM, and these breaks are irreparable. Restricted plasmids are reconstituted correctly in SVM at approximately 30% of the frequency observed in DM. Thus SVM has a reduced capacity to repair certain types of double-strand break. This defect is not due to a DNA ligase deficiency. We conclude that DNA double-strand breaks are repaired by a variety of pathways within mammalian cells and that the structure of the break or its mode of formation determines its subsequent fate

  17. Use of RAPD and PCR double amplification in the study of ancient DNA

    Directory of Open Access Journals (Sweden)

    F. Balzano

    2011-01-01

    Full Text Available This project analysed the DNA extracted from bones of ancient sheep which have been brought to light in Sardinian different archaeological sites. In order to better analyse this highly fragmented DNA, a double amplification technique was chosen. The first approach consisted of RAPD-PCR abd the second one in classic PCR. The RAPD-PCR amplified random fragments and allowed the production of numerous amplicons. The products of RAPD amplification have been amplified, more specifically, by the second PCR using primers for a sequence of 176 bp of mitochondrial D-loop region. These DNA fragments have been sequenced and the sequence analysis has confirmed that it belonged to Ovis aries. Consequently, this provedure can be considered a valid tool to perform amplification of degraded DNA, such as ancient DNA.

  18. APOBEC3 cytidine deaminases in double-strand DNA break repair and cancer promotion.

    Science.gov (United States)

    Nowarski, Roni; Kotler, Moshe

    2013-06-15

    High frequency of cytidine to thymidine conversions was identified in the genome of several types of cancer cells. In breast cancer cells, these mutations are clustered in long DNA regions associated with single-strand DNA (ssDNA), double-strand DNA breaks (DSB), and genomic rearrangements. The observed mutational pattern resembles the deamination signature of cytidine to uridine carried out by members of the APOBEC3 family of cellular deaminases. Consistently, APOBEC3B (A3B) was recently identified as the mutational source in breast cancer cells. A3G is another member of the cytidine deaminases family predominantly expressed in lymphoma cells, where it is involved in mutational DSB repair following ionizing radiation treatments. This activity provides us with a new paradigm for cancer cell survival and tumor promotion and a mechanistic link between ssDNA, DSBs, and clustered mutations. Cancer Res; 73(12); 3494-8. ©2013 AACR. ©2013 AACR.

  19. Carbon ion induced DNA double-strand breaks in melanophore B{sub 16}

    Energy Technology Data Exchange (ETDEWEB)

    Zengquan, Wei; Guangming, Zhou; Jufang, Wang; Jing, He; Qiang, Li; Wenjian, Li; Hongmei, Xie; Xichen, Cai; Huang, Tao; Bingrong, Dang; Guangwu, Han [Chinese Academy of Sciences, Lanzhou (China). Inst. of Modern Physics; Qingxiang, Gao [Lanzhou Univ. (China)

    1997-09-01

    DNA double-strand breaks (DSBs) in melanophore B{sub 16} induced by plateau and extended Bragg peak of 75 MeV/u {sup 12}C{sup 6+} ions were studied by using a technique of inverse pulsed-field gel electrophoresis (PIGE). DNA fragment lengths were distributed in two ranges: the larger in 1.4 Mbp-3.2 Mbp and the smaller in less than 1.2 Mbp. It indicates that distribution of DNA fragments induced by heavy ion irradiation is not stochastic and there probably are sensitive sites to heavy ions in DNA molecules of B{sub 16}. Percentage of DNA released from plug (PR) increased and trended towards a quasi-plateau {proportional_to}85% as dose increased. Content of the larger fragments decreased and flattened with increasing dose while content of the smaller ones increased and trended towards saturation. (orig.)

  20. Carbon ion induced DNA double-strand breaks in melanophore B16

    International Nuclear Information System (INIS)

    Wei Zengquan; Zhou Guangming; Wang Jufang; He Jing; Li Qiang; Li Wenjian; Xie Hongmei; Cai Xichen; Tao Huang; Dang Bingrong; Han Guangwu

    1997-01-01

    DNA double-strand breaks (DSBs) in melanophore B 16 induced by plateau and extended Bragg peak of 75 MeV/u 12 C 6+ ions were studied by using a technique of inverse pulsed-field gel electrophoresis (PIGE). DNA fragment lengths were distributed in two ranges: the larger in 1.4 Mbp-3.2 Mbp and the smaller in less than 1.2 Mbp. It indicates that distribution of DNA fragments induced by heavy ion irradiation is not stochastic and there probably are sensitive sites to heavy ions in DNA molecules of B 16 . Percentage of DNA released from plug (PR) increased and trended towards a quasi-plateau ∝85% as dose increased. Content of the larger fragments decreased and flattened with increasing dose while content of the smaller ones increased and trended towards saturation. (orig.)

  1. Correlation between residual level of DNA double-strand breaks and the radiosensitivity of cancer cells

    International Nuclear Information System (INIS)

    Sun Jianxiang; Sun Weijian; Sui Jianli; Zhou Pingkun

    2008-01-01

    Objective: To understand the variation of the DNA double-strand break rejoining capacity among different cultured cancer cell lines and the primary cancer cells from brain cancer patients, and to explore the predictor of radiotherapy responses of cancers. Methods: DNA double-strand breaks (DSBs) were induced by 60 Co γ-irradiation. Pulsed-field gel electrophoresis was used to analyze the initial production and rejoining of DNA DSBs. Radiosensitivity was determined by in vitro assay of clonogenic-forming capacity. Results: A wide variation of radiosensitivity, e.g. the survival parameter of Do varied from 0.65 to 2.15 Gy, was displayed among the eight cell lines derived from different type of cancers. Although differential level of initial DNA DSBs induced by 20 Gy γ-rays was observed among various cell lines, it was not correlated with the radiosensitivity. The deficiency of DNA DSB rejoining in radiosensitive cell lines was shown either in the early rapid-rejoining phase (SX-10 cells) or in the late slow-rejoining phase (A2780 cells). A significant relationship was observed between the residual level of DNA DSBs measured at 2 h post-20 Gy irradiation and the cellular radiosensitivity (D 0 or SF 2 ). The kinetic curves of rejoining DNA DSBs in the primary human brain tumor cells indicated a variation on DSB rejoining capacity among different individual tumor. The residual level of DNA DSBs after 2 h of rejoining post 20 Gy irradiation in primary human brain tumor cells is compatible to the results obtained in vitro culture cancer cell lines. Conclusions: The residual level of DNA DSBs is correlated with radioresistance of cancer cells, and the residual DNA damage is a useful parameter in predicting the response of tumor tissue to radiotherapy. (authors)

  2. A method for filling in the cohesive ends of double-stranded DNA using Pfu DNA polymerase.

    Science.gov (United States)

    Yang, Shaohui; Li, Xin; Ding, Dongfeng; Hou, Jianhua; Jin, Zhaoxia; Yu, Xinchun; Bo, Tao; Li, Weidong; Li, Minggang

    2005-12-01

    The present paper reports a highly efficient method of making blunt ends from cohesive ends of double-stranded DNA. Klenow fragment and Pfu DNA polymerases were used to fill in the cohesive ends. Since the transformation efficiency can directly reflect the filling-in efficiency, similar ligation and transformation conditions were used, and the filling-in efficiency was compared with the corresponding transformation efficiency. The results indicate that the filling-in efficiency of Pfu DNA polymerase was 1.96 times that of Klenow fragment and its efficiency was markedly higher than that of Klenow fragment (P<0.01). The optimization experiments on reaction conditions indicate, when the pH is 8.5 and the temperature is 74 degrees C, that the filling-in efficiency was highest upon using a buffer containing 3 mM MgSO4 and 300 microM dNTP.

  3. Genetic inactivation of the Fanconi anemia gene FANCC identified in the hepatocellular carcinoma cell line HuH-7 confers sensitivity towards DNA-interstrand crosslinking agents

    Directory of Open Access Journals (Sweden)

    Bassermann Florian

    2010-05-01

    Full Text Available Abstract Background Inactivation of the Fanconi anemia (FA pathway through defects in one of 13 FA genes occurs at low frequency in various solid cancer entities among the general population. As FA pathway inactivation confers a distinct hypersensitivity towards DNA interstrand-crosslinking (ICL-agents, FA defects represent rational targets for individualized therapeutic strategies. Except for pancreatic cancer, however, the prevalence of FA defects in gastrointestinal (GI tumors has not yet been systematically explored. Results A panel of GI cancer cell lines was screened for FA pathway inactivation applying FANCD2 monoubiquitination and FANCD2/RAD51 nuclear focus formation and a newly identified FA pathway-deficient cell line was functionally characterized. The hepatocellular carcinoma (HCC line HuH-7 was defective in FANCD2 monoubiquitination and FANCD2 nuclear focus formation but proficient in RAD51 focus formation. Gene complementation studies revealed that this proximal FA pathway inactivation was attributable to defective FANCC function in HuH-7 cells. Accordingly, a homozygous inactivating FANCC nonsense mutation (c.553C > T, p.R185X was identified in HuH-7, resulting in partial transcriptional skipping of exon 6 and leading to the classic cellular FA hypersensitivity phenotype; HuH-7 cells exhibited a strongly reduced proliferation rate and a pronounced G2 cell cycle arrest at distinctly lower concentrations of ICL-agents than a panel of non-isogenic, FA pathway-proficient HCC cell lines. Upon retroviral transduction of HuH-7 cells with FANCC cDNA, FA pathway functions were restored and ICL-hypersensitivity abrogated. Analyses of 18 surgical HCC specimens yielded no further examples for genetic or epigenetic inactivation of FANCC, FANCF, or FANCG in HCC, suggesting a low prevalence of proximal FA pathway inactivation in this tumor type. Conclusions As the majority of HCC are chemoresistant, assessment of FA pathway function in HCC could

  4. A model treating the DNA double-strand break repair inhibition by damage clustering

    International Nuclear Information System (INIS)

    Rosemann, M.; Abel, H.; Regel, K.

    1992-01-01

    A microdosimetric model for the interpretation of radiation induced irreparable DNA double-strand breaks was applied to the biological endpoint of chromosomal aberrations. The model explains irreparable DNA double-strand breaks in terms of break clustering in DNA subunits. The model predicts quite good chromosomal aberrations in gamma- and X-ray irradiated V79 cells and human lymphocytes. In the case of α-particle irradiation the presumption had to be made, that only the cells with indirect events in the nucleus (due to delta-electrons) reach the metaphase and are analysed. With the help of this model we are able to explain the peculiar effectiveness of ultrasoft C-X-rays in human lymphocytes. In addition, an interpretation of experiments with accelerated and spatially correlated particles is given. (author)

  5. DNA methylation alteration is a major consequence of genome doubling in autotetraploid Brassica rapa

    Directory of Open Access Journals (Sweden)

    Xu Yanhao

    2017-01-01

    Full Text Available Polyploids are typically classified as autopolyploids or allopolyploids based on the origin of their chromosome sets. Autopolyploidy is much more common than traditionally believed. Allopolyploidization, accompanied by genomic and transcriptomic changes, has been well investigated. In this study, genetic, DNA methylation and gene expression changes in autotetraploid Brassica rapa were investigated. No genetic alteration was detected using an amplified fragment length polymorphism (AFLP approach. Using a cDNA-AFLP approach, approximately 0.58% of fragments showed changes in gene expression in autotetraploid B. rapa. The methylation-sensitive amplification polymorphism (MSAP analysis showed that approximately 1.7% of the fragments underwent DNA methylation changes upon genome doubling, with hypermethylation and demethylation changes equally affected. Fragments displaying changes in gene expression and methylation status were isolated and then sequenced and characterized, respectively. This study showed that variation in cytosine methylation is a major consequence of genome doubling in autotetraploid Brassica rapa.

  6. Human RAD18 interacts with ubiquitylated chromatin components and facilitates RAD9 recruitment to DNA double strand breaks.

    Directory of Open Access Journals (Sweden)

    Akiko Inagaki

    Full Text Available RAD18 is an ubiquitin ligase involved in replicative damage bypass and DNA double-strand break (DSB repair processes. We found that RPA is required for the dynamic pattern of RAD18 localization during the cell cycle, and for accumulation of RAD18 at sites of γ-irradiation-induced DNA damage. In addition, RAD18 colocalizes with chromatin-associated conjugated ubiquitin and ubiquitylated H2A throughout the cell cycle and following irradiation. This localization pattern depends on the presence of an intact, ubiquitin-binding Zinc finger domain. Using a biochemical approach, we show that RAD18 directly binds to ubiquitylated H2A and several other unknown ubiquitylated chromatin components. This interaction also depends on the RAD18 Zinc finger, and increases upon the induction of DSBs by γ-irradiation. Intriguingly, RAD18 does not always colocalize with regions that show enhanced H2A ubiquitylation. In human female primary fibroblasts, where one of the two X chromosomes is inactivated to equalize X-chromosomal gene expression between male (XY and female (XX cells, this inactive X is enriched for ubiquitylated H2A, but only rarely accumulates RAD18. This indicates that the binding of RAD18 to ubiquitylated H2A is context-dependent. Regarding the functional relevance of RAD18 localization at DSBs, we found that RAD18 is required for recruitment of RAD9, one of the components of the 9-1-1 checkpoint complex, to these sites. Recruitment of RAD9 requires the functions of the RING and Zinc finger domains of RAD18. Together, our data indicate that association of RAD18 with DSBs through ubiquitylated H2A and other ubiquitylated chromatin components allows recruitment of RAD9, which may function directly in DSB repair, independent of downstream activation of the checkpoint kinases CHK1 and CHK2.

  7. Temperature-dependent conformations of exciton-coupled Cy3 dimers in double-stranded DNA

    Science.gov (United States)

    Kringle, Loni; Sawaya, Nicolas P. D.; Widom, Julia; Adams, Carson; Raymer, Michael G.; Aspuru-Guzik, Alán; Marcus, Andrew H.

    2018-02-01

    Understanding the properties of electronically interacting molecular chromophores, which involve internally coupled electronic-vibrational motions, is important to the spectroscopy of many biologically relevant systems. Here we apply linear absorption, circular dichroism, and two-dimensional fluorescence spectroscopy to study the polarized collective excitations of excitonically coupled cyanine dimers (Cy3)2 that are rigidly positioned within the opposing sugar-phosphate backbones of the double-stranded region of a double-stranded (ds)-single-stranded (ss) DNA fork construct. We show that the exciton-coupling strength of the (Cy3)2-DNA construct can be systematically varied with temperature below the ds-ss DNA denaturation transition. We interpret spectroscopic measurements in terms of the Holstein vibronic dimer model, from which we obtain information about the local conformation of the (Cy3)2 dimer, as well as the degree of static disorder experienced by the Cy3 monomer and the (Cy3)2 dimer probe locally within their respective DNA duplex environments. The properties of the (Cy3)2-DNA construct we determine suggest that it may be employed as a useful model system to test fundamental concepts of protein-DNA interactions and the role of electronic-vibrational coherence in electronic energy migration within exciton-coupled bio-molecular arrays.

  8. A flexible fluorescence correlation spectroscopy based method for quantification of the DNA double labeling efficiency with precision control

    International Nuclear Information System (INIS)

    Hou, Sen; Tabaka, Marcin; Sun, Lili; Trochimczyk, Piotr; Kaminski, Tomasz S; Kalwarczyk, Tomasz; Zhang, Xuzhu; Holyst, Robert

    2014-01-01

    We developed a laser-based method to quantify the double labeling efficiency of double-stranded DNA (dsDNA) in a fluorescent dsDNA pool with fluorescence correlation spectroscopy (FCS). Though, for quantitative biochemistry, accurate measurement of this parameter is of critical importance, before our work it was almost impossible to quantify what percentage of DNA is doubly labeled with the same dye. The dsDNA is produced by annealing complementary single-stranded DNA (ssDNA) labeled with the same dye at 5′ end. Due to imperfect ssDNA labeling, the resulting dsDNA is a mixture of doubly labeled dsDNA, singly labeled dsDNA and unlabeled dsDNA. Our method allows the percentage of doubly labeled dsDNA in the total fluorescent dsDNA pool to be measured. In this method, we excite the imperfectly labeled dsDNA sample in a focal volume of <1 fL with a laser beam and correlate the fluctuations of the fluorescence signal to get the FCS autocorrelation curves; we express the amplitudes of the autocorrelation function as a function of the DNA labeling efficiency; we perform a comparative analysis of a dsDNA sample and a reference dsDNA sample, which is prepared by increasing the total dsDNA concentration c (c > 1) times by adding unlabeled ssDNA during the annealing process. The method is flexible in that it allows for the selection of the reference sample and the c value can be adjusted as needed for a specific study. We express the precision of the method as a function of the ssDNA labeling efficiency or the dsDNA double labeling efficiency. The measurement precision can be controlled by changing the c value. (letter)

  9. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Svetlana Kostyuk

    2015-01-01

    Full Text Available Background. Cell free DNA (cfDNA circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Principal Findings. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci. As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR, PCNA (FACS and antiapoptotic genes (BCL2 (RT-PCR and FACS, BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR. Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs. Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR, in the level of fatty acid binding protein FABP4 (FACS analysis and in the level of fat (Oil Red O. Conclusions. GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose—derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis.

  10. The adsorption-desorption transition of double-stranded DNA interacting with an oppositely charged dendrimer induced by multivalent anions.

    Science.gov (United States)

    Jiang, Yangwei; Zhang, Dong; Zhang, Yaoyang; Deng, Zhenyu; Zhang, Linxi

    2014-05-28

    The adsorption-desorption transition of DNA in DNA-dendrimer solutions is observed when high-valence anions, such as hexavalent anions, are added to the DNA-dendrimer solutions. In the DNA-dendrimer solutions with low-valence anions, dendrimers bind tightly with the V-shaped double-stranded DNA. When high-valence anions, such as pentavalent or hexavalent anions, are added to the DNA-dendrimer solutions, the double-stranded DNA chains can be stretched straightly and the dendrimers are released from the double-stranded DNA chains. In fact, adding high-valence anions to the solutions can change the charge spatial distribution in the DNA-dendrimer solutions, and weaken the electrostatic interactions between the positively charged dendrimers and the oppositely charged DNA chains. Adsorption-desorption transition of DNA is induced by the overcharging of dendrimers. This investigation is capable of helping us understand how to control effectively the release of DNA in gene/drug delivery because an effective gene delivery for dendrimers includes non-covalent DNA-dendrimer binding and the effective release of DNA in gene therapy.

  11. Compound Poisson Processes and Clustered Damage of Radiation Induced DNA Double Strand Breaks

    International Nuclear Information System (INIS)

    Gudowska-Nowak, E.; Ritter, S.; Taucher-Scholz, G.; Kraft, G.

    2000-01-01

    Recent experimental data have demonstrated that DNA damage induced by densely ionizing radiation in mammalian cells is distributed along the DNA molecule in the form of clusters. The principal constituent of DNA damage are double-strand breaks (DSB) which are formed when the breaks occur in both DNA strands and are directly opposite or separated by only a few base pairs. DSBs are believed to be most important lesions produced in chromosomes by radiation; interaction between DSBs can lead to cell killing, mutation or carcinogenesis. The paper discusses a model of clustered DSB formation viewed in terms of compound Poisson process along with the predictive essay of the formalism in application to experimental data. (author)

  12. Photosensitization by iodinated DNA minor groove binding ligands: Evaluation of DNA double-strand break induction and repair.

    Science.gov (United States)

    Briggs, Benjamin; Ververis, Katherine; Rodd, Annabelle L; Foong, Laura J L; Silva, Fernando M Da; Karagiannis, Tom C

    2011-05-03

    Iodinated DNA minor groove binding bibenzimidazoles represent a unique class of UVA photosensitizer and their extreme photopotency has been previously characterized. Earlier studies have included a comparison of three isomers, referred to as ortho-, meta- and para-iodoHoechst, which differ only in the location of the iodine substituent in the phenyl ring of the bibenzimidazole. DNA breakage and clonogenic survival studies in human erythroleukemic K562 cells have highlighted the higher photo-efficiency of the ortho-isomer (subsequently designated UV(A)Sens) compared to the meta- and para-isomers. In this study, the aim was to compare the induction and repair of DNA double-strand breaks induced by the three isomers in K562 cells. Further, we examined the effects of the prototypical broad-spectrum histone deacetylase inhibitor, Trichostatin A, on ortho-iodoHoechst/UVA-induced double-strand breaks in K562 cells. Using γH2AX as a molecular marker of the DNA lesions, our findings indicate a disparity in the induction and particularly, in the repair kinetics of double-strand breaks for the three isomers. The accumulation of γH2AX foci induced by the meta- and para-isomers returned to background levels within 24 and 48 h, respectively; the number of γH2AX foci induced by ortho-iodoHoechst remained elevated even after incubation for 96 h post-irradiation. These findings provide further evidence that the extreme photopotency of ortho-iodoHoechst is due to not only to the high quantum yield of dehalogenation, but also to the severity of the DNA lesions which are not readily repaired. Finally, our findings which indicate that Trichostatin A has a remarkable potentiating effect on ortho-iodoHoechst/UVA-induced DNA lesions are encouraging, particularly in the context of cutaneous T-cell lymphoma, for which a histone deacetylase inhibitor is already approved for therapy. This finding prompts further evaluation of the potential of combination therapies. Copyright © 2011

  13. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  14. How quantum entanglement in DNA synchronizes double-strand breakage by type II restriction endonucleases.

    Science.gov (United States)

    Kurian, P; Dunston, G; Lindesay, J

    2016-02-21

    Macroscopic quantum effects in living systems have been studied widely in pursuit of fundamental explanations for biological energy transport and sensing. While it is known that type II endonucleases, the largest class of restriction enzymes, induce DNA double-strand breaks by attacking phosphodiester bonds, the mechanism by which simultaneous cutting is coordinated between the catalytic centers remains unclear. We propose a quantum mechanical model for collective electronic behavior in the DNA helix, where dipole-dipole oscillations are quantized through boundary conditions imposed by the enzyme. Zero-point modes of coherent oscillations would provide the energy required for double-strand breakage. Such quanta may be preserved in the presence of thermal noise by the enzyme's displacement of water surrounding the DNA recognition sequence. The enzyme thus serves as a decoherence shield. Palindromic mirror symmetry of the enzyme-DNA complex should conserve parity, because symmetric bond-breaking ceases when the symmetry of the complex is violated or when physiological parameters are perturbed from optima. Persistent correlations in DNA across longer spatial separations-a possible signature of quantum entanglement-may be explained by such a mechanism. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Defective double-strand DNA break repair and chromosomal translocations by MYC overexpression.

    Science.gov (United States)

    Karlsson, Asa; Deb-Basu, Debabrita; Cherry, Athena; Turner, Stephanie; Ford, James; Felsher, Dean W

    2003-08-19

    DNA repair mechanisms are essential for the maintenance of genomic integrity. Disruption of gene products responsible for DNA repair can result in chromosomal damage. Improperly repaired chromosomal damage can result in the loss of chromosomes or the generation of chromosomal deletions or translocations, which can lead to tumorigenesis. The MYC protooncogene is a transcription factor whose overexpression is frequently associated with human neoplasia. MYC has not been previously implicated in a role in DNA repair. Here we report that the overexpression of MYC disrupts the repair of double-strand DNA breaks, resulting in a several-magnitude increase in chromosomal breaks and translocations. We found that MYC inhibited the repair of gamma irradiation DNA breaks in normal human cells and blocked the repair of a single double-strand break engineered to occur in an immortal cell line. By spectral karyotypic analysis, we found that MYC even within one cell division cycle resulted in a several-magnitude increase in the frequency of chromosomal breaks and translocations in normal human cells. Hence, MYC overexpression may be a previously undescribed example of a dominant mutator that may fuel tumorigenesis by inducing chromosomal damage.

  16. Methylproamine protects against ionizing radiation by preventing DNA double-strand breaks

    International Nuclear Information System (INIS)

    Sprung, Carl N.; Vasireddy, Raja S.; Karagiannis, Tom C.; Loveridge, Shanon J.; Martin, Roger F.; McKay, Michael J.

    2010-01-01

    Purpose: The majority of cancer patients will receive radiotherapy (RT), therefore, investigations into advances of this modality are important. Conventional RT dose intensities are limited by adverse responses in normal tissues and a primary goal is to ameliorate adverse normal tissue effects. The aim of these experiments is to further our understanding regarding the mechanism of radioprotection by the DNA minor groove binder, methylproamine, in a cellular context at the DNA level. Materials and methods: We used immunocytochemical methods to measure the accumulation of phosphorylated H2AX (γH2AX) foci following ionizing radiation (IR) in patient-derived lymphoblastoid cells exposed to methylproamine. Furthermore, we performed pulsed field gel electrophoresis DNA damage and repair assays to directly interrogate the action of methylproamine on DNA in irradiated cells. Results: We found that methylproamine-treated cells had fewer γH2AX foci after IR compared to untreated cells. Also, the presence of methylproamine decreased the amount of lower molecular weight DNA entering the gel as shown by the pulsed field gel electrophoresis assay. Conclusions: These results suggest that methylproamine acts by preventing the formation of DNA double-strand breaks (dsbs) and support the hypothesis that radioprotection by methylproamine is mediated, at least in part, by decreasing initial DNA damage.

  17. Pathways for double-strand break repair in genetically unstable Z-DNA-forming sequences.

    Science.gov (United States)

    Kha, Diem T; Wang, Guliang; Natrajan, Nithya; Harrison, Lynn; Vasquez, Karen M

    2010-05-14

    DNA can adopt many structures that differ from the canonical B-form, and several of these non-canonical DNA structures have been implicated in genetic instability associated with human disease. Earlier, we found that Z-DNA causes DNA double-strand breaks (DSBs) in mammalian cells that can result in large-scale deletions and rearrangements. In contrast, the same Z-DNA-forming CG repeat in Escherichia coli resulted in only small contractions or expansions within the repeat. This difference in the Z-DNA-induced mutation spectrum between mammals and bacteria might be due to different mechanisms for DSB repair; in mammalian cells, non-homologous end-joining (NHEJ) is a major DSB repair pathway, while E. coli do not contain this system and typically use homologous recombination (HR) to process DSBs. To test the extent to which the different DSB repair pathways influenced the Z-DNA-induced mutagenesis, we engineered bacterial E.coli strains to express an inducible NHEJ system, to mimic the situation in mammalian cells. Mycobacterium tuberculosis NHEJ proteins Ku and ligase D (LigD) were expressed in E.coli cells in the presence or absence of HR, and the Z-DNA-induced mutations were characterized. We found that the presence of the NHEJ mechanism markedly shifted the mutation spectrum from small deletions/insertions to large-scale deletions (from 2% to 24%). Our results demonstrate that NHEJ plays a role in the generation of Z-DNA-induced large-scale deletions, suggesting that this pathway is associated with DNA structure-induced destabilization of genomes from prokaryotes to eukaryotes. (c) 2010 Elsevier Ltd. All rights reserved.

  18. Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA

    Science.gov (United States)

    Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan

    2018-05-01

    Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.

  19. Real Estate in the DNA Damage Response: Ubiquitin and SUMO Ligases Home in on DNA Double-Strand Breaks.

    Science.gov (United States)

    Dantuma, Nico P; Pfeiffer, Annika

    2016-01-01

    Ubiquitin and the ubiquitin-like modifier SUMO are intimately connected with the cellular response to various types of DNA damage. A striking feature is the local accumulation of these proteinaceous post-translational modifications in the direct vicinity to DNA double-strand breaks, which plays a critical role in the formation of ionizing radiation-induced foci. The functional significance of these modifications is the coordinated recruitment and removal of proteins involved in DNA damage signaling and repair in a timely manner. The central orchestrators of these processes are the ubiquitin and SUMO ligases that are responsible for accurately tagging a broad array of chromatin and chromatin-associated proteins thereby changing their behavior or destination. Despite many differences in the mode of action of these enzymes, they share some striking features that are of direct relevance for their function in the DNA damage response. In this review, we outline the molecular mechanisms that are responsible for the recruitment of ubiquitin and SUMO ligases and discuss the importance of chromatin proximity in this process.

  20. In vivo formation and repair of DNA double-strand breaks after computed tomography examinations

    OpenAIRE

    Löbrich, Markus; Rief, Nicole; Kühne, Martin; Heckmann, Martina; Fleckenstein, Jochen; Rübe, Christian; Uder, Michael

    2005-01-01

    Ionizing radiation can lead to a variety of deleterious effects in humans, most importantly to the induction of cancer. DNA double-strand breaks (DSBs) are among the most significant genetic lesions introduced by ionizing radiation that can initiate carcinogenesis. We have enumerated γ-H2AX foci as a measure for DSBs in lymphocytes from individuals undergoing computed tomography examination of the thorax and/or the abdomen. The number of DSBs induced by computed tomography examination was fou...

  1. Protection by DABCO against inactivation of transforming DNA by near-ultraviolet light: action spectra and implications for involvement of singlet oxygen

    International Nuclear Information System (INIS)

    Peak, J.G.; Peak, M.J.; Foote, C.S.

    1981-01-01

    Diazobicyclo (2.2.2) octane (DABCO) protects the genetic activity of purified transforming Bacillus subtilis DNA against inactivation by near-, but not far-, UV light. The maximum dose-modifying factor is 0.4, at 0.1 M DABCO. Maximal protection is at about 350 nm and no protection occurs below 313 nm. The spectrum for protection is similar to that described for 2-aminoethylisothiouronium bromide hydrobromide. The relevance of these observations with regard to the role of singlet oxygen in near-UV effects is discussed. (author)

  2. Fine resolution mapping of double-strand break sites for human ribosomal DNA units

    Directory of Open Access Journals (Sweden)

    Bernard J. Pope

    2016-12-01

    Full Text Available DNA breakage arises during a variety of biological processes, including transcription, replication and genome rearrangements. In the context of disease, extensive fragmentation of DNA has been described in cancer cells and during early stages of neurodegeneration (Stephens et al., 2011 Stephens et al. (2011 [5]; Blondet et al., 2001 Blondet et al. (2001 [1]. Stults et al. (2009 Stults et al. (2009 [6] reported that human rDNA gene clusters are hotspots for recombination and that rDNA restructuring is among the most common chromosomal alterations in adult solid tumours. As such, analysis of rDNA regions is likely to have significant prognostic and predictive value, clinically. Tchurikov et al. (2015a, 2016 Tchurikov et al. (2015a, 2016 [7,9] have made major advances in this direction, reporting that sites of human genome double-strand breaks (DSBs occur frequently at sites in rDNA that are tightly linked with active transcription - the authors used a RAFT (rapid amplification of forum termini protocol that selects for blunt-ended sites. They reported the relative frequency of these rDNA DSBs within defined co-ordinate ‘windows’ of varying size and made these data (as well as the relevant ‘raw’ sequencing information available to the public (Tchurikov et al., 2015b. Assay designs targeting rDNA DSB hotspots will benefit greatly from the publication of break sites at greater resolution. Here, we re-analyse public RAFT data and make available rDNA DSB co-ordinates to the single-nucleotide level.

  3. Elevated Subclinical Double-Stranded DNA Antibodies and Future Proliferative Lupus Nephritis

    Science.gov (United States)

    Lee, Jessica J.; Prince, Lisa K.; Baker, Thomas P.; Papadopoulos, Patricia; Edison, Jess; Abbott, Kevin C.

    2013-01-01

    Summary Background and objectives Elevated anti–double-stranded DNA (dsDNA) antibody and C-reactive protein are associated with proliferative lupus nephritis (PLN). Progression of quantitative anti-dsDNA antibody in patients with PLN has not been compared with that in patients with systemic lupus erythematosus (SLE) without LN before diagnosis. The temporal relationship between anti-dsDNA antibody and C-reactive protein elevation has also not been evaluated. Design, setting, participants, & measurements This case-control Department of Defense Serum Repository (established in 1985) study compared longitudinal prediagnostic quantitative anti-dsDNA antibody and C-reactive protein levels in 23 patients with biopsy-proven PLN (Walter Reed Army Medical Center, 1993–2009) with levels in 21 controls with SLE but without LN matched for patient age, sex, race, and age of serum sample. The oldest (median, 2601 days; 25%, 1245 days, 75%, 3075 days), the second to last (368; 212, 635 days), and the last (180; 135, 477 days) serum sample before diagnosis were analyzed. Results More patients with PLN had an elevated anti-dsDNA antibody level than did the matched controls at any point (78% versus 5%; P4 years (33% versus 0%; P=0.04) before diagnosis. A rate of increase >1 IU/ml per year (70% versus 0%; P<0.001) was most specific for PLN. The anti-dsDNA antibody levels increased before C-reactive protein did in most patients with an antecedent elevation (92% versus 8%; P<0.001). Conclusions Elevated anti-dsDNA antibody usually precedes both clinical and subclinical evidence of proliferative LN, which suggests direct pathogenicity. Absolute anti-dsDNA antibody level and rate of increase could better establish risk of future PLN in patients with SLE. PMID:23833315

  4. The Ku heterodimer and the metabolism of single-ended DNA double-strand breaks.

    Science.gov (United States)

    Balestrini, Alessia; Ristic, Dejan; Dionne, Isabelle; Liu, Xiao Z; Wyman, Claire; Wellinger, Raymund J; Petrini, John H J

    2013-06-27

    Single-ended double-strand breaks (DSBs) are a common form of spontaneous DNA break, generated when the replisome encounters a discontinuity in the DNA template. Given their prevalence, understanding the mechanisms governing the fate(s) of single-ended DSBs is important. We describe the influence of the Ku heterodimer and Mre11 nuclease activity on processing of single-ended DSBs. Separation-of-function alleles of yku70 were derived that phenocopy Ku deficiency with respect to single-ended DSBs but remain proficient for NHEJ. The Ku mutants fail to regulate Exo1 activity, and bypass the requirement for Mre11 nuclease activity in the repair of camptothecin-induced single-ended DSBs. Ku mutants exhibited reduced affinity for DNA ends, manifest as both reduced end engagement and enhanced probability of diffusing inward on linear DNA. This study reveals an interplay between Ku and Mre11 in the metabolism of single-ended DSBs that is distinct from repair pathway choice at double-ended DSBs. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  5. The Ku Heterodimer and the Metabolism of Single-Ended DNA Double-Strand Breaks

    Directory of Open Access Journals (Sweden)

    Alessia Balestrini

    2013-06-01

    Full Text Available Single-ended double-strand breaks (DSBs are a common form of spontaneous DNA break, generated when the replisome encounters a discontinuity in the DNA template. Given their prevalence, understanding the mechanisms governing the fate(s of single-ended DSBs is important. We describe the influence of the Ku heterodimer and Mre11 nuclease activity on processing of single-ended DSBs. Separation-of-function alleles of yku70 were derived that phenocopy Ku deficiency with respect to single-ended DSBs but remain proficient for NHEJ. The Ku mutants fail to regulate Exo1 activity, and bypass the requirement for Mre11 nuclease activity in the repair of camptothecin-induced single-ended DSBs. Ku mutants exhibited reduced affinity for DNA ends, manifest as both reduced end engagement and enhanced probability of diffusing inward on linear DNA. This study reveals an interplay between Ku and Mre11 in the metabolism of single-ended DSBs that is distinct from repair pathway choice at double-ended DSBs.

  6. Inhibition of DNA-double strand break repair by antimony compounds

    International Nuclear Information System (INIS)

    Takahashi, Sentaro; Sato, Hiroshi; Kubota, Yoshihisa; Utsumi, Hiroshi; Bedford, Joel S.; Okayasu, Ryuichi

    2002-01-01

    DNA double strand breaks (DSBs), induced by γ-irradiation in Chinese hamster ovary cells, were used to examine whether antimony compounds affect the repair of DNA damage. The cells were first incubated with antimony trichloride or antimony potassium tartrate (both Sb(III)) for 2 h, and then irradiated with γ-rays at a dose of 40 Gy. The DNA DSB was quantified with pulsed field gel electrophoresis immediately after irradiation (non-repair group) as well as at 30 min post-irradiation (repair group). The degree of repair inhibition was determined by the differences in the amount of DNA DSB between non-repair and repair groups. Both antimony compounds inhibited repair of DNA DSB in a dose dependent manner. In trichloride, 0.2 mM antimony significantly inhibited the rejoining of DSB, while 0.4 mM was necessary in potassium antimony tartrate. The mean lethal doses, D 0 , for the treatment with antimony trichloride and antimony potassium tartrate, were approximately 0.21 and 0.12 mM, respectively. This indicates that the repair inhibition by antimony trichloride occurred in the dose range near D 0 , but the antimony potassium tartrate inhibited the repair at doses where most cells lost their proliferating ability. This is the first report to indicate that antimony compounds may inhibit the repair of radiation-induced DNA DSB

  7. Two pathways of DNA double-strand break repair in G1 cells of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Glazunov, A.V.

    1988-01-01

    The G1 cells of the diploid yeast Saccharomyces cerevislae are known to be capable of a slow repair of DNA double-strand breaks (DSB) during holding the cells in a non-nutrient medium. In the present paper, it has been shown that S. cerevislae cells γ-irradiated in the G1 phase of cell cycle are capable of fast repair of DNA DSB; this process is completed within 30-40 min of holding the cells in water at 28 deg C. For this reason, the kinetics of DNA DSB repair during holding the cells in a non-nutrient medium are biphasic, i.e., the first, ''fast'' phase is completed within 30-40 min; wheras the second, ''slow'' one, within 48 h. Mutations rad51, rad52, rad54 and rad55 inhibit the fast repair of DNA DSB, whereas mutations rad50, rad53 and rad57 do not practically influence this process. It has been shown that the observed fast and slow repair of DNA DSB in the G1 diploid cells of S, cerevislae are separate pathways of DNA DSB repair in yeast

  8. Ionizing-radiation induced DNA double-strand breaks: A direct and indirect lighting up

    International Nuclear Information System (INIS)

    Vignard, Julien; Mirey, Gladys; Salles, Bernard

    2013-01-01

    The occurrence of DNA double-strand breaks (DSBs) induced by ionizing radiation has been extensively studied by biochemical or cell imaging techniques. Cell imaging development relies on technical advances as well as our knowledge of the cell DNA damage response (DDR) process. The DDR involves a complex network of proteins that initiate and coordinate DNA damage signaling and repair activities. As some DDR proteins assemble at DSBs in an established spatio-temporal pattern, visible nuclear foci are produced. In addition, post-translational modifications are important for the signaling and the recruitment of specific partners at damaged chromatin foci. We briefly review here the most widely used methods to study DSBs. We also discuss the development of indirect methods, using reporter expression or intra-nuclear antibodies, to follow the production of DSBs in real time and in living cells

  9. Single-Molecule Manipulation of Double-Stranded DNA Using Optical Tweezers: Interaction Studies of DNA with RecA and YOYO-1

    NARCIS (Netherlands)

    Bennink, Martin L.; Scharer, Orlando D.; Kanaar, Ronald; Sakata-Sogawa, Kumiko; Schins, J.M.; Kanger, Johannes S.; de Grooth, B.G.; Greve, Jan

    1999-01-01

    By using optical tweezers and a specially designed flow cell with an integrated glass micropipette, we constructed a setup similar to that of Smith et al. (Science 271:795-799, 1996) in which an individual double-stranded DNA (dsDNA) molecule can be captured between two polystyrene beads. The first

  10. Immunogenicity and safety assessment of a trivalent, inactivated split influenza vaccine in Korean children: Double-blind, randomized, active-controlled multicenter phase III clinical trial.

    Science.gov (United States)

    Han, Seung Beom; Rhim, Jung-Woo; Shin, Hye Jo; Lee, Soo Young; Kim, Hyun-Hee; Kim, Jong-Hyun; Lee, Kyung-Yil; Ma, Sang Hyuk; Park, Joon Soo; Kim, Hwang Min; Kim, Chun Soo; Kim, Dong Ho; Choi, Young Youn; Cha, Sung-Ho; Hong, Young Jin; Kang, Jin Han

    2015-01-01

    A multicenter, double-blind, randomized, active-control phase III clinical trial was performed to assess the immunogenicity and safety of a trivalent, inactivated split influenza vaccine. Korean children between the ages of 6 months and 18 y were enrolled and randomized into a study (study vaccine) or a control vaccine group (commercially available trivalent, inactivated split influenza vaccine) in a 5:1 ratio. Antibody responses were determined using hemagglutination inhibition assay, and post-vaccination immunogenicity was assessed based on seroconversion and seroprotection rates. For safety assessment, solicited local and systemic adverse events up to 28 d after vaccination and unsolicited adverse events up to 6 months after vaccination were evaluated. Immunogenicity was assessed in 337 and 68 children of the study and control groups. In the study vaccine group, seroconversion rates against influenza A/H1N1, A/H3N2, and B strains were 62.0% (95% CI: 56.8-67.2), 53.4% (95% CI: 48.1-58.7), and 54.9% (95% CI: 48.1-60.2), respectively. The corresponding seroprotection rates were 95.0% (95% CI: 92.6-97.3), 93.8% (95% CI: 91.2-96.4), and 95.3% (95% CI: 93.0-97.5). The lower 95% CI limits of the seroconversion and seroprotection rates were over 40% and 70%, respectively, against all strains. Seroconversion and seroprotection rates were not significantly different between the study and control vaccine groups. Furthermore, the frequencies of adverse events were not significantly different between the 2 vaccine groups, and no serious vaccination-related adverse events were noted. In conclusion, the study vaccine exhibited substantial immunogenicity and safety in Korean children and is expected to be clinically effective.

  11. Genetic polymorphisms of DNA double-strand break repair pathway genes and glioma susceptibility

    International Nuclear Information System (INIS)

    Zhao, Peng; Zou, Peng; Zhao, Lin; Yan, Wei; Kang, Chunsheng; Jiang, Tao; You, Yongping

    2013-01-01

    Genetic variations in DNA double-strand break repair genes can influence the ability of a cell to repair damaged DNA and alter an individual’s susceptibility to cancer. We studied whether polymorphisms in DNA double-strand break repair genes are associated with an increased risk of glioma development. We genotyped 10 potentially functional single nucleotide polymorphisms (SNPs) in 7 DNA double-strand break repair pathway genes (XRCC3, BRCA2, RAG1, XRCC5, LIG4, XRCC4 and ATM) in a case–control study including 384 glioma patients and 384 cancer-free controls in a Chinese Han population. Genotypes were determined using the OpenArray platform. In the single-locus analysis there was a significant association between gliomas and the LIG4 rs1805388 (Ex2 +54C>T, Thr9Ile) TT genotype (adjusted OR, 3.27; 95% CI, 1.87-5.71), as well as the TC genotype (adjusted OR, 1.62; 95% CI, 1.20-2.18). We also found that the homozygous variant genotype (GG) of XRCC4 rs1805377 (IVS7-1A>G, splice-site) was associated with a significantly increased risk of gliomas (OR, 1.77; 95% CI, 1.12-2.80). Interestingly, we detected a significant additive and multiplicative interaction effect between the LIG4 rs1805388 and XRCC4 rs1805377 polymorphisms with an increasing risk of gliomas. When we stratified our analysis by smoking status, LIG4 rs1805388 was associated with an increased glioma risk among smokers. These results indicate for the first time that LIG4 rs1805388 and XRCC4 rs1805377, alone or in combination, are associated with a risk of gliomas

  12. Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Nigel C. Brissett

    2013-11-01

    Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

  13. UVA-induced DNA double-strand breaks result from the repair of clustered oxidative DNA damages

    Science.gov (United States)

    Greinert, R.; Volkmer, B.; Henning, S.; Breitbart, E. W.; Greulich, K. O.; Cardoso, M. C.; Rapp, Alexander

    2012-01-01

    UVA (320–400 nm) represents the main spectral component of solar UV radiation, induces pre-mutagenic DNA lesions and is classified as Class I carcinogen. Recently, discussion arose whether UVA induces DNA double-strand breaks (dsbs). Only few reports link the induction of dsbs to UVA exposure and the underlying mechanisms are poorly understood. Using the Comet-assay and γH2AX as markers for dsb formation, we demonstrate the dose-dependent dsb induction by UVA in G1-synchronized human keratinocytes (HaCaT) and primary human skin fibroblasts. The number of γH2AX foci increases when a UVA dose is applied in fractions (split dose), with a 2-h recovery period between fractions. The presence of the anti-oxidant Naringin reduces dsb formation significantly. Using an FPG-modified Comet-assay as well as warm and cold repair incubation, we show that dsbs arise partially during repair of bi-stranded, oxidative, clustered DNA lesions. We also demonstrate that on stretched chromatin fibres, 8-oxo-G and abasic sites occur in clusters. This suggests a replication-independent formation of UVA-induced dsbs through clustered single-strand breaks via locally generated reactive oxygen species. Since UVA is the main component of solar UV exposure and is used for artificial UV exposure, our results shine new light on the aetiology of skin cancer. PMID:22941639

  14. Lethal effects of 32P decay on transfecting activity of Bacillus subtillis phage phie DNA

    International Nuclear Information System (INIS)

    Loveday, K.S.

    1979-01-01

    Disintegration of 32 P present in the DNA of Bacillus subtilis phage phie (a phage containing double-strand DNA) results in the loss of viability of intact phage as well as transfecting activity of isolated DNA. Only 1/12 of the 32 P disintegrations per phage DNA equivalent inactivities the intact phage while nearly every disintegration inactivates the transfecting DNA. This result provides evidence for a single-strand intermediate in the transfection of B. subtilis by phie DNA

  15. Comparative study of DNA encapsulation into PLGA microparticles using modified double emulsion methods and spray drying techniques.

    Science.gov (United States)

    Oster, C G; Kissel, T

    2005-05-01

    Recently, several research groups have shown the potential of microencapsulated DNA as adjuvant for DNA immunization and in tissue engineering approaches. Among techniques generally used for microencapsulation of hydrophilic drug substances into hydrophobic polymers, modified WOW double emulsion method and spray drying of water-in-oil dispersions take a prominent position. The key parameters for optimized microspheres are particle size, encapsulation efficiency, continuous DNA release and stabilization of DNA against enzymatic and mechanical degradation. This study investigates the possibility to encapsulate DNA avoiding shear forces which readily degrade DNA during this microencapsulation. DNA microparticles were prepared with polyethylenimine (PEI) as a complexation agent for DNA. Polycations are capable of stabilizing DNA against enzymatic, as well as mechanical degradation. Further, complexation was hypothesized to facilitate the encapsulation by reducing the size of the macromolecule. This study additionally evaluated the possibility of encapsulating lyophilized DNA and lyophilized DNA/PEI complexes. For this purpose, the spray drying and double emulsion techniques were compared. The size of the microparticles was characterized by laser diffractometry and the particles were visualized by scanning electron microscopy (SEM). DNA encapsulation efficiencies were investigated photometrically after complete hydrolysis of the particles. Finally, the DNA release characteristics from the particles were studied. Particles with a size of <10 microm which represent the threshold for phagocytic uptake could be prepared with these techniques. The encapsulation efficiency ranged from 100-35% for low theoretical DNA loadings. DNA complexation with PEI 25?kDa prior to the encapsulation process reduced the initial burst release of DNA for all techniques used. Spray-dried particles without PEI exhibited high burst releases, whereas double emulsion techniques showed continuous

  16. Repair pathways for heavy ion-induced complex DNA double strand breaks

    International Nuclear Information System (INIS)

    Yajima, Hirohiko; Nakajima, Nakako; Hirakawa, Hirokazu; Murakami, Takeshi; Okayasu, Ryuichi; Fujimori, Akira

    2012-01-01

    DNA double strand break (DSB) induced by ionizing radiation (IR) is a deleterious damage leading to cell death and genome instability if not properly repaired. It is well known that DSB is repaired by two major pathways, non-homologous end-joining (NHEJ) and homologous recombination (HR). It is also known that NHEJ is dominant throughout the cell cycle after X- or gamma-ray irradiation in mammalian cells, Meanwhile, it is thought that heavy-ion radiation (e.g., carbon-ions, iron-ions) gives rise to clustered DNA damages consisting of not only strand breaks but also aberrant bases in the vicinity of DSBs (complex DSBs). Our previous work suggested that the efficiency of NHEJ is diminished for repair of complex DSBs induced by heavy-ion radiation. We thought that this difficulty in NHEJ process associated with heavy ion induced complex DNA damage might be extended to HR process in cells exposed to heavy ions. In order to find out if this notion is true or not, exposed human cells to X-rays and heavy-ions, and studied HR associated processes at the molecular level. Our result indicates that complex DSBs induced by heavy ions effectively evoke DNA end resection activity during the HR process. Together with our results, a relevant recent progress in the field of DNA DSB repair will be discussed. (author)

  17. Sequence specific electronic conduction through polyion-stabilized double-stranded DNA in nanoscale break junctions

    International Nuclear Information System (INIS)

    Mahapatro, Ajit K; Jeong, Kyung J; Lee, Gil U; Janes, David B

    2007-01-01

    This paper presents a study of sequence specific electronic conduction through short (15-base-pair) double-stranded (ds) DNA molecules, measured by immobilizing 3 ' -thiol-derivatized DNAs in nanometre scale gaps between gold electrodes. The polycation spermidine was used to stabilize the ds-DNA structure, allowing electrical measurements to be performed in a dry state. For specific sequences, the conductivity was observed to scale with the surface density of immobilized DNA, which can be controlled by the buffer concentration. A series of 15-base DNA oligonucleotide pairs, in which the centre sequence of five base pairs was changed from G:C to A:T pairs, has been studied. The conductivity per molecule is observed to decrease exponentially with the number of adjacent A:T pairs replacing G:C pairs, consistent with a barrier at the A:T sites. Conductance-based devices for short DNA sequences could provide sensing approaches with direct electrical readout, as well as label-free detection

  18. Thermodynamics for the Formation of Double-Stranded DNA-Single-Walled Carbon Nanotube Hybrids.

    Science.gov (United States)

    Shiraki, Tomohiro; Tsuzuki, Akiko; Toshimitsu, Fumiyuki; Nakashima, Naotoshi

    2016-03-24

    For the first time, the thermodynamics are described for the formation of double-stranded DNA (ds-DNA)-single-walled carbon nanotube (SWNT) hybrids. This treatment is applied to the exchange reaction of sodium cholate (SC) molecules on SWNTs and the ds-DNAs d(A)20 -d(T)20 and nuclear factor (NF)-κB decoy. UV/Vis/near-IR spectroscopy with temperature variations was used for analyzing the exchange reaction on the SWNTs with four different chiralities: (n,m)=(8,3), (6,5), (7,5), and (8,6). Single-stranded DNAs (ss-DNAs), including d(A)20 and d(T)20, are also used for comparison. The d(A)20-d(T)20 shows a drastic change in its thermodynamic parameters around the melting temperature (Tm ) of the DNA oligomer. No such Tm dependency was measured, owing to high Tm in the NF-κB decoy DNA and no Tm in the ss-DNA. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Mycobacterial nonhomologous end joining mediates mutagenic repair of chromosomal double-strand DNA breaks.

    Science.gov (United States)

    Stephanou, Nicolas C; Gao, Feng; Bongiorno, Paola; Ehrt, Sabine; Schnappinger, Dirk; Shuman, Stewart; Glickman, Michael S

    2007-07-01

    Bacterial nonhomologous end joining (NHEJ) is a recently described DNA repair pathway best characterized in mycobacteria. Bacterial NHEJ proteins LigD and Ku have been analyzed biochemically, and their roles in linear plasmid repair in vivo have been verified genetically; yet the contributions of NHEJ to repair of chromosomal DNA damage are unknown. Here we use an extensive set of NHEJ- and homologous recombination (HR)-deficient Mycobacterium smegmatis strains to probe the importance of HR and NHEJ in repairing diverse types of chromosomal DNA damage. An M. smegmatis Delta recA Delta ku double mutant has no apparent growth defect in vitro. Loss of the NHEJ components Ku and LigD had no effect on sensitivity to UV radiation, methyl methanesulfonate, or quinolone antibiotics. NHEJ deficiency had no effect on sensitivity to ionizing radiation in logarithmic- or early-stationary-phase cells but was required for ionizing radiation resistance in late stationary phase in 7H9 but not LB medium. In addition, NHEJ components were required for repair of I-SceI mediated chromosomal double-strand breaks (DSBs), and in the absence of HR, the NHEJ pathway rapidly mutates the chromosomal break site. The molecular outcomes of NHEJ-mediated chromosomal DSB repair involve predominantly single-nucleotide insertions at the break site, similar to previous findings using plasmid substrates. These findings demonstrate that prokaryotic NHEJ is specifically required for DSB repair in late stationary phase and can mediate mutagenic repair of homing endonuclease-generated chromosomal DSBs.

  20. Evidence for multiple repair pathways of double-strand DNA breaks in Chinese hamster cells

    International Nuclear Information System (INIS)

    Giaccia, A.J.; Weistein, R.; Stamato, T.D.; Roosa, R.

    1984-01-01

    XR-1 is a mutant of the Chinese hamster cell (CHO-K1) which is abnormally sensitive to killing by gamma rays in G/sub 1/ (D37 = 27 rads vs. 318 for parent) and early S phases of the cell cycle but has near normal resistance in late S and early G/sub 2/ (Somatic Cell Genetics, 9:165-173, 1983). Complementation studies between XR-1 and its parent indicate that this sensitivity to gamma rays is a recessive phenotype. Both the XR-1 and its parent cell are able to repair single strand DNA breaks. However, in comparison to its parental cell, the XR-1 cell is markedly deficient in the repair of double strand DNA breaks introduced by gamma irradiation during the sensitive G/sub 1/-early S period, while in the late S-G/sub 2/ resistant period the repair is similar in both cells. This correlation suggests that an unrepaired double strand DNA break is the lethal lesion and that at least two pathways for the repair of these lesions exist in mammalian cells

  1. Calibration of pulsed field gel electrophoresis for measurement of DNA double-strand breaks

    International Nuclear Information System (INIS)

    Ager, D.D.; Dewey, W.C.

    1990-01-01

    Pulsed field gel electrophoresis (PFGE) assay was calibrated for the measurement of X-ray induced DNA double-strand breaks in Chinese hamster ovary (CHO) cells. Calibration was conducted by incorporating [ 125 I] deoxyuridine into DNA, which induces one double-strand break for every disintegration that occurs in frozen cells. Based on the percentage of DNA migrating into the gel, the number of breaks/dalton/Gy was estimated to be (9.3±1.0) x 10 -12 . This value is close to (10 to 12) x 10 -12 determined by neutral filter elution using similar cell lysis procedures at 24 o C and at pH8.0. The estimate is in good agreement with the value of (11.7±2) x 10 -12 breaks/dalton/Gy as measured in Ehrlich ascites tumour cells using the neutral sucrose gradient method (Bloecher 1988), and (6 to 9) x 10 -12 breaks/dalton/Gy as measured in mouse L and Chinese hamster V79 cells using neutral filter elution (Radford and Hodgson 1985). (author)

  2. DNA double strand breaks in the acute phase after synchrotron pencilbeam irradiation

    International Nuclear Information System (INIS)

    Fernandez-Palomo, C; Trippel, M; Schroll, C; Nikkhah, G; Schültke, E; Bräuer-Krisch, E; Requardt, H; Bartzsch, S

    2013-01-01

    Introduction. At the biomedical beamline of the European Synchrotron Radiation Facility (ESRF), we have established a method to study pencilbeam irradiation in-vivoin small animal models. The pencilbeam irradiation technique is based on the principle of microbeam irradiation, a concept of spatially fractionated high-dose irradiation. Using γH2AX as marker, we followed the development of DNA double strand breaks over 48 hrs after whole brain irradiation with the pencilbeam technique. Method. Almost square pencilbeams with an individual size of 51 × 50 μm were produced with an MSC collimator using a step and shoot approach, while the animals were moved vertically through the beam. The center-to-center distance (ctc) was 400 μm, with a peak-to-valley dose ratio (PVDR) of about 400. Five groups of healthy adult mice received peak irradiation doses of either 330 Gy or 2,460 Gy and valley doses of 0.82 Gy and 6.15 Gy, respectively. Animals were sacrificed at 2, 12 and 48 hrs after irradiation. Results. DNA double strand breaks are observed in the path of the pencilbeam. The size of the damaged volume undergoes changes within the first 48 hours after irradiation. Conclusions. The extent of DNA damage caused by pencilbeam irradiation, as assessed by H2AX antibody staining, is dose- dependent

  3. The Molecular Basis of Double-Strand DNA Break Repair: The Critical Structure of the RAD52/RPA Complex

    National Research Council Canada - National Science Library

    Jackson, Dobra

    2001-01-01

    .... RAD52 has specific interactions with RAD51, RPA and DNA (1,2,3). The binding of RAD52 to ends of double-strand breaks has been found to be a key initiation step to DNA repair by homologous recombination...

