Cavazzana, Ilaria; Fredi, Micaela; Ceribelli, Angela; Mordenti, Cristina; Ferrari, Fabio; Carabellese, Nice; Tincani, Angela; Satoh, Minoru; Franceschini, Franco
2016-06-01
To analyze the performance of a line blot assay for the identification of autoantibodies in sera of patients affected by myositis, compared with immunoprecipitation (IP) as gold standard. 66 sera of patients with myositis (23 polymyositis, 8 anti-synthetase syndromes, 29 dermatomyositis and 6 overlap syndromes) were tested by commercial LB (Euroimmun, Lubeck, Germany); 57 sera were analyzed also by IP of K562 cell extract radiolabeled with (35)S-methionine. Inter-rater agreement was calculated with Cohen's k coefficient. Myositis-specific antibodies (MSA) were detected in 36/57 sera (63%) by IP and in 39/66 sera (59%) by LB. The most frequent MSA found by LB were anti-Jo1 and anti-Mi2 found in 15% (10/66) of sera, followed by anti-NXP2 and anti-SRP detected in 106% (7/66) of sera. Anti-TIF1gamma and anti-MDA5 were found in 6 (9%) and 5 sera (7.6%), respectively. A good agreement between methods was found only for anti-TIF1γ, anti-MDA5 and anti-NXP-2 antibodies, while a moderate agreement was estimated for anti-Mi2 and anti-EJ. By contrast, a high discordance rate for the detection of anti-Jo1 antibodies was evident (k: 0.3). Multiple positivity for MSA were found in 11/66 (17%) by LB and 0/57 by IP (p: 0001). Comparing the clinical features of these 11 sera, we found total discrepancies between assays in 3 sera (27.3%), a relative discrepancy due to the occurrence of one discordant autoantibody (not confirmed by IP) in 5 cases (45.5%) and a total discrepancy between LB and IP results, but with a relative concordance with clinical features were found in other 3 sera (27.3%). The semiquantitative results do not support the interpretation of the data. The use of LB assay allowed the detection of new MSA, such as anti-MDA5, anti-MJ and anti-TIF1gamma antibodies, previously not found with routine methods. However, the high prevalence of multiple positivities and the high discondant rate of anti-Jo1 antibodies could create some misinterpretation of the results from the
Chandrangsu, Matt; Burbelo, Peter D.; Iadarola, Michael J.; Smith, Paul D.; Morgan, Nicole Y.
2012-06-01
There is considerable interest in the development of rapid, point-of-care antibody detection for the diagnosis of infectious and auto-immune diseases. In this paper, we present work on the development of a self-contained microfluidic format for the Luciferase Immunoprecipitation Systems (LIPS) assay. Whereas the majority of immunoassays for antigen-specific antibodies employ either bacteria- or yeast-expressed proteins and require the use of secondary antibodies, the LIPS technique uses a fusion protein comprised of a Renilla luciferase reporter and the antigen of interest produced via mammalian cell culture, ensuring the addition of mammalian post-translational modifications. Patient serum is mixed with the fusion protein and passed over immobilized Protein A/G; after washing, the only remaining luciferase-tagged antigens are those retained by specific antibodies. These can be quantitatively measured using chemiluminescence upon the introduction of coelenterazine. The assay has been successfully employed for a wide variety of diseases in a microwell format. We report on a recent demonstration of rapid HSV-2 diagnosis with the LIPS assay in a microfluidic format, using one microliter of serum and obtaining results in under ten minutes. We will also discuss recent progress on two fronts, both aimed at the deployment of this technology in the field: first, simplifying assay operation through the automation of flow control using power-free means; and second, efforts to increase signal levels, primarily through strategies to increase antibody binding capacity, in order to move towards portable battery powered electronics.
Burlibașa, Liliana; Suciu, Ilinca
2015-12-01
Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.
Komar, Dorota N.; Mouriz, Alfonso; Jarillo, José A.; Piñeiro, Manuel
2016-01-01
Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a proced...
Komar, Dorota N; Mouriz, Alfonso; Jarillo, José A; Piñeiro, Manuel
2016-01-14
Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a procedure to identify the DNA-binding sites of proteins in genes or genomic regions of the model species Arabidopsis thaliana. The interactions with DNA of proteins of interest such as transcription factors, chromatin proteins or posttranslationally modified versions of histones can be efficiently analyzed with the ChIP protocol. This method is based on the fixation of protein-DNA interactions in vivo, random fragmentation of chromatin, immunoprecipitation of protein-DNA complexes with specific antibodies, and quantification of the DNA associated with the protein of interest by PCR techniques. The use of this methodology in Arabidopsis has contributed significantly to unveil transcriptional regulatory mechanisms that control a variety of plant biological processes. This approach allowed the identification of the binding sites of the Arabidopsis chromatin protein EBS to regulatory regions of the master gene of flowering FT. The impact of this protein in the accumulation of particular histone marks in the genomic region of FT was also revealed through ChIP analysis.
Rogge, George A; Shen, Li-Ling; Kuhar, Michael J
2010-07-16
Both over expression of cyclic AMP response element binding protein (CREB) in the nucleus accumbens (NAc), and intra-accumbal injection of cocaine- and amphetamine-regulated transcript (CART) peptides, have been shown to decrease cocaine reward. Also, over expression of CREB in the rat NAc increased CART mRNA and peptide levels, but it is not known if this was due to a direct action of P-CREB on the CART gene promoter. The goal of this study was to test if CREB and P-CREB bound directly to the CRE site in the CART promoter, using chromatin immunoprecipitation (ChIP) assays. ChIP assay with anti-CREB antibodies showed an enrichment of the CART promoter fragment containing the CRE region over IgG precipitated material, a non-specific control. Forskolin, which was known to increase CART mRNA levels in GH3 cells, was utilized to show that the drug increased levels of P-CREB protein and P-CREB binding to the CART promoter CRE-containing region. A region of the c-Fos promoter containing a CRE cis-regulatory element was previously shown to bind P-CREB, and it was used here as a positive control. These data suggest that the effects of CREB over expression on blunting cocaine reward could be, at least in part, attributed to the increased expression of the CART gene by direct interaction of P-CREB with the CART promoter CRE site, rather than by some indirect action. Copyright (c) 2010 Elsevier B.V. All rights reserved.
A new scintillation proximity assay-based approach for the detection of KRAS mutations
Energy Technology Data Exchange (ETDEWEB)
Lee, So-Young; Lim, Jae-Cheong; Cho, Eun-Ha; Jung, Sung-Hee [Korea Atomic Energy Research Institute (KAERI), Daejeon (Korea, Republic of). Radioisotope Research Div.
2016-04-01
KRAS is very commonly mutated resulting in a constitutively activated protein, which is independent of epidermal growth factor receptor (EGFR) ligand binding and resistant to anti-EGFR therapy. Although KRAS is frequently studied, there is still no uniform standard for detecting of KRAS mutations. In this report, a new scintillation proximity assay-based approach is described that determines the relative affinities of wild-type and mutated KRAS to the anti-KRAS antibody. We performed in vitro experiments using normal human colonic cells (CCD18Co), KRAS wild type (Caco-2) and KRAS mutant (HCT 116) cell lines to determine the relative affinities of wild type or mutated KRAS toward an anti-KRAS monoclonal antibody. The process consists of two primary steps: immunoprecipitation from cell lysate to enrich the KRAS protein and the scintillation proximity assay of the immunoprecipitant to determine the relative affinity against the antibody. A fixed concentration of cell lysates was purified by the immunoprecipitation method. The expressions of the KRAS protein in all cell lines was quantitatively confirmed by western blot analysis. For the scintillation proximity assay, the KRAS standard protein was radiolabeled with {sup 125}I by a simple mixing process in the iodogen tube immediately at room temperature immediately before use. The obtained CPM (count per minute) values of were used to calculate the KRAS concentration using purified KRAS as the standard. The calculated relative affinities of 7 μg of Caco-2 and HCT 116 immunoprecipitants for the anti-KRAS antibody were 77 and 0%, respectively. The newly developed scintillation proximity assay-based strategy determines the relative affinities of wild-type or mutated KRAS towards the anti-KRAS monoclonal antibody. This determination can help distinguish mutated KRAS from the wild type protein. The new SPA based approach for detecting KRAS mutations is applicable to many other cancer-related mutations.
A new scintillation proximity assay-based approach for the detection of KRAS mutations
International Nuclear Information System (INIS)
Lee, So-Young; Lim, Jae-Cheong; Cho, Eun-Ha; Jung, Sung-Hee
2016-01-01
KRAS is very commonly mutated resulting in a constitutively activated protein, which is independent of epidermal growth factor receptor (EGFR) ligand binding and resistant to anti-EGFR therapy. Although KRAS is frequently studied, there is still no uniform standard for detecting of KRAS mutations. In this report, a new scintillation proximity assay-based approach is described that determines the relative affinities of wild-type and mutated KRAS to the anti-KRAS antibody. We performed in vitro experiments using normal human colonic cells (CCD18Co), KRAS wild type (Caco-2) and KRAS mutant (HCT 116) cell lines to determine the relative affinities of wild type or mutated KRAS toward an anti-KRAS monoclonal antibody. The process consists of two primary steps: immunoprecipitation from cell lysate to enrich the KRAS protein and the scintillation proximity assay of the immunoprecipitant to determine the relative affinity against the antibody. A fixed concentration of cell lysates was purified by the immunoprecipitation method. The expressions of the KRAS protein in all cell lines was quantitatively confirmed by western blot analysis. For the scintillation proximity assay, the KRAS standard protein was radiolabeled with 125 I by a simple mixing process in the iodogen tube immediately at room temperature immediately before use. The obtained CPM (count per minute) values of were used to calculate the KRAS concentration using purified KRAS as the standard. The calculated relative affinities of 7 μg of Caco-2 and HCT 116 immunoprecipitants for the anti-KRAS antibody were 77 and 0%, respectively. The newly developed scintillation proximity assay-based strategy determines the relative affinities of wild-type or mutated KRAS towards the anti-KRAS monoclonal antibody. This determination can help distinguish mutated KRAS from the wild type protein. The new SPA based approach for detecting KRAS mutations is applicable to many other cancer-related mutations.
Gelpí, Carmen; Pérez, Elena; Roldan, Cristina
2014-09-01
The aim of this study was to compare the degree of agreement of a novel Zenit RA chemiluminescent immunoassay (CLIA) from A. Menarini Diagnostics (Florence, Italy) and the gold standard immunoprecipitation assay to screen for the presence of specific anti-U1snRNP, anti-Sm, anti-Ro/SS-A, anti-La/SS-B, anti-Jo-1((his)tRNA-Synthetase) and anti-Scl-70(Topo I) antibodies. We studied 114 sera, 98 from patients with well-defined autoimmune connective tissue diseases and 16 from blood donor volunteers. All samples were fully characterized using the new chemiluminescent immunoassay and immunoprecipitation. In addition, all the samples were analyzed by indirect immunofluorescence (IIF) and anti-Scl-70(Topo I) antibodies were analyzed by immunoblot (IB) assay. Discrepant samples were analyzed using a commercial dot blot technique (Recomline from Mikrogen). The simple Kappa coefficient was used to measure the level of agreement between the results of Zenit RA CLIA and the gold standard. The Kappa agreement between Zenit RA CLIA and gold standard immunoprecipitation, as well as IB and IIFassays for the presence of anti-Scl-70(Topo I)(0.948) was excellent. The concordance between Zenit RA CLIA and gold standard immunoprecipitation for the presence of anti-U1snRNP (0.883), anti-Ro/SS-A (0.878), anti-Jo-1((his)tRNA-Synthetase) (0.791) and anti-Sm (0.786) was good, and excellent when the cut-off was raised to 14 U/ml (arbitrary units/ml). Between Zenit RA CLIA and gold standard immunoprecipitation for the presence of anti-La/SS-B, the Kappa agreement had a value of 0.689, but this improved to 0.775 when the cut-off was raised to14 U/ml. Precision was good based on the evaluation of replicate samples. Inter-assay coefficient variation was lower than 3.4 % (CV in %) in all the kits and <1.2 % (CV in %) for intra-assay measurements. Our findings show that Zenit RA CLIA was specific and sensitive to detect anti-U1snRNP, anti-Sm, anti-Ro/SS-A, anti-La/SS-B, anti-Jo-1((his
International Nuclear Information System (INIS)
Railo, Antti; Pajunen, Antti; Itaeranta, Petri; Naillat, Florence; Vuoristo, Jussi; Kilpelaeinen, Pekka; Vainio, Seppo
2009-01-01
Wnt proteins are important regulators of embryonic development, and dysregulated Wnt signalling is involved in the oncogenesis of several human cancers. Our knowledge of the downstream target genes is limited, however. We used a chromatin immunoprecipitation-based assay to isolate and characterize the actual gene segments through which Wnt-activatable transcription factors, TCFs, regulate transcription and an Affymetrix microarray analysis to study the global transcriptional response to the Wnt3a ligand. The anti-β-catenin immunoprecipitation of DNA-protein complexes from mouse NIH3T3 fibroblasts expressing a fusion protein of β-catenin and TCF7 resulted in the identification of 92 genes as putative TCF targets. GeneChip assays of gene expression performed on NIH3T3 cells and the rat pheochromocytoma cell line PC12 revealed 355 genes in NIH3T3 and 129 genes in the PC12 cells with marked changes in expression after Wnt3a stimulus. Only 2 Wnt-regulated genes were shared by both cell lines. Surprisingly, Disabled-2 was the only gene identified by the chromatin immunoprecipitation approach that displayed a marked change in expression in the GeneChip assay. Taken together, our approaches give an insight into the complex context-dependent nature of Wnt pathway transcriptional responses and identify Disabled-2 as a potential new direct target for Wnt signalling.
Werfel, Stanislas; Leierseder, Simon; Ruprecht, Benjamin; Kuster, Bernhard; Engelhardt, Stefan
2017-09-29
MicroRNAs (miRNAs) have been described to simultaneously inhibit hundreds of targets, albeit to a modest extent. It was recently proposed that there could exist more specific, exceptionally strong binding to a subgroup of targets. However, it is unknown, whether this is the case and how such targets can be identified. Using Argonaute2-ribonucleoprotein immunoprecipitation and in vivo competitive binding assays, we demonstrate for miRNAs-21, -199-3p and let-7 exceptional regulation of a subset of targets, which are characterized by preferential miRNA binding. We confirm this finding by analysis of independent quantitative proteome and transcriptome datasets obtained after miRNA silencing. Our data suggest that mammalian miRNA activity is guided by preferential binding of a small set of 3'-untranslated regions, thereby shaping a steep gradient of regulation between potential targets. Our approach can be applied for transcriptome-wide identification of such targets independently of the presence of seed complementary sequences or other predictors. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Immunoprecipitation of Tri-methylated Capped RNA.
Hayes, Karen E; Barr, Jamie A; Xie, Mingyi; Steitz, Joan A; Martinez, Ivan
2018-02-05
Cellular quiescence (also known as G 0 arrest) is characterized by reduced DNA replication, increased autophagy, and increased expression of cyclin-dependent kinase p27 Kip1 . Quiescence is essential for wound healing, organ regeneration, and preventing neoplasia. Previous findings indicate that microRNAs (miRNAs) play an important role in regulating cellular quiescence. Our recent publication demonstrated the existence of an alternative miRNA biogenesis pathway in primary human foreskin fibroblast (HFF) cells during quiescence. Indeed, we have identified a group of pri-miRNAs (whose mature miRNAs were found induced during quiescence) modified with a 2,2,7-trimethylguanosine (TMG)-cap by the trimethylguanosine synthase 1 (TGS1) protein and transported to the cytoplasm by the Exportin-1 (XPO1) protein. We used an antibody against (TMG)-caps (which does not cross-react with the (m 7 G)-caps that most pri-miRNAs or mRNAs contain [Luhrmann et al ., 1982]) to perform RNA immunoprecipitations from total RNA extracts of proliferating or quiescent HFFs. The novelty of this assay is the specific isolation of pri-miRNAs as well as other non-coding RNAs containing a TMG-cap modification.
LENUS (Irish Health Repository)
O'Callaghan, Isabelle
2010-05-01
To improve the detection of Neisseria gonorrhoeae by designing a multiplex PCR assay using two N gonorrhoeae-specific genes as targets, thereby providing detection and confirmation of a positive result simultaneously.
Ho, Mei M; Kairo, Satnam K; Corbel, Michael J
2006-01-01
Tuberculin purified protein derivative (PPD) currently can only be standardised by delayed hypersensitivity skin reactions in sensitised guinea pigs. An in vitro dot blot immunoassay was developed for both identity and confirmation of potency estimation of PPD. Polyclonal antibodies (mainly IgG) were generated and immunoreacted with human, bovine and, to lesser extent, avian PPD preparations. Combining size exclusion chromatography (FPLC-SEC) and dot blot immunoassay, the results showed that PPD preparations were mixtures of very heterogeneous tuberculoproteins ranging in size from very large aggregates to very small degraded molecules. All individual fractions of PPD separated by size were immunoreactive, although those of the largest molecular sizes appeared the most immunoreactive in this in vitro dot blot immunoassay. This method is very sensitive and specific to tuberculoproteins and can be an in vitro alternative for the in vivo intradermal skin assay which uses guinea pigs for identity of PPD preparations. Although the capacity of PPD to elicit cell-mediated immune responses on intradermal testing has to be confirmed by in vivo assay, the dot blot immunoassay offers a rapid, sensitive and animal-free alternative to in vivo testing for confirming the identity of PPD preparations with appropriate potencies. This alternative assay would be particularly useful for national regulatory laboratories for confirming the data of manufacturers and thus reducing the use of animals.
Abu Samra, Dina Bashir Kamil; Al Kilani, Alia; Hamdan, Samir; Sakashita, Kosuke; Gadhoum, Samah Z.; Merzaban, Jasmeen
2015-01-01
Selectins (E-, P-, and L-selectins) interact with glycoprotein ligands to mediate the essential tethering/rolling step in cell transport and delivery that captures migrating cells from the circulating flow. In this work, we developed a real time immunoprecipitation assay on a surface plasmon resonance chip that captures native glycoforms of two well known E-selectin ligands (CD44/hematopoietic cell E-/L-selectin ligand and P-selectin glycoprotein ligand-1) from hematopoietic cell extracts. Here we present a comprehensive characterization of their binding to E-selectin. We show that both ligands bind recombinant monomeric E-selectin transiently with fast on- and fast off-rates, whereas they bind dimeric E-selectin with remarkably slow onand off-rates. This binding requires the sialyl Lewis x sugar moiety to be placed on both O- and N-glycans, and its association, but not dissociation, is sensitive to the salt concentration. Our results suggest a mechanism through which monomeric selectins mediate initial fast on and fast off kinetics to help capture cells out of the circulating shear flow; subsequently, tight binding by dimeric/oligomeric selectins is enabled to significantly slow rolling. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Abu Samra, Dina Bashir Kamil
2015-06-29
Selectins (E-, P-, and L-selectins) interact with glycoprotein ligands to mediate the essential tethering/rolling step in cell transport and delivery that captures migrating cells from the circulating flow. In this work, we developed a real time immunoprecipitation assay on a surface plasmon resonance chip that captures native glycoforms of two well known E-selectin ligands (CD44/hematopoietic cell E-/L-selectin ligand and P-selectin glycoprotein ligand-1) from hematopoietic cell extracts. Here we present a comprehensive characterization of their binding to E-selectin. We show that both ligands bind recombinant monomeric E-selectin transiently with fast on- and fast off-rates, whereas they bind dimeric E-selectin with remarkably slow onand off-rates. This binding requires the sialyl Lewis x sugar moiety to be placed on both O- and N-glycans, and its association, but not dissociation, is sensitive to the salt concentration. Our results suggest a mechanism through which monomeric selectins mediate initial fast on and fast off kinetics to help capture cells out of the circulating shear flow; subsequently, tight binding by dimeric/oligomeric selectins is enabled to significantly slow rolling. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
A Bayesian deconvolution strategy for immunoprecipitation-based DNA methylome analysis
Down, Thomas A.; Rakyan, Vardhman K.; Turner, Daniel J.; Flicek, Paul; Li, Heng; Kulesha, Eugene; Gräf, Stefan; Johnson, Nathan; Herrero, Javier; Tomazou, Eleni M.; Thorne, Natalie P.; Bäckdahl, Liselotte; Herberth, Marlis; Howe, Kevin L.; Jackson, David K.; Miretti, Marcos M.; Marioni, John C.; Birney, Ewan; Hubbard, Tim J. P.; Durbin, Richard; Tavaré, Simon; Beck, Stephan
2009-01-01
DNA methylation is an indispensible epigenetic modification of mammalian genomes. Consequently there is great interest in strategies for genome-wide/whole-genome DNA methylation analysis, and immunoprecipitation-based methods have proven to be a powerful option. Such methods are rapidly shifting the bottleneck from data generation to data analysis, necessitating the development of better analytical tools. Until now, a major analytical difficulty associated with immunoprecipitation-based DNA methylation profiling has been the inability to estimate absolute methylation levels. Here we report the development of a novel cross-platform algorithm – Bayesian Tool for Methylation Analysis (Batman) – for analyzing Methylated DNA Immunoprecipitation (MeDIP) profiles generated using arrays (MeDIP-chip) or next-generation sequencing (MeDIP-seq). The latter is an approach we have developed to elucidate the first high-resolution whole-genome DNA methylation profile (DNA methylome) of any mammalian genome. MeDIP-seq/MeDIP-chip combined with Batman represent robust, quantitative, and cost-effective functional genomic strategies for elucidating the function of DNA methylation. PMID:18612301
Directory of Open Access Journals (Sweden)
Ran Nakashima
Full Text Available OBJECTIVE: Autoantibodies to aminoacyl-tRNA synthetases (ARSs are useful in the diagnosis of idiopathic inflammatory myopathy (IIM with interstitial pneumonia (IP. We developed an enzyme-linked immunosorbent assay (ELISA system using a mixture of recombinant ARS antigens and tested its utility in a multicenter study. METHODS: We prepared six recombinant ARSs: GST-Jo-1, His-PL-12, His-EJ and GST-KS expressed in Escherichia coli, and His-PL-7 and His-OJ expressed in Hi-5 cells. After confirming their antigenic activity, with the exception of His-OJ, we developed our ELISA system in which the five recombinant ARSs (without His-OJ were mixed. Efficiency was confirmed using the sera from 526 Japanese patients with connective tissue disease (CTD (IIM n = 250, systemic lupus erythematosus n = 91, systemic sclerosis n = 70, rheumatoid arthritis n = 75, Sjögren's syndrome n = 27 and other diseases n = 13, 168 with idiopathic interstitial pneumonia (IIP and 30 healthy controls collected from eight institutes. IIPs were classified into two groups; idiopathic pulmonary fibrosis (IPF (n = 38 and non-IPF (n = 130. RESULTS were compared with those of RNA immunoprecipitation. RESULTS: Sensitivity and specificity of the ELISA were 97.1% and 99.8%, respectively when compared with the RNA immunoprecipitation assay. Anti-ARS antibodies were detected in 30.8% of IIM, 2.5% of non-myositis CTD, and 10.7% of IIP (5.3% of IPF and 12.3% of non-IPF. Anti-ARS-positive non-IPF patients were younger and more frequently treated with glucocorticoids and/or immunosuppressants than anti-ARS-negative patients. CONCLUSION: A newly established ELISA detected anti-ARS antibodies as efficiently as RNA immunoprecipitation. This system will enable easier and wider use in the detection of anti-ARS antibodies in patients with IIM and IIP.
International Nuclear Information System (INIS)
Hapugoda, D.M.; De Silva R, Nilanthi; Abeywickreme, W.; Gunasena, Sunethra; Prithimala, L.D.; Jayawardene, S.L.G.J.; Kumari, Thamara
2003-01-01
Laboratory diagnosis of dengue infection is important for the management of the patients. In this study igM capture ELISA using an inhouse method and commercially available kit (MRL diagnostics,USA) was compared to detect diagnostic capability of Inhouse IgM ELISA for provision of diagnostic facilities to the public at an affordable cost. Eighty acute and convalescent serum samples were collected from serologically confirmed dengue patients. Serological confirmation of patients were performed by Haemagglutination Inhibition (HI) assay, gold standard assay for dengue on paired serum samples. All collected acute and convalescent sera were tested by IgM ELISA using the inhouse method and MRL kit. Antigen and conjugate for the inhouse IgM method were prepared in the laboratory. A cocktail of four dengue antigens containing 25 Antigen ELISA units of each type was prepared and used as the assay antigen. Conjugate was prepared using a serum sample with high dengue Anti flavi IgG antibody titre conjugated with Horseradish peroxidase. A prospective study of both IgM ELISA assays were performed using 113 acute sera collected from dengue suspected cases. Overall results showed that 46% and 52% acute sera collected from dengue confirmed patients were positive by inhouse ELISA assay and MRL kits respectively. In the prospective study done using acute sera collected from dengue suspected patients showed that 44% and 52% were positive by inhouse ELISA assay and MRL kits. There was no significant difference in positivity between these two assays. (P=0.18). Inhouse IgM ELISA can be used for provision of laboratory diagnosis of dengue virus infection more than 5 days. The assay is 10 times less costly than using MRL kits as assay antigen and conjugate can be prepared easily in the laboratory
Methylated DNA Immunoprecipitation Analysis of Mammalian Endogenous Retroviruses.
Rebollo, Rita; Mager, Dixie L
2016-01-01
Endogenous retroviruses are repetitive sequences found abundantly in mammalian genomes which are capable of modulating host gene expression. Nevertheless, most endogenous retrovirus copies are under tight epigenetic control via histone-repressive modifications and DNA methylation. Here we describe a common method used in our laboratory to detect, quantify, and compare mammalian endogenous retrovirus DNA methylation. More specifically we describe methylated DNA immunoprecipitation (MeDIP) followed by quantitative PCR.
Optimal use of tandem biotin and V5 tags in ChIP assays
K.E. Kolodziej (Katarzyna); F. Pourfarzad, F. (Farzin); E. de Boer (Ernie); S. Krpic (Sanja); F.G. Grosveld (Frank); J. Strouboulis (John)
2009-01-01
textabstractBackground: Chromatin immunoprecipitation (ChIP) assays coupled to genome arrays (Chip-on-chip) or massive parallel sequencing (ChIP-seq) lead to the genome wide identification of binding sites of chromatin associated proteins. However, the highly variable quality of antibodies and the
Odagaki, Yuji; Kinoshita, Masakazu; Ota, Toshio; Meana, J Javier; Callado, Luis F; Matsuoka, Isao; García-Sevilla, Jesús A
2018-06-01
Adenosine signaling plays a complex role in multiple physiological processes in the brain, and its dysfunction has been implicated in pathophysiology of neuropsychiatric diseases such as schizophrenia and affective disorders. In the present study, the coupling between adenosine A 1 receptor and G-protein was assessed by means of two [ 35 S]GTPγS binding assays, i.e., conventional filtration method and [ 35 S]GTPγS binding/immunoprecipitation in rat and human brain membranes. The latter method provides information about adenosine A 1 receptor-mediated Gα i-3 activation in rat as well as human brain membranes. On the other hand, adenosine-stimulated [ 35 S]GTPγS binding determined with conventional assay derives from functional activation of Gα i/o proteins (not restricted only to Gα i-3 ) coupled to adenosine A 1 receptors. The determination of adenosine concentrations in the samples used in the present study indicates the possibility that the assay mixture under our experimental conditions contains residual endogenous adenosine at nanomolar concentrations, which was also suggested by the results on the effects of adenosine receptor antagonists on basal [ 35 S]GTPγS binding level. The effects of adenosine deaminase (ADA) on basal binding also support the presence of adenosine. Nevertheless, the varied patterns of ADA discouraged us from adding ADA into assay medium routinely. The concentration-dependent increases elicited by adenosine were determined in 40 subjects without any neuropsychiatric disorders. The increases in %E max values determined by conventional assay according to aging and postmortem delay should be taken into account in future studies focusing on the effects of psychiatric disorders on adenosine A 1 receptor/G-protein interaction in postmortem human brain tissue.
Ozeki, Itaru; Nakajima, Tomoaki; Suii, Hirokazu; Tatsumi, Ryoji; Yamaguchi, Masakatsu; Kimura, Mutsuumi; Arakawa, Tomohiro; Kuwata, Yasuaki; Ohmura, Takumi; Hige, Shuhei; Karino, Yoshiyasu; Toyota, Joji
2018-02-01
We investigated the utility of high-sensitivity hepatitis B surface antigen (HBsAg) assays compared with conventional HBsAg assays. Using serum samples from 114 hepatitis B virus (HBV) carriers in whom HBsAg seroclearance was confirmed by conventional HBsAg assays (cut-off value, 0.05 IU/mL), the amount of HBsAg was re-examined by high-sensitivity HBsAg assays (cut-off value, 0.005 IU/mL). Cases negative for HBsAg in both assays were defined as consistent cases, and cases positive for HBsAg in the high-sensitivity HBsAg assay only were defined as discrepant cases. There were 55 (48.2%) discrepant cases, and the range of HBsAg titers determined by high-sensitivity HBsAg assays was 0.005-0.056 IU/mL. Multivariate analysis showed that the presence of nucleos(t)ide analog therapy, liver cirrhosis, and negative anti-HBs contributed to the discrepancies between the two assays. Cumulative anti-HBs positivity rates among discrepant cases were 12.7%, 17.2%, 38.8%, and 43.9% at baseline, 1 year, 3 years, and 5 years, respectively, whereas the corresponding rates among consistent cases were 50.8%, 56.0%, 61.7%, and 68.0%, respectively. Hepatitis B virus DNA negativity rates were 56.4% and 81.4% at baseline, 51.3% and 83.3% at 1 year, and 36.8% and 95.7% at 3 years, among discrepant and consistent cases, respectively. Hepatitis B surface antigen reversion was observed only in discrepant cases. Re-examination by high-sensitivity HBsAg assays revealed that HBsAg was positive in approximately 50% of cases. Cumulative anti-HBs seroconversion rates and HBV-DNA seroclearance rates were lower in these cases, suggesting a population at risk for HBsAg reversion. © 2017 The Japan Society of Hepatology.
LENUS (Irish Health Repository)
Walsh, A
2011-04-01
Culture for detection of Neisseria gonorrhoeae (NG) is being replaced by molecular assays, but difficulties are observed with false positive and negatives results, especially for extragenital samples. This study evaluates the Abbott CT\\/NG Real-Time assay and a real-time porA pseudogene assay. Samples (n = 600) from a mixed prevalence Irish population include 164 male urines with corresponding urethral swabs, 58 endocervical swabs, 173 male pharyngeal swabs, 205 male rectal swabs, 36 NG clinical isolates and 26 commensal Neisseria species isolates. There was a 100% concordance between the Abbott CT\\/NG Real-Time and the porA assay. The positivity rate was 1.2%, 1.7%, 8.1% and 5.8% for FVU\\/urethral swabs, endocervical, pharyngeal and rectal swabs, respectively. These results were compared to culture and discrepancies were found with nine pharyngeal and three rectal swabs. Seven of the 12 discrepant positive samples were sequenced and were confirmed "true positives". The sensitivity and specificity of the molecular assays was 100%. The sensitivity of the culture-based testing was 100% for urogenital samples but 36% and 75% for pharyngeal and rectal swabs, respectively. The combined Abbott CT\\/NG and porA assays provide a valuable alternative to culture and also generate a significant increase in the diagnosis of pharyngeal and rectal NG infection.
DEFF Research Database (Denmark)
Borch-Jensen, Jonas; Roepstorff, Peter; Møller-Jensen, Jakob
2011-01-01
enterotoxigenic Escherischia coli, GM1-nanodiscs were employed for co-immunoprecipitation. The B subunit of heat labile enterotoxin was identified as a specific interaction partner by mass spectrometry, thus demonstrating that nanodisc technology is useful for highly specific detection and identification...
Lab-on-a-chip-based PCR-RFLP assay for the confirmed detection of short-length feline DNA in food.
Ali, Md Eaqub; Al Amin, Md; Hamid, Sharifah Bee Abd; Hossain, M A Motalib; Mustafa, Shuhaimi
2015-01-01
Wider availability but lack of legal market trades has given feline meat a high potential for use as an adulterant in common meat and meat products. However, mixing of feline meat or its derivatives in food is a sensitive issue, since it is a taboo in most countries and prohibited in certain religions such as Islam and Judaism. Cat meat also has potential for contamination with of severe acute respiratory syndrome, anthrax and hepatitis, and its consumption might lead to an allergic reaction. We developed a very short-amplicon-length (69 bp) PCR assay, authenticated the amplified PCR products by AluI-restriction digestion followed by its separation and detection on a lab-on-a-chip-based automated electrophoretic system, and proved its superiority over the existing long-amplicon-based assays. Although it has been assumed that longer DNA targets are susceptible to breakdown under compromised states, scientific evidence for this hypothesis has been rarely documented. Strong evidence showed that shorter targets are more stable than the longer ones. We confirmed feline-specificity by cross-challenging the primers against 10 different species of terrestrial, aquatic and plant origins in the presence of a 141-bp site of an 18S rRNA gene as a universal eukaryotic control. RFLP analysis separated 43- and 26-bp fragments of AluI-digest in both the gel-image and electropherograms, confirming the original products. The tested detection limit was 0.01% (w/w) feline meat in binary and ternary admixed as well as meatball matrices. Shorter target, better stability and higher sensitivity mean such an assay would be valid for feline identification even in degraded specimens.
Studying RNA-protein interactions in vivo by RNA immunoprecipitation
DEFF Research Database (Denmark)
Selth, Luke A; Close, Pierre; Svejstrup, Jesper Q
2011-01-01
and have significant effects on gene expression. RNA immunoprecipitation (RIP) is a powerful technique used to detect direct and indirect interactions between individual proteins and specific RNA molecules in vivo. Here, we describe RIP methods for both yeast and mammalian cells.......The crucial roles played by RNA-binding proteins in all aspects of RNA metabolism, particularly in the regulation of transcription, have become increasingly evident. Moreover, other factors that do not directly interact with RNA molecules can nevertheless function proximally to RNA polymerases...
Immunoassays in clinical chemistry (principles of immunoradiometric assays)
International Nuclear Information System (INIS)
Chapman, R.S.
1998-01-01
The use of antibodies as reagents in clinical chemistry for the quantitation of a wide range of analytes has now become widely established. Initially antibodies were employed in precipitation techniques, usually for the analysis of serum proteins, in solution or in the form of antibody containing gels, e.g. immunoprecipitation, immunodiffusion, and immunoelectrophoresis. Further developments have led to the highly sensitive techniques of radioimmunoassay and recently immunometric assay for the measurement of drugs, tumour markers and hormones. In general, those techniques without the addition of a label e.g. immunoprecipitation, immunodiffusion and immunoturbidimetry are the older techniques used for the measurement of serum proteins. These techniques are relatively insensitive, measuring at the g/L. level, and in the case of immunodiffusion are generally slow. Automation coupled with the development of chemistries to enhance precipitation has, however, reduced measurement times to minutes in modern laboratories. Nevertheless these methods have detection limits of the order of 1 g/L
Yang, He S; Wu, Alan H B; Lynch, Kara L
2016-06-01
With the rise in the use and misuse of prescription opioids, there is an increasing need for the confirmed identification of opioid analgesics in toxicology laboratories. The goals of this study were to (i) systematically evaluate the hydrolysis efficiency of four β-glucuronidase enzymes under optimized condition; (ii) evaluate compound recovery, matrix effects and precision of three protein precipitation plates and (iii) develop and validate a qualitative liquid-chromatography mass spectrometry (LC-MS/MS) assay to identify 13 opioids in urine. A recombinant β-glucuronidase exhibited the best overall hydrolysis efficiency for seven opioid glucuronide conjugates compared with β-glucuronidase from red abalone, Escherichia coli and Patella vulgata One of the protein precipitation plates tested exhibited overall better recovery of the opioids and lower ion suppression compared with the other two plates. An ESI positive mode LC-MS/MS assay for qualitative opioid analysis was developed and validated. Linearity, LOD, precision, matrix effect, recovery, carryover and interference of the method were evaluated. Sixty-two patient samples were analyzed by both a legacy GC-MS opioid method and the LC-MS/MS method, and 22 samples were analyzed by the LC-MS/MS and an LC-MS/MS reference method. The results of the comparisons showed good concordance. Overall, we described an efficient sample preparation procedure for a sensitive qualitative opioid confirmation assay in urine. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
1983-08-25
solium, Echinococcus granulosus , Entamoeba histolytica, or Wucher erTra-bancr--ofti. The S. mansoni glycoproteins that were immunoprecipitated by sera...Sera from patients or experimental animals infected with Schistosoma, Fasciola hepatica, Trichinella spiralis, Taenia solium, Echinococcus ... granulosus , or Paragonimus westermani cross-react in diag-nostic assays with antigens derived from schistosomes, whether as whole organisms (1-4), crude
Protocol: methodology for chromatin immunoprecipitation (ChIP in Chlamydomonas reinhardtii
Directory of Open Access Journals (Sweden)
Strenkert Daniela
2011-11-01
Full Text Available Abstract We report on a detailed chromatin immunoprecipitation (ChIP protocol for the unicellular green alga Chlamydomonas reinhardtii. The protocol is suitable for the analysis of nucleosome occupancy, histone modifications and transcription factor binding sites at the level of mononucleosomes for targeted and genome-wide studies. We describe the optimization of conditions for crosslinking, chromatin fragmentation and antibody titer determination and provide recommendations and an example for the normalization of ChIP results as determined by real-time PCR.
Accounting for immunoprecipitation efficiencies in the statistical analysis of ChIP-seq data
Bao, Yanchun; Vinciotti, Veronica; Wit, Ernst; 't Hoen, Peter A C
2013-01-01
Background: ImmunoPrecipitation (IP) efficiencies may vary largely between different antibodies and between repeated experiments with the same antibody. These differences have a large impact on the quality of ChIP-seq data: a more efficient experiment will necessarily lead to a higher signal to
International Nuclear Information System (INIS)
Garaj-Vrhovac, V.; Kopjar, N.