  4. Combined Triplex/Duplex Invasion of Double-Stranded DNA by "Tail-Clamp" Peptide Nucleic Acid

    DEFF Research Database (Denmark)

    Bentin, Thomas; Larsen, H. J.; Nielsen, Peter E.

    2003-01-01

    as determined by T-m measurements. Binding to double-stranded (ds) DNA occurred by combined triplex and duplex invasion as analyzed by permanganate probing. Furthermore, C-50 measurements revealed that tail-clamp PNAs consistently bound the dsDNA target more efficiently, and kinetics experiments revealed...

  5. Use of orthogonal field alternational gel electrophoresis (OFAGE) for studying DNA double strand breakage and repair

    International Nuclear Information System (INIS)

    Contopoulou, C.R.; Cook, V.; Mortimer, R.K.

    1987-01-01

    The study of DNA double strand breakage and repair has normally been carried by using neutral sucrose gradient or neutral elution techniques. The authors have applied OFAGE procedures to study x-ray induced double strand breaks and repair. Breakage of chromosomes is seen by a decrease in intensity of individual chromosome bands; as expected, this decrease becomes more pronounced as chromosome size increases. The fragments of broken chromosomes appears as a broad smear in the size range 100 kb to 1000 kb. Following repair, these fragments partially disappear and the chromosomal bands increase in intensity. In four repair deficient mutants, rad51, rad52, rad54, rad55, no increase in chromosomal band intensity was seen. These results have been confirmed by blotting for a specific chromosome

  6. Importance of the efficiency of double-stranded DNA formation in cDNA synthesis for the imprecision of microarray expression analysis.

    Science.gov (United States)

    Thormar, Hans G; Gudmundsson, Bjarki; Eiriksdottir, Freyja; Kil, Siyoen; Gunnarsson, Gudmundur H; Magnusson, Magnus Karl; Hsu, Jason C; Jonsson, Jon J

    2013-04-01

    The causes of imprecision in microarray expression analysis are poorly understood, limiting the use of this technology in molecular diagnostics. Two-dimensional strandness-dependent electrophoresis (2D-SDE) separates nucleic acid molecules on the basis of length and strandness, i.e., double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), and RNA·DNA hybrids. We used 2D-SDE to measure the efficiency of cDNA synthesis and its importance for the imprecision of an in vitro transcription-based microarray expression analysis. The relative amount of double-stranded cDNA formed in replicate experiments that used the same RNA sample template was highly variable, ranging between 0% and 72% of the total DNA. Microarray experiments showed an inverse relationship between the difference between sample pairs in probe variance and the relative amount of dsDNA. Approximately 15% of probes showed between-sample variation (P cDNA synthesized can be an important component of the imprecision in T7 RNA polymerase-based microarray expression analysis. © 2013 American Association for Clinical Chemistry

  7. More efficient repair of DNA double-strand breaks in skeletal muscle stem cells compared to their committed progeny

    OpenAIRE

    Leyla Vahidi Ferdousi; Pierre Rocheteau; Romain Chayot; Benjamin Montagne; Zayna Chaker; Patricia Flamant; Shahragim Tajbakhsh; Miria Ricchetti

    2014-01-01

    International audience; The loss of genome integrity in adult stem cells results in accelerated tissue aging and is possibly cancerogenic. Adult stem cells in different tissues appear to react robustly to DNA damage. We report that adult skeletal stem (satellite) cells do not primarily respond to radiation-induced DNA double-strand breaks (DSBs) via differentiation and exhibit less apoptosis compared to other myogenic cells. Satellite cells repair these DNA lesions more efficiently than their...

  8. Evaluation of the neutral comet assay for detection of alpha-particle induced DNA-double-strand-breaks

    International Nuclear Information System (INIS)

    Hofbauer, Daniela

    2010-01-01

    Aim of this study was to differentiate DNA-double-strand-breaks from DNA-single-strand-breaks on a single cell level, using the comet assay after α- and γ-irradiation. Americium-241 was used as a alpha-irradiation-source, Caesium-137 was used for γ-irradiation. Because of technical problems with both the neutral and alkaline comet assay after irradiation of gastric cancer cells and human lymphocytes, no definite differentiation of DNA-damage was possible.

  9. Radiation-induced DNA double strand breaks in Ehrlich ascites tumour cells and their possible effects on cell survival

    International Nuclear Information System (INIS)

    Bloecher, D.

    1981-01-01

    A method to prepare high-molecular, pure DNA with the aid of enzymes, detergents, and heat treatment is presented. A sedimentation technique with neutral density gradients has been introduced which permits mass separation and molecular mass analysis of high-molecular DNA (msub(r) 10 ). Using this method, the induction of DNA double strand breaks (DSB) in the dose range between 10 Gy [de

  10. hnRNP-U is a specific DNA-dependent protein kinase substrate phosphorylated in response to DNA double-strand breaks

    International Nuclear Information System (INIS)

    Berglund, Fredrik M.; Clarke, Paul R.

    2009-01-01

    Cellular responses to DNA damage are orchestrated by the large phosphoinositol-3-kinase related kinases ATM, ATR and DNA-PK. We have developed a cell-free system to dissect the biochemical mechanisms of these kinases. Using this system, we identify heterogeneous nuclear ribonucleoprotein U (hnRNP-U), also termed scaffold attachment factor A (SAF-A), as a specific substrate for DNA-PK. We show that hnRNP-U is phosphorylated at Ser59 by DNA-PK in vitro and in cells in response to DNA double-strand breaks. Phosphorylation of hnRNP-U suggests novel functions for DNA-PK in the response to DNA damage.

  11. A role for small RNAs in DNA double-strand break repair

    DEFF Research Database (Denmark)

    Wei, W.; Ba, Z.; Wu, Y.

    2012-01-01

    Eukaryotes have evolved complex mechanisms to repair DNA double-strand breaks (DSBs) through coordinated actions of protein sensors, transducers, and effectors. Here we show that ∼21-nucleotide small RNAs are produced from the sequences in the vicinity of DSB sites in Arabidopsis and in human cells....... We refer to these as diRNAs for DSB-induced small RNAs. In Arabidopsis, the biogenesis of diRNAs requires the PI3 kinase ATR, RNA polymerase IV (Pol IV), and Dicer-like proteins. Mutations in these proteins as well as in Pol V cause significant reduction in DSB repair efficiency. In Arabidopsis, di...

  12. Biological defense mechanisms against DNA double-strand break and their possible medical applications

    International Nuclear Information System (INIS)

    Matsumoto, Yoshihisa

    2011-01-01

    Radiation is now widely used for clinical diagnosis and therapeutics. On the other hand, radiation influences various tissues represented by immunological and reproductive systems, and is also recognized as one of the cause of carcinogenesis. Such pleiotropic effects of radiation are mediated through generation of damages on DNA molecule, vitally important genetic macromolecule. Among various types of DNA damages, double-strand break (DSB) is considered most critical and, therefore, responsible for biological effects. DSB is repaired mainly through two pathways: non-homologous end joining (NHEJ) and homologous recombination (HR). Understanding of these mechanisms has been greatly deepened in past 20 years and is now providing a promising approach toward cancer therapy. We have studied the mechanisms of NHEJ, focusing especially on the role of phosphorylation and the assembly of machinery therein, which will be introduced below. (author)

  13. Double-stranded DNA-dependent ATPase Irc3p is directly involved in mitochondrial genome maintenance.

    Science.gov (United States)

    Sedman, Tiina; Gaidutšik, Ilja; Villemson, Karin; Hou, YingJian; Sedman, Juhan

    2014-12-01

    Nucleic acid-dependent ATPases are involved in nearly all aspects of DNA and RNA metabolism. Previous studies have described a number of mitochondrial helicases. However, double-stranded DNA-dependent ATPases, including translocases or enzymes remodeling DNA-protein complexes, have not been identified in mitochondria of the yeast Saccharomyces cerevisae. Here, we demonstrate that Irc3p is a mitochondrial double-stranded DNA-dependent ATPase of the Superfamily II. In contrast to the other mitochondrial Superfamily II enzymes Mss116p, Suv3p and Mrh4p, which are RNA helicases, Irc3p has a direct role in mitochondrial DNA (mtDNA) maintenance. Specific Irc3p-dependent mtDNA metabolic intermediates can be detected, including high levels of double-stranded DNA breaks that accumulate in irc3Δ mutants. irc3Δ-related topology changes in rho- mtDNA can be reversed by the deletion of mitochondrial RNA polymerase RPO41, suggesting that Irc3p counterbalances adverse effects of transcription on mitochondrial genome stability. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Quantitation of the repair of gamma-radiation-induced double-strand DNA breaks in human fibroblasts

    International Nuclear Information System (INIS)

    Woods, W.G.

    1981-01-01

    The quantitation and repair of double-strand DNA breaks in human fibroblasts has been determined using a method involving the nondenaturing elution of DNA from a filter. DNA from cells from two human fibroblast lines exposed to γ-radiation from 0 to 10000 rad showed increasing retention on a filter with decreasing radiation dose, and the data suggest a linear relationship between double-strand breaks induced and radiation dose. The ability of normal human fibroblasts to repair double-strand breaks with various doses of radiation was demonstrated, with a tsub(1/2) of 10 min for repair of 5000 rad exposure and 39 min for repair of 10000 rad damage. The kinetics of the DNA rejoining were not linear and suggest that, as in the repair of single-strand breaks, both an initial fast and a later slow mechanism may be involved. (Auth.)

  15. Cascade of chromosomal rearrangements caused by a heterogeneous T-DNA integration supports the double-stranded break repair model for T-DNA integration.

    Science.gov (United States)

    Hu, Yufei; Chen, Zhiyu; Zhuang, Chuxiong; Huang, Jilei

    2017-06-01

    Transferred DNA (T-DNA) from Agrobacterium tumefaciens can be integrated into the plant genome. The double-stranded break repair (DSBR) pathway is a major model for T-DNA integration. From this model, we expect that two ends of a T-DNA molecule would invade into a single DNA double-stranded break (DSB) or independent DSBs in the plant genome. We call the later phenomenon a heterogeneous T-DNA integration, which has never been observed. In this work, we demonstrated it in an Arabidopsis T-DNA insertion mutant seb19. To resolve the chromosomal structural changes caused by T-DNA integration at both the nucleotide and chromosome levels, we performed inverse PCR, genome resequencing, fluorescence in situ hybridization and linkage analysis. We found, in seb19, a single T-DNA connected two different chromosomal loci and caused complex chromosomal rearrangements. The specific break-junction pattern in seb19 is consistent with the result of heterogeneous T-DNA integration but not of recombination between two T-DNA insertions. We demonstrated that, in seb19, heterogeneous T-DNA integration evoked a cascade of incorrect repair of seven DSBs on chromosomes 4 and 5, and then produced translocation, inversion, duplication and deletion. Heterogeneous T-DNA integration supports the DSBR model and suggests that two ends of a T-DNA molecule could be integrated into the plant genome independently. Our results also show a new origin of chromosomal abnormalities. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  16. True Lies: The Double Life of the Nucleotide Excision Repair Factors in Transcription and DNA Repair

    Directory of Open Access Journals (Sweden)

    Nicolas Le May

    2010-01-01

    Full Text Available Nucleotide excision repair (NER is a major DNA repair pathway in eukaryotic cells. NER removes structurally diverse lesions such as pyrimidine dimers, arising upon UV irradiation or bulky chemical adducts, arising upon exposure to carcinogens and some chemotherapeutic drugs. NER defects lead to three genetic disorders that result in predisposition to cancers, accelerated aging, neurological and developmental defects. During NER, more than 30 polypeptides cooperate to recognize, incise, and excise a damaged oligonucleotide from the genomic DNA. Recent papers reveal an additional and unexpected role for the NER factors. In the absence of a genotoxic attack, the promoters of RNA polymerases I- and II-dependent genes recruit XPA, XPC, XPG, and XPF to initiate gene expression. A model that includes the growth arrest and DNA damage 45α protein (Gadd45α and the NER factors, in order to maintain the promoter of active genes under a hypomethylated state, has been proposed but remains controversial. This paper focuses on the double life of the NER factors in DNA repair and transcription and describes the possible roles of these factors in the RNA synthesis process.

  17. Nanoneedle insertion into the cell nucleus does not induce double-strand breaks in chromosomal DNA.

    Science.gov (United States)

    Ryu, Seunghwan; Kawamura, Ryuzo; Naka, Ryohei; Silberberg, Yaron R; Nakamura, Noriyuki; Nakamura, Chikashi

    2013-09-01

    An atomic force microscope probe can be formed into an ultra-sharp cylindrical shape (a nanoneedle) using micro-fabrication techniques such as focused ion beam etching. This nanoneedle can be effectively inserted through the plasma membrane of a living cell to not only access the cytosol, but also to penetrate through the nuclear membrane. This technique shows great potential as a tool for performing intranuclear measurements and manipulations. Repeated insertions of a nanoneedle into a live cell were previously shown not to affect cell viability. However, the effect of nanoneedle insertion on the nucleus and nuclear components is still unknown. DNA is the most crucial component of the nucleus for proper cell function and may be physically damaged by a nanoneedle. To investigate the integrity of DNA following nanoneedle insertion, the occurrence of DNA double-strand breaks (DSBs) was assessed. The results showed that there was no chromosomal DNA damage due to nanoneedle insertion into the nucleus, as indicated by the expression level of γ-H2AX, a molecular marker of DSBs. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  18. Virtual Cross-Linking of the Active Nemorubicin Metabolite PNU-159682 to Double-Stranded DNA.

    Science.gov (United States)

    Scalabrin, Matteo; Quintieri, Luigi; Palumbo, Manlio; Riccardi Sirtori, Federico; Gatto, Barbara

    2017-02-20

    The DNA alkylating mechanism of PNU-159682 (PNU), a highly potent metabolite of the anthracycline nemorubicin, was investigated by gel-electrophoretic, HPLC-UV, and micro-HPLC/mass spectrometry (MS) measurements. PNU quickly reacted with double-stranded oligonucleotides, but not with single-stranded sequences, to form covalent adducts which were detectable by denaturing polyacrylamide gel electrophoresis (DPAGE). Ion-pair reverse-phase HPLC-UV analysis on CG rich duplex sequences having a 5'-CCCGGG-3' central core showed the formation of two types of adducts with PNU, which were stable and could be characterized by micro-HPLC/MS. The first type contained one alkylated species (and possibly one reversibly bound species), and the second contained two alkylated species per duplex DNA. The covalent adducts were found to produce effective bridging of DNA complementary strands through the formation of virtual cross-links reminiscent of those produced by classical anthracyclines in the presence of formaldehyde. Furthermore, the absence of reactivity of PNU with CG-rich sequence containing a TA core (CGTACG), and the minor reactivity between PNU and CGC sequences (TACGCG·CGCGTA) pointed out the importance of guanine sequence context in modulating DNA alkylation.

  19. Analysis of DNA double-strand break repair pathways in mice

    International Nuclear Information System (INIS)

    Brugmans, Linda; Kanaar, Roland; Essers, Jeroen

    2007-01-01

    During the last years significant new insights have been gained into the mechanism and biological relevance of DNA double-strand break (DSB) repair in relation to genome stability. DSBs are a highly toxic DNA lesion, because they can lead to chromosome fragmentation, loss and translocations, eventually resulting in cancer. DSBs can be induced by cellular processes such as V(D)J recombination or DNA replication. They can also be introduced by exogenous agents DNA damaging agents such as ionizing radiation or mitomycin C. During evolution several pathways have evolved for the repair of these DSBs. The most important DSB repair mechanisms in mammalian cells are nonhomologous end-joining and homologous recombination. By using an undamaged repair template, homologous recombination ensures accurate DSB repair, whereas the untemplated nonhomologous end-joining pathway does not. Although both pathways are active in mammals, the relative contribution of the two repair pathways to genome stability differs in the different cell types. Given the potential differences in repair fidelity, it is of interest to determine the relative contribution of homologous recombination and nonhomologous end-joining to DSB repair. In this review, we focus on the biological relevance of DSB repair in mammalian cells and the potential overlap between nonhomologous end-joining and homologous recombination in different tissues

  20. Quantification and genome-wide mapping of DNA double-strand breaks.

    Science.gov (United States)

    Grégoire, Marie-Chantal; Massonneau, Julien; Leduc, Frédéric; Arguin, Mélina; Brazeau, Marc-André; Boissonneault, Guylain

    2016-12-01

    DNA double-strand breaks (DSBs) represent a major threat to the genetic integrity of the cell. Knowing both their genome-wide distribution and number is important for a better assessment of genotoxicity at a molecular level. Available methods may have underestimated the extent of DSBs as they are based on markers specific to those undergoing active repair or may not be adapted for the large diversity of naturally occurring DNA ends. We have established conditions for an efficient first step of DNA nick and gap repair (NGR) allowing specific determination of DSBs by end labeling with terminal transferase. We used DNA extracted from HeLa cells harboring an I-SceI cassette to induce a targeted nick or DSB and demonstrated by immunocapture of 3'-OH that a prior step of NGR allows specific determination of loci-specific or genome wide DSBs. This method can be applied to the global determination of DSBs using radioactive end labeling and can find several applications aimed at understanding the distribution and kinetics of DSBs formation and repair. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. DNA double strand breaks and Hsp70 expression in proton irradiated living cells

    International Nuclear Information System (INIS)

    Fiedler, Anja; Reinert, Tilo; Tanner, Judith; Butz, Tilman

    2007-01-01

    DNA double strand breaks (DSBs) in living cells can be directly provoked by ionising radiation. DSBs can be visualized by immunostaining the phosphorylated histone γH2AX. Our concern was to test the feasibility of γH2AX staining for a direct visualization of single proton hits. If single protons produce detectable foci, DNA DSBs could be used as 'biological track detectors' for protons. Ionising radiation can also damage proteins indirectly by inducing free radicals. Heat shock proteins (Hsp) help to refold or even degrade the damaged proteins. The level of the most famous heat shock protein Hsp70 is increased by ionising radiation. We investigated the expression of γH2AX and Hsp70 after cross and line patterned irradiation with counted numbers of 2.25 MeV protons on primary human skin fibroblasts. The proton induced DSBs appear more delocalised than it was expected by the ion hit accuracy. Cooling the cells before the irradiation reduces the delocalisation of DNA DSBs, which is probably caused by the reduced diffusion of DNA damaging agents. Proton irradiation seems to provoke protein damages mainly in the cytoplasm indicated by cytoplasmic Hsp70 aggregates. On the contrary, in control heat shocked cells the Hsp70 was predominantly localized in the cell nucleus. However, the irradiated area could not be recognized, all cells on the Si 3 N 4 window showed a homogenous Hsp70 expression pattern

  2. DNA double strand breaks and Hsp70 expression in proton irradiated living cells

    Energy Technology Data Exchange (ETDEWEB)

    Fiedler, Anja [Institute for Experimental Physics II, University of Leipzig (Germany) and Faculty of Biology, Pharmacy and Psychology, University of Leipzig (Germany)]. E-mail: afiedler@uni-leipzig.de; Reinert, Tilo [Institute for Experimental Physics II, University of Leipzig (Germany); Tanner, Judith [Clinic and Polyclinic for Radiation Oncology, University of Halle-Wittenberg (Germany); Butz, Tilman [Institute for Experimental Physics II, University of Leipzig (Germany)

    2007-07-15

    DNA double strand breaks (DSBs) in living cells can be directly provoked by ionising radiation. DSBs can be visualized by immunostaining the phosphorylated histone {gamma}H2AX. Our concern was to test the feasibility of {gamma}H2AX staining for a direct visualization of single proton hits. If single protons produce detectable foci, DNA DSBs could be used as 'biological track detectors' for protons. Ionising radiation can also damage proteins indirectly by inducing free radicals. Heat shock proteins (Hsp) help to refold or even degrade the damaged proteins. The level of the most famous heat shock protein Hsp70 is increased by ionising radiation. We investigated the expression of {gamma}H2AX and Hsp70 after cross and line patterned irradiation with counted numbers of 2.25 MeV protons on primary human skin fibroblasts. The proton induced DSBs appear more delocalised than it was expected by the ion hit accuracy. Cooling the cells before the irradiation reduces the delocalisation of DNA DSBs, which is probably caused by the reduced diffusion of DNA damaging agents. Proton irradiation seems to provoke protein damages mainly in the cytoplasm indicated by cytoplasmic Hsp70 aggregates. On the contrary, in control heat shocked cells the Hsp70 was predominantly localized in the cell nucleus. However, the irradiated area could not be recognized, all cells on the Si{sub 3}N{sub 4} window showed a homogenous Hsp70 expression pattern.

  3. The occurrence of double strand DNA breaks is not the sole condition for meiotic crossing over in Drosophila melanogaster.

    Science.gov (United States)

    Portin, P; Rantanen, M

    2000-01-01

    Analysis of the interchromosomal effects of In(2L + 2R)Cy, In(3L + 3R)LVM and their joint effect on the frequencies of single and double crossovers in the cv-v-f region of the X chromosome as well as interference showed that both inversions, occurring separately, increased the frequency of single as well as double crossovers and the coefficient of coincidence. However, when the inversions occurred together the frequencies of single crossovers no longer increased, but the frequency of double crossovers, as well as the coefficient of coincidence did increase. These results indicate firstly that the interchromosomal effects influence some precondition of exchange, but that this precondition is not an occurrence of double strand DNA breaks. Thus, the occurrence of double strand DNA breaks is not the sole condition for crossing over in Drosophila melanogaster.

  4. R/L, a double reporter mouse line that expresses luciferase gene upon Cre-mediated excision, followed by inactivation of mRFP expression.

    Science.gov (United States)

    Jia, Junshuang; Lin, Xiaolin; Lin, Xia; Lin, Taoyan; Chen, Bangzhu; Hao, Weichao; Cheng, Yushuang; Liu, Yu; Dian, Meijuan; Yao, Kaitai; Xiao, Dong; Gu, Weiwang

    2016-10-01

    The Cre/loxP system has become an important tool for the conditional gene knockout and conditional gene expression in genetically engineered mice. The applications of this system depend on transgenic reporter mouse lines that provide Cre recombinase activity with a defined cell type-, tissue-, or developmental stage-specificity. To develop a sensitive assay for monitoring Cre-mediated DNA excisions in mice, we generated Cre-mediated excision reporter mice, designated R/L mice (R/L: mRFP(monomeric red fluorescent protein)/luciferase), express mRFP throughout embryonic development and adult stages, while Cre-mediated excision deletes a loxP-flanked mRFP reporter gene and STOP sequence, thereby activating the expression of the second reporter gene luciferase, as assayed by in vivo and ex vivo bioluminescence imaging. After germ line deletion of the floxed mRFP and STOP sequence in R/L mice by EIIa-Cre mice, the resulting luciferase transgenic mice in which the loxP-mRFP-STOP-loxP cassette is excised from all cells express luciferase in all tissues and organs examined. The expression of luciferase transgene was activated in liver of RL/Alb-Cre double transgenic mice and in brain of RL/Nestin-Cre double transgenic mice when R/L reporter mice were mated with Alb-Cre mice and Nestin-Cre mice, respectively. Our findings reveal that the double reporter R/L mouse line is able to indicate the occurrence of Cre-mediated excision from early embryonic to adult lineages. Taken together, these findings demonstrate that the R/L mice serve as a sensitive reporter for Cre-mediated DNA excision both in living animals and in organs, tissues, and cells following necropsy.

  5. DNA-dependent protein kinase (DAN-PK), a key enzyme in the re-ligation of DNA double-strand breaks

    International Nuclear Information System (INIS)

    Hennequin, C.; Averbeck, D.

    1999-01-01

    Repair pathways of DNA are now defined and some important findings have been discovered in the last few years. DNA non-homologous end-joining (NEH) is a crucial process in the repair of radiation-induced double-strand breaks (DSBs). NHEj implies at least three steps: the DNA free-ends must get closer, preparation of the free-ends by exonucleases and then a transient hybridization in a region of DNA with weak homology. DNA-dependent protein kinase (DNA-PK) is the key enzyme in this process. DNA-PK is a nuclear serine/threonine kinase that comprises three components: a catalytic subunit (DNA-PK cs ) and two regulatory subunits, DNA-binding proteins, Ku80 and Ku70. The severe combined immuno-deficient (scid) mice are deficient in DNA-PK cs : this protein is involved both in DNA repair and in the V(D)J recombination of immunoglobulin and T-cell receptor genes. It is a protein-kinase of the P13-kinase family and which can phosphorylate Ku proteins, p53 and probably some other proteins still unknown. DNA-PK is an important actor of DSBs repair (induced by ionising radiations or by drugs like etoposide), but obviously it is not the only mechanism existing in the cell for this function. Some others, like homologous recombination, seem also to have a great importance for cell survival. (authors)

  6. DnaC inactivation in Escherichia coli K-12 induces the SOS response and expression of nucleotide biosynthesis genes

    DEFF Research Database (Denmark)

    Løbner-Olesen, Anders; Slominska-Wojewodzka, Monika; Hansen, Flemming G.

    2008-01-01

    Background: Initiation of chromosome replication in E. coli requires the DnaA and DnaC proteins and conditionally-lethal dnaA and dnaC mutants are often used to synchronize cell populations. Methodology/Principal Findings: DNA microarrays were used to measure mRNA steady-state levels in initiatio......C genes was increased at the non-permissive temperature in the respective mutant strains indicating auto-regulation of both genes. Induction of the SOS regulon was observed in dnaC2 cells at 38 degrees C and 42 degrees C. Flow cytometric analysis revealed that dnaC2 mutant cells at non......-permissive temperature had completed the early stages of chromosome replication initiation. Conclusion/Significance: We suggest that in dnaC2 cells the SOS response is triggered by persistent open-complex formation at oriC and/or by arrested forks that require DnaC for replication restart....

  7. Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

    Science.gov (United States)

    Phan, Anh Tuân; Mergny, Jean-Louis

    2002-01-01

    Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

  8. Protection against {sup 131}I-induced Double Strand DNA Breaks in Thyroid Cells

    Energy Technology Data Exchange (ETDEWEB)

    Hershman, J.M.; Okunyan, A.; Cannon, S.; Hogen, V. [Endocrinology, UCLA-VA, Los Angeles (United States); Rivina, Y. [Radiation Biology, UCLA, Los Angeles (United States)

    2012-07-01

    Radioiodine-131 (I{sup 131}) released from nuclear reactor accidents has dramatically increased the incidence of papillary thyroid cancer in exposed individuals, especially young children. The accepted measure for prevention of radiation-induced thyroid cancer is potassium iodide tablets that contain 100 mg iodide taken daily to block thyroid uptake of I{sup 131}. The deposition of ionizing radiation in cells results in double-strand DNA breaks (DSB) at fragile sites, and this early event can generate oncogenic rearrangements that eventually cause the cancer. We have developed a thyroid cell model to quantify the mitogenic effect of I{sup 131}. I{sup 131} causes double strand DNA breaks in FRTL-5 cells detected by 53BP1 or gamma H2AX and had no effect on cells that do not transport iodide. Perchlorate, iodide, and thiocyanate protect against DSB induced by I{sup 131}. Preincubation with the anion or radioprotective compounds prevents DSB; delayed addition of the anion is much less effective. These data provide a basis for studies of radioprotection against DSB induced by I{sup 131} in animals in order to refine the prevention of thyroid cancer resulting from nuclear fallout

  9. In vitro inactivation of Chlamydia trachomatis and of a panel of DNA (HSV-2, CMV, adenovirus, BK virus) and RNA (RSV, enterovirus) viruses by the spermicide benzalkonium chloride.

    Science.gov (United States)

    Bélec, L; Tevi-Benissan, C; Bianchi, A; Cotigny, S; Beumont-Mauviel, M; Si-Mohamed, A; Malkin, J E

    2000-11-01

    Kinetics of inactivation by the detergent spermicide benzalkonium chloride (BZK) of Chlamydia trachomatis and of a panel of DNA viruses [herpes simplex virus hominis type 2 (HSV-2), cytomegalovirus (CMV), adenovirus (ADV) and BK virus (BKV)] and RNA [respiratory syncytial virus (RSV) and enterovirus (ENV)] were established in accordance with a standardized in vitro protocol. After a 5 min incubation, inactivation of >95% of HSV-2 and CMV was obtained at a concentration of 0.0025% (w/v) (25 Ig/L); concentrations as low as 0.0005%, 0.0050% and 0.0125%, induced a 3.0 log10 reduction in infectivity of HSV-2 and CMV, RSV and ADV, respectively. After a 60 min incubation, concentrations of 0.0125% and 0.050% provided a 3.0 log10 reduction in infectivity of ENV and BKV, respectively. These features indicate that sensitivity to BZK was very high (HSV-2 and CMV) or high (RSV) for enveloped viruses, intermediate (ADV) or low (ENV and BKV) for non-enveloped viruses. Furthermore, BZK had marked antichlamydial activity, showing >99% killing after only a 1 min incubation at a concentration of 0.00125%. BZK demonstrates potent in vitro activity against the majority of microorganisms causing sexually transmitted infectious diseases, including those acting as major genital cofactors of human immunodeficiency virus transmission. These attributes qualify BZK as a particularly attractive candidate for microbicide development.

  10. MO-AB-BRA-04: Radiation Measurements with a DNA Double-Strand-Break Dosimeter

    International Nuclear Information System (INIS)

    Obeidat, M; Cline, K; Stathakis, S; Papanikolaou, N; Rasmussen, K; Gutierrez, A; Ha, CS; Lee, SE; Shim, EY; Kirby, N

    2016-01-01

    Purpose: Many types of dosimeters are used to measure radiation, but none of them directly measures the biological effect of this dose. The purpose here is to create a dosimeter that can measure the probability of double-strand breaks (DSB) for DNA, which is directly related to the biological effect of radiation. Methods: The dosimeter has DNA strands, which are labeled on one end with biotin and on the other with fluorescein. The biotin attaches these strands to magnetic beads. We suspended the DNA dosimeter in phosphate-buffered saline (PBS) as it matches the internal environment of the body. We placed small volumes (50µL) of the DNA dosimeter into tubes and irradiated these samples in a water-equivalent plastic phantom with several doses (three samples per dose). After irradiating the samples, a magnet was placed against the tubes. The fluorescein attached to broken DNA strands was extracted (called the supernatant) and placed into a different tube. The fluorescein on the unbroken strands remained attached to the beads in the tube and was re-suspended with 50µL of PBS. A fluorescence reader was used to measure the fluorescence for both the re-suspended beads and supernatant. To prove that we are measuring DSB, we tested dosimeter response with two different lengths of attached DNA strands (1 and 4 kilo-base pair). Results: The probability of DSB at the dose levels of 5, 10, 25, and 50 Gy were 0.05, 0.08, 0.12, and 0.19, respectively, while the coefficients of variation were 0.14, 0.07, 0.02, and 0.01, respectively. The 4 kilo-base-pair dosimeter produced 5.3 times the response of the 1 kilo-base-pair dosimeter. Conclusion: The DNA dosimeter yields a measurable response to dose that scales with the DNA strand length. The goal now is to refine the dosimeter fabrication to reproducibly create a low coefficient of variation for the lower doses. This work was supported in part by Yarmouk University (Irbid, Jordan) and CPRIT (RP140105)

  11. MO-AB-BRA-04: Radiation Measurements with a DNA Double-Strand-Break Dosimeter

    Energy Technology Data Exchange (ETDEWEB)

    Obeidat, M; Cline, K; Stathakis, S; Papanikolaou, N; Rasmussen, K; Gutierrez, A; Ha, CS; Lee, SE; Shim, EY; Kirby, N [University of Texas HSC SA, San Antonio, TX (United States)

    2016-06-15

    Purpose: Many types of dosimeters are used to measure radiation, but none of them directly measures the biological effect of this dose. The purpose here is to create a dosimeter that can measure the probability of double-strand breaks (DSB) for DNA, which is directly related to the biological effect of radiation. Methods: The dosimeter has DNA strands, which are labeled on one end with biotin and on the other with fluorescein. The biotin attaches these strands to magnetic beads. We suspended the DNA dosimeter in phosphate-buffered saline (PBS) as it matches the internal environment of the body. We placed small volumes (50µL) of the DNA dosimeter into tubes and irradiated these samples in a water-equivalent plastic phantom with several doses (three samples per dose). After irradiating the samples, a magnet was placed against the tubes. The fluorescein attached to broken DNA strands was extracted (called the supernatant) and placed into a different tube. The fluorescein on the unbroken strands remained attached to the beads in the tube and was re-suspended with 50µL of PBS. A fluorescence reader was used to measure the fluorescence for both the re-suspended beads and supernatant. To prove that we are measuring DSB, we tested dosimeter response with two different lengths of attached DNA strands (1 and 4 kilo-base pair). Results: The probability of DSB at the dose levels of 5, 10, 25, and 50 Gy were 0.05, 0.08, 0.12, and 0.19, respectively, while the coefficients of variation were 0.14, 0.07, 0.02, and 0.01, respectively. The 4 kilo-base-pair dosimeter produced 5.3 times the response of the 1 kilo-base-pair dosimeter. Conclusion: The DNA dosimeter yields a measurable response to dose that scales with the DNA strand length. The goal now is to refine the dosimeter fabrication to reproducibly create a low coefficient of variation for the lower doses. This work was supported in part by Yarmouk University (Irbid, Jordan) and CPRIT (RP140105)

  12. Radiation-induced double-strand breaks in mammalian DNA: influence of temperature and DMSO.

    Science.gov (United States)

    Elmroth, K; Nygren, J; Erkell, L J; Hultborn, R

    2000-11-01

    To investigate the effects of subphysiological irradiation temperature (2 28 degrees C) and the influence of the radical scavenger DMSO on the induction of double-strand breaks (DSB) in chromosomal DNA from a human breast cancer cell line (MCF-7) as well as in intact cells. The rejoining of DSB in cells irradiated at 2 degrees C or 37 degrees C was also investigated. Agarose plugs with [14C]thymidine labelled MCF-7 cells were lysed in EDTA-NLS-proteinase-K buffer. The plugs containing chromosomal DNA were irradiated with X-rays under different temperatures and scavenging conditions. Intact MCF-7 cells were irradiated in Petri dishes and plugs were made. The cells were then lysed in EDTA-NLS-proteinase-K buffer. The induction of DSB was studied by constant field gel electrophoresis and expressed as DSB/100/Mbp, calculated from the fraction of activity released into the gel. The induction of DSB in chromosomal DNA was reduced by a decrease in temperature. This protective effect of low temperature was inhibited when the DNA was irradiated in the presence of DMSO. No difference was found when intact cells were irradiated at different temperatures. However, the rapid phase of rejoining was slower in cells irradiated at 37 degrees C than at 2 degrees C. The induction of DSB in naked DNA was reduced by hypothermic irradiation. The temperature had no influence on the induction of DSB in the presence of a high concentration of DMSO, indicating that the temperature effect is mediated via the indirect effects of ionizing radiation. Results are difficult to interpret in intact cells. Rejoining during irradiation at the higher temperature may counteract an increased induction. The difference in rejoining may be interpreted in terms of qualitative differences between breaks induced at the two temperatures.

  13. Accumulation of DNA Double-Strand Breaks in Normal Tissues After Fractionated Irradiation

    International Nuclear Information System (INIS)

    Ruebe, Claudia E.; Fricke, Andreas; Wendorf, Juliane; Stuetzel, Annika; Kuehne, Martin; Ong, Mei Fang; Lipp, Peter; Ruebe, Christian

    2010-01-01

    Purpose: There is increasing evidence that genetic factors regulating the recognition and/or repair of DNA double-strand breaks (DSBs) are responsible for differences in radiosensitivity among patients. Genetically defined DSB repair capacities are supposed to determine patients' individual susceptibility to develop adverse normal tissue reactions after radiotherapy. In a preclinical murine model, we analyzed the impact of different DSB repair capacities on the cumulative DNA damage in normal tissues during the course of fractionated irradiation. Material and Methods: Different strains of mice with defined genetic backgrounds (SCID -/- homozygous, ATM -/- homozygous, ATM +/- heterozygous, and ATM +/+ wild-type mice) were subjected to single (2 Gy) or fractionated irradiation (5 x 2 Gy). By enumerating γH2AX foci, the formation and rejoining of DSBs were analyzed in organs representative of both early-responding (small intestine) and late-responding tissues (lung, kidney, and heart). Results: In repair-deficient SCID -/- and ATM -/- homozygous mice, large proportions of radiation-induced DSBs remained unrepaired after each fraction, leading to the pronounced accumulation of residual DNA damage after fractionated irradiation, similarly visible in early- and late-responding tissues. The slight DSB repair impairment of ATM +/- heterozygous mice was not detectable after single-dose irradiation but resulted in a significant increase in unrepaired DSBs during the fractionated irradiation scheme. Conclusions: Radiation-induced DSBs accumulate similarly in acute- and late-responding tissues during fractionated irradiation, whereas the whole extent of residual DNA damage depends decisively on the underlying genetically defined DSB repair capacity. Moreover, our data indicate that even minor impairments in DSB repair lead to exceeding DNA damage accumulation during fractionated irradiation and thus may have a significant impact on normal tissue responses in clinical

  14. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  15. Inhibition of APOBEC3G activity impedes double-stranded DNA repair.

    Science.gov (United States)

    Prabhu, Ponnandy; Shandilya, Shivender M D; Britan-Rosich, Elena; Nagler, Adi; Schiffer, Celia A; Kotler, Moshe

    2016-01-01

    The cellular cytidine deaminase APOBEC3G (A3G) was first described as an anti-HIV-1 restriction factor, acting by directly deaminating reverse transcripts of the viral genome. HIV-1 Vif neutralizes the activity of A3G, primarily by mediating degradation of A3G to establish effective infection in host target cells. Lymphoma cells, which express high amounts of A3G, can restrict Vif-deficient HIV-1. Interestingly, these cells are more stable in the face of treatments that result in double-stranded DNA damage, such as ionizing radiation and chemotherapies. Previously, we showed that the Vif-derived peptide (Vif25-39) efficiently inhibits A3G deamination, and increases the sensitivity of lymphoma cells to ionizing radiation. In the current study, we show that additional peptides derived from Vif, A3G, and APOBEC3F, which contain the LYYF motif, inhibit deamination activity. Each residue in the Vif25-39 sequence moderately contributes to the inhibitory effect, whereas replacing a single residue in the LYYF motif completely abrogates inhibition of deamination. Treatment of A3G-expressing lymphoma cells exposed to ionizing radiation with the new inhibitory peptides reduces double-strand break repair after irradiation. Incubation of cultured irradiated lymphoma cells with peptides that inhibit double-strand break repair halts their propagation. These results suggest that A3G may be a potential therapeutic target that is amenable to peptide and peptidomimetic inhibition. © 2015 FEBS.

  16. DNA Double Strand Break Response and Limited Repair Capacity in Mouse Elongated Spermatids

    Directory of Open Access Journals (Sweden)

    Emad A. Ahmed

    2015-12-01

    Full Text Available Spermatids are extremely sensitive to genotoxic exposures since during spermiogenesis only error-prone non homologous end joining (NHEJ repair pathways are available. Hence, genomic damage may accumulate in sperm and be transmitted to the zygote. Indirect, delayed DNA fragmentation and lesions associated with apoptotic-like processes have been observed during spermatid elongation, 27 days after irradiation. The proliferating spermatogonia and early meiotic prophase cells have been suggested to retain a memory of a radiation insult leading later to this delayed fragmentation. Here, we used meiotic spread preparations to localize phosphorylate histone H2 variant (γ-H2AX foci marking DNA double strand breaks (DSBs in elongated spermatids. This technique enabled us to determine the background level of DSB foci in elongated spermatids of RAD54/RAD54B double knockout (dko mice, severe combined immunodeficiency SCID mice, and poly adenosine diphosphate (ADP-ribose polymerase 1 (PARP1 inhibitor (DPQ-treated mice to compare them with the appropriate wild type controls. The repair kinetics data and the protein expression patterns observed indicate that the conventional NHEJ repair pathway is not available for elongated spermatids to repair the programmed and the IR-induced DSBs, reflecting the limited repair capacity of these cells. However, although elongated spermatids express the proteins of the alternative NHEJ, PARP1-inhibition had no effect on the repair kinetics after IR, suggesting that DNA damage may be passed onto sperm. Finally, our genetic mutant analysis suggests that an incomplete or defective meiotic recombinational repair of Spo11-induced DSBs may lead to a carry-over of the DSB damage or induce a delayed nuclear fragmentation during the sensitive programmed chromatin remodeling occurring in elongated spermatids.

  17. Electrolytic reduction of nitroheterocyclic drugs leads to biologically important damage in DNA

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Pluijmackers-Westmijze, E.J.; Loman, H.

    1985-01-01

    The effects of electrolytic reduction of nitroimidazole drugs on biologically active DNA was studied. The results show that reduction of the drugs in the presence of DNA affects inactivation for both double-stranded (RF) and single-stranded phiX174 DNA. However, stable reduction products did not make a significant contribution to the lethal damage in DNA. This suggests that probably a short-lived intermediate of reduction of nitro-compounds is responsible for damage to DNA. (author)

  18. Zinc Finger Nuclease induced DNA double stranded breaks and rearrangements in MLL

    International Nuclear Information System (INIS)

    Do, To Uyen; Ho, Bay; Shih, Shyh-Jen; Vaughan, Andrew

    2012-01-01

    Highlights: ► A Zinc Finger Nuclease (ZFN) targeting a leukemogenic hot spot for rearrangement in MLL is created. ► The novel ZFN efficiently cleaves MLL exon 13. ► Despite MLL cleavage and evidence of mis-repair, no leukemogenic translocations were produced. ► MLL cleavage alone is insufficient to generate leukemogenic translocations. - Abstract: Radiation treatment or chemotherapy has been linked with a higher risk of secondary cancers such as therapy related Acute Myeloid Leukemia (tAML). Several of these cancers have been shown to be correlated to the introduction of double stranded breaks (DSB) and rearrangements within the Mixed Lineage Leukemia (MLL) gene. We used Zinc Finger Nucleases (ZFNs) to introduce precise cuts within MLL to examine how a single DNA DSB might lead to chromosomal rearrangements. A ZFN targeting exon 13 within the Breakpoint Cluster Region of MLL was transiently expressed in a human lymphoblast cell line originating from a CML patient. Although FISH analysis showed ZFN DSB at this region increased the rate of MLL fragmentation, we were unable to detect leukemogenic rearrangements or translocations via inverse PCR. Interestingly, gene fragmentation as well as small interstitial deletions, insertions and base substitutions increased with the inhibition of DNA-PK, suggesting repair of this particular DSB is linked to non-homologous end joining (NHEJ). Although mis-repair of DSBs may be necessary for the initiation of leukemogenic translocations, a MLL targeted DNA break alone is insufficient

  19. Fine-tuning the ubiquitin code at DNA double-strand breaks: deubiquitinating enzymes at work

    Directory of Open Access Journals (Sweden)

    Elisabetta eCitterio

    2015-09-01

    Full Text Available Ubiquitination is a reversible protein modification broadly implicated in cellular functions. Signaling processes mediated by ubiquitin are crucial for the cellular response to DNA double-strand breaks (DSBs, one of the most dangerous types of DNA lesions. In particular, the DSB response critically relies on active ubiquitination by the RNF8 and RNF168 ubiquitin ligases at the chromatin, which is essential for proper DSB signaling and repair. How this pathway is fine-tuned and what the functional consequences are of its deregulation for genome integrity and tissue homeostasis are subject of intense investigation. One important regulatory mechanism is by reversal of substrate ubiquitination through the activity of specific deubiquitinating enzymes (DUBs, as supported by the implication of a growing number of DUBs in DNA damage response (DDR processes. Here, we discuss the current knowledge of how ubiquitin-mediated signaling at DSBs is controlled by deubiquitinating enzymes, with main focus on DUBs targeting histone H2A and on their recent implication in stem cell biology and cancer.

  20. Zinc Finger Nuclease induced DNA double stranded breaks and rearrangements in MLL

    Energy Technology Data Exchange (ETDEWEB)

    Do, To Uyen [Graduate Group in Immunology, University of California Davis, Davis, CA 95616 (United States); Department of Radiation Oncology, University of California Davis, Sacramento CA 95817 (United States); Ho, Bay; Shih, Shyh-Jen [Department of Radiation Oncology, University of California Davis, Sacramento CA 95817 (United States); Vaughan, Andrew, E-mail: Andrew.vaughan@ucdmc.ucdavis.edu [Graduate Group in Immunology, University of California Davis, Davis, CA 95616 (United States); Department of Radiation Oncology, University of California Davis, Sacramento CA 95817 (United States)

    2012-12-15

    Highlights: ► A Zinc Finger Nuclease (ZFN) targeting a leukemogenic hot spot for rearrangement in MLL is created. ► The novel ZFN efficiently cleaves MLL exon 13. ► Despite MLL cleavage and evidence of mis-repair, no leukemogenic translocations were produced. ► MLL cleavage alone is insufficient to generate leukemogenic translocations. - Abstract: Radiation treatment or chemotherapy has been linked with a higher risk of secondary cancers such as therapy related Acute Myeloid Leukemia (tAML). Several of these cancers have been shown to be correlated to the introduction of double stranded breaks (DSB) and rearrangements within the Mixed Lineage Leukemia (MLL) gene. We used Zinc Finger Nucleases (ZFNs) to introduce precise cuts within MLL to examine how a single DNA DSB might lead to chromosomal rearrangements. A ZFN targeting exon 13 within the Breakpoint Cluster Region of MLL was transiently expressed in a human lymphoblast cell line originating from a CML patient. Although FISH analysis showed ZFN DSB at this region increased the rate of MLL fragmentation, we were unable to detect leukemogenic rearrangements or translocations via inverse PCR. Interestingly, gene fragmentation as well as small interstitial deletions, insertions and base substitutions increased with the inhibition of DNA-PK, suggesting repair of this particular DSB is linked to non-homologous end joining (NHEJ). Although mis-repair of DSBs may be necessary for the initiation of leukemogenic translocations, a MLL targeted DNA break alone is insufficient.

  1. Electromagnetic and optical characteristics of Nb5+-doped double-crossover and salmon DNA thin films

    Science.gov (United States)

    Babu Mitta, Sekhar; Reddy Dugasani, Sreekantha; Jung, Soon-Gil; Vellampatti, Srivithya; Park, Tuson; Park, Sung Ha

    2017-10-01

    We report the fabrication and physical characteristics of niobium ion (Nb5+)-doped double-crossover DNA (DX-DNA) and salmon DNA (SDNA) thin films. Different concentrations of Nb5+ ([Nb5+]) are coordinated into the DNA molecules, and the thin films are fabricated via substrate-assisted growth (DX-DNA) and drop-casting (SDNA) on oxygen plasma treated substrates. We conducted atomic force microscopy to estimate the optimum concentration of Nb5+ ([Nb5+]O = 0.08 mM) in Nb5+-doped DX-DNA thin films, up to which the DX-DNA lattices maintain their structures without deformation. X-ray photoelectron spectroscopy (XPS) was performed to probe the chemical nature of the intercalated Nb5+ in the SDNA thin films. The change in peak intensities and the shift in binding energy were witnessed in XPS spectra to explicate the binding and charge transfer mechanisms between Nb5+ and SDNA molecules. UV-visible, Raman, and photoluminescence (PL) spectra were measured to determine the optical properties and thus investigate the binding modes, Nb5+ coordination sites in Nb5+-doped SDNA thin films, and energy transfer mechanisms, respectively. As [Nb5+] increases, the absorbance peak intensities monotonically increase until ˜[Nb5+]O and then decrease. However, from the Raman measurements, the peak intensities gradually decrease with an increase in [Nb5+] to reveal the binding mechanism and binding sites of metal ions in the SDNA molecules. From the PL, we observe the emission intensities to reduce them at up to ˜[Nb5+]O and then increase after that, expecting the energy transfer between the Nb5+ and SDNA molecules. The current-voltage measurement shows a significant increase in the current observed as [Nb5+] increases in the SDNA thin films when compared to that of pristine SDNA thin films. Finally, we investigate the temperature dependent magnetization in which the Nb5+-doped SDNA thin films reveal weak ferromagnetism due to the existence of tiny magnetic dipoles in the Nb5+-doped SDNA

  2. End-specific strategies of attachment of long double stranded DNA onto gold-coated nanofiber arrays

    International Nuclear Information System (INIS)

    Peckys, Diana B; De Jonge, Niels; Simpson, Michael L; McKnight, Timothy E

    2008-01-01

    We report the effective and site-specific binding of long double stranded (ds)DNA to high aspect ratio carbon nanofiber arrays. The carbon nanofibers were first coated with a thin gold layer to provide anchorage for two controllable binding methods. One method was based on the direct binding of thiol end-labeled dsDNA. The second and enhanced method used amine end-labeled dsDNA bound with crosslinkers to a carboxyl-terminated self-assembled monolayer. The bound dsDNA was first visualized with a fluorescent, dsDNA-intercalating dye. The specific binding onto the carbon nanofiber was verified by a high resolution detection method using scanning electron microscopy in combination with the binding of neutravidin-coated fluorescent microspheres to the immobilized and biotinylated dsDNA. Functional activity of thiol end-labeled dsDNA on gold-coated nanofiber arrays was verified with a transcriptional assay, whereby Chinese hamster lung cells (V79) were impaled upon the DNA-modified nanofibers and scored for transgene expression of the tethered template. Thiol end-labeled dsDNA demonstrated significantly higher expression levels than nanofibers prepared with control dsDNA that lacked a gold-binding end-label. Employing these site-specific and robust techniques of immobilization of dsDNA onto nanodevices can be of advantage for the study of DNA/protein interactions and for gene delivery applications.

  3. Double-stranded DNA translocase activity of transcription factor TFIIH and the mechanism of RNA polymerase II open complex formation.

    Science.gov (United States)

    Fishburn, James; Tomko, Eric; Galburt, Eric; Hahn, Steven

    2015-03-31

    Formation of the RNA polymerase II (Pol II) open complex (OC) requires DNA unwinding mediated by the transcription factor TFIIH helicase-related subunit XPB/Ssl2. Because XPB/Ssl2 binds DNA downstream from the location of DNA unwinding, it cannot function using a conventional helicase mechanism. Here we show that yeast TFIIH contains an Ssl2-dependent double-stranded DNA translocase activity. Ssl2 tracks along one DNA strand in the 5' → 3' direction, implying it uses the nontemplate promoter strand to reel downstream DNA into the Pol II cleft, creating torsional strain and leading to DNA unwinding. Analysis of the Ssl2 and DNA-dependent ATPase activity of TFIIH suggests that Ssl2 has a processivity of approximately one DNA turn, consistent with the length of DNA unwound during transcription initiation. Our results can explain why maintaining the OC requires continuous ATP hydrolysis and the function of TFIIH in promoter escape. Our results also suggest that XPB/Ssl2 uses this translocase mechanism during DNA repair rather than physically wedging open damaged DNA.

  4. PFGE analysis of DNA double-strand breaks and DNA repair process in human osteosarcoma cells irradiated by X-ray

    International Nuclear Information System (INIS)

    Cao Jianping; Majima, H.; Yamaguchi, C.

    2000-01-01

    Objective: To study the induction of DNA double-strand breaks (DSBs) in human osteosarcoma cells irradiated by X-ray, the DNA DSBs repair process and the tumour cell radiosensitivity. Methods: Two cell lines of human osteosarcoma, Rho0 and 143. B were used. Initial DNA damage of DSBs by X-ray irradiation was measured using clamped homogeneous electrical field (CHEF) electrophoresis. Results: X-ray-induced DNA DSBs of human osteosarcoma cells after CHEF-electrophoresis increased linearly with the irradiation dose between 0 and 50 Gy. The repair of DNA DSBs in human osteosarcoma cells increased with the post-irradiation incubation time. In contrast to 14.3B cell line at the same dose point, much more DNA DSBs were induced in Rho0 cell line after X-ray irradiation. Conclusion: CHEF pulsed-field gel electrophoresis (PEGE) is a sensitive method for the determination of radiation-induced DNA DSBs in high molecular weight DNA of human osteosarcoma cells. Radiation-induced DNA DSBs of osteosarcoma increase with the dose in a linear manner. After incubation, both Rho0 cell line and 143. B cell line can repair the DNA DSBs. Between two cell lines of human osteosarcoma, Rho0 and 143.B, Rho0 cell line is more sensitive to ionizing radiation than 143.B line

  5. CD133 positive U87 glioma stem cell radiosensitivity and DNA double-strand break repair

    International Nuclear Information System (INIS)

    Li Ping; Zong Tianzhou; Ji Xiaoqin; Lu Xueguan

    2013-01-01

    Objective: To explore the radiosensitivity and DNA double-strand break repair of CD133 + U87 glioma stem cell. Methods: CD133 + and CD133 - cells were isolated from glioma U87 cell lines by flow cytometry sorter system. After irradiated vertically by 4 Gy X-rays, the radiosensitivity of cells was determined by clonogenic assay. The radiation-induced DNA double-strand break repair of CD133 + and CD133 - cells was determined by the neutral comet assay,and the expression of phosphorylated histone H2AX (γ-H2AX) and Rad51 foci were measured by immunofluorescence. Results: The clone forming rate of CD133 + cells was higher than CD133 - cells (t=3.66, P<0.01) with no radiation. The clone forming rate of CD133 + cells irradiated by 4 Gy X-rays has no significant changes compared to that of the non-irradiation cells (t=0.71, P>0.05), but for CD133 - cells, it decreased compared to non-irradiation cells (t=2.91, P<0.05). The tailmoment between CD133 + cells and CD133 - cells had no difference at 0.5 h after irradiation (t=1.44, P>0.05); the tailmoment of CD133 + cells was lower than CD133 - cells at 6 and 24 h after irradiation,respectively (t=5.31 and 8.09, P<0.01). There was no significant difference in the expression of γ-H2AX foci between CD133 + and CD133 - cells at 0.5 and 6 h after irradiation (t=0.12 and 0.99, P>0.05), γ-H2AX foci of CD133 + cells was significantly decreased compared to CD133 - cells at 24 h after irradiation (t=4.99, P<0.01). For Rad 51 foci, there was no difference between CD133 + and CD133 - cells at 0.5 h after irradiation (t=1.12, P>0.05). The expression of Rad 51 foci of CD133 - cells was decreased compared to that of CD133 + cells at 6 and 24 h after irradiation,respectively (t=22.88 and 12.43, P<0.01). And the expression of Rad51 foci of CD133 + cells had no significant changes at 6-24 h after irradiation. Conclusions: Glioma stem cells is more radioresistive than glioma non-stem cells. The probable mechanism is that the DNA double

  6. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  7. Differences in heavy-ion-induced DNA double-strand breaks in a mouse DNA repair-deficient mutant cell line (SL3-147) before and after chromatin proteolysis

    International Nuclear Information System (INIS)

    Murakami, Masahiro; Eguchi-Kasai, Kiyomi; Sato, Koki; Minohara, Shinichi; Kanai, Tatsuaki; Yatagai, Fumio.

    1995-01-01

    DNA double-strand breaks induced by X- or neon beam-irradiation in a DNA double-strand break-repair-deficient mutant cell line (SL3-147) were examined. The increase in the number of DNA double-strand breaks was dose-depend after irradiation with X-rays and neon beams and was enhanced by chromatin-proteolysis treatment before irradiation. These results suggest that the induction of DNA double-strand breaks by ionizing radiation, including heavy-ions, is influenced by the chromatin structure. (author)

  8. Excess single-stranded DNA inhibits meiotic double-strand break repair.

    Directory of Open Access Journals (Sweden)

    Rebecca Johnson

    2007-11-01

    Full Text Available During meiosis, self-inflicted DNA double-strand breaks (DSBs are created by the protein Spo11 and repaired by homologous recombination leading to gene conversions and crossovers. Crossover formation is vital for the segregation of homologous chromosomes during the first meiotic division and requires the RecA orthologue, Dmc1. We analyzed repair during meiosis of site-specific DSBs created by another nuclease, VMA1-derived endonuclease (VDE, in cells lacking Dmc1 strand-exchange protein. Turnover and resection of the VDE-DSBs was assessed in two different reporter cassettes that can repair using flanking direct repeat sequences, thereby obviating the need for a Dmc1-dependent DNA strand invasion step. Access of the single-strand binding complex replication protein A, which is normally used in all modes of DSB repair, was checked in chromatin immunoprecipitation experiments, using antibody against Rfa1. Repair of the VDE-DSBs was severely inhibited in dmc1Delta cells, a defect that was associated with a reduction in the long tract resection required to initiate single-strand annealing between the flanking repeat sequences. Mutants that either reduce Spo11-DSB formation or abolish resection at Spo11-DSBs rescued the repair block. We also found that a replication protein A component, Rfa1, does not accumulate to expected levels at unrepaired single-stranded DNA (ssDNA in dmc1Delta cells. The requirement of Dmc1 for VDE-DSB repair using flanking repeats appears to be caused by the accumulation of large quantities of ssDNA that accumulate at Spo11-DSBs when Dmc1 is absent. We propose that these resected DSBs sequester both resection machinery and ssDNA binding proteins, which in wild-type cells would normally be recycled as Spo11-DSBs repair. The implication is that repair proteins are in limited supply, and this could reflect an underlying mechanism for regulating DSB repair in wild-type cells, providing protection from potentially harmful effects

  9. Conservation of the rad21 Schizosaccharomyces pombe DNA double-strand break repair gene in mammals

    International Nuclear Information System (INIS)

    McKay, Michael J.; Spek, Peter van der; Kanaar, Roland; Smit, Bep; Bootsma, Dirk; Hoeijmakers, Jan H. J.