2003-01-01
Genotoxic risks of occupational exposure in a radar facility were evaluated by using alkaline comet assay, micronucleus assay and chromatid breakage assay on peripheral blood leukocytes in exposed subjects and corresponding controls. Results show that occupational exposure to microwave radiation correlates with an increase of genome damage in somatic cells. The levels of DNA damage in exposed subjects determined by using alkaline comet assay were increased compared to control and showed interindividual variations. Incidence of micronuclei was also significantly increased compared to baseline control values. After short exposure of cultured lymphocytes to bleomycin, cells of occupationally exposed subjects responded with high numbers of chromatid breaks. Although the level of chromosome damage generated by bleomycin varied greatly between individuals, in exposed subjects a significantly elevated number of chromatid breaks was observed. Our results support data reported in literature indicating that microwave radiation represents a potential DNA-damaging hazard. Alkaline comet assay is confirmed as a sensitive and highly reproducible technique for detection of primary DNA damage inflicted in somatic cells. Micronucleus assay was confirmed as reliable bio-markers of effect and chromatid breakage assay as sensitive bio-marker of individual cancer susceptibility. The results obtained also confirm the necessity to improve measures and to perform accurate health surveillance of individuals occupationally exposed to microwave radiation
Genome-Wide Methylated DNA Immunoprecipitation Analysis of Patients with Polycystic Ovary Syndrome
Shen, Hao-ran; Qiu, Li-hua; Zhang, Zhi-qing; Qin, Yuan-yuan; Cao, Cong; Di, Wen
2013-01-01
Polycystic ovary syndrome (PCOS) is a complex, heterogeneous disorder of uncertain etiology. Recent studies suggested that insulin resistance (IR) plays an important role in the development of PCOS. In the current study, we aimed to investigate the molecular mechanism of IR in PCOS. We employed genome-wide methylated DNA immunoprecipitation (MeDIP) analysis to characterize genes that are differentially methylated in PCOS patients vs. healthy controls. Besides, we also identified the different...
van der Klift, Heleen M; Jansen, Anne M L; van der Steenstraten, Niki; Bik, Elsa C; Tops, Carli M J; Devilee, Peter; Wijnen, Juul T
2015-01-01
A subset of DNA variants causes genetic disease through aberrant splicing. Experimental splicing assays, either RT-PCR analyses of patient RNA or functional splicing reporter minigene assays, are required to evaluate the molecular nature of the splice defect. Here, we present minigene assays performed for 17 variants in the consensus splice site regions, 14 exonic variants outside these regions, and two deep intronic variants, all in the DNA mismatch-repair (MMR) genes MLH1, MSH2, MSH6, and PMS2, associated with Lynch syndrome. We also included two deep intronic variants in APC and PKD2. For one variant (MLH1 c.122A>G), our minigene assay and patient RNA analysis could not confirm the previously reported aberrant splicing. The aim of our study was to further investigate the concordance between minigene splicing assays and patient RNA analyses. For 30 variants results from patient RNA analyses were available, either performed by our laboratory or presented in literature. Some variants were deliberately included in this study because they resulted in multiple aberrant transcripts in patient RNA analysis, or caused a splice effect other than the prevalent exon skip. While both methods were completely concordant in the assessment of splice effects, four variants exhibited major differences in aberrant splice patterns. Based on the present and earlier studies, together showing an almost 100% concordance of minigene assays with patient RNA analyses, we discuss the weight given to minigene splicing assays in the current criteria proposed by InSiGHT for clinical classification of MMR variants. PMID:26247049
Atypical myopathy in Denmark confirmed with the aTRAQ assay
DEFF Research Database (Denmark)
Høffer, Sofie Esbjørn; Votion, Dominique-Marie; Anderberg, Marie
2016-01-01
Atypical myopathy is a severe form of rhabdomyolysis that occurs in grazing horses. Over the past decades, the disease has been emerging in Europe. The disease is widespread in Europe and has been suspected in Denmark since 2000, yet no cases have been confirmed. The objective of this study...
Directory of Open Access Journals (Sweden)
Cui Guan
Full Text Available The honey bee has a well-organized system of division of labour among workers. Workers typically progress through a series of discrete behavioural castes as they age, and this has become an important case study for exploring how dynamic changes in gene expression can influence behaviour. Here we applied both digital gene expression analysis and methyl DNA immunoprecipitation analysis to nurse, forager and reverted nurse bees (nurses that have returned to the nursing state after a period spent foraging from the same colony in order to compare the outcomes of these different forms of genomic analysis. A total of 874 and 710 significantly differentially expressed genes were identified in forager/nurse and reverted nurse/forager comparisons respectively. Of these, 229 genes exhibited reversed directions of gene expression differences between the forager/nurse and reverted nurse/forager comparisons. Using methyl-DNA immunoprecipitation combined with high-throughput sequencing (MeDIP-seq we identified 366 and 442 significantly differentially methylated genes in forager/nurse and reverted nurse/forager comparisons respectively. Of these, 165 genes were identified as differentially methylated in both comparisons. However, very few genes were identified as both differentially expressed and differentially methylated in our comparisons of nurses and foragers. These findings confirm that changes in both gene expression and DNA methylation are involved in the nurse and forager behavioural castes, but the different analytical methods reveal quite distinct sets of candidate genes.
Nohara, Kazunari; Chen, Zheng; Yoo, Seung-Hee
2017-07-06
Chromatin immunoprecipitation (ChIP) is a powerful method to determine protein binding to chromatin DNA. Fiber-rich skeletal muscle, however, has been a challenge for ChIP due to technical difficulty in isolation of high-quality nuclei with minimal contamination of myofibrils. Previous protocols have attempted to purify nuclei before cross-linking, which incurs the risk of altered DNA-protein interaction during the prolonged nuclei preparation process. In the current protocol, we first cross-linked the skeletal muscle tissue collected from mice, and the tissues were minced and sonicated. Since we found that ultracentrifugation was not able to separate nuclei from myofibrils using cross-linked muscle tissue, we devised a sequential filtration procedure to obtain high-quality nuclei devoid of significant myofibril contamination. We subsequently prepared chromatin by using an ultrasonicator, and ChIP assays with anti-BMAL1 antibody revealed robust circadian binding pattern of BMAL1 to target gene promoters. This filtration protocol constitutes an easily applicable method to isolate high-quality nuclei from cross-linked skeletal muscle tissue, allowing consistent sample processing for circadian and other time-sensitive studies. In combination with next-generation sequencing (NGS), our method can be deployed for various mechanistic and genomic studies focusing on skeletal muscle function.
Lahner, Edith; Brigatti, Cristina; Marzinotto, Ilaria; Carabotti, Marilia; Scalese, Giulia; Davidson, Howard W; Wenzlau, Janet M; Bosi, Emanuele; Piemonti, Lorenzo; Annibale, Bruno; Lampasona, Vito
2017-01-01
Objectives: Circulating autoantibodies targeting the H+/K+-ATPase proton pump of gastric parietal cells are considered markers of autoimmune gastritis, whose diagnostic accuracy in atrophic body gastritis, the pathological lesion of autoimmune gastritis, remains unknown. This study aimed to assess autoantibodies against ATP4A and ATP4B subunits of parietal cells H+, K+-ATPase in atrophic body gastritis patients and controls. Methods: One-hundred and four cases with atrophic body gastritis and 205 controls were assessed for serological autoantibodies specific for ATP4A or ATP4B subunits using luminescent immunoprecipitation system (LIPS). Recombinant luciferase-reporter-fused-antigens were expressed by in vitro transcription-translation (ATP4A) or after transfection in Expi293F cells (ATP4B), incubated with test sera, and immune complexes recovered using protein-A-sepharose. LIPS assays were compared with a commercial enzyme immunoassay (EIA) for parietal cell autoantibodies. Results: ATP4A and ATP4B autoantibody titers were higher in cases compared to controls (Pgastritis. Both assays had the highest sensitivity, at the cost of diagnostic accuracy (89 and 90% specificity), outperforming traditional EIA. Once validated, these LIPS assays should be valuable screening tools for detecting biomarkers of damaged atrophic oxyntic mucosa. PMID:28102858
International Nuclear Information System (INIS)
Pierce, S.W.; Victoria, E.J.; Masouredis, S.P.
1990-01-01
The relationship between determinants recognized by warm-type immunoglobulin G red cell autoantibodies and the Rh antigens was characterized by autoantibody competitive inhibition of iodine 125 Rh alloantibody binding and autoantibody immunoprecipitation of iodine 125 red blood cell membrane proteins. The majority of blood donor autoantibody recognized epitopes that are closely related to Rh antigens as determined by competitive inhibition studies. Eighteen of 20 (90%) autoantibodies inhibited anti-Rh(c) binding, 15 inhibited anti-Rh(E), 5 inhibited anti-Rh(D), and only 2 failed to inhibit any of the three Rh alloantibodies tested. Autoantibodies that inhibited anti-Rh(D) also inhibited anti-Rh(c) and anti-Rh(E) and all those that inhibited anti-Rh(E) also inhibited anti-Rh(c). Autoantibodies that inhibited all three Rh alloantibodies immunoprecipitated 30 kd membrane polypeptides, as did two of the three autoantibodies that inhibited only anti-Rh(c) and anti-Rh(E). One autoantibody in this group and two autoantibodies that inhibited only anti-Rh(c), as well as an autoantibody that did not inhibit any of the Rh alloantibodies, immunoprecipitated only a single membrane polypeptide identified as band 3. The majority of normal donor red blood cell autoantibodies inhibited the binding of Rh alloantibodies, which indicates that they either bound to the Rh polypeptides or to epitopes on band 3 that were closely associated with the Rh complex
Sequential chromatin immunoprecipitation to detect SUMOylated MeCP2 in neurons
Directory of Open Access Journals (Sweden)
Tao Wu
2016-03-01
Full Text Available The small ubiquitin-like modifier (SUMO is a short peptide that can be covalently linked to proteins altering their function. SUMOylation is an essential post-translational modification (PTM. Because of its dynamic nature, low abundance levels, and technical limitations, the occupation of endogenous SUMOylated transcription factors at genomic loci is challenging to detect. The chromatin regulator Methyl CpG binding protein 2 (MeCP2 is subjected to PTMs including SUMO. Mutations in MeCP2 lead to Rett syndrome, a severe neurodevelopmental disorder. Here, we present an efficient method to perform sequential chromatin immunoprecipitation (Seq-ChIP for detecting SUMOylated MeCP2 in neurons. This Seq-ChIP technique is a useful tool to determine the occupancy of SUMOylated transcription and chromatin factors at specific genomic regions.
Directory of Open Access Journals (Sweden)
Eugenia Carrillo
Full Text Available Spain has one of the world's largest pools of organ donors and is a global leader in terms of the number of transplants it performs. The current outbreak of leishmaniasis in Fuenlabrada (in the southwest of the region of Madrid, Spain has involved 600 clinical cases since late 2009 (prevalence 0.2%. It may therefore be wise to monitor the town's transplanted population for Leishmania infantum; its members are immunosuppressed and at greater risk of infection and relapse following treatment. The present work examines the use of cytokine release assays to determine the prevalence of Leishmania infection in this population, and to confirm recovery following treatment for visceral leishmaniasis (VL. The humoral and cellular immune responses to L. infantum were characterized in 63 solid organ transplant (SOT recipients from Fuenlabrada, 57 of whom reported no previous episode of VL (NVL subjects, and six of whom had been cured of VL (CVL subjects. Seventeen subjects (12 NVL and 5 CVL showed a patent lymphoproliferative response to soluble Leishmania antigen (SLA. Stimulation of peripheral blood mononuclear cell cultures and of whole blood with SLA led to the production of different combinations of cytokines that might serve to confirm Leishmania infection or recovery from VL and help prevent cured patients from relapsing into this serious condition.
Long, Yang; Yan, Jianghong; Luo, Suxin; Liu, Zhenguo; Xia, Yong
2017-11-15
Endothelial nitric oxide synthase (eNOS) plays central roles in cardiovascular regulation and disease. eNOS function is critically affected by O-linked N-acetylglucosamine (O-GlcNAc) modification. The present method for measuring O-GlcNAcylated eNOS relies on immunoprecipitation. Such method exhibits low detection efficiency and is also costly. We here report a simplified assay by employing the high binding affinity of eNOS with the 2',5'-ADP-Sepharose resins. Together with the O-GlcNAc antibody, this assay readily allows the detection of O-GlcNAcylated eNOS in both cultured endothelial cells and rat vascular tissues. By using this assay, we demonstrate that eNOS O-GlcNAcylation is markedly elevated in the vessels of diabetic rats. Thus, a 2',5'-ADP-Sepharose-based pull-down assay is developed to measure O-GlcNAcylated eNOS. This assay is simple and efficient in detecting O-GlcNAcylated eNOS in cultured cells and animal tissues under both normal and disease conditions. Copyright © 2017 Elsevier Inc. All rights reserved.
Kesli, Recep; Polat, Hakki; Terzi, Yuksel; Kurtoglu, Muhammet Guzel; Uyar, Yavuz
2011-12-01
Hepatitis C virus (HCV) is a global health care problem. Diagnosis of HCV infection is mainly based on the detection of anti-HCV antibodies as a screening test with serum samples. Recombinant immunoblot assays are used as supplemental tests and for the final detection and quantification of HCV RNA in confirmatory tests. In this study, we aimed to compare the HCV core antigen test with the HCV RNA assay for confirming anti-HCV results to determine whether the HCV core antigen test may be used as an alternative confirmatory test to the HCV RNA test and to assess the diagnostic values of the total HCV core antigen test by determining the diagnostic specificity and sensitivity rates compared with the HCV RNA test. Sera from a total of 212 treatment-naive patients were analyzed for anti-HCV and HCV core antigen both with the Abbott Architect test and with the molecular HCV RNA assay consisting of a reverse transcription-PCR method as a confirmatory test. The diagnostic sensitivity, specificity, and positive and negative predictive values of the HCV core antigen assay compared to the HCV RNA test were 96.3%, 100%, 100%, and 89.7%, respectively. The levels of HCV core antigen showed a good correlation with those from the HCV RNA quantification (r = 0.907). In conclusion, the Architect HCV antigen assay is highly specific, sensitive, reliable, easy to perform, reproducible, cost-effective, and applicable as a screening, supplemental, and preconfirmatory test for anti-HCV assays used in laboratory procedures for the diagnosis of hepatitis C virus infection.
Evaluation of total PSA assay on vitros ECi and correlation with Kryptor-PSA assay.
Cassinat, B; Wacquet, M; Toubert, M E; Rain, J D; Schlageter, M H
2001-01-01
An increasing number of multiparametric immuno-analysers for PSA assays are available. As different immuno-assays may vary in their analytical quality and their accuracy for the follow-up of patients, expertise is necessary for each new assay. The PSA assay on the Vitros-ECi analyser has been evaluated and compared with the PSA assay from the Kryptor analyser. Variation coefficients were 0.91 to 1.98% for within-run assays, and 4.2% to 5.4% for interassay (PSA levels = 0.8 microgram/L to 33.6 micrograms/L). Dilution tests showed 93 to 136% recovery until 70 micrograms/L PSA. Functional sensitivity was estimated at 0.03 microgram/L. Equimolarity of the test was confirmed. Correlation of PSA levels measured with Vitros-ECi and Kryptor analysers displayed a correlation coefficient r2 of 0.9716. The half-lives and doubling times of PSA were similar using both methods. Vitros-ECi PSA assay meets the major criteria for the management of prostate cancer patients.
Directory of Open Access Journals (Sweden)
Mark Boaz
2014-01-01
Full Text Available The CYD tetravalent dengue vaccine candidate is being evaluated for protective efficacy against symptomatic dengue in Phase 3 efficacy trials. The laboratory test algorithm to confirm dengue cases was evaluated prior to Phase 3 trials. During a Phase 2 trial in Latin America a dengue epidemic occurred in the study countries. A total of 72 suspected dengue cases were reported and assessed: virological confirmation comprised qRT-PCR methods and a commercial ELISA kit for NS1 protein (Bio-Rad. The qRT-PCR included a screening assay targeting a conserved dengue region of the 3′-UTR (dengue screen assay followed by 4 individual serotype assays targeting the conserved dengue NS5 genomic region (WT dengue qRT-PCR assays. The NS1 and WT dengue qRT-PCR were endpoint assays for protocol virological confirmation (PVC. Of the 72 suspected cases, 14 were PVC. However, a unique pattern of dengue qRT-PCR results were observed in 5 suspected cases from Honduras: the dengue screen qRT-PCR assay was positive but WT dengue qRT-PCR and NS1 Ag ELISA were negative. To investigate these observations, additional molecular methods were applied: a SYBR® Green-based RT-PCR assay, sequencing assays directed at the genome regions covered by the WT dengue qRT-PCR, and a modified commercial dengue RT-PCR test (Simplexa™ Dengue, Focus Diagnostics. The exploratory data confirmed these additional cases as dengue and indicated the serotype 2 WT dengue qRT-PCR assay was unable to detect a circulating Latin American strain (DENV-2/NI/BID-V608/2006 due to a sequence variation in the isolate. The Simplexa Dengue RT-PCR test was able to detect and serotype dengue. Based on these findings an updated molecular test algorithm for the virological confirmation of dengue cases was developed and implemented in the Phase 3 efficacy trials.
Mass Spectrometry to Identify New Biomarkers of Nerve Agent Exposure
2010-04-01
preparations. Improving thermal stability by mutagene- sis or by selecting enzyme candidates in an extremophile biotope, e.g. thermophilic bacteria [36...target for oganophosphorus agent (OP) binding to enzymes is the active site serine in the consensus sequence GlyXSerXGly of acetylcholinesterase. By...human plasma. Task 6. Use a second method, for example enzyme activity assays or immunoprecipitation, to confirm the identity of soman-labeled proteins
Stramer, Susan L; Townsend, Rebecca L; Foster, Gregory A; Johnson, Ramona; Weixlmann, Barbara; Dodd, Roger Y
2018-03-01
Human T-lymphotropic virus (HTLV) blood donation screening has used a dual-testing algorithm beginning with either a chemiluminescent immunoassay or enzyme-linked immunosorbent screening assay (ELISA). Before the availability of a licensed HTLV supplemental assay, repeat-reactive (RR) samples on a first assay (Assay 1) were retested with a second screening assay (Assay 2). Donors with RR results by Assay 2 were deferred from blood donation and further tested using an unlicensed supplemental test to confirm reactivity while nonreactive (NR) donors remained eligible for donation until RR on a subsequent donation. This "dual-test" algorithm was replaced in May 2016 with the requirement that all RRs by Assay 1 be further tested by a licensed HTLV supplemental test (Western blot [WB]). In this study, we have requalified the dual-test algorithm using the available licensed HTLV WB. We tested 100 randomly selected HTLV RRs on screening Assay 1 (Abbott PRISM chemiluminescent immunoassay) but NR on screening Assay 2 (Avioq ELISA) by a Food and Drug Administration-licensed WB (MP Biomedicals) to ensure that no confirmed positives were among those that were RR by Assay 1 but NR by Assay 2. Of the 100 samples evaluated, 79 of 100 were WB seronegative, 21 of 100 indeterminate, and 0 of 100 seropositive. Of the 79 of 100 seronegative specimens, 73 of 79 did not express any bands on WB. We demonstrated that none of the 100 samples RR on Assay 1 but NR on Assay 2 were confirmed positive. This algorithm prevents such donors from requiring further testing and from being deferred. © 2018 AABB.
Directory of Open Access Journals (Sweden)
Heidi A. Neubauer
2017-03-01
Full Text Available Sphingosine kinase 2 (SK2 is a ubiquitously expressed lipid kinase that has important, albeit complex and poorly understood, roles in regulating cell survival and cell death. In addition to being able to promote cell cycle arrest and apoptosis under certain conditions, it has recently been shown that SK2 can promote neoplastic transformation and tumorigenesis in vivo. Therefore, well validated and reliable tools are required to study and better understand the true functions of SK2. Here, we compare two commercially available SK2 antibodies: a rabbit polyclonal antibody from Proteintech that recognizes amino acids 266-618 of human SK2a, and a rabbit polyclonal antibody from ECM Biosciences that recognizes amino acids 36-52 of human SK2a. We examine the performance of these antibodies for use in immunoblotting, immunoprecipitation and immunofluorescence staining of endogenous SK2, using human HEK293 and HeLa cell lines, as well as mouse embryonic fibroblasts (MEFs. Furthermore, we assess the specificity of these antibodies to the target protein through the use of siRNA-mediated SK2 knockdown and SK2 knockout (Sphk2-/- MEFs. Our results demonstrate that the Proteintech anti-SK2 antibody reproducibly displayed superior sensitivity and selectivity towards SK2 in immunoblot analyses, while the ECM Biosciences anti-SK2 antibody was reproducibly superior for SK2 immunoprecipitation and detection by immunofluorescence staining. Notably, both antibodies produced non-specific bands and staining in the MEFs, which was not observed with the human cell lines. Therefore, we conclude that the Proteintech SK2 antibody is a valuable reagent for use in immunoblot analyses, and the ECM Biosciences SK2 antibody is a useful tool for SK2 immunoprecipitation and immunofluorescence staining, at least in the human cell lines employed in this study.
Quantitative CrAssphage PCR Assays for Human Fecal ...
Environmental waters are monitored for fecal pollution to protect public health and water resources. Traditionally, general fecal indicator bacteria are used; however, they cannot distinguish human fecal waste from pollution from other animals. Recently, a novel bacteriophage, crAssphage, was discovered by metagenomic data mining and reported to be abundant in and closely associated with human fecal waste. To confirm bioinformatic predictions, 384 primer sets were designed along the length of the crAssphage genome. Based upon initial screening, two novel crAssphage qPCR assays (CPQ_056 and CPQ_064) were designed and evaluated in reference fecal samples and water matrices. The assays exhibited high specificities (98.6%) when tested against a large animal fecal reference library and were highly abundant in raw sewage and sewage impacted water samples. In addition, CPQ_056 and CPQ_064 assay performance was compared to HF183/BacR287 and HumM2 methods in paired experiments. Findings confirm viral crAssphage qPCR assays perform at a similar level to well established bacterial human-associated fecal source identification technologies. These new viral based assays could become important water quality management and research tools. To inform the public.
Sugiura, Aya; Iwahara, Kunihiro; Suga, Yasuyuki; Uchiyama, Sachinori; Maekawa, Masato
2012-02-01
We compared the ECLusys HBsAgII (ECL HBsAg) assay to the Lumipulse Forte (LPf HBsAg) and HISCL (HIS HBsAg) assays. Measurement of dilution panels for which the WHO HBsAg international reference panel was the parent specimen revealed that the ECL and HIS assays enabled detection to a theoretical level of 0.04 IU/mL, whereas the LPf assay enabled detection to a level of 0.08 IU/mL. In a specificity test using high RF positive specimens (n = 33), pregnancy specimens (n = 35), cytomegalovirus antibody positive specimens (n = 36), and high M protein positive specimens (n = 21) that were confirmed negative for HBsAg by the LPf assay, negative results were obtained for all specimens on the HIS assay, but the ECL assay yielded a positive result for one of the high RF positive specimens. This individual was suggested on further testing to be an HBV carrier who was strongly positive for HBc antibody. In HBsAg mutants detection test, the detection rate was 92.3% with the ECL assay and 69.2% with the HIS assay. In a correlation test using routinely collected clinical specimens (n = 155), including positive stock specimens, aside from the one case where the LPf assay gave a negative result but both the ECL and HIS assays gave positive results, all of the results were consistent for all specimens. The above results confirmed that the ECL assay is both highly sensitive and specific, and also enables a high rate of HBsAg mutant detection.
Radioimmunoassay screening and GC/MS confirmation of whole blood samples for drugs of abuse
Energy Technology Data Exchange (ETDEWEB)
Spiehler, V.R.; Sedgwick, P.
From 1981 to 1984, an average of 300 radioimmunoassay screens on whole blood were performed each week in the authors laboratory. Most samples were screened for opiates phencyclidine and its analogs, barbiturates, and cocaine or its metabolite benzoylecgonine. A commercially available radioimmunoassay was used with modifications to facilitate screening of whole blood. Increasing sample size increased the sensitivity of the assay. Changing reagent concentration (1:1 dilution), incubation time, sample matrix (water, urine, or blood), or fraction counted (precipitate or supernatant) did not affect the utility of the standard curve or the sensitivity of the assay. All positive results for phencyclidine, opiates, cocaine, and related compounds were confirmed by GC/MA. Barbiturate positives were confirmed by UV spectrophotometry.
Sugiura, Aya; Iwahara, Kunihiro; Suga, Yasuyuki; Uchiyama, Sachinori; Maekawa, Masato
2012-04-01
We compared the ECLusys HIV combi assay (ECL HIV Ag/Ab) to the Lumipulse Forte (LPf HIV 1/2 Ab) and HISCL (HIS HIV 1/2 Ab) assays. In a dilution sensitivity test using dilution panels of WHO HIV antibody international reference panel (HIV-1 Subtype A, B, C, E, HIV-1 Group O, HIV-2) and HIV-1/2 Ab CE marked material(HIV-1, HIV-2) parent specimens, the ECL assay enabled detection at a higher level of sensitivity than either the LPf assay or the HIS assay for all dilution panels. In an early detection test in the early phase of infection in which a BBI HIV seroconversion panel was used, the ECL assay enabled detection 7 days after initial blood sample collection, whereas the LPf and HIS assays enabled detection after 27 days. In a specificity test using high RF positive specimens (n=33), pregnancy specimens (n=35), cytomegalovirus antibody positive specimens (n=36), and high M protein positive specimens (n=21) that were confirmed negative for HIV-1/2 antibodies by the LPf assay, negative results were obtained for all specimens on both the ECL assay and the HIS assay. In a correlation test using routinely collected clinical specimens (n=121), including positive stock specimens, the ECL and HIS assays demonstrated the highest agreement rate 98.3%. The above results confirmed that the fourth-generation reagent ECL assay, which simultaneously detects both HIV-1/2 antibodies and p24 antigens, is both highly sensitive and specific, and is a suitable assay for use in routine testing.
Directory of Open Access Journals (Sweden)
Tommy Baumann
2013-10-01
Full Text Available We have shown previously that the raft-associated proteins flotillin-1 and -2 are rapidly recruited to the uropods of chemoattractant-stimulated human neutrophils and T-cells and are involved in cell polarization. Other proteins such as the adhesion receptor PSGL-1, the actin-membrane linker proteins ezrin/radixin/moesin (ERM and the signaling enzyme phosphatidylinositol-4-phosphate 5-kinase type Iγ90 (PIPKIγ90 also accumulate in the T-cell uropod. Using the in situ proximity ligation assay (PLA we now have investigated putative close associations of these proteins in human freshly isolated T-cells before and after chemokine addition. The PLA allows in situ subcellular localization of close proximity of endogenous proteins at single-molecule resolution in fixed cells. It allows detection also of weaker and transient complexes that would not be revealed with co-immunoprecipitation approaches. We previously provided evidence for heterodimer formation of tagged flotillin-1 and -2 in T-cells before and after chemokine addition using fluorescence resonance energy transfer (FRET. We now confirm these findings using PLA for the endogenous flotillins in fixed human T-cells. Moreover, in agreement with the literature, our PLA findings confirm a close association of endogenous PSGL-1 and ERM proteins both in resting and chemokine-activated human T-cells. In addition, we provide novel evidence using the PLA for close associations of endogenous activated ERM proteins with PIPKIγ90 and of endogenous flotillins with PSGL-1 in human T-cells, before and after chemokine addition. Our findings suggest that preformed clusters of these proteins coalesce in the uropod upon cell stimulation.
Activity-Based Detection and Bioanalytical Confirmation of a Fatal Carfentanil Intoxication
Directory of Open Access Journals (Sweden)
Annelies Cannaert
2018-05-01
Full Text Available Carfentanil, one of the most potent opioids known, has recently been reported as a contaminant in street heroin in the United States and Europe, and is associated with an increased number of life-threatening emergency department admissions and deaths. Here, we report on the application of a novel in vitro opioid activity reporter assay and a sensitive bioanalytical assay in the context of a fatal carfentanil intoxication, revealing the highest carfentanil concentrations reported until now. A 21-year-old male was found dead at home with a note stating that he had taken carfentanil with suicidal intentions. A foil bag and plastic bag labeled “C.50” were found at the scene. These bags were similar to a sample obtained by the Belgian Early Warning System on Drugs from a German darknet shop and to those found in the context of a fatality in Norway. Blood, urine and vitreous, obtained during autopsy, were screened with a newly developed in vitro opioid activity reporter assay able to detect compounds based on their μ-opioid receptor activity rather than their chemical structure. All extracts showed strong opioid activity. Results were confirmed by a bioanalytical assay, which revealed extremely high concentrations for carfentanil and norcarfentanil. It should be noted that carfentanil concentrations are typically in pg/mL, but here they were 92 ng/mL in blood, 2.8 ng/mL in urine, and 23 ng/mL in vitreous. The blood and vitreous contained 0.532 and 0.300 ng/mL norcarfentanil, respectively. No norcarfentanil was detected in urine. This is the first report where a novel activity-based opioid screening assay was successfully deployed in a forensic case. Confirmation and quantification using a validated bioanalytical procedure revealed the, to our knowledge, highest carfentanil concentrations reported in humans so far.
Evaluation of environmental genotoxicity by comet assay in Columba livia.
González-Acevedo, Anahi; García-Salas, Juan A; Gosálvez, Jaime; Fernández, José Luis; Dávila-Rodríguez, Martha I; Cerda-Flores, Ricardo M; Méndez-López, Luis F; Cortés-Gutiérrez, Elva I
2016-01-01
The concentrations of recognized or suspected genotoxic and carcinogenic agents found in the air of large cities and, in particular, developing countries, have raised concerns about the potential for chronic health effects in the populations exposed to them. The biomonitoring of environmental genotoxicity requires the selection of representative organisms as "sentinels," as well as the development of suitable and sensitive assays, such as those aimed at assessing DNA damage. The aim of this study was to evaluate DNA damage levels in erythrocytes from Columba livia living in the metropolitan area of Monterrey, Mexico, compared with control animals via comet assay, and to confirm the results via Micronuclei test (MN) and DNA breakage detection-fluorescence in situ hybridization (DBD-FISH). Our results showed a significant increase in DNA migration in animals from the area assayed compared with that observed in control animals sampled in non-contaminated areas. These results were confirmed by MN test and DBD-FISH. In conclusion, these observations confirm that the examination of erythrocytes from Columba livia via alkaline comet assay provides a sensitive and reliable end point for the detection of environmental genotoxicants.
McCullough, Shaun D; On, Doan M; Bowers, Emma C
2017-05-02
Histone modifications work in concert with DNA methylation to regulate cellular structure, function, and response to environmental stimuli. More than 130 unique histone modifications have been described to date, and chromatin immunoprecipitation (ChIP) allows for the exploration of their associations with the regulatory regions of target genes and other DNA/chromatin-associated proteins across the genome. Many variations of ChIP have been developed in the 30 years since its earliest version came into use, which makes it challenging for users to integrate the procedure into their research programs. Furthermore, the differences in ChIP protocols can confound efforts to increase reproducibility across studies. The streamlined ChIP procedure presented here can be readily applied to samples from a wide range of in vitro studies (cell lines and primary cells) and clinical samples (peripheral leukocytes) in toxicology. We also provide detailed guidance on the optimization of critical protocol parameters, such as chromatin fixation, fragmentation, and immunoprecipitation, to increase efficiency and improve reproducibility. Expanding toxicoepigenetic studies to more readily include histone modifications will facilitate a more comprehensive understanding of the role of the epigenome in environmental exposure effects and the integration of epigenetic data in mechanistic toxicology, adverse outcome pathways, and risk assessment. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
Culture confirmation of tuberculosis cases in Birmingham, UK.
Hayer, Kalbir S; Sitch, Alice J; Dedicoat, Martin; Wood, Annette L
2013-10-01
The proportion of culture-confirmed tuberculosis (TB) cases in Birmingham had gradually decreased to less than 65% in 2008. Reasons for this were unclear, therefore this study assessed diagnostic methods used for confirming TB and reviewed factors involved in positive culture. A cross-sectional study was carried out. A list of notified TB cases for Birmingham in those aged 16 y and over in 2009 was collated. Where no positive culture was recorded, further data were collected from hospital databases and case notes. Of 449 TB cases, 419 (93%) had samples taken for culture testing. Of all cases, 309 (69%) were confirmed by culture testing; of those receiving culture testing, 73% were confirmed. Pulmonary TB was identified as a predictor of positive culture in both the unadjusted and adjusted analyses: odds ratio (OR) 2.05, 95% confidence interval (CI) 1.32-3.19, and OR 2.32, 95% CI 1.29-4.17, respectively. Gender, age, ethnicity, UK born, and treatment delay were not significantly associated with positive culture. Of 140 cases not confirmed by culture, 129 (92%) had their diagnosis supported by at least one other test. The vast majority of TB cases had microbiological specimens taken to help confirm the disease. Furthermore, culture confirmation rates in Birmingham were meeting national targets in 2009. However culture confirmation rates were significantly lower in extrapulmonary TB, therefore further work is suggested in this group. The role of other investigations (e.g. interferon-gamma release assay (IGRA), Mantoux) is unclear. Further collaboration between clinicians, histopathologists, and microbiologists is advised to ensure samples are sent appropriately and culture confirmation is optimized.
Vogt, Andreas; Fuerholzner, Bettina; Kinkl, Norbert; Boldt, Karsten; Ueffing, Marius
2013-05-01
High confidence definition of protein interactions is an important objective toward the understanding of biological systems. Isotope labeling in combination with affinity-based isolation of protein complexes has increased in accuracy and reproducibility, yet, larger organisms--including humans--are hardly accessible to metabolic labeling and thus, a major limitation has been its restriction to small animals, cell lines, and yeast. As composition as well as the stoichiometry of protein complexes can significantly differ in primary tissues, there is a great demand for methods capable to combine the selectivity of affinity-based isolation as well as the accuracy and reproducibility of isotope-based labeling with its application toward analysis of protein interactions from intact tissue. Toward this goal, we combined isotope coded protein labeling (ICPL)(1) with immunoprecipitation (IP) and quantitative mass spectrometry (MS). ICPL-IP allows sensitive and accurate analysis of protein interactions from primary tissue. We applied ICPL-IP to immuno-isolate protein complexes from bovine retinal tissue. Protein complexes of immunoprecipitated β-tubulin, a highly abundant protein with known interactors as well as the lowly expressed small GTPase RhoA were analyzed. The results of both analyses demonstrate sensitive and selective identification of known as well as new protein interactions by our method.
Vogt, Andreas; Fuerholzner, Bettina; Kinkl, Norbert; Boldt, Karsten; Ueffing, Marius
2013-01-01
High confidence definition of protein interactions is an important objective toward the understanding of biological systems. Isotope labeling in combination with affinity-based isolation of protein complexes has increased in accuracy and reproducibility, yet, larger organisms—including humans—are hardly accessible to metabolic labeling and thus, a major limitation has been its restriction to small animals, cell lines, and yeast. As composition as well as the stoichiometry of protein complexes can significantly differ in primary tissues, there is a great demand for methods capable to combine the selectivity of affinity-based isolation as well as the accuracy and reproducibility of isotope-based labeling with its application toward analysis of protein interactions from intact tissue. Toward this goal, we combined isotope coded protein labeling (ICPL)1 with immunoprecipitation (IP) and quantitative mass spectrometry (MS). ICPL-IP allows sensitive and accurate analysis of protein interactions from primary tissue. We applied ICPL-IP to immuno-isolate protein complexes from bovine retinal tissue. Protein complexes of immunoprecipitated β-tubulin, a highly abundant protein with known interactors as well as the lowly expressed small GTPase RhoA were analyzed. The results of both analyses demonstrate sensitive and selective identification of known as well as new protein interactions by our method. PMID:23268931
Directory of Open Access Journals (Sweden)
Anita M Quintana
2011-02-01
Full Text Available The c-Myb transcription factor is a critical regulator of proliferation and stem cell differentiation, and mutated alleles of c-Myb are oncogenic, but little is known about changes in c-Myb activity during the cell cycle. To map the association of c-Myb with specific target genes during the cell cycle, we developed a novel Fix-Sort-ChIP approach, in which asynchronously growing cells were fixed with formaldehyde, stained with Hoechst 33342 and separated into different cell cycle fractions by flow sorting, then processed for chromatin immunoprecipitation (ChIP assays. We found that c-Myb actively repositions, binding to some genes only in specific cell cycle phases. In addition, the specificity of c-Myb is dramatically different in small subpopulations of cells, for example cells in the G2/M phase of the cell cycle, than in the bulk population. The repositioning of c-Myb during the cell cycle is not due to changes in its expression and also occurs with ectopically expressed, epitope-tagged versions of c-Myb. The repositioning occurs in established cell lines, in primary human CD34+ hematopoietic progenitors and in primary human acute myeloid leukemia cells. The combination of fixation, sorting and ChIP analysis sheds new light on the dynamic nature of gene regulation during the cell cycle and provides a new type of tool for the analysis of gene regulation in small subsets of cells, such as cells in a specific phase of the cell cycle.
Kaufmann, K.; Muiño, J.M.; Østerås, M.; Farinelli, L.; Krajewski, P.; Angenent, G.C.
2010-01-01
Chromatin immunoprecipitation (ChIP) is a powerful technique to study interactions between transcription factors (TFs) and DNA in vivo. For genome-wide de novo discovery of TF-binding sites, the DNA that is obtained in ChIP experiments needs to be processed for sequence identification. The sequences
Lee, Hong-Won; Kyung, Taeyoon; Yoo, Janghyun; Kim, Tackhoon; Chung, Chaeuk; Ryu, Ji Young; Lee, Hanki; Park, Kihyun; Lee, Sangkyu; Jones, Walton D.; Lim, Dae-Sik; Hyeon, Changbong; Do Heo, Won; Yoon, Tae-Young
2013-01-01
Co-immunoprecipitation (co-IP) has become a standard technique, but its protein-band output provides only static, qualitative information about protein–protein interactions. Here we demonstrate a real-time single-molecule co-IP technique that generates real-time videos of individual protein–protein interactions as they occur in unpurified cell extracts. By analysing single Ras–Raf interactions with a 50-ms time resolution, we have observed transient intermediates of the protein–protein interaction and determined all the essential kinetic rates. Using this technique, we have quantified the active fraction of native Ras proteins in xenograft tumours, normal tissue and cancer cell lines. We demonstrate that the oncogenic Ras mutations selectively increase the active-Ras fraction by one order of magnitude, without affecting total Ras levels or single-molecule signalling kinetics. Our approach allows us to probe the previously hidden, dynamic aspects of weak protein–protein interactions. It also suggests a path forward towards precision molecular diagnostics at the protein–protein interaction level. PMID:23422673
Molecular Confirmation of Salmonella typhimuriumin Poultry from Kathmandu Valley
Directory of Open Access Journals (Sweden)
Sanjeev Kumar Adhikari
2018-05-01
Full Text Available A prevalence study was carried to isolate Salmonella typhimurium from blood (n= 50 and gut samples (n=100 of poultry in Kathmandu valley during early 2016. Salmonella typhimurium bacteria isolated in the selective media were biochemically confirmed based on Bergey’s Manual. Two sets of oligonucleotide primers-the genus specific 16S rRNA and the organism specific invA were employed for molecular level confirmation by the Polymerase Chain Reaction (PCR assay. The amplified fragments in 1% agarose gel observed at 406bp and 285bp, respectively confirmed the isolates to be Salmonella typhimurium. Of 150 samples tested, Salmonella typhimurium were isolated from 49 samples, among which nine were from blood (18% and forty from the gut (40%. The present result indicated an alarmingly high level of Salmonella typhimurium, which can result inzoonotic infection in humans owing to increased contact with poultry and consumption of poultry products in the Kathmandu valley.
Energy Technology Data Exchange (ETDEWEB)
Klapper, P.E.; Cleator, G.M.; Prinja-Wolks, D.; Morris, D.J. (Medical School, Manchester (United Kingdom). Department of Medical microbiology, Virology Unit); Morell, G. (Regional Blood Transfusion Centre, manchester (United Kingdom))
1990-03-01
An immunoradiometric assay (radio-immunosorbent test; RIST) for the detection of IgG antibodies to human herpesvirus 4 (human cytomegalovirus (CMV)) has been developed. The technique utilizes CMV antigen passively adsorbed to a polyvinyl microtitration plate and a radiolabelled murine monoclonal anti-human IgG antibody to detect binding of human antibody to the 'solid phase' reagent. The assay was optimized, and its specifity confirmed by testing paired acute and convalescent sera from patients with acute CMV or other human herpesvirus infections. To determine the assay's sensitivity 1433 blood donor sera were examined. The RIST was more sensitive than a standard complement fixation (CFT). Use of a monoclonal anti-human IgG antibody in the RIST reduced non-specific binding to the control uninfected cell antigen such that blood donor sera could be tested in the assay using only a CMV antigen without generating an unacceptable false positive rate. (author). 23 refs.; 1 tab.
Mizanbayeva, Sulushash; Smits, Henk L; Zhalilova, Katya; Abdoel, Theresia H; Kozakov, Stanislaw; Ospanov, Kenes S; Elzer, Philip H; Douglas, James T
2009-09-01
Serum samples from all patients with culture-confirmed brucellosis including those with chronic disease from Kazakhstan tested positive in the serum agglutination test for titers > or = 1:25 and reacted in the Brucella immunoglobulin M/immunoglobulin G lateral flow assay (LFA) confirming the high sensitivity of these assays. The strong reactivity in the LFA observed for the majority (92.1%) of the samples from the patients with culture-confirmed brucellosis together with the user-friendliness of the assay procedure makes the LFA ideal for the confirmation of brucellosis in endemic areas in Kazakhstan. The Rose Bengal test lacked sensitivity in particular for patients with chronic brucellosis therefore limiting its value as a quick screening assay. The study emphasizes the importance of the LFA as a useful, rapid, and easy-to-perform tool in the diagnostic testing of brucellosis.
Molecular Confirmation of Trypanosoma evansi and Babesia bigemina in Cattle from Lower Egypt
Directory of Open Access Journals (Sweden)
Mahmoud M. Elhaig, Abdelfattah Selim, Mohamed M. Mahmoud and Eman K El-Gayar
2016-11-01
Full Text Available Trypanosomosis and babesiosis are economically important vector-borne diseases for animal health and productivity in developing countries. In Egypt, molecular epidemiological surveys on such diseases are scarce. In the present study, we examined 475 healthy and 25 clinically diagnosed cattle from three provinces in Lower Egypt, for Trypanosoma (T. and Babesia (B. infections using an ITS1 PCR assay that confirmed Trypanosoma species presence and an 18S rRNA assay that detected B. bigemina. Results confirmed Trypanosoma spp. and B. bigemina presence in 30.4% and 11% individuals, respectively, with eight animals (1.6% being co-infected with both hemoparasites. Subsequent type-specific PCRs revealed that all Trypanosoma PCR positive samples corresponded to T. evansi and that none of the animals harboured T. brucei gambiense or T. brucei rhodesiense. Nucleotide sequencing of the variable surface glycoprotein revealed the T. evansi cattle strain to be most closely related (99% nucleotide sequence identity to strains previously detected in dromedary camels in Egypt, while the 18S rRNA gene phylogeny confirmed the presence of a unique B. bigemina haplotype closely related to strains from Turkey and Brazil. Statistically significant differences in PCR prevalence were noted with respect to gender, clinical status and locality. These results confirm the presence of high numbers of carrier animals and signal the need for expanded surveillance and control efforts.
Chromatin immunoprecipitation to analyze DNA binding sites of HMGA2.
Directory of Open Access Journals (Sweden)
Nina Winter
Full Text Available BACKGROUND: HMGA2 is an architectonic transcription factor abundantly expressed during embryonic and fetal development and it is associated with the progression of malignant tumors. The protein harbours three basically charged DNA binding domains and an acidic protein binding C-terminal domain. DNA binding induces changes of DNA conformation and hence results in global overall change of gene expression patterns. Recently, using a PCR-based SELEX (Systematic Evolution of Ligands by Exponential Enrichment procedure two consensus sequences for HMGA2 binding have been identified. METHODOLOGY/PRINCIPAL FINDINGS: In this investigation chromatin immunoprecipitation (ChIP experiments and bioinformatic methods were used to analyze if these binding sequences can be verified on chromatin of living cells as well. CONCLUSION: After quantification of HMGA2 protein in different cell lines the colon cancer derived cell line HCT116 was chosen for further ChIP experiments because of its 3.4-fold higher HMGA2 protein level. 49 DNA fragments were obtained by ChIP. These fragments containing HMGA2 binding sites have been analyzed for their AT-content, location in the human genome and similarities to sequences generated by a SELEX study. The sequences show a significantly higher AT-content than the average of the human genome. The artificially generated SELEX sequences and short BLAST alignments (11 and 12 bp of the ChIP fragments from living cells show similarities in their organization. The flanking regions are AT-rich, whereas a lower conservation is present in the center of the sequences.
Fujisawa, Masaki; Nakano, Toshitsugu; Ito, Yasuhiro
2011-01-30
During ripening, climacteric fruits increase their ethylene level and subsequently undergo various physiological changes, such as softening, pigmentation and development of aroma and flavor. These changes occur simultaneously and are caused by the highly synchronized expression of numerous genes at the onset of ripening. In tomatoes, the MADS-box transcription factor RIN has been regarded as a key regulator responsible for the onset of ripening by acting upstream of both ethylene- and non-ethylene-mediated controls. However, except for LeACS2, direct targets of RIN have not been clarified, and little is known about the transcriptional cascade for ripening. Using immunoprecipitated (IPed) DNA fragments recovered by chromatin immunoprecipitation (ChIP) with anti-RIN antibody from ripening tomato fruit, we analyzed potential binding sites for RIN (CArG-box sites) in the promoters of representative ripening-induced genes by quantitative PCR. Results revealed nearly a 5- to 20-fold enrichment of CArG boxes in the promoters of LeACS2, LeACS4, PG, TBG4, LeEXP1, and LeMAN4 and of RIN itself, indicating direct interaction of RIN with their promoters in vivo. Moreover, sequence analysis and genome mapping of 51 cloned IPed DNAs revealed potential RIN binding sites. Quantitative PCR revealed that four of the potential binding sites were enriched 4- to 17-fold in the IPed DNA pools compared with the controls, indicating direct interaction of RIN with these sites in vivo. Near one of the four CArG boxes we found a gene encoding a protein similar to thioredoxin y1. An increase in the transcript level of this gene was observed with ripening in normal fruit but not in the rin mutant, suggesting that RIN possibly induces its expression. The presented results suggest that RIN controls fruit softening and ethylene production by the direct transcriptional regulation of cell-wall-modifying genes and ethylene biosynthesis genes during ripening. Moreover, the binding of RIN to its own
A Cross-Reactivity of Fenofibric Acid With MDMA DRI Assay.
Bugier, Sarah; Garcia-Hejl, Carine; Vest, Philippe; Plantamura, Julie; Chianea, Denis; Renard, Christophe
2016-09-01
Within the framework of routine fitness examinations, French Air Force military crew underwent urine testing for 3,4 methylenedioxymetamphetamine (MDMA [ecstasy]). The cross-reactivity of a dyslipidemic drug, fenofibrate, with an MDMA immunoassay was studied and confirmed on a large population sample. A 3-year retrospective study was performed on the MDMA DRI Ecstasy Assay on the Unicel DXC 600. In the event of positive test result, a confirmatory testing was carried out by gas chromatography/mass spectrometry (GC/MS) to establish the presence of MDMA. When analysis by GC/MS did not confirm the presence of MDMA, a false-positive result was suspected and the samples were analyzed by high-performance liquid chromatography-mass spectrometry to identify a potential interfering substance. A total of 15,169 urine samples, from 7,803 patients, were tested for 3 years. Of the tested samples, 22 (0.15%) were positive by DRI Ecstasy Assay. None of them were positive by GC/MS. A cross-reactivity of fenofibrate's metabolite with MDMA using this assay was systematically found. Fenofibrate's interference with MDMA immunoassay was confirmed. Fenofibrate being widely prescribed, physicians had to be alerted that this treatment could lead to false-positive results. Reprint & Copyright © 2016 Association of Military Surgeons of the U.S.
Directory of Open Access Journals (Sweden)
Daniel Castellano-Castillo
Full Text Available Chromatin immunoprecipitation (ChIP has gained importance to identify links between the genome and the proteome. Adipose tissue has emerged as an active tissue, which secretes a wide range of molecules that have been related to metabolic and obesity-related disorders, such as diabetes, cardiovascular failure, metabolic syndrome, or cancer. In turn, epigenetics has raised the importance in discerning the possible relationship between metabolic disorders, lifestyle and environment. However, ChIP application in human adipose tissue is limited by several factors, such as sample size, frozen sample availability, high lipid content and cellular composition of the tissue. Here, we optimize the standard protocol of ChIP for small pieces of frozen human adipose tissue. In addition, we test ChIP for the histone mark H3K4m3, which is related to active promoters, and validate the performance of the ChIP by analyzing gene promoters for factors usually studied in adipose tissue using qPCR. Our improvements result in a higher performance in chromatin shearing and DNA recovery of adipocytes from the tissue, which may be useful for ChIP-qPCR or ChIP-seq analysis.
Multiclass determination and confirmation of antibiotic residues in honey using LC-MS/MS.
Lopez, Mayda I; Pettis, Jeffery S; Smith, I Barton; Chu, Pak-Sin
2008-03-12
A multiclass method has been developed for the determination and confirmation in honey of tetracyclines (chlortetracycline, doxycycline, oxytetracycline, and tetracycline), fluoroquinolones (ciprofloxacin, danofloxacin, difloxacin, enrofloxacin, and sarafloxacin), macrolides (tylosin), lincosamides (lincomycin), aminoglycosides (streptomycin), sulfonamides (sulfathiazole), phenicols (chloramphenicol), and fumagillin residues using liquid chromatography tandem mass spectrometry (LC-MS/MS). Erythromycin (a macrolide) and monensin (an ionophore) can be detected and confirmed but not quantitated. Honey samples (approximately 2 g) are dissolved in 10 mL of water and centrifuged. An aliquot of the supernatant is used to determine streptomycin. The remaining supernatant is filtered through a fine-mesh nylon fabric and cleaned up by solid phase extraction. After solvent evaporation and sample reconstitution, 15 antibiotics are assayed by LC-MS/MS using electrospray ionization (ESI) in positive ion mode. Afterward, chloramphenicol is assayed using ESI in negative ion mode. The method has been validated at the low part per billion levels for most of the drugs with accuracies between 65 and 104% and coefficients of variation less than 17%. The evaluation of matrix effects caused by honey of different floral origin is presented.
Rösner, Stephan; Gehlweiler, Kevin; Küsters, Uta; Kolbert, Mathias; Hübner, Kirsten; Pfennigwerth, Niels; Mack, Dietrich
2018-01-01
Multidrug-resistant Gram-negative bacilli (MDR-GNB) producing carbapenemases are increasing at an alarming speed. Rapid confirmation of carbapenemase type will be an important diagnostic step in clinical microbiology laboratories not only to reduce the risk of transmissions but also for optimising antibiotic therapy in the future. We compared diagnostic reliability of two commercially available molecular assays (Check-Direct CPE vs. AID line probe assay) for detection and typing of carbapenemase genes in 80 well-characterized isolates of MDR-GNB. Respective strains were isolated in various clinical specimens at our clinical microbiology laboratory. The reference standard included confirmation of carbapenemase-production at the molecular level at the German National Reference Laboratory for Multidrug-resistant Gram-negative bacteria (Ruhr-University Bochum, Germany). 53 Enterobacteriaceae and 27 members of the A. baumannii-complex were used in this study. The tested assays appeared highly reliable to confirm carbapenemase-producing Enterobacteriaceae (CPE) with respective sensitivities of 97.7%, but are currently unsuitable for analysis of members of the A. baumannii-complex. Both assays are easy to perform and rapid tools for confirmation and typing of the most common carbapenemase genes in Enterobacteriaceae. Implementation should be possible for any clinical microbiology laboratory with Check-Direct CPE being easier to handle and having less technological requirements.
Directory of Open Access Journals (Sweden)
Stephan Rösner
Full Text Available Multidrug-resistant Gram-negative bacilli (MDR-GNB producing carbapenemases are increasing at an alarming speed. Rapid confirmation of carbapenemase type will be an important diagnostic step in clinical microbiology laboratories not only to reduce the risk of transmissions but also for optimising antibiotic therapy in the future. We compared diagnostic reliability of two commercially available molecular assays (Check-Direct CPE vs. AID line probe assay for detection and typing of carbapenemase genes in 80 well-characterized isolates of MDR-GNB. Respective strains were isolated in various clinical specimens at our clinical microbiology laboratory. The reference standard included confirmation of carbapenemase-production at the molecular level at the German National Reference Laboratory for Multidrug-resistant Gram-negative bacteria (Ruhr-University Bochum, Germany. 53 Enterobacteriaceae and 27 members of the A. baumannii-complex were used in this study. The tested assays appeared highly reliable to confirm carbapenemase-producing Enterobacteriaceae (CPE with respective sensitivities of 97.7%, but are currently unsuitable for analysis of members of the A. baumannii-complex. Both assays are easy to perform and rapid tools for confirmation and typing of the most common carbapenemase genes in Enterobacteriaceae. Implementation should be possible for any clinical microbiology laboratory with Check-Direct CPE being easier to handle and having less technological requirements.
Nikolova, Teodora; Marini, Federico; Kaina, Bernd
2017-10-01
Genotoxicity testing relies on the quantitative measurement of adverse effects, such as chromosome aberrations, micronuclei, and mutations, resulting from primary DNA damage. Ideally, assays will detect DNA damage and cellular responses with high sensitivity, reliability, and throughput. Several novel genotoxicity assays may fulfill these requirements, including the comet assay and the more recently developed γH2AX assay. Although they are thought to be specific for genotoxicants, a systematic comparison of the assays has not yet been undertaken. In the present study, we compare the γH2AX focus assay with the alkaline and neutral versions of the comet assay, as to their sensitivities and limitations for detection of genetic damage. We investigated the dose-response relationships of γH2AX foci and comet tail intensities at various times following treatment with four prototypical genotoxicants, methyl methanesulfonate (MMS), N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), mitomycin C, and hydrogen peroxide (H 2 O 2 ) and we tested whether there is a correlation between the endpoints, i.e., alkali-labile sites and DNA strand breaks on the one hand and the cell's response to DNA double-strand breaks and blocked replication forks on the other. Induction of γH2AX foci gave a linear dose response and all agents tested were positive in the assay. The increase in comet tail intensity was also a function of dose; however, mitomycin C was almost completely ineffective in the comet assay, and the doses needed to achieve a significant effect were somewhat higher for some treatments in the comet assay than in the γH2AX foci assay, which was confirmed by threshold analysis. There was high correlation between tail intensity and γH2AX foci for MMS and H 2 O 2 , less for MNNG, and none for mitomycin C. From this we infer that the γH2AX foci assay is more reliable, sensitive, and robust than the comet assay for detecting genotoxicant-induced DNA damage. Copyright © 2017 Elsevier
Development of a heavy metals enzymatic-based assay using papain
International Nuclear Information System (INIS)
Shukor, Yunus; Baharom, Nor Azlan; Rahman, Fadhil Abd.; Abdullah, Mohd. Puad; Shamaan, Nor Aripin; Syed, Mohd. Arif
2006-01-01
A heavy metals enzymatic-based assay using papain was developed. Papain was assayed using the Casein-coomassie-dye-binding assay. The assay is sensitive to several heavy metals. The IC 50 (concentration of toxicant giving 50% inhibition) of Hg 2+ , Ag 2+ , Pb 2 , Zn 2+ is 0.39, 0.40, 2.16, 2.11 mg l -1 , respectively. For Cu 2+ and Cd 2+ the LOQ (limits of quantitation) is 0.004 and 0.1 mg l -1 , respectively. The IC 50 and LOQ values were found to be generally comparable to several other enzymatic and bioassays tests such as: immobilized urease, 15-min Microtox TM , 48 h Daphnia magna, and 96 h Rainbow trout. The papain assay is xenobiotics tolerant, has a wide pH for optimum activity, is temperature stable, and has a relatively quick assay time. The papain assay was used to identify polluted water samples from industrial sources in Penang, Malaysia. We found one site where the assay gave a positive toxic response. The toxicity of the site was confirmed using Atomic Emission Spectrometry analysis
Herpes simplex encephalitis: MRI findings in two cases confirmed by polymerase chain reaction assay
Energy Technology Data Exchange (ETDEWEB)
Lee, J.W.; Kim, I.O.; Kim, W.S.; Yeon, K.M. [Dept. of Radiology and the Institute of Radiation Medicine, Seoul National University Hospital, Seoul (Korea); Lee, H.-J.; Hwang, Y.S. [Dept. of Paediatrics, Seoul National University College of Medicine, Seoul (Korea)
2001-09-01
Herpes simplex virus (HSV) type I causes a fulminant necrotising meningoencephalitis distinguished from other encephalitides by its focal and often haemorrhagic nature. Specific antiviral therapy with acyclovir can significantly improve the prognosis. We present MRI findings of two cases of herpes simplex encephalitis (HSE) confirmed by PCR analysis, focusing on the serial changes after acyclovir therapy: gyral swelling, high signal intensity on T2-weighted images in the subfrontal region, temporal lobe and insula in the initial stage, then regional extension with enhancement and haemorrhage despite appropriate acyclovir therapy, and finally encephalomalacia and brain atrophy. (orig.)
Herpes simplex encephalitis: MRI findings in two cases confirmed by polymerase chain reaction assay
International Nuclear Information System (INIS)
Lee, J.W.; Kim, I.O.; Kim, W.S.; Yeon, K.M.; Lee, H.-J.; Hwang, Y.S.
2001-01-01
Herpes simplex virus (HSV) type I causes a fulminant necrotising meningoencephalitis distinguished from other encephalitides by its focal and often haemorrhagic nature. Specific antiviral therapy with acyclovir can significantly improve the prognosis. We present MRI findings of two cases of herpes simplex encephalitis (HSE) confirmed by PCR analysis, focusing on the serial changes after acyclovir therapy: gyral swelling, high signal intensity on T2-weighted images in the subfrontal region, temporal lobe and insula in the initial stage, then regional extension with enhancement and haemorrhage despite appropriate acyclovir therapy, and finally encephalomalacia and brain atrophy. (orig.)
van Wilgenburg, Ellen; Elgar, Mark A
2013-01-01
Confirmation bias is a tendency of people to interpret information in a way that confirms their expectations. A long recognized phenomenon in human psychology, confirmation bias can distort the results of a study and thus reduce its reliability. While confirmation bias can be avoided by conducting studies blind to treatment groups, this practice is not always used. Surprisingly, this is true of research in animal behaviour, and the extent to which confirmation bias influences research outcomes in this field is rarely investigated. Here we conducted a meta-analysis, using studies on nestmate recognition in ants, to compare the outcomes of studies that were conducted blind with those that were not. Nestmate recognition studies typically perform intra- and inter colony aggression assays, with the a priori expectation that there should be little or no aggression among nestmates. Aggressive interactions between ants can include subtle behaviours such as mandible flaring and recoil, which can be hard to quantify, making these types of assays prone to confirmation bias. Our survey revealed that only 29% of our sample of 79 studies were conducted blind. These studies were more likely to report aggression among nestmates if they were conducted blind (73%) than if they were not (21%). Moreover, we found that the effect size between nestmate and non-nestmate treatment means is significantly lower in experiments conducted blind than those in which colony identity is known (1.38 versus 2.76). We discuss the implications of the impact of confirmation bias for research that attempts to obtain quantitative synthesises of data from different studies.
Directory of Open Access Journals (Sweden)
Ellen van Wilgenburg
Full Text Available Confirmation bias is a tendency of people to interpret information in a way that confirms their expectations. A long recognized phenomenon in human psychology, confirmation bias can distort the results of a study and thus reduce its reliability. While confirmation bias can be avoided by conducting studies blind to treatment groups, this practice is not always used. Surprisingly, this is true of research in animal behaviour, and the extent to which confirmation bias influences research outcomes in this field is rarely investigated. Here we conducted a meta-analysis, using studies on nestmate recognition in ants, to compare the outcomes of studies that were conducted blind with those that were not. Nestmate recognition studies typically perform intra- and inter colony aggression assays, with the a priori expectation that there should be little or no aggression among nestmates. Aggressive interactions between ants can include subtle behaviours such as mandible flaring and recoil, which can be hard to quantify, making these types of assays prone to confirmation bias. Our survey revealed that only 29% of our sample of 79 studies were conducted blind. These studies were more likely to report aggression among nestmates if they were conducted blind (73% than if they were not (21%. Moreover, we found that the effect size between nestmate and non-nestmate treatment means is significantly lower in experiments conducted blind than those in which colony identity is known (1.38 versus 2.76. We discuss the implications of the impact of confirmation bias for research that attempts to obtain quantitative synthesises of data from different studies.
Chang, Chun-Kai; Kao, Cheng-Feng; Lin, Pi-Han; Huang, Hui-Lin; Ho, Shu-Yuan; Wong, Kuo-Chen; Lin, Bo-Chang; Yeh, Chang-Ching; Lee, Chia-Yeh; Kao, Chuan-Liang; Lee, Chun-Nan; Chang, Sui-Yuan; Yang, Jyh-Yuan
2017-08-01
The fourth-generation human immunodeficiency virus (HIV) combination assay, which can simultaneously detect the presence of anti-HIV antibody and HIV antigen, has been shown to shorten the window period in HIV diagnosis compared with the third-generation HIV antibody immunoassay. This study was aimed to determine the performance of HIV combination assays in Taiwan, where the HIV-1 seroprevalence is 0.007% and HIV-2 infection has never been reported. Performance of three fourth-generation HIV Ag/Ab combination assays (Dia.Pro, Wantai, and Bio-Rad) and one third-generation HIV Ab immunoassay (AxSYM HIV 1/2 gO) was assessed. A total of 152 specimens, including 86 confirmed HIV-seropositive and 66 HIV-seronegative samples, were used in the study. The sensitivity of four assays varied from 98.8% to 100%, and specificity varied from 98.5% to 100%. Performance of the 75 equivocal samples, the HIV status of which was confirmed later, in terms of negative prediction varied from 81.8% to 87.5%. The Bio-Rad and Dia.Pro assays exhibited higher sensitivity for the detection of p24 antigen among the three fourth-generation HIV combination assays. The three fourth-generation HIV Ag/Ab combination assays exhibited better sensitivity, specificity, and negative prediction than the third-generation HIV Ab immunoassay. Copyright © 2015. Published by Elsevier B.V.
Versatile High-Throughput Fluorescence Assay for Monitoring Cas9 Activity.
Seamon, Kyle J; Light, Yooli K; Saada, Edwin A; Schoeniger, Joseph S; Harmon, Brooke
2018-06-05
The RNA-guided DNA nuclease Cas9 is now widely used for the targeted modification of genomes of human cells and various organisms. Despite the extensive use of Clustered Regularly Interspaced Palindromic Repeats (CRISPR) systems for genome engineering and the rapid discovery and engineering of new CRISPR-associated nucleases, there are no high-throughput assays for measuring enzymatic activity. The current laboratory and future therapeutic uses of CRISPR technology have a significant risk of accidental exposure or clinical off-target effects, underscoring the need for therapeutically effective inhibitors of Cas9. Here, we develop a fluorescence assay for monitoring Cas9 nuclease activity and demonstrate its utility with S. pyogenes (Spy), S. aureus (Sau), and C. jejuni (Cje) Cas9. The assay was validated by quantitatively profiling the species specificity of published anti-CRISPR (Acr) proteins, confirming the reported inhibition of Spy Cas9 by AcrIIA4 and Cje Cas9 by AcrIIC1 and no inhibition of Sau Cas9 by either anti-CRISPR. To identify drug-like inhibitors, we performed a screen of 189 606 small molecules for inhibition of Spy Cas9. Of 437 hits (0.2% hit rate), six were confirmed as Cas9 inhibitors in a direct gel electrophoresis secondary assay. The high-throughput nature of this assay makes it broadly applicable for the discovery of additional Cas9 inhibitors or the characterization of Cas9 enzyme variants.
Directory of Open Access Journals (Sweden)
Nakano Toshitsugu
2011-01-01
Full Text Available Abstract Background During ripening, climacteric fruits increase their ethylene level and subsequently undergo various physiological changes, such as softening, pigmentation and development of aroma and flavor. These changes occur simultaneously and are caused by the highly synchronized expression of numerous genes at the onset of ripening. In tomatoes, the MADS-box transcription factor RIN has been regarded as a key regulator responsible for the onset of ripening by acting upstream of both ethylene- and non-ethylene-mediated controls. However, except for LeACS2, direct targets of RIN have not been clarified, and little is known about the transcriptional cascade for ripening. Results Using immunoprecipitated (IPed DNA fragments recovered by chromatin immunoprecipitation (ChIP with anti-RIN antibody from ripening tomato fruit, we analyzed potential binding sites for RIN (CArG-box sites in the promoters of representative ripening-induced genes by quantitative PCR. Results revealed nearly a 5- to 20-fold enrichment of CArG boxes in the promoters of LeACS2, LeACS4, PG, TBG4, LeEXP1, and LeMAN4 and of RIN itself, indicating direct interaction of RIN with their promoters in vivo. Moreover, sequence analysis and genome mapping of 51 cloned IPed DNAs revealed potential RIN binding sites. Quantitative PCR revealed that four of the potential binding sites were enriched 4- to 17-fold in the IPed DNA pools compared with the controls, indicating direct interaction of RIN with these sites in vivo. Near one of the four CArG boxes we found a gene encoding a protein similar to thioredoxin y1. An increase in the transcript level of this gene was observed with ripening in normal fruit but not in the rin mutant, suggesting that RIN possibly induces its expression. Conclusions The presented results suggest that RIN controls fruit softening and ethylene production by the direct transcriptional regulation of cell-wall-modifying genes and ethylene biosynthesis genes
Immunoradiometric assay for cytomegalovirus-specific IgG antibodies
International Nuclear Information System (INIS)
Klapper, P.E.; Cleator, G.M.; Prinja-Wolks, D.; Morris, D.J.
1990-01-01
An immunoradiometric assay (radio-immunosorbent test; RIST) for the detection of IgG antibodies to human herpesvirus 4 [human cytomegalovirus (CMV)] has been developed. The technique utilizes CMV antigen passively adsorbed to a polyvinyl microtitration plate and a radiolabelled murine monoclonal anti-human IgG antibody to detect binding of human antibody to the 'solid phase' reagent. The assay was optimized, and its specifity confirmed by testing paired acute and convalescent sera from patients with acute CMV or other human herpesvirus infections. To determine the assay's sensitivity 1433 blood donor sera were examined. The RIST was more sensitive than a standard complement fixation (CFT). Use of a monoclonal anti-human IgG antibody in the RIST reduced non-specific binding to the control uninfected cell antigen such that blood donor sera could be tested in the assay using only a CMV antigen without generating an unacceptable false positive rate. (author). 23 refs.; 1 tab
Development and evaluation of a rapid dipstick assay for serodiagnosis of acute human brucellosis
Smits, H. L.; Basahi, M. A.; Díaz, R.; Marrodan, T.; Douglas, J. T.; Rocha, A.; Veerman, J.; Zheludkov, M. M.; Witte, O. W.; de Jong, J.; Gussenhoven, G. C.; Goris, M. G.; van der Hoorn, M. A.
1999-01-01
A dipstick assay for the detection of brucella-specific immunoglobulin M antibodies was evaluated with 707 sera from 247 laboratory-confirmed brucellosis patients and 342 control sera from brucellosis-free individuals. These sera were collected from six different countries. The assay was found to be
Principles of validation of diagnostic assays for infectious diseases
International Nuclear Information System (INIS)
Jacobson, R.H.
1998-01-01
Assay validation requires a series of inter-related processes. Assay validation is an experimental process: reagents and protocols are optimized by experimentation to detect the analyte with accuracy and precision. Assay validation is a relative process: its diagnostic sensitivity and diagnostic specificity are calculated relative to test results obtained from reference animal populations of known infection/exposure status. Assay validation is a conditional process: classification of animals in the target population as infected or uninfected is conditional upon how well the reference animal population used to validate the assay represents the target population; accurate predictions of the infection status of animals from test results (PV+ and PV-) are conditional upon the estimated prevalence of disease/infection in the target population. Assay validation is an incremental process: confidence in the validity of an assay increases over time when use confirms that it is robust as demonstrated by accurate and precise results; the assay may also achieve increasing levels of validity as it is upgraded and extended by adding reference populations of known infection status. Assay validation is a continuous process: the assay remains valid only insofar as it continues to provide accurate and precise results as proven through statistical verification. Therefore, the work required for validation of diagnostic assays for infectious diseases does not end with a time-limited series of experiments based on a few reference samples rather, to assure valid test results from an assay requires constant vigilance and maintenance of the assay, along with reassessment of its performance characteristics for each unique population of animals to which it is applied. (author)
MIYACHI, K; HIRANO, Y; HORIGOME, T; MIMORI, T; MIYAKAWA, H; ONOZUKA, Y; SHIBATA, M; HIRAKATA, M; SUWA, A; HOSAKA, H; MATSUSHIMA, S; KOMATSU, T; MATSUSHIMA, H; HANKINS, R W; FRITZLER, M J
2004-01-01
We have reported previously that p95c, a novel 95-kDa cytosolic protein, was the target of autoantibodies in sera of patients with autoimmune hepatic diseases. We studied 30 sera that were shown previously to immunoprecipitate a 95 kDa protein from [35S]-methionine-labelled HeLa lysates and had a specific precipitin band in immunodiffusion. Thirteen sera were available to test the ability of p95c antibodies to inhibit nuclear envelope assembly in an in vitro assay in which confocal fluorescence microscopy was also used to identify the stages at which nuclear assembly was inhibited. The percentage inhibition of nuclear envelope assembly of the 13 sera ranged from 7% to 99% and nuclear envelope assembly and the swelling of nucleus was inhibited at several stages. The percentage inhibition of nuclear assembly was correlated with the titre of anti-p95c as determined by immunodiffusion. To confirm the identity of this autoantigen, we used a full-length cDNA of the p97/valosin-containing protein (VCP) to produce a radiolabelled recombinant protein that was then used in an immunoprecipitation (IP) assay. Our study demonstrated that 12 of the 13 (93%) human sera with antibodies to p95c immunoprecipitated recombinant p97/VCP. Because p95c and p97 have similar molecular masses and cell localization, and because the majority of sera bind recombinant p97/VCP and anti-p95c antibodies inhibit nuclear assembly, this is compelling evidence that p95c and p97/VCP are identical. PMID:15147362
Use of laminar flow patterning for miniaturised biochemical assays
DEFF Research Database (Denmark)
Regenberg, Birgitte; Krühne, Ulrich; Beyer, M.
2004-01-01
Laminar flow in microfluidic chambers was used to construct low (one dimensional) density arrays suitable for miniaturized biochemical assays. By varying the ratio of flows of two guiding streams flanking a sample stream, precise focusing and positioning of the latter was achieved, and reactive s...... species carried in the sample stream were deposited on functionalized chip surfaces as discrete 50 mm wide lanes. Using different model systems we have confirmed the method's suitability for qualitative screening and quantification tasks in receptor-ligand assays, recording biotin...
International Nuclear Information System (INIS)
Keasler, Victor V.; Hodgson, Amanda J.; Madden, Charles R.; Slagle, Betty L.
2009-01-01
Identifying the requirements for the regulatory HBx protein in hepatitis B virus (HBV) replication is an important goal. A plasmid-based HBV replication assay was used to evaluate whether HBx subcellular localization influences its ability to promote virus replication, as measured by real time PCR quantitation of viral capsid-associated DNA. HBx targeted to the nucleus by a nuclear localization signal (NLS-HBx) was able to restore HBx-deficient HBV replication, while HBx containing a nuclear export signal (NES-HBx) was not. Both NLS-HBx and NES-HBx were expressed at similar levels (by immunoprecipitation and Western blotting), and proper localization of the signal sequence-tagged proteins was confirmed by deconvolution microscopy using HBx, NLS-HBx, and NES-HBx proteins fused to GFP. Importantly, these findings were confirmed in vivo by hydrodynamic injection into mice. Our results demonstrate that in these HBV replication assays, at least one function of HBx requires its localization to the nucleus.
LaRbp38: A Leishmania amazonensis protein that binds nuclear and kinetoplast DNAs
International Nuclear Information System (INIS)
Lira, C.B.B.; Siqueira Neto, J.L.; Giardini, M.A.; Winck, F.V.; Ramos, C.H.I.; Cano, M.I.N.
2007-01-01
Leishmania amazonensis causes a wide spectrum of leishmaniasis. There are no vaccines or adequate treatment for leishmaniasis, therefore there is considerable interest in the identification of new targets for anti-leishmania drugs. The central role of telomere-binding proteins in cell maintenance makes these proteins potential targets for new drugs. In this work, we used a combination of purification chromatographies to screen L. amazonensis proteins for molecules capable of binding double-stranded telomeric DNA. This approach resulted in the purification of a 38 kDa polypeptide that was identified by mass spectrometry as Rbp38, a trypanosomatid protein previously shown to stabilize mitochondrial RNA and to associate with nuclear and kinetoplast DNAs. Western blotting and supershift assays confirmed the identity of the protein as LaRbp38. Competition and chromatin immunoprecipitation assays confirmed that LaRbp38 interacted with kinetoplast and nuclear DNAs in vivo and suggested that LaRbp38 may have dual cellular localization and more than one function
Emerging Technologies and Generic Assays for the Detection of Anti-Drug Antibodies
Directory of Open Access Journals (Sweden)
Michael A. Partridge
2016-01-01
Full Text Available Anti-drug antibodies induced by biologic therapeutics often impact drug pharmacokinetics, pharmacodynamics response, clinical efficacy, and patient safety. It is critical to assess the immunogenicity risk of potential biotherapeutics in producing neutralizing and nonneutralizing anti-drug antibodies, especially in clinical phases of drug development. Different assay methodologies have been used to detect all anti-drug antibodies, including ELISA, radioimmunoassay, surface plasmon resonance, and electrochemiluminescence-based technologies. The most commonly used method is a bridging assay, performed in an ELISA or on the Meso Scale Discovery platform. In this report, we aim to review the emerging new assay technologies that can complement or address challenges associated with the bridging assay format in screening and confirmation of ADAs. We also summarize generic anti-drug antibody assays that do not require drug-specific reagents for nonclinical studies. These generic assays significantly reduce assay development efforts and, therefore, shorten the assay readiness timeline.
Directory of Open Access Journals (Sweden)
Vidal Mônica Scarpelli Martinelli
2003-01-01
Full Text Available Chromoblastomycosis (CBM is a chronic subcutaneous infection caused by several dematiaceous fungi. The most commonly etiological agent found in Brazil is Fonsecaea pedrosoi, which appears as thick walled, brownish colored cells with transverse and longitudinal division in the lesions, called "muriform cells". This disease is found worldwide but countries like Madagascar and Brazil have highest incidence. Diagnosis is made by clinical, direct and histopathologic examination and culture of specimens. Serological tests have been used to identify specific antibodies against Fonsecaea pedrosoi antigens, as well as immunotechniques have been used for CBM serological identification and diagnosis. In the present study double immunodiffusion (DID, counterimmunoelectrophoresis (CIE and immunoenzymatic test (ELISA have been used to evaluate humoral immune response in patients with CBM caused by F. pedrosoi. Metabolic antigen was used for immunoprecipitation tests (DID and CIE while somatic antigen for ELISA. Our results demonstrated 53% sensitivity and 96% specificity for DID, while CIE presented 68% sensitivity and 90.5% specificity. ELISA demonstrated 78% sensibility and 83% specificity. Serological tests can be a useful tool to study different aspects of CBM, such as helping differential diagnosis, when culture of the pathogenic agent is impossible.
Ma, Y; Gregorio, G; Gäken, J; Muratori, L; Bianchi, F B; Mieli-Vergani, G; Vergani, D
1997-06-01
Liver kidney microsomal type 1 antibody (LKM1) is the diagnostic marker of autoimmune hepatitis (AIH) type 2 and is also found in patients with hepatitis C virus (HCV) infection. Cytochrome P4502D6 (CYP2D6) is the documented target antigen of LKM1 in AIH, but not in HCV infection. To compare the reactivity in the two conditions, we established a radioligand assay using eukaryotically expressed CYP2D6 as target. A 1.2-kb human CYP2D6 cDNA was isolated from a human liver cDNA library and subcloned into an in vitro transcription vector pSP64 Poly(A). Recombinant CYP2D6 was then produced by in vitro transcription/translation, metabolically labelled with 35S methionine and used in the immunoprecipitation assay. Antibodies that bound radiolabelled CYP2D6 were immunoprecipitated and their levels assessed as cpm. Sera from 50 LKM1-positive patients (26 with AIH; 24 with HCV infection), 128 LKM1-negative patients and 57 normal controls were tested. Reactivity to 35S labelled CYP2D6 was observed in all LKM1-positive sera from patients with AIH and HCV infection, but in none of the controls. The cpm in both conditions were significantly higher than in normal controls (pLKM1 (r 0.87, p<0.001 and r=0.64, p<0.001 for AIH and HCV infection, respectively). Reactivity to 35S labelled CYP2D6 was inhibited by addition of an excess of eukaryotically expressed CYP2D6. CYP2D6 is a major target antigen of both AIH and HCV infection. The novel radioligand assay is highly sensitive and specific.
International Nuclear Information System (INIS)
Nixon, E.
1989-01-01
14 C labeled 4'-phosphopantetheine (PAN) is detectable as 2 bands after SDS-PAGE of mitochondrial proteins. The bands comigrate with subunit 6 of cytochrome oxidase (COX) and a small ATPase subunit in tube gel slices of immunoprecipitates. However, other work demonstrated these bands to be due to modification of a novel protein, related to acyl carrier protein (ACP) of spinach and E. coli, that exists in two forms. To resolve this discrepancy, 1-dimensional (1D) slab and 2-dimensional (2D) SDS-PAGE was used for increased resolution over tube gels. Total mitochondrial protein gels from PAN labeled cells were western blotted, probed for COX, and autoradiographed. In 1D there is exact migration of PAN with COX6. In 2D PAN overlaps a protein distinct from and not antigenically related to COX subunits. These data suggest it is the ACP-like protein that in PAN-modified. Its possible association with COX during assembly will be discussed
Quantitative immunoassays for diagnosis and carrier detection in cystic fibrosis
International Nuclear Information System (INIS)
Bullock, S.; Hayward, C.; Manson, J.; Brock, D.J.H.; Raeburn, J.A.