    1996-01-01

    Purpose/Objective: Genetic factors are likely to be major determinants of human cellular ionizing radiation sensitivity. DNA double strand breaks (dsbs) are significant ionizing radiation-induced lesions; cellular DNA dsb processing is also important in a number of other contexts. To further the understanding of DNA dsb processing in mammalian cells, we cloned and sequenced mammalian homologs of the rad21 Schizosaccharomyces pombe DNA dsb repair gene. Materials and Methods: The genes were cloned by evolutionary walking, exploiting sequence homology between the yeast and mammalian genes. Results: No major motifs indicative of a particular function were present in the predicted amino acid sequences of the mammalian genes. Alignment of the Rad21 amino acid sequence with its putative homologs showed that similarity was distributed across the length of the proteins, with more highly conserved regions at both termini. The mHR21 sp (mouse homolog ofR ad21, S. pombe) and hHR21 sp (humanh omolog of Rad21, S. pombe) predicted proteins were 96% identical, whereas the human and S. pombe proteins were 25% identical and 47% similar. RNA blot analysis showed that mHR21 sp mRNA was abundant in all adult mouse tissues examined, with highest expression in testis and thymus. In addition to a 3.1kb mRNA transcript in all tissues, an additional 2.2kb transcript was present at a high level in post-meiotic spermatids, white expression of the 3.1kb mRNA in testis was confined to the meiotic compartment. hHR21 sp mRNA was cell cycle regulated in human cells, increasing in late S phase to a peak in G2 phase. The level of hHR21 sp transcripts was not altered by exposure of normal diploid fibroblasts to 10 Gy ionizing radiation. In situ hybridization showed mHR21 sp resided on chromosome 15D3, whereashHR21 sp localized to the syntenic 8q24 region. Conclusion: Cloning these novel mammalian genes and characterization of their protein products should contribute to the understanding of cellular

  10. Opposing roles of RNF8/RNF168 and deubiquitinating enzymes in ubiquitination-dependent DNA double-strand break response signaling and DNA-repair pathway choice

    International Nuclear Information System (INIS)

    Nakada, Shinichiro

    2016-01-01

    The E3 ubiquitin ligases ring finger protein (RNF) 8 and RNF168 transduce the DNA double-strand break (DSB) response (DDR) signal by ubiquitinating DSB sites. The depletion of RNF8 or RNF168 suppresses the accumulation of DNA-repair regulating factors such as 53BP1 and RAP80 at DSB sites, suggesting roles for RNF8- and RNF168-mediated ubiquitination in DSB repair. This mini-review provides a brief overview of the RNF8- and RNF168-dependent DDR-signaling and DNA-repair pathways. The choice of DNA-repair pathway when RNF8- and RNF168-mediated ubiquitination-dependent DDR signaling is negatively regulated by deubiquitinating enzymes (DUBs) is reviewed to clarify how the opposing roles of RNF8/RNF168 and DUBs regulate ubiquitination-dependent DDR signaling and the choice of DNA-repair pathway

  11. A polycomb group protein, PHF1, is involved in the response to DNA double-strand breaks in human cell

    OpenAIRE

    Hong, Zehui; Jiang, Jie; Lan, Li; Nakajima, Satoshi; Kanno, Shin-ichiro; Koseki, Haruhiko; Yasui, Akira

    2008-01-01

    DNA double-strand breaks (DSBs) represent the most toxic DNA damage arisen from endogenous and exogenous genotoxic stresses and are known to be repaired by either homologous recombination or nonhomologous end-joining processes. Although many proteins have been identified to participate in either of the processes, the whole processes still remain elusive. Polycomb group (PcG) proteins are epigenetic chromatin modifiers involved in gene silencing, cancer development and the maintenance of embry...

  12. γ-ray dose rate effect in DNA double-strand break repair deficient murine cells

    International Nuclear Information System (INIS)

    Li Liya; Li Peiwen

    2002-01-01

    Objective: To analyze the dose rate effect and potentially lethal damage repair in DNA double-strand break repair deficient murine cells (SCID) irradiated by γ-ray. Methods: The wild type (CB.17+/+) and SCID cells were exposed to γ-ray at high and low dose rates. The high dose rate exposure was fractionated into two equal doses at 24 h intervals. The survival rates of irradiated cells were calculated by clone-forming analysis. Results: When γ-ray was given to wild type (CB.17+/+) cells in two fractions at 24 h intervals, the survival rate was significantly higher than that when the same total dose was given singly. In contrast, there was no difference in the survival rates between the single and fractionated exposure in SCID cells. SCID cells were more sensitive than CB.17+/+ cells to both low and high dose rates γ-ray exposure for cell killing. The survival rate by low dose rate exposure was significantly higher than that by high dose rate exposure, not only in CB.17+/+ cells but also in SCID cells. Conclusions: SCID cells are deficient in repairing γ-ray induced double-strand breaks. There is dose rate effect in both SCID and CB.17+/+ cells

  13. Poly(ADP-ribose polymerase (PARP-1 is not involved in DNA double-strand break recovery

    Directory of Open Access Journals (Sweden)

    Fernet Marie

    2003-07-01

    Full Text Available Abstract Background The cytotoxicity and the rejoining of DNA double-strand breaks induced by γ-rays, H2O2 and neocarzinostatin, were investigated in normal and PARP-1 knockout mouse 3T3 fibroblasts to determine the role of poly(ADP-ribose polymerase (PARP-1 in DNA double-strand break repair. Results PARP-1-/- were considerably more sensitive than PARP-1+/+ 3T3s to induced cell kill by γ-rays and H2O2. However, the two cell lines did not show any significant difference in the susceptibility to neocarzinostatin below 1.5 nM drug. Restoration of PARP-1 expression in PARP-1-/- 3T3s by retroviral transfection of the full PARP-1 cDNA did not induce any change in neocarzinostatin response. Moreover the incidence and the rejoining kinetics of neocarzinostatin-induced DNA double-strand breaks were identical in PARP-1+/+ and PARP-1-/- 3T3s. Poly(ADP-ribose synthesis following γ-rays and H2O2 was observed in PARP-1-proficient cells only. In contrast neocarzinostatin, even at supra-lethal concentration, was unable to initiate PARP-1 activation yet it induced H2AX histone phosphorylation in both PARP1+/+ and PARP-1-/- 3T3s as efficiently as γ-rays and H2O2. Conclusions The results show that PARP-1 is not a major determinant of DNA double-strand break recovery with either strand break rejoining or cell survival as an endpoint. Even though both PARP-1 and ATM activation are major determinants of the cell response to γ-rays and H2O2, data suggest that PARP-1-dependent poly(ADP-ribose synthesis and ATM-dependent H2AX phosphorylation, are not inter-related in the repair pathway of neocarzinostatin-induced DNA double-strand breaks.

  14. Binding to the minor groove of the double-strand, tau protein prevents DNA from damage by peroxidation.

    Science.gov (United States)

    Wei, Yan; Qu, Mei-Hua; Wang, Xing-Sheng; Chen, Lan; Wang, Dong-Liang; Liu, Ying; Hua, Qian; He, Rong-Qiao

    2008-07-02

    Tau, an important microtubule associated protein, has been found to bind to DNA, and to be localized in the nuclei of both neurons and some non-neuronal cells. Here, using electrophoretic mobility shifting assay (EMSA) in the presence of DNA with different chain-lengths, we observed that tau protein favored binding to a 13 bp or a longer polynucleotide. The results from atomic force microscopy also showed that tau protein preferred a 13 bp polynucleotide to a 12 bp or shorter polynucleotide. In a competitive assay, a minor groove binder distamycin A was able to replace the bound tau from the DNA double helix, indicating that tau protein binds to the minor groove. Tau protein was able to protect the double-strand from digestion in the presence of DNase I that was bound to the minor groove. On the other hand, a major groove binder methyl green as a negative competitor exhibited little effect on the retardation of tau-DNA complex in EMSA. This further indicates the DNA minor groove as the binding site for tau protein. EMSA with truncated tau proteins showed that both the proline-rich domain (PRD) and the microtubule-binding domain (MTBD) contributed to the interaction with DNA; that is to say, both PRD and MTBD bound to the minor groove of DNA and bent the double-strand, as observed by electron microscopy. To investigate whether tau protein is able to prevent DNA from the impairment by hydroxyl free radical, the chemiluminescence emitted by the phen-Cu/H(2)O(2)/ascorbate was measured. The emission intensity of the luminescence was markedly decreased when tau protein was present, suggesting a significant protection of DNA from the damage in the presence of hydroxyl free radical.

  15. Large-scale chromosome folding versus genomic DNA sequences: A discrete double Fourier transform technique.

    Science.gov (United States)

    Chechetkin, V R; Lobzin, V V

    2017-08-07

    Using state-of-the-art techniques combining imaging methods and high-throughput genomic mapping tools leaded to the significant progress in detailing chromosome architecture of various organisms. However, a gap still remains between the rapidly growing structural data on the chromosome folding and the large-scale genome organization. Could a part of information on the chromosome folding be obtained directly from underlying genomic DNA sequences abundantly stored in the databanks? To answer this question, we developed an original discrete double Fourier transform (DDFT). DDFT serves for the detection of large-scale genome regularities associated with domains/units at the different levels of hierarchical chromosome folding. The method is versatile and can be applied to both genomic DNA sequences and corresponding physico-chemical parameters such as base-pairing free energy. The latter characteristic is closely related to the replication and transcription and can also be used for the assessment of temperature or supercoiling effects on the chromosome folding. We tested the method on the genome of E. coli K-12 and found good correspondence with the annotated domains/units established experimentally. As a brief illustration of further abilities of DDFT, the study of large-scale genome organization for bacteriophage PHIX174 and bacterium Caulobacter crescentus was also added. The combined experimental, modeling, and bioinformatic DDFT analysis should yield more complete knowledge on the chromosome architecture and genome organization. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Radiation dose determines the method for quantification of DNA double strand breaks

    International Nuclear Information System (INIS)

    Bulat, Tanja; Keta, Olitija; Korićanac, Lela; Žakula, Jelena; Petrović, Ivan; Ristić-Fira, Aleksandra; Todorović, Danijela

    2016-01-01

    Ionizing radiation induces DNA double strand breaks (DSBs) that trigger phosphorylation of the histone protein H2AX (γH2AX). Immunofluorescent staining visualizes formation of γH2AX foci, allowing their quantification. This method, as opposed to Western blot assay and Flow cytometry, provides more accurate analysis, by showing exact position and intensity of fluorescent signal in each single cell. In practice there are problems in quantification of γH2AX. This paper is based on two issues: the determination of which technique should be applied concerning the radiation dose, and how to analyze fluorescent microscopy images obtained by different microscopes. HTB140 melanoma cells were exposed to γ-rays, in the dose range from 1 to 16 Gy. Radiation effects on the DNA level were analyzed at different time intervals after irradiation by Western blot analysis and immunofluorescence microscopy. Immunochemically stained cells were visualized with two types of microscopes: AxioVision (Zeiss, Germany) microscope, comprising an ApoTome software, and AxioImagerA1 microscope (Zeiss, Germany). Obtained results show that the level of γH2AX is time and dose dependent. Immunofluorescence microscopy provided better detection of DSBs for lower irradiation doses, while Western blot analysis was more reliable for higher irradiation doses. AxioVision microscope containing ApoTome software was more suitable for the detection of γH2AX foci. (author)

  17. The Heterochromatic Barrier to DNA Double Strand Break Repair: How to Get the Entry Visa

    Directory of Open Access Journals (Sweden)

    Aaron A. Goodarzi

    2012-09-01

    Full Text Available Over recent decades, a deep understanding of pathways that repair DNA double strand breaks (DSB has been gained from biochemical, structural, biophysical and cellular studies. DNA non-homologous end-joining (NHEJ and homologous recombination (HR represent the two major DSB repair pathways, and both processes are now well understood. Recent work has demonstrated that the chromatin environment at a DSB significantly impacts upon DSB repair and that, moreover, dramatic modifications arise in the chromatin surrounding a DSB. Chromatin is broadly divided into open, transcriptionally active, euchromatin (EC and highly compacted, transcriptionally inert, heterochromatin (HC, although these represent extremes of a spectrum. The HC superstructure restricts both DSB repair and damage response signaling. Moreover, DSBs within HC (HC-DSBs are rapidly relocalized to the EC-HC interface. The damage response protein kinase, ataxia telangiectasia mutated (ATM, is required for HC-DSB repair but is dispensable for the relocalization of HC-DSBs. It has been proposed that ATM signaling enhances HC relaxation in the DSB vicinity and that this is a prerequisite for HC-DSB repair. Hence, ATM is essential for repair of HC-DSBs. Here, we discuss how HC impacts upon the response to DSBs and how ATM overcomes the barrier that HC poses to repair.

  18. Radiation dose determines the method for quantification of DNA double strand breaks

    Energy Technology Data Exchange (ETDEWEB)

    Bulat, Tanja; Keta, Olitija; Korićanac, Lela; Žakula, Jelena; Petrović, Ivan; Ristić-Fira, Aleksandra [University of Belgrade, Vinča Institute of Nuclear Sciences, Belgrade (Serbia); Todorović, Danijela, E-mail: dtodorovic@medf.kg.ac.rs [University of Kragujevac, Faculty of Medical Sciences, Kragujevac (Serbia)

    2016-03-15

    Ionizing radiation induces DNA double strand breaks (DSBs) that trigger phosphorylation of the histone protein H2AX (γH2AX). Immunofluorescent staining visualizes formation of γH2AX foci, allowing their quantification. This method, as opposed to Western blot assay and Flow cytometry, provides more accurate analysis, by showing exact position and intensity of fluorescent signal in each single cell. In practice there are problems in quantification of γH2AX. This paper is based on two issues: the determination of which technique should be applied concerning the radiation dose, and how to analyze fluorescent microscopy images obtained by different microscopes. HTB140 melanoma cells were exposed to γ-rays, in the dose range from 1 to 16 Gy. Radiation effects on the DNA level were analyzed at different time intervals after irradiation by Western blot analysis and immunofluorescence microscopy. Immunochemically stained cells were visualized with two types of microscopes: AxioVision (Zeiss, Germany) microscope, comprising an ApoTome software, and AxioImagerA1 microscope (Zeiss, Germany). Obtained results show that the level of γH2AX is time and dose dependent. Immunofluorescence microscopy provided better detection of DSBs for lower irradiation doses, while Western blot analysis was more reliable for higher irradiation doses. AxioVision microscope containing ApoTome software was more suitable for the detection of γH2AX foci. (author)

  19. Cisplatin enhances the formation of DNA single- and double-strand breaks by hydrated electrons and hydroxyl radicals.

    Science.gov (United States)

    Rezaee, Mohammad; Sanche, Léon; Hunting, Darel J

    2013-03-01

    The synergistic interaction of cisplatin with ionizing radiation is the clinical rationale for the treatment of several cancers including head and neck, cervical and lung cancer. The underlying molecular mechanism of the synergy has not yet been identified, although both DNA damage and repair processes are likely involved. Here, we investigate the indirect effect of γ rays on strand break formation in a supercoiled plasmid DNA (pGEM-3Zf-) covalently modified by cisplatin. The yields of single- and double-strand breaks were determined by irradiation of DNA and cisplatin/DNA samples with (60)Co γ rays under four different scavenging conditions to examine the involvement of hydrated electrons and hydroxyl radicals in inducing the DNA damage. At 5 mM tris in an N2 atmosphere, the presence of an average of two cisplatins per plasmid increased the yields of single- and double-strand breaks by factors of 1.9 and 2.2, respectively, relative to the irradiated unmodified DNA samples. Given that each plasmid of 3,200 base pairs contained an average of two cisplatins, this represents an increase in radiosensitivity of 3,200-fold on a per base pair basis. When hydrated electrons were scavenged by saturating the samples with N2O, these enhancement factors decreased to 1.5 and 1.2, respectively, for single- and double-strand breaks. When hydroxyl radicals were scavenged using 200 mM tris, the respective enhancement factors were 1.2 and 1.6 for single- and double-strand breaks, respectively. Furthermore, no enhancement in DNA damage by cisplatin was observed after scavenging both hydroxyl radicals and hydrated electrons. These findings show that hydrated electrons can induce both single- and double-strand breaks in the platinated DNA, but not in unmodified DNA. In addition, cisplatin modification is clearly an extremely efficient means of increasing the formation of both single- and double-strand breaks by the hydrated electrons and hydroxyl radicals created by ionizing

  20. Bioelectrochemical sensing of promethazine with bamboo-type multiwalled carbon nanotubes dispersed in calf-thymus double stranded DNA.

    Science.gov (United States)

    Primo, Emiliano N; Oviedo, M Belén; Sánchez, Cristián G; Rubianes, María D; Rivas, Gustavo A

    2014-10-01

    We report the quantification of promethazine (PMZ) using glassy carbon electrodes (GCE) modified with bamboo-like multi-walled carbon nanotubes (bCNT) dispersed in double stranded calf-thymus DNA (dsDNA) (GCE/bCNT-dsDNA). Cyclic voltammetry measurements demonstrated that PMZ presents a thin film-confined redox behavior at GCE/bCNT-dsDNA, opposite to the irreversibly-adsorbed behavior obtained at GCE modified with bCNT dispersed in ethanol (GCE/bCNT). Differential pulse voltammetry-adsorptive stripping with medium exchange experiments performed with GCE/bCNT-dsDNA and GCE modified with bCNTs dispersed in single-stranded calf-thymus DNA (ssDNA) confirmed that the interaction between PMZ and bCNT-dsDNA is mainly hydrophobic. These differences are due to the intercalation of PMZ within the dsDNA that supports the bCNTs, as evidenced from the bathochromic displacement of UV-Vis absorption spectra of PMZ and quantum dynamics calculations at DFTB level. The efficient accumulation of PMZ at GCE/bCNT-dsDNA made possible its sensitive quantification at nanomolar levels (sensitivity: (3.50±0.05)×10(8) μA·cm(-2)·M(-1) and detection limit: 23 nM). The biosensor was successfully used for the determination of PMZ in a pharmaceutical product with excellent correlation. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Detection and Repair of Ionizing Radiation-Induced DNA Double Strand Breaks: New Developments in Nonhomologous End Joining

    International Nuclear Information System (INIS)

    Wang, Chen; Lees-Miller, Susan P.

    2013-01-01

    DNA damage can occur as a result of endogenous metabolic reactions and replication stress or from exogenous sources such as radiation therapy and chemotherapy. DNA double strand breaks are the most cytotoxic form of DNA damage, and defects in their repair can result in genome instability, a hallmark of cancer. The major pathway for the repair of ionizing radiation-induced DSBs in human cells is nonhomologous end joining. Here we review recent advances on the mechanism of nonhomologous end joining, as well as new findings on its component proteins and regulation

  2. Detection and Repair of Ionizing Radiation-Induced DNA Double Strand Breaks: New Developments in Nonhomologous End Joining

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Chen [Departments of Biochemistry and Molecular Biology and Oncology, and Southern Alberta Cancer Research Institute, University of Calgary, Calgary (Canada); Lees-Miller, Susan P., E-mail: leesmill@ucalgary.ca [Departments of Biochemistry and Molecular Biology and Oncology, and Southern Alberta Cancer Research Institute, University of Calgary, Calgary (Canada)

    2013-07-01

    DNA damage can occur as a result of endogenous metabolic reactions and replication stress or from exogenous sources such as radiation therapy and chemotherapy. DNA double strand breaks are the most cytotoxic form of DNA damage, and defects in their repair can result in genome instability, a hallmark of cancer. The major pathway for the repair of ionizing radiation-induced DSBs in human cells is nonhomologous end joining. Here we review recent advances on the mechanism of nonhomologous end joining, as well as new findings on its component proteins and regulation.

  3. Smoking cessation reverses DNA double-strand breaks in human mononuclear cells.

    Directory of Open Access Journals (Sweden)

    Mari Ishida

    Full Text Available OBJECTIVE: Cigarette smoking is a major risk factor for atherosclerotic cardiovascular disease, which is responsible for a significant proportion of smoking-related deaths. However, the precise mechanism whereby smoking induces this pathology has not been fully delineated. Based on observation of DNA double-strand breaks (DSBs, the most harmful type of DNA damage, in atherosclerotic lesions, we hypothesized that there is a direct association between smoking and DSBs. The goal of this study was to investigate whether smoking induces DSBs and smoking cessation reverses DSBs in vivo through examination of peripheral mononuclear cells (MNCs. APPROACH AND RESULTS: Immunoreactivity of oxidative modification of DNA and DSBs were increased in human atherosclerotic lesions but not in the adjacent normal area. DSBs in human MNCs isolated from the blood of volunteers can be detected as cytologically visible "foci" using an antibody against the phosphorylated form of the histone H2AX (γ-H2AX. Young healthy active smokers (n = 15 showed increased γ-H2AX foci number when compared with non-smokers (n = 12 (foci number/cell: median, 0.37/cell; interquartile range [IQR], 0.31-0.58 vs. 4.36/cell; IQR, 3.09-7.39, p<0.0001. Smoking cessation for 1 month reduced the γ-H2AX foci number (median, 4.44/cell; IQR, 4.36-5.24 to 0.28/cell; IQR, 0.12-0.53, p<0.05. A positive correlation was noted between γ-H2AX foci number and exhaled carbon monoxide levels (r = 0.75, p<0.01. CONCLUSIONS: Smoking induces DSBs in human MNCs in vivo, and importantly, smoking cessation for 1 month resulted in a decrease in DSBs to a level comparable to that seen in non-smokers. These data reinforce the notion that the cigarette smoking induces DSBs and highlight the importance of smoking cessation.

  4. The contribution of alu elements to mutagenic DNA double-strand break repair.

    Science.gov (United States)

    Morales, Maria E; White, Travis B; Streva, Vincent A; DeFreece, Cecily B; Hedges, Dale J; Deininger, Prescott L

    2015-03-01

    Alu elements make up the largest family of human mobile elements, numbering 1.1 million copies and comprising 11% of the human genome. As a consequence of evolution and genetic drift, Alu elements of various sequence divergence exist throughout the human genome. Alu/Alu recombination has been shown to cause approximately 0.5% of new human genetic diseases and contribute to extensive genomic structural variation. To begin understanding the molecular mechanisms leading to these rearrangements in mammalian cells, we constructed Alu/Alu recombination reporter cell lines containing Alu elements ranging in sequence divergence from 0%-30% that allow detection of both Alu/Alu recombination and large non-homologous end joining (NHEJ) deletions that range from 1.0 to 1.9 kb in size. Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DNA double-strand break (DSB) repair. Further reduction in recombination was observed in a sequence divergence-dependent manner for diverged Alu/Alu recombination constructs with up to 10% sequence divergence. With greater levels of sequence divergence (15%-30%), we observed a significant increase in DSB repair due to a shift from Alu/Alu recombination to variable-length NHEJ which removes sequence between the two Alu elements. This increase in NHEJ deletions depends on the presence of Alu sequence homeology (similar but not identical sequences). Analysis of recombination products revealed that Alu/Alu recombination junctions occur more frequently in the first 100 bp of the Alu element within our reporter assay, just as they do in genomic Alu/Alu recombination events. This is the first extensive study characterizing the influence of Alu element sequence divergence on DNA repair, which will inform predictions regarding the effect of Alu element sequence divergence on both

  5. Repair response for DNA double-strand damage through ubiquitylation of chromatin

    International Nuclear Information System (INIS)

    Nakada, Shinichiro

    2011-01-01

    The chromatin modulation (remodeling) via lysine63 (K63)-linked ubiquitin (U) has been found important in the repair response for DNA double-strand damage, and the sequential signaling events at the damage site are explained. As the first step of the repair, MRN (MRE11, RAD50 and nibrin) complex recognizes the damage site and binds to it followed by many linked reactions by recruited and activated enzymes of various protein kinases and phosphatases, which resulting in the enhanced early signaling. As well, gamma-H2AX (phosphorylated histone H2AX) is yielded by the process, to which phosphorylated MDC1 (mediator of DNA-damage checkpoint 1) binds to produce their complex. Then further binding of RNF8-HERC2-UBC13 (ring finger protein 8, hect domain and RCC1 (CHC1)-like domain, and U conjugating enzyme E2N, respectively) occurs for starting the cumulative ubiquitylation of H2AX via K63 as the middle phase response. Signaling in the late phase occurs on the U chain formed at the damage site by binding of RAP (receptor-associated protein) 80 and other recruited 5 proteins like BRCA1 (breast cancer 1, early onset) to repair DNA by the homologous recombination after 53BP1 (tumor protein p53 binding protein) binding followed by methylation of histone H4. In a case of human compound heterozygous RNF168 defect, RIDDLE syndrome (radiosensitivity, immunodeficiency, dysmorphic features and learning difficulties), cells have no and slight abnormality of G2/M and intra-S checkpoint, respectively. Another defecting case with homozygous nonsense mutation has high radiosensitivity, intra-S checkpoint abnormality and others. Abnormality of immuno-globulins observed in both cases is similar to that in the RNF8-knockout mouse. Many tasks in chromatin ubiquitylation in the repair are still remained to be solved for protection and treatment of related diseases. (T.T.)

  6. Role of XRCC4 phosphorylation by DNA-PK in the regulation of NHEJ repair pathway of DNA double strand break

    International Nuclear Information System (INIS)

    Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Kamdar, Radhika P.; Sicheng, Liu; Wanotayan, Rujira; Matsumoto, Yoshihisa

    2014-01-01

    Non-homologous end-joining (NHEJ) is the predominant pathway of DNA double strand breaks in higher eukaryotes and is active throughout the cell cycle. NHEJ repair includes many factors as Ku70/86, DNA-PKcs, XRCC4-Ligase IV complex and XLF (also known as Cernunnos). In these factors, DNA-PKcs acts as central regulator in NHEJ repair. It recruited at the DNA damages site after DNA damage and after association with Ku its kinase activity is activated. It phosphorylates many of important NHEJ proteins in vitro including XRCC4, Ku 70/86, Artemis, and even DNA-PKcs but till now, very less studies have been done to know the role and significance of phosphorylation in the NHEJ repair. Studies by other researchers identified various phosphorylation sites in XRCC4 by DNA-PK using mass spectrometry but these phosphorylation sites were shown to be dispensable for DSB repair. In the present investigation, we identified 3 serine and one new threonine phosphorylation sites in XRCC4 protein by DNA-PK. In vivo phosphorylation at these sites was verified by generating phosphorylation specific antibodies and the requirement for DNA-PK therein was verified by using DNA-PK inhibitor and DNA-PK proficient and deficient cell lines in response to radiation and zeocin treatment. We have also found that phosphorylation at these sites showed dose dependency in response to radiation treatment. The two serine and one threonine phosphorylation site is also biological important as their mutation into alanine significantly elevated radiosensitivity as measured by colony formation assay. Neutral comet assay showed delayed kinetics in DSB repair of these mutants. Furthermore, we have found a protein, with putative DSB repair function, which interacts with domain including the phosphorylation sites.These results indicate that these phosphorylation sites would mediate functional link between XRCC4 and DNA-PK. (author)

  7. Molecular characterization of a complex site-specific radiation-induced DNA double-strand break

    International Nuclear Information System (INIS)

    Datta, K.; Dizdaroglu, M.; Jaruga, P.; Neumann, R.D.; Winters, T.A.

    2003-01-01

    Radiation lethality is a function of radiation-induced DNA double-strand breaks (DSB). Current models propose the lethality of a DSB to be a function of its structural complexity. We present here for the first time a map of damage associated with a site-specific double-strand break produced by decay of 125 I in a plasmid bound by a 125 I-labeled triplex forming oligonucleotide ( 125 I-TFO). The E. coli DNA repair enzymes, endonuclease IV (endo IV), endonuclease III (endo III), and formamidopyrimidine-DNA glycosylase (Fpg), which recognize AP sites, and pyrimidine and purine base damage respectively, were used as probes in this study. 125 I-TFO bound plasmid was incubated with and without DMSO at -80 deg C for 1 month. No significant difference in DSB yield was observed under these conditions. A 32 base pair fragment from the upstream side of the decay site was isolated by restriction digestion and enzymatically probed to identify damage sites. Endo IV treatment of the 5'-end labeled upper strand indicated clustering of AP sites within 3 bases downstream and 7 bases upstream of the targeted base. Also, repeated experiments consistently detected an AP site 4 bases upstream of the 125 Itarget base. This was further supported by complementary results with the 3'-end labeled upper strand. Endo IV analysis of the lower strand also shows clustering of AP sites near the DSB end. Endo III and Fpg probing demonstrated that base damage is also clustered near the targeted break site. DSBs produced in the absence of DMSO displayed a different pattern of enzyme sensitive damage than those produced in the presence of DMSO. Identification of specific base damage types within the restriction fragment containing the DSB end was achieved with GC/MS. Base damage consisted of 8-hydroguanine, 8-hydroxyadenine, and 5-hydroxycytosine. These lesions were observed at relative yields of 8-hydroguanine and 5-hydroxycytosine to 8-hydroxyadenine of 7.4:1 and 4.7:1, respectively, in the absence

  8. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. An alternative mechanism for radioprotection by dimethyl sulfoxide. Possible facilitation of DNA double-strand break repair

    International Nuclear Information System (INIS)

    Kashino, Genro; Liu, Yong; Suzuki, Minoru; Masunaga, Shin-ichiro; Kinashi, Yuko; Ono, Koji; Tano, Keizo; Watanabe, Masami

    2010-01-01

    The radioprotective effects of dimethyl sulfoxide (DMSO) have been known for many years, and the suppression of hydroxyl (OH) radicals induced by ionizing radiation has been thought to be the main cause of this effect. However, the DMSO concentration used was very high, and might be toxic, in earlier studies. In the present study, we administered a lower, non-toxic concentration (0.5%, id est (i.e.), 64 mM) of DMSO before irradiation and examined its radioprotective effects. Colony formation assay and micronucleus assay showed significant radioprotective effects in Chinese hamster ovary (CHO), but not in xrs5, which is defective in the repair function of DNA double-strand breaks. The levels of phosphorylated H2AX and the formation of 53BP1 foci 15 minutes after irradiation, which might reflect initial DNA double-strand breaks, in DMSO-treated CHO cells were similar to those in non-treated cells, suggesting that the radioprotective effects were not attributable to the suppression of general indirect action in the lower concentration of DMSO. On the other hand, 2 hours after irradiation, the average number of 53BP1 foci, which might reflect residual DNA double-strand breaks, was significantly decreased in DMSO-treated CHO cells compared to non-treated cells. The results indicated that low concentration of DMSO exerts radioprotective effects through the facilitation of DNA double-strand break repair rather than through the suppression of indirect action. (author)

  10. An alternative mechanism for radioprotection by dimethyl sulfoxide; possible facilitation of DNA double-strand break repair.

    Science.gov (United States)

    Kashino, Genro; Liu, Yong; Suzuki, Minoru; Masunaga, Shin-ichiro; Kinashi, Yuko; Ono, Koji; Tano, Keizo; Watanabe, Masami

    2010-01-01

    The radioprotective effects of dimethyl sulfoxide (DMSO) have been known for many years, and the suppression of hydroxyl (OH) radicals induced by ionizing radiation has been thought to be the main cause of this effect. However, the DMSO concentration used was very high, and might be toxic, in earlier studies. In the present study, we administered a lower, non-toxic concentration (0.5%, i.e., 64 mM) of DMSO before irradiation and examined its radioprotective effects. Colony formation assay and micronucleus assay showed significant radioprotective effects in CHO, but not in xrs5, which is defective in the repair function of DNA double-strand breaks. The levels of phosphorylated H2AX and the formation of 53BP1 foci 15 minutes after irradiation, which might reflect initial DNA double-strand breaks, in DMSO-treated CHO cells were similar to those in non-treated cells, suggesting that the radioprotective effects were not attributable to the suppression of general indirect action in the lower concentration of DMSO. On the other hand, 2 hours after irradiation, the average number of 53BP1 foci, which might reflect residual DNA double-strand breaks, was significantly decreased in DMSO-treated CHO cells compared to non-treated cells. The results indicated that low concentration of DMSO exerts radioprotective effects through the facilitation of DNA double-strand break repair rather than through the suppression of indirect action.

  11. The ubiquitin-selective segregase VCP/p97 orchestrates the response to DNA double-strand breaks

    DEFF Research Database (Denmark)

    Meerang, Mayura; Ritz, Danilo; Paliwal, Shreya

    2011-01-01

    Unrepaired DNA double-strand breaks (DSBs) cause genetic instability that leads to malignant transformation or cell death. Cells respond to DSBs with the ordered recruitment of signalling and repair proteins to the site of lesion. Protein modification with ubiquitin is crucial for the signalling ...

  12. Induction of DNA double-strand breaks in hepatoma cell SMMC-7721 by accelerated carbon ion 12C6+

    International Nuclear Information System (INIS)

    Lei Suwen; Su Xu; Wang Jufang; Zhao Jing; Li Wenjian

    2004-01-01

    DNA lesions, especially DNA double-strand breaks (dsbs), are looked upon as the dominant molecular effect of radiation action. Dsbs mark the beginning of a cascade of cellular processes that either results in complete repair of the DNA damage or lead to deleterious stages such as mutation, transformation or even cell death. Changing the radiation quality can influence the radiosensitivity of cells in culture. Accelerated particles provide an excellent means of varying the ionization density of the test radiation. With ion beams, the molecular mechanisms underlying the biological consequences of high linear energy transfer (LET) irradiation can be studied and describing radiation action with biophysical models can be tested. In this paper, radiation-induced DNA double-strand breaks (dsbs) were measured in hepatoma SMMC-7721 cells by means of an experimental approach involving pulsed-field gel electrophoresis and densitometric scanning of ethidium bromide stained gels. With this set-up, the induction of dsbs was investigated in SMMC-7721 cells after irradiation with accelerated carbon ions with specific LET 70 keV/μm. The fraction of DNA retained was taken as quantitative measure to calculate absolute yields of induced DNA dsbs. Experimental data shows that the induction of DNA dsbs increasing with the dose of irradiation. Data are compared with published results on dsbs induction in mammalian cells by radiations of comparable LET

  13. Possible role(s) of nuclear matrix and DNA loop organization in fixation or repair of DNA double-strand breaks

    International Nuclear Information System (INIS)

    Malyapa, R.S.; Wright, W.D.; Roti Roti, J.L.

    1995-01-01

    DNA double-strand breaks produced by ionizing radiation are considered to be a critical radiation-induced lesion responsible, in part, for cell killing. However, the manner in which structures within the nucleus involving DNA organization contribute to the balance between fixation or repair of these critical lesions remains largely obscure. The repair process requires both functional enzymes and substrate availability, i.e., access to and orientation of damage sites. Therefore, the ability to repair damaged DNA could be influenced not only by DNA integrity but also by the spatial organization of DNA. Therefore, the authors investigated the possibility that radiation-induced DNA damage differentially affects DNA supercoiling ability in cells of differing radiosensitivities using radioresistant and radiosensitive mutants of different origins. This study was also designed to determine if differences in the composition of the nuclear matrix exist between cell lines of each origin. Results from these studies indicate that differences in the composition of the nuclear matrix proteins and DNA stability might be related to intrinsic radiation resistance

  14. Inactivation of the DNA-repair gene MGMT and the clinical response of gliomas to alkylating agents.

    Science.gov (United States)

    Esteller, M; Garcia-Foncillas, J; Andion, E; Goodman, S N; Hidalgo, O F; Vanaclocha, V; Baylin, S B; Herman, J G

    2000-11-09

    The DNA-repair enzyme O6-methylguanine-DNA methyltransferase (MGMT) inhibits the killing of tumor cells by alkylating agents. MGMT activity is controlled by a promoter; methylation of the promoter silences the gene in cancer, and the cells no longer produce MGMT. We examined gliomas to determine whether methylation of the MGMT promoter is related to the responsiveness of the tumor to alkylating agents. We analyzed the MGMT promoter in tumor DNA by a methylation-specific polymerase-chain-reaction assay. The gliomas were obtained from patients who had been treated with carmustine (1,3-bis(2-chloroethyl)-1-nitrosourea, or BCNU). The molecular data were correlated with the clinical outcome. The MGMT promoter was methylated in gliomas from 19 of 47 patients (40 percent). This finding was associated with regression of the tumor and prolonged overall and disease-free survival. It was an independent and stronger prognostic factor than age, stage, tumor grade, or performance status. Methylation of the MGMT promoter in gliomas is a useful predictor of the responsiveness of the tumors to alkylating agents.

  15. IDN2 Interacts with RPA and Facilitates DNA Double-Strand Break Repair by Homologous Recombination in Arabidopsis.

    Science.gov (United States)

    Liu, Mingming; Ba, Zhaoqing; Costa-Nunes, Pedro; Wei, Wei; Li, Lanxia; Kong, Fansi; Li, Yan; Chai, Jijie; Pontes, Olga; Qi, Yijun

    2017-03-01

    Repair of DNA double-strand breaks (DSBs) is critical for the maintenance of genome integrity. We previously showed that DSB-induced small RNAs (diRNAs) facilitate homologous recombination-mediated DSB repair in Arabidopsis thaliana Here, we show that INVOLVED IN DE NOVO2 (IDN2), a double-stranded RNA binding protein involved in small RNA-directed DNA methylation, is required for DSB repair in Arabidopsis. We find that IDN2 interacts with the heterotrimeric replication protein A (RPA) complex. Depletion of IDN2 or the diRNA binding ARGONAUTE2 leads to increased accumulation of RPA at DSB sites and mislocalization of the recombination factor RAD51. These findings support a model in which IDN2 interacts with RPA and facilitates the release of RPA from single-stranded DNA tails and subsequent recruitment of RAD51 at DSB sites to promote DSB repair. © 2017 American Society of Plant Biologists. All rights reserved.

  16. Fumarase is involved in DNA double-strand break resection through a functional interaction with Sae2

    DEFF Research Database (Denmark)

    Leshets, Michael; Ramamurthy, Dharanidharan; Lisby, Michael

    2018-01-01

    One of the most severe forms of DNA damage is the double-strand break (DSB). Failure to properly repair the damage can cause mutation, gross chromosomal rearrangements and lead to the development of cancer. In eukaryotes, homologous recombination (HR) and non-homologous end joining (NHEJ) are the......One of the most severe forms of DNA damage is the double-strand break (DSB). Failure to properly repair the damage can cause mutation, gross chromosomal rearrangements and lead to the development of cancer. In eukaryotes, homologous recombination (HR) and non-homologous end joining (NHEJ......) are the main DSB repair pathways. Fumarase is a mitochondrial enzyme which functions in the tricarboxylic acid cycle. Intriguingly, the enzyme can be readily detected in the cytosolic compartment of all organisms examined, and we have shown that cytosolic fumarase participates in the DNA damage response...

  17. Performance Characteristics of Different Anti-Double-Stranded DNA Antibody Assays in the Monitoring of Systemic Lupus Erythematosus

    Directory of Open Access Journals (Sweden)

    Michael Mahler

    2017-01-01

    Full Text Available Objective. We sought to evaluate different anti-double-stranded DNA assays for their performance characteristics in monitoring disease activity fluctuations in systemic lupus erythematosus (SLE. Methods. 36 active SLE patients were followed monthly. At each study visit (total n=371, blood was collected and disease activity was scored using the SELENA-SLEDAI (excluding anti-dsDNA or complement components and by a physician’s global assessment (PGA. Four anti-dsDNA tests were compared. Linear mixed-effects models with random intercept and fixed slopes were used to evaluate the relationship between the longitudinal fluctuations of disease activity and anti-dsDNA titers. Results. At enrollment, positivity for QUANTA Lite and high-avidity anti-dsDNA assay was both 64% and significantly lower than anti-dsDNA positivity by QUANTA Flash (83% and CLIFT (96%. Linear mixed-effects modeling indicated that the change in clinical SELENA-SLEDAI scores was associated with the titers of all anti-dsDNA with QUANTA Flash yielding the highest marginal R2 (0.15; p<0.01. QUANTA Flash was the only anti-dsDNA assay significantly associated with the change in PGA (marginal R2=0.05; p<0.01. Conclusion. These data indicate that anti-dsDNA antibodies determined by QUANTA Flash have a value in monitoring SLE disease activity.

  18. Trex2 enables spontaneous sister chromatid exchanges without facilitating DNA double-strand break repair.

    Science.gov (United States)

    Dumitrache, Lavinia C; Hu, Lingchuan; Son, Mi Young; Li, Han; Wesevich, Austin; Scully, Ralph; Stark, Jeremy; Hasty, Paul

    2011-08-01

    Trex2 is a 3' → 5' exonuclease that removes 3'-mismatched sequences in a biochemical assay; however, its biological function remains unclear. To address biology we previously generated trex2(null) mouse embryonic stem (ES) cells and expressed in these cells wild-type human TREX2 cDNA (Trex2(hTX2)) or cDNA with a single-amino-acid change in the catalytic domain (Trex2(H188A)) or in the DNA-binding domain (Trex2(R167A)). We found the trex2(null) and Trex2(H188A) cells exhibited spontaneous broken chromosomes and trex2(null) cells exhibited spontaneous chromosomal rearrangements. We also found ectopically expressed human TREX2 was active at the 3' ends of I-SceI-induced chromosomal double-strand breaks (DSBs). Therefore, we hypothesized Trex2 participates in DNA DSB repair by modifying 3' ends. This may be especially important for ends with damaged nucleotides. Here we present data that are unexpected and prompt a new model. We found Trex2-altered cells (null, H188A, and R167A) were not hypersensitive to camptothecin, a type-1 topoisomerase inhibitor that induces DSBs at replication forks. In addition, Trex2-altered cells were not hypersensitive to γ-radiation, an agent that causes DSBs throughout the cell cycle. This observation held true even in cells compromised for one of the two major DSB repair pathways: homology-directed repair (HDR) or nonhomologous end joining (NHEJ). Trex2 deletion also enhanced repair of an I-SceI-induced DSB by both HDR and NHEJ without affecting pathway choice. Interestingly, however, trex2(null) cells exhibited reduced spontaneous sister chromatid exchanges (SCEs) but this was not due to a defect in HDR-mediated crossing over. Therefore, reduced spontaneous SCE could be a manifestation of the same defect that caused spontaneous broken chromosomes and spontaneous chromosomal rearrangements. These unexpected data suggest Trex2 does not enable DSB repair and prompt a new model that posits Trex2 suppresses the formation of broken

  19. A newly identified DNA ligase of Saccharomyces cerevisiae involved in RAD52-independent repair of DNA double-strand breaks

    Science.gov (United States)

    Schär, Primo; Herrmann, Gernot; Daly, Graham; Lindahl, Tomas

    1997-01-01

    Eukaryotic DNA ligases are ATP-dependent DNA strand-joining enzymes that participate in DNA replication, repair, and recombination. Whereas mammalian cells contain several different DNA ligases, encoded by at least three distinct genes, only one DNA ligase has been detected previously in either budding yeast or fission yeast. Here, we describe a newly identified nonessential Saccharomyces cerevisiae gene that encodes a DNA ligase distinct from the CDC9 gene product. This DNA ligase shares significant amino acid sequence homology with human DNA ligase IV; accordingly, we designate the yeast gene LIG4. Recombinant LIG4 protein forms a covalent enzyme-AMP complex and can join a DNA single-strand break in a DNA/RNA hybrid duplex, the preferred substrate in vitro. Disruption of the LIG4 gene causes only marginally increased cellular sensitivity to several DNA damaging agents, and does not further sensitize cdc9 or rad52 mutant cells. In contrast, lig4 mutant cells have a 1000-fold reduced capacity for correct recircularization of linearized plasmids by illegitimate end-joining after transformation. Moreover, homozygous lig4 mutant diploids sporulate less efficiently than isogenic wild-type cells, and show retarded progression through meiotic prophase I. Spore viability is normal, but lig4 mutants appear to produce a higher proportion of tetrads with only three viable spores. The mutant phenotypes are consistent with functions of LIG4 in an illegitimate DNA end-joining pathway and ensuring efficient meiosis. PMID:9271115

  20. The opportunistic pathogen Pseudomonas aeruginosa activates the DNA double-strand break signaling and repair pathway in infected cells

    International Nuclear Information System (INIS)

    Elsen, S.; Collin-Faure, V.; Gidrol, X.; Lemercier, C.

    2013-01-01

    Highly hazardous DNA double-strand breaks can be induced in eukaryotic cells by a number of agents including pathogenic bacterial strains. We have investigated the genotoxic potential of Pseudomonas aeruginosa, an opportunistic pathogen causing devastating nosocomial infections in cystic fibrosis or immunocompromised patients. Our data revealed that infection of immune or epithelial cells by P. aeruginosa triggered DNA strand breaks and phosphorylation of histone H2AX (γH2AX), a marker of DNA double-strand breaks. Moreover, it induced formation of discrete nuclear repair foci similar to gamma-irradiation-induced foci, and containing γH2AX and 53BP1, an adaptor protein mediating the DNA-damage response pathway. Gene deletion, mutagenesis, and complementation in P. aeruginosa identified ExoS bacterial toxin as the major factor involved in γH2AX induction. Chemical inhibition of several kinases known to phosphorylate H2AX demonstrated that Ataxia Telangiectasia Mutated (ATM) was the principal kinase in P. aeruginosa-induced H2AX phosphorylation. Finally, infection led to ATM kinase activation by an auto-phosphorylation mechanism. Together, these data show for the first time that infection by P. aeruginosa activates the DNA double-strand break repair machinery of the host cells. This novel information sheds new light on the consequences of P. aeruginosa infection in mammalian cells. As pathogenic Escherichia coli or carcinogenic Helicobacter pylori can alter genome integrity through DNA double-strand breaks, leading to chromosomal instability and eventually cancer, our findings highlight possible new routes for further investigations of P. aeruginosa in cancer biology and they identify ATM as a potential target molecule for drug design. (authors)

  1. Division-induced DNA double strand breaks in the chromosome terminus region of Escherichia coli lacking RecBCD DNA repair enzyme.

    Directory of Open Access Journals (Sweden)

    Anurag Kumar Sinha

    2017-10-01

    Full Text Available Marker frequency analysis of the Escherichia coli recB mutant chromosome has revealed a deficit of DNA in a specific zone of the terminus, centred on the dif/TerC region. Using fluorescence microscopy of a marked chromosomal site, we show that the dif region is lost after replication completion, at the time of cell division, in one daughter cell only, and that the phenomenon is transmitted to progeny. Analysis by marker frequency and microscopy shows that the position of DNA loss is not defined by the replication fork merging point since it still occurs in the dif/TerC region when the replication fork trap is displaced in strains harbouring ectopic Ter sites. Terminus DNA loss in the recB mutant is also independent of dimer resolution by XerCD at dif and of Topo IV action close to dif. It occurs in the terminus region, at the point of inversion of the GC skew, which is also the point of convergence of specific sequence motifs like KOPS and Chi sites, regardless of whether the convergence of GC skew is at dif (wild-type or a newly created sequence. In the absence of FtsK-driven DNA translocation, terminus DNA loss is less precisely targeted to the KOPS convergence sequence, but occurs at a similar frequency and follows the same pattern as in FtsK+ cells. Importantly, using ftsIts, ftsAts division mutants and cephalexin treated cells, we show that DNA loss of the dif region in the recB mutant is decreased by the inactivation of cell division. We propose that it results from septum-induced chromosome breakage, and largely contributes to the low viability of the recB mutant.

  2. DNA Methylation and Gene Expression Profiling of Ewing Sarcoma Primary Tumors Reveal Genes That Are Potential Targets of Epigenetic Inactivation

    Directory of Open Access Journals (Sweden)

    Nikul Patel

    2012-01-01

    Full Text Available The role of aberrant DNA methylation in Ewing sarcoma is not completely understood. The methylation status of 503 genes in 52 formalin-fixed paraffin-embedded EWS tumors and 3 EWS cell lines was compared to human mesenchymal stem cell primary cultures (hMSCs using bead chip methylation analysis. Relative expression of methylated genes was assessed in 5-Aza-2-deoxycytidine-(5-AZA-treated EWS cell lines and in a cohort of primary EWS samples and hMSCs by gene expression and quantitative RT-PCR. 129 genes demonstrated statistically significant hypermethylation in EWS tumors compared to hMSCs. Thirty-six genes were profoundly methylated in EWS and unmethylated in hMSCs. 5-AZA treatment of EWS cell lines resulted in upregulation of expression of hundreds of genes including 162 that were increased by at least 2-fold. The expression of 19 of 36 candidate hypermethylated genes was increased following 5-AZA. Analysis of gene expression from an independent cohort of tumors confirmed decreased expression of six of nineteen hypermethylated genes (AXL, COL1A1, CYP1B1, LYN, SERPINE1, and VCAN. Comparing gene expression and DNA methylation analyses proved to be an effective way to identify genes epigenetically regulated in EWS. Further investigation is ongoing to elucidate the role of these epigenetic alterations in EWS pathogenesis.

  3. Elucidaton of DNA methylation changes in response to ionizng radiation induced double strand breaks

    International Nuclear Information System (INIS)

    Herrlitz, Maren Linda

    2014-01-01

    would be an effect of overexpression or be indicative of a possible function in these nuclear subcompartments is yet to be elucidated. Additionally, by using flow cytometry analysis, exposure to IR and concomitant overexpression of TET2CD-GFP strongly induced 5hmC formation, therefore suggesting a function of TET2 in response to irradiation. Recruitment analysis showed that the TET2 catalytic domain was recruited to UV laser-induced but not X-rays- or heavy ion-induced damage sites. Endogenous TET2, which was analyzed in high TET2 expressing human fibroblasts, was recruited to damage sites after irradiation with heavy ions or X-rays. As 5hmC is the direct product of the catalytic activity of TET enzymes, local 5hmC formation and abundance at damage sites was investigated. It was observed that 5hmC accumulated at heavy ion- as well as X-ray-induced DNA double strand breaks (DSBs). In addition, investigating 5hmC foci over time after irradiation with X-rays revealed that 5hmC formation and kinetics is similar to that of γH2AX foci, whereby every 5hmC focus co-localized with γH2AX. However, this did not hold true for all γH2AX foci, whose total number was always higher than that of 5hmC. Furthermore, 5hmC (and γH2AX) foci formation was almost unaffected by the inhibition of DNA-PKcs' enzymatic activity. Conversely, 5hmC and γH2AX foci persistence was significantly delayed after DNA-PKcs inhibition. Results obtained in this thesis show that DNA methylation changes (5hmC formation) take place within the time frame of one replication cycle after exposure to IR and that these changes can be observed at sites of DSBs. 5hmC at DSBs might be formed by the oxidative function of TET2, which was shown to be recruited to DSBs. However, involvement of the other TET enzymes in 5hmC production cannot be excluded. Therefore, these results suggest a role of 5hmC in the response to IR induced DSBs, whereby the here presented data suggest that the fast, radiation induced demethylation

  4. Elucidaton of DNA methylation changes in response to ionizng radiation induced double strand breaks

    Energy Technology Data Exchange (ETDEWEB)

    Herrlitz, Maren Linda

    2014-07-04

    would be an effect of overexpression or be indicative of a possible function in these nuclear subcompartments is yet to be elucidated. Additionally, by using flow cytometry analysis, exposure to IR and concomitant overexpression of TET2CD-GFP strongly induced 5hmC formation, therefore suggesting a function of TET2 in response to irradiation. Recruitment analysis showed that the TET2 catalytic domain was recruited to UV laser-induced but not X-rays- or heavy ion-induced damage sites. Endogenous TET2, which was analyzed in high TET2 expressing human fibroblasts, was recruited to damage sites after irradiation with heavy ions or X-rays. As 5hmC is the direct product of the catalytic activity of TET enzymes, local 5hmC formation and abundance at damage sites was investigated. It was observed that 5hmC accumulated at heavy ion- as well as X-ray-induced DNA double strand breaks (DSBs). In addition, investigating 5hmC foci over time after irradiation with X-rays revealed that 5hmC formation and kinetics is similar to that of γH2AX foci, whereby every 5hmC focus co-localized with γH2AX. However, this did not hold true for all γH2AX foci, whose total number was always higher than that of 5hmC. Furthermore, 5hmC (and γH2AX) foci formation was almost unaffected by the inhibition of DNA-PKcs' enzymatic activity. Conversely, 5hmC and γH2AX foci persistence was significantly delayed after DNA-PKcs inhibition. Results obtained in this thesis show that DNA methylation changes (5hmC formation) take place within the time frame of one replication cycle after exposure to IR and that these changes can be observed at sites of DSBs. 5hmC at DSBs might be formed by the oxidative function of TET2, which was shown to be recruited to DSBs. However, involvement of the other TET enzymes in 5hmC production cannot be excluded. Therefore, these results suggest a role of 5hmC in the response to IR induced DSBs, whereby the here presented data suggest that the fast, radiation induced

  5. γH2AX foci as a marker for DNA double-strand breaks

    International Nuclear Information System (INIS)

    Deckbar, Dorothee

    2009-01-01

    Full text: The DNA double-strand break (DSB) is the most deleterious lesion of all DNA damages. Left unrepaired or being mis-rejoined it can lead to chromosome aberrations which compromise the genomic stability and carry the potential to initiate carcinogenesis. So DSB repair mechanisms are under intensive investigation for many years. As older techniques had to utilize non-physiological doses to monitor DSB repair, they did not allow repair studies on the cellular level or after in vivo irradiation. But during the last years, an upcoming method allows the detection of a single DSB after physiologically relevant doses. To maintain the genomic integrity after the occurrence of a DSB, cellular mechanisms have evolved that detect and repair DSBs and even halt cell cycle progression to provide time for repair. In these processes, one of the first steps is the phosphorylation of the histone H2AX at serine 139 (γH2AX). Within minutes after DSB induction, large numbers of H2AX molecules are phosphorylated around the break site leading to the accumulation of proteins involved in chromatin remodelling, to damage signal amplification, and eventually to checkpoint activation and DSB repair. The finding that DSB-surrounding proteins can be visualized as foci in immunofluorescence microscopy opened up new opportunities in cancer biology and radiation biology. It was now for the first time possible to measure DSB repair after physiologically relevant doses of ionizing radiation, i.e. after doses used for therapeutic as well as for diagnostic purposes. First reports even describe the measurement of DSB repair after in vivo irradiation in mice and humans. This did not only improve the basic research investigating the mechanisms of DSB repair but also the research on low-dose effects and radiation protection. So the potential of γH2AX foci analysis as a predictive marker for radiosensitivity or radiation induced side effects is actually discussed. (author)

  6. DNA double-strand break response in stem cells: mechanisms to maintain genomic integrity.

    Science.gov (United States)

    Nagaria, Pratik; Robert, Carine; Rassool, Feyruz V

    2013-02-01

    Embryonic stem cells (ESCs) represent the point of origin of all cells in a given organism and must protect their genomes from both endogenous and exogenous genotoxic stress. DNA double-strand breaks (DSBs) are one of the most lethal forms of damage, and failure to adequately repair DSBs would not only compromise the ability of SCs to self-renew and differentiate, but will also lead to genomic instability and disease. Herein, we describe the mechanisms by which ESCs respond to DSB-inducing agents such as reactive oxygen species (ROS) and ionizing radiation, compared to somatic cells. We will also discuss whether the DSB response is fully reprogrammed in induced pluripotent stem cells (iPSCs) and the role of the DNA damage response (DDR) in the reprogramming of these cells. ESCs have distinct mechanisms to protect themselves against DSBs and oxidative stress compared to somatic cells. The response to damage and stress is crucial for the maintenance of self-renewal and differentiation capacity in SCs. iPSCs appear to reprogram some of the responses to genotoxic stress. However, it remains to be determined if iPSCs also retain some DDR characteristics of the somatic cells of origin. The mechanisms regulating the genomic integrity in ESCs and iPSCs are critical for its safe use in regenerative medicine and may shed light on the pathways and factors that maintain genomic stability, preventing diseases such as cancer. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. DNMT3AR882H mutant and Tet2 inactivation cooperate in the deregulation of DNA methylation control to induce lymphoid malignancies in mice

    DEFF Research Database (Denmark)

    Scourzic, L; Couronné, L; Pedersen, Marianne Terndrup

    2016-01-01

    malignancies with one mouse developing an AITL-like disease, two mice presenting acute myeloid leukemia (AML)-like and two others T-cell acute lymphoblastic leukemia (T-ALL)-like diseases within 6 months following transplantation. Serial transplantations of DNMT3A(R882H) Tet2(-/-) progenitors led...... to a differentiation bias toward the T-cell compartment, eventually leading to AITL-like disease in 9/12 serially transplanted recipients. Expression profiling suggested that DNMT3A(R882H) Tet2(-/-) T-ALLs resemble those of NOTCH1 mutant. Methylation analysis of DNMT3A(R882H) Tet2(-/-) T-ALLs showed a global increase...... in DNA methylation affecting tumor suppressor genes and local hypomethylation affecting genes involved in the Notch pathway. Our data confirm the transformation potential of DNMT3A(R882H) Tet2(-/-) progenitors and represent the first cooperative model in mice involving Tet2 inactivation driving lymphoid...