1982-01-01
Quantitative immunoprecipitation and immunoradiometric assays have been developed for a protein present in the serum of cystic fibrosis homozygotes, and to a lesser extent in the serum of heterozygotes. When tested on a panel of sera from 14 cystic fibrosis patients, 29 heterozygotes and 23 controls, the immunoprecipitation assay allowed correct assignments to be made on 94% of occasions with one batch of antiserum and 95% with another. With the same panel of sera, the immunoradiometric assay allowed 94% correct assignments. It is suggested that such accuracy is the maximum that can be expected in the present state of knowledge of cystic fibrosis. (author)
Riakhovskiĭ, A A; Tillib, S V
2007-09-01
Using the method of immunoprecipitation of the in vivo crosslinked and sheared by sonication chromatin, mapping of potential trithorax-associated regulatory elements within the extended (9 kb) promoter region of the fork head gene (fkh) in the Drosophila melanogaster salivary gland cells was performed. Relative homogeneity of the salivary gland cells, along with the parallel use of the antibodies to different domains of the same trithorax protein (TRX), and the introduction of cross-hybridization steps for additional specific enrichment of initial DNA libraries, provided improvement of the method effectiveness and identification of one major and two less expressed potential TRX-binding sites.
Directory of Open Access Journals (Sweden)
Herrmann Harald
2008-09-01
Full Text Available Abstract Background Colocalization of Stk33 with vimentin by double immunofluorescence in certain cells indicated that vimentin might be a target for phosphorylation by the novel kinase Stk33. We therefore tested in vitro the ability of Stk33 to phosphorylate recombinant full length vimentin and amino-terminal truncated versions thereof. In order to prove that Stk33 and vimentin are also in vivo associated proteins co-immunoprecipitation experiments were carried out. For testing the enzymatic activity of immunoprecipitated Stk33 we incubated precipitated Stk33 with recombinant vimentin proteins. To investigate whether Stk33 binds directly to vimentin, an in vitro co-sedimentation assay was performed. Results The results of the kinase assays demonstrate that Stk33 is able to specifically phosphorylate the non-α-helical amino-terminal domain of vimentin in vitro. Furthermore, co-immunoprecipitation experiments employing cultured cell extracts indicate that Stk33 and vimentin are associated in vivo. Immunoprecipitated Stk33 has enzymatic activity as shown by successful phosphorylation of recombinant vimentin proteins. The results of the co-sedimentation assay suggest that vimentin binds directly to Stk33 and that no additional protein mediates the association. Conclusion We hypothesize that Stk33 is involved in the in vivo dynamics of the intermediate filament cytoskeleton by phosphorylating vimentin.
Analytical and Clinical Performance Evaluation of the Abbott Architect PIVKA Assay.
Ko, Dae-Hyun; Hyun, Jungwon; Kim, Hyun Soo; Park, Min-Jeong; Kim, Jae-Seok; Park, Ji-Young; Shin, Dong Hoon; Cho, Hyoun Chan
2018-01-01
Protein induced by vitamin K absence (PIVKA) is measured using various assays and is used to help diagnose hepatocellular carcinoma. The present study evaluated the analytical and clinical performances of the recently released Abbott Architect PIVKA assay. Precision, linearity, and correlation tests were performed in accordance with the Clinical Laboratory Standardization Institute guidelines. Sample type suitability was assessed using serum and plasma samples from the same patients, and the reference interval was established using sera from 204 healthy individuals. The assay had coefficients of variation of 3.2-3.5% and intra-laboratory variation of 3.6-5.5%. Linearity was confirmed across the entire measurable range. The Architect PIVKA assay was comparable to the Lumipulse PIVKA assay, and the plasma and serum samples provided similar results. The lower reference limit was 13.0 mAU/mL and the upper reference limit was 37.4 mAU/mL. The ability of the Architect PIVKA assay to detect hepatocellular carcinoma was comparable to that of the alpha-fetoprotein test and the Lumipulse PIVKA assay. The Architect PIVKA assay provides excellent analytical and clinical performance, is simple for clinical laboratories to adopt, and has improved sample type suitability that could broaden the assay's utility. © 2018 by the Association of Clinical Scientists, Inc.
Determination of assay and impurities of gamma irradiated chloramphenicol in eye ointment
International Nuclear Information System (INIS)
Hong, L.; Altorfer, H.R.
2005-01-01
A sample preparation method was developed to isolate chloramphenicol and its radiolytic products from an oily ointment base. The isolation method suspended the eye ointment in n-hexane at 45 deg C, and isolated the target compounds as residue by centrifugation. It was found that the main element to ensure a satisfactory isolation was keeping the sample solution at 45 deg C during sample preparation. Linearity, precision, accuracy and suitability of the method were confirmed valid for both assay and impurity tests. This isolation method was ideal for assay, unique for extraction of unexpected and complex radiolysis products, and had a number of advantages compared to the pretreatment methods described in the United States Pharmacopoeia and British Pharmacopoeia, in terms of accuracy, precision, and easy handling. The effect of γ-irradiation on chloramphenicol eye ointment was studied by HPLC-DAD, after applying the developed sample preparation method. The present assay and impurity test methods with HPLC-DAD were confirmed to be suitable for irradiated chloramphenicol in eye ointment. (author)
Automated immunoradiometric assay of thyrotrophin (TSH) in dried blood filter paper spots
Energy Technology Data Exchange (ETDEWEB)
John, R.; Woodhead, J.S. (Welsh National School of Medicine, Cardiff (UK))
1982-11-10
An immunoradiometric two-site assay for thyrotrophin (TSH) in dried blood filter paper spots is described. The assay is automated by means of the Kemtek 3000 automated immunoassay system. The technique uses a 6.0 mm disc punched from the dried blood samples collected as part of the screening programme for phenylketonuria. The method is sensitive and precise, and results correlate well with those obtained in TSH assays of serum samples. The procedure is rapid, results being available within 24 h of receipt of samples. Of 25204 specimens so far screened by this assay, 99.9% have TSH levels less than 15 mU/l. One false positive result has been obtained and six confirmed cases of neonatal hypothyroidism detected, giving a prevalence of 1 in 4200.
Miao, Dongmei; Steck, Andrea K; Zhang, Li; Guyer, K Michelle; Jiang, Ling; Armstrong, Taylor; Muller, Sarah M; Krischer, Jeffrey; Rewers, Marian; Yu, Liping
2015-02-01
We recently developed new electrochemiluminescence (ECL) insulin autoantibody (IAA) and glutamic acid decarboxylase 65 autoantibody (GADA) assays that discriminate high-affinity, high-risk diabetes-specific autoantibodies from low-affinity, low-risk islet autoantibodies (iAbs) detected by radioassay (RAD). Here, we report a further validation of the ECL-IAA and -GADA assays in 3,484 TrialNet study participants. The ECL assay and RAD were congruent in those with prediabetes and in subjects with multiple autoantibodies, but only 24% (P<0.0001) of single RAD-IAA-positive and 46% (P<0.0001) of single RAD-GADA-positive were confirmed by the ECL-IAA and -GADA assays, respectively. During a follow-up (mean, 2.4 years), 51% of RAD-IAA-positive and 63% of RAD-GADA-positive subjects not confirmed by ECL became iAb negative, compared with only 17% of RAD-IAA-positive (P<0.0001) and 15% of RAD-GADA-positive (P<0.0001) subjects confirmed by ECL assays. Among subjects with multiple iAbs, diabetes-free survival was significantly shorter if IAA or GADA was positive by ECL and negative by RAD than if IAA or GADA was negative by ECL and positive by RAD (P<0.019 and P<0.0001, respectively). Both positive and negative predictive values in terms of progression to type 1 diabetes mellitus were superior for ECL-IAA and ECL-GADA, compared with RADs. The prevalence of the high-risk human leukocyte antigen-DR3/4, DQB1*0302 genotype was significantly higher in subjects with RAD-IAA or RAD-GADA confirmed by ECL. In conclusion, both ECL-IAA and -GADA are more disease-specific and better able to predict the risk of progression to type 1 diabetes mellitus than the current standard RADs.
Niu, Yuchun; Ma, Feng; Huang, Weimei; Fang, Shun; Li, Man; Wei, Ting; Guo, Linlang
2017-01-09
Taurine upregulated gene1 (TUG1) as a 7.1-kb lncRNA, has been shown to play an oncogenic role in various cancers. However, the biological functions of lncRNA TUG1 in small cell lung cancer (SCLC) remain unknown. The aim of this study is to explore the roles of TUG1 in cell growth and chemoresistance of SCLC and its possible molecular mechanism. The expression of TUG1 in thirty-three cases of SCLC tissues and SCLC cell line were examined by quantitative RT-PCR (qRT-PCR). The functional roles of TUG1 in SCLC were demonstrated by CCK8 assay, colony formation assay, wound healing assay and transwell assay, flow cytometry analysis and in vivo study through siRNA or shRNA mediated knockdown. Western blot assays were used to evaluate gene and protein expression in cell lines. Chromatin immunoprecipitation (ChIP) and RNA binding protein immunoprecipitation (RIP) were performed to confirm the molecular mechanism of TUG1 involved in cell growth and chemoresistance of small cell lung cancer. We found that TUG1 was overexpressed in SCLC tissues, and its expression was correlated with the clinical stage and the shorter survival time of SCLC patients. Moreover, downregulation of TUG1 expression could impair cell proliferation and increased cell sensitivity to anticancer drugs both in vitro and in vivo. We also discovered that TUG1 knockdown significantly promoted cell apoptosis and cell cycle arrest, and inhibited cell migration and invasion in vitro . We further demonstrated that TUG1 can regulate the expression of LIMK2b (a splice variant of LIM-kinase 2) via binding with enhancer of zeste homolog 2 (EZH2), and then promoted cell growth and chemoresistance of SCLC. Together, these results suggested that TUG1 mediates cell growth and chemoresistance of SCLC by regulating LIMK2b via EZH2.
Kremastinou, J; Polymerou, V; Lavranos, D; Aranda Arrufat, A; Harwood, J; Martínez Lorenzo, M J; Ng, K P; Queiros, L; Vereb, I; Cusini, M
2016-09-01
Treponema pallidum infections can have severe complications if not diagnosed and treated at an early stage. Screening and diagnosis of syphilis require assays with high specificity and sensitivity. The Elecsys Syphilis assay is an automated treponemal immunoassay for the detection of antibodies against T. pallidum The performance of this assay was investigated previously in a multicenter study. The current study expands on that evaluation in a variety of diagnostic settings and patient populations, at seven independent laboratories. The samples included routine diagnostic samples, blood donation samples, samples from patients with confirmed HIV infections, samples from living organ or bone marrow donors, and banked samples, including samples previously confirmed as syphilis positive. This study also investigated the seroconversion sensitivity of the assay. With a total of 1,965 syphilis-negative routine diagnostic samples and 5,792 syphilis-negative samples collected from blood donations, the Elecsys Syphilis assay had specificity values of 99.85% and 99.86%, respectively. With 333 samples previously identified as syphilis positive, the sensitivity was 100% regardless of disease stage. The assay also showed 100% sensitivity and specificity with samples from 69 patients coinfected with HIV. The Elecsys Syphilis assay detected infection in the same bleed or earlier, compared with comparator assays, in a set of sequential samples from a patient with primary syphilis. In archived serial blood samples collected from 14 patients with direct diagnoses of primary syphilis, the Elecsys Syphilis assay detected T. pallidum antibodies for 3 patients for whom antibodies were not detected with the Architect Syphilis TP assay, indicating a trend for earlier detection of infection, which may have the potential to shorten the time between infection and reactive screening test results. Copyright © 2016 Kremastinou et al.
Kremastinou, J.; Polymerou, V.; Lavranos, D.; Aranda Arrufat, A.; Harwood, J.; Martínez Lorenzo, M. J.; Ng, K. P.; Queiros, L.; Vereb, I.
2016-01-01
Treponema pallidum infections can have severe complications if not diagnosed and treated at an early stage. Screening and diagnosis of syphilis require assays with high specificity and sensitivity. The Elecsys Syphilis assay is an automated treponemal immunoassay for the detection of antibodies against T. pallidum. The performance of this assay was investigated previously in a multicenter study. The current study expands on that evaluation in a variety of diagnostic settings and patient populations, at seven independent laboratories. The samples included routine diagnostic samples, blood donation samples, samples from patients with confirmed HIV infections, samples from living organ or bone marrow donors, and banked samples, including samples previously confirmed as syphilis positive. This study also investigated the seroconversion sensitivity of the assay. With a total of 1,965 syphilis-negative routine diagnostic samples and 5,792 syphilis-negative samples collected from blood donations, the Elecsys Syphilis assay had specificity values of 99.85% and 99.86%, respectively. With 333 samples previously identified as syphilis positive, the sensitivity was 100% regardless of disease stage. The assay also showed 100% sensitivity and specificity with samples from 69 patients coinfected with HIV. The Elecsys Syphilis assay detected infection in the same bleed or earlier, compared with comparator assays, in a set of sequential samples from a patient with primary syphilis. In archived serial blood samples collected from 14 patients with direct diagnoses of primary syphilis, the Elecsys Syphilis assay detected T. pallidum antibodies for 3 patients for whom antibodies were not detected with the Architect Syphilis TP assay, indicating a trend for earlier detection of infection, which may have the potential to shorten the time between infection and reactive screening test results. PMID:27358468
A duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains.
Benacer, Douadi; Zain, Siti Nursheena Mohd; Lewis, John W; Khalid, Mohd Khairul Nizam Mohd; Thong, Kwai Lin
2017-01-01
This study aimed to develop a duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains. Primers were designed to target the rrs (LG1/LG2) and ligB (LP1/LP2) genes to confirm the presence of the Leptospira genus and the pathogenic species, respectively. The assay showed 100% specificity against 17 Leptospira strains with a limit of detection of 23.1pg/µl of leptospiral DNA and sensitivity of 103 leptospires/ml in both spiked urine and water. Our duplex endpoint PCR assay is suitable for rapid early detection of Leptospira with high sensitivity and specificity.
Reverse zymography alone does not confirm presence of a protease inhibitor.
Dutta, Sangita; Bhattacharyya, Debasish
2013-03-01
Reverse zymography is applied for identification and semi-quantification of protease inhibitors that are of protein in nature. However, a protein that shows band in reverse zymography against a protease used for digestion of the gel need not be an inhibitor; it might be resistant to degradation by the protease. We demonstrate that in reverse zymography, avidin, streptavidin and the leaf extract of Catharanthus roseus behave like inhibitors of proteases like papain, ficin, bromelain extracts from pineapple leaf, stem and fruit and trypsin. Still, they do not act as inhibitors of those proteases when enzyme assays were done in solution. In reverse zymography, the extract of pineapple crown leaf shows two major inhibitor bands against its own proteases. Identification of these proteins from sequences derived from MALDI TOF MS analysis indicated that they are fruit and stem bromelains. Avidin, streptavidin and bromelains are 'kinetically stable proteins' that are usually resistant to proteolysis. Thus, it is recommended that identification of an inhibitor of a protease by reverse zymography should be supported by independent assay methods for confirmation.
Ollier, Laurence; Laffont, Catherine; Kechkekian, Aurore; Doglio, Alain; Giordanengo, Valérie
2008-12-01
Routine use of the automated chemiluminescent microparticle immunoassay Abbott ARCHITECT anti-HBc for diagnosis of hepatitis B is limited in case of borderline reactive sera with low signal close to the cut-off index. In order to determine the significance of anti-HBc detection when borderline reactivity occurs using the ARCHITECT anti-HBc assay, a comparative study was designed. 3540 serum samples collected over a 2-month period in the hospital of Nice were examined for markers of HBV infection (HBsAg, anti-HBs and anti-HBc). One hundred seven samples with sufficient volume and with borderline reactivity by the ARCHITECT assay were tested by two other anti-HBc assays, a microparticle enzyme immunoassay (MEIA, AxSYM Core, Abbott Laboratories, IL, USA) and an enzyme linked fluorescent assay (ELFA, VIDAS Anti-HBc Total II, bioMérieux, Lyon, France). Only 46 samples were confirmed by the AxSYM and the VIDAS assays. Additional serological information linked to patient history showed that the remaining samples (61) were false positives (11), had low titer of anti-HBc antibodies (13), or were inconclusive (37). This comparative study highlighted the existence of a grey zone around the cut-off index. Confirmative results through a different immunoassay are needed to confirm the diagnosis of HBV on borderline reactive sera using the ARCHITECT anti-HBc assay.
International Nuclear Information System (INIS)
Lindner, E.N.
2000-01-01
As described, the purpose of the Performance Confirmation Plan is to specify monitoring, testing, and analysis activities for evaluating the accuracy and adequacy of the information used to determine that performance objectives for postclosure will be met. This plan defines a number of specific performance confirmation activities and associated test concepts in support of the MGR that will be implemented to fulfill this purpose. In doing so, the plan defines an approach to identify key factors and processes, predict performance, establish tolerances and test criteria, collect data (through monitoring, testing, and experiments), analyze these data, and recommend appropriate action. The process of defining which factors to address under performance confirmation incorporates input from several areas. In all cases, key performance confirmation factors are those factors which are: (1) important to safety, (2) measurable and predictable, and (3) relevant to the program (i.e., a factor that is affected by construction, emplacement, or is a time-dependent variable). For the present version of the plan, performance confirmation factors important to safety are identified using the principal factors from the RSS (CRWMS M and O 2000a) (which is derived from TSPA analyses) together with other available performance assessment analyses. With this basis, key performance confirmation factors have been identified, and test concepts and test descriptions have been developed in the plan. Other activities are also incorporated into the performance confirmation program outside of these key factors. Additional activities and tests have been incorporated when they are prescribed by requirements and regulations or are necessary to address data needs and model validation requirements relevant to postclosure safety. These other activities have been included with identified factors to construct the overall performance confirmation program
International Nuclear Information System (INIS)
Lindner, E.N.
2000-01-01
As described, the purpose of the Performance Confirmation Plan is to specify monitoring, testing, and analysis activities for evaluating the accuracy and adequacy of the information used to determine that performance objectives for postclosure will be met. This plan defines a number of specific performance confirmation activities and associated test concepts in support of the MGR that will be implemented to fulfill this purpose. In doing so, the plan defines an approach to identify key factors and processes, predict performance, establish tolerances and test criteria, collect data (through monitoring, testing, and experiments), analyze these data, and recommend appropriate action. The process of defining which factors to address under performance confirmation incorporates input from several areas. In all cases, key performance confirmation factors are those factors which are: (1) important to safety, (2) measurable and predictable, and (3) relevant to the program (i.e., a factor that i s affected by construction, emplacement, or is a time-dependent variable). For the present version of the plan, performance confirmation factors important to safety are identified using the principal factors from the RSS (CRWMS M and O 2000a) (which is derived from TSPA analyses) together with other available performance assessment analyses. With this basis, key performance confirmation factors have been identified, and test concepts and test descriptions have been developed in the plan. Other activities are also incorporated into the performance confirmation program outside of these key factors. Additional activities and tests have been incorporated when they are prescribed by requirements and regulations or are necessary to address data needs and model validation requirements relevant to postclosure safety. These other activities have been included with identified factors to construct the overall performance confirmation program
Field experience with a mobile tomographic nondestructive assay system
International Nuclear Information System (INIS)
Prettyman, T.H.; Betts, S.E.; Taggart, D.P.; Estep, R.J.; Nicholas, N.J.; Lucas, M.C.; Harlan, R.A.
1995-01-01
A mobile tomographic gamma-ray scanner (TGS) developed by Los Alamos National Laboratory was recently demonstrated at the Rocky Flats Environmental Technology Site and is currently in use at Los Alamos waste storage areas. The scanner was developed to assay radionuclides in low-level, transuranic, and mixed waste in containers ranging in size from 2 ft 3 boxes to 83-gallon overpacks. The tomographic imaging capability provides a complete correction for source distribution and matrix attenuation effects, enabling accurate assays of Pu-239 and other gamma-ray emitting isotopes. In addition, the system can reliably detect self-absorbing material such as plutonium metal shot, and can correct for bias caused by self-absorption. The system can be quickly configured to execute far-field scans, segmented gamma-ray scans, and a host of intermediate scanning protocols, enabling higher throughput (up to 20 drums per 8-hour shift). In this paper, we will report on the results of field trials of the mobile system at Rocky Flats and Los Alamos. Assay accuracy is confirmed for cases in which TGS assays can be compared with assays (e.g. with calorimetry) of individual packages within the drums. The mobile tomographic technology is expected to considerably reduce characterization costs at DOE production and environmental technology sites
Use of immunoblotting assay improves the sensitivity of paracoccidioidomycosis diagnosis
Directory of Open Access Journals (Sweden)
D. F. Silva
2008-01-01
Full Text Available The purpose of this work was to evaluate two serological assays: double immunodiffusion (DI and immunoblotting (IB in immunodiagnosis of paracoccidioidomycosis (PCM. We evaluated by IB assay 23 sera samples from patients with clinical confirmation of PCM, all of them with negative DI results against culture filtrate from Paracoccidioides brasiliensis isolate 113. For IB, as well as for comparative DI assay, we employed soluble components of the cell wall outer surface (SCCWOS from P. brasiliensis isolate 113 cultivated at 36°C in Fava-Neto's agar medium for 5 and 10 days. Among the 20 sera samples analyzed by DI, 13 (65% were negative and 7 (35% were positive against SCCWOS obtained on the 5th and 10th days. By IB assay, 95.4% and 100% of sera reacted against gp43 and gp70 present in SCCWOS from the 5th day and 95.6% recognized these fractions when evaluated against SCCWOS from the 10th day. Our results demonstrated that the use of an immunoenzymatic assay significantly improves the sensitivity of PCM immunodiagnosis and also suggests that at least two serological tests for antibody detection should be adopted in cases of questionable diagnosis.
Cytosolic 5'-nucleotidase II interacts with the leucin rich repeat of NLR family member Ipaf.
Directory of Open Access Journals (Sweden)
Federico Cividini
Full Text Available IMP/GMP preferring cytosolic 5'-nucleotidase II (cN-II is a bifunctional enzyme whose activities and expression play crucial roles in nucleotide pool maintenance, nucleotide-dependent pathways and programmed cell death. Alignment of primary amino acid sequences of cN-II from human and other organisms show a strong conservation throughout the entire vertebrata taxon suggesting a fundamental role in eukaryotic cells. With the aim to investigate the potential role of this homology in protein-protein interactions, a two hybrid system screening of cN-II interactors was performed in S. cerevisiae. Among the X positive hits, the Leucin Rich Repeat (LRR domain of Ipaf was found to interact with cN-II. Recombinant Ipaf isoform B (lacking the Nucleotide Binding Domain was used in an in vitro affinity chromatography assay confirming the interaction obtained in the screening. Moreover, co-immunoprecipitation with proteins from wild type Human Embryonic Kidney 293 T cells demonstrated that endogenous cN-II co-immunoprecipitated both with wild type Ipaf and its LRR domain after transfection with corresponding expression vectors, but not with Ipaf lacking the LRR domain. These results suggest that the interaction takes place through the LRR domain of Ipaf. In addition, a proximity ligation assay was performed in A549 lung carcinoma cells and in MDA-MB-231 breast cancer cells and showed a positive cytosolic signal, confirming that this interaction occurs in human cells. This is the first report of a protein-protein interaction involving cN-II, suggesting either novel functions or an additional level of regulation of this complex enzyme.
Sonkar, Subash C; Sachdev, Divya; Mishra, Prashant K; Kumar, Anita; Mittal, Pratima; Saluja, Daman
2016-12-15
The currently available nucleic acid amplification tests (NAATs) for trichomoniasis are accurate, quick and confirmative with superior sensitivity than traditional culture-based microbiology assays. However, these assays are associated with problems of carry over contamination, false positive results, requirement of technical expertise for performance and detection of end product. Hence, a diagnostic assay with easy visualization of the amplified product will be profitable. An in-house, rapid, sensitive, specific molecular-beacon-based PCR assay, using primers against pfoB gene of Trichomonas vaginalis, was developed and evaluated using dry ectocervical swabs (n=392) from symptomatic females with vaginal discharge. Total DNA was isolated and used as template for the PCR assays. The performance and reproducibility of PCR assay was evaluated by composite reference standard (CRS). For easy visualization of the amplified product, molecular-beacon was designed and amplicons were visualized directly using fluorescent handheld dark reader or by Micro-Plate Reader. Molecular-beacons are single-stranded hairpin shaped nucleic acid probes composed of a stem, with fluorophore/quencher pair and a loop region complementary to the desired DNA. The beacon-based PCR assay designed in the present study is highly specific as confirmed by competition experiments and extremely sensitive with detection limit of 20fg of genomic DNA (3-4 pathogens). The minimum infrastructure requirement and ease to perform the assay makes this method highly useful for resource poor countries for better disease management. Copyright © 2016 Elsevier B.V. All rights reserved.
Repository performance confirmation
International Nuclear Information System (INIS)
Hansen, Francis D.
2011-01-01
Repository performance confirmation links the technical bases of repository science and societal acceptance. This paper explores the myriad aspects of what has been labeled performance confirmation in U.S. programs, which involves monitoring as a collection of distinct activities combining technical and social significance in radioactive waste management. This paper is divided into four parts: (1) A distinction is drawn between performance confirmation monitoring and other testing and monitoring objectives; (2) A case study illustrates confirmation activities integrated within a long-term testing and monitoring strategy for Yucca Mountain; (3) A case study reviews compliance monitoring developed and implemented for the Waste Isolation Pilot Plant; and (4) An approach for developing, evaluating and implementing the next generation of performance confirmation monitoring is presented. International interest in repository monitoring is exhibited by the European Commission Seventh Framework Programme 'Monitoring Developments for Safe Repository Operation and Staged Closure' (MoDeRn) Project. The MoDeRn partners are considering the role of monitoring in a phased approach to the geological disposal of radioactive waste. As repository plans advance in different countries, the need to consider monitoring strategies within a controlled framework has become more apparent. The MoDeRn project pulls together technical and societal experts to assimilate a common understanding of a process that could be followed to develop a monitoring program. A fundamental consideration is the differentiation of confirmation monitoring from the many other testing and monitoring activities. Recently, the license application for Yucca Mountain provided a case study including a technical process for meeting regulatory requirements to confirm repository performance as well as considerations related to the preservation of retrievability. The performance confirmation plan developed as part of the
Chang, Ti Ling; Ito, Kosei; Ko, Tun Kiat; Liu, Qiang; Salto-Tellez, Manuel; Yeoh, Khay Guan; Fukamachi, Hiroshi; Ito, Yoshiaki
2010-01-01
The transcription factor RUNX3 is a gastric tumor suppressor. Tumorigenic Runx3(-/-) gastric epithelial cells attach weakly to each other, compared with nontumorigenic Runx3(+/+) cells. We aimed to identify RUNX3 target genes that promote cell-cell contact to improve our understanding of RUNX3's role in suppressing gastric carcinogenesis. We compared gene expression profiles of Runx3(+/+) and Runx3(-/-) cells and observed down-regulation of genes associated with cell-cell adhesion in Runx3(-/-) cells. Reporter, mobility shift, and chromatin immunoprecipitation assays were used to examine the regulation of these genes by RUNX3. Tumorigenesis assays and immunohistological analyses of human gastric tumors were performed to confirm the role of the candidate genes in gastric tumor development. Mobility shift and chromatin immunoprecipitation assays revealed that the promoter activity of the gene that encodes the tight junction protein claudin-1 was up-regulated via the binding of RUNX3 to the RUNX consensus sites. The tumorigenicity of gastric epithelial cells from Runx3(-/-) mice was significantly reduced by restoration of claudin-1 expression, whereas knockdown of claudin-1 increased the tumorigenicity of human gastric cancer cells. Concomitant expression of RUNX3 and claudin-1 was observed in human normal gastric epithelium and cancers. The tight junction protein claudin-1 has gastric tumor suppressive activity and is a direct transcriptional target of RUNX3. Claudin-1 is down-regulated during the epithelial-mesenchymal transition; RUNX3 might therefore act as a tumor suppressor to antagonize the epithelial-mesenchymal transition. Copyright 2010 AGA Institute. Published by Elsevier Inc. All rights reserved.
Identification of extracellular signal-regulated kinase 3 as a new interaction partner of cyclin D3
International Nuclear Information System (INIS)
Sun Maoyun; Wei Yuanyan; Yao Luyang; Xie Jianhui; Chen Xiaoning; Wang Hanzhou; Jiang Jianhai; Gu Jianxin
2006-01-01
Cyclin D3, like cyclin D1 and D2 isoforms, is a crucial component of the core cell cycle machinery in mammalian cells. It also exhibits its unique properties in many other physiological processes. In the present study, using yeast two-hybrid screening, we identified ERK3, an atypical mitogen-activated protein kinase (MAPK), as a cyclin D3 binding partner. GST pull-down assays showed that cyclin D3 interacts directly and specifically with ERK3 in vitro. The binding of cyclin D3 and ERK3 was further confirmed in vivo by co-immunoprecipitation assay and confocal microscopic analysis. Moreover, carboxy-terminal extension of ERK3 was responsible for its association with intact cyclin D3. These findings further expand distinct roles of cyclin D3 and suggest the potential activity of ERK3 in cell proliferation
Mizanbayeva, Sulushash; Smits, Henk L.; Zhalilova, Katya; Abdoel, Theresia H.; Kozakov, Stanislaw; Ospanov, Kenes S.; Elzer, Philip H.; Douglas, James T.
2009-01-01
Serum samples from all patients with culture-confirmed brucellosis including those with chronic disease from Kazakhstan tested positive in the serum agglutination test for titers > or = 1:25 and reacted in the Brucella immunoglobulin M/immunoglobulin G lateral flow assay (LFA) confirming the high
Martínez-Valladares, María; Rojo-Vázquez, Francisco Antonio
2016-02-05
Loop-mediated isothermal amplification (LAMP) is a very specific, efficient, and rapid gene amplification procedure in which the reaction can run at a constant temperature. In the current study we have developed a LAMP assay to improve the diagnosis of Fasciola spp. in the faeces of sheep. After the optimisation of the LAMP assay we have shown similar results between this technique and the standard PCR using the outer primers of the LAMP reaction. In both cases the limit of detection was 10 pg; also, the diagnosis of fasciolosis was confirmed during the first week post-infection in experimental infected sheep by both techniques. In eight naturally infected sheep, the infection with F. hepatica was confirmed in all animals before a treatment with triclabendazole and on day 30 post treatment in two sheep using the LAMP assay; however, when we carried out the standard PCR with the outer primers, the results before treatment were the same but on day 30 post-treatment the infection was only confirmed in one out of the two sheep. On the other hand, the standard PCR took around 3 h to obtain a result, comparing with 1 h and 10 min for the LAMP assay. The LAMP assay described here could be a good alternative to conventional diagnostic methods to detect F. hepatica in faeces since it solves the drawbacks of the standard PCR.
Mekonnen, Solomon A; Beissner, Marcus; Saar, Malkin; Ali, Solomon; Zeynudin, Ahmed; Tesfaye, Kassahun; Adbaru, Mulatu G; Battke, Florian; Poppert, Sven; Hoelscher, Michael; Löscher, Thomas; Bretzel, Gisela; Herbinger, Karl-Heinz
2017-10-02
Onchocerciasis is a parasitic disease caused by the filarial nematode Onchocerca volvulus. In endemic areas, the diagnosis is commonly confirmed by microscopic examination of skin snip samples, though this technique is considered to have low sensitivity. The available melting-curve based quantitative real-time PCR (qPCR) using degenerated primers targeting the O-150 repeat of O. volvulus was considered insufficient for confirming the individual diagnosis, especially in elimination studies. This study aimed to improve detection of O. volvulus DNA in clinical samples through the development of a highly sensitive qPCR assay. A novel hydrolysis probe based qPCR assay was designed targeting the specific sequence of the O. volvulus O-5S rRNA gene. A total of 200 clinically suspected onchocerciasis cases were included from Goma district in South-west Ethiopia, from October 2012 through May 2013. Skin snip samples were collected and subjected to microscopy, O-150 qPCR, and the novel O-5S qPCR. Among the 200 individuals, 133 patients tested positive (positivity rate of 66.5%) and 67 negative by O-5S qPCR, 74 tested positive by microscopy (37.0%) and 78 tested positive by O-150 qPCR (39.0%). Among the 133 O-5S qPCR positive individuals, microscopy and O-150 qPCR detected 55.6 and 59.4% patients, respectively, implying a higher sensitivity of O-5S qPCR than microscopy and O-150 qPCR. None of the 67 individuals who tested negative by O-5S qPCR tested positive by microscopy or O-150 qPCR, implying 100% specificity of the newly designed O-5S qPCR assay. The novel O-5S qPCR assay is more sensitive than both microscopic examination and the existing O-150 qPCR for the detection of O. volvulus from skin snip samples. The newly designed assay is an important step towards appropriate individual diagnosis and control of onchocerciasis.
An automated immunoradiometric assay of thyrotrophin (TSH) in dried blood filter paper spots
International Nuclear Information System (INIS)
John, R.; Woodhead, J.S.
1982-01-01
An immunoradiometric two-site assay for thyrotrophin (TSH) in dried blood filter paper spots is described. The assay is automated by means of the Kemtek 3000 automated immunoassay system. The technique uses a 6.0 mm disc punched from the dried blood samples collected as part of the screening programme for phenylketonuria. The method is sensitive and precise, and results correlate well with those obtained in TSH assays of serum samples. The procedure is rapid, results being available within 24 h of receipt of samples. Of 25204 specimens so far screened by this assay, 99.9% have TSH levels less than 15 mU/l. One false positive result has been obtained and six confirmed cases of neonatal hypothyroidism detected, giving a prevalence of 1 in 4200. (Auth.)
Gurav, Yogesh K; Yadav, Pragya D; Gokhale, Mangesh D; Chiplunkar, Tushar R; Vishwanathan, Rajlakshmi; Patil, Deepak Y; Jain, Rajlaxmi; Shete, Anita M; Patil, Savita L; Sarang, G D; Sapkal, Gajanan N; Andhare, M D; Sale, Y R; Awate, Pradeep S; Mourya, Devendra T
2018-03-01
Kyasanur forest disease (KFD) outbreak was confirmed in Dodamarg Taluka, Sindhudurga district (Maharashtra) in India during the year 2016. The rise in suspected KFD cases was reported in January 2016, peaked during March, and then declined gradually from April 2016. The outbreak was thoroughly investigated considering different socio-clinical parameters. Total, 488 suspected KFD cases were investigated using KFD specific real-time RT-PCR and anti-KFDV IgM enzyme-linked immunosorbent assay (ELISA). Sero-epidemiological survey was carried out in the affected area using anti-KFDV IgG ELISA. Among suspected KFD cases, high age-specific attack rate (105.1 per 1000 persons) was observed in adults (aged 40-59 years). Out of 488 suspected KFD cases, 130 were laboratory confirmed. Of these, 54 cases were KFDV real-time RT-PCR positive, 66 cases were anti-KFDV IgM ELISA positive and 10 cases were positive by both the assays. Case fatality ratio among laboratory-confirmed KFD cases were 2.3% (3/130). Majority of laboratory-confirmed KFD cases (93.1%) had visited Western Ghats forest in Dodamarg for activities like working in cashew nut farms (79.8%), cashew nut fruit collection (76.6%), collection of firewood (68.5%) and dry leaves/grass (40.3%), etc., before the start of symptoms. Common clinical features included fever (100%), headache (93.1%), weakness (84.6%), and myalgia (83.1%). Hemorrhagic manifestations were observed in nearly one-third of the laboratory-confirmed KFD cases (28.5%). A seroprevalence of (9.7%, 72/745) was recorded in KFD-affected area and two neighboring villages (9.1%, 15/165). Serosurvey conducted in Ker village showed clinical to subclinical ratio of 6:1 in KFD-affected areas. This study confirms the outbreak of KFD Sindhudurg district with 130 cases. Detection of anti-KFDV IgG antibodies among the healthy population in KFD-affected area during the KFD outbreak suggested the past exposure of KFD infection. This outbreak investigation has helped
Grobosch, T; Lemm-Ahlers, U
2002-04-01
In all, 3872 urine specimens were screened for lysergic acid diethylamide (LSD) using the CEDIA DAU LSD assay. Forty-eight samples, mainly from psychiatric patients or drug abusers, were found to be LSD positive, but only 13 (27%) of these could be confirmed by high-performance liquid chromatography with fluorescence detection (HPLC-FLD) following immunoaffinity extraction (IAE). Additional analysis for LSD using the DPC Coat-a-Count RIA was performed to compare the two immunoassay screening methods. Complete agreement between the DPC RIA assay and HPLC-FLD results was observed at concentrations below a cutoff concentration of 500 pg/mL. Samples that were LSD positive in the CEDIA DAU assay but not confirmed by HPLC-FLD were also investigated for interfering compounds using REMEDI HS drug-profiling system. REMEDI HS analysis identified 15 compounds (parent drugs and metabolites) that are believed to cross-react in the CEDIA DAU LSD assay: ambroxol, prilocaine, pipamperone, diphenhydramine, metoclopramide, amitriptyline, doxepine, atracurium, bupivacaine, doxylamine, lidocaine, mepivacaine, promethazine, ranitidine, and tramadole. The IAE/HPLC-FLD combination is rapid, easy to perform and reliable. It can reduce costs when standard, rather than more advanced, HPLC equipment is used, especially for labs that perform analyses for LSD infrequently. The chromatographic analysis of LSD, nor-LSD, and iso-LSD is not influenced by any of the tested cross-reacting compounds even at a concentration of 100 ng/mL.
Fu, Shuang; Guo, Yan; Chen, Hong; Xu, Zhen-Ming; Qiu, Guang-Bin; Zhong, Ming; Sun, Kai-Lai; Fu, Wei-Neng
2011-01-01
Background MYCT1, a putative target of c-Myc, is a novel candidate tumor suppressor gene cloned from laryngeal squamous cell carcinoma (LSCC). Its transcriptional regulation and biological effects on LSCC have not been clarified. Methodology/Principal Findings Using RACE assay, we cloned a 1106 bp transcript named Myc target 1 transcript variant 1 (MYCT1-TV) and confirmed its transcriptional start site was located at 140 bp upstream of the ATG start codon of MYCT1-TV. Luciferase, electrophoretic mobility shift and chromatin immunoprecipitation assays confirmed c-Myc could regulate the promoter activity of MYCT1-TV by specifically binding to the E-box elements within −886 to −655 bp region. These results were further verified by site-directed mutagenesis and RNA interference (RNAi) assays. MYCT1-TV and MYCT1 expressed lower in LSCC than those in paired adjacent normal laryngeal tissues, and overexpression of MYCT1-TV and MYCT1 could inhibit cell proliferation and invasion and promote apoptosis in LSCC cells. Conclusions/Significance Our data indicate that MYCT1-TV, a novel MYCT1 transcript, is regulated by c-Myc and down-regulation of MYCT1-TV/MYCT1 could contribute to LSCC development and function. PMID:21998677
Burgess, Janette K.; Lopez, Jose A.; Gaudry, Leonie E.; Chong, Beng H.