  8. Female meiotic sex chromosome inactivation in chicken.

    Directory of Open Access Journals (Sweden)

    Sam Schoenmakers

    2009-05-01

    Full Text Available During meiotic prophase in male mammals, the heterologous X and Y chromosomes remain largely unsynapsed, and meiotic sex chromosome inactivation (MSCI leads to formation of the transcriptionally silenced XY body. In birds, the heterogametic sex is female, carrying Z and W chromosomes (ZW, whereas males have the homogametic ZZ constitution. During chicken oogenesis, the heterologous ZW pair reaches a state of complete heterologous synapsis, and this might enable maintenance of transcription of Z- and W chromosomal genes during meiotic prophase. Herein, we show that the ZW pair is transiently silenced, from early pachytene to early diplotene using immunocytochemistry and gene expression analyses. We propose that ZW inactivation is most likely achieved via spreading of heterochromatin from the W on the Z chromosome. Also, persistent meiotic DNA double-strand breaks (DSBs may contribute to silencing of Z. Surprisingly, gammaH2AX, a marker of DSBs, and also the earliest histone modification that is associated with XY body formation in mammalian and marsupial spermatocytes, does not cover the ZW during the synapsed stage. However, when the ZW pair starts to desynapse, a second wave of gammaH2AX accumulates on the unsynapsed regions of Z, which also show a reappearance of the DSB repair protein RAD51. This indicates that repair of meiotic DSBs on the heterologous part of Z is postponed until late pachytene/diplotene, possibly to avoid recombination with regions on the heterologously synapsed W chromosome. Two days after entering diplotene, the Z looses gammaH2AX and shows reactivation. This is the first report of meiotic sex chromosome inactivation in a species with female heterogamety, providing evidence that this mechanism is not specific to spermatogenesis. It also indicates the presence of an evolutionary force that drives meiotic sex chromosome inactivation independent of the final achievement of synapsis.

  9. 125I-induced DNA double strand breaks: use in calibration of the neutral filter elution technique and comparison with X-ray induced breaks

    International Nuclear Information System (INIS)

    Radford, I.R.; Hodgson, G.S.

    1985-01-01

    The neutral filter elution assay, for measurement of DNA double strand breakage, has been calibrated using mouse L cells and Chinese hamster V79 cells labelled with [ 125 I]dUrd and then held at liquid nitrogen temperature to accumulate decays. The basis of the calibration is the observation that each 125 I decay, occurring in DNA, produces a DNA double strand break. Linear relationships between 125 I decays per cell and lethal lesions per cell (minus natural logarithm survival) and the level of elution, were found. Using the calibration data, it was calculated that the yield of DNA double strand breaks after X-irradiation of both cell types was from 6 to 9 x 10 -12 DNA double strand breaks per Gy per dalton of DNA, for doses greater than 6 Gy. Neutral filter elution and survival data for X-irradiated and 125 I-labelled cells suggested that the relationships between lethal lesions and DNA double strand breakage were significantly different for both cell types. An attempt was made to study the repair kinetics for 125 I-induced DNA double strand breaks, but was frustrated by the rapid DNA degradation which occurs in cells that have been killed by the freezing-thawing process. (author)

  10. DNA-incorporated 125I induces more than one double-strand break per decay in mammalian cells.

    Science.gov (United States)

    Elmroth, Kecke; Stenerlöw, Bo

    2005-04-01

    The Auger-electron emitter 125I releases cascades of 20 electrons per decay that deposit a great amount of local energy, and for DNA-incorporated 125I, approximately one DNA double-strand break (DSB) is produced close to the decay site. To investigate the potential of 125I to induce additional DSBs within adjacent chromatin structures in mammalian cells, we applied DNA fragment-size analysis based on pulsed-field gel electrophoresis (PFGE) of hamster V79-379A cells exposed to DNA-incorporated 125IdU. After accumulation of decays at -70 degrees C in the presence of 10% DMSO, there was a non-random distribution of DNA fragments with an excess of fragments even higher. In contrast, using a conventional low-resolution assay without measurement of smaller DNA fragments, the yield was close to one DSB/decay. We conclude that a large fraction of the DSBs induced by DNA-incorporated 125I are nonrandomly distributed and that significantly more than one DSB/decay is induced in an intact cell. Thus, in addition to DSBs produced close to the decay site, DSBs may also be induced within neighboring chromatin fibers, releasing smaller DNA fragments that are not detected by conventional DSB assays.

  11. Phenotypic Analysis of ATM Protein Kinase in DNA Double-Strand Break Formation and Repair.

    Science.gov (United States)

    Mian, Elisabeth; Wiesmüller, Lisa

    2017-01-01

    Ataxia telangiectasia mutated (ATM) encodes a serine/threonine protein kinase, which is involved in various regulatory processes in mammalian cells. Its best-known role is apical activation of the DNA damage response following generation of DNA double-strand breaks (DSBs). When DSBs appear, sensor and mediator proteins are recruited, activating transducers such as ATM, which in turn relay a widespread signal to a multitude of downstream effectors. ATM mutation causes Ataxia telangiectasia (AT), whereby the disease phenotype shows differing characteristics depending on the underlying ATM mutation. However, all phenotypes share progressive neurodegeneration and marked predisposition to malignancies at the organismal level and sensitivity to ionizing radiation and chromosome aberrations at the cellular level. Expression and localization of the ATM protein can be determined via western blotting and immunofluorescence microscopy; however, detection of subtle alterations such as resulting from amino acid exchanges rather than truncating mutations requires functional testing. Previous studies on the role of ATM in DSB repair, which connects with radiosensitivity and chromosomal stability, gave at first sight contradictory results. To systematically explore the effects of clinically relevant ATM mutations on DSB repair, we engaged a series of lymphoblastoid cell lines (LCLs) derived from AT patients and controls. To examine DSB repair both in a quantitative and qualitative manners, we used an EGFP-based assay comprising different substrates for distinct DSB repair mechanisms. In this way, we demonstrated that particular signaling defects caused by individual ATM mutations led to specific DSB repair phenotypes. To explore the impact of ATM on carcinogenic chromosomal aberrations, we monitored chromosomal breakage at a breakpoint cluster region hotspot within the MLL gene that has been associated with therapy-related leukemia. PCR-based MLL-breakage analysis of HeLa cells

  12. Constitutional chromothripsis rearrangements involve clustered double-stranded DNA breaks and nonhomologous repair mechanisms.

    Science.gov (United States)

    Kloosterman, Wigard P; Tavakoli-Yaraki, Masoumeh; van Roosmalen, Markus J; van Binsbergen, Ellen; Renkens, Ivo; Duran, Karen; Ballarati, Lucia; Vergult, Sarah; Giardino, Daniela; Hansson, Kerstin; Ruivenkamp, Claudia A L; Jager, Myrthe; van Haeringen, Arie; Ippel, Elly F; Haaf, Thomas; Passarge, Eberhard; Hochstenbach, Ron; Menten, Björn; Larizza, Lidia; Guryev, Victor; Poot, Martin; Cuppen, Edwin

    2012-06-28

    Chromothripsis represents a novel phenomenon in the structural variation landscape of cancer genomes. Here, we analyze the genomes of ten patients with congenital disease who were preselected to carry complex chromosomal rearrangements with more than two breakpoints. The rearrangements displayed unanticipated complexity resembling chromothripsis. We find that eight of them contain hallmarks of multiple clustered double-stranded DNA breaks (DSBs) on one or more chromosomes. In addition, nucleotide resolution analysis of 98 breakpoint junctions indicates that break repair involves nonhomologous or microhomology-mediated end joining. We observed that these eight rearrangements are balanced or contain sporadic deletions ranging in size between a few hundred base pairs and several megabases. The two remaining complex rearrangements did not display signs of DSBs and contain duplications, indicative of rearrangement processes involving template switching. Our work provides detailed insight into the characteristics of chromothripsis and supports a role for clustered DSBs driving some constitutional chromothripsis rearrangements. Copyright © 2012 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Physical and biological parameters affecting DNA double strand break misrejoining in mammalian cells

    International Nuclear Information System (INIS)

    Kuehne, M.; Rothkamm, K.; Loebrich, M.

    2002-01-01

    In an attempt to investigate the effect of radiation quality, dose and specific repair pathways on correct and erroneous rejoining of DNA double strand breaks (DSBs), an assay was applied that allows the identification and quantification of incorrectly rejoined DSB ends produced by ionising radiation. While substantial misrejoining occurs in mammalian cells after high acute irradiation doses, decreasing misrejoining frequencies were observed in dose fractionation experiments with X rays. In line with this finding, continuous irradiation with gamma rays at low dose rate leads to non detectable misrejoining. This indicates that the probability for a DSB to be misrejoined decreases drastically when DSBs are separated in time and space. The same dose fractionation approach was applied to determine DSB misrejoining after a particle exposure. In contrast to the results with X rays, there was no significant decrease in DSB misrejoining with increasing fractionation. This suggests that DSB misrejoining after a irradiation is not significantly affected by a separation of particle tracks. To identify the enzymatic pathways that are involved in DSB misrejoining, cell lines deficient in non-homologous end-joining (NHEJ) were examined. After high X ray doses, DSB misrejoining is considerable reduced in NHEJ mutants. Low dose rate experiments show elevated DSB misrejoining in NHEJ mutants compared with wild-type cells. The authors propose that NHEJ serves as an efficient pathway for rejoining correct break ends in situations of separated breaks but generates genomic rearrangements if DSBs are close in time and space. (author)

  14. Inhibition of APOBEC3G Activity Impedes Double-Strand DNA Repair

    Science.gov (United States)

    Prabhu, Ponnandy; Shandilya, Shivender; Britan-Rosich, Elena; Nagler, Adi; Schiffer, Celia A.; Kotler, Moshe

    2015-01-01

    The cellular cytidine deaminase APOBEC3G (A3G) was first described as an anti-HIV-1 restriction factor by directly deaminating reverse transcripts of the viral genome. HIV-1 Vif neutralizes the activity of A3G, primarily by mediating degradation of A3G to establish effective infection in host target cells. Lymphoma cells, which express high amounts of A3G, can restrict Vif-deficient HIV-1. Interestingly, these cells are more stable in the face of treatments that result in dsDNA damage, such as ionizing irradiation (IR) and chemotherapies. Previously, we showed that the Vif-derived peptide (Vif25-39) efficiently inhibits A3G deamination, and increases sensitivity of lymphoma cells to IR. In the current study, we show that additional peptides derived from Vif, A3G and A3F, which contain the LYYF motif, inhibit deamination activity. Each residue in the Vif25-39 sequence moderately contributes to the inhibitory effect, while, replacing a single amino acid in the LYYF motif completely abrogate inhibition of deamination. Treatment of A3G-expressing lymphoma cells exposed to ionizing radiation with the new inhibitory peptides reduces double-strand break (DSB) repair after radiation. Incubation of cultured irradiated lymphoma cells with peptides that inhibit DSB repair halts their propagation. These results suggest that A3G may be a potential therapeutic target amenable to peptide and peptidomimetic inhibition. PMID:26460502

  15. Dissimilar kinetic behavior of electrically manipulated single- and double-stranded DNA tethered to a gold surface.

    Science.gov (United States)

    Rant, Ulrich; Arinaga, Kenji; Tornow, Marc; Kim, Yong Woon; Netz, Roland R; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard

    2006-05-15

    We report on the electrical manipulation of single- and double-stranded oligodeoxynucleotides that are end tethered to gold surfaces in electrolyte solution. The response to alternating repulsive and attractive electric surface fields is studied by time-resolved fluorescence measurements, revealing markedly distinct dynamics for the flexible single-stranded and stiff double-stranded DNA, respectively. Hydrodynamic simulations rationalize this finding and disclose two different kinetic mechanisms: stiff polymers undergo rotation around the anchoring pivot point; flexible polymers, on the other hand, are pulled onto the attracting surface segment by segment.

  16. Repair on the go: E. coli maintains a high proliferation rate while repairing a chronic DNA double-strand break.

    Directory of Open Access Journals (Sweden)

    Elise Darmon

    Full Text Available DNA damage checkpoints exist to promote cell survival and the faithful inheritance of genetic information. It is thought that one function of such checkpoints is to ensure that cell division does not occur before DNA damage is repaired. However, in unicellular organisms, rapid cell multiplication confers a powerful selective advantage, leading to a dilemma. Is the activation of a DNA damage checkpoint compatible with rapid cell multiplication? By uncoupling the initiation of DNA replication from cell division, the Escherichia coli cell cycle offers a solution to this dilemma. Here, we show that a DNA double-strand break, which occurs once per replication cycle, induces the SOS response. This SOS induction is needed for cell survival due to a requirement for an elevated level of expression of the RecA protein. Cell division is delayed, leading to an increase in average cell length but with no detectable consequence on mutagenesis and little effect on growth rate and viability. The increase in cell length caused by chronic DNA double-strand break repair comprises three components: two types of increase in the unit cell size, one independent of SfiA and SlmA, the other dependent of the presence of SfiA and the absence of SlmA, and a filamentation component that is dependent on the presence of either SfiA or SlmA. These results imply that chronic checkpoint induction in E. coli is compatible with rapid cell multiplication. Therefore, under conditions of chronic low-level DNA damage, the SOS checkpoint operates seamlessly in a cell cycle where the initiation of DNA replication is uncoupled from cell division.

  17. scid mutation in mice confers hypersensitivity to ionizing radiation and a deficiency in DNA double-strand break repair

    International Nuclear Information System (INIS)

    Biedermann, K.A.; Sun, J.R.; Giaccia, A.J.; Tosto, L.M.; Brown, J.M.

    1991-01-01

    C.B-17 severe combined immunodeficient (scid) mice carry the scid mutation and are severely deficient in both T cell- and B cell-mediated immunity, apparently as a result of defective V(D)J joining of the immunoglobulin and T-cell receptor gene elements. In the present studies, we have defined the tissue, cellular, and molecular basis of another characteristic of these mice: their hypersensitivity to ionizing radiation. Bone marrow stem cells, intestinal crypt cells, and epithelial skin cells from scid mice are 2- to 3-fold more sensitive when irradiated in situ than are congenic BALB/c or C.B-17 controls. Two independently isolated embryo fibroblastic scid mouse cell lines display similar hypersensitivities to gamma-rays. In addition, these cell lines are sensitive to cell killing by bleomycin, which also produces DNA strand breaks, but not by the DNA crosslinking agent mitomycin C or UV irradiation. Measurement of the rejoining of gamma-ray-induced DNA double-strand breaks by pulsed-field gel electrophoresis indicates that these animals are defective in this repair system. This suggests that the gamma-ray sensitivity of the scid mouse fibroblasts could be the result of reduced repair of DNA double-strand breaks. Therefore, a common factor may participate in both the repair of DNA double-strand breaks as well as V(D)J rejoining during lymphocyte development. This murine autosomal recessive mutation should prove extremely useful in fundamental studies of radiation-induced DNA damage and repair

  18. DNA and protein binding, double-strand DNA cleavage and cytotoxicity of mixed ligand copper(II) complexes of the antibacterial drug nalidixic acid.

    Science.gov (United States)

    Loganathan, Rangasamy; Ganeshpandian, Mani; Bhuvanesh, Nattamai S P; Palaniandavar, Mallayan; Muruganantham, Amsaveni; Ghosh, Swapan K; Riyasdeen, Anvarbatcha; Akbarsha, Mohammad Abdulkader

    2017-09-01

    The water soluble mixed ligand complexes [Cu(nal)(diimine)(H 2 O)](ClO 4 ) 1-4, where H(nal) is nalidixic acid and diimine is 2,2'-bipyridine (1), 1,10-phenanthroline (2), 5,6-dimethyl-1,10-phenanthroline (3), and 3,4,7,8-tetramethyl-1,10-phenanthroline (4), have been isolated. The coordination geometry around Cu(II) in 1 and that in the Density Functional Theory optimized structures of 1-4 has been assessed as square pyramidal. The trend in DNA binding constants (K b ) determined using absorption spectral titration (K b : 1, 0.79±0.1base pair. In contrast, 3 and 4 are involved in intimate hydrophobic interaction with DNA through the methyl substituents on phen ring, which is supported by viscosity and protein binding studies. DNA docking studies imply that 4 is involved preferentially in DNA major groove binding while 1-3 in minor groove binding and that all the complexes, upon removing the axially coordinated water molecule, bind in the major groove. Interestingly, 3 and 4 display prominent double-strand DNA cleavage while 1 and 2 effect only single-strand DNA cleavage in the absence of an activator. The complexes 3 and 4 show cytotoxicity higher than 1 and 2 against human breast cancer cell lines (MCF-7). The complex 4 induces apoptotic mode of cell death in cancer cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Induction of DNA damage in γ-irradiated nuclei stripped of nuclear protein classes: differential modulation of double-strand break and DNA-protein crosslink formation

    International Nuclear Information System (INIS)

    Xue, L.-Y.; Friedman, L.R.; Oleinick, N.L.; Chiu, S.-M.

    1994-01-01

    The influence of chromatin proteins on the induction of DNA double-strand breaks (dsb) and DNA-protein crosslinks (dpc) by γ-radiation was investigated. Low molecular weight non-histone proteins and classes of histones were extracted with increasing concentrations of NaC1, whereas nuclear matrix proteins were not extractable even by 2.0 M NACl. The yield of dsb increased with progressive removal of proteins from chromatin. The data support our previous conclusion that nuclear matrix protein rather than the majority of the histones are the predominant substrates for dpc production, although the involvement of a subset of tightly bound histones (H3 and H4) has not been excluded. This finding demonstrates that chromatin proteins can differentially modify the yield of two types of radiation-induced DNA lesions. (author)

  20. The Mismatch-Binding Factor MutSβ Can Mediate ATR Activation in Response to DNA Double-Strand Breaks

    Czech Academy of Sciences Publication Activity Database

    Burdová, Kamila; Mihaljevic, B.; Sturzenegger, A.; Chappidi, N.; Janščák, Pavel

    2015-01-01

    Roč. 59, č. 4 (2015), s. 603-614 ISSN 1097-2765 R&D Projects: GA ČR GAP305/10/0281; GA ČR(CZ) GA14-05743S Grant - others:Oncosuisse(CH) KLS-02344-02-2009; Swiss National Science Foundation(CH) 31003A_146206; Novartis Foundation for Medical and Biological Research(CH) 11A16 Institutional support: RVO:68378050 Keywords : Ataxia telangiectasia-mutated and Rad3-related (ATR) protein kinase * DNA-damage response * DNA Double-Strand Breaks Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 13.958, year: 2015

  1. Enhancement of fluorescence quenching and exciplex formation in DNA major groove by double incorporation of modified fluorescent deoxyuridines.

    Science.gov (United States)

    Tanaka, Makiko; Oguma, Kazuhiro; Saito, Yoshio; Saito, Isao

    2012-06-15

    5-(1-Naphthalenylethynyl)-2'-deoxyuridine ((N)U) and 5-[(4-cyano-1-naphthalenyl)ethynyl]-2'-deoxyuridine ((CN)U) were synthesized and incorporated into oligodeoxynucleotides. Fluorescence emissions of modified duplexes containing double (N)U were efficiently quenched depending upon the sequence pattern of the naphthalenes in DNA major groove, as compared to the duplex possessing single (N)U. When one of the naphthalene moieties has a cyano substituent, the exciplex emission from the chromophores in DNA major groove was observed at longer wavelength. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Iodination as a probe for small regions of disrupted secondary structure in double-stranded DNA

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank; Nes, Ingolf F.; Wells, Robert D.

    1976-01-01

    Conditions were established where the thallium-catalyzed iodination of random coil DNA proceeded 100–200 times faster than for native DNA. This reaction was explored as a probe for localized regions of disrupted base pairs in duplex DNA. A heteroduplex was constructed between DNA fragments produced...

  3. Flexible double-headed cytosine-linked 2'-deoxycytidine nucleotides. Synthesis, polymerase incorporation to DNA and interaction with DNA methyltransferases

    Czech Academy of Sciences Publication Activity Database

    Kielkowski, Pavel; Cahová, Hana; Pohl, Radek; Hocek, Michal

    2016-01-01

    Roč. 24, č. 6 (2016), s. 1268-1276 ISSN 0968-0896 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * pyrimidines * DNA methyltransferases * DNA polymerases Subject RIV: CC - Organic Chemistry Impact factor: 2.930, year: 2016

  4. Arabidopsis DNA polymerase lambda mutant is mildly sensitive to DNA double strand breaks but defective in integration of a transgene

    Czech Academy of Sciences Publication Activity Database

    Furukawa, T.; Angelis, Karel; Britt, A.B.

    2015-01-01

    Roč. 6, MAY 27 (2015) ISSN 1664-462X R&D Projects: GA ČR GA13-06595S Institutional support: RVO:61389030 Keywords : DNA polymerase * DNA repair * Non homologous end joining Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.495, year: 2015

  5. The influence of bromodeoxyuridine on the induction and repair of DNA double-strand breaks in glioblastoma cells

    International Nuclear Information System (INIS)

    Nusser, N.N.; Bartkowiak, D.; Roettinger, E.M.

    2002-01-01

    Aims: To examine the dose response of DNA damage and its modification by the radiosensitizer, 5-bromo-2'-deoxyuridine (BrdU). The sensitizing mechanism is analyzed with regard to its influence on the induction and repair of DNA double-strand breaks (DSBs). Material and Methods: Cells from three different human glioblastoma lines, A7, LH and U87MG, were X-irradiated with and without exposure to BrdU. DNA fragments were separated by field-inversion gel electrophoresis (FIGE) and quantified by fluorometry immediately and 24 h after irradiation. Results: In all cell lines, the dose response followed a linear-quadratic rather than a purely linear function. BrdU-treated cells exhibited a significantly higher amount of mobile DNA. In repair experiments with and without BrdU, the amount of mobile DNA fell close to control values within 24 h. Conclusions: The linear-quadratic model appropriately describes the X-ray induced fragmentation of DNA. BrdU sensitizing acts predominantly by increasing DNA fragility, and not by impairing damage repair. The amount of DSBs persistent after 24 h of repair is minimal, even after highly cytotoxic doses. However, it appears to depend on the extent of initial damage, causing sensitized cells to retain more DSBs than unsensitized cells. (orig.)

  6. DNA double strand break repair is enhanced by P53 following induction by DNA damage and is dependent on the C-terminal domain of P53

    International Nuclear Information System (INIS)

    Wei Tang; Powell, Simon N.

    1996-01-01

    Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA

  7. Differential gene expression in a DNA double-strand-break repair mutant XRS-5 defective in Ku80. Analysis by cDNA microarray

    Energy Technology Data Exchange (ETDEWEB)

    Chan, John Y.H.; Chen, Lung-Kun; Chang, Jui-Feng [National Yang Ming Univ., Taipei, Taiwan (China). Inst. of Radiological Sciences] (and others)

    2001-12-01

    The ability of cells to rejoin DNA double-strand breaks (DSBs) usually correlates with their radiosensitivity. This correlation has been demonstrated in radiosensitive cells, including the Chinese hamster ovary mutant XRS-5. XRS-5 is defective in a DNA end-binding protein, Ku80, which is a component of a DNA-dependent protein kinase complex used for joining strand breaks. However, Ku80-deficient cells are known to be retarded in cell proliferation and growth as well as other yet to be identified defects. Using custom-made 600-gene cDNA microarray filters, we found differential gene expressions between the wild-type and XRS-5 cells. Defective Ku80 apparently affects the expression of several repair genes, including topoisomerase-I and -IIA, ERCC5, MLH1, and ATM. In contrast, other DNA repair-associated genes, such as GADD45A, EGR1 MDM2 and p53, were not affected. In addition, for large numbers of growth-associated genes, such as cyclins and clks, the growth factors and cytokines were also affected. Down-regulated expression was also found in several categories of seemingly unrelated genes, including apoptosis, angiogenesis, kinase and signaling, phosphatase, stress protein, proto-oncogenes and tumor suppressors, transcription and translation factors. A RT-PCR analysis confirmed that the XRS-5 cells used were defective in Ku80 expression. The diversified groups of genes being affected could mean that Ku80, a multi-functional DNA-binding protein, not only affects DNA repair, but is also involved in transcription regulation. Our data, taken together, indicate that there are specific genes being modulated in Ku80- deficient cells, and that some of the DNA repair pathways and other biological functions are apparently linked, suggesting that a defect in one gene could have global effects on many other processes. (author)

  8. Differential gene expression in a DNA double-strand-break repair mutant XRS-5 defective in Ku80. Analysis by cDNA microarray

    International Nuclear Information System (INIS)

    Chan, John Y.H.; Chen, Lung-Kun; Chang, Jui-Feng

    2001-01-01

    The ability of cells to rejoin DNA double-strand breaks (DSBs) usually correlates with their radiosensitivity. This correlation has been demonstrated in radiosensitive cells, including the Chinese hamster ovary mutant XRS-5. XRS-5 is defective in a DNA end-binding protein, Ku80, which is a component of a DNA-dependent protein kinase complex used for joining strand breaks. However, Ku80-deficient cells are known to be retarded in cell proliferation and growth as well as other yet to be identified defects. Using custom-made 600-gene cDNA microarray filters, we found differential gene expressions between the wild-type and XRS-5 cells. Defective Ku80 apparently affects the expression of several repair genes, including topoisomerase-I and -IIA, ERCC5, MLH1, and ATM. In contrast, other DNA repair-associated genes, such as GADD45A, EGR1 MDM2 and p53, were not affected. In addition, for large numbers of growth-associated genes, such as cyclins and clks, the growth factors and cytokines were also affected. Down-regulated expression was also found in several categories of seemingly unrelated genes, including apoptosis, angiogenesis, kinase and signaling, phosphatase, stress protein, proto-oncogenes and tumor suppressors, transcription and translation factors. A RT-PCR analysis confirmed that the XRS-5 cells used were defective in Ku80 expression. The diversified groups of genes being affected could mean that Ku80, a multi-functional DNA-binding protein, not only affects DNA repair, but is also involved in transcription regulation. Our data, taken together, indicate that there are specific genes being modulated in Ku80- deficient cells, and that some of the DNA repair pathways and other biological functions are apparently linked, suggesting that a defect in one gene could have global effects on many other processes. (author)

  9. Contribution of sleep to the repair of neuronal DNA double-strand breaks: evidence from flies and mice

    OpenAIRE

    Bellesi, Michele; Bushey, Daniel; Chini, Mattia; Tononi, Giulio; Cirelli, Chiara

    2016-01-01

    Exploration of a novel environment leads to neuronal DNA double-strand breaks (DSBs). These DSBs are generated by type 2 topoisomerase to relieve topological constrains that limit transcription of plasticity-related immediate early genes. If not promptly repaired, however, DSBs may lead to cell death. Since the induction of plasticity-related genes is higher in wake than in sleep, we asked whether it is specifically wake associated with synaptic plasticity that leads to DSBs, and whether slee...

  10. Induction and repair of DNA double-strand breaks in rat cerebellar cortex exposed to 60Co γ-rays

    Science.gov (United States)

    Bulanova, T. S.; Zadneprianetc, M. G.; Ježková, L.; Kruglyakova, E. A.; Smirnova, E. V.; Boreyko, A. V.

    2018-01-01

    The induction and repair of DNA double-strand breaks are studied using the immunohistochemical staining procedure of paraffin-embedded rat cerebellum tissues after exposure to γ-rays of 60Co. The dose dependence of radiation-induced colocalized γH2AX/53BP1 foci is studied and its linear character is established. It is shown that these foci are efficiently eliminated 24 h after irradiation.

  11. Double-helical - ladder structural transition in the B-DNA is induced by a loss of dispersion energy

    Czech Academy of Sciences Publication Activity Database

    Černý, Jiří; Kabeláč, Martin; Hobza, Pavel

    2008-01-01

    Roč. 130, č. 47 (2008), s. 16055-16059 ISSN 0002-7863 R&D Projects: GA MŠk LC512; GA AV ČR IAA400550808 Institutional research plan: CEZ:AV0Z40550506 Keywords : B-DNA * double-helical structure * ladder-like structure Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 8.091, year: 2008

  12. Beyond repair foci: DNA double-strand break repair in euchromatic and heterochromatic compartments analyzed by transmission electron microscopy.

    Directory of Open Access Journals (Sweden)

    Yvonne Lorat

    Full Text Available DNA double-strand breaks (DSBs generated by ionizing radiation pose a serious threat to the preservation of genetic and epigenetic information. The known importance of local chromatin configuration in DSB repair raises the question of whether breaks in different chromatin environments are recognized and repaired by the same repair machinery and with similar efficiency. An essential step in DSB processing by non-homologous end joining is the high-affinity binding of Ku70-Ku80 and DNA-PKcs to double-stranded DNA ends that holds the ends in physical proximity for subsequent repair.Using transmission electron microscopy to localize gold-labeled pKu70 and pDNA-PKcs within nuclear ultrastructure, we monitored the formation and repair of actual DSBs within euchromatin (electron-lucent and heterochromatin (electron-dense in cortical neurons of irradiated mouse brain.While DNA lesions in euchromatin (characterized by two pKu70-gold beads, reflecting the Ku70-Ku80 heterodimer are promptly sensed and rejoined, DNA packaging in heterochromatin appears to retard DSB processing, due to the time needed to unravel higher-order chromatin structures. Complex pKu70-clusters formed in heterochromatin (consisting of 4 or ≥ 6 gold beads may represent multiple breaks in close proximity caused by ionizing radiation of highly-compacted DNA. All pKu70-clusters disappeared within 72 hours post-irradiation, indicating efficient DSB rejoining. However, persistent 53BP1 clusters in heterochromatin (comprising ≥ 10 gold beads, occasionally co-localizing with γH2AX, but not pKu70 or pDNA-PKcs, may reflect incomplete or incorrect restoration of chromatin structure rather than persistently unrepaired DNA damage.Higher-order organization of chromatin determines the accessibility of DNA lesions to repair complexes, defining how readily DSBs are detected and processed. DNA lesions in heterochromatin appear to be more complex, with multiple breaks in spatial vicinity inducing

  13. Analysis of DNA Double-Strand Breaks and Cytotoxicity after 7 Tesla Magnetic Resonance Imaging of Isolated Human Lymphocytes

    Science.gov (United States)

    Guttek, Karina; Hartig, Roland; Godenschweger, Frank; Roggenbuck, Dirk; Ricke, Jens; Reinhold, Dirk; Speck, Oliver

    2015-01-01

    The global use of magnetic resonance imaging (MRI) is constantly growing and the field strengths increasing. Yet, only little data about harmful biological effects caused by MRI exposure are available and published research analyzing the impact of MRI on DNA integrity reported controversial results. This in vitro study aimed to investigate the genotoxic and cytotoxic potential of 7 T ultra-high-field MRI on isolated human peripheral blood mononuclear cells. Hence, unstimulated mononuclear blood cells were exposed to 7 T static magnetic field alone or in combination with maximum permissible imaging gradients and radiofrequency pulses as well as to ionizing radiation during computed tomography and γ-ray exposure. DNA double-strand breaks were quantified by flow cytometry and automated microscopy analysis of immunofluorescence stained γH2AX. Cytotoxicity was studied by CellTiter-Blue viability assay and [3H]-thymidine proliferation assay. Exposure of unstimulated mononuclear blood cells to 7 T static magnetic field alone or combined with varying gradient magnetic fields and pulsed radiofrequency fields did not induce DNA double-strand breaks, whereas irradiation with X- and γ-rays led to a dose-dependent induction of γH2AX foci. The viability assay revealed a time- and dose-dependent decrease in metabolic activity only among samples exposed to γ-radiation. Further, there was no evidence for altered proliferation response after cells were exposed to 7 T MRI or low doses of ionizing radiation (≤ 0.2 Gy). These findings confirm the acceptance of MRI as a safe non-invasive diagnostic imaging tool, but whether MRI can induce other types of DNA lesions or DNA double-strand breaks during altered conditions still needs to be investigated. PMID:26176601

  14. In vivo formation and repair of DNA double-strand breaks after computed tomography examinations.

    Science.gov (United States)

    Löbrich, Markus; Rief, Nicole; Kühne, Martin; Heckmann, Martina; Fleckenstein, Jochen; Rübe, Christian; Uder, Michael

    2005-06-21

    Ionizing radiation can lead to a variety of deleterious effects in humans, most importantly to the induction of cancer. DNA double-strand breaks (DSBs) are among the most significant genetic lesions introduced by ionizing radiation that can initiate carcinogenesis. We have enumerated gamma-H2AX foci as a measure for DSBs in lymphocytes from individuals undergoing computed tomography examination of the thorax and/or the abdomen. The number of DSBs induced by computed tomography examination was found to depend linearly on the dose-length product, a radiodiagnostic unit that is proportional to both the local dose delivered and the length of the body exposed. Analysis of lymphocytes sampled up to 1 day postirradiation provided kinetics for the in vivo loss of gamma-H2AX foci that correlated with DSB repair. Interestingly, in contrast to results obtained in vitro, normal individuals repair DSBs to background levels. A patient who had previously shown severe side effects after radiotherapy displayed levels of gamma-H2AX foci at various sampling times postirradiation that were several times higher than those of normal individuals. Gamma-H2AX and pulsed-field gel electrophoresis analysis of fibroblasts obtained from this patient confirmed a substantial DSB repair defect. Additionally, these fibroblasts showed significant in vitro radiosensitivity. These data show that the in vivo induction and repair of DSBs can be assessed in individuals exposed to low radiation doses, adding a further dimension to DSB repair studies and providing the opportunity to identify repair-compromised individuals after diagnostic irradiation procedures.

  15. Mycobacterial UvrD1 is a Ku-dependent DNA helicase that plays a role in multiple DNA repair events, including double-strand break repair.

    Science.gov (United States)

    Sinha, Krishna Murari; Stephanou, Nicolas C; Gao, Feng; Glickman, Michael S; Shuman, Stewart

    2007-05-18

    Mycobacterium tuberculosis and other bacterial pathogens have a Ku-dependent nonhomologous end joining pathway of DNA double-strand break repair. Here we identify mycobacterial UvrD1 as a novel interaction partner for Ku in a genome-wide yeast two-hybrid screen. UvrD1 per se is a vigorous DNA-dependent ATPase but a feeble DNA helicase. Ku stimulates UvrD1 to catalyze ATP-dependent unwinding of 3'-tailed DNAs. UvrD1, Ku, and DNA form a stable ternary complex in the absence of ATP. The Ku binding determinants are located in the distinctive C-terminal segment of UvrD1. A second mycobacterial paralog, UvrD2, is a vigorous Ku-independent DNA helicase. Ablation of UvrD1 sensitizes Mycobacterium smegmatis to killing by ultraviolet and ionizing radiation and to a single chromosomal break generated by I-SceI endonuclease. The physical and functional interactions of bacterial Ku and UvrD1 highlight the potential for cross-talk between components of nonhomologous end joining and nucleotide excision repair pathways.

  16. JNK Phosphorylates SIRT6 to Stimulate DNA Double-Strand Break Repair in Response to Oxidative Stress by Recruiting PARP1 to DNA Breaks

    Directory of Open Access Journals (Sweden)

    Michael Van Meter

    2016-09-01

    Full Text Available The accumulation of damage caused by oxidative stress has been linked to aging and to the etiology of numerous age-related diseases. The longevity gene, sirtuin 6 (SIRT6, promotes genome stability by facilitating DNA repair, especially under oxidative stress conditions. Here we uncover the mechanism by which SIRT6 is activated by oxidative stress to promote DNA double-strand break (DSB repair. We show that the stress-activated protein kinase, c-Jun N-terminal kinase (JNK, phosphorylates SIRT6 on serine 10 in response to oxidative stress. This post-translational modification facilitates the mobilization of SIRT6 to DNA damage sites and is required for efficient recruitment of poly (ADP-ribose polymerase 1 (PARP1 to DNA break sites and for efficient repair of DSBs. Our results demonstrate a post-translational mechanism regulating SIRT6, and they provide the link between oxidative stress signaling and DNA repair pathways that may be critical for hormetic response and longevity assurance.

  17. Inactivation of Escherichia coli O157:H7 in nonintact beefsteaks of different thicknesses cooked by pan broiling, double pan broiling, or roasting by using five types of cooking appliances.

    Science.gov (United States)

    Shen, Cangliang; Adler, Jeremy M; Geornaras, Ifigenia; Belk, Keith E; Smith, Gary C; Sofos, John N

    2010-03-01

    This study compared thermal inactivation of Escherichia coli O157:H7 in nonintact beefsteaks of different thicknesses by different cooking methods and appliances. Coarsely ground beef was inoculated with rifampin-resistant E. coli O157:H7 (eight-strain composite, 6 to 7 log CFU/g) and then mixed with sodium chloride (0.45%) plus sodium tripolyphosphate (0.23%); the total water added was 10%. The meat was stuffed into bags (10-cm diameter), semifrozen (-20 degrees C, 6 h), and cut into 1.5-, 2.5-, and 4.0-cm-thick steaks. Samples were then individually vacuum packaged, frozen (-20 degrees C, 42 h), and tempered (4 degrees C, 2.5 h) before cooking. Partially thawed (-2 +/- 1 degrees C) steaks were pan broiled (Presto electric skillet and Sanyo grill), double pan broiled (George Foreman grill), or roasted (Oster toaster oven and Magic Chef standard kitchen oven) to a geometric center temperature of 65 degrees C. Extent of pathogen inactivation decreased in order of roasting (2.0 to 4.2 log CFU/g) > pan broiling (1.6 to 2.8 log CFU/g) >/= double pan broiling (1.1 to 2.3 log CFU/g). Cooking of 4.0-cm-thick steaks required a longer time (19.8 to 65.0 min; variation was due to different cooking appliances), and caused greater reductions in counts (2.3 to 4.2 log CFU/g) than it did in thinner samples (1.1 to 2.9 log CFU/g). The time to reach the target temperature increased in order of George Foreman grill (3.9 to 19.8 min) electric skillet (16.3 to 55.0 min) kitchen oven (20.0 to 63.0 min); variation was due to steak thickness. Results indicated that increased steak thickness allowed greater inactivation of E. coli O157:H7, as time to reach the target internal temperature increased. Roasting in a kitchen oven was most effective for pathogen inactivation.

  18. Relative frequency of formation of base radioproduct, single and double strand breaks on irradiation of diluted aqueous solution of DNA

    International Nuclear Information System (INIS)

    Ryznar, L.; Drasil, V.

    1975-01-01

    Diluted aqueous solution of DNA labelled with 6- 3 H-TdR was irradiated in the absence of oxygen and numbers of formed single and double strand breaks and the 5,6-dihydrothymine (DHT) yield were determined. The results indicate that, under given conditions, a molecule of a base radioproduct is formed approximately 10 times more frequently than one single strand break. The occurence of a single strand break is 20 times higher than that of a double strand break. The DNA labelled with 6- 3 H-TdR was isolated from mice fibroblasts of L-strain according to Marmur (specific activity 3.0 MBq/82 μCi/mg DNA, molecular weight M/sub n/=9.32x10 6 dalton). Solution of DNA was irradiated in the absence of oxygen (180 Gy /1.8x10 4 rads/, absorbed dose rate 0.3 Gy/s). It was lyophilized with an addition of non-labelled thymine, thymidine and DHT and then hydrolysed with 90% formic acid. The dried hydrolysate was chromatographed with irradiated non-labelled thymine added as a carrier. (F.G.)

  19. Adaptation of the neutral bacterial comet assay to assess antimicrobial-mediated DNA double-strand breaks in Escherichia coli

    Science.gov (United States)

    SOLANKY, DIPESH; HAYDEL, SHELLEY E.

    2012-01-01

    This study aimed to determine the mechanism of action of a natural antibacterial clay mineral mixture, designated CB, by investigating the induction of DNA double-strand breaks (DSBs) in Escherichia coli. To quantify DNA damage upon exposure to soluble antimicrobial compounds, we modified a bacterial neutral comet assay, which primarily associates the general length of an electrophoresed chromosome, or comet, with the degree of DSB-associated DNA damage. To appropriately account for antimicrobial-mediated strand fragmentation, suitable control reactions consisting of exposures to water, ethanol, kanamycin, and bleomycin were developed and optimized for the assay. Bacterial exposure to the CB clay resulted in significantly longer comet lengths, compared to water and kanamycin exposures, suggesting that the induction of DNA DSBs contributes to the killing activity of this antibacterial clay mineral mixture. The comet assay protocol described herein provides a general technique for evaluating soluble antimicrobial-derived DNA damage and for comparing DNA fragmentation between experimental and control assays. PMID:22940101

  20. Deficiency of double-strand DNA break repair does not impair Mycobacterium tuberculosis virulence in multiple animal models of infection.

    Science.gov (United States)

    Heaton, Brook E; Barkan, Daniel; Bongiorno, Paola; Karakousis, Petros C; Glickman, Michael S

    2014-08-01

    Mycobacterium tuberculosis persistence within its human host requires mechanisms to resist the effector molecules of host immunity, which exert their bactericidal effects through damaging pathogen proteins, membranes, and DNA. Substantial evidence indicates that bacterial pathogens, including M. tuberculosis, require DNA repair systems to repair the DNA damage inflicted by the host during infection, but the role of double-strand DNA break (DSB) repair systems is unclear. Double-strand DNA breaks are the most cytotoxic form of DNA damage and must be repaired for chromosome replication to proceed. M. tuberculosis elaborates three genetically distinct DSB repair systems: homologous recombination (HR), nonhomologous end joining (NHEJ), and single-strand annealing (SSA). NHEJ, which repairs DSBs in quiescent cells, may be particularly relevant to M. tuberculosis latency. However, very little information is available about the phenotype of DSB repair-deficient M. tuberculosis in animal models of infection. Here we tested M. tuberculosis strains lacking NHEJ (a Δku ΔligD strain), HR (a ΔrecA strain), or both (a ΔrecA Δku strain) in C57BL/6J mice, C3HeB/FeJ mice, guinea pigs, and a mouse hollow-fiber model of infection. We found no difference in bacterial load, histopathology, or host mortality between wild-type and DSB repair mutant strains in any model of infection. These results suggest that the animal models tested do not inflict DSBs on the mycobacterial chromosome, that other repair pathways can compensate for the loss of NHEJ and HR, or that DSB repair is not required for M. tuberculosis pathogenesis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  1. Mouse embryonic stem cells, but not somatic cells, predominantly use homologous recombination to repair double-strand DNA breaks.

    Science.gov (United States)

    Tichy, Elisia D; Pillai, Resmi; Deng, Li; Liang, Li; Tischfield, Jay; Schwemberger, Sandy J; Babcock, George F; Stambrook, Peter J

    2010-11-01

    Embryonic stem (ES) cells give rise to all cell types of an organism. Since mutations at this embryonic stage would affect all cells and be detrimental to the overall health of an organism, robust mechanisms must exist to ensure that genomic integrity is maintained. To test this proposition, we compared the capacity of murine ES cells to repair DNA double-strand breaks with that of differentiated cells. Of the 2 major pathways that repair double-strand breaks, error-prone nonhomologous end joining (NHEJ) predominated in mouse embryonic fibroblasts, whereas the high fidelity homologous recombinational repair (HRR) predominated in ES cells. Microhomology-mediated end joining, an emerging repair pathway, persisted at low levels in all cell types examined. The levels of proteins involved in HRR and microhomology-mediated end joining were highly elevated in ES cells compared with mouse embryonic fibroblasts, whereas those for NHEJ were quite variable, with DNA Ligase IV expression low in ES cells. The half-life of DNA Ligase IV protein was also low in ES cells. Attempts to increase the abundance of DNA Ligase IV protein by overexpression or inhibition of its degradation, and thereby elevate NHEJ in ES cells, were unsuccessful. When ES cells were induced to differentiate, however, the level of DNA Ligase IV protein increased, as did the capacity to repair by NHEJ. The data suggest that preferential use of HRR rather than NHEJ may lend ES cells an additional layer of genomic protection and that the limited levels of DNA Ligase IV may account for the low level of NHEJ activity.

  2. De novo-engineered transcription activator-like effector (TALE) hybrid nuclease with novel DNA binding specificity creates double-strand breaks

    KAUST Repository

    Mahfouz, Magdy M.; Li, Lixin; Shamimuzzaman, Md.; Wibowo, Anjar Tri; Fang, Xiaoyun; Zhu, Jian-Kang

    2011-01-01

    Site-specific and rare cutting nucleases are valuable tools for genome engineering. The generation of double-strand DNA breaks (DSBs) promotes homologous recombination in eukaryotes and can facilitate gene targeting, additions, deletions

  3. Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation.

    Science.gov (United States)

    Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

    2016-03-22

    Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

  4. Modeling the yield of double-strand breaks due to formation of multiply damaged sites in irradiated plasmid DNA

    International Nuclear Information System (INIS)

    Xapsos, M.A.; Pogozelski, W.K.

    1996-01-01

    Although double-strand breaks have long been recognized as an important type of DNa lesion, it is well established that this broad class of damage does not correlate well with indicators of the effectiveness of radiation as the cellular level. Assays of double-strand breaks do not distinguish the degree of complexity or clustering of singly damaged sites produced in a single energy deposition event, which is currently hypothesized to be key to understanding cellular end points. As a step toward this understanding, double-strand breaks that are formed proportionally to dose in plasmid DNA are analyzed from the mechanistic aspect to evaluate the yield that arises from multiply damaged sites as hypothesized by Ward (Prog. Nucleic Acid Res. Mol. Biol. 35, 95-125, 1988) and Goodhead (Int. J. Radiat. Biol. 65, 7-17, 1994) as opposed to the yield that arises form single hydroxyl radicals as hypothesized by Siddiqi and Bothe (Radiat. Res. 112, 449-463, 1987). For low-LET radiation such as γ rays, the importance of multiply damaged sites is shown to increase with the solution's hydroxyl radical scavenging capacity. For moderately high-LET radiation such as 100 keV/μm helium ions, a much different behavior is observed. In this case, a large fraction of double-strand breaks are formed as a result of multiply damaged sties over a broad range of scavenging conditions. Results also indicate that the RBE for common cellular end points correlates more closely with the RBE for common cellular end points correlates more closely with the RBE for multiply damaged sites than with the RBE for total double-strand breaks over a range of LET up to at least 100 keV/μm. 22 refs., 3 figs., 2 tabs

  5. Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is associated with G to A mutations in K-ras in colorectal tumorigenesis.

    Science.gov (United States)

    Esteller, M; Toyota, M; Sanchez-Cespedes, M; Capella, G; Peinado, M A; Watkins, D N; Issa, J P; Sidransky, D; Baylin, S B; Herman, J G

    2000-05-01

    O6-methylguanine DNA methyltransferase (MGMT) is a DNA repair protein that removes mutagenic and cytotoxic adducts from the O6 position of guanine. O6-methylguanine mispairs with thymine during replication, and if the adduct is not removed, this results in conversion from a guanine-cytosine pair to an adenine-thymine pair. In vitro assays show that MGMT expression avoids G to A mutations and MGMT transgenic mice are protected against G to A transitions at ras genes. We have recently demonstrated that the MGMT gene is silenced by promoter methylation in many human tumors, including colorectal carcinomas. To study the relevance of defective MGMT function by aberrant methylation in relation to the presence of K-ras mutations, we studied 244 colorectal tumor samples for MGMT promoter hypermethylation and K-ras mutational status. Our results show a clear association between the inactivation of MGMT by promoter hypermethylation and the appearance of G to A mutations at K-ras: 71% (36 of 51) of the tumors displaying this particular type of mutation had abnormal MGMT methylation, whereas only 32% (12 of 37) of those with other K-ras mutations not involving G to A transitions and 35% (55 of 156) of the tumors without K-ras mutations demonstrated MGMT methylation (P = 0.002). In addition, MGMT loss associated with hypermethylation was observed in the small adenomas, including those that do not yet contain K-ras mutations. Hypermethylation of other genes such as p16INK4a and p14ARF was not associated with either MGMT hypermethylation or K-ras mutation. Our data suggest that epigenetic silencing of MGMT by promoter hypermethylation may lead to a particular genetic change in human cancer, specifically G to A transitions in the K-ras oncogene.

  6. Double-check probing of DNA bending and unwinding by XPA-RPA: an architectural function in DNA repair

    Czech Academy of Sciences Publication Activity Database

    Missura, M.; Buterin, T.; Hindges, R.; Hübscher, U.; Kašpárková, Jana; Brabec, Viktor; Naegeli, H.

    2001-01-01

    Roč. 20, č. 13 (2001), s. 3554-3564 ISSN 0261-4189 Institutional research plan: CEZ:AV0Z5004920 Keywords : damage recognition * DNA repair * xeroderma pigmentosum Subject RIV: BO - Biophysics Impact factor: 12.450, year: 2001

  7. Increased sister chromatid cohesion and DNA damage response factor localization at an enzyme-induced DNA double-strand break in vertebrate cells.

    LENUS (Irish Health Repository)

    Dodson, Helen

    2009-10-01

    The response to DNA damage in vertebrate cells involves successive recruitment of DNA signalling and repair factors. We used light microscopy to monitor the genetic dependencies of such localization to a single, induced DNA double strand break (DSB) in vertebrate cells. We used an inducible version of the rare-cutting I-SceI endonuclease to cut a chromosomally integrated I-SceI site beside a Tet operator array that was visualized by binding a Tet repressor-GFP fusion. Formation of gamma-H2AX foci at a single DSB was independent of ATM or Ku70. ATM-deficient cells showed normal kinetics of 53Bp1 recruitment to DSBs, but Rad51 localization was retarded. 53Bp1 and Rad51 foci formation at a single DSB was greatly reduced in H2AX-null DT40 cells. We also observed decreased inter-sister chromatid distances after DSB induction, suggesting that cohesin loading at DSBs causes elevated sister chromatid cohesion. Loss of ATM reduced DSB-induced cohesion, consistent with cohesin being an ATM target in the DSB response. These data show that the same genetic pathways control how cells respond to single DSBs and to multiple lesions induced by whole-cell DNA damage.

  8. Genetic variation in a DNA double strand break repair gene in saudi population: a comparative study with worldwide ethnic groups.

    Science.gov (United States)

    Areeshi, Mohammed Yahya

    2013-01-01

    DNA repair capacity is crucial in maintaining cellular functions and homeostasis. However, it can be altered based on DNA sequence variations in DNA repair genes and this may lead to the development of many diseases including malignancies. Identification of genetic polymorphisms responsible for reduced DNA repair capacity is necessary for better prevention. Homologous recombination (HR), a major double strand break repair pathway, plays a critical role in maintaining the genome stability. The present study was performed to determine the frequency of the HR gene XRCC3 Exon 7 (C18067T, rs861539) polymorphisms in Saudi Arabian population in comparison with epidemiological studies by "MEDLINE" search to equate with global populations. The variant allelic (T) frequency of XRCC3 (C>T) was found to be 39%. Our results suggest that frequency of XRCC3 (C>T) DNA repair gene exhibits distinctive patterns compared with the Saudi Arabian population and this might be attributed to ethnic variation. The present findings may help in high-risk screening of humans exposed to environmental carcinogens and cancer predisposition in different ethnic groups.

  9. [Lethal effect after transmutation of 33P incorporated into bacteriophage S 13 and mechanisms of DNA double helix rupture].

    Science.gov (United States)

    Apelgot, S

    1980-04-01

    The experiments show the lethal effect of the beta decay of 33P incorporated in DNA of bacteriophage S 13. The lethal efficiency is high, 0.72 at 0 degrees C and 0.55 at--197 degrees C. The presence of a radical scavenger like AET has no influence. It was found previously that for such phages with single-stranded DNA, the lethal efficiency of 32P decay is unity, and that the lethal event is a DNA single-strand break, owing to the high energy of the nucleogenic 32S atom. As the recoil energy of the 33S atom is too low to account for such a break, it is suggested that the reorganization of the phosphate molecule into sulphate is able to bring about a DNA single-strand break with an efficiency as high as 0.7, at 0 degrees C. A model for the DNA double-strand-break produced by a transmutation processes is suggested.

  10. DNA double-strand braks serve as a major factor for the expression of Arabidopsis Argonaute 2

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Sung Beom; Chung, Moon Soo; Lee, Gun Woong; Chung, Byung Yeoup [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)

    2017-02-15

    Argonaute 2 (AtAGO2) is a well characterized effector protein in Arabidopsis for its functionalities associated with DNA double-strand break (DSB)-induced small RNAs (diRNAs) and for its inducible expression upon γ-irradiation. However, its transcriptional regulation depending on the recovery time after the irradiation and on the specific response to DSBs has been poorly understood. We analyzed the 1,313 bp promoter sequence of the AtAGO2 gene (1.3kb{sub pro}) to characterize the transcriptional regulation of AtAGO2 at various recovery times after γ-irradiation. A stable transformant harboring 1.3kbpro fused with GUS gene showed that the AtAGO2 is highly expressed in response to γ-irradiation, after which the expression of the gene is gradually decreased until 5 days of DNA damage recovery. We also confrm that the AtAGO2 expression patterns are similar to that of γ-irradiation after the treatments of radiomimetic genotoxins (bleomycin and zeocin). However, methyl methanesulfonate and mitomycin C, which are associated with the inhibition of DNA replication, do not induce the expression of the AtAGO2, suggesting that the expression of the AtAGO2 is closely related with DNA DSBs rather than DNA replication.