2000-01-01
The drug-dependent antibody of a patient with rifampicin-induced thrombocytopenia was characterized using the antigen-capture enzyme-linked immunosorbent assay (MAIPA assay), flow cytometry, and immunoprecipitation. The antibody was found to bind glycoprotein (GP) Ib-IX but not GPIIb-IIIa because
Kho, S L; Chua, K H; George, E; Tan, J A M A
2013-07-15
Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.
Yousaf, Nasim; Gould, David
2017-01-01
Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.
Directory of Open Access Journals (Sweden)
Fernando Nalesso
2013-04-01
Full Text Available Primary choriocarcinoma of the ovary is rare. Furthermore, this tumor can arise from gestational tissue or pure germ cells of the ovary, with the latter resulting in non-gestational choriocarcinoma. While the clinical characteristics and histology of both tumor types are identical, differentiation of these tumors is necessary for effective treatment. One strategy for the differentiation of these tumors types is to assay for the presence of paternal DNA. Accordingly, in the present case, a patient with primary choriocarcinoma of the ovary with a non-gestational origin was confirmed by DNA analysis. The patient subsequently exhibited an excellent response to chemotherapy, and following surgery, achieved complete remission. A pathological analysis of surgical specimens further confirmed the absence of tumor.
Development of a novel in vitro assay for the evaluation of integron DNA integrase activity
Directory of Open Access Journals (Sweden)
Fatemeh Tohidi
2016-05-01
Full Text Available Integrons play an important role in multidrug resistance. The integron platform codes for integrase (intI that is required for gene cassette integration through site-specific recombination. The recombination crossover occurs between the G and TT nucleotides in non-palindromic attI and palindromic attC sites. The aim of this study was to establish an efficient in vitro assay for integrase purification and activity detection. To this end, the intI gene was cloned into the pET-22b plasmid. Then, the resulting recombinant plasmid was transformed into Escherichia coli Origami™ strain. The recombinant protein expression was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE and western blot assays. The recombinant intI protein was purified by nickel–nitrilotriacetic acid (Ni–NTA affinity chromatography, and its activity was measured by a newly introduced assay. Briefly, specific primers for each side of attI and attC were used, thereby, a polymerase chain reaction would be performed, if a fused plasmid containing both attI and attC sites was created upon recombination. SDS-PAGE and western blotting confirmed the presence of a 38-kDa recombinant protein. Optimum conditions were established for the measurement of the integrase activity and a new model assay was conducted to analyse the recombination activity in vitro. Although the electrophoretic mobility shift assay is an efficient and reliable method, the newly introduced assay provided new or enhanced capability to determine the integrase activity, suggesting that there is no need for expensive and advanced equipment.
Cao, Biyun; He, Guangzhao; Yang, Hong; Chang, Huafang; Li, Shuqun; Deng, Anping
2013-10-15
Phenylethanolamine A (PA) is a new emerged β-adrenergic agonist illegally used as feed additives for growth promotion. In this study, a highly sensitive and specific indirect competitive enzyme-linked immunosorbent assay (ELISA) for the detection of PA in tissue and feed samples was developed and confirmed by liquid chromatography tandem mass spectrometry (LC-MS/MS). By reduction of nitryl group to amino group, the PA derivative was synthesized and coupled to carrier proteins with diazobenzidine method. The antisera obtained from four immunized rabbits were characterized in terms of sensitivity and specificity. All antisera displayed high sensitivity with IC50 values lower than 0.48 ng mL(-1). The most sensitive ELISA was established with IC50 and limit of detection (LOD) values of 0.049 ng mL(-1) and 0.003 ng mL(-1), respectively. The cross-reactivity (CR) values of the antisera with three frequently used β-adrenergic agonists (clenbuterol, salbutamol and ractopamine) were lesser than 0.39%; there was no CR of the antisera with other six compounds including two structurally related substances (isoproterenol, phenylephrine). To investigate the accuracy and precision of the assay, swine kidney, liver, meat and feed samples were fortified with PA at different content and analyzed by ELISA. Acceptable recovery rates of 92.2-113.7% and intra-assay coefficients of variation of 3.8-10.9% (n=3) were achieved. Seven spiked samples were simultaneously analyzed by ELISA and LC-MS/MS. There was a high correlation coefficient of 0.9956 (n=7) between the two methods. The proposed ELISA proven to be a feasible quantitative/screening method for PA analysis in tissue and feed samples with the properties of high sensitivity and specificity, high sample throughput and low expensive. © 2013 Elsevier B.V. All rights reserved.
Kang, Sung-Il; Her, Moon; Kim, Ji-Yeon; Lee, Jin Ju; Lee, Kichan; Sung, So-Ra; Jung, Suk Chan
2015-06-01
A rapid and accurate diagnosis of brucellosis is required to reduce and prevent the spread of disease among animals and the risk of transfer to humans. In this study, a Brucella abortus-specific (Ba) LAMP assay was developed, that had six primers designed from the BruAb2_0168 region of chromosome I. The specificity of this LAMP assay was confirmed with Brucella reference strains, B. abortus vaccine strains, B. abortus isolates and phylogenetically or serologically related strains. The detection limit of target DNA was up to 20 fg/μl within 60 min. The sensitivity of the new LAMP assay was equal to or slightly higher than other PCR based assays. Moreover, this Ba-LAMP assay could specifically amplify all B. abortus biovars compared to previous PCR assays. To our knowledge, this is the first report of specific detection of B. abortus using a LAMP assay. The Ba-LAMP assay can offer a rapid, sensitive and accurate diagnosis of bovine brucellosis in the field. Copyright © 2015 Elsevier Ltd. All rights reserved.
He, Jinxin; Wang, Yuan; Sun, Shiqi; Zhang, Xiaoying
2015-11-01
Immunoglobulin Y (IgY) antibodies were generated against canine parvovirus virus-like particles (CPV-VLPs) antigen using chickens. Anti-CPV-VLPs-IgY was extracted from hen egg yolk and used for developing enzyme-linked immunosorbent assay (ELISA) and immunochromatographic assay (ICA) for the detection of CPV in dog feces. The cutoff negative values for anti-CPV-VLPs-IgY were determined using negative fecal samples (already confirmed by polymerase chain reaction [PCR]). In both ELISA and ICA, there was no cross-reaction with other diarrheal pathogens. Thirty-four fecal samples were collected from dogs with diarrhea, of which 26.47% were confirmed as CPV-positive samples by PCR, while 29.41% and 32.35% of the samples were found to be positive by ELISA and ICA, respectively. The developed ELISA and ICA exhibited 97.06% and 94.12% conformity with PCR. Higher sensitivity and specificity were observed for IgY-based ELISA and ICA. Thus, they could be suitable for routine use in the diagnosis of CPV in dogs.
Dhiman, Sunil; Goswami, Diganta; Kumar, Dinesh; Rabha, Bipul; Sharma, Dhirendra Kumar; Bhola, Rakesh Kumar; Baruah, Indra; Veer, Vijay
2013-11-01
The present study evaluates the performance of OptiMAL-IT test and nested PCR assay in detection of malaria parasites. A total of 76 randomly selected blood samples collected from two malaria endemic areas were tested for malaria parasites using microscopy and OptiMAL-IT test in the field. PCR assays were performed in the laboratory using DNA extracted from blood spots of the same samples collected on the FTA classic cards. Of the total of 61 field confirmed malaria positive samples, only 58 (95%) were detected positive using microscopy in the laboratory. Sensitivity, specificity, positive predictive value, negative predictive value and false discovery rate of OptiMal-IT in comparison to the microscopy were 93%, 83%, 95%, 79% and 5%, respectively. On the other hand, the sensitivity and specificity of PCR assay were 97% and 100%, respectively, whereas positive predictive value, negative predictive value and false discovery rate were 100%, 90% and 0%, respectively. The overall performance of OptiMal-IT and PCR assays for malaria diagnosis was 76% and 97%, respectively. PCR assay enabled the identification of infection with Plasmodium malariae Laveran, 1881 in four samples misidentified by microscopy and Plasmodium-specific antigen (PAN) identified by the OptiMAL-IT test. In addition to the standard methods, such PCR assay could be useful to obtain the real incidence of each malaria parasite species for epidemiological perspectives.
Shukla, Shruti; Leem, Hyerim; Lee, Jong-Suk; Kim, Myunghee
2014-06-01
This study was designed to confirm the applicability of a liposome-based immunochromatographic assay for the rapid detection of Salmonella enterica subsp. enterica serovar Typhimurium (Salmonella Typhimurium) in artificially contaminated tomato samples. To determine the detection limit and pre-enrichment incubation time (10, 12, and 18 h pre-enrichment in 1% buffered peptone water), the tests were performed with different cell numbers of Salmonella Typhimurium (3 × 10(0), 3 × 10(1), 3 × 10(2), and 3 × 10(3) CFU·mL(-1)) inoculated into 25 g of crushed tomato samples. The assay was able to detect as few as 30 Salmonella Typhimurium cells per 25 g of tomato samples (1.2 cells·g(-1)) after 12 h pre-enrichment incubation. Moreover, when the developed assay was compared with traditional morphological and biochemical culture-based methods as well as colloidal gold nanoparticle-based commercial test strips, the developed assay yielded positive results for the detection of Salmonella Typhimurium within a shorter period time. These findings confirm that the developed assay may have practical application for the sensitive detection of Salmonella Typhimurium in various food samples, including raw vegetables, with a relatively low detection limit and shorter analysis time.
Yang, Yuan; Wang, Yan-Zhai; Fang, Zhen; Yu, Yang-Yang; Yong, Yang-Chun
2018-02-01
Toxicity assessment of water is of great important to the safety of human health and to social security because of more and more toxic compounds that are spilled into the aquatic environment. Therefore, the development of fast and reliable toxicity assessment methods is of great interest and attracts much attention. In this study, by using the electrochemical activity of Shewanella oneidensis MR-1 cells as the toxicity indicator, 3,5-dichlorophenol (DCP) as the model toxic compound, a new biosensor for water toxicity assessment was developed. Strikingly, the presence of DCP in the water significantly inhibited the maximum current output of the S. oneidensis MR-1 in a three-electrode system and also retarded the current evolution by the cells. Under the optimized conditions, the maximum current output of the biosensor was proportional to the concentration of DCP up to 30 mg/L. The half maximal inhibitory concentration of DCP determined by this biosensor is about 14.5 mg/L. Furthermore, simultaneous monitoring of the retarded time (Δt) for current generation allowed the identification of another biosensor signal in response to DCP which could be employed to verify the electrochemical result by dual confirmation. Thus, the present study has provided a reliable and promising approach for water quality assessment and risk warning of water toxicity.
DEFF Research Database (Denmark)
Hoegh, A M; Nielsen, J B; Lester, A
2012-01-01
The purpose of this study was to validate a multiplex real-time PCR assay capable of detecting toxigenic Clostridium difficile and simultaneously identifying C. difficile ribotype 027/ST-1 by targeting the toxin genes tcdA, tcdB and cdtA in one reaction and in a separate reaction identifying the Δ...... to confirm the correct identification of the Δ117 deletion in tcdC and C. difficile ribotype 027/ST-1, respectively. The PCR assay displayed a sensitivity, specificity, PPV and NPV of 99.0%, 97.4%, 87.4% and 99.8%, respectively, compared to toxigenic culture on 665 samples evaluable both by PCR and culture....... Sequencing of tcdC, ribotyping and MLST of cultured isolates validated the genotyping assay and confirmed the ability of the assay to correctly identify C. difficile ribotype 027/ST-1 in our current epidemiological setting. We describe the use of a combination of two separate PCR assays for sensitive...
Target-Specific Assay for Rapid and Quantitative Detection of Mycobacterium chimaera DNA.
Zozaya-Valdés, Enrique; Porter, Jessica L; Coventry, John; Fyfe, Janet A M; Carter, Glen P; Gonçalves da Silva, Anders; Schultz, Mark B; Seemann, Torsten; Johnson, Paul D R; Stewardson, Andrew J; Bastian, Ivan; Roberts, Sally A; Howden, Benjamin P; Williamson, Deborah A; Stinear, Timothy P
2017-06-01
Mycobacterium chimaera is an opportunistic environmental mycobacterium belonging to the Mycobacterium avium - M. intracellulare complex. Although most commonly associated with pulmonary disease, there has been growing awareness of invasive M. chimaera infections following cardiac surgery. Investigations suggest worldwide spread of a specific M. chimaera clone, associated with contaminated hospital heater-cooler units used during the surgery. Given the global dissemination of this clone, its potential to cause invasive disease, and the laboriousness of current culture-based diagnostic methods, there is a pressing need to develop rapid and accurate diagnostic assays specific for M. chimaera Here, we assessed 354 mycobacterial genome sequences and confirmed that M. chimaera is a phylogenetically coherent group. In silico comparisons indicated six DNA regions present only in M. chimaera We targeted one of these regions and developed a TaqMan quantitative PCR (qPCR) assay for M. chimaera with a detection limit of 100 CFU/ml in whole blood spiked with bacteria. In vitro screening against DNA extracted from 40 other mycobacterial species and 22 bacterial species from 21 diverse genera confirmed the in silico -predicted specificity for M. chimaera Screening 33 water samples from heater-cooler units with this assay highlighted the increased sensitivity of PCR compared to culture, with 15 of 23 culture-negative samples positive by M. chimaera qPCR. We have thus developed a robust molecular assay that can be readily and rapidly deployed to screen clinical and environmental specimens for M. chimaera . Copyright © 2017 American Society for Microbiology.
Mendez, N.; Herrera, V.; Zhang, L.; Hedjran, F.; Feuer, R.; Blair, S.; Trogler, W.; Reid, T.
2014-01-01
Oncolytic viruses (OVs) constitute a promising class of cancer therapeutics which exploit validated genetic pathways known to be deregulated in many cancers. To overcome an immune response and to enhance its potential use to treat primary and metastatic tumors, a method for liposomal encapsulation of adenovirus has been developed. The encapsulation of adenovirus in non-toxic anionic lecithin-cholesterol-PEG liposomes ranging from 140–180nm in diameter have been prepared by self-assembly around the viral capsid. The encapsulated viruses retain their ability to infect cancer cells. Furthermore, an immunoprecipitation (IP) technique has shown to be a fast and effective method to extract non-encapsulated viruses and homogenize the liposomes remaining in solution. 78% of adenovirus plaque forming units were encapsulated and retained infectivity after IP processing. Additionally, encapsulated viruses have shown enhanced transfection efficiency up to 4× higher compared to non-encapsulated Ads. Extracting non-encapsulated viruses from solution may prevent an adverse in vivo immune response and may enhance treatment for multiple administrations. PMID:25154663
Mendez, Natalie; Herrera, Vanessa; Zhang, Lingzhi; Hedjran, Farah; Feuer, Ralph; Blair, Sarah L; Trogler, William C; Reid, Tony R; Kummel, Andrew C
2014-11-01
Oncolytic viruses (OVs) constitute a promising class of cancer therapeutics which exploit validated genetic pathways known to be deregulated in many cancers. To overcome an immune response and to enhance its potential use to treat primary and metastatic tumors, a method for liposomal encapsulation of adenovirus has been developed. The encapsulation of adenovirus in non-toxic anionic lecithin-cholesterol-PEG liposomes ranging from 140 to 180 nm in diameter have been prepared by self-assembly around the viral capsid. The encapsulated viruses retain their ability to infect cancer cells. Furthermore, an immunoprecipitation (IP) technique has shown to be a fast and effective method to extract non-encapsulated viruses and homogenize the liposomes remaining in solution. 78% of adenovirus plaque forming units were encapsulated and retained infectivity after IP processing. Additionally, encapsulated viruses have shown enhanced transfection efficiency up to 4 × higher compared to non-encapsulated Ads. Extracting non-encapsulated viruses from solution may prevent an adverse in vivo immune response and may enhance treatment for multiple administrations. Copyright © 2014 Elsevier Ltd. All rights reserved.
Assaying Cellular Viability Using the Neutral Red Uptake Assay.
Ates, Gamze; Vanhaecke, Tamara; Rogiers, Vera; Rodrigues, Robim M
2017-01-01
The neutral red uptake assay is a cell viability assay that allows in vitro quantification of xenobiotic-induced cytotoxicity. The assay relies on the ability of living cells to incorporate and bind neutral red, a weak cationic dye, in lysosomes. As such, cytotoxicity is expressed as a concentration-dependent reduction of the uptake of neutral red after exposure to the xenobiotic under investigation. The neutral red uptake assay is mainly used for hazard assessment in in vitro toxicology applications. This method has also been introduced in regulatory recommendations as part of 3T3-NRU-phototoxicity-assay, which was regulatory accepted in all EU member states in 2000 and in the OECD member states in 2004 as a test guideline (TG 432). The present protocol describes the neutral red uptake assay using the human hepatoma cell line HepG2, which is often employed as an alternative in vitro model for human hepatocytes. As an example, the cytotoxicity of acetaminophen and acetyl salicylic acid is assessed.
Kim, G G; Donnenberg, V S; Donnenberg, A D; Gooding, W; Whiteside, T L
2007-08-31
Natural killer (NK) cell-or T cell-mediated cytotoxicity traditionally is measured in 4-16 h (51)Cr-release assays (CRA). A new four-color flow cytometry-based cytotoxicity assay (FCC) was developed to simultaneously measure NK cell cytotoxicity and NK cell phenotype (CD3(-)CD16(+)CD56(+)). Target cells, K562 or Daudi, were labeled with Cell Tracker Orange (CTO) prior to the addition of effector cells. Following co-incubation, 7 amino-actinomycin D (7-AAD) was added to measure death of target cells. The phenotype of effectors, viability of targets, the formation of tumor-effector cell conjugates and absolute numbers of all cells were measured based on light scatter (FSC/SSC), double discrimination of the fluorescence peak integral and height, and fluorescence intensity. Kinetic studies (0.5 and 1 to 4 h) at different effector to target (E:T) cell ratios (50, 25, 12, and 6) confirmed that the 3 h incubation was optimal. The FCC assay is more sensitive than the CRA, has a coefficient of variation (CV) 8-13% and reliably measures NK cell-or lymphokine-activated killer (LAK) cell-mediated killing of target cells in normal controls and subjects with cancer. The FCC assay can be used to study a range of phenotypic attributes, in addition to lytic activity of various subsets of effector cells, without radioactive tracers and thus, it is relatively inexpensive. The FCC assay has a potential for providing information about molecular interactions underlying target cell lysis and thus becoming a major tool for studies of disease pathogenesis as well as development of novel immune therapies.
DEFF Research Database (Denmark)
Kristensen, B.K.; Askerlund, P.; Bykova, N.V.
2004-01-01
.2 mM CuSO4 for 10 min at room temperature). The oxidised proteins in both samples were tagged with dinitrophenylhydrazine (DNP), which forms a covalent bond with carbonyl groups. The DNP-tagged proteins were immunoprecipitated using anti-DNP antibodies and digested with trypsin. The mixture...... of peptides was analysed by nano-HPLC coupled online to an ESI-Quad-TOF mass spectrometer. The peptides were separated by stepwise ion exchange chromatography followed by reverse phase chromatography (2D-LC), and analysed by MS/MS. Proteins were identified by un-interpreted fragment ion database searches...... blots showed that neither the isolation of mitochondria, nor their subfractionation introduced carbonyl groups. We therefore conclude that a number of proteins are oxidised in the matrix of rice leaf mitochondria in vivo and further identify a group of proteins that are particularly susceptible to mild...
Breitkopf, Susanne B; Yuan, Min; Pihan, German A; Asara, John M
2012-10-02
Hypothesis directed proteomics offers higher throughput over global analyses. We show that immunoprecipitation (IP)-tandem mass spectrometry (LC-MS/MS) in H929 multiple myeloma (MM) cancer cells led to the discovery of a rare and unexpected BCR-ABL fusion, informing a therapeutic intervention using imatinib (Gleevec). BCR-ABL is the driving mutation in chronic myeloid leukemia (CML) and is uncommon to other cancers. Three different IP-MS experiments central to cell signaling pathways were sufficient to discover a BCR-ABL fusion in H929 cells: phosphotyrosine (pY) peptide IP, p85 regulatory subunit of phosphoinositide-3-kinase (PI3K) IP, and the GRB2 adaptor IP. The pY peptides inform tyrosine kinase activity, p85 IP informs the activating adaptors and receptor tyrosine kinases (RTKs) involved in AKT activation and GRB2 IP identifies RTKs and adaptors leading to ERK activation. Integration of the bait-prey data from the three separate experiments identified the BCR-ABL protein complex, which was confirmed by biochemistry, cytogenetic methods, and DNA sequencing revealed the e14a2 fusion transcript. The tyrosine phosphatase SHP2 and the GAB2 adaptor protein, important for MAPK signaling, were common to all three IP-MS experiments. The comparative treatment of tyrosine kinase inhibitor (TKI) drugs revealed only imatinib, the standard of care in CML, was inhibitory to BCR-ABL leading to down-regulation of pERK and pS6K and inhibiting cell proliferation. These data suggest a model for directed proteomics from patient tumor samples for selecting the appropriate TKI drug(s) based on IP and LC-MS/MS. The data also suggest that MM patients, in addition to CML patients, may benefit from BCR-ABL diagnostic screening.
International Nuclear Information System (INIS)
Nicholson, S.; Efandis, T.; Gust, I.
1991-01-01
A study was performed to assess the sensitivity and specificity of the amerlite monoclonal immunoassay for detection of hepatitis B surface antigen (HBsAG) by comparison with the Abbott Ausria II radioimmunoassay (RI). Serial bleeds from 34 patients with acute or chronic hepatitis B were tested by both assays. The Abbott Ausria II assay detected HBsAG longer than the Amersham Amerlite assay on two occasions and earlier on one occasion. Twelve patients with low HBsAg positive results (confirmed by Ausria II) were tested by the Amerlite assay, four were repeatably positive, five repeatably negative and three gave borderline results (which on repeat testing were negative). A similar trend was seen when a panel of sera containing known concentrations of HBsAG was tested. Replicate testing of 10 specimens eight times showed very good reproducibility by the Amerlite assay. Overall, the specificity of both assays was comparable, however differences in sensitivity were observed. 3 tabs
Sphingosine 1-phosphate lyase enzyme assay using a BODIPY-labeled substrate
International Nuclear Information System (INIS)
Bandhuvula, Padmavathi; Li Zaiguo; Bittman, Robert; Saba, Julie D.
2009-01-01
Sphingosine 1-phosphate lyase (SPL) is responsible for the irreversible catabolism of sphingosine 1-phosphate, which signals through five membrane receptors to mediate cell stress responses, angiogenesis, and lymphocyte trafficking. The standard assay for SPL activity utilizes a radioactive dihydrosphingosine 1-phosphate substrate and is expensive and cumbersome. In this study, we describe an SPL assay that employs an ω-labeled BODIPY-sphingosine 1-phosphate substrate, allowing fluorescent product detection by HPLC and incorporating advantages of the BODIPY fluorophore. The major aldehyde product is confirmed by reaction with 2,4-dinitrophenylhydrazine. The SPL-catalyzed reaction is linear over a 30 min time period and yields a K m of 35 μM for BODIPY-sphingosine 1-phosphate.
Random assay in radioimmunoassay: Feasibility and application compared with batch assay
Energy Technology Data Exchange (ETDEWEB)
Lee, Jung Min; Lee, Hwan Hee; Park, Sohyun; Kim, Tae Sung; Kim, Seok Ki [Dept. of Nuclear MedicineNational Cancer Center, Goyang (Korea, Republic of)
2016-12-15
The batch assay has been conventionally used for radioimmunoassay (RIA) because of its technical robustness and practical convenience. However, it has limitations in terms of the relative lag of report time due to the necessity of multiple assays in a small number of samples compared with the random assay technique. In this study, we aimed to verify whether the random assay technique can be applied in RIA and is feasible in daily practice. The coefficients of variation (CVs) of eight standard curves within a single kit were calculated in a CA-125 immunoradiometric assay (IRMA) for the reference of the practically ideal CV of the CA-125 kit. Ten standard curves of 10 kits from 2 prospectively collected lots (pLot) and 85 standard curves of 85 kits from 3 retrospectively collected lots (Lot) were obtained. Additionally, the raw measurement data of both 170 control references and 1123 patients' sera were collected retrospectively between December 2015 and January 2016. A standard curve of the first kit of each lot was used as a master standard curve for a random assay. The CVs of inter-kits were analyzed in each lot, respectively. All raw measurements were normalized by decay and radioactivity. The CA-125 values from control samples and patients' sera were compared using the original batch assay and random assay. In standard curve analysis, the CVs of inter-kits in pLots and Lots were comparable to those within a single kit. The CVs from the random assay with normalization were similar to those from the batch assay in the control samples (CVs % of low/high concentration; Lot1 2.71/1.91, Lot2 2.35/1.83, Lot3 2.83/2.08 vs. Lot1 2.05/1.21, Lot2 1.66/1.48, Lot3 2.41/2.14). The ICCs between the batch assay and random assay using patients' sera were satisfactory (Lot1 1.00, Lot2 0.999, Lot3 1.00). The random assay technique could be successfully applied to the conventional CA-125 IRMA kits. The random assay showed strong agreement with the batch assay. The
Validation of the Filovirus Plaque Assay for Use in Preclinical Studies
Directory of Open Access Journals (Sweden)
Amy C. Shurtleff
2016-04-01
Full Text Available A plaque assay for quantitating filoviruses in virus stocks, prepared viral challenge inocula and samples from research animals has recently been fully characterized and standardized for use across multiple institutions performing Biosafety Level 4 (BSL-4 studies. After standardization studies were completed, Good Laboratory Practices (GLP-compliant plaque assay method validation studies to demonstrate suitability for reliable and reproducible measurement of the Marburg Virus Angola (MARV variant and Ebola Virus Kikwit (EBOV variant commenced at the United States Army Medical Research Institute of Infectious Diseases (USAMRIID. The validation parameters tested included accuracy, precision, linearity, robustness, stability of the virus stocks and system suitability. The MARV and EBOV assays were confirmed to be accurate to ±0.5 log10 PFU/mL. Repeatability precision, intermediate precision and reproducibility precision were sufficient to return viral titers with a coefficient of variation (%CV of ≤30%, deemed acceptable variation for a cell-based bioassay. Intraclass correlation statistical techniques for the evaluation of the assay’s precision when the same plaques were quantitated by two analysts returned values passing the acceptance criteria, indicating high agreement between analysts. The assay was shown to be accurate and specific when run on Nonhuman Primates (NHP serum and plasma samples diluted in plaque assay medium, with negligible matrix effects. Virus stocks demonstrated stability for freeze-thaw cycles typical of normal usage during assay retests. The results demonstrated that the EBOV and MARV plaque assays are accurate, precise and robust for filovirus titration in samples associated with the performance of GLP animal model studies.
Matrix effects of TRU [transuranic] assays using the SWEPP PAN assay system
International Nuclear Information System (INIS)
Smith, J.R.
1990-08-01
The Drum Assay System (DAS) at the Stored Waste Experimental Pilot Plant (SWEPP) is a second-generation active-passive neutron assay system. It has been used to assay over 5000 208-liter drums of transuranic waste from the Rocky Flats Plant (RFP). Data from these assays have been examined and compared with the assays performed at Rocky Flats, mainly utilize counting of 239 Pu gamma rays. For the most part the passive assays are in very good agreement with the Rocky Flats assays. The active assays are strongly correlated with the results of the other two methods, but require matrix-dependent correction factors beyond those provided by the system itself. A set of matrix-dependent correction factors has been developed from the study of the assay results. 3 refs., 4 figs., 3 tabs
Comparison of Batch Assay and Random Assay Using Automatic Dispenser in Radioimmunoassay
Energy Technology Data Exchange (ETDEWEB)
Moon, Seung Hwan; Jang, Su Jin; Kang, Ji Yeon; Lee, Dong Soo; Chung, June Key; Lee, Myung Chul [Seoul Metropolitan Government Seoul National University Boramae Medical Center, Seoul (Korea, Republic of); Lee, Ho Young; Shin, Sun Young; Min, Gyeong Sun; Lee, Hyun Joo [Seoul National University college of Medicine, Seoul (Korea, Republic of)
2009-08-15
Radioimmunoassay (RIA) was usually performed by the batch assay. To improve the efficiency of RIA without increase of the cost and time, random assay could be a choice. We investigated the possibility of the random assay using automatic dispenser by assessing the agreement between batch assay and random assay. The experiments were performed with four items; Triiodothyronine (T3), free thyroxine (fT4), Prostate specific antigen (PSA), Carcinoembryonic antigen (CEA). In each item, the sera of twenty patients, the standard, and the control samples were used. The measurements were done 4 times with 3 hour time intervals by random assay and batch assay. The coefficient of variation (CV) of the standard samples and patients' data in T3, fT4, PSA, and CEA were assessed. ICC (Intraclass correlation coefficient) and coefficient of correlation were measured to assessing the agreement between two methods. The CVs (%) of T3, fT4, PSA, and CEA measured by batch assay were 3.2+-1.7%, 3.9+-2.1%, 7.1+-6.2%, 11.2+-7.2%. The CVs by random assay were 2.1+-1.7%, 4.8+-3.1%, 3.6+-4.8%, and 7.4+-6.2%. The ICC between the batch assay and random assay were 0.9968 (T3), 0.9973 (fT4), 0.9996 (PSA), and 0.9901 (CEA). The coefficient of correlation between the batch assay and random assay were 0.9924(T3), 0.9974 (fT4), 0.9994 (PSA), and 0.9989 (CEA) (p<0.05). The results of random assay showed strong agreement with the batch assay in a day. These results suggest that random assay using automatic dispenser could be used in radioimmunoassay
Comparison of Batch Assay and Random Assay Using Automatic Dispenser in Radioimmunoassay
International Nuclear Information System (INIS)
Moon, Seung Hwan; Jang, Su Jin; Kang, Ji Yeon; Lee, Dong Soo; Chung, June Key; Lee, Myung Chul; Lee, Ho Young; Shin, Sun Young; Min, Gyeong Sun; Lee, Hyun Joo
2009-01-01
Radioimmunoassay (RIA) was usually performed by the batch assay. To improve the efficiency of RIA without increase of the cost and time, random assay could be a choice. We investigated the possibility of the random assay using automatic dispenser by assessing the agreement between batch assay and random assay. The experiments were performed with four items; Triiodothyronine (T3), free thyroxine (fT4), Prostate specific antigen (PSA), Carcinoembryonic antigen (CEA). In each item, the sera of twenty patients, the standard, and the control samples were used. The measurements were done 4 times with 3 hour time intervals by random assay and batch assay. The coefficient of variation (CV) of the standard samples and patients' data in T3, fT4, PSA, and CEA were assessed. ICC (Intraclass correlation coefficient) and coefficient of correlation were measured to assessing the agreement between two methods. The CVs (%) of T3, fT4, PSA, and CEA measured by batch assay were 3.2±1.7%, 3.9±2.1%, 7.1±6.2%, 11.2±7.2%. The CVs by random assay were 2.1±1.7%, 4.8±3.1%, 3.6±4.8%, and 7.4±6.2%. The ICC between the batch assay and random assay were 0.9968 (T3), 0.9973 (fT4), 0.9996 (PSA), and 0.9901 (CEA). The coefficient of correlation between the batch assay and random assay were 0.9924(T3), 0.9974 (fT4), 0.9994 (PSA), and 0.9989 (CEA) (p<0.05). The results of random assay showed strong agreement with the batch assay in a day. These results suggest that random assay using automatic dispenser could be used in radioimmunoassay
Huang, Bill X.; Kim, Hee-Yong
2013-01-01
Akt is a critical protein for cell survival and known to interact with various proteins. However, Akt binding partners that modulate or regulate Akt activation have not been fully elucidated. Identification of Akt-interacting proteins has been customarily achieved by co-immunoprecipitation combined with western blot and/or MS analysis. An intrinsic problem of the method is loss of interacting proteins during procedures to remove non-specific proteins. Moreover, antibody contamination often interferes with the detection of less abundant proteins. Here, we developed a novel two-step chemical crosslinking strategy to overcome these problems which resulted in a dramatic improvement in identifying Akt interacting partners. Akt antibody was first immobilized on protein A/G beads using disuccinimidyl suberate and allowed to bind to cellular Akt along with its interacting proteins. Subsequently, dithiobis[succinimidylpropionate], a cleavable crosslinker, was introduced to produce stable complexes between Akt and binding partners prior to the SDS-PAGE and nanoLC-MS/MS analysis. This approach enabled identification of ten Akt partners from cell lysates containing as low as 1.5 mg proteins, including two new potential Akt interacting partners. None of these but one protein was detectable without crosslinking procedures. The present method provides a sensitive and effective tool to probe Akt-interacting proteins. This strategy should also prove useful for other protein interactions, particularly those involving less abundant or weakly associating partners. PMID:23613850
Antioxidant properties of species from the Brazilian cerrado by different assays
Directory of Open Access Journals (Sweden)
K.S. Farias
2013-01-01
Full Text Available The purpose of this study was to screen the antioxidant activity of medicinal plant extracts from the Brazilian cerrado, through other methods than the total phenolic content and its correlation with the antioxidant activity. Ethanolic extracts of ten species were evaluated through three antioxidant assays, in vitro, including 2,2-diphenyl-1-picrylhydrazyl (DPPH, total antioxidant activity and reducing power; and by using the Folin-Ciocalteu method the total phenolic content was determined. Ethanolic extracts of Stryphnodendron obovatum, Cecropia pachystachya and Duguetia furfuraceae showed strong antioxidant activity (IC50<5 µg mL-1 in the DPPH free radical scavenging assay; the species Vernonia phosphorea, Hymenaea stignocarpa and Jacaranda ulei may also be highlighted. These results were confirmed in the assays of total antioxidant capacity and reducing power. The extracts of S. obovatum and V. phosphorea showed an abundant phenolic content; therefore, the phenolic content may play a role in the antioxidant activity. These two species, traditionally used in Brazil, showed great power in these assay systems and may be a promising source for the development of natural antioxidants and future candidates for phytochemical and pharmacological studies in related diseases.
Sachdeva, Amita; Defibaugh-Chávez, Stephanie L H; Day, James B; Zink, Donald; Sharma, Shashi K
2010-11-01
Our laboratory tested water samples used for cooling low-acid canned foods at a canning facility under investigation by the U.S. Food and Drug Administration. We used an enzyme-linked immunosorbent assay with digoxigenin-labeled antibodies (DIG-ELISA) and real-time PCR as screening methods and confirmed the presence of neurotoxin-producing Clostridium botulinum in the samples by mouse bioassay.
Sachdeva, Amita; Defibaugh-Chávez, Stephanie L. H.; Day, James B.; Zink, Donald; Sharma, Shashi K.
2010-01-01
Our laboratory tested water samples used for cooling low-acid canned foods at a canning facility under investigation by the U.S. Food and Drug Administration. We used an enzyme-linked immunosorbent assay with digoxigenin-labeled antibodies (DIG-ELISA) and real-time PCR as screening methods and confirmed the presence of neurotoxin-producing Clostridium botulinum in the samples by mouse bioassay.
International Nuclear Information System (INIS)
Miller, R.J.; Chang, K.-J.
1981-01-01
A radioreceptor assay is described for assaying opioid drugs in biological fluids. The method enables the assay of total opioid activity, being specific for opioids as a class but lacking specificity within the class. A radio-iodinated opioid and the liquid test sample are incubated with an opiate receptor material. The percentage inhibition of the binding of the radio-iodinated compound to the opiate receptor is calculated and the opioid activity of the test liquid determined from a standard curve. Examples of preparing radio-iodinated opioids and assaying opioid activity are given. A test kit for the assay is described. Compared to other methods, this assay is cheap, easy and rapid. (U.K.)
Berninger, Mary Lou; O'Hearn, Emily; Lomkin, Richanne; Newens, Ken; Havas, Karyn A
2018-03-01
Vesicular stomatitis (VS) is a vesicular disease of horses, cattle, and pigs in the Western Hemisphere caused by viruses in the genus Vesiculovirus. Disease manifests as vesicles and erosions on the oral mucosa, teats, prepuce, and coronary band, and is similar in presentation to foot-and-mouth disease. Laboratory confirmation is therefore required. Conventional assays include competitive (c)ELISA and complement fixation (CF). The cELISA provides more accurate herd-level detection of VSV-exposed cattle, but may lack the ability to capture fluctuating antibody levels in individual animals. The CF assay can confirm newly infected animals because of its ability to detect antigen-antibody complexes, thus is considered to be indicative of IgM. We evaluated the immune status of 2 herds affected by VSV in 2014 by testing sera collected in June 2015. Two conventional assays were compared to a novel IgM-IgG ELISA. When sampled in 2015, both herds had detectable VSV-specific antibodies; 18% and 36% of animals tested by cELISA and 2% and 8% of animals tested by CF were positive. The novel IgM-IgG assay exhibited fair agreement (adjusted kappa score of 48) with the conventional assays, and should be evaluated further to assess its ability to replace the 2 separate assays with a single assay system, or for its ability to replace the CF assay as a more sensitive method for defining newly exposed animals.
International Nuclear Information System (INIS)
Lee, Sang-Wang; Kim, Eun-Joo; Um, Soo-Jong
2007-01-01
To elucidate the regulatory mechanism of p73 gene expression, we analyzed the human p73 promoter and found three putative Egr-1-binding sites located upstream of exon 1 (-1728, -321, and -38). The Egr-1 responsiveness of these sites was analyzed by transient transfection assays using 5'- and 3'-serial truncations of the p73 promoter, subcloned in a CAT reporter vector. The functional significance of the region was further confirmed by an electrophoretic mobility shift assay using the Egr-1 protein synthesized in vitro and a [ 32 P]-labeled middle site sequence, followed by competition with unlabeled wild-type or mutant oligonucleotides and supershift assays using an anti-Egr-1 antibody. When induced by either the nitric oxide donor NOC-18 or the PPARγ agonist troglitazone, Egr-1 bound to the p73 promoter, as assessed by chromatin immunoprecipitation assays, accompanied by increased expression of p73. MTT assays revealed that cell growth was significantly inhibited on treating the cells with troglitazone. Overall, our results provide direct evidence that Egr-1 positively regulated p73 expression by binding to its promoter in vivo, consistent with Egr-1 and p73 being involved in p53-independent tumor suppression
Development of an opioid self-administration assay to study drug seeking in zebrafish.
Bossé, Gabriel D; Peterson, Randall T
2017-09-29
The zebrafish (Danio rerio) has become an excellent tool to study mental health disorders, due to its physiological and genetic similarity to humans, ease of genetic manipulation, and feasibility of small molecule screening. Zebrafish have been shown to exhibit characteristics of addiction to drugs of abuse in non-contingent assays, including conditioned place preference, but contingent assays have been limited to a single assay for alcohol consumption. Using inexpensive electronic, mechanical, and optical components, we developed an automated opioid self-administration assay for zebrafish, enabling us to measure drug seeking and gain insight into the underlying biological pathways. Zebrafish trained in the assay for five days exhibited robust self-administration, which was dependent on the function of the μ-opioid receptor. In addition, a progressive ratio protocol was used to test conditioned animals for motivation. Furthermore, conditioned fish continued to seek the drug despite an adverse consequence and showed signs of stress and anxiety upon withdrawal of the drug. Finally, we validated our assay by confirming that self-administration in zebrafish is dependent on several of the same molecular pathways as in other animal models. Given the ease and throughput of this assay, it will enable identification of important biological pathways regulating drug seeking and could lead to the development of new therapeutic molecules to treat addiction. Copyright © 2017 Elsevier B.V. All rights reserved.
Antibody class capture assay (ACCA) for rubella-specific IgM antibody.
Isaac, M; Payne, R A
1982-01-01
Enzyme-linked immunosorbent assays for IgM antirubella were carried out on 1,546 sera, using an IgM capture method with a F (ab')2 conjugate (ACCA). Under the conditions described, sera containing IgM antirubella bound up to 15 times as much enzyme activity as negative specimens. Paired serum specimens from 27 patients, serial serum specimens from 6 patients, and single serum specimens from 15 patients who had had recent rubella were examined by the haemagglutination inhibition test (HAI) in the presence and absence of 2-mercaptoethanol following sucrose density gradient centrifugation (SDGC). ACCA confirmed all the results found with HAI following SDGC. Specimens were examined from ten patients with congenital rubella; ACCA confirmed the results found with both immunofluorescence following SDGC and radioimmunoassay. Pre- and post-vaccination specimens from 123 patients who had been vaccinated against rubella were examined. An IgM response could only be demonstrated in the 57 cases when IgG was absent in the first specimen. The specificity of the assay was confirmed by testing 31 serum specimens from rubella immune patients that also contained rheumatoid factor, 163 serum specimens from patients with acute infections other than rubella, and 12 serum specimens from infants with miscellaneous neonatal abnormalities other than congenital rubella. The ACCA proved a simple, sensitive, and specific test for IgM antirubella and the results compared favourably with those obtained by the SDGC technique.
Loop-mediated isothermal amplification assays for screening of bacterial integrons
Directory of Open Access Journals (Sweden)
Guangchao Yu
2014-01-01
Full Text Available BACKGROUND: The occurrence and prevalence of integrons in clinical microorganisms and their role played in antimicrobial resistance have been well studied recently. As screening and detection of integrons are concerned, current diagnostic methodologies are restricted by significant drawbacks and novel methods are required for integrons detection. RESULTS: In this study, three loop-mediated isothermal amplification (LAMP assays targeting on class 1, 2 and 3 integrons were implemented and evaluated. Optimization of these detection assays were performed, including studing on the reaction temperature, volume, time, sensitivity and specificity (both primers and targets. Application of the established LAMP assays were further verified on a total of 1082 isolates (previously identified to be 397 integron-positive and 685 integron-negative strains. According to the results, the indispensability of each primer had been confirmed and the optimal reaction temperature, volume and time were found to be 65°C, 45 min and 25 µL, respectively. As application was concerned, 361, 28 and 8 isolates carrying intI1, intI2 and intI3 yielded positive amplicons, respectively. Other 685 integron-negative bacteria were negative for the integron-screening LAMP assays, totaling the detection rate and specificity to be 100%. CONCLUSIONS: The intI1-, intI2- and intI3-LAMP assays established in this study were demonstrated to be the valid and rapid detection methodologies for the screening of bacterial integrons.
Reassessing the reliability of the salivary cortisol assay for the diagnosis of Cushing syndrome.
Zhang, Qian; Dou, Jingtao; Gu, Weijun; Yang, Guoqing; Lu, Juming
2013-10-01
The cortisol concentration in saliva is 10-fold lower than total serum cortisol and accurately reflects the serum concentration, both levels being lowest around midnight. The salivary cortisol assay measures free cortisol and is unaffected by confounding factors. This study analysed published data on the sensitivity and specificity of salivary cortisol levels in the diagnosis of Cushing syndrome. Data from studies on the use of different salivary cortisol assay techniques in the diagnosis of Cushing syndrome, published between 1998 and 2012 and retrieved using Ovid MEDLINE®, were analysed for variance and correlation. For the 11 studies analysed, mean sensitivity and specificity of the salivary cortisol assay were both >90%. Repeated measurements were easily made with this assay, enabling improved diagnostic accuracy in comparison with total serum cortisol measurements. This analysis confirms the reliability of the saliva cortisol assay as pragmatic tool for the accurate diagnosis of Cushing syndrome. With many countries reporting a rising prevalence of metabolic syndrome, diabetes and obesity--in which there is often a high circulating cortisol level--salivary cortisol measurement will help distinguish these states from Cushing syndrome.
Riediger, Irina N; Stoddard, Robyn A; Ribeiro, Guilherme S; Nakatani, Sueli M; Moreira, Suzana D R; Skraba, Irene; Biondo, Alexander W; Reis, Mitermayer G; Hoffmaster, Alex R; Vinetz, Joseph M; Ko, Albert I; Wunder, Elsio A
2017-09-01
With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5-10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge. Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors. The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86%) for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%). The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%. These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making.
Multiplex PCR-based assay for detection of Bordetella pertussis in nasopharyngeal swab specimens.
Wadowsky, R M; Michaels, R H; Libert, T; Kingsley, L A; Ehrlich, G D
1996-11-01
A multiplex PCR-based assay was developed for the detection of Bordetella pertussis in nasopharyngeal swab specimens. The assay simultaneously amplified two separate DNA targets (153 and 203 bp) within a B. pertussis repetitive element and a 438-bp target within the beta-actin gene of human DNA (PCR amplification control). PCR products were detected by a sensitive and specific liquid hybridization gel retardation assay. A total of 496 paired nasopharyngeal swab specimens were tested by both the PCR-based assay and culture. Although 30 (6%) of the specimens inhibited the amplification of the beta-actin target, in all 29 specimens studied, the inhibition disappeared on repeat testing or was easily overcome with a 1:8 dilution or less of specimen digest. Of the 495 specimen pairs yielding a final evaluable result by the PCR-based assay, 19.0% were positive by the PCR-based assay, whereas 13.9% were positive by culture (P < 0.0001). After resolving the PCR-positive, culture-negative results by testing an additional aliquot from these specimens by the multiplex PCR-based assay, the PCR-based assay had a sensitivity and specificity of 98.9 and 99.7%, respectively, compared with values of 73.4 and 100%, respectively, for culture. In comparison with patients with culture-confirmed pertussis, those with PCR-positive, culture-negative results were older and more likely to have had prolonged cough, immunization with pertussis vaccine, or treatment with erythromycin. This multiplex PCR-based assay is substantially more sensitive than culture and identifies specimens that contain inhibitors of PCR.
A High Sensitivity Micro Format Chemiluminescence Enzyme Inhibition Assay for Determination of Hg(II
Directory of Open Access Journals (Sweden)
Kanchanmala Deshpande
2010-06-01
Full Text Available A highly sensitive and specific enzyme inhibition assay based on alcohol oxidase (AlOx and horseradish peroxidase (HRP for determination of mercury Hg(II in water samples has been presented. This article describes the optimization and miniaturization of an enzymatic assay using a chemiluminescence reaction. The analytical performance and detection limit for determination of Hg(II was optimized in 96 well plates and further extended to 384 well plates with a 10-fold reduction in assay volume. Inhibition of the enzyme activity by dissolved Hg(II was found to be linear in the range 5–500 pg.mL−1 with 3% CVin inter-batch assay. Due to miniaturization of assay in 384 well plates, Hg(II was measurable as low as 1 pg.mL−1 within15 min. About 10-fold more specificity of the developed assay for Hg(II analysis was confirmed by challenging with interfering divalent metal ions such as cadmium Cd(II and lead Pb(II. Using the proposed assay we could successfully demonstrate that in a composite mixture of Hg(II, Cd(II and Pb(II, inhibition by each metal ion is significantly enhanced in the presence of the others. Applicability of the proposed assay for the determination of the Hg(II in spiked drinking and sea water resulted in recoveries ranging from 100–110.52%.
Evidence for the interaction of the regulatory protein Ki-1/57 with p53 and its interacting proteins
International Nuclear Information System (INIS)
Nery, Flavia C.; Rui, Edmilson; Kuniyoshi, Tais M.; Kobarg, Joerg
2006-01-01
Ki-1/57 is a cytoplasmic and nuclear phospho-protein of 57 kDa and interacts with the adaptor protein RACK1, the transcription factor MEF2C, and the chromatin remodeling factor CHD3, suggesting that it might be involved in the regulation of transcription. Here, we describe yeast two-hybrid studies that identified a total of 11 proteins interacting with Ki-1/57, all of which interact or are functionally associated with p53 or other members of the p53 family of proteins. We further found that Ki-1/57 is able to interact with p53 itself in the yeast two-hybrid system when the interaction was tested directly. This interaction could be confirmed by pull down assays with purified proteins in vitro and by reciprocal co-immunoprecipitation assays from the human Hodgkin analogous lymphoma cell line L540. Furthermore, we found that the phosphorylation of p53 by PKC abolishes its interaction with Ki-1/57 in vitro
Armadillo Repeat Containing 8α Binds to HRS and Promotes HRS Interaction with Ubiquitinated Proteins
Tomaru, Koji; Ueda, Atsuhisa; Suzuki, Takeyuki; Kobayashi, Nobuaki; Yang, Jun; Yamamoto, Masaki; Takeno, Mitsuhiro; Kaneko, Takeshi; Ishigatsubo, Yoshiaki
2010-01-01
Recently, we reported that a complex with an essential role in the degradation of Fructose-1,6-bisphosphatase in yeast is well conserved in mammalian cells; we named this mammalian complex C-terminal to the Lissencephaly type-1-like homology (CTLH) complex. Although the function of the CTLH complex remains unclear, here we used yeast two-hybrid screening to isolate Hepatocyte growth factor-regulated tyrosine kinase substrate (HRS) as a protein binding to a key component of CTLH complex, Armadillo repeat containing 8 (ARMc8) α. The association was confirmed by a yeast two-hybrid assay and a co-immunoprecipitation assay. The proline-rich domain of HRS was essential for the association. As demonstrated through immunofluorescence microscopy, ARMc8α co-localized with HRS. ARMc8α promoted the interaction of HRS with various ubiquitinated proteins through the ubiquitin-interacting motif. These findings suggest that HRS mediates protein endosomal trafficking partly through its interaction with ARMc8α. PMID:20224683
GATA-1 directly regulates Nanog in mouse embryonic stem cells
Energy Technology Data Exchange (ETDEWEB)
Li, Wen-Zhong; Ai, Zhi-Ying [College of Life Sciences, Northwest A& F University, Yangling 712100 (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A& F University, Yangling 712100 (China); Wang, Zhi-Wei [School of Life Sciences and Medical Center, University of Science and Technology of China, Hefei, Anhui 230027 (China); Chen, Lin-Lin [College of Life Sciences, Northwest A& F University, Yangling 712100 (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A& F University, Yangling 712100 (China); Guo, Ze-Kun, E-mail: gzknwaf@126.com [College of Veterinary Medicine, Northwest A& F University, Yangling 712100 (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A& F University, Yangling 712100 (China); Zhang, Yong, E-mail: zylabnwaf@126.com [College of Veterinary Medicine, Northwest A& F University, Yangling 712100 (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A& F University, Yangling 712100 (China)
2015-09-25
Nanog safeguards pluripotency in mouse embryonic stem cells (mESCs). Insight into the regulation of Nanog is important for a better understanding of the molecular mechanisms that control pluripotency of mESCs. In a silico analysis, we identify four GATA-1 putative binding sites in Nanog proximal promoter. The Nanog promoter activity can be significantly repressed by ectopic expression of GATA-1 evidenced by a promoter reporter assay. Mutation studies reveal that one of the four putative binding sites counts for GATA-1 repressing Nanog promoter activity. Direct binding of GATA-1 on Nanog proximal promoter is confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation. Our data provide new insights into the expanded regulatory circuitry that coordinates Nanog expression. - Highlights: • The Nanog proximal promoter conceives functional element for GATA-1. • GATA-1 occupies the Nanog proximal promoter in vitro and in vivo. • GATA-1 transcriptionally suppresses Nanog.
Directory of Open Access Journals (Sweden)
Ľubomír Pojezdal
2017-01-01
Full Text Available The diagnostic properties of the one-step real-time reverse-transcription polymerase chain reaction assay for viral haemorrhagic septicaemia virus detection were compared to methods currently in use in the Czech Republic, namely, virus isolation using the cell culture and conventional reverse-transcription polymerase chain reaction followed by the nested polymerase chain reaction. The assays were tested on a panel of 25 archived viral haemorrhagic septicaemia isolates and 8 archived infectious haematopoietic necrosis isolates obtained from monitoring and/or outbreaks of the diseases among farmed salmonids in the Czech Republic. The ability to detect the presence of the virus in the tissues of fish was tested on additional 32 field samples collected from the rainbow trout (Oncorhynchus mykiss, brown trout (Salmo trutta and brook trout (Salvelinus fontinalis. The real-time assay showed the highest analytic sensitivity by detecting the presence of viral nucleic acid in samples with 10-7 dilution, whereas the sensitivity of the conventional polymerase chain reaction peaked at 10-5. Diagnostic specificity of both molecular assays was confirmed by absence of cross-reactivity with the infectious haematopoietic necrosis virus isolates. This, along with consistent results in the detection of the virus in the fish tissues, confirms that the one-step real-time reverse-transcription polymerase chain reaction is currently an optimal stand-alone diagnostic method for the detection of the viral haemorrhagic septicaemia virus.
Performance of hepatitis B assays on the Bayer ADVIA Centaur Immunoassay System.
van Helden, Josef; Denoyel, Gérard; Karwowska, Sylwia; Reamer, Randy; Schmalz, John; Wright, Ted; Preisel-Simmons, Barbara
2004-01-01
Bayer HealthCare LLC, Diagnostics Division, has developed several new assays on the ADVIA Centaur immunoassay system for the detection of markers of hepatitis B virus infection in human serum and plasma. This panel includes assays for: hepatitis B surface antigen (HBsAg), a confirmatory test method for HBsAg, antibodies to hepatitis B surface antigen (anti-HBs), IgM and IgG antibodies to hepatitis B core antigen (anti-HBc Total) and IgM antibodies to hepatitis B core antigen (anti-HBc IgM). These assays employ magnetic particle separation technology with direct chemiluminescence for optimal assay performance. All of the assays are fully automated, require sample volumes ranging from 15 microl to 100 microl (with the exception of the ADVIA Centaur HBsAg Confirmatory Assay, which requires 2 x 100 microl), and have throughputs of up to 240 tests per hour. The five ADVIA Centaur HBV assays were tested in extensive performance evaluations conducted at two sites in Europe. The performance evaluations, which included samples from HBV-infected individuals, blood donors, hospitalized/clinical patients, and HBV vaccinees (for Anti-HBs evaluation), generated performance data in support of obtaining the Communautés Européennes (CE) mark for European market distribution. The HBV performance evaluations resulted in an overall diagnostic specificity > 99%, i.e. 99.94% for the ADVIA Centaur HBsAg Assay, 100% for the ADVIA Centaur Anti-HBs Assay, 100% for the ADVIA Centaur HBc IgM Assay and 99.94% for the ADVIA Centaur HBc Total Assay. All of the ADVIA Centaur assays showed a very good diagnostic sensitivity on these populations with 100% for the ADVIA Centaur HBsAg Assay, 99.0% for the ADVIA Centaur Anti-HBs Assay, 98.53% for the ADVIA Centaur HBc IgM Assay and 100% for the ADVIA Centaur HBc Total Assay. The ADVIA Centaur HBsAg Confirmatory Test confirmed 100% of the positive HBsAg samples. Testing of interfering substances and potential cross-reacting samples for all ADVIA
Directory of Open Access Journals (Sweden)
Kathleen Ingenhoven
2017-07-01
Full Text Available ObjectiveTo develop and validate a method for the detection of binding anti-drug antibodies (ADAs against interferon beta (IFN-β in human serum as part of a European initiative (ABIRISK aimed at the prediction and analysis of clinical relevance of anti-biopharmaceutical immunization to minimize the risk.MethodA two-tiered bridging enzyme-linked immunosorbent assay (ELISA format was selected and validated according to current recommendations. Screening assay: ADA in serum samples form complexes with immobilized IFN-β and biotinylated IFN-β, which are then detected using HRP labeled Streptavidin and TMB substrate. Confirmation assay: Screen “putative positive” samples are tested in the presence of excess drug (preincubation of sera with 0.3 µg/mL of soluble IFN-β and percentage of inhibition is calculated.ResultsThe assay is precise, and the sensitivity of the assay was confirmed to be 26 ng/mL using commercially available polyclonal rabbit antihuman IFN-β in human sera as the positive control.ConclusionAn ultrasensitive ELISA for IFN-β-binding ADA testing has been validated. This will form the basis to assess anti-biopharmaceutical immunization toward IFN-β with regards to its clinical relevance and may allow for the development of predictive tools, key aims within the ABIRISK consortium.
Clinical performance of a new hepatitis B surface antigen quantitative assay with automatic dilution
Directory of Open Access Journals (Sweden)
Ta-Wei Liu
2015-01-01
Full Text Available Hepatitis B virus surface antigen (HBsAg levels reflect disease status and can predict the clinical response to antiviral treatment; however, the emergence of HBsAg mutant strains has become a challenge. The Abbott HBsAg quantification assay provides enhanced detection of HBsAg and HBsAg mutants. We aimed to evaluate the performance of the Abbott HBsAg quantification assay with automatic sample dilutions (shortened as automatic Architect assay, compared with the Abbott HBsAg quantification assay with manual sample dilutions (shortened as manual Architect assay and the Roche HBsAg quantification assay with automatic sample dilutions (shortened as Elecsys. A total of 130 sera samples obtained from 87 hepatitis B virus (HBV-infected patients were collected to assess the correlation between the automatic and manual Architect assays. Among the 87 patients, 41 provided 42 sera samples to confirm the linearity and reproducibility of the automatic Architect assay, and find out the correlation among the Elecsys and two Architect assays. The coefficients of variation (0.44–9.53% and R2 = 0.996–1, which were both determined using values obtained from the automatic Architect assay, showed good reproducibility and linearity. Results of the two Architect assays demonstrated a feasible correlation (n = 130 samples; R = 0.898, p 0.93 in all cases. In conclusion, the correlation between the automatic and manual dilution Architect assays was feasible, particularly in the HBeAg-negative and low DNA groups. With lower labor costs and less human error than the manual version, the Abbott automatic dilution Architect assay provided a good clinical performance with regard to the HBsAg levels.
Selection of non-destructive assay methods: Neutron counting or calorimetric assay?
International Nuclear Information System (INIS)
Cremers, T.L.; Wachter, J.R.
1994-01-01
The transition of DOE facilities from production to D ampersand D has lead to more measurements of product, waste, scrap, and other less attractive materials. Some of these materials are difficult to analyze by either neutron counting or calorimetric assay. To determine the most efficacious analysis method, variety of materials, impure salts and hydrofluorination residues have been assayed by both calorimetric assay and neutron counting. New data will be presented together with a review of published data. The precision and accuracy of these measurements are compared to chemistry values and are reported. The contribution of the gamma ray isotopic determination measurement to the overall error of the calorimetric assay or neutron assay is examined and discussed. Other factors affecting selection of the most appropriate non-destructive assay method are listed and considered
Detection of 12 respiratory viruses by duplex real time PCR assays in respiratory samples.
Arvia, Rosaria; Corcioli, Fabiana; Ciccone, Nunziata; Della Malva, Nunzia; Azzi, Alberta
2015-12-01
Different viruses can be responsible for similar clinical manifestations of respiratory infections. Thus, the etiological diagnosis of respiratory viral diseases requires the detection of a large number of viruses. In this study, 6 duplex real-time PCR assays, using EvaGreen intercalating dye, were developed to detect 12 major viruses responsible for respiratory diseases: influenza A and B viruses, enteroviruses (including enterovirus spp, and rhinovirus spp), respiratory syncytial virus, human metapneumovirus, coronaviruses group I (of which CoV 229E and CoV NL63 are part) and II (including CoV OC43 and CoV HKU1), parainfluenza viruses type 1, 2, 3 and 4, human adenoviruses and human bocaviruses. The 2 target viruses of each duplex reaction were distinguishable by the melting temperatures of their amplicons. The 6 duplex real time PCR assays were applied for diagnostic purpose on 202 respiratory samples from 157 patients. One hundred fifty-seven samples were throat swabs and 45 were bronchoalveolar lavages. The results of the duplex PCR assays were confirmed by comparison with a commercial, validated, assay; in addition, the positive results were confirmed by sequencing. The analytical sensitivity of the duplex PCR assays varied from 10(3) copies/ml to 10(4) copies/ml. For parainfluenza virus 2 only it was 10(5) copies/ml. Seventy clinical samples (35%) from 55 patients (30 children and 25 adults) were positive for 1 or more viruses. In adult patients, influenza A virus was the most frequently detected respiratory virus followed by rhinoviruses. In contrast, respiratory syncytial virus was the most common virus in children, followed by enteroviruses, influenza A virus and coronavirus NL63. The small number of samples/patients does not allow us to draw any epidemiological conclusion. Altogether, the results of this study indicate that the 6 duplex PCR assays described in this study are sensitive, specific and cost-effective. Thus, this assay could be
DEFF Research Database (Denmark)
Blauenfeldt, Thomas; Wagner, Dirk; Aabye, Martine Grosos
2016-01-01
accuracy of IP-10 release assay and IGRAs. RESULTS: We included 65 patients with confirmed pulmonary tuberculosis and 160 healthy controls from 6 European centres collaborating in the TBnet. In patients, IP-10 responses increased 1.07 (IQR 0.90-1.36) fold and IFN-γ responses decreased 0.88 (IQR 0......INTRODUCTION: Interferon-γ (IFN-γ) inducible protein 10kD (IP-10) and IFN-γ release assays (IGRAs) are immunodiagnostic tests aiming to identify the presence of specific cellular immune responses, interpreted as markers for latent infection with Mycobacterium tuberculosis. Incubation at higher...
Dowd, Scot E; John, David; Eliopolus, James; Gerba, Charles P; Naranjo, Jaime; Klein, Robert; López, Beatriz; de Mejía, Maricruz; Mendoza, Carlos E; Pepper, Ian L
2003-09-01
Human enteropathogenic microsporidia (HEM), Cryptosporidium parvum, Cyclospora cayetanesis, and Giardia lamblia are associated with gastrointestinal disease in humans. To date, the mode of transmission and environmental occurrence of HEM (Encephalitozoon intestinalis and Enterocytozoon bieneusi) and Cyclospora cayetanesis have not been fully elucidated due to lack of sensitive and specific environmental screening methods. The present study was undertaken with recently developed methods, to screen various water sources used for public consumption in rural areas around the city of Guatemala. Water concentrates collected in these areas were subjected to community DNA extraction followed by PCR amplification, PCR sequencing and computer database homology comparison (CDHC). All water samples screened in this study had been previously confirmed positive for Giardia spp. by immunofluorescent assay (IFA). Of the 12 water concentrates screened, 6 showed amplification of microsporidial SSU-rDNA and were subsequently confirmed to be Encephalitozoon intestinalis. Five of the samples allowed for amplification of Cyclospora 18S-rDNA; three of these were confirmed to be Cyclospora cayetanesis while two could not be identified because of inadequate sequence information. Thus, this study represents the first confirmed identification of Cyclospora cayetanesis and Encephalitozoon intestinalis in source water used for consumption. The fact that the waters tested may be used for human consumption indicates that these emerging protozoa may be transmitted by ingestion of contaminated water.
Hua, Boyang; Wang, Yanbo; Park, Seongjin; Han, Kyu Young; Singh, Digvijay; Kim, Jin H; Cheng, Wei; Ha, Taekjip
2018-03-13
Here, we demonstrate that the use of the single-molecule centroid localization algorithm can improve the accuracy of fluorescence binding assays. Two major artifacts in this type of assay, i.e., nonspecific binding events and optically overlapping receptors, can be detected and corrected during analysis. The effectiveness of our method was confirmed by measuring two weak biomolecular interactions, the interaction between the B1 domain of streptococcal protein G and immunoglobulin G and the interaction between double-stranded DNA and the Cas9-RNA complex with limited sequence matches. This analysis routine requires little modification to common experimental protocols, making it readily applicable to existing data and future experiments.
D-dimer assay for deep vein thrombosis: its role with colour Doppler sonography
Energy Technology Data Exchange (ETDEWEB)
Bradley, M.; Bladon, J.; Barker, H
2000-07-01
AIM: To evaluate the role of a negative D-dimer assay in the initial management of patients with clinically suspected deep venous thrombosis (DVT), using colour Doppler ultrasound as the primary diagnostic technique. MATERIALS AND METHODS: A double-blind prospective trial was performed on 143 patients with clinically suspected DVT. All patients underwent a D-dimer assay prior to anticoagulant therapy. DVT was confirmed or excluded by diagnostic colour Doppler ultrasound within 24 h of presentation. RESULTS: In nearly one-third of the cases (31.8%), Doppler ultrasound was positive. The D-dimer assay demonstrated a sensitivity of 97.7% with only one false-negative, but the specificity was low at 48.9% with 45 false-positive results. The positive predictive value for D-dimer assay was 48.8%, whilst the important negative predictive value was 98%. CONCLUSION: If D-dimer was used to screen for DVT, and patients with negative results were not imaged, then the imaging workload could be reduced by 35%. In this study one small calf vein thrombus would have been missed by adopting this practice. Bradley, M. (2000)
Phenotypic assays for the determination of coreceptor tropism in HIV-1 infected individuals.
Braun, Patrick; Wiesmann, Frank
2007-10-15
Coreceptor tropism antagonists represent a new class of antiretrovirals for the treatment of HIV infection. The knowledge of patients' viral population tropism before the initiation of and during therapy with such compounds may be critical in order to optimize treatment strategies. In this review we focus on the characteristics of phenotypic assays for the determination of HIV coreceptor tropism. Beside traditional phenotypic assays, there are at least four phenotypic recombinant virus assays (RVA) available to predict coreceptor usage: Trofile (Monogram Biosciences), Phenoscript (VIRalliance), XtrackC/ PhenX-R (inPheno) and a platform developed by Virco. Trofile and Phenoscript represent single-cycle assays and are able to determine coreceptor tropism without cocultivation of HIV particles in cell culture. Trofile offers the most clinically validated data with currently about 25,000 analysed samples. The detection of minority variants is a limitation of all population-based assays and varies between 1 and 10%, depending on the assay used. XtrackC/PhenX-R and Virco's platform combine genotypic and phenotypic assays to analyze a patient's sample for tropism. Although all assays are validated for the assessment of coreceptor tropism in different HIV-1 subtypes, there is still a need for further evaluations. Furthermore, the establishment of cut-offs for X4 minority species will be difficult, and is affected by many factors like patient sample quality, the input volume, viral load, the detection limits and PCR variations. Overall, RVAs confirm efficiency and accuracy thus making them suitable for the clinical management of HIV infected individuals treated with coreceptor antagonists.
Directory of Open Access Journals (Sweden)
Carina Ladeira
2015-06-01
The results concerning of positive findings by micronuclei and non significant ones by comet assay, are corroborated by Deng et al. (2005 study performed in workers occupationally exposed to methotrexate, also a cytostatic drug. According to Cavallo et al. (2009, the comet assay seems to be more suitable for the prompt evaluation of the genotoxic effects, for instance, of polycyclic aromatic hydrocarbons mixtures containing volatile substances, whereas the micronucleus test seems more appropriate to evaluate the effects of exposure to antineoplastic agents. However, there are studies that observed an increase in both the comet assay and the micronucleus test in nurses handling antineoplastic drugs, although statistical significance was only seen in the comet assay, quite the opposite of our results (Maluf & Erdtmann, 2000; Laffon et al. 2005.
Use of urinary pregnanediol 3-glucuronide to confirm ovulation.
Ecochard, R; Leiva, R; Bouchard, T; Boehringer, H; Direito, A; Mariani, A; Fehring, R
2013-10-01
Urinary hormonal markers may assist in increasing the efficacy of Fertility Awareness Based Methods (FABM). This study uses urinary pregnanediol-3a-glucuronide (PDG) testing to more accurately identify the infertile phase of the menstrual cycle in the setting of FABM. Secondary analysis of an observational and simulation study, multicentre, European study. The study includes 107 women and tracks daily first morning urine (FMU), observed the changes in cervical mucus discharge, and ultrasonography to identify the day of ovulation over 326 menstrual cycles. The following three scenarios were tested: (A) use of the daily pregnandiol-3a-glucuronide (PDG) test alone; (B) use of the PDG test after the first positive urine luteinizing hormone (LH) kit result; (C) use of the PDG test after the disappearance of fertile type mucus. Two models were used: (1) one day of PDG positivity; or (2) waiting for three days of PDG positivity before declaring infertility. After the first positivity of a LH test or the end of fertile mucus, three consecutive days of PDG testing over a threshold of 5μg/mL resulted in a 100% specificity for ovulation confirmation. They were respectively associated an identification of an average of 6.1 and 7.6 recognized infertile days. The results demonstrate a clinical scenario with 100% specificity for ovulation confirmation and provide the theoretical background for a future development of a competitive lateral flow assay for the detection of PDG in the urine. Copyright © 2013 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Sebastian Weiterer
Full Text Available Chromatin immunoprecipitation in combination with a genome-wide analysis via high-throughput sequencing is the state of the art method to gain genome-wide representation of histone modification or transcription factor binding profiles. However, chromatin immunoprecipitation analysis in the context of human experimental samples is limited, especially in the case of blood cells. The typically extremely low yields of precipitated DNA are usually not compatible with library amplification for next generation sequencing. We developed a highly reproducible protocol to present a guideline from the first step of isolating monocytes from a blood sample to analyse the distribution of histone modifications in a genome-wide manner.The protocol describes the whole work flow from isolating monocytes from human blood samples followed by a high-sensitivity and small-scale chromatin immunoprecipitation assay with guidance for generating libraries compatible with next generation sequencing from small amounts of immunoprecipitated DNA.
Rubin, I; Lykkegaard, S; Olsen, A A; Selmer, J; Ballegaard, M
1988-01-01
Monoclonal antibodies were produced against human angiotensinogen. An enzyme linked immunosorbent assay (ELISA) was developed using a high affinity monoclonal antibody as catching antibody and a polyclonal rabbit anti human angiotensinogen antibody as detecting antibody in a "sandwich" ELISA. Linear range of the ELISA was 15-450 pmol/l of human angiotensinogen. Intra- and inter- assay variation coefficients were in the range of 2% to 8%. A correlation coefficient, r = 0.97, (n = 20), with values obtained by radioimmunoassay. This correlation coefficient, obtained by using both normal and pregnant sera, confirmed that the ELISA fulfill the requirements for clinical useful assay. Characterization of the antibodies were performed with respect to affinity constant and epitopes.
Use of the local lymph node assay in assessment of immune function
International Nuclear Information System (INIS)
Berg, Femke A. van den; Baken, Kirsten A.; Vermeulen, Jolanda P.; Gremmer, Eric R.; Steeg, Harry van; Loveren, Henk van
2005-01-01
The murine local lymph node assay (LLNA) was originally developed as a predictive test method for the identification of chemicals with sensitizing potential. In this study we demonstrated that an adapted LLNA can also be used as an immune function assay by studying the effects of orally administered immunomodulating compounds on the T-cell-dependent immune response induced by the contact sensitizer 2,4-dinitrochlorobenzene (DNCB). C57Bl/6 mice were treated with the immunotoxic compounds cyclosporin A (CsA), bis(tri-n-butyltin)oxide (TBTO) or benzo[a]pyrene (B[a]P). Subsequently, cell proliferation and interferon-γ (IFN-γ) and interleukin (IL)-4 release were determined in the auricular lymph nodes (LNs) after DNCB application on both ears. Immunosuppression induced by CsA, TBTO and B[a]P was clearly detectable in this application of the LLNA. Cytokine release measurements proved valuable to confirm the results of the cell proliferation assay and to obtain an indication of the effect on Th1/Th2 balance. We believe to have demonstrated the applicability of an adapted LLNA as an immune function assay in the mouse
Use of the local lymph node assay in assessment of immune function.
van den Berg, Femke A; Baken, Kirsten A; Vermeulen, Jolanda P; Gremmer, Eric R; van Steeg, Harry; van Loveren, Henk
2005-07-01
The murine local lymph node assay (LLNA) was originally developed as a predictive test method for the identification of chemicals with sensitizing potential. In this study we demonstrated that an adapted LLNA can also be used as an immune function assay by studying the effects of orally administered immunomodulating compounds on the T-cell-dependent immune response induced by the contact sensitizer 2,4-dinitrochlorobenzene (DNCB). C57Bl/6 mice were treated with the immunotoxic compounds cyclosporin A (CsA), bis(tri-n-butyltin)oxide (TBTO) or benzo[a]pyrene, (B[a]P). Subsequently, cell proliferation and interferon-gamma (IFN-gamma) and interleukin (IL)-4 release were determined in the auricular lymph nodes (LNs) after DNCB application on both ears. Immunosuppression induced by CsA, TBTO and B[a]P was clearly detectable in this application of the LLNA. Cytokine release measurements proved valuable to confirm the results of the cell proliferation assay and to obtain an indication of the effect on Th1/Th2 balance. We believe to have demonstrated the applicability of an adapted LLNA as an immune function assay in the mouse.
Directory of Open Access Journals (Sweden)
Irina N Riediger
2017-09-01
Full Text Available With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5-10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge.Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors.The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86% for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%. The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%.These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making.
Meng, Juncai; Lai, Ming-Tain; Munshi, Vandna; Grobler, Jay; McCauley, John; Zuck, Paul; Johnson, Eric N; Uebele, Victor N; Hermes, Jeffrey D; Adam, Gregory C
2015-06-01
HIV-1 protease (PR) represents one of the primary targets for developing antiviral agents for the treatment of HIV-infected patients. To identify novel PR inhibitors, a label-free, high-throughput mass spectrometry (HTMS) assay was developed using the RapidFire platform and applied as an orthogonal assay to confirm hits identified in a fluorescence resonance energy transfer (FRET)-based primary screen of > 1 million compounds. For substrate selection, a panel of peptide substrates derived from natural processing sites for PR was evaluated on the RapidFire platform. As a result, KVSLNFPIL, a new substrate measured to have a ~ 20- and 60-fold improvement in k cat/K m over the frequently used sequences SQNYPIVQ and SQNYPIV, respectively, was identified for the HTMS screen. About 17% of hits from the FRET-based primary screen were confirmed in the HTMS confirmatory assay including all 304 known PR inhibitors in the set, demonstrating that the HTMS assay is effective at triaging false-positives while capturing true hits. Hence, with a sampling rate of ~7 s per well, the RapidFire HTMS assay enables the high-throughput evaluation of peptide substrates and functions as an efficient tool for hits triage in the discovery of novel PR inhibitors. © 2015 Society for Laboratory Automation and Screening.
Janardhanan, Jeshina; Prakash, John Antony Jude; Abraham, Ooriapadickal C; Varghese, George M
2014-05-01
A nested polymerase chain reaction (PCR) targeting the 56-kDa antigen gene is currently the most commonly used molecular technique for confirmation of scrub typhus and genotyping of Orientia tsutsugamushi. In this study, we have compared the commonly used nested PCR (N-PCR) with a single-step conventional PCR (C-PCR) for amplification and genotyping. Eschar samples collected from 24 patients with scrub typhus confirmed by IgM enzyme-linked immunosorbent assay were used for DNA extraction following which amplifications were carried out using nested and C-PCR methods. The amplicons were sequenced and compared to other sequences in the database using BLAST. Conventional PCR showed a high positivity rate of 95.8% compared to the 75% observed using N-PCR. On sequence analysis, the N-PCR amplified region showed more variation among strains than the C-PCR amplified region. The C-PCR, which is more economical, provided faster and better results compared to N-PCR. Copyright © 2014 Elsevier Inc. All rights reserved.
Microbead agglutination based assays
Kodzius, Rimantas
2013-01-21
We report a simple and rapid room temperature assay for point-of-care (POC) testing that is based on specific agglutination. Agglutination tests are based on aggregation of microbeads in the presence of a specific analyte thus enabling the macroscopic observation. Such tests are most often used to explore antibody-antigen reactions. Agglutination has been used for protein assays using a biotin/streptavidin system as well as a hybridization based assay. The agglutination systems are prone to selftermination of the linking analyte, prone to active site saturation and loss of agglomeration at high analyte concentrations. We investigated the molecular target/ligand interaction, explaining the common agglutination problems related to analyte self-termination, linkage of the analyte to the same bead instead of different microbeads. We classified the agglutination process into three kinds of assays: a two- component assay, a three-component assay and a stepped three- component assay. Although we compared these three kinds of assays for recognizing DNA and protein molecules, the assay can be used for virtually any molecule, including ions and metabolites. In total, the optimized assay permits detecting analytes with high sensitivity in a short time, 5 min, at room temperature. Such a system is appropriate for POC testing.
Jacques, Nathalie; Vimond, Nadege; Conforti, Rosa; Griscelli, Franck; Lecluse, Yann; Laplanche, Agnes; Malka, David; Vielh, Philippe; Farace, Françoise
2008-09-15
Circulating endothelial cells (CEC) are currently proposed as a potential biomarker for measuring the impact of anti-angiogenic treatments in cancer. However, the lack of consensus on the appropriate method of CEC measurement has led to conflicting data in cancer patients. A validated assay adapted for evaluating the clinical utility of CEC in large cohorts of patients undergoing anti-angiogenic treatments is needed. We developed a four-color flow cytometric assay to measure CEC as CD31(+), CD146(+), CD45(-), 7-amino-actinomycin-D (7AAD)(-) events in whole blood. The distinctive features of the assay are: (1) staining of 1 ml whole blood, (2) use of a whole blood IgPE control to measure accurately background noise, (3) accumulation of a large number of events (almost 5 10(6)) to ensure statistical analysis, and (4) use of 10 microm fluorescent microbeads to evaluate the event size. Assay reproducibility was determined in duplicate aliquots of samples drawn from 20 metastatic cancer patients. Assay linearity was tested by spiking whole blood with low numbers of HUVEC. Five-color flow cytometric experiments with CD144 were performed to confirm the endothelial origin of the cells. CEC were measured in 20 healthy individuals and 125 patients with metastatic cancer. Reproducibility was good between duplicate aliquots (r(2)=0.948, mean difference between duplicates of 0.86 CEC/ml). Detected HUVEC correlated with spiked HUVEC (r(2)=0.916, mean recovery of 100.3%). Co-staining of CD31, CD146 and CD144 confirmed the endothelial nature of cells identified as CEC. Median CEC levels were 6.5/ml (range, 0-15) in healthy individuals and 15.0/ml (range, 0-179) in patients with metastatic carcinoma (p<0.001). The assay proposed here allows reproducible and sensitive measurement of CEC by flow cytometry and could help evaluate CEC as biomarkers of anti-angiogenic therapies in large cohorts of patients.