  11. Influence of reduced glutathione on end-joining of DNA double-strand breaks: Cytogenetical and molecular approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghoshal, Nitin [Molecular Genetics Laboratory, Department of Biotechnology & Bioinformatics, North-Eastern Hill University, Shillong, Meghalaya-793022 (India); Sharma, Sheetal [Department of Biochemistry, Indian Institute of Science, Bangalore, 560 012 (India); Banerjee, Atanu; Kurkalang, Sillarine [Molecular Genetics Laboratory, Department of Biotechnology & Bioinformatics, North-Eastern Hill University, Shillong, Meghalaya-793022 (India); Raghavan, Sathees C. [Department of Biochemistry, Indian Institute of Science, Bangalore, 560 012 (India); Chatterjee, Anupam, E-mail: chatterjeeanupam@hotmail.com [Molecular Genetics Laboratory, Department of Biotechnology & Bioinformatics, North-Eastern Hill University, Shillong, Meghalaya-793022 (India)

    2017-01-15

    Highlights: • DNA lesions induced by Blem and radiation interact well and form higher frequency of exchange aberrations. • Cellular level of glutathione does influence such interaction of DNA lesions. • Oligomer-based cell-free assay system demonstrated better end-joining efficiency at higher level of endogenous GSH. - Abstract: Radiation induced DNA double-strand breaks (DSB) are the major initial lesions whose misrejoining may lead to exchange aberrations. However, the role of glutathione (GSH), a major cellular thiol, in regulating cell’s sensitivity to DNA damaging agents is not well understood. Influence of endogenous GSH on the efficiency of X-rays and bleomycin (Blem) induced DNA DSBs end-joining has been tested here cytogenetically, in human lymphocytes and Hct116 cells. In another approach, oligomeric DNA (75 bp) containing 5′-compatible and non-compatible overhangs mimicking the endogenous DSB were for rejoining in presence of cell-free extracts from cells having different endogenous GSH levels. Frequency of aberrations, particularly exchange aberrations, was significantly increased when Blem was combined with radiation. The exchange aberration frequency was further enhanced when combined treatment was given at 4 °C since DNA lesions are poorly repaired at 4 °C so that a higher number of DNA breaks persist and interact when shifted from 4 °C to 37 °C. The exchange aberrations increased further when the combined treatment was given to Glutathione-ester (GE) pre-treated cells, indicating more frequent rejoining of DNA lesions in presence of higher cellular GSH. This is further supported by the drastic reduction in frequency of exchange aberrations but significant increase in incidences of deletions when combined treatment was given to GSH-depleted cells. End-joining efficiency of DNA DSBs with compatible ends was better than for non-compatible ends. End-joining efficiency of testicular and MCF7 cell extracts was better than that of lungs and

  12. Investigation of DNA double strand breaks induced by α particle and 7Li ions

    International Nuclear Information System (INIS)

    Kong Fuquan; Cai Minghui; Zhao Kui; Guo Jiyu; Ni Meinan; Sui Li; Yang Mingjian; Zhan Yong

    2006-01-01

    α particles and Lithium ions were produced by 241 Am radiation source and HI-13 tandem accelerator at China Institute of Atomic Energy (CIAE) respectively to simulate ionizing radiation in Boron Neutron Capture Therapy (BNCT) process. Plasmid DNA in aqueous solution was irradiated and the DNA fragments were imaged by AFM. The image software ImageJ was used to measure the length of DNA fragments. The length distribution and conformation changes of DNA fragments were assessed. Our results showed that the mean length of DNA fragments as well as the fraction of linear and open circle DNA molecules decreased by dose. At higher dose, Lithium ions induced more pronounced relative biological effects than α particles. (author)

  13. Cyclic GMP-AMP synthase is activated by double-stranded DNA-induced oligomerization.

    Science.gov (United States)

    Li, Xin; Shu, Chang; Yi, Guanghui; Chaton, Catherine T; Shelton, Catherine L; Diao, Jiasheng; Zuo, Xiaobing; Kao, C Cheng; Herr, Andrew B; Li, Pingwei

    2013-12-12

    Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor mediating innate antimicrobial immunity. It catalyzes the synthesis of a noncanonical cyclic dinucleotide, 2',5' cGAMP, that binds to STING and mediates the activation of TBK1 and IRF-3. Activated IRF-3 translocates to the nucleus and initiates the transcription of the IFN-β gene. The structure of mouse cGAS bound to an 18 bp dsDNA revealed that cGAS interacts with dsDNA through two binding sites, forming a 2:2 complex. Enzyme assays and IFN-β reporter assays of cGAS mutants demonstrated that interactions at both DNA binding sites are essential for cGAS activation. Mutagenesis and DNA binding studies showed that the two sites bind dsDNA cooperatively and that site B plays a critical role in DNA binding. The structure of mouse cGAS bound to dsDNA and 2',5' cGAMP provided insight into the catalytic mechanism of cGAS. These results demonstrated that cGAS is activated by dsDNA-induced oligomerization. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Bi-directional routing of DNA mismatch repair protein human exonuclease 1 to replication foci and DNA double strand breaks

    DEFF Research Database (Denmark)

    Liberti, Sascha E; Andersen, Sofie Dabros; Wang, Jing

    2011-01-01

    (PIP-box) region on hEXO1 located in its COOH-terminal ((788)QIKLNELW(795)). This motif is essential for PCNA binding and co-localization during S-phase. Recruitment of hEXO1 to DNA DSB sites is dependent on the MMR protein hMLH1. We show that two distinct hMLH1 interaction regions of hEXO1 (residues...

  15. DNA ligase 1 deficient plants display severe growth defects and delayed repair of both DNA single and double strand breaks

    Czech Academy of Sciences Publication Activity Database

    Waterworth, W.M.; Kozák, Jaroslav; Provost, C.M.; Bray, C.M.; Angelis, Karel; West, C.E.

    2009-01-01

    Roč. 9, art.no.79 (2009), s. 1-12 ISSN 1471-2229 R&D Projects: GA MŠk 1M0505; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50380511 Keywords : ARABIDOPSIS-THALIANA * T-DNA * COMET ASSAY Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.774, year: 2009

  16. Gefitinib radiosensitizes stem-like glioma cells: inhibition of epidermal growth factor receptor-Akt-DNA-PK signaling, accompanied by inhibition of DNA double-strand break repair.

    Science.gov (United States)

    Kang, Khong Bee; Zhu, Congju; Wong, Yin Ling; Gao, Qiuhan; Ty, Albert; Wong, Meng Cheong

    2012-05-01

    We compared radiosensitivity of brain tumor stem cells (BTSCs) with matched nonstem glioma cells, and determined whether gefitinib enhanced BTSC radiosensitivity by inhibiting epidermal growth factor receptor (EGFR)-Akt-DNA-dependent protein kinase (DNA-PK) signaling, followed by enhanced DNA double-stand breaks (DSBs) and inhibition of DSB repair. Radiosensitivity of stem-like gliomaspheres and nonstem glioma cells (obtained at patient neurosurgical resection) were evaluated by clonogenic assays, γ-H(2)AX immunostaining and cell cycle distribution. Survival of irradiated and nonirradiated NOD-SCID mice intracranially implanted with stem-like gliomaspheres were monitored. Glioma cells treated with gefitinib, irradiation, or both were assayed for clonogenic survival, γ-H(2)AX immunostaining, DNA-PKcs expression, and phosphorylation of EGFR and Akt. Stem-like gliomaspheres displayed BTSC characteristics of self-renewal; differentiation into lineages of neurons, oligodendrocytes, and astrocytes; and initiation of glioma growth in NOD-SCID mice. Irradiation dose-dependently reduced clonogenic survival, induced G(2)/M arrest and increased γ-H(2)AX immunostaining of nonstem glioma cells, but not stem-like gliomaspheres. There was no difference in survival of irradiated and nonirradiated mice implanted with stem-like gliomaspheres. The addition of gefitinib significantly inhibited clonogenic survival, increased γ-H(2)AX immunostaining, and reduced DNA-PKcs expression of irradiated stem-like gliomaspheres, without affecting irradiated-nonstem glioma cells. Gefitinib alone, and when combined with irradiation, inhibited phosphorylation of EGFR (Y1068 and Y1045) and Akt (S473) in stem-like gliomaspheres. In nonstem glioma cells, gefitinib alone inhibited EGFR Y1068 phosphorylation, with further inhibition by combined gefitinib and irradiation. Stem-like gliomaspheres are resistant to irradiation-induced cytotoxicity, G(2)/M arrest, and DNA DSBs, compared with nonstem

  17. Gefitinib Radiosensitizes Stem-Like Glioma Cells: Inhibition of Epidermal Growth Factor Receptor-Akt-DNA-PK Signaling, Accompanied by Inhibition of DNA Double-Strand Break Repair

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Khong Bee, E-mail: dmskkb@nccs.com.sg [Brain Tumour Research Laboratory, Division of Medical Sciences, National Cancer Centre Singapore (Singapore); Zhu Congju; Wong Yinling; Gao Qiuhan; Ty, Albert; Wong, Meng Cheong [Brain Tumour Research Laboratory, Division of Medical Sciences, National Cancer Centre Singapore (Singapore)

    2012-05-01

    Purpose: We compared radiosensitivity of brain tumor stem cells (BTSCs) with matched nonstem glioma cells, and determined whether gefitinib enhanced BTSC radiosensitivity by inhibiting epidermal growth factor receptor (EGFR)-Akt-DNA-dependent protein kinase (DNA-PK) signaling, followed by enhanced DNA double-stand breaks (DSBs) and inhibition of DSB repair. Methods and Materials: Radiosensitivity of stem-like gliomaspheres and nonstem glioma cells (obtained at patient neurosurgical resection) were evaluated by clonogenic assays, {gamma}-H{sub 2}AX immunostaining and cell cycle distribution. Survival of irradiated and nonirradiated NOD-SCID mice intracranially implanted with stem-like gliomaspheres were monitored. Glioma cells treated with gefitinib, irradiation, or both were assayed for clonogenic survival, {gamma}-H{sub 2}AX immunostaining, DNA-PKcs expression, and phosphorylation of EGFR and Akt. Results: Stem-like gliomaspheres displayed BTSC characteristics of self-renewal; differentiation into lineages of neurons, oligodendrocytes, and astrocytes; and initiation of glioma growth in NOD-SCID mice. Irradiation dose-dependently reduced clonogenic survival, induced G{sub 2}/M arrest and increased {gamma}-H{sub 2}AX immunostaining of nonstem glioma cells, but not stem-like gliomaspheres. There was no difference in survival of irradiated and nonirradiated mice implanted with stem-like gliomaspheres. The addition of gefitinib significantly inhibited clonogenic survival, increased {gamma}-H{sub 2}AX immunostaining, and reduced DNA-PKcs expression of irradiated stem-like gliomaspheres, without affecting irradiated-nonstem glioma cells. Gefitinib alone, and when combined with irradiation, inhibited phosphorylation of EGFR (Y1068 and Y1045) and Akt (S473) in stem-like gliomaspheres. In nonstem glioma cells, gefitinib alone inhibited EGFR Y1068 phosphorylation, with further inhibition by combined gefitinib and irradiation. Conclusions: Stem-like gliomaspheres are

  18. Life forms employ different repair strategies of repair single- and double strand DNA breaks caused by different qualities of radiation: criticality of RecA mediated repair system

    International Nuclear Information System (INIS)

    Sharan, R.N.

    2013-01-01

    Different qualities of radiation, either through direct or indirect pathway, induce qualitative different spectrum of damages in DNA, which are also different in in vitro and in vivo systems. The single- and double strand breaks of DNA are of special interest as they lead to serious biological consequences. The implications of such damage to DNA and their processing by various inherent repair pathways together decide the fate of the living form

  19. High-affinity triplex targeting of double stranded DNA using chemically modified peptide nucleic acid oligomers

    DEFF Research Database (Denmark)

    Hansen, Mads E; Bentin, Thomas; Nielsen, Peter E

    2009-01-01

    While sequence-selective dsDNA targeting by triplex forming oligonucleotides has been studied extensively, only very little is known about the properties of PNA-dsDNA triplexes-mainly due to the competing invasion process. Here we show that when appropriately modified using pseudoisocytosine subs...

  20. RNF4 is required for DNA double-strand break repair in vivo

    DEFF Research Database (Denmark)

    Vyas, R; Kumar, R; Clermont, F

    2013-01-01

    for both homologous recombination (HR) and non-homologous end joining repair. To establish a link between Rnf4 and the DNA damage response (DDR) in vivo, we generated an Rnf4 allelic series in mice. We show that Rnf4-deficiency causes persistent ionizing radiation-induced DNA damage and signaling...

  1. Role of the Coulomb interaction in the low-frequency density of states of DNA double helices

    International Nuclear Information System (INIS)

    Garcia, A.E.; Krumhansl, J.A.

    1988-01-01

    The complete vibrational frequency spectrum of several DNA double-helical oligomers is calculated using established pair potentials. Various cutoff values are used for the range of the Coulomb interactions. At very low frequency the integrated density of states shows a noninteger exponent with values ranging from 0.75 to 1.55, depending on the cutoff value for the Coulomb interactions. We conclude that the cumulative densities of states in those molecules depend more on competing interactions than on various proposed universal laws

  2. Effect of cellular glutathione content on the induction of DNA double strand breaks by 25 MeV electrons

    Energy Technology Data Exchange (ETDEWEB)

    Frankenberg, D.; Kistler, M.; Eckhardt-Schupp, F.

    1987-08-01

    The effect of endogenous glutathione (GSH) on the induction of DNA double strand breaks (dsb) by 25 MeV electrons was investigated using stationary haploid yeast cells defective in ..gamma..-glutamyl-cysteine-synthetase (gsh 1) containing less than 5 per cent of the normal GSH content. In gsh 1 cells the induction of dsb is increased by a factor of 1.5 under oxic and 1.8 under anoxic irradiation conditions whereas the oxygen enhancement ratio was only slightly decreased (1.9) compared to wild-type cells (2.4).

  3. Effect of cellular glutathione content on the induction of DNA double strand breaks by 25 MeV electrons

    International Nuclear Information System (INIS)

    Frankenberg, D.; Kistler, M.; Eckhardt-Schupp, F.

    1987-01-01

    The effect of endogenous glutathione (GSH) on the induction of DNA double strand breaks (dsb) by 25 MeV electrons was investigated using stationary haploid yeast cells defective in γ-glutamyl-cysteine-synthetase (gsh 1) containing less than 5 per cent of the normal GSH content. In gsh 1 cells the induction of dsb is increased by a factor of 1.5 under oxic and 1.8 under anoxic irradiation conditions whereas the oxygen enhancement ratio was only slightly decreased (1.9) compared to wild-type cells (2.4). (author)

  4. Human RECQ5 helicase promotes repair of DNA double-strand breaks by synthesis-dependent strand annealing

    Czech Academy of Sciences Publication Activity Database

    Paliwal, S.; Kanagaraj, R.; Sturzenegger, A.; Burdová, Kamila; Janščák, Pavel

    2014-01-01

    Roč. 42, č. 4 (2014), s. 2380-2390 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565; GA ČR GAP305/10/0281 Grant - others:Swiss National Science Foundation(CH) 31003A-129747; Swiss National Science Foundation(CH) 31003A_146206 Institutional support: RVO:68378050 Keywords : Human RECQ5 helicase * DNA double-strand breaks * mitotic homologous recombination Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  5. Single and double strand breaks induced by 3H incorporated in DNA of cultured human kidney cells

    International Nuclear Information System (INIS)

    Tisljar-Lentulis, G.; Henneberg, P.; Mielke, T.; Feinendegen, L.E.

    1978-01-01

    In the course of the investigations of the biological effects of radionuclides incorporated in DNA single (SSB) and double strand breaks (DSB) caused tritium-decay were measured and compared with respective data resulting from 125 I. Tritium bound to thymidine and iododeoxyuridine seems to be more effective than tritium bound to other DNA-precursors. On the basis of decay, methyl- 3 H thymidine appears to be more effective with regard to the production of strand breaks than 3 H in position 6 of the pyrimidine ring. Based on the numbers of strand-breaks per rad, position 6 is more effective in accordance with data obtained by F. Krasin et al. The ratio of SSBs to DSBs per tritium decay appears to be approximately 8 in mammlian cells. Not only SSBs but also DSBs induced by 3 H in mammalian cells are reapairable. (orig./AJ) [de

  6. Contribution of sleep to the repair of neuronal DNA double-strand breaks: evidence from flies and mice.

    Science.gov (United States)

    Bellesi, Michele; Bushey, Daniel; Chini, Mattia; Tononi, Giulio; Cirelli, Chiara

    2016-11-10

    Exploration of a novel environment leads to neuronal DNA double-strand breaks (DSBs). These DSBs are generated by type 2 topoisomerase to relieve topological constrains that limit transcription of plasticity-related immediate early genes. If not promptly repaired, however, DSBs may lead to cell death. Since the induction of plasticity-related genes is higher in wake than in sleep, we asked whether it is specifically wake associated with synaptic plasticity that leads to DSBs, and whether sleep provides any selective advantage over wake in their repair. In flies and mice, we find that enriched wake, more than simply time spent awake, induces DSBs, and their repair in mice is delayed or prevented by subsequent wake. In both species the repair of irradiation-induced neuronal DSBs is also quicker during sleep, and mouse genes mediating the response to DNA damage are upregulated in sleep. Thus, sleep facilitates the repair of neuronal DSBs.

  7. Do chromatin changes around a nascent double strand DNA break spread spherically into linearly non-adjacent chromatin?

    Science.gov (United States)

    Savic, Velibor

    2013-01-01

    In the last decade, a lot has been done in elucidating the sequence of events that occur at the nascent double strand DNA break. Nevertheless, the overall structure formed by the DNA damage response (DDR) factors around the break site, the repair focus, remains poorly understood. Although most of the data presented so far only address events that occur in chromatin in cis around the break, there are strong indications that in mammalian systems it may also occur in trans, analogous to the recent findings showing this if budding yeast. There have been attempts to address the issue but the final proof is still missing due to lack of a proper experimental system. If found to be true, the spatial distribution of DDR factors would have a major impact on the neighboring chromatin both in cis and in trans, significantly affecting local chromatin function; gene transcription and potentially other functions.

  8. FBH1 co-operates with MUS81 in inducing DNA double-strand breaks and cell death following replication stress

    DEFF Research Database (Denmark)

    Fugger, Kasper; Chu, Wai Kit; Haahr, Peter

    2013-01-01

    The molecular events occurring following the disruption of DNA replication forks are poorly characterized, despite extensive use of replication inhibitors such as hydroxyurea in the treatment of malignancies. Here, we identify a key role for the FBH1 helicase in mediating DNA double-strand break...... formation following replication inhibition. We show that FBH1-deficient cells are resistant to killing by hydroxyurea, and exhibit impaired activation of the pro-apoptotic factor p53, consistent with decreased DNA double-strand break formation. Similar findings were obtained in murine ES cells carrying...... of replication stress. Our data suggest that FBH1 helicase activity is required to eliminate cells with excessive replication stress through the generation of MUS81-induced DNA double-strand breaks....

  9. Genetic recombination induced by DNA double-strand break in bacteriophage T4: nature of the left/right bias.

    Science.gov (United States)

    Shcherbakov, Victor P; Shcherbakova, Tamara; Plugina, Lidiya; Sizova, Svetlana; Kudryashova, Elena; Granovsky, Igor

    2008-06-01

    The experimental system combining double-strand breaks (DSBs), produced site-specifically by SegC endonuclease, with the famous advantages of the bacteriophage T4 rII mutant recombination analysis was used here to elucidate the origin of the recombination bias on two sides of the DSB, especially pronounced in gene 39 (topoisomerase II) and gene 59 (41-helicase loader) mutants. Three sources were found to contribute to the bias: (1) the SegC endonuclease may remain bound to the end of the broken DNA and thus protect it from exonuclease degradation; (2) in heteroduplex heterozygotes (HHs), arising as the recombinant products in the left-hand crosses, the transcribed strands are of rII mutant phenotype, so they, in contrast to the right-hand HHs, do not produce plaques on the lawn of the lambda-lysogenic host; and (3) the intrinsic polarity of T4 chromosome, reflected in transcription, may be a cause for discrimination of promoter-proximal and promoter-distal DNA sequences. It is shown that the apparent recombination bias does not imply one-sidedness of the DSB repair but just reflects a different depth of the end processing. It is inferred that the cause, underlying the "intrinsic" bias, might be interference between strand exchange and transcription. Topoisomerase and helicase functions are necessary to turn the process in favor of strand exchange. The idea is substantiated that the double-stranded to single-stranded DNA transition edge (not ss-DNA tip) serves as an actual recombinogenic element.

  10. Induction and repair of DNA double strand breaks: The increasing spectrum of non-homologous end joining pathways

    International Nuclear Information System (INIS)

    Mladenov, Emil; Iliakis, George

    2011-01-01

    A defining characteristic of damage induced in the DNA by ionizing radiation (IR) is its clustered character that leads to the formation of complex lesions challenging the cellular repair mechanisms. The most widely investigated such complex lesion is the DNA double strand break (DSB). DSBs undermine chromatin stability and challenge the repair machinery because an intact template strand is lacking to assist restoration of integrity and sequence in the DNA molecule. Therefore, cells have evolved a sophisticated machinery to detect DSBs and coordinate a response on the basis of inputs from various sources. A central function of cellular responses to DSBs is the coordination of DSB repair. Two conceptually different mechanisms can in principle remove DSBs from the genome of cells of higher eukaryotes. Homologous recombination repair (HRR) uses as template a homologous DNA molecule and is therefore error-free; it functions preferentially in the S and G2 phases. Non-homologous end joining (NHEJ), on the other hand, simply restores DNA integrity by joining the two ends, is error prone as sequence is only fortuitously preserved and active throughout the cell cycle. The basis of DSB repair pathway choice remains unknown, but cells of higher eukaryotes appear programmed to utilize preferentially NHEJ. Recent work suggests that when the canonical DNA-PK dependent pathway of NHEJ (D-NHEJ), becomes compromised an alternative NHEJ pathway and not HRR substitutes in a quasi-backup function (B-NHEJ). Here, we outline aspects of DSB induction by IR and review the mechanisms of their processing in cells of higher eukaryotes. We place particular emphasis on backup pathways of NHEJ and summarize their increasing significance in various cellular processes, as well as their potential contribution to carcinogenesis.

  11. Variations in the Processing of DNA Double-Strand Breaks Along 60-MeV Therapeutic Proton Beams

    Energy Technology Data Exchange (ETDEWEB)

    Chaudhary, Pankaj; Marshall, Thomas I. [Centre for Cancer Research and Cell Biology, Queen' s University Belfast, Belfast (United Kingdom); Currell, Frederick J. [Centre for Cancer Research and Cell Biology, Queen' s University Belfast, Belfast (United Kingdom); Centre for Plasma Physics, School of Mathematics and Physics, Queen' s University Belfast, Belfast (United Kingdom); Kacperek, Andrzej [Douglas Cyclotron, Clatterbridge Cancer Centre, Bebbington, Wirral (United Kingdom); Schettino, Giuseppe, E-mail: giuseppe.schettino@npl.co.uk [National Physical Laboratory, Teddington (United Kingdom); Prise, Kevin M. [Centre for Cancer Research and Cell Biology, Queen' s University Belfast, Belfast (United Kingdom)

    2016-05-01

    Purpose: To investigate the variations in induction and repair of DNA damage along the proton path, after a previous report on the increasing biological effectiveness along clinically modulated 60-MeV proton beams. Methods and Materials: Human skin fibroblast (AG01522) cells were irradiated along a monoenergetic and a modulated spread-out Bragg peak (SOBP) proton beam used for treating ocular melanoma at the Douglas Cyclotron, Clatterbridge Centre for Oncology, Wirral, Liverpool, United Kingdom. The DNA damage response was studied using the 53BP1 foci formation assay. The linear energy transfer (LET) dependence was studied by irradiating the cells at depths corresponding to entrance, proximal, middle, and distal positions of SOBP and the entrance and peak position for the pristine beam. Results: A significant amount of persistent foci was observed at the distal end of the SOBP, suggesting complex residual DNA double-strand break damage induction corresponding to the highest LET values achievable by modulated proton beams. Unlike the directly irradiated, medium-sharing bystander cells did not show any significant increase in residual foci. Conclusions: The DNA damage response along the proton beam path was similar to the response of X rays, confirming the low-LET quality of the proton exposure. However, at the distal end of SOBP our data indicate an increased complexity of DNA lesions and slower repair kinetics. A lack of significant induction of 53BP1 foci in the bystander cells suggests a minor role of cell signaling for DNA damage under these conditions.

  12. A polycomb group protein, PHF1, is involved in the response to DNA double-strand breaks in human cell

    Science.gov (United States)

    Hong, Zehui; Jiang, Jie; Lan, Li; Nakajima, Satoshi; Kanno, Shin-ichiro; Koseki, Haruhiko; Yasui, Akira

    2008-01-01

    DNA double-strand breaks (DSBs) represent the most toxic DNA damage arisen from endogenous and exogenous genotoxic stresses and are known to be repaired by either homologous recombination or nonhomologous end-joining processes. Although many proteins have been identified to participate in either of the processes, the whole processes still remain elusive. Polycomb group (PcG) proteins are epigenetic chromatin modifiers involved in gene silencing, cancer development and the maintenance of embryonic and adult stem cells. By screening proteins responding to DNA damage using laser micro-irradiation, we found that PHF1, a human homolog of Drosophila polycomb-like, Pcl, protein, was recruited to DSBs immediately after irradiation and dissociated within 10 min. The accumulation at DSBs is Ku70/Ku80-dependent, and knockdown of PHF1 leads to X-ray sensitivity and increases the frequency of homologous recombination in HeLa cell. We found that PHF1 interacts physically with Ku70/Ku80, suggesting that PHF1 promotes nonhomologous end-joining processes. Furthermore, we found that PHF1 interacts with a number of proteins involved in DNA damage responses, RAD50, SMC1, DHX9 and p53, further suggesting that PHF1, besides the function in PcG, is involved in genome maintenance processes. PMID:18385154

  13. Ubiquitin-specific protease 5 is required for the efficient repair of DNA double-strand breaks.

    Directory of Open Access Journals (Sweden)

    Satoshi Nakajima

    Full Text Available During the DNA damage response (DDR, ubiquitination plays an important role in the recruitment and regulation of repair proteins. However, little is known about elimination of the ubiquitination signal after repair is completed. Here we show that the ubiquitin-specific protease 5 (USP5, a deubiquitinating enzyme, is involved in the elimination of the ubiquitin signal from damaged sites and is required for efficient DNA double-strand break (DSB repair. Depletion of USP5 sensitizes cells to DNA damaging agents, produces DSBs, causes delayed disappearance of γH2AX foci after Bleocin treatment, and influences DSB repair efficiency in the homologous recombination pathway but not in the non-homologous end joining pathway. USP5 co-localizes to DSBs induced by laser micro-irradiation in a RAD18-dependent manner. Importantly, polyubiquitin chains at sites of DNA damage remained for longer periods in USP5-depleted cells. Our results show that disassembly of polyubiquitin chains by USP5 at sites of damage is important for efficient DSB repair.

  14. More efficient repair of DNA double-strand breaks in skeletal muscle stem cells compared to their committed progeny

    Directory of Open Access Journals (Sweden)

    Leyla Vahidi Ferdousi

    2014-11-01

    Full Text Available The loss of genome integrity in adult stem cells results in accelerated tissue aging and is possibly cancerogenic. Adult stem cells in different tissues appear to react robustly to DNA damage. We report that adult skeletal stem (satellite cells do not primarily respond to radiation-induced DNA double-strand breaks (DSBs via differentiation and exhibit less apoptosis compared to other myogenic cells. Satellite cells repair these DNA lesions more efficiently than their committed progeny. Importantly, non-proliferating satellite cells and post-mitotic nuclei in the fiber exhibit dramatically distinct repair efficiencies. Altogether, reduction of the repair capacity appears to be more a function of differentiation than of the proliferation status of the muscle cell. Notably, satellite cells retain a high efficiency of DSB repair also when isolated from the natural niche. Finally, we show that repair of DSB substrates is not only very efficient but, surprisingly, also very accurate in satellite cells and that accurate repair depends on the key non-homologous end-joining factor DNA-PKcs.

  15. More efficient repair of DNA double-strand breaks in skeletal muscle stem cells compared to their committed progeny.

    Science.gov (United States)

    Vahidi Ferdousi, Leyla; Rocheteau, Pierre; Chayot, Romain; Montagne, Benjamin; Chaker, Zayna; Flamant, Patricia; Tajbakhsh, Shahragim; Ricchetti, Miria

    2014-11-01

    The loss of genome integrity in adult stem cells results in accelerated tissue aging and is possibly cancerogenic. Adult stem cells in different tissues appear to react robustly to DNA damage. We report that adult skeletal stem (satellite) cells do not primarily respond to radiation-induced DNA double-strand breaks (DSBs) via differentiation and exhibit less apoptosis compared to other myogenic cells. Satellite cells repair these DNA lesions more efficiently than their committed progeny. Importantly, non-proliferating satellite cells and post-mitotic nuclei in the fiber exhibit dramatically distinct repair efficiencies. Altogether, reduction of the repair capacity appears to be more a function of differentiation than of the proliferation status of the muscle cell. Notably, satellite cells retain a high efficiency of DSB repair also when isolated from the natural niche. Finally, we show that repair of DSB substrates is not only very efficient but, surprisingly, also very accurate in satellite cells and that accurate repair depends on the key non-homologous end-joining factor DNA-PKcs. Copyright © 2014. Published by Elsevier B.V.

  16. The foci of DNA double strand break-recognition proteins localize with γH2AX after heat treatment

    International Nuclear Information System (INIS)

    Takahashi, Akihisa; Mori, Eiichiro; Ohnishi, Takeo

    2010-01-01

    Recently, there have been many reports concerning proteins which can recognize DNA double strand break (DSBs), and such proteins include histone H2AX phosphorylated at serine 139 (γH2AX), ataxia telangiectasia mutated (ATM) phospho-serine 1981, DNA-dependent protein kinase catalytic subunit (DNA-PKcs) phospho-threonine 2609, Nijmegen breakage syndrome 1 (NBS1) phospho-serine 343, checkpoint kinase 2 (CHK2), phospho-threonine 68, and structural maintenance of chromosomes 1 (SMC1) phospho-serine 966. Thus, it should be possible to follow the formation of DSBs and their repair using immunohistochemical methods with multiple antibodies to detect these proteins. When normal human fibroblasts (AG1522 cells) were exposed to 3 Gy of X-rays as a control, clearly discernable foci for these proteins were detected, and these foci localized with γH2AX foci. After heat treatment at 45.5 deg C for 20 min, these proteins are partially localized with γH2AX foci. Here we show that there were slight differences in the localization pattern among these proteins, such as a disappearance from the nucleus (phospho-ATM) and translocation to the cytoplasm (phospho-NBS1) at 30 min after heat treatment, and some foci (phospho-DNA-PKcs and phospho-CHK2) appeared at 8 h after heat treatment. These results are discussed from perspectives of heat-induced denaturation of proteins and formation of DSBs. (author)

  17. In Vitro Expansion of Bone Marrow Derived Mesenchymal Stem Cells Alters DNA Double Strand Break Repair of Etoposide Induced DNA Damage

    Directory of Open Access Journals (Sweden)

    Ian Hare

    2016-01-01

    Full Text Available Mesenchymal stem cells (MSCs are of interest for use in diverse cellular therapies. Ex vivo expansion of MSCs intended for transplantation must result in generation of cells that maintain fidelity of critical functions. Previous investigations have identified genetic and phenotypic alterations of MSCs with in vitro passage, but little is known regarding how culturing influences the ability of MSCs to repair double strand DNA breaks (DSBs, the most severe of DNA lesions. To investigate the response to DSB stress with passage in vitro, primary human MSCs were exposed to etoposide (VP16 at various passages with subsequent evaluation of cellular damage responses and DNA repair. Passage number did not affect susceptibility to VP16 or the incidence and repair kinetics of DSBs. Nonhomologous end joining (NHEJ transcripts showed little alteration with VP16 exposure or passage; however, homologous recombination (HR transcripts were reduced following VP16 exposure with this decrease amplified as MSCs were passaged in vitro. Functional evaluations of NHEJ and HR showed that MSCs were unable to activate NHEJ repair following VP16 stress in cells after successive passage. These results indicate that ex vivo expansion of MSCs alters their ability to perform DSB repair, a necessary function for cells intended for transplantation.

  18. In Vitro Expansion of Bone Marrow Derived Mesenchymal Stem Cells Alters DNA Double Strand Break Repair of Etoposide Induced DNA Damage.

    Science.gov (United States)

    Hare, Ian; Gencheva, Marieta; Evans, Rebecca; Fortney, James; Piktel, Debbie; Vos, Jeffrey A; Howell, David; Gibson, Laura F

    2016-01-01

    Mesenchymal stem cells (MSCs) are of interest for use in diverse cellular therapies. Ex vivo expansion of MSCs intended for transplantation must result in generation of cells that maintain fidelity of critical functions. Previous investigations have identified genetic and phenotypic alterations of MSCs with in vitro passage, but little is known regarding how culturing influences the ability of MSCs to repair double strand DNA breaks (DSBs), the most severe of DNA lesions. To investigate the response to DSB stress with passage in vitro, primary human MSCs were exposed to etoposide (VP16) at various passages with subsequent evaluation of cellular damage responses and DNA repair. Passage number did not affect susceptibility to VP16 or the incidence and repair kinetics of DSBs. Nonhomologous end joining (NHEJ) transcripts showed little alteration with VP16 exposure or passage; however, homologous recombination (HR) transcripts were reduced following VP16 exposure with this decrease amplified as MSCs were passaged in vitro. Functional evaluations of NHEJ and HR showed that MSCs were unable to activate NHEJ repair following VP16 stress in cells after successive passage. These results indicate that ex vivo expansion of MSCs alters their ability to perform DSB repair, a necessary function for cells intended for transplantation.

  19. TH-CD-201-11: Optimizing the Response and Cost of a DNA Double-Strand Break Dosimeter

    Energy Technology Data Exchange (ETDEWEB)

    Obeidat, M; Cline, K; Stathakis, S; Papanikolaou, N; Rasmussen, K; Gutierrez, A; Ha, CS; Lee, SE; Shim, EY; Kirby, N [University of Texas HSC SA, San Antonio, TX (United States)

    2016-06-15

    Purpose: A DNA double-strand break (DSB) dosimeter was developed to measure the biological effect of radiation. The goal here is to refine the fabrication method of this dosimeter to reproducibly create a low coefficient of variation (CoV) and reduce the cost for the dosimeter. Methods: Our dosimeter consists of 4 kilo-base pair DNA strands (labeled on one end with biotin and on the other with fluorescein) attached to streptavidin magnetic beads. The final step of the DNA dosimeter fabrication is to suspend these attached beads in phosphate-buffered saline (PBS). The amount of PBS used to suspend the attached beads and the relative volume of the DNA strands to the beads both affect the CoV and dosimeter cost. We diluted the beads attached with DNA in different volumes of PBS (100, 200, and 400 µL) to create different concentrations of the DNA dosimeter. Then we irradiated these dosimeters (50 µL samples) in a water-equivalent plastic phantom at 25 and 50 Gy (three samples per dose) and calculated the CoV for each dosimeter concentration. Also, we used different masses of DNA strands (1, 2, 8, 16, 24, and 32 µg) to attach to the same volume of magnetic beads (100 µL) to explore how this affects the cost of the dosimeter. Results: The lowest CoV was produced for the highest concentration of dosimeter (100 µL of PBS), which created CoV of 2.0 and 1.0% for 25 and 50 Gy, respectively. We found that the lowest production cost for the dosimeter occurs by attaching 16 µg of DNA strands with 100 µL of beads. Conclusion: : We optimized the fabrication of the DNA dosimeter to produce low CoV and cost, but we still need to explore ways to further improve the dosimeter for use at lower doses. This work was supported in part by Yarmouk University (Irbid, Jordan) and CPRIT (RP140105)

  20. Cyclic GMP-AMP Synthase is Activated by Double-stranded DNA-Induced Oligomerization

    OpenAIRE

    Li, Xin; Shu, Chang; Yi, Guanghui; Chaton, Catherine T.; Shelton, Catherine L.; Diao, Jiasheng; Zuo, Xiaobing; Kao, C Cheng; Herr, Andrew B.; Li, Pingwei

    2013-01-01

    Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor mediating innate antimicrobial immunity. It catalyzes the synthesis of a noncanonical cyclic dinucleotide 2′,5′ cGAMP that binds to STING and mediates the activation of TBK1 and IRF-3. Activated IRF-3 translocates to the nucleus and initiates the transcription of the IFN-β gene. The structure of mouse cGAS bound to an 18 bp dsDNA revealed that cGAS interacts with dsDNA through two binding sites, forming a 2:2 complex. Enzyme assays and ...

  1. Damage to cellular DNA from particulate radiations, the efficacy of its processing and the radiosensitivity of mammalian cells. Emphasis on DNA double strand breaks and chromatin breaks

    Science.gov (United States)

    Lett, J. T.

    1992-01-01

    For several years, it has been evident that cellular radiation biology is in a necessary period of consolidation and transition (Lett 1987, 1990; Lett et al. 1986, 1987). Both changes are moving apace, and have been stimulated by studies with heavy charged particles. From the standpoint of radiation chemistry, there is now a consensus of opinion that the DNA hydration shell must be distinguished from bulk water in the cell nucleus and treated as an integral part of DNA (chromatin) (Lett 1987). Concomitantly, sentiment is strengthening for the abandonment of the classical notions of "direct" and "indirect" action (Fielden and O'Neill 1991; O'Neill 1991; O'Neill et al. 1991; Schulte-Frohlinde and Bothe 1991 and references therein). A layer of water molecules outside, or in the outer edge of, the DNA (chromatin) hydration shell influences cellular radiosensitivity in ways not fully understood. Charge and energy transfer processes facilitated by, or involving, DNA hydration must be considered in rigorous theories of radiation action on cells. The induction and processing of double stand breaks (DSBs) in DNA (chromatin) seem to be the predominant determinants of the radiotoxicity of normally radioresistant mammalian cells, the survival curves of which reflect the patterns of damage induced and the damage present after processing ceases, and can be modelled in formal terms by the use of reaction (enzyme) kinetics. Incongruities such as sublethal damage are neither scientifically sound nor relevant to cellular radiation biology (Calkins 1991; Lett 1990; Lett et al. 1987a). Increases in linear energy transfer (LET infinity) up to 100-200 keV micron-1 cause increases in the extents of neighboring chemical and physical damage in DNA denoted by the general term DSB. Those changes are accompanied by decreasing abilities of cells normally radioresistant to sparsely ionizing radiations to process DSBs in DNA and chromatin and to recover from radiation exposure, so they make

  2. Gefitinib Radiosensitizes Stem-Like Glioma Cells: Inhibition of Epidermal Growth Factor Receptor-Akt-DNA-PK Signaling, Accompanied by Inhibition of DNA Double-Strand Break Repair

    International Nuclear Information System (INIS)

    Kang, Khong Bee; Zhu Congju; Wong Yinling; Gao Qiuhan; Ty, Albert; Wong, Meng Cheong

    2012-01-01

    Purpose: We compared radiosensitivity of brain tumor stem cells (BTSCs) with matched nonstem glioma cells, and determined whether gefitinib enhanced BTSC radiosensitivity by inhibiting epidermal growth factor receptor (EGFR)–Akt-DNA–dependent protein kinase (DNA-PK) signaling, followed by enhanced DNA double-stand breaks (DSBs) and inhibition of DSB repair. Methods and Materials: Radiosensitivity of stem-like gliomaspheres and nonstem glioma cells (obtained at patient neurosurgical resection) were evaluated by clonogenic assays, γ-H 2 AX immunostaining and cell cycle distribution. Survival of irradiated and nonirradiated NOD-SCID mice intracranially implanted with stem-like gliomaspheres were monitored. Glioma cells treated with gefitinib, irradiation, or both were assayed for clonogenic survival, γ-H 2 AX immunostaining, DNA-PKcs expression, and phosphorylation of EGFR and Akt. Results: Stem-like gliomaspheres displayed BTSC characteristics of self-renewal; differentiation into lineages of neurons, oligodendrocytes, and astrocytes; and initiation of glioma growth in NOD-SCID mice. Irradiation dose-dependently reduced clonogenic survival, induced G 2 /M arrest and increased γ-H 2 AX immunostaining of nonstem glioma cells, but not stem-like gliomaspheres. There was no difference in survival of irradiated and nonirradiated mice implanted with stem-like gliomaspheres. The addition of gefitinib significantly inhibited clonogenic survival, increased γ-H 2 AX immunostaining, and reduced DNA-PKcs expression of irradiated stem-like gliomaspheres, without affecting irradiated-nonstem glioma cells. Gefitinib alone, and when combined with irradiation, inhibited phosphorylation of EGFR (Y1068 and Y1045) and Akt (S473) in stem-like gliomaspheres. In nonstem glioma cells, gefitinib alone inhibited EGFR Y1068 phosphorylation, with further inhibition by combined gefitinib and irradiation. Conclusions: Stem-like gliomaspheres are resistant to irradiation

  3. Differential regulation of the cellular response to DNA double-strand breaks in G1

    DEFF Research Database (Denmark)

    Barlow, Jacqueline H; Lisby, Michael; Rothstein, Rodney

    2008-01-01

    -induced breaks are recognized by Rfa1 only after the cell enters S phase. This difference is dependent on the DNA end-binding Yku70/Yku80 complex. Cell-cycle regulation is also observed in the DNA damage checkpoint response. Specifically, the 9-1-1 complex is required in G1 cells to recruit the Ddc2 checkpoint...... protein to damaged DNA, while, upon entry into S phase, the cyclin-dependent kinase Cdc28 and the 9-1-1 complex both serve to recruit Ddc2 to foci. Together, these results demonstrate that the DNA repair machinery distinguishes between different types of damage in G1, which translates into different modes...

  4. Mitochondrial DNA double-strand breaks in oligodendrocytes cause demyelination, axonal injury, and CNS inflammation

    DEFF Research Database (Denmark)

    Madsen, Pernille M.; Pinto, Milena; Patel, Shreyans

    2017-01-01

    with time of induction. In addition, after short transient induction of mtDNA DSBs, PLP:mtPstI mice showed an exacerbated response to experimental autoimmune encephalomyelitis. Together, our data demonstrate that mtDNA damage can cause primary oligodendropathy, which in turn triggers demyelination, proving...... forms, which are not accurately reproduced in the models currently available. For this reason, the PLP: mtPstI mouse represents a unique and much needed platform for testing remyelinating therapies....

  5. Structure and dynamics of double helical DNA in torsion angle hyperspace: a molecular mechanics approach.

    Science.gov (United States)

    Borkar, Aditi; Ghosh, Indira; Bhattacharyya, Dhananjay

    2010-04-01

    Analysis of the conformational space populated by the torsion angles and the correlation between the conformational energy and the sequence of DNA are important for fully understanding DNA structure and function. Presence of seven variable torsion angles about single covalent bonds in DNA main chain puts a big challenge for such analysis. We have carried out restrained energy minimization studies for four representative dinucleosides, namely d(ApA):d(TpT), d(CpG):d(CpG), d(GpC):d(GpC) and d(CpA):d(TpG) to determine the energy hyperspace of DNA in context to the values of the torsion angles and the structural properties of the DNA conformations populating the favorable regions of this energy hyperspace. The torsion angles were manipulated by constraining their values at the reference points and then performing energy minimization. The energy minima obtained on the potential energy contour plots mostly correspond to the conformations populated in crystal structures of DNA. Some novel favorable conformations that are not present in crystal structure data are also found. The plots also suggest few low energy routes for conformational transitions or the associated energy barrier heights. Analyses of base pairing and stacking possibility reveal structural changes accompanying these transitions as well as the flexibility of different base steps towards variations in different torsion angles.

  6. Phase, current, absorbance, and photoluminescence of double and triple metal ion-doped synthetic and salmon DNA thin films

    Science.gov (United States)

    Chopade, Prathamesh; Reddy Dugasani, Sreekantha; Reddy Kesama, Mallikarjuna; Yoo, Sanghyun; Gnapareddy, Bramaramba; Lee, Yun Woo; Jeon, Sohee; Jeong, Jun-Ho; Park, Sung Ha

    2017-10-01

    We fabricated synthetic double-crossover (DX) DNA lattices and natural salmon DNA (SDNA) thin films, doped with 3 combinations of double divalent metal ions (M2+)-doped groups (Co2+-Ni2+, Cu2+-Co2+, and Cu2+-Ni2+) and single combination of a triple M2+-doped group (Cu2+-Ni2+-Co2+) at various concentrations of M2+ ([M2+]). We evaluated the optimum concentration of M2+ ([M2+]O) (the phase of M2+-doped DX DNA lattices changed from crystalline (up to ([M2+]O) to amorphous (above [M2+]O)) and measured the current, absorbance, and photoluminescent characteristics of multiple M2+-doped SDNA thin films. Phase transitions (visualized in phase diagrams theoretically as well as experimentally) from crystalline to amorphous for double (Co2+-Ni2+, Cu2+-Co2+, and Cu2+-Ni2+) and triple (Cu2+-Ni2+-Co2+) dopings occurred between 0.8 mM and 1.0 mM of Ni2+ at a fixed 0.5 mM of Co2+, between 0.6 mM and 0.8 mM of Co2+ at a fixed 3.0 mM of Cu2+, between 0.6 mM and 0.8 mM of Ni2+ at a fixed 3.0 mM of Cu2+, and between 0.6 mM and 0.8 mM of Co2+ at fixed 2.0 mM of Cu2+ and 0.8 mM of Ni2+, respectively. The overall behavior of the current and photoluminescence showed increments as increasing [M2+] up to [M2+]O, then decrements with further increasing [M2+]. On the other hand, absorbance at 260 nm showed the opposite behavior. Multiple M2+-doped DNA thin films can be used in specific devices and sensors with enhanced optoelectric characteristics and tunable multi-functionalities.

  7. Relationship between internal dosimetry and DNA double strand breaks in lymphocytes after radionuclide therapy; Zusammenhang zwischen physikalischer Dosimetrie und DNA Doppelstrangbruechen in Lymphozyten nach Radionuklidtherapie

    Energy Technology Data Exchange (ETDEWEB)

    Eberlein, Uta

    2015-09-30

    In radionuclide therapy radiopharmaceuticals are administered mostly systemically. Primarily, beta-emitters are used because of their short range in tissue. As a result the radiopharmaceutical distributes within the human body and accumulates in organs and target structures. Thus, the body is irradiated internally, in contrast to external irradiation in radiotherapy. The pattern of the activity distribution within the human body is determined by the physical and chemical properties of the radiopharmaceutical. Furthermore, the amount of activity and its accumulation in organs or tissues is essential for the calculation of the absorbed dose which defines the energy deposited in the body by ionizing radiation. During internal or external irradiation, patients are exposed to ionizing radiation which does not only destroy the malignant cells but also damages healthy tissue and cells. This is mainly caused by direct and indirect interaction of the radiation with the DNA which damages the DNA structure. Most frequently, there are single strand breaks and base damages. DNA double strand breaks (DSBs) are rare; nevertheless, they are the most critical lesions for cells as repairing the damage is difficult. Unrepaired or misrepaired DNA could cause mutations, chromosomal aberrations or lead to cell death. The formation of a DNA DSB in nuclear chromatin results in the rapid phosphorylation of the histone H2 variant H2AX, then called gamma-H2AX. Furthermore, DSBs also recruit the damage sensor 53BP1 to the chromatin surrounding the DSBs, which leads to 53BP1 and gamma-H2AX co-localization in the chromatin surrounding a DSB. By immunofluorescence staining with gamma-H2AX and 53BP1 antibodies those biomarkers can be addressed by microscopically visible DNA damage protein foci, this is also known as the DNA damage focus assay. With progression of DSB repair, gamma-H2AX and 53BP1 foci disappear. It is assumed that one focus corresponds to one DSB. Therefore, the number of foci per

  8. DNA double-strand break measurement in mammalian cells by pulsed-field gel electrophoresis: an approach using restriction enzymes and gene probing

    International Nuclear Information System (INIS)

    Loebrich, M.; Ikpeme, S.; Kiefer, J.

    1994-01-01

    DNA samples prepared from human SP 3 cells, which had not been exposed to various doses of X-ray, were treated with NotI restriction endonuclease before being run in a contour-clamped homogeneous electrophoresis system. The restriction enzyme cuts the DNA at defined positions delivering DNA sizes which can be resolved by pulsed-field gel electrophoresis (PFGE). In order to investigate only one of the DNA fragments, a human lactoferrin cDNA, pHL-41, was hybridized to the DNA separated by PFGE. As a result, only the DNA fragment which contains the hybridized gene was detected resulting in a one-band pattern. The decrease of this band was found to be exponential with increasing radiation dose. From the slope, a double-strand break induction rate of (6.3±0.7) x 10 -3 /Mbp/Gy was deduced for 80 kV X-rays. (Author)

  9. Measurement of intracellular DNA double-strand break induction and rejoining along the track of carbon and neon particle beams in water

    International Nuclear Information System (INIS)

    Heilmann, Johannes; Taucher-Scholz, Gisela; Haberer, Thomas; Scholz, Michael; Kraft, Gerhard

    1996-01-01

    Purpose: The study was aimed at the measurement of effect-depth distributions of intracellularly induced DNA damage in water as tissue equivalent after heavy ion irradiation with therapy particle beams. Methods and Materials: An assay involving embedding of Chinese hamster ovary (CHO-K1) cells in large agarose plugs and electrophoretic elution of radiation induced DNA fragments by constant field gel electrophoresis was developed. Double-strand break production was quantified by densitometric analysis of DNA-fluorescence after staining with ethidium-bromide and determination of the fraction of DNA eluted out of the agarose plugs. Intracellular double-strand break induction and the effect of a 3 h rejoining incubation were investigated following irradiation with 250 kV x-rays and 190 MeV/u carbon- and 295 MeV/u neon-ions. Results and Conclusion: While the DNA damage induced by x-irradiation decreased continuously with penetration depth, a steady increase in the yield of double-strand breaks was observed for particle radiation, reaching distinct maxima at the position of the physical Bragg peaks. Beyond this, the extent of radiation damage dropped drastically. From comparison of DNA damage and calculated dose profiles, relative biological efficiencies (RBEs) for both double-strand break induction and unrejoined strand breaks after 3 h were determined. While RBE for the induction of DNA double-strand breaks decreased continuously with penetration depth, RBE maxima greater than unity were found with carbon- and neon-ions for double-strand break rejoining near the maximum range of the particles. The method presented here allows for a fast and accurate determination of depth profiles of relevant radiobiological effects for mixed particle fields in tissue equivalent

  10. The mechanism of double-stranded DNA sensing through the cGAS-STING pathway.

    Science.gov (United States)

    Shu, Chang; Li, Xin; Li, Pingwei

    2014-12-01

    Microbial nucleic acids induce potent innate immune responses by stimulating the expression of type I interferons. Cyclic GMP-AMP synthase (cGAS) is a cytosolic dsDNA sensor mediating the innate immunity to microbial DNA. cGAS is activated by dsDNA and catalyze the synthesis of a cyclic dinucleotide cGAMP with 2',5' and 3',5'phosphodiester linkages. cGAMP binds to the adaptor STING located on the endoplasmic reticulum membrane and mediates the recruitment and activation of the protein kinase TBK1 and transcription factor IRF3. Phosphorylated IRF3 translocates to the nucleus and initiates the transcription of the IFN-β gene. The crystal structures of cGAS and its complex with dsDNA, STING and its complex with various cyclic dinucleotides have been determined recently. Here we summarize the results from these structural studies and provide an overview about the mechanism of cGAS activation by dsDNA, the catalytic mechanism of cGAS, and the structural basis of STING activation by cGAMP. Published by Elsevier Ltd.

  11. A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

    International Nuclear Information System (INIS)

    Hahn, P.J.; Giddings, L.; Lane, M.J.

    1989-01-01

    Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

  12. Production of DNA Double Strand Breaks in Human Cells due to Acute Exposure to Tritiated Water (HTO)

    International Nuclear Information System (INIS)

    Gonen, R.; German, U.; Alfassi, Z. B.; Priel, E.

    2014-01-01

    The average and maximum energies of the beta emission from 3H are 5.69 keV and 18.6 keV respectively. The average range in water (or soft tissues), around 0.5 1/4m (500 nm), is considerably less than the typical diameter of a cell (10-30 1/4m), and even of a cell nucleus (5-10 1/4m), thus the micro-location of the tritium atom may well be crucial in determining its biochemical consequences. Due to the high ionization density of the beta particles emitted by tritium (about 400 ion pairs/1/4m) possible interaction of tritium beta radiation with DNA may play a significant role. Tritiated water (HTO) is the main chemical form in which tritium is found in the environment. In the body it may be retained as organically bound tritium (OBT), binding to biological molecules or remaining as OBT with various degrees of solubility. OBT can be retained in the human body much longer than HTO and therefore the dose arising from OBT can reach 50% of the total tritium dose . Histones are major protein components of chromatin. They function as spools around which DNA winds and play an important role in the regulation of gene expression. In the absence of histones, the DNA in chromosomes would be unmanageably long, as human cells each have about 1.8 m of DNA. During mitosis, DNA is duplicated and condensed, resulting in about 120 1/4m of chromosomes. It was recently reported that the phosphorylation of histone H2AX on serine residue 139 (D 3 -H2AX) is associated with Double Strand Breaks (DSB) sites in DNA), which indicates the possibility of research based on the detection of DSBs in DNA. The phosphorylated megabase chromatin domain surrounding the DSB can be immunostained and visualized as discrete foci by fluorescence microscopy, as each DNA DSB formed produces a visible D 3 -H2AX focus. Since 1 Gy of radiation produces approximately 60 DSBs/cell, doses of a few mGy should be distinguishable from the background, and it was recently shown that the exposure to 1 mGy of X-rays induces

  13. Depletion of the type 1 IGF receptor delays repair of radiation-induced DNA double strand breaks

    International Nuclear Information System (INIS)

    Turney, Benjamin W.; Kerr, Martin; Chitnis, Meenali M.; Lodhia, Kunal; Wang, Yong; Riedemann, Johann; Rochester, Mark; Protheroe, Andrew S.; Brewster, Simon F.; Macaulay, Valentine M.

    2012-01-01

    Background and purpose: IGF-1R depletion sensitizes prostate cancer cells to ionizing radiation and DNA-damaging cytotoxic drugs. This study investigated the hypothesis that IGF-1R regulates DNA double strand break (DSB) repair. Methods: We tested effects of IGF-1R siRNA transfection on the repair of radiation-induced DSBs by immunoblotting and immunofluorescence for γH2AX, and pulsed-field gel electrophoresis. Homologous recombination (HR) was quantified by reporter assays, and cell cycle distribution by flow cytometry. Results: We confirmed that IGF-1R depletion sensitized DU145 and PC3 prostate cancer cells to ionizing radiation. DU145 control transfectants resolved radiation-induced DSBs within 24 h, while IGF-1R depleted cells contained 30–40% unrepaired breaks at 24 h. IGF-1R depletion induced significant reduction in DSB repair by HR, although the magnitude of the repair defect suggests additional contributory factors. Radiation-induced G2-M arrest was attenuated by IGF-1R depletion, potentially suppressing cell cycle-dependent processes required for HR. In contrast, IGF-1R depletion induced only minor radiosensitization in LNCaP cells, and did not influence repair. Cell cycle profiles were similar to DU145, so were unlikely to account for differences in repair responses. Conclusions: These data indicate a role for IGF-1R in DSB repair, at least in part via HR, and support use of IGF-1R inhibitors with DNA damaging cancer treatments.

  14. The Fanconi anemia group A protein modulates homologous repair of DNA double-strand breaks in mammalian cells.

    Science.gov (United States)

    Yang, Yun-Gui; Herceg, Zdenko; Nakanishi, Koji; Demuth, Ilja; Piccoli, Colette; Michelon, Jocelyne; Hildebrand, Gabriele; Jasin, Maria; Digweed, Martin; Wang, Zhao-Qi

    2005-10-01

    Fanconi anemia (FA) cells exhibit hypersensitivity to DNA interstrand cross-links (ICLs) and high levels of chromosome instability. FA gene products have been shown to functionally or physically interact with BRCA1, RAD51 and the MRE11/RAD50/NBS1 complex, suggesting that the FA complex may be involved in the repair of DNA double-strand breaks (DSBs). Here, we have investigated specifically the function of the FA group A protein (FANCA) in the repair of DSBs in mammalian cells. We show that the targeted deletion of Fanca exons 37-39 generates a null for Fanca in mice and abolishes ubiquitination of Fancd2, the downstream effector of the FA complex. Cells lacking Fanca exhibit increased chromosomal aberrations and attenuated accumulation of Brca1 and Rad51 foci in response to DNA damage. The absence of Fanca greatly reduces gene-targeting efficiency in mouse embryonic stem (ES) cells and compromises the survival of fibroblast cells in response to ICL agent treatment. Fanca-null cells exhibit compromised homology-directed repair (HDR) of DSBs, particularly affecting the single-strand annealing pathway. These data identify the Fanca protein as an integral component in the early step of HDR of DSBs and thereby minimizing the genomic instability.