MXD1 localizes in the nucleolus, binds UBF and impairs rRNA synthesis.
Lafita-Navarro, Maria Del Carmen; Blanco, Rosa; Mata-Garrido, Jorge; Liaño-Pons, Judit; Tapia, Olga; García-Gutiérrez, Lucía; García-Alegría, Eva; Berciano, María T; Lafarga, Miguel; León, Javier
2016-10-25
MXD1 is a protein that interacts with MAX, to form a repressive transcription factor. MXD1-MAX binds E-boxes. MXD1-MAX antagonizes the transcriptional activity of the MYC oncoprotein in most models. It has been reported that MYC overexpression leads to augmented RNA synthesis and ribosome biogenesis, which is a relevant activity in MYC-mediated tumorigenesis. Here we describe that MXD1, but not MYC or MNT, localizes to the nucleolus in a wide array of cell lines derived from different tissues (carcinoma, leukemia) as well as in embryonic stem cells. MXD1 also localizes in the nucleolus of primary tissue cells as neurons and Sertoli cells. The nucleolar localization of MXD1 was confirmed by co-localization with UBF. Co-immunoprecipitation experiments showed that MXD1 interacted with UBF and proximity ligase assays revealed that this interaction takes place in the nucleolus. Furthermore, chromatin immunoprecipitation assays showed that MXD1 was bound in the transcribed rDNA chromatin, where it co-localizes with UBF, but also in the ribosomal intergenic regions. The MXD1 involvement in rRNA synthesis was also suggested by the nucleolar segregation upon rRNA synthesis inhibition by actinomycin D. Silencing of MXD1 with siRNAs resulted in increased synthesis of pre-rRNA while enforced MXD1 expression reduces it. The results suggest a new role for MXD1, which is the control of ribosome biogenesis. This new MXD1 function would be important to curb MYC activity in tumor cells.
Directory of Open Access Journals (Sweden)
Touseef Hussain
2018-05-01
Full Text Available Phytophthora infestans (mont de Bary is a pathogen of great concern across the globe, and accurate detection is an important component in responding to the outbreaks of potential disease. Although the molecular diagnostic protocol used in regulatory programs has been evaluated but till date methods implying direct comparison has rarely used. In this study, a known area soil samples from potato fields where light blight appear every year (both A1 and A2 mating type was assayed by soil bait method, PCR assay detection and quantification of the inoculums. Suspected disease symptoms appeared on bait tubers were further confirmed by rapid PCR, inoculums were quantified through Real Time PCR, which confirms presence of P. infestans. These diagnostic methods can be highly correlated with one another. Potato tuber baiting increased the sensitivity of the assay compared with direct extraction of DNA from tuber and soil samples. Our study determines diagnostic sensitivity and specificity of the assays to determine the performance of each method. Overall, molecular techniques based on different types of PCR amplification and Real-time PCR can lead to high throughput, faster and more accurate detection method which can be used in quarantine programmes in potato industry and diagnostic laboratory.
Directory of Open Access Journals (Sweden)
Valentina Rosu
Full Text Available Mycobacterium avium subspecies paratuberculosis (MAP is a versatile pathogen with a broad host range. Its association with type-1 diabetes mellitus (T1DM has been recently proposed. Rapid identification of infectious agents such as MAP in diabetic patients at the level of clinics might be helpful in deciphering the role of chronic bacterial infection in the development of autoimmune diseases such as T1DM.We describe use of an ELISA method to identify live circulating MAP through the detection of a cell envelope protein, MptD by a specific M13 phage--fMptD. We also used another ELISA format to detect immune response to MptD peptide. Both the methods were tested with blood plasma obtained from T1DM, type-2 diabetes (T2DM patients and non-diabetic controls. Our results demonstrate MptD and fMptD ELISA assays to be accurate and sensitive to detect MAP bacilli in a large fraction (47.3% of T1DM patients as compared to non-diabetic controls (12.6% and those with confirmed T2DM (7.7%. Comparative analysis of ELISA assays performed here with 3 other MAP antigen preparations, namely HbHA, Gsd and whole cell MAP lysates confirmed comparable sensitivity of the MptD peptide and the fMptD based ELISA assays. Moreover, we were successful in demonstrating positive bacterial culture in two of the clinical specimen derived from T1DM patients.The MptD peptide/fMptD based ELISA or similar tests could be suggested as rapid and specific field level diagnostic tests for the identification of MAP in diabetic patients and for finding the explanations towards the occurrence of type-1 or type-2 diabetes in the light of an active infectious trigger.
2010-09-28
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration 21 CFR Part 866 [Docket No. FDA-2009-N-0344] Microbiology Devices; Reclassification of Herpes Simplex Virus Types 1 and 2 Serological Assays; Confirmation of Effective Date AGENCY: Food and Drug Administration, HHS. ACTION: Direct...
Santiago, Gilberto A; Vergne, Edgardo; Quiles, Yashira; Cosme, Joan; Vazquez, Jesus; Medina, Juan F; Medina, Freddy; Colón, Candimar; Margolis, Harold; Muñoz-Jordán, Jorge L
2013-01-01
Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV). There are four genetically distinct DENVs (DENV-1-4) that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA) for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.
Liu, Xiaofeng; Wang, Xiaoyu; Wang, Qian; Luo, Mingyang; Guo, Huancheng; Gong, Wenjie; Tu, Changchun; Sun, Jinfu
2018-02-01
Classical swine fever virus (CSFV) NS5A protein is a multifunctional protein, playing critical roles in viral RNA replication, translation and assembly. To further explore its functions in viral replication, interaction of NS5A with host factors was assayed using a his-tag "pull down" assay coupled with shotgun LC-MS/MS. Host protein translation initiation factor 3 subunit E was identified as a binding partner of NS5A, and confirmed by co-immunoprecipitation and co-localization analysis. Overexpression of eIF3E markedly enhanced CSFV genomic replication, viral protein expression and production of progeny virus, and downregulation of eIF3E by siRNA significantly decreased viral proliferation in PK-15 cells. Luciferase reporter assay showed an enhancement of translational activity of the internal ribosome entry site of CSFV by eIF3E and a decrease in cellular translation by NS5A. These data indicate that eIF3E plays an important role in CSFV replication, thereby identifying it as a potential target for inhibition of the virus. Copyright © 2017 Elsevier Inc. All rights reserved.
Open innovation for phenotypic drug discovery: The PD2 assay panel.
Lee, Jonathan A; Chu, Shaoyou; Willard, Francis S; Cox, Karen L; Sells Galvin, Rachelle J; Peery, Robert B; Oliver, Sarah E; Oler, Jennifer; Meredith, Tamika D; Heidler, Steven A; Gough, Wendy H; Husain, Saba; Palkowitz, Alan D; Moxham, Christopher M
2011-07-01
Phenotypic lead generation strategies seek to identify compounds that modulate complex, physiologically relevant systems, an approach that is complementary to traditional, target-directed strategies. Unlike gene-specific assays, phenotypic assays interrogate multiple molecular targets and signaling pathways in a target "agnostic" fashion, which may reveal novel functions for well-studied proteins and discover new pathways of therapeutic value. Significantly, existing compound libraries may not have sufficient chemical diversity to fully leverage a phenotypic strategy. To address this issue, Eli Lilly and Company launched the Phenotypic Drug Discovery Initiative (PD(2)), a model of open innovation whereby external research groups can submit compounds for testing in a panel of Lilly phenotypic assays. This communication describes the statistical validation, operations, and initial screening results from the first PD(2) assay panel. Analysis of PD(2) submissions indicates that chemical diversity from open source collaborations complements internal sources. Screening results for the first 4691 compounds submitted to PD(2) have confirmed hit rates from 1.6% to 10%, with the majority of active compounds exhibiting acceptable potency and selectivity. Phenotypic lead generation strategies, in conjunction with novel chemical diversity obtained via open-source initiatives such as PD(2), may provide a means to identify compounds that modulate biology by novel mechanisms and expand the innovation potential of drug discovery.
Souberbielle, Jean-Claude; Fayol, Véronique; Sault, Corinne; Lawson-Body, Ethel; Kahan, André; Cormier, Catherine
2005-02-01
The recent development of nonradioactive automated assays for serum parathyroid hormone (PTH) and 25-hydroxyvitamin D (25OHD) has made measurement of these two hormones possible in many laboratories. In this study, we compared two new assays for PTH and 25OHD adapted on an automated analyzer, the LIAISON, with two manual immunoassays used worldwide. We studied 228 osteoporotic patients, 927 healthy individuals, 38 patients with primary hyperparathyroidism, and 167 hemodialyzed patients. Serum PTH was measured with the Allegro and the LIAISON assays, and 25OHD was measured with DiaSorin RIA and the LIAISON assay. Regression analysis was used to calculate decision thresholds for the LIAISON assays that were equivalent to those of the Allegro PTH and DiaSorin 25OHD assays. The 25OHD concentrations obtained with the LIAISON assay and the RIA in osteoporotic patients were well correlated (r = 0.83; P 50 nmol/L as eligible for the reference population for the LIAISON PTH assay. In this group, the 3rd-97th percentile interval for LIAISON PTH was 3-51 ng/L. Considering upper reference limits of 46 and 51 ng/L for the Allegro and LIAISON assays, respectively, the frequency of above-normal PTH concentrations in patients with primary hyperparathyroidism was similar in both assays. Regression analysis between serum PTH measured by the Allegro and LIAISON assays in 167 hemodialyzed patients and the corresponding Bland-Altman analysis of these data suggest that the LIAISON PTH assay tends to read higher than the Allegro assay at low concentrations but lower at high concentrations (>300 ng/L). Because clinical decision limits for both PTH and 25OHD should be assay specific, we propose equivalences between these assays and two manual assays used worldwide. These assay-specific decision limits should help potential users of the LIAISON PTH and 25OHD assays.
Maheux, Andrée F; Dion-Dupont, Vanessa; Bisson, Marc-Antoine; Bouchard, Sébastien; Jubinville, Éric; Nkuranga, Martine; Rodrigue, Lynda; Bergeron, Michel G; Rodriguez, Manuel J
2015-03-01
MI agar and Colilert(®), as well as mFC agar combined with an Escherichia coli-specific molecular assay (mFC + E. coli rtPCR), were compared in terms of their sensitivity, ease of use, time to result and affordability. The three methods yielded a positive E. coli signal for 11.5, 10.8, and 11.5% of the 968 well water samples tested, respectively. One hundred and thirty-six (136) samples gave blue colonies on mFC agar and required confirmation. E. coli-specific rtPCR showed false-positive results in 23.5% (32/136) of cases. In terms of ease of use, Colilert was the simplest method to use while the MI method provided ease of use comparable to all membrane filtration methods. However, the mFC + E. coli rtPCR assay required highly trained employees for confirmation purposes. In terms of affordability, and considering contamination rate of well water samples tested, the Colilert method and the mFC + E. coli rtPCR assay were at least five times more costly than the MI agar method. Overall, compared with the other two methods tested, the MI agar method offers the most advantages to assess drinking water quality.
Development of an integrated assay facility
International Nuclear Information System (INIS)
Molesworth, T.V.; Bailey, M.; Findlay, D.J.S.; Sene, M.R.; Swinhoe, M.T.
1990-01-01
Initial results of active neutron and active gamma-ray interrogation of a 500 liter cemented simulated CAGR intermediate level radioactive waste drum are described. The basis of the interrogation systems was the Harwell electron linear accelerator HELIOS, which was used to produce the interrogating neutrons and gamma-rays. Several sets of neutron detectors were located around the drum to count signature neutrons. The responses of the system were measured by placing known samples at many different locations within the drum. In general, measured responses confirmed calculated responses. Good agreement was obtained for the azimuthal angle dependences. The absolute responses agreed well for gamma-ray interrogation, but the calculations were apparently over-estimates for neutron interrogation. Those aspects requiring consideration in the practical application of assay techniques are identified. 8 refs., 6 figs
In late February, two separate observations confirmed the 1978 discovery by U.S. Naval Observatory scientist James W. Christy of a moon orbiting the planet Pluto. According to the U.S. Naval Observatory, these two observations were needed before the International Astronomical Society (IAS) would officially recognize the discovery.Two types of observations of the moon, which was named Charon after the ferryman in Greek mythology who carried the dead to Pluto's realm, were needed for confirmation: a transit, in which the moon passes in front of Pluto, and an occultation, in which the moon passes behind the planet. These two phenomena occur only during an 8-year period every 124 years that had been calculated to take place during 1984-1985. Both events were observed in late February.
Effects of estradiol and progesterone on the variability of the micronucleus assay
International Nuclear Information System (INIS)
Baeyens, Ans; Vandersickel, Veerle; Thierens, Hubert; Ridder, Leo De; Vral, Anne
2005-01-01
To investigate chromosomal radiosensitivity of lymphocytes the micronucleus (MN) assay has been used for many years. The results of these studies suggest the use of the MN assay as a biomarker for cancer predisposition. However, the MN assay has still some limitations associated with the reproducibility and sensitivity. Especially a high intra-individual variability has been observed. An explanation for this high intra-individual variability is not yet available. In literature it is suggested that the high variability among females is attributable to hormonal status. In this study we investigated if the high intra-individual variability in micronucleus formation in lymphocytes of females after in vitro exposure to ionising radiation is caused by variations in hormone levels of estradiol (E2) and progesterone (PROG). For this, the MN assay was performed on blood samples of 18 healthy women during 7 consecutive weeks while the estradiol and progesterone levels were determined at the same time. The MN assay was also examined in cultures of isolated blood lymphocytes with estradiol or progesterone levels added in vitro. The results demonstrated that estradiol and progesterone levels have no influence on the variations in radiation-induced MN yields observed in blood samples of healthy women. These conclusions were confirmed by the 'in vitro' experiments as no correlation between the MN yields and the concentrations of hormones (estradiol or progesterone) added in vitro to isolated lymphocytes cultures was observed
Worlock, A; Blair, D; Hunsicker, M; Le-Nguyen, T; Motta, C; Nguyen, C; Papachristou, E; Pham, J; Williams, A; Vi, M; Vinluan, B; Hatzakis, A
2017-04-04
The Aptima HCV Quant Dx assay (Aptima assay) is a fully automated quantitative assay on the Panther® system. This assay is intended for confirmation of diagnosis and monitoring of HCV RNA in plasma and serum specimens. The purpose of the testing described in this paper was to evaluate the performance of the Aptima assay. The analytical sensitivity, analytical specificity, precision, and linearity of the Aptima assay were assessed. The performance of the Aptima assay was compared to two commercially available HCV assays; the Abbott RealTime HCV assay (Abbott assay, Abbott Labs Illinois, USA) and the Roche COBAS Ampliprep/COBAS Taqman HCV Quantitative Test v2.0 (Roche Assay, Roche Molecular Systems, Pleasanton CA, USA). The 95% Lower Limit of Detection (LoD) of the assay was determined from dilutions of the 2nd HCV WHO International Standard (NIBSC 96/798 genotype 1) and HCV positive clinical specimens in HCV negative human plasma and serum. Probit analysis was performed to generate the 95% predicted detection limits. The Lower Limit of Quantitation (LLoQ) was established for each genotype by diluting clinical specimens and the 2nd HCV WHO International Standard (NIBSC 96/798 genotype 1) in HCV negative human plasma and serum. Specificity was determined using 200 fresh and 536 frozen HCV RNA negative clinical specimens including 370 plasma specimens and 366 serum specimens. Linearity for genotypes 1 to 6 was established by diluting armored RNA or HCV positive clinical specimens in HCV negative serum or plasma from 8.08 log IU/mL to below 1 log IU/mL. Precision was tested using a 10 member panel made by diluting HCV positive clinical specimens or spiking armored RNA into HCV negative plasma and serum. A method comparison was conducted against the Abbott assay using 1058 clinical specimens and against the Roche assay using 608 clinical specimens from HCV infected patients. In addition, agreement between the Roche assay and the Aptima assay using specimens with low
Mucin 1 (MUC1 is a novel partner for MAL2 in breast carcinoma cells
Directory of Open Access Journals (Sweden)
McGuckin Michael A
2009-01-01
Full Text Available Abstract Background The MAL2 gene, encoding a four-transmembrane protein of the MAL family, is amplified and overexpressed in breast and other cancers, yet the significance of this is unknown. MAL-like proteins have trafficking functions, but their molecular roles are largely obscure, partly due to a lack of known binding partners. Methods Yeast two-hybrid screening of a breast carcinoma cDNA expression library was performed using a full-length MAL2 bait, and subsequent deletion mapping experiments were performed. MAL2 interactions were confirmed by co-immunoprecipitation analyses and confocal microscopy was employed to compare protein sub-cellular distributions. Sucrose density gradient centrifugation of membranes extracted in cold Triton X-100 was employed to compare protein distributions between Triton X-100-soluble and -insoluble fractions. Results The tumor-associated protein mucin 1 (MUC1 was identified as a potential MAL2 partner, with MAL2/MUC1 interactions being confirmed in myc-tagged MAL2-expressing MCF-10A cells using co-immunoprecipitation assays. Deletion mapping experiments demonstrated a requirement for the first MAL2 transmembrane domain for MUC1 binding, whereas the MAL2 N-terminal domain was required to bind D52-like proteins. Confocal microscopy identified cytoplasmic co-localisation of MUC1 and MAL2 in breast cell lines, and centrifugation of cell lysates to equilibrium in sucrose density gradients demonstrated that MAL2 and MUC1 proteins were co-distributed between Triton X-100-soluble and -insoluble fractions. However co-immunoprecipitation analyses detected MAL2/MUC1 interactions in Triton X-100-soluble fractions only. Myc-MAL2 expression in MCF-10A cells was associated with both increased MUC1 detection within Triton X-100-soluble and -insoluble fractions, and increased MUC1 detection at the cell surface. Conclusion These results identify MUC1 as a novel MAL2 partner, and suggest a role for MAL2 in regulating MUC1
Nondestructive Assay Data Integration with the SKB-50 Assemblies - FY16 Update
International Nuclear Information System (INIS)
Tobin, Stephen Joseph; Fugate, Michael Lynn; Trellue, Holly Renee; DeBaere, Paul; Sjoland, Anders; Liljenfeldt, Henrik; Hu, Jianwei; Backstrom, Ulrika; Bengtsson, Martin; Burr, Tomas; Eliasson, Annika; Favalli, Andrea; Gauld, Ian; Grogan, Brandon; Jansson, Peter; Junell, Henrik; Schwalbach, Peter; Vaccaro, Stefano; Vo, Duc Ta; Wildestrand, Henrik
2016-01-01
A project to research the application of non-destructive assay (NDA) techniques for spent fuel assemblies is underway at the Central Interim Storage Facility for Spent Nuclear Fuel (for which the Swedish acronym is Clab) in Oskarshamn, Sweden. The research goals of this project contain both safeguards and non-safeguards interests. These nondestructive assay (NDA) technologies are designed to strengthen the technical toolkit of safeguard inspectors and others to determine the following technical goals more accurately; Verify initial enrichment, burnup, and cooling time of facility declaration for spent fuel assemblies; Detect replaced or missing pins from a given spent fuel assembly to confirm its integrity; and Estimate plutonium mass and related plutonium and uranium fissile mass parameters in spent fuel assemblies. Estimate heat content, and measure reactivity (multiplication).
Nondestructive Assay Data Integration with the SKB-50 Assemblies - FY16 Update
Energy Technology Data Exchange (ETDEWEB)
Tobin, Stephen Joseph [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Fugate, Michael Lynn [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Trellue, Holly Renee [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); DeBaere, Paul [DG Energy, Luxembourg (Germany); Sjoland, Anders [Swedish Nuclear Fuel and Waste Management Company, Stockholm (Sweden); Liljenfeldt, Henrik [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Hu, Jianwei [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Backstrom, Ulrika [Swedish Nuclear Fuel and Waste Management Company, Stockholm (Sweden); Vattenfall AB, Stockholm (Sweden); Bengtsson, Martin [Swedish Nuclear Fuel and Waste Management Company, Stockholm (Sweden); Vattenfall AB, Stockholm (Sweden); Burr, Tomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); International Atomic Energy Agency, Vienna (Austria); Eliasson, Annika [Swedish Nuclear Fuel and Waste Management Company, Stockholm (Sweden); Favalli, Andrea [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Gauld, Ian [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Grogan, Brandon [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Jansson, Peter [Uppsala Univ. (Sweden); Junell, Henrik [Swedish Nuclear Fuel and Waste Management Company, Stockholm (Sweden); Schwalbach, Peter [DG Energy, Luxembourg (Germany); Vaccaro, Stefano [DG Energy, Luxembourg (Germany); Vo, Duc Ta [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Wildestrand, Henrik [Swedish Nuclear Fuel and Waste Management Company, Stockholm (Sweden); Vattenfall AB, Stockholm (Sweden)
2016-10-28
A project to research the application of non-destructive assay (NDA) techniques for spent fuel assemblies is underway at the Central Interim Storage Facility for Spent Nuclear Fuel (for which the Swedish acronym is Clab) in Oskarshamn, Sweden. The research goals of this project contain both safeguards and non-safeguards interests. These nondestructive assay (NDA) technologies are designed to strengthen the technical toolkit of safeguard inspectors and others to determine the following technical goals more accurately; Verify initial enrichment, burnup, and cooling time of facility declaration for spent fuel assemblies; Detect replaced or missing pins from a given spent fuel assembly to confirm its integrity; and Estimate plutonium mass and related plutonium and uranium fissile mass parameters in spent fuel assemblies. Estimate heat content, and measure reactivity (multiplication).
Genc, Ozlem; Aksu, Evrim; Gulcan, Aynur
2016-06-01
In this study, we aimed to identify the molecular carbapenemase types of the Enterobacteriaceae isolates and to evaluate the performance of manually prepared and commercially available combination disc methods and the modified Hodge test. One hundred and forty carbapenemase producing isolates and 45 isolates as control group were included in our study. The Xpert CARBA-R test was used as the molecular method. Antibiotic susceptibility tests were performed using combined discs, manually prepared with APBA (3-aminophenyl boronic acid), DPA (dipicolinic acid), EDTA (Ethylene diamine tetra acetic acid), cloxacillin supplements and Mastdiscs Combi-D70C that includes four antibiotic discs with specific inhibitors and temocillin discs. The modified Hodge test was performed on all isolates. OXA-48 gene was identified in 129 isolates , the NDM gene was identified in 10 isolates and VIM in one isolate. Thirty inaccurate results (30/185, 16%) were detected by using the manually prepared confirmation test. The sensitivity and specificity of this test were identified respectively 85% and 73%. Also, the sensitivity and specificity of the Mastdiscs Combi-D70C were identified as 100%. Negative results were detected in 3 NDM isolates with the use of a modified Hodge test. Sensitivity and specificity were calculated for the modified Hodge test respectively 97% and 100%. Finally, molecular methods provide results rapidly but they are not always easily accessible. The modified Hodge test can be used only for screening as a first step test and is not one of the tests that can identify the type of the carbapenemase. When carbapenem-resistant Enterobacteriaceae are detected, a commercial kit like Mastdiscs Combi-D70 may be preferred instead of the manually prepared phenotypic verification tests. Copyright © 2016 Elsevier B.V. All rights reserved.
Zhai, Juping; Ding, Mengyuan; Yang, Tianjie; Zuo, Bin; Weng, Zhen; Zhao, Yunxiao; He, Jun; Wu, Qingyu; Ruan, Changgeng; He, Yang
2017-10-23
Platelet autoantibody detection is critical for immune thrombocytopenia (ITP) diagnosis and prognosis. Therefore, we aimed to establish a quantitative flow cytometric immunobead assay (FCIA) for ITP platelet autoantibodies evaluation. Capture microbeads coupled with anti-GPIX, -GPIb, -GPIIb, -GPIIIa and P-selectin antibodies were used to bind the platelet-bound autoantibodies complex generated from plasma samples of 250 ITP patients, 163 non-ITP patients and 243 healthy controls, a fluorescein isothiocyanate (FITC)-conjugated secondary antibody was the detector reagent and mean fluorescence intensity (MFI) signals were recorded by flow cytometry. Intra- and inter-assay variations of the quantitative FCIA assay were assessed. Comparisons of the specificity, sensitivity and accuracy between quantitative and qualitative FCIA or monoclonal antibody immobilization of platelet antigen (MAIPA) assay were performed. Finally, treatment process was monitored by our quantitative FCIA in 8 newly diagnosed ITPs. The coefficient of variations (CV) of the quantitative FCIA assay were respectively 9.4, 3.8, 5.4, 5.1 and 5.8% for anti-GPIX, -GPIb, -GPIIIa, -GPIIb and -P-selectin autoantibodies. Elevated levels of autoantibodies against platelet glycoproteins GPIX, GPIb, GPIIIa, GPIIb and P-selectin were detected by our quantitative FCIA in ITP patients compared to non-ITP patients or healthy controls. The sensitivity, specificity and accuracy of our quantitative assay were respectively 73.13, 81.98 and 78.65% when combining all 5 autoantibodies, while the sensitivity, specificity and accuracy of MAIPA assay were respectively 41.46, 90.41 and 72.81%. A quantitative FCIA assay was established. Reduced levels of platelet autoantibodies could be confirmed by our quantitative FCIA in ITP patients after corticosteroid treatment. Our quantitative assay is not only good for ITP diagnosis but also for ITP treatment monitoring.
Rosebrock, J A; Parker, C L; Kute, T E
1981-01-01
This investigation was to study the biosynthesis of 3H-labeled alpha-fetoprotein (AFP) by cultured mouse hepatoma (HEPA-2) cells. Both the function and regulation of this oncodevelopmental gene are unknown. However, evidence indicates that mechanisms controlling the expression of AFP involve aspects of both normal embryonic development and neoplastic transformation. the secretion of AFP was analyzed during different phases of the growth cycle to provide information on AFP production using standard culture conditions. The highest rate of secretion occurred during the stationary phase, followed by the late logarithmic and early logarithmic phases of growth, respectively. The production of AFP was then determined following the addition of glucocorticoids and estrogens in an attempt to understand hormonal factors that may be involved. Studies utilizing estradiol-17 beta indicated that the secretion of AFP did not appear to be sensitive to this steroid even though sucrose density gradient analysis of HEPA-2 cytosol, for estrogenic receptors, revealed competitive binding moieties on the 8S and 4S regions of the gradient. In contrast, the secretion of the total complement of proteins, including AFP, was significantly stimulated by the glucocorticoids, dexamethasone and corticosterone. Analysis of HEPA-2 cytosol for glucocorticoid receptors revealed binding components in the 7S and 3-4S regions of the gradient. The 3H-dexamethasone binding appeared to be stereospecific since nonlabeled dexamethasone, but not nonlabeled estradiol-17 beta, effectively displaced the bound radioactivity. The glucocorticoid-binding component in HEPA-2 therefore displayed characteristics reported for glucocorticoid receptors in normal liver and other hepatomas.
Czech Academy of Sciences Publication Activity Database
Tichý, Vlastimil; Šebest, Peter; Orság, Petr; Havran, Luděk; Pivoňková, Hana; Fojta, Miroslav
2017-01-01
Roč. 29, č. 2 (2017), s. 319-323 ISSN 1040-0397 R&D Projects: GA ČR GAP206/11/1638 Institutional support: RVO:68081707 Keywords : catalytic hydrogen evolution * probe * mechanism * suggest Subject RIV: CG - Electrochemistry OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 2.851, year: 2016
Directory of Open Access Journals (Sweden)
Gilberto A Santiago
Full Text Available Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV. There are four genetically distinct DENVs (DENV-1-4 that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.
A Functional Henipavirus Envelope Glycoprotein Pseudotyped Lentivirus Assay System
Directory of Open Access Journals (Sweden)
Broder Christopher C
2010-11-01
Full Text Available Abstract Background Hendra virus (HeV and Nipah virus (NiV are newly emerged zoonotic paramyxoviruses discovered during outbreaks in Queensland, Australia in 1994 and peninsular Malaysia in 1998/9 respectively and classified within the new Henipavirus genus. Both viruses can infect a broad range of mammalian species causing severe and often-lethal disease in humans and animals, and repeated outbreaks continue to occur. Extensive laboratory studies on the host cell infection stage of HeV and NiV and the roles of their envelope glycoproteins have been hampered by their highly pathogenic nature and restriction to biosafety level-4 (BSL-4 containment. To circumvent this problem, we have developed a henipavirus envelope glycoprotein pseudotyped lentivirus assay system using either a luciferase gene or green fluorescent protein (GFP gene encoding human immunodeficiency virus type-1 (HIV-1 genome in conjunction with the HeV and NiV fusion (F and attachment (G glycoproteins. Results Functional retrovirus particles pseudotyped with henipavirus F and G glycoproteins displayed proper target cell tropism and entry and infection was dependent on the presence of the HeV and NiV receptors ephrinB2 or B3 on target cells. The functional specificity of the assay was confirmed by the lack of reporter-gene signals when particles bearing either only the F or only G glycoprotein were prepared and assayed. Virus entry could be specifically blocked when infection was carried out in the presence of a fusion inhibiting C-terminal heptad (HR-2 peptide, a well-characterized, cross-reactive, neutralizing human mAb specific for the henipavirus G glycoprotein, and soluble ephrinB2 and B3 receptors. In addition, the utility of the assay was also demonstrated by an examination of the influence of the cytoplasmic tail of F in its fusion activity and incorporation into pseudotyped virus particles by generating and testing a panel of truncation mutants of NiV and HeV F
Assay strategies and methods for phospholipases
International Nuclear Information System (INIS)
Reynolds, L.J.; Washburn, W.N.; Deems, R.A.; Dennis, E.A.
1991-01-01
Of the general considerations discussed, the two issues which are most important in choosing an assay are (1) what sensitivity is required to assay a particular enzyme and (2) whether the assay must be continuous. One can narrow the options further by considering substrate availability, enzyme specificity, assay convenience, or the presence of incompatible side reactions. In addition, the specific preference of a particular phospholipase for polar head group, micellar versus vesicular substrates, and anionic versus nonionic detergents may further restrict the options. Of the many assays described in this chapter, several have limited applicability or serious drawbacks and are not commonly employed. The most commonly used phospholipase assays are the radioactive TLC assay and the pH-stat assay. The TLC assay is probably the most accurate, sensitive assay available. These aspects often outweigh the disadvantages of being discontinuous, tedious, and expensive. The radioactive E. coli assay has become popular recently as an alternative to the TLC assay for the purification of the mammalian nonpancreatic phospholipases. The assay is less time consuming and less expensive than the TLC assay, but it is not appropriate when careful kinetics are required. Where less sensitivity is needed, or when a continuous assay is necessary, the pH-stat assay is often employed. With purified enzymes, when free thiol groups are not present, a spectrophotometric thiol assay can be used. This assay is ∼ as sensitive as the pH-stat assay but is more convenient and more reproducible, although the substrate is not available commercially. Despite the many assay choices available, the search continues for a convenient, generally applicable assay that is both sensitive and continuous
Pride, Michael W; Huijts, Susanne M; Wu, Kangjian; Souza, Victor; Passador, Sherry; Tinder, Chunyan; Song, Esther; Elfassy, Arik; McNeil, Lisa; Menton, Ronald; French, Roger; Callahan, Janice; Webber, Chris; Gruber, William C; Bonten, Marc J M; Jansen, Kathrin U
2012-08-01
To improve the clinical diagnosis of pneumococcal infection in bacteremic and nonbacteremic community-acquired pneumonia (CAP), a Luminex technology-based multiplex urinary antigen detection (UAD) diagnostic assay was developed and validated. The UAD assay can simultaneously detect 13 different serotypes of Streptococcus pneumoniae by capturing serotype-specific S. pneumoniae polysaccharides (PnPSs) secreted in human urine. Assay specificity is achieved by capturing the polysaccharides with serotype-specific monoclonal antibodies (MAbs) on spectrally unique microspheres. Positivity for each serotype was based on positivity cutoff values calculated from a standard curve run on each assay plate together with positive- and negative-control urine samples. The assay is highly specific, since significant signals are detected only when each PnPS was paired with its homologous MAb-coated microspheres. Validation experiments demonstrated excellent accuracy and precision. The UAD assay and corresponding positivity cutoff values were clinically validated by assessing 776 urine specimens obtained from patients with X-ray-confirmed CAP. The UAD assay demonstrated 97% sensitivity and 100% specificity using samples obtained from patients with bacteremic, blood culture-positive CAP. Importantly, the UAD assay identified Streptococcus pneumoniae (13 serotypes) in a proportion of individuals with nonbacteremic CAP, a patient population for which the pneumococcal etiology of CAP was previously difficult to assess. Therefore, the UAD assay provides a specific, noninvasive, sensitive, and reproducible tool to support vaccine efficacy as well as epidemiological evaluation of pneumococcal disease, including CAP, in adults.
Tien, Wei-Ping; Lim, Gareth; Yeo, Gladys; Chiang, Suzanna Nicole; Chong, Chee-Seng; Ng, Lee-Ching; Hapuarachchi, Hapuarachchige Chanditha
2017-09-19
The monitoring of vectors is one of the key surveillance measures to assess the risk of arbovirus transmission and the success of control strategies in endemic regions. The recent re-emergence of Zika virus (ZIKV) in the tropics, including Singapore, emphasizes the need to develop cost-effective, rapid and accurate assays to monitor the virus spread by mosquitoes. As ZIKV infections largely remain asymptomatic, early detection of ZIKV in the field-caught mosquitoes enables timely implementation of appropriate mosquito control measures. We developed a rapid, sensitive and specific real-time reverse transcription polymerase chain reaction (rRT-PCR) assay for the detection of ZIKV in field-caught mosquitoes. The primers and PCR cycling conditions were optimized to minimize non-specific amplification due to cross-reactivity with the genomic material of Aedes aegypti, Aedes albopictus, Culex quinquefasciatus, Culex tritaeniorhynchus, Culex sitiens and Anopheles sinensis, as well as accompanying microbiota. The performance of the assay was further evaluated with a panel of flaviviruses and alphaviruses as well as in field-caught Ae. aegypti mosquitoes confirmed to be positive for ZIKV. As compared to a probe-based assay, the newly developed assay demonstrated 100% specificity and comparable detection sensitivity for ZIKV in mosquitoes. Being a SYBR Green-based method, the newly-developed assay is cost-effective and easy to adapt, thus is applicable to large-scale vector surveillance activities in endemic countries, including those with limited resources and expertise. The amplicon size (119 bp) also allows sequencing to confirm the virus type. The primers flank relatively conserved regions of ZIKV genome, so that, the assay is able to detect genetically diverse ZIKV strains. Our findings, therefore, testify the potential use of the newly-developed assay in vector surveillance programmes for ZIKV in endemic regions.
International network for comparison of HIV neutralization assays: the NeutNet report II.
Directory of Open Access Journals (Sweden)
Leo Heyndrickx
Full Text Available BACKGROUND: Neutralizing antibodies provide markers for vaccine-induced protective immunity in many viral infections. By analogy, HIV-1 neutralizing antibodies induced by immunization may well predict vaccine effectiveness. Assessment of neutralizing antibodies is therefore of primary importance, but is hampered by the fact that we do not know which assay(s can provide measures of protective immunity. An international collaboration (NeutNet involving 18 different laboratories previously compared different assays using monoclonal antibodies (mAbs and soluble CD4 (Phase I study. METHODS: In the present study (Phase II, polyclonal reagents were evaluated by 13 laboratories. Each laboratory evaluated nine plasmas against an 8 virus panel representing different genetic subtypes and phenotypes. TriMab, a mixture of three mAbs, was used as a positive control allowing comparison of the results with Phase I in a total of nine different assays. The assays used either uncloned virus produced in peripheral blood mononuclear cells (PBMCs (Virus Infectivity Assays, VIA, or Env (gp160-pseudotyped viruses (pseudoviruses, PSV produced in HEK293T cells from molecular clones or from uncloned virus. Target cells included PBMC and genetically engineered cell lines in either single- or multiple-cycle infection format. Infection was quantified by using a range of assay read-outs including extra- or intra-cellular p24 antigen detection, luciferase, beta-galactosidase or green fluorescent protein (GFP reporter gene expression. FINDINGS: Using TriMab, results of Phase I and Phase II were generally in agreement for six of the eight viruses tested and confirmed that the PSV assay is more sensitive than PBMC (p = 0.014. Comparisons with the polyclonal reagents showed that sensitivities were dependent on both virus and plasma. CONCLUSIONS: Here we further demonstrate clear differences in assay sensitivities that were dependent on both the neutralizing reagent and the virus
International network for comparison of HIV neutralization assays: the NeutNet report II.
Heyndrickx, Leo; Heath, Alan; Sheik-Khalil, Enas; Alcami, Jose; Bongertz, Vera; Jansson, Marianne; Malnati, Mauro; Montefiori, David; Moog, Christiane; Morris, Lynn; Osmanov, Saladin; Polonis, Victoria; Ramaswamy, Meghna; Sattentau, Quentin; Tolazzi, Monica; Schuitemaker, Hanneke; Willems, Betty; Wrin, Terri; Fenyö, Eva Maria; Scarlatti, Gabriella
2012-01-01
Neutralizing antibodies provide markers for vaccine-induced protective immunity in many viral infections. By analogy, HIV-1 neutralizing antibodies induced by immunization may well predict vaccine effectiveness. Assessment of neutralizing antibodies is therefore of primary importance, but is hampered by the fact that we do not know which assay(s) can provide measures of protective immunity. An international collaboration (NeutNet) involving 18 different laboratories previously compared different assays using monoclonal antibodies (mAbs) and soluble CD4 (Phase I study). In the present study (Phase II), polyclonal reagents were evaluated by 13 laboratories. Each laboratory evaluated nine plasmas against an 8 virus panel representing different genetic subtypes and phenotypes. TriMab, a mixture of three mAbs, was used as a positive control allowing comparison of the results with Phase I in a total of nine different assays. The assays used either uncloned virus produced in peripheral blood mononuclear cells (PBMCs) (Virus Infectivity Assays, VIA), or Env (gp160)-pseudotyped viruses (pseudoviruses, PSV) produced in HEK293T cells from molecular clones or from uncloned virus. Target cells included PBMC and genetically engineered cell lines in either single- or multiple-cycle infection format. Infection was quantified by using a range of assay read-outs including extra- or intra-cellular p24 antigen detection, luciferase, beta-galactosidase or green fluorescent protein (GFP) reporter gene expression. Using TriMab, results of Phase I and Phase II were generally in agreement for six of the eight viruses tested and confirmed that the PSV assay is more sensitive than PBMC (p = 0.014). Comparisons with the polyclonal reagents showed that sensitivities were dependent on both virus and plasma. Here we further demonstrate clear differences in assay sensitivities that were dependent on both the neutralizing reagent and the virus. Consistent with the Phase I study, we recommend
He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang
2010-08-27
P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
International Nuclear Information System (INIS)
Reese, M.G.; Johnson, L.R.; Ransom, D.K.