  15. Altered Hematopoiesis in Mice Lacking DNA Polymerase μ Is Due to Inefficient Double-Strand Break Repair

    Science.gov (United States)

    Lucas, Daniel; Escudero, Beatriz; Ligos, José Manuel; Segovia, Jose Carlos; Estrada, Juan Camilo; Terrados, Gloria; Blanco, Luis; Samper, Enrique; Bernad, Antonio

    2009-01-01

    Polymerase mu (Polμ) is an error-prone, DNA-directed DNA polymerase that participates in non-homologous end-joining (NHEJ) repair. In vivo, Polμ deficiency results in impaired Vκ-Jκ recombination and altered somatic hypermutation and centroblast development. In Polμ−/− mice, hematopoietic development was defective in several peripheral and bone marrow (BM) cell populations, with about a 40% decrease in BM cell number that affected several hematopoietic lineages. Hematopoietic progenitors were reduced both in number and in expansion potential. The observed phenotype correlates with a reduced efficiency in DNA double-strand break (DSB) repair in hematopoietic tissue. Whole-body γ-irradiation revealed that Polμ also plays a role in DSB repair in non-hematopoietic tissues. Our results show that Polμ function is required for physiological hematopoietic development with an important role in maintaining early progenitor cell homeostasis and genetic stability in hematopoietic and non-hematopoietic tissues. PMID:19229323

  16. Depletion of the type 1 IGF receptor delays repair of radiation-induced DNA double strand breaks.

    Science.gov (United States)

    Turney, Benjamin W; Kerr, Martin; Chitnis, Meenali M; Lodhia, Kunal; Wang, Yong; Riedemann, Johann; Rochester, Mark; Protheroe, Andrew S; Brewster, Simon F; Macaulay, Valentine M

    2012-06-01

    IGF-1R depletion sensitizes prostate cancer cells to ionizing radiation and DNA-damaging cytotoxic drugs. This study investigated the hypothesis that IGF-1R regulates DNA double strand break (DSB) repair. We tested effects of IGF-1R siRNA transfection on the repair of radiation-induced DSBs by immunoblotting and immunofluorescence for γH2AX, and pulsed-field gel electrophoresis. Homologous recombination (HR) was quantified by reporter assays, and cell cycle distribution by flow cytometry. We confirmed that IGF-1R depletion sensitized DU145 and PC3 prostate cancer cells to ionizing radiation. DU145 control transfectants resolved radiation-induced DSBs within 24 h, while IGF-1R depleted cells contained 30-40% unrepaired breaks at 24 h. IGF-1R depletion induced significant reduction in DSB repair by HR, although the magnitude of the repair defect suggests additional contributory factors. Radiation-induced G2-M arrest was attenuated by IGF-1R depletion, potentially suppressing cell cycle-dependent processes required for HR. In contrast, IGF-1R depletion induced only minor radiosensitization in LNCaP cells, and did not influence repair. Cell cycle profiles were similar to DU145, so were unlikely to account for differences in repair responses. These data indicate a role for IGF-1R in DSB repair, at least in part via HR, and support use of IGF-1R inhibitors with DNA damaging cancer treatments. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  17. Twist–radial normal mode analysis in double-stranded DNA chains

    International Nuclear Information System (INIS)

    Torrellas, Germán; Maciá, Enrique

    2012-01-01

    We study the normal modes of a duplex DNA chain at low temperatures. We consider the coupling between the hydrogen-bond radial oscillations and the twisting motion of each base pair within the Peyrard–Bishop–Dauxois model. The coupling is mediated by the stacking interaction between adjacent base pairs along the helix. We explicitly consider different mass values for different nucleotides, extending previous works. We disclose several resonance conditions of interest, determined by the fine-tuning of certain model parameters. The role of these dynamical effects on the DNA chain charge transport properties is discussed.

  18. TU-H-CAMPUS-TeP2-04: Measurement of Stereotactic Output Factors with DNA Double-Strand Breaks

    Energy Technology Data Exchange (ETDEWEB)

    Cline, K; Obeidat, M; Stathakis, S; Kabat, C; Markovic, M; Papanikolaou, N; Rasmussen, K; Gutierrez, A; Ha, C; Lee, S; Shim, E; Kirby, N [University of Texas HSC SA, San Antonio, TX (United States)

    2016-06-15

    Purpose: Radiotherapy treatment is specified by radiation dose prescriptions, but biological DNA damage actually controls treatment effectiveness. It is impractical to directly measure dose in the clinic, so we measure quantities, such as collected charge, and calculate the relationship to dose. At small fields, such as those in stereotactic radiosurgery (SRS), charged-particle equilibrium (CPE) breaks down and the accuracy of the measurement for delivered dose decreases. By measuring DNA double-strand breaks (DSB) directly, we believe treatment accuracy could improve by providing a more meaningful measurement. Methods: A DNA dosimeter, consisting of magnetic streptavidin beads attached to 4 kilobase pair DNA strands labeled with biotin and fluorescein amidite (FAM) on opposing ends, was suspended in phosphate-buffered saline (PBS). Twenty µL samples were placed in plastic micro-capillary tubes inside a water tank setup and irradiated with 10 cm, 3 cm, 1.25 cm, 0.75 cm, and 0.5 cm radiation field sizes, where the three smallest sizes were cones. After irradiation, the dosimeters were mechanically separated into beads (intact DNA) and supernatant (broken DNA/FAM) using a magnet. The fluorescence was read and the probability of DSB was calculated. This was used to calculate the output factor for an SRS beam and compared to that measured using a diode detector. Results: The output factors relative to a 10 cm field were 0.89±0.07, 0.76±0.08, 0.59±0.04, and 0.78±0.12 for the field sizes of 3 cm, 1.25 cm, 0.75 cm, and 0.5 cm, respectively. Some of the diode measurements do not fall within these uncertainties. Conclusion: This was the first attempt to measure output factors in a water tank with the DNA dosimeter. Although differences compared to the diode were observed, the uncertainty analysis ignored systematic errors. For future work, we will repeat this experiment to quantify and correct systematic errors, such as those caused by positional alignment and sample

  19. DNA with Parallel Strand Orientation: A Nanometer Distance Study with Spin Labels in the Watson-Crick and the Reverse Watson-Crick Double Helix.

    Science.gov (United States)

    Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen

    2015-10-29

    Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.

  20. Oncogenic ras-driven cancer cell vesiculation leads to emission of double-stranded DNA capable of interacting with target cells

    International Nuclear Information System (INIS)

    Lee, Tae Hoon; Chennakrishnaiah, Shilpa; Audemard, Eric; Montermini, Laura; Meehan, Brian; Rak, Janusz

    2014-01-01

    Highlights: • Oncogenic H-ras stimulates emission of extracellular vesicles containing double-stranded DNA. • Vesicle-associated extracellular DNA contains mutant N-ras sequences. • Vesicles mediate intercellular transfer of mutant H-ras DNA to normal fibroblasts where it remains for several weeks. • Fibroblasts exposed to vesicles containing H-ras DNA exhibit increased proliferation. - Abstract: Cell free DNA is often regarded as a source of genetic cancer biomarkers, but the related mechanisms of DNA release, composition and biological activity remain unclear. Here we show that rat epithelial cell transformation by the human H-ras oncogene leads to an increase in production of small, exosomal-like extracellular vesicles by viable cancer cells. These EVs contain chromatin-associated double-stranded DNA fragments covering the entire host genome, including full-length H-ras. Oncogenic N-ras and SV40LT sequences were also found in EVs emitted from spontaneous mouse brain tumor cells. Disruption of acidic sphingomyelinase and the p53/Rb pathway did not block emission of EV-related oncogenic DNA. Exposure of non-transformed RAT-1 cells to EVs containing mutant H-ras DNA led to the uptake and retention of this material for an extended (30 days) but transient period of time, and stimulated cell proliferation. Thus, our study suggests that H-ras-mediated transformation stimulates vesicular emission of this histone-bound oncogene, which may interact with non-transformed cells

  1. Oncogenic ras-driven cancer cell vesiculation leads to emission of double-stranded DNA capable of interacting with target cells

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Tae Hoon; Chennakrishnaiah, Shilpa [Montreal Children’s Hospital, Research Institute of McGill University Health Centre, McGill University, Montreal, Quebec (Canada); Audemard, Eric [McGill University and Genome Quebec Innovation Centre, Montreal, Quebec (Canada); Montermini, Laura; Meehan, Brian [Montreal Children’s Hospital, Research Institute of McGill University Health Centre, McGill University, Montreal, Quebec (Canada); Rak, Janusz, E-mail: janusz.rak@mcgill.ca [Montreal Children’s Hospital, Research Institute of McGill University Health Centre, McGill University, Montreal, Quebec (Canada)

    2014-08-22

    Highlights: • Oncogenic H-ras stimulates emission of extracellular vesicles containing double-stranded DNA. • Vesicle-associated extracellular DNA contains mutant N-ras sequences. • Vesicles mediate intercellular transfer of mutant H-ras DNA to normal fibroblasts where it remains for several weeks. • Fibroblasts exposed to vesicles containing H-ras DNA exhibit increased proliferation. - Abstract: Cell free DNA is often regarded as a source of genetic cancer biomarkers, but the related mechanisms of DNA release, composition and biological activity remain unclear. Here we show that rat epithelial cell transformation by the human H-ras oncogene leads to an increase in production of small, exosomal-like extracellular vesicles by viable cancer cells. These EVs contain chromatin-associated double-stranded DNA fragments covering the entire host genome, including full-length H-ras. Oncogenic N-ras and SV40LT sequences were also found in EVs emitted from spontaneous mouse brain tumor cells. Disruption of acidic sphingomyelinase and the p53/Rb pathway did not block emission of EV-related oncogenic DNA. Exposure of non-transformed RAT-1 cells to EVs containing mutant H-ras DNA led to the uptake and retention of this material for an extended (30 days) but transient period of time, and stimulated cell proliferation. Thus, our study suggests that H-ras-mediated transformation stimulates vesicular emission of this histone-bound oncogene, which may interact with non-transformed cells.

  2. Investigation on accordance of DNA double-strand break of blood between in vivo and in vitro irradiation using single cell gel electrophoresis

    International Nuclear Information System (INIS)

    Liu Qiang; Jiang Enhai; Li Jin; Tang Weisheng; Wang Zhiquan; Zhao Yongcheng; Fan Feiyue

    2006-01-01

    Objective: To observe the consistency of DNA double-strand break between in vivo and in vitro irradiation, as a prophase study in radiation biodosimetry using single cell gel electrophoresis (SCGE). Methods: Detect DNA double-strand break after whole-body and in vitro radiation in mice lymphocytes using neutral single cell gel electrophoresis. The comet images were processed by CASP software and all the data were analysed by SPSS12.0. Results: There is no difference between in vivo and in vitro irradiation group in HDNA%, TDNA%, CL, TL, TM and OTM. Conclusion: The result of neutral single cell gel electrophoresis shortly after in vitro irradiation can precisely reflect the DNA double-strand break of lymphocytes in whole-body irradiation. (authors)

  3. Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

    NARCIS (Netherlands)

    Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  4. Coexposure to benzo[a]pyrene plus UVA induced DNA double strand breaks: visualization of Ku assembly in the nucleus having DNA lesions

    International Nuclear Information System (INIS)

    Toyooka, Tatsushi; Ibuki, Yuko; Koike, Manabu; Ohashi, Norio; Takahashi, Sentaro; Goto, Rensuke

    2004-01-01

    Benzo[a]pyrene (BaP) is a ubiquitous environmental pollutant with potential carcinogenicity. It has been shown that BaP, upon UVA irradiation, synergistically induced oxidative DNA damage, but other DNA damage was not confirmed. In this study, we examined whether coexposure to BaP plus UVA induces double strand breaks (DSBs) using xrs-5 cells, deficient in the repair of DSBs (Ku80 mutant), and whether Ku translocates involving the formation of DSBs. BaP plus UVA had a significant cytotoxic effect on CHO-K1 cells and an even more drastic effect on Ku80-deficient, xrs-5 cells, suggesting that the DSBs were generated by coexposure to BaP plus UVA. The DSBs were repaired in CHO-K1 cells within 30 min, but not in xrs-5 cells, indicating the involvement of a non-homologous end joining, which needs Ku proteins. Furthermore, we succeeded in visualizing that Ku80 rapidly assembled to the exposed region, in which DSBs might be generated, and clarified that the presence of both Ku70 and Ku80 was important for their accumulation

  5. X-ray-induced DNA double-strand breaks after angiographic examinations of different anatomic regions; Strahleninduzierte DNA-Doppelstrangbrueche nach Angiografien verschiedener Koerperregionen

    Energy Technology Data Exchange (ETDEWEB)

    Kuefner, M.A.; Schwab, S.A.; Azoulay, S.; Heckmann, M.; Heinrich, M.C.; Uder, M. [Universitaetsklinikum Erlangen (Germany). Radiologisches Inst.; Grudzenski, S.; Lobrich, M. [Technische Univ. Darmstadt (Germany). Strahlenbiologie und DNA-Reparatur

    2009-04-15

    Purpose: The aim of this study was to investigate DNA double-strand breaks (DSBs) in blood lymphocytes as markers of the biological radiation effects in angiography patients. Materials and Methods: The method is based on the phosphorylation of the histone variant H 2AX ({gamma}-H2AX) after formation of DSBs. Blood samples were collected before and up to 24 hours after exposure of 31 patients undergoing angiographies of different body regions. Blood lymphocytes were isolated, fixed, and stained with a specific {gamma}-H2AX antibody. Distinct foci representing DSBs were enumerated using fluorescence microscopy. Additional in-vitro experiments (10 - 100 mGy) were performed for evaluation of DBS repair. Results: 15 minutes after the end of fluoroscopy values between 0.01 and 1.50 DSBs per cell were obtained. The DNA damage level normalized to the dose area product was 0.099 (cardiac angiographies), 0.053 (abdominal angiographies), 0.023 (pelvic/leg angiographies) and 0.004 excess foci/cell/mGym{sup 2} (cerebrovascular angiographies). A linear correlation was found between {gamma}-H2AX foci levels and the dose area product (abdomen: R2 = 0.96; pelvis/legs: R2 = 0.71). In-vivo on average 46 % of DSBs disappeared within 1 hour and 70 % within 2.5 hours. Conclusion: {gamma}-H2AX immunofluorescence microscopy is a sensitive and reliable method for the determination of X-ray-induced DSBs during angiography. The DNA damage level depends on the dose, the exposed anatomic region, and the duration/fractionation of the X-ray exposure. (orig.)

  6. DNA double strand breaks but not interstrand crosslinks prevent progress through meiosis in fully grown mouse oocytes.

    Directory of Open Access Journals (Sweden)

    Wai Shan Yuen

    Full Text Available There is some interest in how mammalian oocytes respond to different types of DNA damage because of the increasing expectation of fertility preservation in women undergoing chemotherapy. Double strand breaks (DSBs induced by ionizing radiation and agents such as neocarzinostatin (NCS, and interstrand crosslinks (ICLs induced by alkylating agents such as mitomycin C (MMC, are toxic DNA lesions that need to be repaired for cell survival. Here we examined the effects of NCS and MMC treatment on oocytes collected from antral follicles in mice, because potentially such oocytes are readily collected from ovaries and do not need to be in vitro grown to achieve meiotic competency. We found that oocytes were sensitive to NCS, such that this ionizing radiation mimetic blocked meiosis I and caused fragmented DNA. In contrast, MMC had no impact on the completion of either meiosis I or II, even at extremely high doses. However, oocytes treated with MMC did show γ-H2AX foci and following their in vitro maturation and parthenogenetic activation the development of the subsequent embryos was severely compromised. Addition of MMC to 1-cell embryos caused a similarly poor level of development, demonstrating oocytes have eventual sensitivity to this ICL-inducing agent but this does not occur during their meiotic division. In oocytes, the association of Fanconi Anemia protein, FANCD2, with sites of ICL lesions was not apparent until entry into the embryonic cell cycle. In conclusion, meiotic maturation of oocytes is sensitive to DSBs but not ICLs. The ability of oocytes to tolerate severe ICL damage and yet complete meiosis, means that this type of DNA lesion goes unrepaired in oocytes but impacts on subsequent embryo quality.

  7. Cell lines derived from a Medaka radiation-sensitive mutant have defects in DNA double-strand break responses

    International Nuclear Information System (INIS)

    Hidaka, Masayuki; Oda, Shoji; Mitani, Hiroshi; Kuwahara, Yoshikazu; Fukumoto, Manabu

    2010-01-01

    It was reported that the radiation-sensitive Medaka mutant 'ric1' has a defect in the repair of DNA double-strand breaks (DSBs) induced by γ-rays during early embryogenesis. To study the cellular response of a ric1 mutant to ionizing radiation (IR), we established the mutant embryonic cell lines RIC1-e9, RIC1-e42, RIC1-e43. Following exposure to γ-irradiation, the DSBs in wild-type cells were repaired within 1 h, while those in RIC1 cells were not rejoined even after 2 h. Cell death was induced in the wild-type cells with cell fragmentation, but only a small proportion of the RIC1 cells underwent cell death, and without cell fragmentation. Although both wild-type and RIC1 cells showed mitotic inhibition immediately after γ-irradiation, cell division was much slower to resume in the wild-type cells (20 h versus 12 h). In both wild-type and RIC1 cells, Ser139 phosphorylated H2AX (γH2AX) foci were formed after γ-irradiation, however, the γH2AX foci disappeared more quickly in the RIC1 cell lines. These results suggest that the instability of γH2AX foci in RIC1 cells cause an aberration of the DNA damage response. As RIC1 cultured cells showed similar defective DNA repair as ric1 embryos and RIC1 cells revealed defective cell death and cell cycle checkpoint, they are useful for investigating DNA damage responses in vitro. (author)

  8. Xrcc1-dependent and Ku-dependent DNA double-strand break repair kinetics in Arabidopsis plants.

    Science.gov (United States)

    Charbonnel, Cyril; Gallego, Maria E; White, Charles I

    2010-10-01

    Double-strand breakage (DSB) of DNA involves loss of information on the two strands of the DNA fibre and thus cannot be repaired by simple copying of the complementary strand which is possible with single-strand DNA damage. Homologous recombination (HR) can precisely repair DSB using another copy of the genome as template and non-homologous recombination (NHR) permits repair of DSB with little or no dependence on DNA sequence homology. In addition to the well-characterised Ku-dependent non-homologous end-joining (NHEJ) pathway, much recent attention has been focused on Ku-independent NHR. The complex interrelationships and regulation of NHR pathways remain poorly understood, even more so in the case of plants, and we present here an analysis of Ku-dependent and Ku-independent repair of DSB in Arabidopsis thaliana. We have characterised an Arabidopsis xrcc1 mutant and developed quantitative analysis of the kinetics of appearance and loss of γ-H2AX foci as a tool to measure DSB repair in dividing root tip cells of γ-irradiated plants in vivo. This approach has permitted determination of DSB repair kinetics in planta following a short pulse of γ-irradiation, establishing the existence of a Ku-independent, Xrcc1-dependent DSB repair pathway. Furthermore, our data show a role for Ku80 during the first minutes post-irradiation and that Xrcc1 also plays such a role, but only in the absence of Ku. The importance of Xrcc1 is, however, clearly visible at later times in the presence of Ku, showing that alternative end-joining plays an important role in DSB repair even in the presence of active NHEJ. © 2010 The Authors. Journal compilation © 2010 Blackwell Publishing Ltd.

  9. DNA repair in modeled microgravity: Double strand break rejoining activity in human lymphocytes irradiated with γ-rays

    International Nuclear Information System (INIS)

    Mognato, Maddalena; Girardi, Cristina; Fabris, Sonia; Celotti, Lucia

    2009-01-01

    Cell response to ionising radiation depends, besides on genetic and physiological features of the biological systems, on environmental conditions occurring during DNA repair. Many data showed that microgravity, experienced by astronauts during space flights or modeled on Earth, causes apoptosis, cytoskeletal alteration, cell growth inhibition, increased frequency of mutations and chromosome aberrations. In this study, we analysed the progression of the rejoining of double strand breaks (DSBs) in human peripheral blood lymphocytes (PBLs) irradiated with γ-rays and incubated in static condition (1g) or in modeled microgravity (MMG). γ-H2AX foci formation and disappearance, monitored during the repair incubation, showed that the kinetics of DSBs rejoining was different in the two gravity conditions. The fraction of foci-positive cells decreased slower in MMG than in 1g at 6 and 24 h after irradiation (P < 0.01) and the mean number of γ-H2AX foci per nucleus was significantly higher in MMG than in 1g at the same time-points (P < 0.001). In the same samples we determined apoptotic level and the rate of DSB rejoining during post-irradiation incubation. A significant induction of apoptosis was observed in MMG at 24 h after irradiation (P < 0.001), whereas at shorter times the level of apoptosis was slightly higher in MMG respect to 1g. In accordance with the kinetics of γ-H2AX foci, the slower rejoining of radiation-induced DSBs in MMG was observed by DNA fragmentation analyses during the repair incubation; the data of pulsed-field gel electrophoresis assay showed that the fraction of DNA released in the gel was significantly higher in PBL incubated in MMG after irradiation with respect to cells maintained in 1g. Our results provide evidences that MMG incubation during DNA repair delayed the rate of radiation-induced DSB rejoining, and increased, as a consequence, the genotoxic effects of ionising radiation.

  10. DNA repair in modeled microgravity: Double strand break rejoining activity in human lymphocytes irradiated with {gamma}-rays

    Energy Technology Data Exchange (ETDEWEB)

    Mognato, Maddalena, E-mail: maddalena.mognato@unipd.it [Dipartimento di Biologia, Universita di Padova, via U. Bassi 58 B, 35121 Padova (Italy); Girardi, Cristina; Fabris, Sonia [Dipartimento di Biologia, Universita di Padova, via U. Bassi 58 B, 35121 Padova (Italy); Celotti, Lucia [Dipartimento di Biologia, Universita di Padova, via U. Bassi 58 B, 35121 Padova (Italy); Laboratori Nazionali di Legnaro, INFN, Padova (Italy)

    2009-04-26

    Cell response to ionising radiation depends, besides on genetic and physiological features of the biological systems, on environmental conditions occurring during DNA repair. Many data showed that microgravity, experienced by astronauts during space flights or modeled on Earth, causes apoptosis, cytoskeletal alteration, cell growth inhibition, increased frequency of mutations and chromosome aberrations. In this study, we analysed the progression of the rejoining of double strand breaks (DSBs) in human peripheral blood lymphocytes (PBLs) irradiated with {gamma}-rays and incubated in static condition (1g) or in modeled microgravity (MMG). {gamma}-H2AX foci formation and disappearance, monitored during the repair incubation, showed that the kinetics of DSBs rejoining was different in the two gravity conditions. The fraction of foci-positive cells decreased slower in MMG than in 1g at 6 and 24 h after irradiation (P < 0.01) and the mean number of {gamma}-H2AX foci per nucleus was significantly higher in MMG than in 1g at the same time-points (P < 0.001). In the same samples we determined apoptotic level and the rate of DSB rejoining during post-irradiation incubation. A significant induction of apoptosis was observed in MMG at 24 h after irradiation (P < 0.001), whereas at shorter times the level of apoptosis was slightly higher in MMG respect to 1g. In accordance with the kinetics of {gamma}-H2AX foci, the slower rejoining of radiation-induced DSBs in MMG was observed by DNA fragmentation analyses during the repair incubation; the data of pulsed-field gel electrophoresis assay showed that the fraction of DNA released in the gel was significantly higher in PBL incubated in MMG after irradiation with respect to cells maintained in 1g. Our results provide evidences that MMG incubation during DNA repair delayed the rate of radiation-induced DSB rejoining, and increased, as a consequence, the genotoxic effects of ionising radiation.

  11. Effects of 3-Deoxyadenosine (Cordycepin) on the repair of X-ray-induced DNA single- and double-strand breaks in chinese hamster V79 cells

    International Nuclear Information System (INIS)

    Hiraoka, Wakako; Kuwabara, Mikinori; Sato, Fumiaki

    1990-01-01

    The ability of cordycepin to inhibit the repair of DNA strand breaks was examined with X-irradiated Chinese hamster V79 cells in log-phase culture. A filter elution technique revealed that 70 μM cordycepin did not inhibit the repair of single-strand breaks but inhibited the repair of double-strand breaks. These findings confirmed the fact that the increase in the lethality of cordycepin in X-irradiated cultured mammalian cells was attributable to unrepaired DNA double-strand breaks. (author)

  12. Comparison between pulsed-field and constant-field gel electrophoresis for measurement of DNA double-strand breaks in irradiated Chinese hamster ovary cells

    International Nuclear Information System (INIS)

    Wlodek, D.; Banath, J.; Olive, P.L.

    1991-01-01

    Pulsed-field gel electrophoresis (PFGE) is one of the most sensitive methods for detecting DNA double-strand breaks in mammalian cells. However, it has been observed that constant-field gel electrophoresis (CFGE), when optimized, can detect breaks with equal efficiency. The migration of DNA from the well and the separation of DNA molecules according to size appear to be different processes; only the latter requires the application of PFGE. CFGE is very sensitive and can detect DNA damage produced by less than 5Gy of radiation. Low voltage (ca.0.6V/cm) during electrophoresis appears to be essential for the migration of the largest fraction of DNA from the agarose plug containing the cells; the electrophoresis run time, cell density in the plug, agarose concentration, nature of detergent and extent of radiolabelling are less important. It is concluded that CFGE is equally sensitive but more rapid and economical than PFGE for the measurement of DNA damage. (author)

  13. Modulation of the Singlet Oxygen Generation from the Double Strand DNA-SYBR Green I Complex Mediated by T-Melamine-T Mismatch for Visual Detection of Melamine.

    Science.gov (United States)

    Hu, Hao; Zhang, Jinyi; Ding, Yu; Zhang, Xinfeng; Xu, Kailai; Hou, Xiandeng; Wu, Peng

    2017-05-02

    Singlet oxygen ( 1 O 2 ), generated via photosensitization, has been proved to oxidize chromogenic substrates with neither H 2 O 2 oxidation nor enzyme (horseradish peroxidase, HRP) catalysis. Of the various methods for modulation of the 1 O 2 generation, DNA-controlled photosensitization received great attention. Therefore, integration of the formation/deformation DNA structures with DNA-controlled photosensitization will be extremely appealing in visual biosensor developments. Here, the stable melamine-thymine complex was explored in combination with DNA-controlled photosensitization for visual detection of melamine. A T-rich single stand DNA was utilized as the recognition unit. Upon the formation of the T-M-T complex, double stand DNA was formed, which was ready for the binding of SYBR Green I and activated the photosensitization. Subsequent oxidation of TMB allowed visual detection of melamine in dairy products, with spike-recoveries ranging from 94% to 106%.

  14. DNA double-strand breaks induced by cavitational mechanical effects of ultrasound in cancer cell lines.

    Directory of Open Access Journals (Sweden)

    Yukihiro Furusawa

    Full Text Available Ultrasonic technologies pervade the medical field: as a long established imaging modality in clinical diagnostics; and, with the emergence of targeted high intensity focused ultrasound, as a means of thermally ablating tumours. In parallel, the potential of [non-thermal] intermediate intensity ultrasound as a minimally invasive therapy is also being rigorously assessed. Here, induction of apoptosis in cancer cells has been observed, although definitive identification of the underlying mechanism has thus far remained elusive. A likely candidate process has been suggested to involve sonochemical activity, where reactive oxygen species (ROS mediate the generation of DNA single-strand breaks. Here however, we provide compelling new evidence that strongly supports a purely mechanical mechanism. Moreover, by a combination of specific assays (neutral comet tail and staining for γH2AX foci formation we demonstrate for the first time that US exposure at even moderate intensities exhibits genotoxic potential, through its facility to generate DNA damage across multiple cancer lines. Notably, colocalization assays highlight that ionizing radiation and ultrasound have distinctly different signatures to their respective γH2AX foci formation patterns, likely reflecting the different stress distributions that initiated damage formation. Furthermore, parallel immuno-blotting suggests that DNA-PKcs have a preferential role in the repair of ultrasound-induced damage.

  15. Application of laser-accelerated protons to the demonstration of DNA double-strand breaks in human cancer cells

    Science.gov (United States)

    Yogo, A.; Sato, K.; Nishikino, M.; Mori, M.; Teshima, T.; Numasaki, H.; Murakami, M.; Demizu, Y.; Akagi, S.; Nagayama, S.; Ogura, K.; Sagisaka, A.; Orimo, S.; Nishiuchi, M.; Pirozhkov, A. S.; Ikegami, M.; Tampo, M.; Sakaki, H.; Suzuki, M.; Daito, I.; Oishi, Y.; Sugiyama, H.; Kiriyama, H.; Okada, H.; Kanazawa, S.; Kondo, S.; Shimomura, T.; Nakai, Y.; Tanoue, M.; Sasao, H.; Wakai, D.; Bolton, P. R.; Daido, H.

    2009-05-01

    We report the demonstrated irradiation effect of laser-accelerated protons on human cancer cells. In vitro (living) A549 cells are irradiated with quasimonoenergetic proton bunches of 0.8-2.4 MeV with a single bunch duration of 15 ns. Irradiation with the proton dose of 20 Gy results in a distinct formation of γ-H2AX foci as an indicator of DNA double-strand breaks generated in the cancer cells. This is a pioneering result that points to future investigations of the radiobiological effects of laser-driven ion beams. Unique high-current and short-bunch features make laser-driven proton bunches an excitation source for time-resolved determination of radical yields.

  16. Cytotoxicity of 125I decay in the DNA double strand break repair deficient mutant cell line, xrs-5

    International Nuclear Information System (INIS)

    Yasui, L.S.

    1992-01-01

    Survival of parental Chinese hamster ovary (CHO) K1 cells and the DNA double strand break (DSB) repair deficient mutant, xrs-5 was determined after accumulation of 125 I decays. Both CHO and xrs-5 cells were extremely sensitive to accumulated 125 I decays. D o values for CHO and xrs-5 cells were 40 and approximately 7 decays per cell, respectively. Difference in cell survival between CHO and xrs-5 cells was not due to differences in overall 125 IUdR incorporation, differences in labelling index (LI) or differences in plating efficiency (PE). Relative biological effectiveness (RBE) values calculated relative to 137 Cs gamma radiation survival values (D o and D 10 ) were higher in xrs-5 cells compared with CHO cells, although both CHO and xrs-5 cells have high RBE values that correspond to a high sensitivity of CHO and xrs-5 cells to 125 I decay. (Author)

  17. Radiobiological inactivation of Epstein-Barr virus

    International Nuclear Information System (INIS)

    Henderson, E.; Heston, L.; Grogan, E.; Miller, G.

    1978-01-01

    Lymphocyte transforming properties of B95-8 strain Epstein-Barr virus (EBV) are very sensitive to inactivation by either uv or x irradiation. No dose of irradiation increases the transforming capacity of EBV. The x-ray dose needed for inactivation of EBV transformation (dose that results in 37% survival, 60,000 rads) is similar to the dose required for inactivation of plaque formation by herpes simplex virus type 1 (Fischer strain). Although herpes simplex virus is more sensitive than EBV to uv irradiation, this difference is most likely due to differences in the kinetics or mechanisms of repair of uv damage to the two viruses. The results lead to the hypothesis that a large part, or perhaps all, of the EBV genome is in some way needed to initiate transformation. The abilities of EBV to stimulate host cell DNA synthesis, to induce nuclear antigen, and to immortalize are inactivated in parallel. All clones of marmoset cells transformed by irradiated virus produce extracellular transforming virus. These findings suggest that the abilities of the virus to transform and to replicate complete progeny are inactivated together. The amounts of uv and x irradiation that inactivate transformation by B95-8 virus are less than the dose needed to inactivate early antigen induction by the nontransforming P 3 HR-1 strain of EBV. Based on radiobiological inactivation, 10 to 50% of the genome is needed for early antigen induction

  18. Contribution of DNA double-strand break repair gene XRCC3 genotypes to oral cancer susceptibility in Taiwan.

    Science.gov (United States)

    Tsai, Chia-Wen; Chang, Wen-Shin; Liu, Juhn-Cherng; Tsai, Ming-Hsui; Lin, Cheng-Chieh; Bau, Da-Tian

    2014-06-01

    The DNA repair gene X-ray repair cross complementing protein 3 (XRCC3) is thought to play a major role in double-strand break repair and in maintaining genomic stability. Very possibly, defective double-strand break repair of cells can lead to carcinogenesis. Therefore, a case-control study was performed to reveal the contribution of XRCC3 genotypes to individual oral cancer susceptibility. In this hospital-based research, the association of XRCC3 rs1799794, rs45603942, rs861530, rs3212057, rs1799796, rs861539, rs28903081 genotypes with oral cancer risk in a Taiwanese population was investigated. In total, 788 patients with oral cancer and 956 age- and gender-matched healthy controls were genotyped. The results showed that there was significant differential distribution among oral cancer and controls in the genotypic (p=0.001428) and allelic (p=0.0013) frequencies of XRCC3 rs861539. As for the other polymorphisms, there was no difference between case and control groups. In gene-lifestyle interaction analysis, we have provided the first evidence showing that there is an obvious joint effect of XRCC3 rs861539 genotype with individual areca chewing habits on oral cancer risk. In conclusion, the T allele of XRCC3 rs861539, which has an interaction with areca chewing habit in oral carcinogenesis, may be an early marker for oral cancer in Taiwanese. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  19. Immediate and repair induced DNA double strand breaks in mammalian cells

    International Nuclear Information System (INIS)

    Bryant, P.E.

    1986-01-01

    It seems logical to postulate that double strand breaks (dsb) arising both at the time of irradiation and via repair processes are potentially equally damaging for a cell in terms of the potential to induce chromosomal aberrations. However, in some cell systems the repair of double es or es-ssb sites may run concurrently with the incision so that these lesions do not remain open for long: hence the lack of accumulation of dsb during repair. The rate of incision will thus determine both the accumulation and the probability of exchanges leading to chromosomal aberrations between these and other frank dsb. Rapid incision leading to a large additional pool of dsb appears to be the case in Chinese hamster V79 cells. Some evidence also exists for the conversion of base damage, via dsb, into deletion type chromatid aberrations which accumulate in irradiated G2 human cells treated with ara C. A small fraction of dsb, probably arising both at the time of irradiation as well as enzymatically during repair of base or sugar damage, appears to be either left unrepaired, yielding deletion type chromosomal aberrations, or is misrepaired, yielding exchange aberrations. The induction of these aberrations appears to be of central importance in the biological effects of ionizing radiation such as mutations, oncogenic transformation, and cell death. 52 refs., 5 figs

  20. Investigation of Double-Band Electrophoretic Pattern of ITS-rDNA Region in Iranian Isolates of Leishmania Tropica

    Directory of Open Access Journals (Sweden)

    MA Ghatee

    2013-06-01

    Full Text Available Background: Leishmania tropica is a genetically divergent species. Amplification of entire internal tran­scribed spacer (ITS region of L. tropica isolates obtained from Bam district, one of the well known focus of anthroponotic cutaneous leishmaniasis ACL( in Iran, revealed a double-band pat­tern in agarose gel electrophoresis. This study explains how this pattern occurs.Methods: Twenty seven L. tropica smear preparations were collected from Bam district, south east Iran, and eight L. major and one L. infantum smear preparations were gathered from Shiraz, south west Iran. Furthermore one L. major and one L. infantum cultured standard strains were tested using entire ITS-PCR to survey their electrophoretic pattern. The ITS sequences of L. tropica, L. major, and L. infantum already deposited in GenBank were analyzed. Analysis of GenBank sequences of L. tropica revealed two groups of sequences based on length size, one group having a 100 bp gap. Therefore, a new re­verse primer namely LITS-MG was designed to exclude this gap in PCR products.Results: Whole ITS fragment amplification resulted in a double-band pattern in all L. tropica cases, while a sharp single band was observed for L. infantum and L. major isolates. This result was correspond­ing to the result obtained from in silico analysis of GenBank sequences. Use of LITS-MG primer was expectedly resulted in a single band including ITS1, 5.8s and partial ITS2 product for L. tropica which is appropriate for following molecular studies such as sequencing or restriction analysis.Conclusion: Sequences analysis of GenBank L. tropica sequences and following practical laboratory tests revealed at least two alleles in L. tropica which were confirmed in Bam isolates. This especial double-band pattern is because of a 100 bp fragment difference within ITS-rDNA alleles

  1. The involvement of human RECQL4 in DNA double-strand break repair

    DEFF Research Database (Denmark)

    Singh, Dharmendra Kumar; Karmakar, Parimal; Aamann, Maria Diget

    2010-01-01

    Rothmund-Thomson syndrome (RTS) is an autosomal recessive hereditary disorder associated with mutation in RECQL4 gene, a member of the human RecQ helicases. The disease is characterized by genomic instability, skeletal abnormalities and predisposition to malignant tumors, especially osteosarcomas......-induced DSBs and remains for a shorter duration than WRN and BLM, indicating its distinct role in repair of DSBs. Endogenous RECQL4 also colocalizes with gammaH2AX at the site of DSBs. The RECQL4 domain responsible for its DNA damage localization has been mapped to the unique N-terminus domain between amino...

  2. Genes Involved in DNA Double-Strand Break Repair: Implications for Breast Cancer.

    Science.gov (United States)

    1996-10-01

    dependent kinase (p350) as a cietv of America Scholar. W.K.R. is a Howard Hughes Medical Insti- candidate gene for the murine SCID defect. Science 267:1178...Howard Hughes Medical Institute (W. K. R.). 26), are rescued by transfection of Ku86 cDNA (27, 28), and have 2 To whom requests for reprints should be... Jackman . J.. Wang. M. G., McBride. 0. W., and Fornace, 40. Papathanasiou. M. A.. Kerr, N. C. K., Robbins, J. H., McBride. 0. W., Alamo, I., A. J

  3. Estimation of strength in different extra Watson-Crick hydrogen bonds in DNA double helices through quantum chemical studies.

    Science.gov (United States)

    Bandyopadhyay, D; Bhattacharyya, D

    2006-10-15

    It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.

  4. Caffeine inhibits homology-directed repair of I-SceI-induced DNA double-strand breaks.

    Science.gov (United States)

    Wang, Huichen; Boecker, Wilfried; Wang, Hongyan; Wang, Xiang; Guan, Jun; Thompson, Larry H; Nickoloff, Jac A; Iliakis, George

    2004-01-22

    We recently reported that two Chinese hamster mutants deficient in the RAD51 paralogs XRCC2 and XRCC3 show reduced radiosensitization after treatment with caffeine, thus implicating homology-directed repair (HDR) of DNA double-strand breaks (DSBs) in the mechanism of caffeine radiosensitization. Here, we investigate directly the effect of caffeine on HDR initiated by DSBs induced by a rare cutting endonuclease (I-SceI) into one of two direct DNA repeats. The results demonstrate a strong inhibition by caffeine of HDR in wild-type cells, and a substantial reduction of this effect in HDR-deficient XRCC3 mutant cells. Inhibition of HDR and cell radiosensitization to killing shows similar dependence on caffeine concentration suggesting a cause-effect relationship between these effects. UCN-01, a kinase inhibitor that effectively abrogates checkpoint activation in irradiated cells, has only a small effect on HDR, indicating that similar to radiosensitization, inhibition of checkpoint signaling is not sufficient for HDR inhibition. Recombination events occurring during treatment with caffeine are characterized by rearrangements reminiscent to those previously reported for the XRCC3 mutant, and immunofluorescence microscopy demonstrates significantly reduced formation of IR-specific RAD51 foci after caffeine treatment. In summary, our results identify inhibition of HDR as a significant contributor to caffeine radiosensitization.

  5. Small Rad51 and Dmc1 Complexes Often Co-occupy Both Ends of a Meiotic DNA Double Strand Break.

    Directory of Open Access Journals (Sweden)

    M Scott Brown

    2015-12-01

    Full Text Available The Eukaryotic RecA-like proteins Rad51 and Dmc1 cooperate during meiosis to promote recombination between homologous chromosomes by repairing programmed DNA double strand breaks (DSBs. Previous studies showed that Rad51 and Dmc1 form partially overlapping co-foci. Here we show these Rad51-Dmc1 co-foci are often arranged in pairs separated by distances of up to 400 nm. Paired co-foci remain prevalent when DSBs are dramatically reduced or when strand exchange or synapsis is blocked. Super-resolution dSTORM microscopy reveals that individual foci observed by conventional light microscopy are often composed of two or more substructures. The data support a model in which the two tracts of ssDNA formed by a single DSB separate from one another by distances of up to 400 nm, with both tracts often bound by one or more short (about 100 nt Rad51 filaments and also by one or more short Dmc1 filaments.

  6. p53 binding protein 1 foci as a biomarker of DNA double strand breaks induced by ionizing radiation

    International Nuclear Information System (INIS)

    Ng, C.K.M.; Wong, M.Y.P.; Lam, R.K.K.; Ho, J.P.Y.; Chiu, S.K.; Yu, K.N.

    2011-01-01

    Foci of p53 binding protein 1 (53 BP1) have been used as a biomarker of DNA double-strand breaks (DSBs) in cells induced by ionizing radiations. 53 BP1 was shown to relocalize into foci shortly after irradiation, with the number of foci closely paralleling the number of DNA DSBs. However, consensus on criteria in terms of the numbers of 53 BP1 foci to define cells damaged by direct irradiation or by bystander signals has not been reached, which is partly due to the presence of 53 BP1 also in normal cells. The objective of the present work was to study the changes in the distribution of cells with different numbers of 53 BP1 foci in a cell population after low-dose ionizing irradiation (<0.1 Gy) provided by alpha particles, with a view to propose feasible criteria for defining cells damaged by direct irradiation or by bystander signals. It was proposed that the change in the percentage of cells with 1-3 foci should be used for such purposes. The underlying reasons were discussed.

  7. A novel automatic quantification method for high-content screening analysis of DNA double strand-break response.

    Science.gov (United States)

    Feng, Jingwen; Lin, Jie; Zhang, Pengquan; Yang, Songnan; Sa, Yu; Feng, Yuanming

    2017-08-29

    High-content screening is commonly used in studies of the DNA damage response. The double-strand break (DSB) is one of the most harmful types of DNA damage lesions. The conventional method used to quantify DSBs is γH2AX foci counting, which requires manual adjustment and preset parameters and is usually regarded as imprecise, time-consuming, poorly reproducible, and inaccurate. Therefore, a robust automatic alternative method is highly desired. In this manuscript, we present a new method for quantifying DSBs which involves automatic image cropping, automatic foci-segmentation and fluorescent intensity measurement. Furthermore, an additional function was added for standardizing the measurement of DSB response inhibition based on co-localization analysis. We tested the method with a well-known inhibitor of DSB response. The new method requires only one preset parameter, which effectively minimizes operator-dependent variations. Compared with conventional methods, the new method detected a higher percentage difference of foci formation between different cells, which can improve measurement accuracy. The effects of the inhibitor on DSB response were successfully quantified with the new method (p = 0.000). The advantages of this method in terms of reliability, automation and simplicity show its potential in quantitative fluorescence imaging studies and high-content screening for compounds and factors involved in DSB response.

  8. Age-dependent decline in rejoining of X-ray-induced DNA double-strand breaks in normal human lymphocytes

    International Nuclear Information System (INIS)

    Mayer, P.J.; Lange, C.S.; Bradley, M.O.; Nichols, W.W.

    1989-01-01

    Unstimulated human peripheral bloodlymphocytes (HPBL), separated by density centrifugation from anticoagulated whole blood, were X-irradiated on ice and incubated in medium at 37 0 C for repair times of 15, 30 and 120 min. Blood donors were 18 normotensive, non-smoking Caucasians aged 23-78, free from overt pathology and not taking any medications. Neutral filter elution was used to assay DNA double-strand break (DSB) induction and completeness of DSB rejoining. After 30 or 120 min repair incubation, the percentage of DSBs rejoined by cells from oder donors was less than half the percentage of DSBs rejoined by cells from younger donors. When data from the 3 age groups were pooled, the age-related decline in percent DSBs rejoined was significant for repair times 30 min and 120 min but not for 15 min. These age-related declines were observed even though DNA from older donors sustained fewer strand breaks as demonstrated by the negative correlation between donor age and DSB induction. These results suggest that the efficacy of X-ray-induced DSB repair diminishes with in vivo age in unstimulated HPBL. (author). 38 refs.; 2 figs.; 1 tab

  9. Cyclen-based double-tailed lipids for DNA delivery: Synthesis and the effect of linking group structures.

    Science.gov (United States)

    Zhang, Yi-Mei; Chang, De-Chun; Zhang, Ji; Liu, Yan-Hong; Yu, Xiao-Qi

    2015-09-01

    The gene transfection efficiency (TE) of cationic lipids is largely influenced by the lipid structure. Six novel 1, 4, 7, 10-tetraazacyclododecane (cyclen)-based cationic lipids L1-L6, which contain double oleyl as hydrophobic tails, were designed and synthesized. The difference between these lipids is their diverse backbone. Liposomes prepared by the lipids and DOPE showed good DNA affinity, and full DNA condensation could be achieved at N/P of 4 to form lipoplexes with proper size and zeta-potentials for gene transfection. Structure-activity relationship of these lipids as non-viral gene delivery vectors was investigated. It was found that minor backbone structural variations, including linking group and the structural symmetry would affect the TE. The diethylenetriamine derived lipid L4 containing amide linking bonds gave the best TE, which was several times higher than commercially available transfection reagent lipofectamine 2000. Besides, these lipids exhibited low cytotoxicity, suggesting their good biocompatibility. Results reveal that such type of cationic lipids might be promising non-viral gene vectors, and also afford us clues for the design of novel vectors with higher TE and biocompatibility. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Improving DNA double-strand repair inhibitor KU55933 therapeutic index in cancer radiotherapy using nanoparticle drug delivery

    Science.gov (United States)

    Tian, Xi; Lara, Haydee; Wagner, Kyle T.; Saripalli, Srinivas; Hyder, Syed Nabeel; Foote, Michael; Sethi, Manish; Wang, Edina; Caster, Joseph M.; Zhang, Longzhen; Wang, Andrew Z.

    2015-11-01

    Radiotherapy is a key component of cancer treatment. Because of its importance, there has been high interest in developing agents and strategies to further improve the therapeutic index of radiotherapy. DNA double-strand repair inhibitors (DSBRIs) are among the most promising agents to improve radiotherapy. However, their clinical translation has been limited by their potential toxicity to normal tissue. Recent advances in nanomedicine offer an opportunity to overcome this limitation. In this study, we aim to demonstrate the proof of principle by developing and evaluating nanoparticle (NP) formulations of KU55933, a DSBRI. We engineered a NP formulation of KU55933 using nanoprecipitation method with different lipid polymer nanoparticle formulation. NP KU55933 using PLGA formulation has the best loading efficacy as well as prolonged drug release profile. We demonstrated that NP KU55933 is a potent radiosensitizer in vitro using clonogenic assay and is more effective as a radiosensitizer than free KU55933 in vivo using mouse xenograft models of non-small cell lung cancer (NSCLC). Western blots and immunofluorescence showed NP KU55933 exhibited more prolonged inhibition of DNA repair pathway. In addition, NP KU55933 leads to lower skin toxicity than KU55933. Our study supports further investigations using NP to deliver DSBRIs to improve cancer radiotherapy treatment.

  11. The N-terminus of RPA large subunit and its spatial position are important for the 5'->3' resection of DNA double-strand breaks.

    Science.gov (United States)

    Tammaro, Margaret; Liao, Shuren; McCane, Jill; Yan, Hong

    2015-10-15

    The first step of homology-dependent repair of DNA double-strand breaks (DSBs) is the resection of the 5' strand to generate 3' ss-DNA. Of the two major nucleases responsible for resection, EXO1 has intrinsic 5'->3' directionality, but DNA2 does not. DNA2 acts with RecQ helicases such as the Werner syndrome protein (WRN) and the heterotrimeric eukaryotic ss-DNA binding protein RPA. We have found that the N-terminus of the RPA large subunit (RPA1N) interacts with both WRN and DNA2 and is essential for stimulating WRN's 3'->5' helicase activity and DNA2's 5'->3' ss-DNA exonuclease activity. A mutant RPA complex that lacks RPA1N is unable to support resection in Xenopus egg extracts and human cells. Furthermore, relocating RPA1N to the middle subunit but not to the small subunit causes severe defects in stimulating DNA2 and WRN and in supporting resection. Together, these findings suggest that RPA1N and its spatial position are critical for restricting the directionality of the WRN-DNA2 resection pathway. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. The N-terminus of RPA large subunit and its spatial position are important for the 5′->3′ resection of DNA double-strand breaks

    Science.gov (United States)

    Tammaro, Margaret; Liao, Shuren; McCane, Jill; Yan, Hong

    2015-01-01

    The first step of homology-dependent repair of DNA double-strand breaks (DSBs) is the resection of the 5′ strand to generate 3′ ss-DNA. Of the two major nucleases responsible for resection, EXO1 has intrinsic 5′->3′ directionality, but DNA2 does not. DNA2 acts with RecQ helicases such as the Werner syndrome protein (WRN) and the heterotrimeric eukaryotic ss-DNA binding protein RPA. We have found that the N-terminus of the RPA large subunit (RPA1N) interacts with both WRN and DNA2 and is essential for stimulating WRN's 3′->5′ helicase activity and DNA2's 5′->3′ ss-DNA exonuclease activity. A mutant RPA complex that lacks RPA1N is unable to support resection in Xenopus egg extracts and human cells. Furthermore, relocating RPA1N to the middle subunit but not to the small subunit causes severe defects in stimulating DNA2 and WRN and in supporting resection. Together, these findings suggest that RPA1N and its spatial position are critical for restricting the directionality of the WRN-DNA2 resection pathway. PMID:26227969

  13. Condensin suppresses recombination and regulates double-strand break processing at the repetitive ribosomal DNA array to ensure proper chromosome segregation during meiosis in budding yeast

    Science.gov (United States)

    Li, Ping; Jin, Hui; Yu, Hong-Guo

    2014-01-01

    During meiosis, homologues are linked by crossover, which is required for bipolar chromosome orientation before chromosome segregation at anaphase I. The repetitive ribosomal DNA (rDNA) array, however, undergoes little or no meiotic recombination. Hyperrecombination can cause chromosome missegregation and rDNA copy number instability. We report here that condensin, a conserved protein complex required for chromosome organization, regulates double-strand break (DSB) formation and repair at the rDNA gene cluster during meiosis in budding yeast. Condensin is highly enriched at the rDNA region during prophase I, released at the prophase I/metaphase I transition, and reassociates with rDNA before anaphase I onset. We show that condensin plays a dual role in maintaining rDNA stability: it suppresses the formation of Spo11-mediated rDNA breaks, and it promotes DSB processing to ensure proper chromosome segregation. Condensin is unnecessary for the export of rDNA breaks outside the nucleolus but required for timely repair of meiotic DSBs. Our work reveals that condensin coordinates meiotic recombination with chromosome segregation at the repetitive rDNA sequence, thereby maintaining genome integrity. PMID:25103240

  14. Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

    Science.gov (United States)

    Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

    2018-06-01

    It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

  15. The cumulative burden of double-stranded DNA virus detection after allogeneic HCT is associated with increased mortality.

    Science.gov (United States)

    Hill, Joshua A; Mayer, Bryan T; Xie, Hu; Leisenring, Wendy M; Huang, Meei-Li; Stevens-Ayers, Terry; Milano, Filippo; Delaney, Colleen; Sorror, Mohamed L; Sandmaier, Brenda M; Nichols, Garrett; Zerr, Danielle M; Jerome, Keith R; Schiffer, Joshua T; Boeckh, Michael

    2017-04-20

    Strategies to prevent active infection with certain double-stranded DNA (dsDNA) viruses after allogeneic hematopoietic cell transplantation (HCT) are limited by incomplete understanding of their epidemiology and clinical impact. We retrospectively tested weekly plasma samples from allogeneic HCT recipients at our center from 2007 to 2014. We used quantitative PCR to test for cytomegalovirus, BK polyomavirus, human herpesvirus 6B, HHV-6A, adenovirus, and Epstein-Barr virus between days 0 and 100 post-HCT. We evaluated risk factors for detection of multiple viruses and association of viruses with mortality through day 365 post-HCT with Cox models. Among 404 allogeneic HCT recipients, including 125 cord blood, 125 HLA-mismatched, and 154 HLA-matched HCTs, detection of multiple viruses was common through day 100: 90% had ≥1, 62% had ≥2, 28% had ≥3, and 5% had 4 or 5 viruses. Risk factors for detection of multiple viruses included cord blood or HLA-mismatched HCT, myeloablative conditioning, and acute graft-versus-host disease ( P values < .01). Absolute lymphocyte count of <200 cells/mm 3 was associated with greater virus exposure on the basis of the maximum cumulative viral load area under the curve (AUC) ( P = .054). The maximum cumulative viral load AUC was the best predictor of early (days 0-100) and late (days 101-365) overall mortality (adjusted hazard ratio [aHR] = 1.36, 95% confidence interval [CI] [1.25, 1.49], and aHR = 1.04, 95% CI [1.0, 1.08], respectively) after accounting for immune reconstitution and graft-versus-host disease. In conclusion, detection of multiple dsDNA viruses was frequent after allogeneic HCT and had a dose-dependent association with increased mortality. These data suggest opportunities to improve outcomes with better antiviral strategies. © 2017 by The American Society of Hematology.

  16. MeHg Developing Exposure Causes DNA Double-Strand Breaks and Elicits Cell Cycle Arrest in Spinal Cord Cells

    Directory of Open Access Journals (Sweden)

    Fabiana F. Ferreira

    2015-01-01

    Full Text Available The neurotoxicity caused by methylmercury (MeHg is well documented; however, the developmental neurotoxicity in spinal cord is still not fully understood. Here we investigated whether MeHg affects the spinal cord layers development. Chicken embryos at E3 were treated in ovo with 0.1 μg MeHg/50 μL saline solution and analyzed at E10. Thus, we performed immunostaining using anti-γ-H2A.X to recognize DNA double-strand breaks and antiphosphohistone H3, anti-p21, and anti-cyclin E to identify cells in proliferation and cell cycle proteins. Also, to identify neuronal cells, we used anti-NeuN and anti-βIII-tubulin antibodies. After the MeHg treatment, we observed the increase on γ-H2A.X in response to DNA damage. MeHg caused a decrease in the proliferating cells and in the thickness of spinal cord layers. Moreover, we verified that MeHg induced an increase in the number of p21-positive cells but did not change the cyclin E-positive cells. A significantly high number of TUNEL-positive cells indicating DNA fragmentation were observed in MeHg-treated embryos. Regarding the neuronal differentiation, MeHg induced a decrease in NeuN expression and did not change the expression of βIII-tubulin. These results showed that in ovo MeHg exposure alters spinal cord development by disturbing the cell proliferation and death, also interfering in early neuronal differentiation.

  17. Impact of charged particle exposure on homologous DNA double-strand break repair in human blood-derived cells

    Directory of Open Access Journals (Sweden)

    Melanie eRall

    2015-11-01

    Full Text Available Ionizing radiation generates DNA double-strand breaks (DSB which, unless faithfully repaired, can generate chromosomal rearrangements in hematopoietic stem and/or progenitor cells (HSPC, potentially priming the cells towards a leukemic phenotype. Using an enhanced green fluorescent protein (EGFP-based reporter system, we recently identified differences in the removal of enzyme-mediated DSB in human HSPC versus mature peripheral blood lymphocytes (PBL, particularly regarding homologous DSB repair (HR. Assessment of chromosomal breaks via premature chromosome condensation or γH2AX foci indicated similar efficiency and kinetics of radiation-induced DSB formation and rejoining in PBL and HSPC. Prolonged persistence of chromosomal breaks was observed for higher LET charged particles which are known to induce more complex DNA damage compared to X rays. Consistent with HR deficiency in HSPC observed in our previous study, we noticed here pronounced focal accumulation of 53BP1 after X-ray and carbon ion exposure (intermediate LET in HSPC versus PBL. For higher LET, 53BP1 foci kinetics were similarly delayed in PBL and HSPC suggesting similar failure to repair complex DNA damage. Data obtained with plasmid reporter systems revealed a dose- and LET-dependent HR increase after X-ray, carbon ion and higher LET exposure, particularly in HR-proficient immortalized and primary lymphocytes, confirming preferential use of conservative HR in PBL for intermediate LET damage repair. HR measured adjacent to the leukemia-associated MLL breakpoint cluster sequence in reporter lines revealed dose-dependency of potentially leukemogenic rearrangements underscoring the risk of leukemia-induction by radiation treatment.

  18. DNA double-strand breaks in human induced pluripotent stem cell reprogramming and long-term in vitro culturing.

    Science.gov (United States)

    Simara, Pavel; Tesarova, Lenka; Rehakova, Daniela; Matula, Pavel; Stejskal, Stanislav; Hampl, Ales; Koutna, Irena

    2017-03-21

    Human induced pluripotent stem cells (hiPSCs) play roles in both disease modelling and regenerative medicine. It is critical that the genomic integrity of the cells remains intact and that the DNA repair systems are fully functional. In this article, we focused on the detection of DNA double-strand breaks (DSBs) by phosphorylated histone H2AX (known as γH2AX) and p53-binding protein 1 (53BP1) in three distinct lines of hiPSCs, their source cells, and one line of human embryonic stem cells (hESCs). We measured spontaneously occurring DSBs throughout the process of fibroblast reprogramming and during long-term in vitro culturing. To assess the variations in the functionality of the DNA repair system among the samples, the number of DSBs induced by γ-irradiation and the decrease over time was analysed. The foci number was detected by fluorescence microscopy separately for the G1 and S/G2 cell cycle phases. We demonstrated that fibroblasts contained a low number of non-replication-related DSBs, while this number increased after reprogramming into hiPSCs and then decreased again after long-term in vitro passaging. The artificial induction of DSBs revealed that the repair mechanisms function well in the source cells and hiPSCs at low passages, but fail to recognize a substantial proportion of DSBs at high passages. Our observations suggest that cellular reprogramming increases the DSB number but that the repair mechanism functions well. However, after prolonged in vitro culturing of hiPSCs, the repair capacity decreases.

  19. Recognition, signaling, and repair of DNA double-strand breaks produced by ionizing radiation in mammalian cells: the molecular choreography.

    Science.gov (United States)

    Thompson, Larry H

    2012-01-01

    The faithful maintenance of chromosome continuity in human cells during DNA replication and repair is critical for preventing the conversion of normal diploid cells to an oncogenic state. The evolution of higher eukaryotic cells endowed them with a large genetic investment in the molecular machinery that ensures chromosome stability. In mammalian and other vertebrate cells, the elimination of double-strand breaks with minimal nucleotide sequence change involves the spatiotemporal orchestration of a seemingly endless number of proteins ranging in their action from the nucleotide level to nucleosome organization and chromosome architecture. DNA DSBs trigger a myriad of post-translational modifications that alter catalytic activities and the specificity of protein interactions: phosphorylation, acetylation, methylation, ubiquitylation, and SUMOylation, followed by the reversal of these changes as repair is completed. "Superfluous" protein recruitment to damage sites, functional redundancy, and alternative pathways ensure that DSB repair is extremely efficient, both quantitatively and qualitatively. This review strives to integrate the information about the molecular mechanisms of DSB repair that has emerged over the last two decades with a focus on DSBs produced by the prototype agent ionizing radiation (IR). The exponential growth of molecular studies, heavily driven by RNA knockdown technology, now reveals an outline of how many key protein players in genome stability and cancer biology perform their interwoven tasks, e.g. ATM, ATR, DNA-PK, Chk1, Chk2, PARP1/2/3, 53BP1, BRCA1, BRCA2, BLM, RAD51, and the MRE11-RAD50-NBS1 complex. Thus, the nature of the intricate coordination of repair processes with cell cycle progression is becoming apparent. This review also links molecular abnormalities to cellular pathology as much a possible and provides a framework of temporal relationships. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Genetic polymorphisms in DNA double-strand break repair genes XRCC5, XRCC6 and susceptibility to hepatocellular carcinoma.

    Science.gov (United States)

    Li, Rui; Yang, Yuan; An, Yu; Zhou, Yun; Liu, Yanhong; Yu, Qing; Lu, Daru; Wang, Hongyang; Jin, Li; Zhou, Weiping; Qian, Ji; Shugart, Yin Yao

    2011-04-01

    Environmental risk factors cause DNA damages. Imprecise DNA repair leads to chromosome aberrations, genome destabilization and hepatocarcinogenesis. Ku is a key DNA double-strand break repair protein. We hypothesized that the genetic variants in Ku subunits encoding genes, XRCC5/XRCC6, may contribute to hepatocellular carcinoma (HCC) susceptibility. We genotyped 13 common single nucleotide polymorphisms (SNPs) in XRCC5 and XRCC6 and evaluated their associations with HCC risk in 689 pathologically confirmed cases and 690 cancer-free controls from a Chinese population. We found that a significantly reduced risk for HCC was associated with XRCC5 rs16855458 [odds ratio (OR)=0.59; 95% confidence interval (CI)=0.43-0.81; CA+AA versus CC] and a significantly increased risk for HCC was associated with XRCC5 rs9288516 (OR=2.02; 95% CI=1.42-2.86; TA+AA versus TT) even after Bonferroni correction (Pcorrected=0.026 and 0.002, respectively). The effects of rs16855458 (OR=0.57; 95% CI=0.37-0.86, P=0.008) and rs9288516 (OR=1.86; 95% CI=1.19-2.90, P=0.007) were more significant in hepatitis B surface antigen-infected subjects than non-infected subjects. The haplotype-based analysis revealed that in XRCC5, AA in block 1 (OR=0.63; 95% CI=0.48-0.83) and CGGTT in block 2 (OR=0.52; 95% CI=0.39-0.69) were associated with decreased HCC risk (Pcorrected=0.013 and analysis. In conclusion, XRCC5 variants may play a role in determining individual's HCC susceptibility, which warranted validation in larger studies.

  1. NF-κB regulates DNA double-strand break repair in conjunction with BRCA1-CtIP complexes.

    Science.gov (United States)

    Volcic, Meta; Karl, Sabine; Baumann, Bernd; Salles, Daniela; Daniel, Peter; Fulda, Simone; Wiesmüller, Lisa

    2012-01-01

    NF-κB is involved in immune responses, inflammation, oncogenesis, cell proliferation and apoptosis. Even though NF-κB can be activated by DNA damage via Ataxia telangiectasia-mutated (ATM) signalling, little was known about an involvement in DNA repair. In this work, we dissected distinct DNA double-strand break (DSB) repair mechanisms revealing a stimulatory role of NF-κB in homologous recombination (HR). This effect was independent of chromatin context, cell cycle distribution or cross-talk with p53. It was not mediated by the transcriptional NF-κB targets Bcl2, BAX or Ku70, known for their dual roles in apoptosis and DSB repair. A contribution by Bcl-xL was abrogated when caspases were inhibited. Notably, HR induction by NF-κB required the targets ATM and BRCA2. Additionally, we provide evidence that NF-κB interacts with CtIP-BRCA1 complexes and promotes BRCA1 stabilization, and thereby contributes to HR induction. Immunofluorescence analysis revealed accelerated formation of replication protein A (RPA) and Rad51 foci upon NF-κB activation indicating HR stimulation through DSB resection by the interacting CtIP-BRCA1 complex and Rad51 filament formation. Taken together, these results define multiple NF-κB-dependent mechanisms regulating HR induction, and thereby providing a novel intriguing explanation for both NF-κB-mediated resistance to chemo- and radiotherapies as well as for the sensitization by pharmaceutical intervention of NF-κB activation.

  2. A mathematical model for the detection mechanism of DNA double-strand breaks depending on autophosphorylation of ATM.

    Science.gov (United States)

    Mouri, Kazunari; Nacher, Jose C; Akutsu, Tatsuya

    2009-01-01

    After IR stress, DNA double-strand breaks (DSBs) occur and repair proteins (RPs) bind to them, generating DSB-RP complexes (DSBCs), which results in repaired DSBs (RDSBs). In recent experimental studies, it is suggested that the ATM proteins detect these DNA lesions depending on the autophosphorylation of ATM which exists as a dimer before phosphorylation. Interestingly, the ATM proteins can work as a sensor for a small number of DSBs (approximately 18 DSBs in a cell after exposure to IR). Thus the ATM proteins amplify the small input signals based on the phosphorylation of the ATM dimer proteins. The true DSB-detection mechanism depending on ATM autophosphorylation has yet to be clarified. We propose a mathematical model for the detection mechanism of DSBs by ATM. Our model includes both a DSB-repair mechanism and an ATM-phosphorylation mechanism. We model the former mechanism as a stochastic process, and obtain theoretical mean values of DSBs and DSBCs. In the latter mechanism, it is known that ATM autophosphorylates itself, and we find that the autophosphorylation induces bifurcation of the phosphorylated ATM (ATM*). The bifurcation diagram depends on the total concentration of ATM, which makes three types of steady state diagrams of ATM*: monostable, reversible bistable, and irreversible bistable. Bistability exists depending on the Hill coefficient in the equation of ATM autophosphorylation, and it emerges as the total concentration of ATM increases. Combining these two mechanisms, we find that ATM* exhibits switch-like behaviour in the presence of bistability, and the detection time after DNA damage decreases when the total concentration of ATM increases. This work provides a mathematical model that explains the DSB-detection mechanism depending on ATM autophosphorylation. These results indicate that positive auto-regulation works both as a sensor and amplifier of small input signals.

  3. Mobile phone radiofrequency exposure has no effect on DNA double strand breaks (DSB) in human lymphocytes.

    Science.gov (United States)

    Danese, Elisa; Lippi, Giuseppe; Buonocore, Ruggero; Benati, Marco; Bovo, Chiara; Bonaguri, Chiara; Salvagno, Gian Luca; Brocco, Giorgio; Roggenbuck, Dirk; Montagnana, Martina

    2017-07-01

    The use of mobile phones has been associated with an increased risk of developing certain type of cancer, especially in long term users. Therefore, this study was aimed to investigate the potential genotoxic effect of mobile phone radiofrequency exposure on human peripheral blood mononuclear cells in vitro. The study population consisted in 14 healthy volunteers. After collection of two whole blood samples, the former was placed in a plastic rack, 1 cm from the chassis of a commercial mobile phone (900 MHz carrier frequency), which was activated by a 30-min call. The second blood sample was instead maintained far from mobile phones or other RF sources. The influence of mobile phone RF on DNA integrity was assessed by analyzing γ-H2AX foci in lymphocytes using immunofluorescence staining kit on AKLIDES. No measure of γ-H2AX foci was significantly influenced by mobile phone RF exposure, nor mobile phone exposure was associated with significant risk of genetic damages in vitro (odds ratio comprised between 0.27 and 1.00). The results of this experimental study demonstrate that exposure of human lymphocytes to a conventional 900 MHz RF emitted by a commercial mobile phone for 30 min does not significantly impact DNA integrity.

  4. DNA double-strand break repair: a tale of pathway choices

    Institute of Scientific and Technical Information of China (English)

    Jing Li; Xingzhi Xu

    2016-01-01

    Deoxyribonucleic acid double-strand breaks (DSBs) are cytotoxic lesions that must be repaired either through homologous recombination (HR) or non-homologous end-joining (NHEJ) pathways.DSB repair is critical for genome integrity,cellular homeostasis and also constitutes the biological foundation for radiotherapy and the majority of chemotherapy.The choice between HR and NHEJ is a complex yet not completely understood process that will entail more future efforts.Herein we review our current understandings about how the choice is made over an antagonizing balance between p53-binding protein 1 and breast cancer 1 in the context of cell cycle stages,downstream effects,and distinct chromosomal histone marks.These exciting areas of research will surely bring more mechanistic insights about DSB repair and be utilized in the clinical settings.

  5. Anti-double strand (ds) DNA antibody formation by NZB/W (F1) spleen cells in a microculture system detected by solid phase radioimmunoassay.

    Science.gov (United States)

    Okudaira, H; Terada, E; Ogita, T; Aotsuka, S; Yokohari, R

    1981-01-01

    A solid-phase radioimmunoassay method was devised to detect mouse anti-double strand (ds) DNA antibody. This method could easily detect the anti-dsDNA antibody in 1 : 10,000 dilutions (1 unit) of pooled 9-10-month-old female NZB/W F1 sera. The sensitivity was about 10(3)- and 10(2)-fold higher than that of the modified Farr method and of the double antibody technique respectively. NZB/W mice developed high titer anti-dsDNA antibody as they grew older. Spleen cells brought to a microculture system using flat-bottomed polystyrene plates produced anti-dsDNA antibody clearly detectable by solid-phase radioimmunoassay. Anti-dsDNA antibody produced in vitro (y units) was in close correlation with the anti-dsDNA antibody titer of the spleen donor (x units) (y = 4.8 X 10(-2) x -65, gamma = 0.94, P less than 0.001). A combination of the microculture system and solid-phase radioimmunoassay was recommended for the characterization of anti-dsDNA antibody-forming cells.

  6. Anti-double strand (ds) DNA antibody formation by NZB/W (F1) spleen cells in a microculture system detected by solid-phase radioimmunoassay

    International Nuclear Information System (INIS)

    Okudaira, H.; Terada, E.; Ogita, T.; Aotsuka, S.; Yokohari, R.

    1981-01-01

    A solid-phase radioimmunoassay method was devised to detect mouse anti-double strand (ds) DNA antibody. This method could easily detect the anti-ds DNA antibody in 1 : 10,000 dilutions (1 unit) of pooled 9-10 month-old female NZB/W F1 sera. The sensitivity was about 10 3 and 10 2 -fold higher than that of the modified Farr method and of the double antibody technique respectively. NZB/W mice developed high titer anti-dsDNA antibody as they grew older. Spleen cells brought to a microculture system using flat-bottomed polystyrene plates produced anti-dsDNA antibody clearly detectable by solid-phase radioimmunoassay. Anti-dsDNA antibody produced in vitro (y units) was in close correlation with the anti-dsDNA antibody titer of the spleen donor (x units) (y = 4.8 X 10 -2 x-65, γ = 0.94, P < 0.001). A combination of the microculture system and solid-phase radioimmunoassay was recommended for the characterization of anti-dsDNA antibody-forming cells. (Auth.)

  7. DNA double-strand breaks as potential indicators for the biological effects of ionising radiation exposure from cardiac CT and conventional coronary angiography: a randomised, controlled study

    Energy Technology Data Exchange (ETDEWEB)

    Geisel, Dominik; Zimmermann, Elke; Rief, Matthias; Greupner, Johannes; Hamm, Bernd [Charite Medical School, Department of Radiology, Berlin (Germany); Laule, Michael; Knebel, Fabian [Charite Medical School, Department of Cardiology, Berlin (Germany); Dewey, Marc [Charite Medical School, Department of Radiology, Berlin (Germany); Charite, Institut fuer Radiologie, Berlin (Germany)

    2012-08-15

    To prospectively compare induced DNA double-strand breaks by cardiac computed tomography (CT) and conventional coronary angiography (CCA). 56 patients with suspected coronary artery disease were randomised to undergo either CCA or cardiac CT. DNA double-strand breaks were assessed in fluorescence microscopy of blood lymphocytes as indicators of the biological effects of radiation exposure. Radiation doses were estimated using dose-length product (DLP) and dose-area product (DAP) with conversion factors for CT and CCA, respectively. On average there were 0.12 {+-} 0.06 induced double-strand breaks per lymphocyte for CT and 0.29 {+-} 0.18 for diagnostic CCA (P < 0.001). This relative biological effect of ionising radiation from CCA was 1.9 times higher (P < 0.001) than the effective dose estimated by conversion factors would have suggested. The correlation between the biological effects and the estimated radiation doses was excellent for CT (r = 0.951, P < 0.001) and moderate to good for CCA (r = 0.862, P < 0.001). One day after radiation, a complete repair of double-strand breaks to background levels was found in both groups. Conversion factors may underestimate the relative biological effects of ionising radiation from CCA. DNA double-strand break assessment may provide a strategy for individualised assessments of radiation. (orig.)

  8. Inactivation Data.xlsx

    Data.gov (United States)

    U.S. Environmental Protection Agency — The data set is a spreadsheet that contains results of inactivation experiments that were conducted to to determine the effectiveness of chlorine in inactivating B....

  9. Optimization of Neutral Comet Assay for studying DNA double-strand breaks in pea and wheat

    Directory of Open Access Journals (Sweden)

    Ivelina Nikolova

    2013-01-01

    Full Text Available This study describes an adaptation of the Comet assay under neutral conditions for mono- and dicotyledonous plants pea (Pisum sativum L. and wheat (Triticum aestivum L.. Modifications concern lysis and electrophoresis steps, respectively. Electrophoresis was carried out varying the intensity of the electric field. A linear relationship between the percentages of DNA in the tail from control background with alteration of intensity was found. Trypan blue dye exclusion test was used in order to determine the intactness of nuclear membrane of the isolated nuclei from both plant model systems. Assessment was conducted on non-irradiated and irradiated nuclei on a monolayer with three doses of UVC. It was found that the share of intact nuclei (trypan blue negative ones is about 95% in controls. Gradual dose-related increase of damaged nuclei was observed in both species, reaching statistical significance only at the higher dose applied.

  10. Writers, Readers, and Erasers of Histone Ubiquitylation in DNA Double-Strand Break Repair

    DEFF Research Database (Denmark)

    Smeenk, Godelieve; Mailand, Niels

    2016-01-01

    accurate lesion repair and restoration of genome integrity. In vertebrate cells, ubiquitin-dependent modifications of histones adjacent to DSBs by RNF8, RNF168, and other ubiquitin ligases have a key role in promoting the assembly of repair protein complexes, serving as direct recruitment platforms...... for a range of genome caretaker proteins and their associated factors. These DNA damage-induced chromatin ubiquitylation marks provide an essential component of a histone code for DSB repair that is controlled by multifaceted regulatory circuits, underscoring its importance for genome stability maintenance....... In this review, we provide a comprehensive account of how DSB-induced histone ubiquitylation is sensed, decoded and modulated by an elaborate array of repair factors and regulators. We discuss how these mechanisms impact DSB repair pathway choice and functionality for optimal protection of genome integrity...

  11. Radiation sensitivity of organisms of different organization level: an approach including DNA strand breakage

    International Nuclear Information System (INIS)

    Kampf, G.

    1983-01-01

    The mean numbers of DNA double-strand breaks (DSB) suggested to be necessary to lead to the loss of reproductive capacity are compared with bacteriophages, bacteria, and cells of the Chinese hamster after the influence of several radiation qualities. The results suggest that the critical target for the inactivating action of radiations may not be the entire DNA of all organisms but a structure unit of it designed as membrane-attached super structure unit. With organisms having only one of these structures (bacteria) the inactivation probability of one DSB will be near unity, with their multiplication in higher cells it will become lower. This means, eukaryotic cells are able to tolerate more DSB before being inactivated than organisms of a lower organization level, and consequently are more ''lesion resistant''. This behavior represents an evolutionary stabilization of higher cells towards the lethal action of severe DNA lesions such as DSB. (author)

  12. Absence of zero-temperature transmission rate of a double-chain tight-binding model for DNA with random sequence of nucleotides in thermodynamic limit

    International Nuclear Information System (INIS)

    Xiong Gang; Wang, X.R.

    2005-01-01

    The zero-temperature transmission rate spectrum of a double-chain tight-binding model for real DNA is calculated. It is shown that a band of extended-like states exists only for finite chain length with strong inter-chain coupling. While the whole spectrum tends to zero in thermodynamic limit, regardless of the strength of inter-chain coupling. It is also shown that a more faithful model for real DNA with periodic sugar-phosphate chains in backbone structures can be mapped into the above simple double-chain tight-binding model. Combined with above results, the transmission rate of real DNA with long random sequence of nucleotides is expected to be poor

  13. Hsp90α regulates ATM and NBN functions in sensing and repair of DNA double-strand breaks.

    Science.gov (United States)

    Pennisi, Rosa; Antoccia, Antonio; Leone, Stefano; Ascenzi, Paolo; di Masi, Alessandra

    2017-08-01

    The molecular chaperone heat shock protein 90 (Hsp90α) regulates cell proteostasis and mitigates the harmful effects of endogenous and exogenous stressors on the proteome. Indeed, the inhibition of Hsp90α ATPase activity affects the cellular response to ionizing radiation (IR). Although the interplay between Hsp90α and several DNA damage response (DDR) proteins has been reported, its role in the DDR is still unclear. Here, we show that ataxia-telangiectasia-mutated kinase (ATM) and nibrin (NBN), but not 53BP1, RAD50, and MRE11, are Hsp90α clients as the Hsp90α inhibitor 17-(allylamino)-17-demethoxygeldanamycin (17-AAG) induces ATM and NBN polyubiquitination and proteosomal degradation in normal fibroblasts and lymphoblastoid cell lines. Hsp90α-ATM and Hsp90α-NBN complexes are present in unstressed and irradiated cells, allowing the maintenance of ATM and NBN stability that is required for the MRE11/RAD50/NBN complex-dependent ATM activation and the ATM-dependent phosphorylation of both NBN and Hsp90α in response to IR-induced DNA double-strand breaks (DSBs). Hsp90α forms a complex also with ph-Ser1981-ATM following IR. Upon phosphorylation, NBN dissociates from Hsp90α and translocates at the DSBs, while phThr5/7-Hsp90α is not recruited at the damaged sites. The inhibition of Hsp90α affects nuclear localization of MRE11 and RAD50, impairs DDR signaling (e.g., BRCA1 and CHK2 phosphorylation), and slows down DSBs repair. Hsp90α inhibition does not affect DNA-dependent protein kinase (DNA-PK) activity, which possibly phosphorylates Hsp90α and H2AX after IR. Notably, Hsp90α inhibition causes H2AX phosphorylation in proliferating cells, this possibly indicating replication stress events. Overall, present data shed light on the regulatory role of Hsp90α on the DDR, controlling ATM and NBN stability and influencing the DSBs signaling and repair. © 2017 Federation of European Biochemical Societies.

  14. Risk scaling factors from inactivation to chromosome aberrations, mutations and oncogenic transformations in mammalian cells

    International Nuclear Information System (INIS)

    Alkaharam, A.S.; Watt, D.E.

    1997-01-01

    Analyses of bio-effect mechanisms of damage to mammalian cells in terms of the quality parameter 'mean free path for primary ionisation', for heavy charged particles, strongly suggests that there is a common mechanism for the biological endpoints of chromosome aberrations, mutations and oncogenic transformation. The lethal lesions are identified as unrepaired double-strand breaks in the intracellular DNA. As data for the various endpoints studied can be represented in a unified scheme, for any radiation type, it follows that radiation risk factors can be determined on the basis of simple ratios to the inactivation cross sections. There are intrinsic physical reasons why neutrons can never reach the saturation level of heavier particles for equal fluences. The probabilities of risk with respect to inactivation, for chromosome dicentrics, mutation of the HPRT gene and of oncogenic transformation are respectively 0.24, 5.8 x 10 -5 , and 4.1 x 10 -3 . (author)

  15. Novel essential residues of Hda for interaction with DnaA in the regulatory inactivation of DnaA: unique roles for Hda AAA Box VI and VII motifs.

    Science.gov (United States)

    Nakamura, Kenta; Katayama, Tsutomu

    2010-04-01

    Escherichia coli ATP-DnaA initiates chromosomal replication. For preventing extra-initiations, a complex of ADP-Hda and the DNA-loaded replicase clamp promotes DnaA-ATP hydrolysis, yielding inactive ADP-DnaA. However, the Hda-DnaA interaction mode remains unclear except that the Hda Box VII Arg finger (Arg-153) and DnaA sensor II Arg-334 within each AAA(+) domain are crucial for the DnaA-ATP hydrolysis. Here, we demonstrate that direct and functional interaction of ADP-Hda with DnaA requires the Hda residues Ser-152, Phe-118 and Asn-122 as well as Hda Arg-153 and DnaA Arg-334. Structural analyses suggest intermolecular interactions between Hda Ser-152 and DnaA Arg-334 and between Hda Phe-118 and the DnaA Walker B motif region, in addition to an intramolecular interaction between Hda Asn-122 and Arg-153. These interactions likely sustain a specific association of ADP-Hda and DnaA, promoting DnaA-ATP hydrolysis. Consistently, ATP-DnaA and ADP-DnaA interact with the ADP-Hda-DNA-clamp complex with similar affinities. Hda Phe-118 and Asn-122 are contained in the Box VI region, and their hydrophobic and electrostatic features are basically conserved in the corresponding residues of other AAA(+) proteins, suggesting a conserved role for Box VI. These findings indicate novel interaction mechanisms for Hda-DnaA as well as a potentially fundamental mechanism in AAA(+) protein interactions.

  16. DNA damage, homology-directed repair, and DNA methylation.

    Directory of Open Access Journals (Sweden)

    Concetta Cuozzo

    2007-07-01

    Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

  17. Synthesis of DNA

    Science.gov (United States)

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  18. Mouse but not human embryonic stem cells are deficient in rejoining of ionizing radiation-induced DNA double-strand breaks.

    Science.gov (United States)

    Bañuelos, C A; Banáth, J P; MacPhail, S H; Zhao, J; Eaves, C A; O'Connor, M D; Lansdorp, P M; Olive, P L

    2008-09-01

    Mouse embryonic stem (mES) cells will give rise to all of the cells of the adult mouse, but they failed to rejoin half of the DNA double-strand breaks (dsb) produced by high doses of ionizing radiation. A deficiency in DNA-PK(cs) appears to be responsible since mES cells expressed strand breaks more rapidly. Consistent with more rapid dsb rejoining, H2AX(-/-) mES cells also expressed 6 times more DNA-PK(cs) than wild-type mES cells. Similar results were obtained for ATM(-/-) mES cells. Differentiation of mES cells led to an increase in DNA-PK(cs), an increase in dsb rejoining rate, and a decrease in Ku70/80. Unlike mouse ES, human ES cells were proficient in rejoining of dsb and expressed high levels of DNA-PK(cs). These results confirm the importance of homologous recombination in the accurate repair of double-strand breaks in mES cells, they help explain the chromosome abnormalities associated with deficiencies in H2AX and ATM, and they add to the growing list of differences in the way rodent and human cells deal with DNA damage.

  19. High Incidence of HPV-Associated Head and Neck Cancers in FA Deficient Mice Is Associated with E7’s Induction of DNA Damage through Its Inactivation of Pocket Proteins

    Science.gov (United States)

    Park, Jung Wook; Shin, Myeong-Kyun; Pitot, Henry C.; Lambert, Paul F.

    2013-01-01

    Fanconi anemia (FA) patients are highly susceptible to solid tumors at multiple anatomical sites including head and neck region. A subset of head and neck cancers (HNCs) is associated with ‘high-risk’ HPVs, particularly HPV16. However, the correlation between HPV oncogenes and cancers in FA patients is still unclear. We previously learned that FA deficiency in mice predisposes HPV16 E7 transgenic mice to HNCs. To address HPV16 E6’s oncogenic potential under FA deficiency in HNCs, we utilized HPV16 E6-transgenic mice (K14E6) and HPV16 E6/E7-bi-transgenic mice (K14E6E7) on genetic backgrounds sufficient or deficient for one of the fanc genes, fancD2 and monitored their susceptibility to HNCs. K14E6 mice failed to develop tumor. However, E6 and fancD2-deficiency accelerated E7-driven tumor development in K14E6E7 mice. The increased tumor incidence was more correlated with E7-driven DNA damage than proliferation. We also found that deficiency of pocket proteins, pRb, p107, and p130 that are well-established targets of E7, could recapitulate E7’s induction of DNA damage. Our findings support the hypothesis that E7 induces HPV-associated HNCs by promoting DNA damage through the inactivation of pocket proteins, which explains why a deficiency in DNA damage repair would increase susceptibility to E7-driven cancer. Our results further demonstrate the unexpected finding that FA deficiency does not predispose E6 transgenic mice to HNCs, indicating a specificity in the synergy between FA deficiency and HPV oncogenes in causing HNCs. PMID:24086435

  20. High incidence of HPV-associated head and neck cancers in FA deficient mice is associated with E7's induction of DNA damage through its inactivation of pocket proteins.

    Science.gov (United States)

    Park, Jung Wook; Shin, Myeong-Kyun; Pitot, Henry C; Lambert, Paul F

    2013-01-01

    Fanconi anemia (FA) patients are highly susceptible to solid tumors at multiple anatomical sites including head and neck region. A subset of head and neck cancers (HNCs) is associated with 'high-risk' HPVs, particularly HPV16. However, the correlation between HPV oncogenes and cancers in FA patients is still unclear. We previously learned that FA deficiency in mice predisposes HPV16 E7 transgenic mice to HNCs. To address HPV16 E6's oncogenic potential under FA deficiency in HNCs, we utilized HPV16 E6-transgenic mice (K14E6) and HPV16 E6/E7-bi-transgenic mice (K14E6E7) on genetic backgrounds sufficient or deficient for one of the fanc genes, fancD2 and monitored their susceptibility to HNCs. K14E6 mice failed to develop tumor. However, E6 and fancD2-deficiency accelerated E7-driven tumor development in K14E6E7 mice. The increased tumor incidence was more correlated with E7-driven DNA damage than proliferation. We also found that deficiency of pocket proteins, pRb, p107, and p130 that are well-established targets of E7, could recapitulate E7's induction of DNA damage. Our findings support the hypothesis that E7 induces HPV-associated HNCs by promoting DNA damage through the inactivation of pocket proteins, which explains why a deficiency in DNA damage repair would increase susceptibility to E7-driven cancer. Our results further demonstrate the unexpected finding that FA deficiency does not predispose E6 transgenic mice to HNCs, indicating a specificity in the synergy between FA deficiency and HPV oncogenes in causing HNCs.

  1. High incidence of HPV-associated head and neck cancers in FA deficient mice is associated with E7's induction of DNA damage through its inactivation of pocket proteins.

    Directory of Open Access Journals (Sweden)

    Jung Wook Park

    Full Text Available Fanconi anemia (FA patients are highly susceptible to solid tumors at multiple anatomical sites including head and neck region. A subset of head and neck cancers (HNCs is associated with 'high-risk' HPVs, particularly HPV16. However, the correlation between HPV oncogenes and cancers in FA patients is still unclear. We previously learned that FA deficiency in mice predisposes HPV16 E7 transgenic mice to HNCs. To address HPV16 E6's oncogenic potential under FA deficiency in HNCs, we utilized HPV16 E6-transgenic mice (K14E6 and HPV16 E6/E7-bi-transgenic mice (K14E6E7 on genetic backgrounds sufficient or deficient for one of the fanc genes, fancD2 and monitored their susceptibility to HNCs. K14E6 mice failed to develop tumor. However, E6 and fancD2-deficiency accelerated E7-driven tumor development in K14E6E7 mice. The increased tumor incidence was more correlated with E7-driven DNA damage than proliferation. We also found that deficiency of pocket proteins, pRb, p107, and p130 that are well-established targets of E7, could recapitulate E7's induction of DNA damage. Our findings support the hypothesis that E7 induces HPV-associated HNCs by promoting DNA damage through the inactivation of pocket proteins, which explains why a deficiency in DNA damage repair would increase susceptibility to E7-driven cancer. Our results further demonstrate the unexpected finding that FA deficiency does not predispose E6 transgenic mice to HNCs, indicating a specificity in the synergy between FA deficiency and HPV oncogenes in causing HNCs.

  2. A structural model of the genome packaging process in a membrane-containing double stranded DNA virus.

    Directory of Open Access Journals (Sweden)

    Chuan Hong

    2014-12-01

    Full Text Available Two crucial steps in the virus life cycle are genome encapsidation to form an infective virion and genome exit to infect the next host cell. In most icosahedral double-stranded (ds DNA viruses, the viral genome enters and exits the capsid through a unique vertex. Internal membrane-containing viruses possess additional complexity as the genome must be translocated through the viral membrane bilayer. Here, we report the structure of the genome packaging complex with a membrane conduit essential for viral genome encapsidation in the tailless icosahedral membrane-containing bacteriophage PRD1. We utilize single particle electron cryo-microscopy (cryo-EM and symmetry-free image reconstruction to determine structures of PRD1 virion, procapsid, and packaging deficient mutant particles. At the unique vertex of PRD1, the packaging complex replaces the regular 5-fold structure and crosses the lipid bilayer. These structures reveal that the packaging ATPase P9 and the packaging efficiency factor P6 form a dodecameric portal complex external to the membrane moiety, surrounded by ten major capsid protein P3 trimers. The viral transmembrane density at the special vertex is assigned to be a hexamer of heterodimer of proteins P20 and P22. The hexamer functions as a membrane conduit for the DNA and as a nucleating site for the unique vertex assembly. Our structures show a conformational alteration in the lipid membrane after the P9 and P6 are recruited to the virion. The P8-genome complex is then packaged into the procapsid through the unique vertex while the genome terminal protein P8 functions as a valve that closes the channel once the genome is inside. Comparing mature virion, procapsid, and mutant particle structures led us to propose an assembly pathway for the genome packaging apparatus in the PRD1 virion.

  3. A structural model of the genome packaging process in a membrane-containing double stranded DNA virus.

    Science.gov (United States)

    Hong, Chuan; Oksanen, Hanna M; Liu, Xiangan; Jakana, Joanita; Bamford, Dennis H; Chiu, Wah

    2014-12-01

    Two crucial steps in the virus life cycle are genome encapsidation to form an infective virion and genome exit to infect the next host cell. In most icosahedral double-stranded (ds) DNA viruses, the viral genome enters and exits the capsid through a unique vertex. Internal membrane-containing viruses possess additional complexity as the genome must be translocated through the viral membrane bilayer. Here, we report the structure of the genome packaging complex with a membrane conduit essential for viral genome encapsidation in the tailless icosahedral membrane-containing bacteriophage PRD1. We utilize single particle electron cryo-microscopy (cryo-EM) and symmetry-free image reconstruction to determine structures of PRD1 virion, procapsid, and packaging deficient mutant particles. At the unique vertex of PRD1, the packaging complex replaces the regular 5-fold structure and crosses the lipid bilayer. These structures reveal that the packaging ATPase P9 and the packaging efficiency factor P6 form a dodecameric portal complex external to the membrane moiety, surrounded by ten major capsid protein P3 trimers. The viral transmembrane density at the special vertex is assigned to be a hexamer of heterodimer of proteins P20 and P22. The hexamer functions as a membrane conduit for the DNA and as a nucleating site for the unique vertex assembly. Our structures show a conformational alteration in the lipid membrane after the P9 and P6 are recruited to the virion. The P8-genome complex is then packaged into the procapsid through the unique vertex while the genome terminal protein P8 functions as a valve that closes the channel once the genome is inside. Comparing mature virion, procapsid, and mutant particle structures led us to propose an assembly pathway for the genome packaging apparatus in the PRD1 virion.

  4. Inactivation of Caliciviruses

    Directory of Open Access Journals (Sweden)

    Raymond Nims

    2013-03-01

    Full Text Available The Caliciviridae family of viruses contains clinically important human and animal pathogens, as well as vesivirus 2117, a known contaminant of biopharmaceutical manufacturing processes employing Chinese hamster cells. An extensive literature exists for inactivation of various animal caliciviruses, especially feline calicivirus and murine norovirus. The caliciviruses are susceptible to wet heat inactivation at temperatures in excess of 60 °C with contact times of 30 min or greater, to UV-C inactivation at fluence ≥30 mJ/cm2, to high pressure processing >200 MPa for >5 min at 4 °C, and to certain photodynamic inactivation approaches. The enteric caliciviruses (e.g.; noroviruses display resistance to inactivation by low pH, while the non-enteric species (e.g.; feline calicivirus are much more susceptible. The caliciviruses are inactivated by a variety of chemicals, including alcohols, oxidizing agents, aldehydes, and β-propiolactone. As with inactivation of viruses in general, inactivation of caliciviruses by the various approaches may be matrix-, temperature-, and/or contact time-dependent. The susceptibilities of the caliciviruses to the various physical and chemical inactivation approaches are generally similar to those displayed by other small, non-enveloped viruses, with the exception that the parvoviruses and circoviruses may require higher temperatures for inactivation, while these families appear to be more susceptible to UV-C inactivation than are the caliciviruses.

  5. Temporal analysis of meiotic DNA double-strand break formation and repair in Drosophila females.

    Science.gov (United States)

    Mehrotra, S; McKim, K S

    2006-11-24

    Using an antibody against the phosphorylated form of His2Av (gamma-His2Av), we have described the time course for the series of events leading from the formation of a double-strand break (DSB) to a crossover in Drosophila female meiotic prophase. MEI-P22 is required for DSB formation and localizes to chromosomes prior to gamma-His2Av foci. Drosophila females, however, are among the group of organisms where synaptonemal complex (SC) formation is not dependent on DSBs. In the absence of two SC proteins, C(3)G and C(2)M, the number of DSBs in oocytes is significantly reduced. This is consistent with the appearance of SC protein staining prior to gamma-His2Av foci. However, SC formation is incomplete or absent in the neighboring nurse cells, and gamma-His2Av foci appear with the same kinetics as in oocytes and do not depend on SC proteins. Thus, competence for DSB formation in nurse cells occurs with a specific timing that is independent of the SC, whereas in the oocytes, some SC proteins may have a regulatory role to counteract the effects of a negative regulator of DSB formation. The SC is not sufficient for DSB formation, however, since DSBs were absent from the heterochromatin even though SC formation occurs in these regions. All gamma-His2Av foci disappear before the end of prophase, presumably as repair is completed and crossovers are formed. However, oocytes in early prophase exhibit a slower response to X-ray-induced DSBs compared to those in the late pachytene stage. Assuming all DSBs appear as gamma-His2Av foci, there is at least a 3:1 ratio of noncrossover to crossover products. From a comparison of the frequency of gamma-His2Av foci and crossovers, it appears that Drosophila females have only a weak mechanism to ensure a crossover in the presence of a low number of DSBs.

  6. Transformation frequency of γ irradiated plasmid DNA and the enzymatic double strand break formation by incubation in a protein extract of Escherichia coli

    International Nuclear Information System (INIS)

    Schulte-Frohlinde, D.; Mark, F.; Ventur, Y.

    1994-01-01

    It was found that incubation of γ-irradiated or DNaseI-treated plasmid DNA in a protein extract of Escherichia coli leads to enzyme-induced formation of double strand breaks (dsb) in competition with repair of precursors of these dsb. A survival curve of the plasmid DNA (as determined by transformation of E. coli) was calculated on the basis of enzyme-induced dsb as well as those produced by irradiation assuming that they are lethal. The calculated D O value was the same as that measured directly by transformation of irradiated plasmid DNA. Two models are presented that fit the experimental survival data as a function of dose. One is based on damage formation in the plasmid DNA including enzymatic conversion of single strand damage into dsb (U-model), the other is an enzymatic repair saturation model based on Michaelis-Menten kinetics. (Author)

  7. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  8. A quantitative model of the major pathways for radiation-induced DNA double-strand break repair

    International Nuclear Information System (INIS)

    Belov, O.V.; Krasavin, E.A.; Lyashko, M.S.; Batmunkh, M.; Sweilam, N.H.

    2014-01-01

    We have developed a model approach to simulate the major pathways of DNA double-strand break (DSB) repair in mammalian and human cells. The proposed model shows a possible mechanistic explanation of the basic regularities of DSB processing through the nonhomologous end-joining (NHEJ), homologous recombination (HR), and single-strand annealing (SSA). It reconstructs the time-courses of radiation-induced foci specific to particular repair processes including the major intermediate stages. The model is validated for ionizing radiations of a wide range of linear energy transfer (0.2-236 keV/μm) including a relatively broad spectrum of heavy ions. The appropriate set of reaction rate constants was suggested to satisfy the kinetics of DSB rejoining for the considered types of exposure. The simultaneous assessment of three repair pathways allows one to describe their possible biological relations in response to radiation. With the help of the proposed approach, we reproduce several experimental data sets on γ-H2AX foci remaining in different types of cells including those defective in NHEJ, HR, or SSA functions.

  9. Do Exogenous DNA Double-Strand Breaks Change Incomplete Synapsis and Chiasma Localization in the Grasshopper Stethophyma grossum?

    Directory of Open Access Journals (Sweden)

    Adela Calvente

    Full Text Available Meiotic recombination occurs as a programmed event that initiates by the formation of DNA double-strand breaks (DSBs that give rise to the formation of crossovers that are observed as chiasmata. Chiasmata are essential for the accurate chromosome segregation and the generation of new combinations of parental alleles. Some treatments that provoke exogenous DSBs also lead to alterations in the recombination pattern of some species in which full homologous synapsis is achieved at pachytene. We have carried out a similar approach in males of the grasshopper Stethophyma grossum, whose homologues show incomplete synapsis and proximal chiasma localization. After irradiating males with γ rays we have studied the distribution of both the histone variant γ-H2AX and the recombinase RAD51. These proteins are cytological markers of DSBs at early prophase I. We have inferred synaptonemal complex (SC formation via identification of SMC3 and RAD 21 cohesin subunits. Whereas thick and thin SMC3 filaments would correspond to synapsed and unsynapsed regions, the presence of RAD21 is only restricted to synapsed regions. Results show that irradiated spermatocytes maintain restricted synapsis between homologues. However, the frequency and distribution of chiasmata in metaphase I bivalents is slightly changed and quadrivalents were also observed. These results could be related to the singular nuclear polarization displayed by the spermatocytes of this species.

  10. Do Exogenous DNA Double-Strand Breaks Change Incomplete Synapsis and Chiasma Localization in the Grasshopper Stethophyma grossum?

    Science.gov (United States)

    Calvente, Adela; Santos, Juan Luis; Rufas, Julio S

    2016-01-01

    Meiotic recombination occurs as a programmed event that initiates by the formation of DNA double-strand breaks (DSBs) that give rise to the formation of crossovers that are observed as chiasmata. Chiasmata are essential for the accurate chromosome segregation and the generation of new combinations of parental alleles. Some treatments that provoke exogenous DSBs also lead to alterations in the recombination pattern of some species in which full homologous synapsis is achieved at pachytene. We have carried out a similar approach in males of the grasshopper Stethophyma grossum, whose homologues show incomplete synapsis and proximal chiasma localization. After irradiating males with γ rays we have studied the distribution of both the histone variant γ-H2AX and the recombinase RAD51. These proteins are cytological markers of DSBs at early prophase I. We have inferred synaptonemal complex (SC) formation via identification of SMC3 and RAD 21 cohesin subunits. Whereas thick and thin SMC3 filaments would correspond to synapsed and unsynapsed regions, the presence of RAD21 is only restricted to synapsed regions. Results show that irradiated spermatocytes maintain restricted synapsis between homologues. However, the frequency and distribution of chiasmata in metaphase I bivalents is slightly changed and quadrivalents were also observed. These results could be related to the singular nuclear polarization displayed by the spermatocytes of this species.

  11. Molecular mechanism of protein assembly on DNA double-strand breaks in the non-homologous end-joining pathway

    International Nuclear Information System (INIS)

    Yano, Ken-ichi; Morotomi-Yano, Keiko; Adachi, Noritaka; Akiyama, Hidenori

    2009-01-01

    Non-homologous end-joining (NHEJ) is the major repair pathway for DNA double-strand breaks (DSBs) in mammalian species. Upon DSB induction, a living cell quickly activates the NHEJ pathway comprising of multiple molecular events. However, it has been difficult to analyze the initial phase of DSB responses in living cells, primarily due to technical limitations. Recent advances in real-time imaging and site-directed DSB induction using laser microbeam allow us to monitor the spatiotemporal dynamics of NHEJ factors in the immediate-early phase after DSB induction. These new approaches, together with the use of cell lines deficient in each essential NHEJ factor, provide novel mechanistic insights into DSB recognition and protein assembly on DSBs in the NHEJ pathway. In this review, we provide an overview of recent progresses in the imaging analyses of the NHEJ core factors. These studies strongly suggest that the NHEJ core factors are pre-assembled into a large complex on DSBs prior to the progression of the biochemical reactions in the NHEJ pathway. Instead of the traditional step-by-step assembly model from the static view of NHEJ, a novel model for dynamic protein assembly in the NHEJ pathway is proposed. This new model provides important mechanistic insights into the protein assembly at DSBs and the regulation of DSB repair. (author)

  12. Nitric oxide mediated DNA double strand breaks induced in proliferating bystander cells after {alpha}-particle irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Han Wei [Department of Physics and Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon Tong (Hong Kong); Chen Shaopeng [Department of Physics and Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon Tong (Hong Kong); Key Laboratory of Ion Beam Bioengineering, Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); Yu, K.N., E-mail: peter.yu@cityu.edu.hk [Department of Physics and Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon Tong (Hong Kong); Wu Lijun [Key Laboratory of Ion Beam Bioengineering, Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China)

    2010-02-03

    Low-dose {alpha}-particle exposures comprise 55% of the environmental dose to the human population and have been shown to induce bystander responses. Previous studies showed that bystander effect could induce stimulated cell growth or genotoxicity, such as excessive DNA double strand breaks (DSBs), micronuclei (MN), mutation and decreased cell viability, in the bystander cell population. In the present study, the stimulated cell growth, detected with flow cytometry (FCM), and the increased MN and DSB, detected with p53 binding protein 1 (53BP1) immunofluorescence, were observed simultaneously in the bystander cell population, which were co-cultured with cells irradiated by low-dose {alpha}-particles (1-10 cGy) in a mixed system. Further studies indicated that nitric oxide (NO) and transforming growth factor {beta}1 (TGF-{beta}1) played very important roles in mediating cell proliferation and inducing MN and DSB in the bystander population through treatments with NO scavenger and TGF-{beta}1 antibody. Low-concentrations of NO, generated by spermidine, were proved to induce cell proliferation, DSB and MN simultaneously. The proliferation or shortened cell cycle in bystander cells gave them insufficient time to repair DSBs. The increased cell division might increase the probability of carcinogenesis in bystander cells since cell proliferation increased the probability of mutation from the mis-repaired or un-repaired DSBs.

  13. Age-dependent change of HMGB1 and DNA double-strand break accumulation in mouse brain

    International Nuclear Information System (INIS)

    Enokido, Yasushi; Yoshitake, Ayaka; Ito, Hikaru; Okazawa, Hitoshi

    2008-01-01

    HMGB1 is an evolutionarily conserved non-histone chromatin-associated protein with key roles in maintenance of nuclear homeostasis; however, the function of HMGB1 in the brain remains largely unknown. Recently, we found that the reduction of nuclear HMGB1 protein level in the nucleus associates with DNA double-strand break (DDSB)-mediated neuronal damage in Huntington's disease [M.L. Qi, K. Tagawa, Y. Enokido, N. Yoshimura, Y. Wada, K. Watase, S. Ishiura, I. Kanazawa, J. Botas, M. Saitoe, E.E. Wanker, H. Okazawa, Proteome analysis of soluble nuclear proteins reveals that HMGB1/2 suppress genotoxic stress in polyglutamine diseases, Nat. Cell Biol. 9 (2007) 402-414]. In this study, we analyze the region- and cell type-specific changes of HMGB1 and DDSB accumulation during the aging of mouse brain. HMGB1 is localized in the nuclei of neurons and astrocytes, and the protein level changes in various brain regions age-dependently. HMGB1 reduces in neurons, whereas it increases in astrocytes during aging. In contrast, DDSB remarkably accumulates in neurons, but it does not change significantly in astrocytes during aging. These results indicate that HMGB1 expression during aging is differentially regulated between neurons and astrocytes, and suggest that the reduction of nuclear HMGB1 might be causative for DDSB in neurons of the aged brain

  14. Nitric oxide mediated DNA double strand breaks induced in proliferating bystander cells after α-particle irradiation

    International Nuclear Information System (INIS)

    Han Wei; Chen Shaopeng; Yu, K.N.; Wu Lijun

    2010-01-01

    Low-dose α-particle exposures comprise 55% of the environmental dose to the human population and have been shown to induce bystander responses. Previous studies showed that bystander effect could induce stimulated cell growth or genotoxicity, such as excessive DNA double strand breaks (DSBs), micronuclei (MN), mutation and decreased cell viability, in the bystander cell population. In the present study, the stimulated cell growth, detected with flow cytometry (FCM), and the increased MN and DSB, detected with p53 binding protein 1 (53BP1) immunofluorescence, were observed simultaneously in the bystander cell population, which were co-cultured with cells irradiated by low-dose α-particles (1-10 cGy) in a mixed system. Further studies indicated that nitric oxide (NO) and transforming growth factor β1 (TGF-β1) played very important roles in mediating cell proliferation and inducing MN and DSB in the bystander population through treatments with NO scavenger and TGF-β1 antibody. Low-concentrations of NO, generated by spermidine, were proved to induce cell proliferation, DSB and MN simultaneously. The proliferation or shortened cell cycle in bystander cells gave them insufficient time to repair DSBs. The increased cell division might increase the probability of carcinogenesis in bystander cells since cell proliferation increased the probability of mutation from the mis-repaired or un-repaired DSBs.

  15. Transcription-associated processes cause DNA double-strand breaks and translocations in neural stem/progenitor cells.

    Science.gov (United States)

    Schwer, Bjoern; Wei, Pei-Chi; Chang, Amelia N; Kao, Jennifer; Du, Zhou; Meyers, Robin M; Alt, Frederick W

    2016-02-23

    High-throughput, genome-wide translocation sequencing (HTGTS) studies of activated B cells have revealed that DNA double-strand breaks (DSBs) capable of translocating to defined bait DSBs are enriched around the transcription start sites (TSSs) of active genes. We used the HTGTS approach to investigate whether a similar phenomenon occurs in primary neural stem/progenitor cells (NSPCs). We report that breakpoint junctions indeed are enriched around TSSs that were determined to be active by global run-on sequencing analyses of NSPCs. Comparative analyses of transcription profiles in NSPCs and B cells revealed that the great majority of TSS-proximal junctions occurred in genes commonly expressed in both cell types, possibly because this common set has higher transcription levels on average than genes transcribed in only one or the other cell type. In the latter context, among all actively transcribed genes containing translocation junctions in NSPCs, those with junctions located within 2 kb of the TSS show a significantly higher transcription rate on average than genes with junctions in the gene body located at distances greater than 2 kb from the TSS. Finally, analysis of repair junction signatures of TSS-associated translocations in wild-type versus classical nonhomologous end-joining (C-NHEJ)-deficient NSPCs reveals that both C-NHEJ and alternative end-joining pathways can generate translocations by joining TSS-proximal DSBs to DSBs on other chromosomes. Our studies show that the generation of transcription-associated DSBs is conserved across divergent cell types.

  16. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes.

    Science.gov (United States)

    Pietilä, Maija K; Roine, Elina; Sencilo, Ana; Bamford, Dennis H; Oksanen, Hanna M

    2016-01-01

    Viruses infecting archaea show a variety of virion morphotypes, and they are currently classified into more than ten viral families or corresponding groups. A pleomorphic virus morphotype is very common among haloarchaeal viruses, and to date, several such viruses have been isolated. Here, we propose the classification of eight such viruses and formation of a new family, Pleolipoviridae (from the Greek pleo for more or many and lipos for lipid), containing three genera, Alpha-, Beta-, and Gammapleolipovirus. The proposal is currently under review by the International Committee on Taxonomy of Viruses (ICTV). The members of the proposed family Pleolipoviridae infect halophilic archaea and are nonlytic. They share structural and genomic features and differ from any other classified virus. The virion of pleolipoviruses is composed of a pleomorphic membrane vesicle enclosing the genome. All pleolipoviruses have two major structural protein species, internal membrane and spike proteins. Although the genomes of the pleolipoviruses are single- or double-stranded, linear or circular DNA molecules, they share the same genome organization and gene synteny and show significant similarity at the amino acid level. The canonical features common to all members of the proposed family Pleolipoviridae show that they are closely related and thus form a new viral family.

  17. Rejoining of DNA double-strand breaks in human fibroblasts and its impairment in one ataxia telangiectasia and two Fanconi strains

    International Nuclear Information System (INIS)

    Coquerelle, T.M.; Weibezahn, K.F.

    1981-01-01

    Using the technique of neutral elution through polycarbonate filters as a measure of DNA length, and hence of the number of double-strand breaks incurred as a result of radiation damage, we found that normal human fibroblasts rejoin 50% of all breaks within only 3 min (37 degrees C). This fast rejoining was impaired in fibroblasts from one patient with Ataxia telangiectasia and in fibroblasts from two patients with Fanconi's anemia. Also the number of residual breaks after several hours of repair was higher than in control cells. Other cases with the same diseases were normal in their rejoining of double-strand breaks

  18. Skewed X-inactivation in cloned mice

    International Nuclear Information System (INIS)

    Senda, Sho; Wakayama, Teruhiko; Yamazaki, Yukiko; Ohgane, Jun; Hattori, Naka; Tanaka, Satoshi; Yanagimachi, Ryuzo; Shiota, Kunio

    2004-01-01

    In female mammals, dosage compensation for X-linked genes is accomplished by inactivation of one of two X chromosomes. The X-inactivation ratio (a percentage of the cells with inactivated maternal X chromosomes in the whole cells) is skewed as a consequence of various genetic mutations, and has been observed in a number of X-linked disorders. We previously reported that phenotypically normal full-term cloned mouse fetuses had loci with inappropriate DNA methylation. Thus, cloned mice are excellent models to study abnormal epigenetic events in mammalian development. In the present study, we analyzed X-inactivation ratios in adult female cloned mice (B6C3F1). Kidneys of eight naturally produced controls and 11 cloned mice were analyzed. Although variations in X-inactivation ratio among the mice were observed in both groups, the distributions were significantly different (Ansary-Bradley test, P < 0.01). In particular, 2 of 11 cloned mice showed skewed X-inactivation ratios (19.2% and 86.8%). Similarly, in intestine, 1 of 10 cloned mice had a skewed ratio (75.7%). Skewed X-inactivation was observed to various degrees in different tissues of different individuals, suggesting that skewed X-inactivation in cloned mice is the result of secondary cell selection in combination with stochastic distortion of primary choice. The present study is the first demonstration that skewed X-inactivation occurs in cloned animals. This finding is important for understanding both nuclear transfer technology and etiology of X-linked disorders

  19. A correlation between residual radiation-induced DNA double-strand breaks in cultured fibroblasts and late radiotherapy reactions in breast cancer patients

    International Nuclear Information System (INIS)

    Kiltie, A.E.; Ryan, A.J.; Swindell, R.; Barber, J.B.P.; West, C.M.L.; Magee, B.; Hendry, J.H.

    1999-01-01

    Background and purpose: Prediction of late normal tissue reactions to radiotherapy would permit tailoring of dosage to each patient. Measurement of residual DNA double strand breaks using pulsed field gel electrophoresis (PFGE) shows promise in this field. The aim of this study was to test the predictive potential of PFGE in a group of retrospectively studied breast cancer patients.Materials and methods: Thirty nine patients, treated uniformly for breast cancer 9-15 years previously, with excision of the tumour and radiotherapy to the breast and drainage areas, were assessed clinically using the LENT SOMA scale, and a 5-mm punch biopsy taken from the buttock. Fibroblast cell strains were established and used to study residual DNA double strand breaks, using PFGE.Results: There were significant correlations between the DNA assay results and the fibrosis score (r s =0.46; P=0.003), the combined fibrosis and retraction score (r s =0.45, P=0.004) and the overall LENT score (r s =0.43; P=0.006). Using polychotomous logistic regression, the fibroblast DNA assay result was an independent prognostic factor for fibrosis severity.Conclusions: There is a relationship between residual radiation-induced DNA damage in fibroblasts and the severity of the late normal tissue damage seen in the patients from whom the cells were cultured. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  20. Combined quantum-mechanics/molecular-mechanics dynamics simulation of A-DNA double strands irradiated by ultra-low-energy carbon ions

    Energy Technology Data Exchange (ETDEWEB)

    Ngaojampa, C.; Nimmanpipug, P. [Computer Simulation and Modeling Laboratory (CSML), Department of Chemistry and Center for Innovation Chemistry, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Yu, L.D., E-mail: yuld@fnrf.science.cmu.ac.t [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Anuntalabhochai, S. [Molecular Biology Laboratory, Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Lee, V.S., E-mail: vannajan@gmail.co [Computer Simulation and Modeling Laboratory (CSML), Department of Chemistry and Center for Innovation Chemistry, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand)

    2011-02-15

    In order to promote understanding of the fundamentals of ultra-low-energy ion interaction with DNA, molecular dynamics simulations using combined quantum-mechanics/molecular-mechanics of poly-AT and poly-GC A-DNA double strands irradiated by <200 eV carbon ions were performed to investigate the molecular implications of mutation bias. The simulations were focused on the responses of the DNA backbones and nitrogenous bases to irradiation. Analyses of the root mean square displacements of the backbones and non-hydrogen atoms of base rings of the simulated DNA structure after irradiation revealed a potential preference of DNA double strand separation, dependent on the irradiating energy. The results show that for the backbones, the large difference in the displacement between poly-GC and poly-AT in the initial time period could be the reason for the backbone breakage; for the nitrogenous base pairs, A-T is 30% more sensitive or vulnerable to ion irradiation than G-C, demonstrating a preferential, instead of random, effect of irradiation-induced mutation.

  1. Combined quantum-mechanics/molecular-mechanics dynamics simulation of A-DNA double strands irradiated by ultra-low-energy carbon ions

    International Nuclear Information System (INIS)

    Ngaojampa, C.; Nimmanpipug, P.; Yu, L.D.; Anuntalabhochai, S.; Lee, V.S.

    2011-01-01

    In order to promote understanding of the fundamentals of ultra-low-energy ion interaction with DNA, molecular dynamics simulations using combined quantum-mechanics/molecular-mechanics of poly-AT and poly-GC A-DNA double strands irradiated by <200 eV carbon ions were performed to investigate the molecular implications of mutation bias. The simulations were focused on the responses of the DNA backbones and nitrogenous bases to irradiation. Analyses of the root mean square displacements of the backbones and non-hydrogen atoms of base rings of the simulated DNA structure after irradiation revealed a potential preference of DNA double strand separation, dependent on the irradiating energy. The results show that for the backbones, the large difference in the displacement between poly-GC and poly-AT in the initial time period could be the reason for the backbone breakage; for the nitrogenous base pairs, A-T is 30% more sensitive or vulnerable to ion irradiation than G-C, demonstrating a preferential, instead of random, effect of irradiation-induced mutation.

  2. Relation between sedimentation behaviour of DNA-membrane complexes and DNA single- and double-strand breaks after irradiation with gamma-rays, pulse neutrons and 12C ions

    International Nuclear Information System (INIS)

    Erzgraber, G.; Lapidus, I.L.

    1985-01-01

    The experimental data on sedimentation behaviour of DNA-membrane complexes at radiation of the Chinese hamster cells (V79-4) in a wide dose range of 127 Cs γ-rays, pulse neutrons (reactor IBR-2, Laboratory of Neutron Physics, JINR, Dubna) are accelerated 12 C ions (cyclotron U-200, Laboratory of Nuclear Reactions, JINR, Dubna) are presented An assumption on the role of DNA single- and double-strend breaks in changing the sedimentation properties of DNA-membrane complexes has been confirmed by the experiments with radiation of different quality. The possibility of estimating induction and repair of DNA breaks on the basis of dependence of the relative sedimentation velocity of complexes on the irradiation does is discussed

  3. Inactivation of the Autolysis-Related Genes lrgB and yycI in Staphylococcus aureus Increases Cell Lysis-Dependent eDNA Release and Enhances Biofilm Development In Vitro and In Vivo.

    Directory of Open Access Journals (Sweden)

    Cristiana Ossaille Beltrame

    Full Text Available Staphylococcus aureus ica-independent biofilms are multifactorial in nature, and various bacterial proteins have been associated with biofilm development, including fibronectin-binding proteins A and B, protein A, surface protein SasG, proteases, and some autolysins. The role of extracellular DNA (eDNA has also been demonstrated in some S. aureus biofilms. Here, we constructed a Tn551 library, and the screening identified two genes that affected biofilm formation, lrgB and yycI. The repressive effect of both genes on the development of biofilm was also confirmed in knockout strains constructed by allelic recombination. In contrast, the superexpression of either lrgB or yycI by a cadmium-inducible promoter led to a decrease in biofilm accumulation. Indeed, a significant increase in the cell-lysis dependent eDNA release was detected when lrgB or yycI were inactivated, explaining the enhanced biofilm formed by these mutants. In fact, lrgB and yycI genes belong to distinct operons that repress bacterial autolysis through very different mechanisms. LrgB is associated with the synthesis of phage holin/anti-holin analogues, while YycI participates in the activation/repression of the two-component system YycGF (WalKR. Our in vivo data suggest that autolysins activation lead to increased bacterial virulence in the foreign body animal model since a higher number of attached cells was recovered from the implanted catheters inoculated with lrgB or yycI knockout mutants.

  4. Inactivation of Heterosigma akashiwo in ballast water by circular orifice plate-generated hydrodynamic cavitation.

    Science.gov (United States)

    Feng, Daolun; Zhao, Jie; Liu, Tian

    2016-01-01

    The discharge of alien ballast water is a well-known, major reason for marine species invasion. Here, circular orifice plate-generated hydrodynamic cavitation was used to inactivate Heterosigma akashiwo in ballast water. In comparison with single- and multihole orifice plates, the conical-hole orifice plate yielded the highest inactivation percentage, 51.12%, and consumed only 6.84% energy (based on a 50% inactivation percentage). Repeating treatment, either using double series-connection or circling inactivation, elevated the inactivation percentage, yet consumed much more energy. The results indicate that conical-hole-generated hydrodynamic cavitation shows great potential as a pre-inactivation method for ballast water treatment.

  5. Effect of Chromatin Structure on the Extent and Distribution of DNA Double Strand Breaks Produced by Ionizing Radiation; Comparative Study of hESC and Differentiated Cells Lines.

    Science.gov (United States)

    Venkatesh, Priyanka; Panyutin, Irina V; Remeeva, Evgenia; Neumann, Ronald D; Panyutin, Igor G

    2016-01-02

    Chromatin structure affects the extent of DNA damage and repair. Thus, it has been shown that heterochromatin is more protective against DNA double strand breaks (DSB) formation by ionizing radiation (IR); and that DNA DSB repair may proceed differently in hetero- and euchromatin regions. Human embryonic stem cells (hESC) have a more open chromatin structure than differentiated cells. Here, we study the effect of chromatin structure in hESC on initial DSB formation and subsequent DSB repair. DSB were scored by comet assay; and DSB repair was assessed by repair foci formation via 53BP1 antibody staining. We found that in hESC, heterochromatin is confined to distinct regions, while in differentiated cells it is distributed more evenly within the nuclei. The same dose of ionizing radiation produced considerably more DSB in hESC than in differentiated derivatives, normal human fibroblasts; and one cancer cell line. At the same time, the number of DNA repair foci were not statistically different among these cells. We showed that in hESC, DNA repair foci localized almost exclusively outside the heterochromatin regions. We also noticed that exposure to ionizing radiation resulted in an increase in heterochromatin marker H3K9me3 in cancer HT1080 cells, and to a lesser extent in IMR90 normal fibroblasts, but not in hESCs. These results demonstrate the importance of chromatin conformation for DNA protection and DNA damage repair; and indicate the difference of these processes in hESC.

  6. An Approach to Detect and Study DNA Double-Strand Break Repair by Transcript RNA Using a Spliced-Antisense RNA Template.

    Science.gov (United States)

    Keskin, Havva; Storici, Francesca

    2018-01-01

    A double-strand break (DSB) is one of the most dangerous DNA lesion, and its repair is crucial for genome stability. Homologous recombination is considered the safest way to repair a DNA DSB and requires an identical or nearly identical DNA template, such as a sister chromatid or a homologous chromosome for accurate repair. Can transcript RNA serve as donor template for DSB repair? Here, we describe an approach that we developed to detect and study DNA repair by transcript RNA. Key features of the method are: (i) use of antisense (noncoding) RNA as template for DSB repair by RNA, (ii) use of intron splicing to distinguish the sequence of the RNA template from that of the DNA that generates the RNA template, and (iii) use of a trans and cis system to study how RNA repairs a DSB in homologous but distant DNA or in its own DNA, respectively. This chapter provides details on how to use a spliced-antisense RNA template to detect and study DSB repair by RNA in trans or cis in yeast cells. Our approach for detection of DSB repair by RNA in cells can be applied to cell types other than yeast, such as bacteria, mammalian cells, or other eukaryotic cells. © 2018 Elsevier Inc. All rights reserved.

  7. DNA Double-Strand Breaks Induce the Nuclear Actin Filaments Formation in Cumulus-Enclosed Oocytes but Not in Denuded Oocytes.

    Directory of Open Access Journals (Sweden)

    Ming-Hong Sun

    Full Text Available As a gamete, oocyte needs to maintain its genomic integrity and passes this haploid genome to the next generation. However, fully-grown mouse oocyte cannot respond to DNA double-strand breaks (DSBs effectively and it is also unable to repair them before the meiosis resumption. To compensate for this disadvantage and control the DNA repair events, oocyte needs the cooperation with its surrounding cumulus cells. Recently, evidences have shown that nuclear actin filament formation plays roles in cellular DNA DSB repair. To explore whether these nuclear actin filaments are formed in the DNA-damaged oocytes, here, we labeled the filament actins in denuded oocytes (DOs and cumulus-enclosed oocytes (CEOs. We observed that the nuclear actin filaments were formed only in the DNA-damaged CEOs, but not in DOs. Formation of actin filaments in the nucleus was an event downstream to the DNA damage response. Our data also showed that the removal of cumulus cells led to a reduction in the nuclear actin filaments in oocytes. Knocking down of the Adcy1 gene in cumulus cells did not affect the formation of nuclear actin filaments in oocytes. Notably, we also observed that the nuclear actin filaments in CEOs could be induced by inhibition of gap junctions. From our results, it was confirmed that DNA DSBs induce the nuclear actin filament formation in oocyte and which is controlled by the cumulus cells.

  8. Aphidicolin synchronization of mouse L cells perturbs the relationship between cell killing and DNA double-strand breakage after X-irradiation

    International Nuclear Information System (INIS)

    Radford, I.R.; Broadhurst, S.

    1988-01-01

    The relationship between X-ray-induced cell killing and DNA double-strand breakage was examined for synchronized mouse L cells that had entered S-phase, G2-phase, mitosis, and G1-phase following release from aphidicolin and compared to asynchronous culture response. Aphidicolin-synchronized cells showed cycle phase-dependent changes in dose-responses for both killing and DNA dsb. However, on the basis of DNA dsb per unit length of DNA required to produce a lethal lesion, aphidicolin-synchronized cells were more sensitive to X-rays than asynchronous cultures. This sensitivity peaked 2 h after release from aphidicolin treatment, and then progressively declined towards the asynchronous culture value. It is argued that results are due to deregulation of the temporal order of DNA replication following aphidicolin treatment, and can be incorporated into the critical DNA target size model by postulating that the targets for radiation action in mammalian cells are DNA-associated with potentially transcriptionally active proto-oncogenes or constitutive fragile sites. (author)

  9. Preparation of Phi29 DNA polymerase free of amplifiable DNA using ethidium monoazide, an ultraviolet-free light-emitting diode lamp and trehalose.

    Directory of Open Access Journals (Sweden)

    Hirokazu Takahashi

    Full Text Available We previously reported that multiply-primed rolling circle amplification (MRPCA using modified random RNA primers can amplify tiny amounts of circular DNA without producing any byproducts. However, contaminating DNA in recombinant Phi29 DNA polymerase adversely affects the outcome of MPRCA, especially for negative controls such as non-template controls. The amplified DNA in negative control casts doubt on the result of DNA amplification. Since Phi29 DNA polymerase has high affinity for both single-strand and double-stranded DNA, some amount of host DNA will always remain in the recombinant polymerase. Here we describe a procedure for preparing Phi29 DNA polymerase which is essentially free of amplifiable DNA. This procedure is realized by a combination of host DNA removal using appropriate salt concentrations, inactivation of amplifiable DNA using ethidium monoazide, and irradiation with visible light from a light-emitting diode lamp. Any remaining DNA, which likely exists as oligonucleotides captured by the Phi29 DNA polymerase, is degraded by the 3'-5' exonuclease activity of the polymerase itself in the presence of trehalose, used as an anti-aggregation reagent. Phi29 DNA polymerase purified by this procedure has little amplifiable DNA, resulting in reproducible amplification of at least ten copies of plasmid DNA without any byproducts and reducing reaction volume. This procedure could aid the amplification of tiny amounts DNA, thereby providing clear evidence of contamination from laboratory environments, tools and reagents.

  10. Human DNA polymerase delta double-mutant D316A;E318A interferes with DNA mismatch repair in vitro

    DEFF Research Database (Denmark)

    Liu, Dekang; Frederiksen, Jane H.; Liberti, Sascha Emilie

    2017-01-01

    DNA mismatch repair (MMR) is a highly-conserved DNA repair mechanism, whose primary role is to remove DNA replication errors preventing them from manifesting as mutations, thereby increasing the overall genome stability. Defects in MMR are associated with increased cancer risk in humans and other...... organisms. Here, we characterize the interaction between MMR and a proofreading-deficient allele of the human replicative DNA polymerase delta, PolδD316A;E318A, which has a higher capacity for strand displacement DNA synthesis than wild type Polδ. Human cell lines overexpressing PolδD316A;E318A display...

  11. Heterochromatinization associated with cell differentiation as a model to study DNA double strand break induction and repair in the context of higher-order chromatin structure

    Czech Academy of Sciences Publication Activity Database

    Falk, Martin; Lukášová, Emilie; Štefančíková, Lenka; Baranová, E.; Falková, Iva; Ježková, L.; Davídková, Marie; Bačíková, Alena; Vachelová, Jana; Michaelidesová, Anna; Kozubek, Stanislav

    2014-01-01

    Roč. 83, Jan (2014), s. 177-185 ISSN 0969-8043 R&D Projects: GA MŠk(CZ) LD12039 Institutional support: RVO:68081707 ; RVO:61389005 Keywords : DNA double strand break (DSB) repair * Immature and terminally differentiated granulocytes * gamma H2AX/53BP1 repair foci Subject RIV: BO - Biophysics; BO - Biophysics (UJF-V) Impact factor: 1.231, year: 2014

  12. Discovery of DNA repair inhibitors by combinatorial library profiling

    Science.gov (United States)

    Moeller, Benjamin J.; Sidman, Richard L.; Pasqualini, Renata; Arap, Wadih

    2011-01-01

    Small molecule inhibitors of DNA repair are emerging as potent and selective anti-cancer therapies, but the sheer magnitude of the protein networks involved in DNA repair processes poses obstacles to discovery of effective candidate drugs. To address this challenge, we used a subtractive combinatorial selection approach to identify a panel of peptide ligands that bind DNA repair complexes. Supporting the concept that these ligands have therapeutic potential, we show that one selected peptide specifically binds and non-competitively inactivates DNA-PKcs, a protein kinase critical in double-strand DNA break repair. In doing so, this ligand sensitizes BRCA-deficient tumor cells to genotoxic therapy. Our findings establish a platform for large-scale parallel screening for ligand-directed DNA repair inhibitors, with immediate applicability to cancer therapy. PMID:21343400

  13. Processing of DNA double strand breaks by alternative non-homologous end-joining in hyperacetylated chromatin.

    Science.gov (United States)

    Manova, Vasilissa; Singh, Satyendra K; Iliakis, George

    2012-08-22

    Mammalian cells employ at least two subpathways of non-homologous end-joining for the repair of ionizing radiation induced DNA double strand breaks: The canonical DNA-PK-dependent form of non-homologous end-joining (D-NHEJ) and an alternative, slowly operating, error-prone backup pathway (B-NHEJ). In contrast to D-NHEJ, which operates with similar efficiency throughout the cell cycle, B-NHEJ operates more efficiently in G2-phase. Notably, B-NHEJ also shows strong and as of yet unexplained dependency on growth activity and is markedly compromised in serum-deprived cells, or in cells that enter the plateau-phase of growth. The molecular mechanisms underpinning this response remain unknown. Since chromatin structure or changes in chromatin structure are prime candidate-B-NHEJ-modulators, we study here the role of chromatin hyperacetylation, either by HDAC2 knockdown or treatment with the HDAC inhibitor TSA, on the repair by B-NHEJ of IR-induced DSBs. siRNA-mediated knockdown of HDAC2 fails to provoke histone hyperacetylation in Lig4-/- MEFs and has no detectable effect on B-NHEJ function. Treatment with TSA that inhibits multiple HDACs causes efficient, reversible chromatin hyperacetylation in Lig4-/- MEFs, as well as in human HCT116 Lig4-/- cells and the human glioma cell line M059K. The IR yield of DSBs in TSA-treated cells remains similar to that of untreated cells despite the expected chromatin relaxation. In addition, chromatin hyperacetylation leaves unchanged repair of DSBs by B-NHEJ in irradiated exponentially growing, or plateau-phase cells. Notably, under the experimental conditions employed here, chromatin hyperacetylation fails to detectably modulate B-NHEJ in M059K cells as well. In summary, the results show that chromatin acetylation or deacetylation does not affect the kinetics of alternative NHEJ in all types of cells examined both in exponentially growing and serum deprived cultures. We conclude that parameters beyond chromatin acetylation determine B

  14. Frequencies of micronucleated reticulocytes, a dosimeter of DNA double-strand breaks, in infants receiving computed tomography or cardiac catheterization.

    Science.gov (United States)

    Khattab, Mona; Walker, Dale M; Albertini, Richard J; Nicklas, Janice A; Lundblad, Lennart K A; Vacek, Pamela M; Walker, Vernon E

    2017-08-01

    The use of computed tomography (CT scans) has increased dramatically in recent decades, raising questions about the long-term safety of CT-emitted x-rays especially in infants who are more sensitive to radiation-induced effects. Cancer risk estimates for CT scans typically are extrapolated from models; therefore, new approaches measuring actual DNA damage are needed for improved estimations. Hence, changes in a dosimeter of DNA double-strand breaks, micronucleated reticulocytes (MN-RETs) measured by flow cytometry, were investigated in mice and infants exposed to CT scans. In male C57BL/6N mice (6-8 weeks-of-age), there was a dose-related increase in MN-RETs in blood samples collected 48h after CT scans delivering targeted exposures of 1-130 cGy x-rays (n=5-10/group, r=0.994, p=0.01), with significant increases occurring at exposure levels as low as 0.83 cGy x-rays compared to control mice (p=0.002). In paired blood specimens from infants with no history of a prior CT scan, there was no difference in MN-RET frequencies found 2h before (mean, 0.10±0.07%) versus 48h after (mean, 0.11±0.05%) a scheduled CT scan/cardiac catheterization. However, in infants having prior CT scan(s), MN-RET frequencies measured at 48h after a scheduled CT scan (mean=0.22±0.12%) were significantly higher than paired baseline values (mean, 0.17±0.07%; p=0.032). Increases in baseline (r=0.722, p<0.001) and 48-h post exposure (r=0.682, p<0.001) levels of MN-RETs in infants with a history of prior CT scans were significantly correlated with the number of previous CT scans. These preliminary findings suggest that prior CT scans increase the cellular responses to subsequent CT exposures. Thus, further investigation is needed to characterize the potential cancer risk from single versus repeated CT scans or cardiac catheterizations in infants. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Determination and analysis of site-specific 125I decay-induced DNA double-strand break end-group structures.

    Science.gov (United States)

    Datta, Kamal; Weinfeld, Michael; Neumann, Ronald D; Winters, Thomas A

    2007-02-01

    End groups contribute to the structural complexity of radiation-induced DNA double-strand breaks (DSBs). As such, end-group structures may affect a cell's ability to repair DSBs. The 3'-end groups of strand breaks caused by gamma radiation, or oxidative processes, under oxygenated aqueous conditions have been shown to be distributed primarily between 3'-phosphoglycolate and 3'-phosphate, with 5'-phosphate ends in both cases. In this study, end groups of the high-LET-like DSBs caused by 125I decay were investigated. Site-specific DNA double-strand breaks were produced in plasmid pTC27 in the presence or absence of 2 M DMSO by 125I-labeled triplex-forming oligonucleotide targeting. End-group structure was assessed enzymatically as a function of the DSB end to serve as a substrate for ligation and various forms of end labeling. Using this approach, we have demonstrated 3'-hydroxyl (3'-OH) and 3'-phosphate (3'-P) end groups and 5'-ends (> or = 42%) terminated by phosphate. A 32P postlabeling assay failed to detect 3'-phosphoglycolate in a restriction fragment terminated by the 125I-induced DNA double-strand break, and this is likely due to restricted oxygen diffusion during irradiation as a frozen aqueous solution. Even so, end-group structure and relative distribution varied as a function of the free radical scavenging capacity of the irradiation buffer.

  16. Evidence for induction of DNA double strand breaks in the bystander response to targeted soft X-rays in CHO cells

    International Nuclear Information System (INIS)

    Kashino, Genro; Prise, Kevin M.; Schettino, Giuseppe; Folkard, Melvyn; Vojnovic, Borivoj; Michael, Barry D.; Suzuki, Keiji; Kodama, Seiji; Watanabe, Masami

    2004-01-01

    This study investigated the role of DNA double strand breaks and DNA base damage in radiation-induced bystander responses in Chinese hamster ovary (CHO) cell lines. Two CHO repair-deficient clones, xrs5 (DNA double strand break repair-deficient) and EM9 (DNA base excision repair-deficient) were used in addition to the wild type (CHO). The Gray Cancer Institute ultrasoft X-ray microprobe is a powerful tool for investigating the bystander response, because it permits the irradiation of only a single nucleus of a cell, as reported previously. In order to investigate the bystander effect in each repair-deficient cell line, we irradiated a single cell within a population and scored the formation of micronuclei. When a single nucleus in the population was targeted with 1 Gy, elevated numbers of micronuclei were induced in the neighbouring unirradiated cells in the EM9 and xrs5 cell lines, whereas induction was not observed in CHO. The induction of micronuclei in xrs5 was significantly higher than that in EM9. Under these conditions, the surviving fraction in the neighbouring cells was significantly lower in xrs5 than in the other cell lines, showing a higher cell killing effect in xrs5. To confirm that bystander factors secreted from irradiated cells caused these effects, we carried out medium transfer experiments using conventional X-irradiation. Medium conditioned for 24 h with irradiated cells was transferred to unirradiated cells and elevated induction of micronuclei was observed in xrs5. These results suggest that DNA double strand breaks rather than base damage are caused by factors secreted in the medium from irradiated cells

  17. DNA double-strand breaks induced by high-energy neon and iron ions in human fibroblasts. I. Pulsed-field gel electrophoresis method

    International Nuclear Information System (INIS)

    Rydberg, B.; Loebrich, M.; Cooper, P.K.

    1994-01-01

    The relative effectiveness of high-energy neon and iron ions for the production of DNA double-strand breaks was measured in one transformed and one nontransformed human fibroblast cell line using pulsed-field gel electrophoresis. The DNA released from the gel plug (fraction of activity released: FAR) as well as the size distribution of the DNA entering the gel were used to compare the effects of the heavy-ion exposure with X-ray exposure. Both methods gave similar results, indicating similar distributions of breaks over megabase-pair distances for the heavy ions and the X rays. The relative biological effectiveness (RBE) compared to 225 kVp X rays of initially induced DNA double-strand breaks was found to be 0.85 for 425 MeV/u neon ions (LET 32 keV/μm) and 0.42-0.55 for 250-600 MeV/u iron ions (LET 190-350 keV/μm). Postirradiation incubation showed less efficient repair of breaks induced by the neon ions and the 600 MeV/u iron ions compared to X rays. Survival experiments demonstrated RBE values larger than one for cell killing by the heavy ions in parallel experiments (neon: RBE = 1.2, iron: RBE = 2.3-3.0, based on D 10 values). It is concluded that either the initial yield of DNA double-strand breaks induced by the high-energy particles is lower than the yield for X rays, or the breaks induced by heavy ions are present in clusters that cannot be resolved with the technique used. These results are confirmed in the accompanying paper. 48 refs., 5 figs., 2 tabs

  18. Cell inactivation by heavy charged particles

    Energy Technology Data Exchange (ETDEWEB)

    Blakely, E A [Lawrence Berkeley Lab., CA (United States). Cell and Molecular Biology Div.

    1992-06-01

    The inactivation of cells resulting in lethal or aberrant effects by charged particles is of growing interest. Charged particles at extremely high LET are capable of completely eliminating cell-type and cell-line differences in repair capacity. It is still not clear however whether the repair systems are inactivated, or merely that heavy-ion lesions are less repairable. Studies correlating the particle inactivation dose of radioresistant cells with intact DNA analyzed with pulse field gel electrophoresis and other techniques may be useful, but more experiments are also needed to assess the fidelity of repair. For particle irradiations between 40-100 keV/{mu}m there is however evidence for particle-induced activation of specific genes in mammalian cells, and certain repair processes in bacteria. New data are available on the inactivation of developmental processes in several systems including seeds, and cells of the nematode C. elegans. Future experimental and theoretical modeling research emphasis should focus on exploring particle-induced inactivation of endpoints assessing functionality and not just lethality, and on analyzing molecular damage and genetic effects arising in damage but non-inactivated survivors. The discrete nature of selective types of particle damage as a function of radiation quality indicates the value of accelerated ions as probes of normal and aberrant biological processes. Information obtained from molecular analyses of damage and repair must however be integrated into the context of cellular and tissue functions of the organism. (orig.).

  19. A new model describing the curves for repair of both DNA double-strand breaks and chromosome damage

    International Nuclear Information System (INIS)

    Foray, N.; Badie, C.; Alsbeih, G.; Malaise, E.P.; Fertil, B.

    1996-01-01

    A review of reports dealing with fittings of the data for repair of DNA double-strand breaks (DSBs) and excess chromosome fragments (ECFs) shows that several models are used to fit the repair curves. Since DSBs and ECFs are correleated, it is worth developing a model describing both phenomena. The curve-fitting models used most extensively, the two repair half-times model for DSBs and the monoexponential plus residual model for ECFs, appear to be too inflexible to describe the repair curves for both DSBs and ECFs. We have therefore developed a new concept based on a variable repair half-time. According to this concept, the repair curve is continuously bending and dependent on time and probably reflects a continuous spectrum of damage repairability. The fits of the curves for DSB repair to the variable repair half-time and the variable repair half-time plus residual models were compared to those obtained with the two half-times plus residual and two half-times models. Similarly, the fits of the curves for ECF repair to the variable repair half-time and variable half-time plus residual models were compared to that obtained with the monoexponential plus residual model. The quality of fit and the dependence of adjustable parameters on the portion of the curve fitted were used as comparison criteria. We found that: (a) It is useful to postulate the existence of a residual term for unrepairable lesions, regardless of the model adopted. (b) With the two cell lines tested (a normal and a hypersensitive one), data for both DSBs and ECTs are best fitted to the variable repair half-time plus residual model, whatever the repair time range. 47 refs., 3 figs., 3 tabs

  20. Hematopoietic Stem Cells from Ts65Dn Mice Are Deficient in the Repair of DNA Double-Strand Breaks.

    Science.gov (United States)

    Wang, Yingying; Chang, Jianhui; Shao, Lijian; Feng, Wei; Luo, Yi; Chow, Marie; Du, Wei; Meng, Aimin; Zhou, Daohong

    2016-06-01

    Down syndrome (DS) is a genetic disorder caused by the presence of an extra partial or whole copy of chromosome 21. In addition to musculoskeletal and neurodevelopmental abnormalities, children with DS exhibit various hematologic disorders and have an increased risk of developing acute lymphoblastic leukemia and acute megakaryocytic leukemia. Using the Ts65Dn mouse model, we investigated bone marrow defects caused by trisomy for 132 orthologs of the genes on human chromosome 21. The results showed that, although the total bone marrow cellularity as well as the frequency of hematopoietic progenitor cells (HPCs) was comparable between Ts65Dn mice and their age-matched euploid wild-type (WT) control littermates, human chromosome 21 trisomy led to a significant reduction in hematopoietic stem cell (HSC) numbers and clonogenic function in Ts65Dn mice. We also found that spontaneous DNA double-strand breaks (DSBs) were significantly increased in HSCs from the Ts65Dn mice, which was correlated with the significant reduction in HSC clonogenic activity compared to those from WT controls. Moreover, analysis of the repair kinetics of radiation-induced DSBs revealed that HSCs from Ts65Dn mice were less proficient in DSB repair than the cells from WT controls. This deficiency was associated with a higher sensitivity of Ts65Dn HSCs to radiation-induced suppression of HSC clonogenic activity than that of euploid HSCs. These findings suggest that an additional copy of genes on human chromosome 21 may selectively impair the ability of HSCs to repair DSBs, which may contribute to DS-associated hematological abnormalities and malignancies.

  1. The influence of ginger (Zingiber officinale on human sperm quality and DNA fragmentation: A double-blind randomized clinical trial

    Directory of Open Access Journals (Sweden)

    Jalil Hosseini

    2016-08-01

    Full Text Available Background: Although the effectiveness of ginger as an antioxidant agent has been exploited, little human research has been conducted on its activity on male reproductive functions. Objective: This study was designed to investigate the effects of ginger (Zingiber officinale on sperm DNA fragmentation (SDF in infertile men. Materials and Methods: This randomized double-blind, placebo-controlled trial with a 1:1 allocation was performed on 100 infertility treatment candidates who were admitted to Royan Institute for Reproductive Biomedicine, Tehran, Iran. Patients were randomly assigned to receive one of two treatments: ginger and placebo. Patients were given a 3-month oral treatment (members received capsules containing 250 mg of ginger powder twice a day in ginger and a placebo in other group. Before and after treatment, standardized semen samples were obtained to determine sperm concentration, motility, and SDF according to World Health Organization. Results: There was no significant difference between two groups regarding SDF at baseline (53.48. 95%CI: 37.95-69.02 in cases and (56.75, 95%CI: 40.01-73.5 in controls. The average positive percentage of SDF in patients receiving ginger (17.77, 95%CI: 6.16-29.39 was lower compared with placebo (40.54, 95%CI: 23.94-57.13 after three month of treatment (p=0.02. In multivariate analysis, SDF was significantly lower in patients receiving ginger compared with placebo (mean difference: 3.21, 95%CI: 0.78-5.63, p=0.009. There were no significant differences between two groups regarding to semen parameters. Conclusion: The present study has demonstrated that ginger in a controlled study of efficacy was effective in decreasing SDF in infertile men.

  2. The DNA damage response during mitosis

    International Nuclear Information System (INIS)

    Heijink, Anne Margriet; Krajewska, Małgorzata; Vugt, Marcel A.T.M. van

    2013-01-01

    Cells are equipped with a cell-intrinsic signaling network called the DNA damage response (DDR). This signaling network recognizes DNA lesions and initiates various downstream pathways to coordinate a cell cycle arrest with the repair of the damaged DNA. Alternatively, the DDR can mediate clearance of affected cells that are beyond repair through apoptosis or senescence. The DDR can be activated in response to DNA damage throughout the cell cycle, although the extent of DDR signaling is different in each cell cycle phase. Especially in response to DNA double strand breaks, only a very marginal response was observed during mitosis. Early on it was recognized that cells which are irradiated during mitosis continued division without repairing broken chromosomes. Although these initial observations indicated diminished DNA repair and lack of an acute DNA damage-induced cell cycle arrest, insight into the mechanistic re-wiring of DDR signaling during mitosis was only recently provided. Different mechanisms appear to be at play to inactivate specific signaling axes of the DDR network in mitosis. Importantly, mitotic cells not simply inactivate the entire DDR, but appear to mark their DNA damage for repair after mitotic exit. Since the treatment of cancer frequently involves agents that induce DNA damage as well as agents that block mitotic progression, it is clinically relevant to obtain a better understanding of how cancer cells deal with DNA damage during interphase versus mitosis. In this review, the molecular details concerning DDR signaling during mitosis as well as the consequences of encountering DNA damage during mitosis for cellular fate are discussed

  3. The DNA damage response during mitosis

    Energy Technology Data Exchange (ETDEWEB)

    Heijink, Anne Margriet; Krajewska, Małgorzata; Vugt, Marcel A.T.M. van, E-mail: m.vugt@umcg.nl

    2013-10-15

    Cells are equipped with a cell-intrinsic signaling network called the DNA damage response (DDR). This signaling network recognizes DNA lesions and initiates various downstream pathways to coordinate a cell cycle arrest with the repair of the damaged DNA. Alternatively, the DDR can mediate clearance of affected cells that are beyond repair through apoptosis or senescence. The DDR can be activated in response to DNA damage throughout the cell cycle, although the extent of DDR signaling is different in each cell cycle phase. Especially in response to DNA double strand breaks, only a very marginal response was observed during mitosis. Early on it was recognized that cells which are irradiated during mitosis continued division without repairing broken chromosomes. Although these initial observations indicated diminished DNA repair and lack of an acute DNA damage-induced cell cycle arrest, insight into the mechanistic re-wiring of DDR signaling during mitosis was only recently provided. Different mechanisms appear to be at play to inactivate specific signaling axes of the DDR network in mitosis. Importantly, mitotic cells not simply inactivate the entire DDR, but appear to mark their DNA damage for repair after mitotic exit. Since the treatment of cancer frequently involves agents that induce DNA damage as well as agents that block mitotic progression, it is clinically relevant to obtain a better understanding of how cancer cells deal with DNA damage during interphase versus mitosis. In this review, the molecular details concerning DDR signaling during mitosis as well as the consequences of encountering DNA damage during mitosis for cellular fate are discussed.

  4. The DNA damage response during mitosis.

    Science.gov (United States)

    Heijink, Anne Margriet; Krajewska, Małgorzata; van Vugt, Marcel A T M

    2013-10-01

    Cells are equipped with a cell-intrinsic signaling network called the DNA damage response (DDR). This signaling network recognizes DNA lesions and initiates various downstream pathways to coordinate a cell cycle arrest with the repair of the damaged DNA. Alternatively, the DDR can mediate clearance of affected cells that are beyond repair through apoptosis or senescence. The DDR can be activated in response to DNA damage throughout the cell cycle, although the extent of DDR signaling is different in each cell cycle phase. Especially in response to DNA double strand breaks, only a very marginal response was observed during mitosis. Early on it was recognized that cells which are irradiated during mitosis continued division without repairing broken chromosomes. Although these initial observations indicated diminished DNA repair and lack of an acute DNA damage-induced cell cycle arrest, insight into the mechanistic re-wiring of DDR signaling during mitosis was only recently provided. Different mechanisms appear to be at play to inactivate specific signaling axes of the DDR network in mitosis. Importantly, mitotic cells not simply inactivate the entire DDR, but appear to mark their DNA damage for repair after mitotic exit. Since the treatment of cancer frequently involves agents that induce DNA damage as well as agents that block mitotic progression, it is clinically relevant to obtain a better understanding of how cancer cells deal with DNA damage during interphase versus mitosis. In this review, the molecular details concerning DDR signaling during mitosis as well as the consequences of encountering DNA damage during mitosis for cellular fate are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. A double-blind trial of a new inactivated, trivalent, intra-nasal anti-influenza vaccine in general practice: relationship between immunogenicity and respiratory morbidity over the winter of 1997-98.

    Science.gov (United States)

    Kiderman, A; Furst, A; Stewart, B; Greenbaum, E; Morag, A; Zakay-Rones, Z

    2001-02-01

    Influenza is responsible for considerable morbidity not only among older people but in younger age groups as well. However, most large-scale anti-influenza vaccination campaigns are still aimed principally at the elderly using injectable vaccines. Until now there has been much less emphasis on targeting younger populations or using intra-nasal vaccines in mass anti-influenza immunisation programmes. To assess the immunogenicity of a new inactivated intra-nasal anti-influenza vaccine and to measure its effect on respiratory morbidity in a volunteer general practice population. A prospective, double-blind, placebo-controlled trial using the new vaccine was carried out over the winter of 1997-98 on 274 healthy patients aged 12-60 from three Israeli general practices, 182 in the vaccine group and 92 in the placebo group. Following vaccination the changes in the antigen levels and episodes of respiratory illness in the vaccine and placebo groups were measured. Protective antibody levels occurred after a single dose of vaccine [influenza H1N1, 41% immune pre-vaccination to 73% post-vaccination; influenza H3N2, 35-66%; influenza B, 27-64%]. Between January and March 1998, when influenza activity was at a peak in Israel, the average number of respiratory illness events in the vaccine group [14 events/100 subjects per month] was significantly less than in the placebo group [22 events/100 subjects per month]; similarly, the average number of respiratory illness days in the vaccine group over the same period [69 days/100 subjects per month] was significantly less than in the placebo group [117 days/100 subjects per month]. The new vaccine possessed significant immunogenicity and was associated with a significant reduction in respiratory morbidity among a group of healthy older children and adults. Since intra-nasal vaccines are simpler to administer and more acceptable to the public than injections the vaccine's potential for use in routine anti-influenza vaccination

  6. Sensitization to radiation and alkylating agents by inhibitors of poly(ADP-ribose) polymerase is enhanced in cells deficient in DNA double-strand break repair.

    Science.gov (United States)

    Löser, Dana A; Shibata, Atsushi; Shibata, Akiko K; Woodbine, Lisa J; Jeggo, Penny A; Chalmers, Anthony J

    2010-06-01

    As single agents, chemical inhibitors of poly(ADP-ribose) polymerase (PARP) are nontoxic and have clinical efficacy against BRCA1- and BRCA2-deficient tumors. PARP inhibitors also enhance the cytotoxicity of ionizing radiation and alkylating agents but will only improve clinical outcomes if tumor sensitization exceeds effects on normal tissues. It is unclear how tumor DNA repair proficiency affects the degree of sensitization. We have previously shown that the radiosensitizing effect of PARP inhibition requires DNA replication and will therefore affect rapidly proliferating tumors more than normal tissues. Because many tumors exhibit defective DNA repair, we investigated the impact of double-strand break (DSB) repair integrity on the sensitizing effects of the PARP inhibitor olaparib. Sensitization to ionizing radiation and the alkylating agent methylmethane sulfonate was enhanced in DSB repair-deficient cells. In Artemis(-/-) and ATM(-/-) mouse embryo fibroblasts, sensitization was replication dependent and associated with defective repair of replication-associated damage. Radiosensitization of Ligase IV(-/-) mouse embryo fibroblasts was independent of DNA replication and is explained by inhibition of "alternative" end joining. After methylmethane sulfonate treatment, PARP inhibition promoted replication-independent accumulation of DSB, repair of which required Ligase IV. Our findings predict that the sensitizing effects of PARP inhibitors will be more pronounced in rapidly dividing and/or DNA repair defective tumors than normal tissues and show their potential to enhance the therapeutic ratio achieved by conventional DNA-damaging agents.

  7. Force-induced rupture of double-stranded DNA in the absence and presence of covalently bonded anti-tumor drugs: Insights from molecular dynamics simulations

    Science.gov (United States)

    Upadhyaya, Anurag; Nath, Shesh; Kumar, Sanjay

    2018-06-01

    DNA intra-strand cross-link (ICL) agents are widely used in the treatment of cancer. ICLs are thought to form a link between the same strand (intra-strand) or complimentary strand (inter-strand) and thereby increase the stability of DNA, which forbids the processes like replication and transcription. As a result, cell death occurs. In this work, we have studied the enhanced stability of a double stranded DNA in the presence of ICLs and compared our findings with the results obtained in the absence of these links. Using atomistic simulations with explicit solvent, a force is applied along and perpendicular to the direction of the helix and we measured the rupture force and the unzipping force of DNA-ICL complexes. Our results show that the rupture and the unzipping forces increase significantly in the presence of these links. The ICLs bind to the minor groove of DNA, which enhance the DNA stabilisation. Such information may be used to design alternative drugs that can stall replication and transcription that are critical to a growing number of anticancer drug discovery efforts.

  8. DNA double-strand breaks measured by pulsed-field gel electrophoresis in irradiated lymphocytes from normal humans and those with Alzheimer's disease

    International Nuclear Information System (INIS)

    Tobi, S.E.; Itzhaki, R.F.

    1993-01-01

    The authors previously found that radiation-induced chromosome aberrations (dicentrics) are more numerous in lymphocytes from Alzheimer's disease (AD) patients than in those from age-matched normal individuals (Tobi et al. 1990). They have examined double-strand breaks (dsb) produced by g amma - irradiation in the DNA of AD and normal lymphocytes by using pulsed-field gel electrophoresis. The percentage of DNA migrating into the gels is an indirect measure of the number of dsb; DNA content of sequential slices of the gel was assayed by direct fluorometry and the percentage migrating was dose dependent. Results show that the level of damage is similar in AD and normal lymphocytes and preliminary assays of the rate of repair suggest that the half-time is also similar, the value being > 1 h. The latter is consistent with the known rate of rejoining of chromosome fragments in interphase lymphocytes (Pantelias and Maillie 1985). (Author)

  9. Double positivity for HPV-DNA/p16ink4a is the biomarker with strongest diagnostic accuracy and prognostic value for human papillomavirus related oropharyngeal cancer patients.

    Science.gov (United States)

    Mena, Marisa; Taberna, Miren; Tous, Sara; Marquez, Sandra; Clavero, Omar; Quiros, Beatriz; Lloveras, Belen; Alejo, Maria; Leon, Xavier; Quer, Miquel; Bagué, Silvia; Mesia, Ricard; Nogués, Julio; Gomà, Montserrat; Aguila, Anton; Bonfill, Teresa; Blazquez, Carmen; Guix, Marta; Hijano, Rafael; Torres, Montserrat; Holzinger, Dana; Pawlita, Michael; Pavon, Miguel Angel; Bravo, Ignacio G; de Sanjosé, Silvia; Bosch, Francesc Xavier; Alemany, Laia

    2018-03-01

    The etiologic role of human papillomaviruses (HPV) in oropharyngeal cancer (OPC) is well established. Nevertheless, information on survival differences by anatomic sub-site or treatment remains scarce, and it is still unclear the HPV-relatedness definition with best diagnostic accuracy and prognostic value. We conducted a retrospective cohort study of all patients diagnosed with a primary OPC in four Catalonian hospitals from 1990 to 2013. Formalin-fixed, paraffin-embedded cancer tissues were subjected to histopathological evaluation, DNA quality control, HPV-DNA detection, and p16 INK4a /pRb/p53/Cyclin-D1 immunohistochemistry. HPV-DNA positive and a random sample of HPV-DNA negative cases were subjected to HPV-E6*I mRNA detection. Demographic, tobacco/alcohol use, clinical and follow-up data were collected. Multivariate models were used to evaluate factors associated with HPV positivity as defined by four different HPV-relatedness definitions. Proportional-hazards models were used to compare the risk of death and recurrence among HPV-related and non-related OPC. 788 patients yielded a valid HPV-DNA result. The percentage of positive cases was 10.9%, 10.2%, 8.5% and 7.4% for p16 INK4a , HPV-DNA, HPV-DNA/HPV-E6*I mRNA, and HPV-DNA/p16 INK4a , respectively. Being non-smoker or non-drinker was consistently associated across HPV-relatedness definitions with HPV positivity. A suggestion of survival differences between anatomic sub-sites and treatments was observed. Double positivity for HPV-DNA/p16 INK4a showed strongest diagnostic accuracy and prognostic value. Double positivity for HPV-DNA/p16 INK4a , a test that can be easily implemented in the clinical practice, has optimal diagnostic accuracy and prognostic value. Our results have strong clinical implications for patients' classification and handling and also suggest that not all the HPV-related OPC behave similarly. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Breaks in plasmid DNA strand induced by laser radiation at a wavelength of 193 nm

    International Nuclear Information System (INIS)

    Gurzadyan, G.G.; Shul'te Frolinde, D.

    1996-01-01

    DNA of plasmid pB322 irradiated with laser at a wavelength of 193 nm was treated with an extract containing proteins from E.coli K12 AB1157 (wild-type). The enzymes were found to produce single- and double-strand DNA breaks, which was interpreted as a transformation of a portion of cyclobutane pyrimidine dimers and (6-4) photoproducts into nonrepairable single-strand DNA breaks. The products resulted from ionization of DNA, in particular, single-strand breaks, transform to double-strand breaks. A comparison of these data with the data on survival of plasmid upon transformation of E.coli K12 AB1157 enables one to assess the biological significance of single- and double-strand breaks. The inactivation of the plasmid is mainly determined by the number of directly formed laser-induced single-strand breaks. 26 refs.; 2 figs

  11. DNA apoptosis and stability in B-cell chronic lymphoid leukaemia: implication of the DNA double-strand breaks repair system by non homologous recombination

    International Nuclear Information System (INIS)

    Deriano, L.

    2005-01-01

    After an introduction presenting the diagnosis and treatment of chronic lymphoid leukaemia, its molecular and genetic characteristics, and its cellular origin and clonal evolution, this research thesis describes the apoptosis (definition and characteristics, cancer and chemotherapy, apoptotic ways induced by gamma irradiation), the genotoxic stresses, the different repair mechanisms for different damages, and the DNA repair processes. It reports how human chronic lymphocytic leukaemia B cells can escape DNA damage-induced apoptosis through the non-homologous end-joining DNA repair pathway, and presents non-homologous end-joining DNA repair as a potent mutagenic process in human chronic lymphocytic leukaemia B cells

  12. Phenolic promiscuity in the cell nucleus--epigallocatechingallate (EGCG) and theaflavin-3,3'-digallate from green and black tea bind to model cell nuclear structures including histone proteins, double stranded DNA and telomeric quadruplex DNA.

    Science.gov (United States)

    Mikutis, Gediminas; Karaköse, Hande; Jaiswal, Rakesh; LeGresley, Adam; Islam, Tuhidul; Fernandez-Lahore, Marcelo; Kuhnert, Nikolai

    2013-02-01

    Flavanols from tea have been reported to accumulate in the cell nucleus in considerable concentrations. The nature of this phenomenon, which could provide novel approaches in understanding the well-known beneficial health effects of tea phenols, is investigated in this contribution. The interaction between epigallocatechin gallate (EGCG) from green tea and a selection of theaflavins from black tea with selected cell nuclear structures such as model histone proteins, double stranded DNA and quadruplex DNA was investigated using mass spectrometry, Circular Dichroism spectroscopy and fluorescent assays. The selected polyphenols were shown to display affinity to all of the selected cell nuclear structures, thereby demonstrating a degree of unexpected molecular promiscuity. Most interestingly theaflavin-digallate was shown to display the highest affinity to quadruplex DNA reported for any naturally occurring molecule reported so far. This finding has immediate implications in rationalising the chemopreventive effect of the tea beverage against cancer and possibly the role of tea phenolics as "life span essentials".

  13. Mutagenic repair of double-stranded DNA breaks in vaccinia virus genomes requires cellular DNA ligase IV activity in the cytosol.

    Science.gov (United States)

    Luteijn, Rutger David; Drexler, Ingo; Smith, Geoffrey L; Lebbink, Robert Jan; Wiertz, Emmanuel J H J

    2018-04-20

    Poxviruses comprise a group of large dsDNA viruses that include members relevant to human and animal health, such as variola virus, monkeypox virus, cowpox virus and vaccinia virus (VACV). Poxviruses are remarkable for their unique replication cycle, which is restricted to the cytoplasm of infected cells. The independence from the host nucleus requires poxviruses to encode most of the enzymes involved in DNA replication, transcription and processing. Here, we use the CRISPR/Cas9 genome engineering system to induce DNA damage to VACV (strain Western Reserve) genomes. We show that targeting CRISPR/Cas9 to essential viral genes limits virus replication efficiently. Although VACV is a strictly cytoplasmic pathogen, we observed extensive viral genome editing at the target site; this is reminiscent of a non-homologous end-joining DNA repair mechanism. This pathway was not dependent on the viral DNA ligase, but critically involved the cellular DNA ligase IV. Our data show that DNA ligase IV can act outside of the nucleus to allow repair of dsDNA breaks in poxvirus genomes. This pathway might contribute to the introduction of mutations within the genome of poxviruses and may thereby promote the evolution of these viruses.

  14. Assessment of DNA double-strand breaks induced by intravascular iodinated contrast media following in vitro irradiation and in vivo, during paediatric cardiac catheterization.

    Science.gov (United States)

    Gould, Richard; McFadden, Sonyia L; Horn, Simon; Prise, Kevin M; Doyle, Philip; Hughes, Ciara M

    2016-01-01

    Paediatric cardiac catheterizations may result in the administration of substantial amounts of iodinated contrast media and ionizing radiation. The aim of this work was to investigate the effect of iodinated contrast media in combination with in vitro and in vivo X-ray radiation on lymphocyte DNA. Six concentrations of iodine (15, 17.5, 30, 35, 45, and 52.5 mg of iodine per mL blood) represented volumes of iodinated contrast media used in the clinical setting. Blood obtained from healthy volunteers was mixed with iodinated contrast media and exposed to radiation doses commonly used in paediatric cardiac catheterizations (0 mGy, 70 mGy, 140 mGy, 250 mGy and 450 mGy). Control samples contained no iodine. For in vivo experimentation, pre and post blood samples were collected from children undergoing cardiac catheterization, receiving iodine concentrations of up to 51 mg of iodine per mL blood and radiation doses of up to 400 mGy. Fluorescence microscopy was performed to assess γH2AX-foci induction, which corresponded to the number of DNA double-strand breaks. The presence of iodine in vitro resulted in significant increases of DNA double-strand breaks beyond that induced by radiation for ≥ 17.5 mg/mL iodine to blood. The in vivo effects of contrast media on children undergoing cardiac catheterization resulted in a 19% increase in DNA double-strand breaks in children receiving an average concentration of 19 mg/mL iodine to blood. A larger investigation is required to provide further information of the potential benefit of lowering the amount of iodinated contrast media received during X-ray radiation investigations. Copyright © 2015 John Wiley & Sons, Ltd.

  15. Influence of different iodinated contrast media on the induction of DNA double-strand breaks after in vitro X-ray irradiation.

    Science.gov (United States)

    Deinzer, Christoph K W; Danova, Daniela; Kleb, Beate; Klose, Klaus J; Heverhagen, Johannes T

    2014-01-01

    The objective of this work was to examine differences in DNA double-strand break induction in peripheral blood lymphocytes after in vitro X-ray irradiation between iodinated contrast agents. Four different iodinated X-ray contrast agents--three of them with two different iodine concentrations--and mannitol (negative control; concentration of 150 mg mannitol per ml blood) were pipetted into blood samples so that there was a concentration of 0, 7.5 or 15 mg of iodine per ml blood in the samples. Negative controls without contrast medium (0 mg of iodine per ml blood) were also processed for every irradiation dose. The tubes were exposed to 0, 20 or 500 mGy in vitro X-ray irradiation. After that, the lymphocytes were separated by using density-gradient centrifugation. Fluorescence microscopy was applied to determine the average number of γH2AX-foci per lymphocyte in the presence or absence of different contrast media or mannitol. Differences in the number of γH2AX-foci were statistically analysed by one-way ANOVA and post-hoc Tukey's honestly significant difference test. Iodinated contrast agents led to a statistically significant increase in DNA double-strand breaks after in vitro irradiation. This effect increased statistically significant with rising radiation dose and appeared independent of the contrast agent used (iopromid, iodixanol, iomeprol, iopamidol). A statistically significant difference in DNA damage between the different tested contrast agents was not found. Therefore, the increase in DNA double-strand breaks depends solely on the amount of iodine applied. For evaluation of clinical consequences, our findings could be tested in further animal studies. Copyright © 2014 John Wiley & Sons, Ltd.

  16. Rapid MCNP simulation of DNA double strand break (DSB) relative biological effectiveness (RBE) for photons, neutrons, and light ions.

    Science.gov (United States)

    Stewart, Robert D; Streitmatter, Seth W; Argento, David C; Kirkby, Charles; Goorley, John T; Moffitt, Greg; Jevremovic, Tatjana; Sandison, George A

    2015-11-07

    To account for particle interactions in the extracellular (physical) environment, information from the cell-level Monte Carlo damage simulation (MCDS) for DNA double strand break (DSB) induction has been integrated into the general purpose Monte Carlo N-particle (MCNP) radiation transport code system. The effort to integrate these models is motivated by the need for a computationally efficient model to accurately predict particle relative biological effectiveness (RBE) in cell cultures and in vivo. To illustrate the approach and highlight the impact of the larger scale physical environment (e.g. establishing charged particle equilibrium), we examined the RBE for DSB induction (RBEDSB) of x-rays, (137)Cs γ-rays, neutrons and light ions relative to γ-rays from (60)Co in monolayer cell cultures at various depths in water. Under normoxic conditions, we found that (137)Cs γ-rays are about 1.7% more effective at creating DSB than γ-rays from (60)Co (RBEDSB  =  1.017) whereas 60-250 kV x-rays are 1.1 to 1.25 times more efficient at creating DSB than (60)Co. Under anoxic conditions, kV x-rays may have an RBEDSB up to 1.51 times as large as (60)Co γ-rays. Fission neutrons passing through monolayer cell cultures have an RBEDSB that ranges from 2.6 to 3.0 in normoxic cells, but may be as large as 9.93 for anoxic cells. For proton pencil beams, Monte Carlo simulations suggest an RBEDSB of about 1.2 at the tip of the Bragg peak and up to 1.6 a few mm beyond the Bragg peak. Bragg peak RBEDSB increases with decreasing oxygen concentration, which may create opportunities to apply proton dose painting to help address tumor hypoxia. Modeling of the particle RBE for DSB induction across multiple physical and biological scales has the potential to aid in the interpretation of laboratory experiments and provide useful information to advance the safety and effectiveness of hadron therapy in the treatment of cancer.

  17. Ultraviolet light induces double-strand breaks in DNA of cultured human P3 cells as measured by neutral filter elution

    International Nuclear Information System (INIS)

    Peak, J.G.; Peak, M.J.

    1990-01-01

    Neutral filter elution at pH 7.2 and 9.6 was used to measure the induction of DNA lesions in human P3 teratocarcinoma cells by monochromatic 254-, 270-, 313-, 334-, 334-,365-, and 405-nm radiation and by 60 gamma rays. In this assay DNA double-strand breaks (dsb) increase the rate of elution of DNA from cell lysates on a filter. Yields of dsb as measured by this procedure were determined by using a calibration of the assay that correlates elution parameters with number of dsb caused by disintegration of 125 I incorporated into the DNA. Analysis of fluence responses obtained by using the calibrated assay indicated that the number of dsb induced per dalton of DNA as measured by this assay is proportional to the square of the fluence at all the energies of radiation studied, implying that the induction of these lesions may be a two-hit event. Analysis of the relative efficiencies for the induction of dsb by ultraviolet radiation, corrected for quantum efficiency, revealed a spectrum that coincided closely with that for the induction of single-strand breaks (ssb) in the same cells, having a close fit with the spectrum of nucleic acid in the UVC and UVB region below 313 nm, and a shoulder in the UVA region. It was calculated, however, that there may be too few ssb for dsb to result from randomly distributed closely opposed ssb. (author)

  18. Fine-tuning alkyne cycloadditions: Insights into photochemistry responsible for the double-strand DNA cleavage via structural perturbations in diaryl alkyne conjugates

    Directory of Open Access Journals (Sweden)

    Igor V. Alabugin

    2011-06-01

    Full Text Available Hybrid molecules combining photoactivated aryl acetylenes and a dicationic lysine moiety cause the most efficient double-strand (ds DNA cleavage known to date for a small molecule. In order to test the connection between the alkylating ability and the DNA-damaging properties of these compounds, we investigated the photoreactivity of three isomeric aryl–tetrafluoropyridinyl (TFP alkynes with amide substituents in different positions (o-, m-, and p- toward a model π-system. Reactions with 1,4-cyclohexadiene (1,4-CHD were used to probe the alkylating properties of the triplet excited states in these three isomers whilst Stern–Volmer quenching experiments were used to investigate the kinetics of photoinduced electron transfer (PET. The three analogous isomeric lysine conjugates cleaved DNA with different efficiencies (34, 15, and 0% of ds DNA cleavage for p-, m-, and o-substituted lysine conjugates, respectively consistent with the alkylating ability of the respective acetamides. The significant protecting effect of the hydroxyl radical and singlet oxygen scavengers to DNA cleavage was shown only with m-lysine conjugate. All three isomeric lysine conjugates inhibited human melanoma cell growth under photoactivation: The p-conjugate had the lowest CC50 (50% cell cytotoxicity value of 1.49 × 10−7 M.

  19. Repair kinetics of DNA double-strand breaks and incidence of apoptosis in mouse neural stem/progenitor cells and their differentiated neurons exposed to ionizing radiation.

    Science.gov (United States)

    Kashiwagi, Hiroki; Shiraishi, Kazunori; Sakaguchi, Kenta; Nakahama, Tomoya; Kodama, Seiji

    2018-05-01

    Neuronal loss leads to neurodegenerative disorders, including Alzheimer's disease, Parkinson's disease and Huntington's disease. Because of their long lifespans, neurons are assumed to possess highly efficient DNA repair ability and to be able to protect themselves from deleterious DNA damage such as DNA double-strand breaks (DSBs) produced by intrinsic and extrinsic sources. However, it remains largely unknown whether the DSB repair ability of neurons is more efficient compared with that of other cells. Here, we investigated the repair kinetics of X-ray-induced DSBs in mouse neural cells by scoring the number of phosphorylated 53BP1 foci post irradiation. We found that p53-independent apoptosis was induced time dependently during differentiation from neural stem/progenitor cells (NSPCs) into neurons in culture for 48 h. DSB repair in neurons differentiated from NSPCs in culture was faster than that in mouse embryonic fibroblasts (MEFs), possibly due to the higher DNA-dependent protein kinase activity, but it was similar to that in NSPCs. Further, the incidence of p53-dependent apoptosis induced by X-irradiation in neurons was significantly higher than that in NSPCs. This difference in response of X-ray-induced apoptosis between neurons and NSPCs may reflect a difference in the fidelity of non-homologous end joining or a differential sensitivity to DNA damage other than DSBs.

  20. Resistance to bleomycin in cancer cell lines is characterized by prolonged