1980-01-01
In a solid phase assay for quantitative determination of biological and other analytes, a sample such as serum is contacted with a receptor for the analyte being assayed, the receptor being supported on a solid support. No tracer for the analyte is added to the sample before contacting with the receptor; instead the tracer is contacted with the receptor after unbound analyte has been removed from the receptor. The assay can be otherwise performed in a conventional manner but can give greater sensitivity. (author)
Keck, Nicolas; Boschiroli, Maria-Laura; Smyej, Florence; Vogler, Valérie; Moyen, Jean-Louis; Desvaux, Stéphanie
2018-01-01
In the French Camargue region, where bovine tuberculosis had been enzootic for several years in bullfighting cattle herds, the gamma-interferon (IFN) assay was used since 2003 in parallel with the intradermal test in order to increase overall disease detection sensitivity in infected herds. This study presents the results of a field-evaluation of the assay during a 10-year period (2004-2014) of disease control and surveillance program and explores the particular pattern of IFN assay results in bullfight herds in comparison to cattle from other regions of France. The low sensitivity [59.2% (50.6; 67.3)] of IFN assay using the tuberculin stimulation could be related to the poor gamma-IFN production from bullfight cattle blood cells which is significantly lower than in animals of conventional breeds. The characteristics of the assay were progressively adapted to the epidemiological situation and the desired strategic applications. Data analysis with a receiver operating characteristic curve based on a simple S/P value algorithm allowed for the determination of a new cutoff adapted for a global screening, giving a high specificity of 99.9% results and a high accuracy of the assay. Having regularly risen to above 5% since 2005, with a peak around 10% in 2010, the annual incidence dropped to under 1% in 2014. The positive predictive value relative to the bacteriological confirmation evolved during the years, from 33% in 2009 to 12% during the last screening period, a normal trend in a context of decreasing prevalence. The estimated rate of false-positive reactions during screening campaigns was 0.67%, confirming the high specificity of the test, measured in bTB negative herds, in this epidemiological context. The proportion of false-positive reactions decreased with the age and was higher in males than in females. Although these results indicate that the IFN assay is accurate in the field, it also emphasizes great differences between interferon quantities produced by
Energy Technology Data Exchange (ETDEWEB)
Singer, Timothy M. [Mutagenesis Section, Environmental and Occupational Toxicology Division, Safe Environments Programme, 0803A, Health Canada, Ottawa, Ont., K1A 0K9 (Canada); Department of Biology, Carleton University, 1125 Colonel By Drive, Ottawa, Ont., K1S 5B6 (Canada); Lambert, Iain B. [Department of Biology, Carleton University, 1125 Colonel By Drive, Ottawa, Ont., K1S 5B6 (Canada); Williams, Andrew [Biostatistics and Epidemiology Division, Safe Environments Programme, 6604B, Health Canada, Ottawa, Ont., K1A 0K9 (Canada); Douglas, George R. [Mutagenesis Section, Environmental and Occupational Toxicology Division, Safe Environments Programme, 0803A, Health Canada, Ottawa, Ont., K1A 0K9 (Canada); Yauk, Carole L. [Mutagenesis Section, Environmental and Occupational Toxicology Division, Safe Environments Programme, 0803A, Health Canada, Ottawa, Ont., K1A 0K9 (Canada)]. E-mail: carole_yauk@hc-sc.gc.ca
2006-06-25
Several rodent assays are capable of monitoring germline mutation. These include traditional assays, such as the dominant lethal (DL) assay, the morphological specific locus (SL) test and the heritable translocation (HT) assay, and two assays that have been developed more recently-the expanded simple tandem repeat (ESTR) and transgenic rodent (TGR) mutation assays. In this paper, we have compiled the limited amount of experimental data that are currently available to make conclusions regarding the comparative ability of the more recently developed assays to detect germline mutations induced by chemical and radiological agents. The data suggest that ESTR and TGR assays are generally comparable with SL in detecting germline mutagenicity induced by alkylating agents and radiation, though TGR offered less sensitivity than ESTR in some cases. The DL and HT assays detect clastogenic events and are most susceptible to mutations arising in post-spermatogonial cells, and they may not provide the best comparisons with TGR and ESTR instability. The measurement of induced ESTR instability represents a relatively sensitive method of identifying agents causing germline mutation in rodents, and may also be useful for bio-monitoring exposed individuals in the human population. Any future use of the TGR and ESTR germline mutation assays in a regulatory testing context will entail more robust and extensive characterization of assay performance. This will require substantially more data, including experiments measuring multiple endpoints, a greatly expanded database of chemical agents and a focus on characterizing stage-specific activity of mutagens in these assays, preferably by sampling epididymal sperm exposed at defined pre-meiotic, meiotic and post-meiotic stages of development.
International Nuclear Information System (INIS)
Singer, Timothy M.; Lambert, Iain B.; Williams, Andrew; Douglas, George R.; Yauk, Carole L.
2006-01-01
Several rodent assays are capable of monitoring germline mutation. These include traditional assays, such as the dominant lethal (DL) assay, the morphological specific locus (SL) test and the heritable translocation (HT) assay, and two assays that have been developed more recently-the expanded simple tandem repeat (ESTR) and transgenic rodent (TGR) mutation assays. In this paper, we have compiled the limited amount of experimental data that are currently available to make conclusions regarding the comparative ability of the more recently developed assays to detect germline mutations induced by chemical and radiological agents. The data suggest that ESTR and TGR assays are generally comparable with SL in detecting germline mutagenicity induced by alkylating agents and radiation, though TGR offered less sensitivity than ESTR in some cases. The DL and HT assays detect clastogenic events and are most susceptible to mutations arising in post-spermatogonial cells, and they may not provide the best comparisons with TGR and ESTR instability. The measurement of induced ESTR instability represents a relatively sensitive method of identifying agents causing germline mutation in rodents, and may also be useful for bio-monitoring exposed individuals in the human population. Any future use of the TGR and ESTR germline mutation assays in a regulatory testing context will entail more robust and extensive characterization of assay performance. This will require substantially more data, including experiments measuring multiple endpoints, a greatly expanded database of chemical agents and a focus on characterizing stage-specific activity of mutagens in these assays, preferably by sampling epididymal sperm exposed at defined pre-meiotic, meiotic and post-meiotic stages of development
Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.
Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G
2016-05-01
The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.
Li, Dongdong; An, Jingna; Wang, Tingting; Tao, Chuanmin; Wang, Lanlan
2016-11-01
The resurgence of syphilis in recent years has become a serious threat to the public health worldwide, and the serological detection of specific antibodies against Treponema pallidum (TP) remains the most reliable method for laboratory diagnosis of syphilis. The performance of the Elecsys ® Syphilis assay, a brand new electrochemiluminescene immunoassay (ECLIA), was assessed by large amounts of samples in this study. In comparison with InTec assay, the Elecsys ® Syphilis assay was evaluated in 146 preselected samples from patients with syphilis, 1803 clinical routine samples, and 175 preselected samples from specific populations with reportedly increased rates of false-positive syphilis test results. Discrepancy samples must be investigated by Mikrogen Syphilis recomline assay. There was an overall agreement of 99.58% between two assays (Kappa = 0.975). The sensitivity and specificity of the Elecsys ® Syphilis assay were 100.0% (95% CI, 96.8-100.0%) and 99.8% (95% CI, 99.5-100.0%), respectively. The Elecsys syphilis assay displays better sensitivity (100%), specificity (99.8%), PPV (98.7%), and NPV (100%) in 2124 samples enrolled, compared with the InTec assay. Considering the excellent ease of use and automation, high throughput, and its superior sensitivity, especially in primary syphilis, the Elecsys ® Syphilis assay could represent an outstanding choice for screening of syphilis in high-volume laboratories. However, more attention was still needed, or the results must be confirmed by other treponemal immunoassays. The new Elecsys ® Syphilis assay is applied to patients with malignant neoplasm or HIV infection. © 2016 Wiley Periodicals, Inc.
Calibration and Confirmation in Geophysical Models
Werndl, Charlotte
2016-04-01
For policy decisions the best geophysical models are needed. To evaluate geophysical models, it is essential that the best available methods for confirmation are used. A hotly debated issue on confirmation in climate science (as well as in philosophy) is the requirement of use-novelty (i.e. that data can only confirm models if they have not already been used before. This talk investigates the issue of use-novelty and double-counting for geophysical models. We will see that the conclusions depend on the framework of confirmation and that it is not clear that use-novelty is a valid requirement and that double-counting is illegitimate.
Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii
DEFF Research Database (Denmark)
Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida
2002-01-01
6 log values for standards containing > or =5 copies/tube. Application of the assay to a series of 10-fold dilutions of P. carinii organisms isolated from rat lung demonstrated that it was reproducibly quantitative over 5 log values (r = 0.99). The assay was applied to a recently reported in vitro...... axenic cultivation system for P. carinii and confirmed our microscopy findings that no organism multiplication had occurred during culture. For all cultures analyzed, QTD PCR assays showed a decrease in P. carinii DNA that exceeded the expected decrease due to dilution of the inoculum upon transfer......A method for reliable quantification of Pneumocystis carinii in research models of P. carinii pneumonia (PCP) that is more convenient and reproducible than microscopic enumeration of organisms would greatly facilitate investigations of this organism. We developed a rapid quantitative touchdown (QTD...
The comet assay in testing the potential genotoxicity of nanomaterials
Directory of Open Access Journals (Sweden)
Amaya Azqueta
2015-06-01
validation. The comet assay has not been yet proposed as an appropriate test to check the genotoxic potential of NMs, though at a research level it is the most used in vitro assay and the second most used in vivo assay. Moreover, the combination of the comet assay with enzymes that convert altered bases to breaks allows the identification of DNA damage induced by secondary mechanisms (e.g. oxidative stress induced by inflammation, which is very relevant in the case of NMs. Possible problems with the use of the comet assay have been suggested: NMs have been detected in close association with comets, and might interact with the DNA; or NMs might inhibit the action of enzymes. However, control experiments have not confirmed that these interactions are significant.
The regulatory effects of low-dose ionizing radiation on Ikaros-autotaxin interaction
Energy Technology Data Exchange (ETDEWEB)
Kang, Hana; Cho, Seong Jun; Kim, Sung Jin; Nam, Seon Young; Yang, Kwang Hee [KHNP Radiation Health Institute, Korea Hydro and Nuclear Power Co, Seoul (Korea, Republic of)
2016-11-15
Ikaros, a transcription factor containing zinc-finger motif, has known as a critical regulator of hematopoiesis in immune system. Ikaros protein modulates the transcription of target genes via binding to the regulatory elements of the genes promoters. However the regulatory function of Ikaros in other organelle except nuclear remains to be determined. This study explored radiation-induced modulatory function of Ikaros in cytoplasm. The results showed that Ikaros protein lost its DNA binding ability after LDIR (low-dose ionizing radiation) exposure. Cell fractionation and Western blot analysis showed that Ikaros protein was translocated into cytoplasm from nuclear by LDIR. This was confirmed by immunofluorescence assay. We identified Autotaxin as a novel protein which potentially interacts with Ikaros through in vitro protein-binding screening. Co-immunoprecipitation assay revealed that Ikaros and Autotaxin are able to bind each other. Autotaxin is a crucial enzyme generating lysophosphatidic acid (LPA), a phospholipid mediator, which has potential regulatory effects on immune cell growth and motility. Our results indicate that LDIR potentially regulates immune system via protein-protein interaction of Ikaros and Autotaxin.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Institute of Scientific and Technical Information of China (English)
CHEN Li; CHEN Bo-bin; LI Jun-jie; JIN Wei; SHAO Zhi-min
2011-01-01
Objective To explore the activity of PEA3 ( polyomavirus enhancer activator 3 ) on CXCL12 (Chemokine CXC motif ligand 12) transcription and to reveal the role of PEA3 involved in CXCL12-mediated metastasis and angiogenesis in breast cancer. Methods Methods such as cell transfection, ChIP assay (chromatin immunoprecipitation ), and siRNA (small interfering RNA) were applied to demonstrate and confirm the interaction between PEA3 and CXCL12. Results Over-expression of PEA3 could increase the CXCL12 mRNA level and the CXCL12 promoter activity in human MCF-7 breast cancer cells. ChIP assay demonstrated that PEA3 could bind to the CXCL12 promoter in the cells transfected with PEA3 expression vector. PEA3 siRNA decreased CXCL12 promoter activity and the binding of PEA3 to the CXCL12 promoter in MCF-7 cells. Conclusions PEA3 could activate CXCL12 promoter transcription. It may be a potential mechanism of tumor angiogenesis and metastasis regarding of PEA3 and CXCL12.
Directory of Open Access Journals (Sweden)
Hyun-Joo Park
Full Text Available The neuromedin B receptor (NMB-R, a member of the mammalian bombesin receptor family, is frequently overexpressed in various tumors. In the present study, we found that exposure to hypoxic conditions increases the levels of NMBR mRNA and protein in breast cancer cells, which are tightly regulated by hypoxia-inducible factor-1α (HIF-1α. We confirmed the effect of HIF-1α on NMBR transcription by performing an NMBR promoter-driven reporter assay and then identified a functional hypoxia-responsive element (HRE in the human NMBR promoter region. Further, the binding of HIF-1α to the NMBR promoter was corroborated by electrophoretic mobility shift and chromatin immunoprecipitation assays, which showed that HIF-1α specifically and directly bound to the NMBR promoter in response to hypoxia. Immunohistochemical analysis of a xenograft and a human breast cancer tissue array revealed a significant correlation between NMB-R and HIF-1α expression. Taken together, our findings indicate that hypoxia induces NMB-R expression through a novel mechanism to regulate HIF-1α expression in breast cancer cells.
Identification of a new Mpl-interacting protein, Atp5d.
Liu, Hongyan; Zhao, Zhenhu; Zhong, Yuxu; Shan, Yajun; Sun, Xiaohong; Mao, Bingzhi; Cong, Yuwen
2014-06-01
Thrombopoietin (TPO) can regulate hematopoiesis and megakaryopoiesis via activation of its receptor, c-Mpl, and multiple downstream signal transduction pathways. Using the cytoplasmic domain of Mpl as bait, we performed yeast two-hybrid screening, and found that the protein Atp5d might associate with Mpl. Atp5d is known as the δ subunit of mitochondrial ATP synthase, but little is known about the function of dissociative Atp5d. The interaction between Mpl and Atp5d was confirmed by the yeast two-hybrid system, mammalian two-hybrid assay, pull-down experiment, and co-immunoprecipitation study in vivo and in vitro. An additional immunofluorescence assay showed that the two proteins can colocalize along the plasma membrane in the cytoplasm. Using the yeast two-hybrid system, we tested a series of cytoplasmic truncated mutations for their ability to bind Atp5d and found an association between Atp5d and the Aa98-113 domain of Mpl. The dissociation of Atp5d from Mpl after TPO stimulation suggests that Atp5d may be a new component of TPO signaling.
Directory of Open Access Journals (Sweden)
Frank Eertmans
2014-01-01
Full Text Available Neutral a-glucosidase (NAG activity in human seminal plasma is an important indicator for epididymis functionality. In the present study, the classic World Health Organization (WHO method has been adapted to enhance assay robustness. Changes include modified enzyme reaction buffer composition and usage of an alternative enzyme inhibitor for background correction (glucose instead of castanospermine. Both methods have been tested in parallel on 144 semen samples, obtained from 94 patients/donors and 50 vasectomized men (negative control, respectively. Passing-Bablok regression analysis demonstrated equal assay performance. In terms of assay validation, analytical specificity, detection limit, measuring range, precision, and cut-off values have been calculated. These data confirm that the adapted method is a reliable, improved tool for NAG analysis in human semen.
International Nuclear Information System (INIS)
Eisentraut, A.M.
1977-01-01
An improved radioimmunoassay is described for measuring total triiodothyronine or total thyroxine levels in a sample of serum containing free endogenous thyroid hormone and endogenous thyroid hormone bound to thyroid hormone binding protein. The thyroid hormone is released from the protein by adding hydrochloric acid to the serum. The pH of the separated thyroid hormone and thyroid hormone binding protein is raised in the absence of a blocking agent without interference from the endogenous protein. 125 I-labelled thyroid hormone and thyroid hormone antibodies are added to the mixture, allowing the labelled and unlabelled thyroid hormone and the thyroid hormone antibody to bind competitively. This results in free thyroid hormone being separated from antibody bound thyroid hormone and thus the unknown quantity of thyroid hormone may be determined. A thyroid hormone test assay kit is described for this radioimmunoassay. It provides a 'single tube' assay which does not require blocking agents for endogenous protein interference nor an external solid phase sorption step for the separation of bound and free hormone after the competitive binding step; it also requires a minimum number of manipulative steps. Examples of the assay are given to illustrate the reproducibility, linearity and specificity of the assay. (UK)
Interspecific in vitro assay for the chimera-forming ability of human pluripotent stem cells.
Masaki, Hideki; Kato-Itoh, Megumi; Umino, Ayumi; Sato, Hideyuki; Hamanaka, Sanae; Kobayashi, Toshihiro; Yamaguchi, Tomoyuki; Nishimura, Ken; Ohtaka, Manami; Nakanishi, Mahito; Nakauchi, Hiromitsu
2015-09-15
Functional assay limitations are an emerging issue in characterizing human pluripotent stem cells (PSCs). With rodent PSCs, chimera formation using pre-implantation embryos is the gold-standard assay of pluripotency (competence of progeny to differentiate into all three germ layers). In human PSCs (hPSCs), however, this can only be monitored via teratoma formation or in vitro differentiation, as ethical concerns preclude generation of human-human or human-animal chimeras. To circumvent this issue, we developed a functional assay utilizing interspecific blastocyst injection and in vitro culture (interspecies in vitro chimera assay) that enables the development and observation of embryos up to headfold stage. The assay uses mouse pre-implantation embryos and rat, monkey and human PSCs to create interspecies chimeras cultured in vitro to the early egg-cylinder stage. Intra- and interspecific chimera assays with rodent PSC lines were performed to confirm the consistency of results in vitro and in vivo. The behavior of chimeras developed in vitro appeared to recapitulate that of chimeras developed in vivo; that is, PSC-derived cells survived and were integrated into the epiblast of egg-cylinder-stage embryos. This indicates that the interspecific in vitro chimera assay is useful in evaluating the chimera-forming ability of rodent PSCs. However, when human induced PSCs (both conventional and naïve-like types) were injected into mouse embryos and cultured, some human cells survived but were segregated; unlike epiblast-stage rodent PSCs, they never integrated into the epiblast of egg-cylinder-stage embryos. These data suggest that the mouse-human interspecies in vitro chimera assay does not accurately reflect the early developmental potential/process of hPSCs. The use of evolutionarily more closely related species as host embryos might be necessary to evaluate the developmental potency of hPSCs. © 2015. Published by The Company of Biologists Ltd.
International Nuclear Information System (INIS)
Mowles, E.A.; Pinto-Furtado, L.G.; Bolton, A.E.
1986-01-01
A rapid, sensitive immunoradiometric assay has been developed for human pregnancy-associated plasma protein A (PAPP-A) using a purified mouse monoclonal antibody as the tracer and a rabbit polyclonal antibody to this protein in the solid-phase antibody preparation. The assay showed no measurable cross-reaction (< 0.1%) against a range of purified human placental proteins, and a good correlation with a previously described radioimmunoassay procedure when tested on samples taken throughout normal human pregnancies. No PAPP-A-like immunological activity could be detected in sera from non-pregnant women, confirming the absence of this protein from the circulation outside pregnancy. (Auth.)
Lectin binding assays for in-process monitoring of sialylation in protein production.
Xu, Weiduan; Chen, Jianmin; Yamasaki, Glenn; Murphy, John E; Mei, Baisong
2010-07-01
Many therapeutic proteins require appropriate glycosylation for their biological activities and plasma half life. Coagulation factor VIII (FVIII) is a glycoprotein which has extensive post-translational modification by N-linked glycosylation. The terminal sialic acid in the N-linked glycans of FVIII is required for maximal circulatory half life. The extent of FVIII sialylation can be determined by high pH anion-exchange chromatography coupled with a pulse electrochemical detector (HPAEC-PED), but this requires a large amount of purified protein. Using FVIII as a model, the objective of the present study was to develop assays that enable detection and prediction of sialylation deficiency at an early stage in the process and thus prevent downstream product quality excursions. Lectin ECA (Erythrina Cristagalli) binds to unsialylated Galbeta1-4 GlcNAc and the ECA-binding level (i.e., terminal Gal(beta1-4) exposure) is inversely proportional to the level of sialylation. By using ECA, a cell-based assay was developed to measure the global sialylation profile in FVIII producing cells. To examine the Galbeta1-4 exposure on the FVIII molecule in bioreactor tissue culture fluid (TCF), an ELISA-based ECA-FVIII binding assay was developed. The ECA-binding specificity in both assays was assessed by ECA-specific sugar inhibitors and neuraminidase digestion. The ECA-binding specificity was also independently confirmed by a ST3GAL4 siRNA knockdown experiment. To establish the correlation between Galbeta1-4 exposure and the HPAEC-PED determined FVIII sialylation value, the FVIII containing bioreactor TCF and the purified FVIII samples were tested with ECA ELISA binding assay. The results indicated an inverse correlation between ECA binding and the corresponding HPAEC-PED sialylation value. The ECA-binding assays are cost effective and can be rapidly performed, thereby making them effective for in-process monitoring of protein sialylation.
Comet Assay on Daphnia magna in eco-genotoxicity testing.
Pellegri, Valerio; Gorbi, Gessica; Buschini, Annamaria
2014-10-01
Detection of potentially hazardous compounds in water bodies is a priority in environmental risk assessment. For the evaluation and monitoring of water quality, a series of methodologies may be applied. Among them, the worldwide used toxicity tests with organisms of the genus Daphnia is one of the most powerful. In recent years, some attempts were made to utilize Daphnia magna in genotoxicity testing as many of the new environmental contaminants are described as DNA-damaging agents in aquatic organisms. The aim of this research was to develop a highly standardized protocol of the Comet Assay adapted for D. magna, especially regarding the isolation of cells derived from the same tissue (haemolymph) from newborn organisms exposed in vivo. Several methods for haemolymph extraction and different Comet Assay parameters were compared. Electrophoretic conditions were adapted in order to obtain minimum DNA migration in cells derived from untreated organisms and, at the same time, maximum sensitivity in specimens treated with known genotoxicants (CdCl2 and H2O2). Additional tests were performed to investigate if life-history traits of the cladoceran (such as the age of adult organisms that provide newborns, the clutch size of origin, the number of generations reared in standard conditions) and the water composition as well, might influence the response of the assay. This study confirms the potential application of the Comet Assay in D. magna for assessing genotoxic loads in aqueous solution. The newly developed protocol could integrate the acute toxicity bioassay, thus expanding the possibility of using this model species in freshwater monitoring (waters, sediment and soil elutriates) and is in line with the spirit of the EU Water Framework Directive in reducing the number of bioassays that involve medium-sized species. Copyright © 2014 Elsevier B.V. All rights reserved.
Decaro, Nicola; Amorisco, Francesca; Desario, Costantina; Lorusso, Eleonora; Camero, Michele; Bellacicco, Anna Lucia; Sciarretta, Rossana; Lucente, Maria Stella; Martella, Vito; Buonavoglia, Canio
2010-10-01
A TaqMan-based real-time PCR assay targeting the glycoprotein B-encoding gene was developed for diagnosis of canid herpesvirus 1 (CHV-1) infection. The established assay was highly specific, since no cross-reactions were observed with other canine DNA viruses, including canine parvovirus type 2, canine minute virus, or canine adenovirus types 1 and 2. The detection limit was 10(1) and 1.20 x 10(1) DNA copies per 10 microl(-1) of template for standard DNA and a CHV-1-positive kidney sample, respectively: about 1-log higher than a gel-based PCR assay targeting the thymidine kinase gene. The assay was also reproducible, as shown by satisfactory low intra-assay and inter-assay coefficients of variation. CHV-1 isolates of different geographical origins were recognised by the TaqMan assay. Tissues and clinical samples collected from three pups which died of CHV-1 neonatal infection were also tested, displaying a wide distribution of CHV-l DNA in their organs. Unlike other CHV-1-specific diagnostic methods, this quantitative assay permits simultaneous detection and quantitation of CHV-1 DNA in a wide range of canine tissues and body fluids, thus providing a useful tool for confirmation of a clinical diagnosis, for the study of viral pathogenesis and for evaluation of the efficacy of vaccines and antiviral drugs. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Wang, R F; Cao, W W; Cerniglia, C E
1996-01-01
In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).
Differentiating Botulinum Neurotoxin-Producing Clostridia with a Simple, Multiplex PCR Assay.
Williamson, Charles H D; Vazquez, Adam J; Hill, Karen; Smith, Theresa J; Nottingham, Roxanne; Stone, Nathan E; Sobek, Colin J; Cocking, Jill H; Fernández, Rafael A; Caballero, Patricia A; Leiser, Owen P; Keim, Paul; Sahl, Jason W
2017-09-15
NT-producing and nontoxigenic isolates can be found in each species, a PCR assay to determine the presence of the ntnh gene, which is a universally present component of bont gene clusters, and to provide information about the type ( ha + or orfX + ) of bont gene cluster present in a sample was also developed. The PCR assays provide simple, rapid, and inexpensive tools for screening uncharacterized isolates from clinical or environmental samples. The information provided by these assays can inform epidemiological studies, aid with identifying mixtures of isolates and unknown isolates in culture collections, and confirm the presence of bacteria of interest. Copyright © 2017 Williamson et al.
International Nuclear Information System (INIS)
Masjhur, J.S.; Ilyas, R.A.M.
1989-01-01
This paper confirms the value of ''sensitive'' TSH assay in thyroid function assessment of untreated subjects and those who have undergone radioiodine treatment for hyperthyroidism from 120 patients. (ELC). 3 tabs.; 1 fig.; 7 refs
Ghasemian, Mehrdad; Gharavi, Mohammad Javad; Akhlaghi, Lame; Mohebali, Mehdi; Meamar, Ahmad Reza; Aryan, Ehsan; Oormazdi, Hormozd
2014-03-01
Parasitological methods for the diagnosis of Visceral leishmaniasis (VL) require invasive procedures, so serological and molecular approaches have been developed but are not generally applicable in the field. We evaluated a loop mediated isothermal amplification (LAMP) assay using blood from VL patients and compared it to nested PCR. Forty-seven subjects with clinical features (fever, hepatosplenomegaly and anemia) were confirmed positive for VL by the direct agglutination test (DAT) at titers >3200. Forty DAT negative individuals from non-endemic areas with no clinical signs or symptoms of VL served as controls. A LAMP assay was performed using a set of six primers targeting Leishmania infantum kinetoplast DNA (kDNA) minicircle gene under isothermal (64 °C) conditions. For nested PCR we used primers targeting the kDNA minicircle gene. The LAMP assay provided a detection limit of 1 parasite in 1 ml of peripheral blood and detected L. infantum DNA in 44 of 47 DAT-confirmed VL cases, with diagnostic sensitivity of 93.6% (95% CI). No L. infantum DNA was amplified in controls, indicating a specificity of 100%. The nested PCR yielded sensitivity of 96% (95% CI) and a specificity of 100% (95% CI). The LAMP assay gave results similar to those of nested PCR but in a shorter time. The LAMP method is simple; requires no sophisticated equipment; has a short reaction time; and results, indicated by turbidity of the reaction mixture, are observable with the naked eye.
Directory of Open Access Journals (Sweden)
Mehrdad Ghasemian
2014-03-01
Full Text Available Parasitological methods for the diagnosis of Visceral leishmaniasis (VL require invasive procedures, so serological and molecular approaches have been developed but are not generally applicable in the field. We evaluated a loop mediated isothermal amplification (LAMP assay using blood from VL patients and compared it to nested PCR.Forty-seven subjects with clinical features (fever, hepatosplenomegaly and anemia were confirmed positive for VL by the direct agglutination test (DAT at titers >3200. Forty DAT negative individuals from non-endemic areas with no clinical signs or symptoms of VL served as controls. A LAMP assay was performed using a set of six primers targeting Leishmania infantum kinetoplast DNA (kDNA minicircle gene under isothermal (64 °C conditions. For nested PCR we used primers targeting the kDNA minicircle gene.The LAMP assay provided a detection limit of 1 parasite in 1 ml of peripheral blood and detected L. infantum DNA in 44 of 47 DAT-confirmed VL cases, with diagnostic sensitivity of 93.6% (95% CI. No L. infantum DNA was amplified in controls, indicating a specificity of 100%. The nested PCR yielded sensitivity of 96% (95% CI and a specificity of 100% (95% CI.The LAMP assay gave results similar to those of nested PCR but in a shorter time. The LAMP method is simple; requires no sophisticated equipment; has a short reaction time; and results, indicated by turbidity of the reaction mixture, are observable with the naked eye.
Lee, Jia-Ying Joey; Miller, James Alastair; Basu, Sreetama; Kee, Ting-Zhen Vanessa; Loo, Lit-Hsin
2018-06-01
Human lungs are susceptible to the toxicity induced by soluble xenobiotics. However, the direct cellular effects of many pulmonotoxic chemicals are not always clear, and thus, a general in vitro assay for testing pulmonotoxicity applicable to a wide variety of chemicals is not currently available. Here, we report a study that uses high-throughput imaging and artificial intelligence to build an in vitro pulmonotoxicity assay by automatically comparing and selecting human lung-cell lines and their associated quantitative phenotypic features most predictive of in vivo pulmonotoxicity. This approach is called "High-throughput In vitro Phenotypic Profiling for Toxicity Prediction" (HIPPTox). We found that the resulting assay based on two phenotypic features of a human bronchial epithelial cell line, BEAS-2B, can accurately classify 33 reference chemicals with human pulmonotoxicity information (88.8% balance accuracy, 84.6% sensitivity, and 93.0% specificity). In comparison, the predictivity of a standard cell-viability assay on the same set of chemicals is much lower (77.1% balanced accuracy, 84.6% sensitivity, and 69.5% specificity). We also used the assay to evaluate 17 additional test chemicals with unknown/unclear human pulmonotoxicity, and experimentally confirmed that many of the pulmonotoxic reference and predicted-positive test chemicals induce DNA strand breaks and/or activation of the DNA-damage response (DDR) pathway. Therefore, HIPPTox helps us to uncover these common modes-of-action of pulmonotoxic chemicals. HIPPTox may also be applied to other cell types or models, and accelerate the development of predictive in vitro assays for other cell-type- or organ-specific toxicities.
The Comet Assay: Tails of the (Unexpected. Use of the comet assay in pharmaceutical development.
Directory of Open Access Journals (Sweden)
Bas-jan Van Der Leede
2015-08-01
Full Text Available In genotoxicity testing of pharmaceuticals the rodent alkaline comet assay is being increasingly used as a second in vivo assay in addition to the in vivo micronucleus assay to mitigate in vitro positive results as recommended by regulatory guidance. In this presentation we want to give insight into the circumstances in vivo comet assay is deployed in a Genetic Toxicology Department of a pharmaceutical company. As the in vivo comet assay is a salvage assay, it means that some events have occurred in an in vitro assay and that the compound (or metabolite responsible for this signal is potentially deselected for further development. More than often the decision to perform an in vivo comet assay is at a very early stage in development and the first time that the compound will be tested in vivo at high/toxic dose levels. As almost no toxicokinetic data and tissue distribution data are available a careful design with maximizes the chances for successful mitigation is necessary. Decisions on acute or repeated dosing need to be made and arrangements for combining the in vivo comet assay with the in vivo micronucleus assay are to be considered. Often synthesis methods need to be scaled up fast to provide the required amount of compound and information on suitable formulations needs to be in place. As exposure data is crucial for interpretation of results, analytical methods need to be brought in place rapidly. An experienced multi skilled and communicative team needs to be available to deploy successfully this kind of assays at an early stage of development. We will present a few scenarios on study conduct and demonstrate how this assay can make a difference for the further development of a new drug.
Energy Technology Data Exchange (ETDEWEB)
Oguntimein, Gbekeloluwa B. [Morgan State Univ., Baltimore, MD (United States); Rodriguez, Jr., Miguel [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); National Lab., Oak Ridge, TN (United States). BioEnergy Science Center; Dumitrache, Alexandru [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); National Lab., Oak Ridge, TN (United States). BioEnergy Science Center; Shollenberger, Todd [National Renewable Energy Lab. (NREL), Golden, CO (United States); Decker, Stephen R. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Davison, Brian H. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); National Lab., Oak Ridge, TN (United States). BioEnergy Science Center; Brown, Steven D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); National Lab., Oak Ridge, TN (United States). BioEnergy Science Center; LanzaTech, Inc., Skokie, IL (United States)
2017-11-09
Here, to develop and prototype a high-throughput microplate assay to assess anaerobic microorganisms and lignocellulosic biomasses in a rapid, cost-effective screen for consolidated bioprocessing potential. Clostridium thermocellum parent Δhpt strain deconstructed Avicel to cellobiose, glucose, and generated lactic acid, formic acid, acetic acid and ethanol as fermentation products in titers and ratios similar to larger scale fermentations confirming the suitability of a plate-based method for C. thermocellum growth studies. C. thermocellum strain LL1210, with gene deletions in the key central metabolic pathways, produced higher ethanol titers in the Consolidated Bioprocessing (CBP) plate assay for both Avicel and switchgrass fermentations when compared to the Δhpt strain. A prototype microplate assay system is developed that will facilitate high-throughput bioprospecting for new lignocellulosic biomass types, genetic variants and new microbial strains for bioethanol production.
Miles, Timothy D; Martin, Frank N; Coffey, Michael D
2015-02-01
Several isothermal amplification techniques recently have been developed that are tolerant of inhibitors present in many plant extracts, which can reduce the need for obtaining purified DNA for running diagnostic assays. One such commercially available technique that has similarities with real-time polymerase chain reaction (PCR) for designing primers and a labeled probe is recombinase polymerase amplification (RPA). This technology was used to develop two simple and rapid approaches for detection of Phytophthora spp.: one genus-specific assay multiplexed with a plant internal control and the other species-specific assays for Phytophthora ramorum and P. kernoviae. All assays were tested for sensitivity (ranging from 3 ng to 1 fg of DNA) and specificity using DNA extracted from more than 136 Phytophthora taxa, 21 Pythium spp., 1 Phytopythium sp., and a wide range of plant species. The lower limit of linear detection using purified DNA was 200 to 300 fg of DNA in all pathogen RPA assays. Six different extraction buffers were tested for use during plant tissue maceration and the assays were validated in the field by collecting 222 symptomatic plant samples from over 50 different hosts. Only 56 samples were culture positive for Phytophthora spp. whereas 91 were positive using the Phytophthora genus-specific RPA test and a TaqMan real-time PCR assay. A technique for the generation of sequencing templates from positive RPA amplifications to confirm species identification was also developed. These RPA assays have added benefits over traditional technologies because they are rapid (results can be obtained in as little as 15 min), do not require DNA extraction or extensive training to complete, use less expensive portable equipment than PCR-based assays, and are significantly more specific than current immunologically based methods. This should provide a rapid, field-deployable capability for pathogen detection that will facilitate point-of-sample collection processing
Radioreceptor assays: plasma membrane receptors and assays for polypeptide and glycoprotein hormones
International Nuclear Information System (INIS)
Schulster, D.
1977-01-01
Receptors for peptide, protein and glycoprotein hormones, and the catecholamines are located on the plasma membranes of their target cells. Preparations of the receptors may be used as specific, high-affinity binding agents for these hormones in assay methodology akin to that for radioimmunoassay. A particular advantage of the radioreceptor assay is that it has a specificity directed towards the biologically active region of the hormone, rather than to some immunologically active region that may have little (or no) involvement in the expression of hormonal activity. Methods for hormone receptor preparation vary greatly, and range from the use of intact cells (as the source of hormone receptor) to the use of purified or solubilized membrane receptors. Receptors isolated from plasma membranes have proved to be of variable stability, and may be damaged during preparation and/or storage. Moreover, since they are present in relatively low concentration in the cell, their preparation in sufficient quantity for use in a radioreceptor assay may present technical problems. In general, there is good correlation between radioreceptor assays and in-vitro bioassays; differences between results from radioreceptor assays and radioimmunoassays are similar to those noted between in-vitro bioassays and radioimmunoassays. The sensitivity of the method is such that normal plasma concentrations of various hormones have been assayed by this technique. (author)
Sulfonylureas and Glinides as New PPARγ Agonists:. Virtual Screening and Biological Assays
Scarsi, Marco; Podvinec, Michael; Roth, Adrian; Hug, Hubert; Kersten, Sander; Albrecht, Hugo; Schwede, Torsten; Meyer, Urs A.; Rücker, Christoph
2007-12-01
This work combines the predictive power of computational drug discovery with experimental validation by means of biological assays. In this way, a new mode of action for type 2 diabetes drugs has been unvealed. Most drugs currently employed in the treatment of type 2 diabetes either target the sulfonylurea receptor stimulating insulin release (sulfonylureas, glinides), or target PPARγ improving insulin resistance (thiazolidinediones). Our work shows that sulfonylureas and glinides bind to PPARγ and exhibit PPARγ agonistic activity. This result was predicted in silico by virtual screening and confirmed in vitro by three biological assays. This dual mode of action of sulfonylureas and glinides may open new perspectives for the molecular pharmacology of antidiabetic drugs, since it provides evidence that drugs can be designed which target both the sulfonylurea receptor and PPARγ. Targeting both receptors could in principle allow to increase pancreatic insulin secretion, as well as to improve insulin resistance.
International Nuclear Information System (INIS)
Mizushima, Yutaka; Takeichi, Noritoshi; Minami, Akio; Kasai, Masaharu; Itaya, Toshiyuki
1981-01-01
KMT-17, a fibrosarcoma induced by 3-methylcholanthrene in a WKA rat, is a sensitive tumor to various kinds of immunological assays and is a suitable model tumor for the study of the immune status in tumor bearing hosts. The antitumor immune response of KMT-17 bearing rats was studied by a radioisotopic footpad assay (FPA) in comparison with other in vivo and in vitro assays. Delayed hypersensitivity to tumor antigens measured by the FPA was observed from the 8th day after transplantation of KMT-17 cells, reached a peak on the 12 - 15th day, and then declined in the late stage on the 17th day. The kinetics of the FPA correlated well with those of an in vivo Winn assay and of an in vitro lymphocyte cytotoxicity assay ( 51 Cr-release assay). The appearance of an antitumor antibody detected by a complement dependent cytotoxicity test also correlated well with the kinetics of the FPA. A growth inhibition assay (GIA) for non-specific cell-mediated immunity also showed similar kinetics to that of the FPA. The delayed hypersensitivity footpad reaction to tumor cell extracts measured by this FPA was tumor-specific. These results suggest that the FPA is a simple and reliable in vivo assay for evaluating antitumor immunity in tumor bearing hosts. (author)
Directory of Open Access Journals (Sweden)
Angela Filomena
2017-10-01
Full Text Available Infection with Helicobacter pylori (H. pylori occurs in 50% of the world population, and is associated with the development of ulcer and gastric cancer. Serological diagnostic tests indicate an H. pylori infection by detecting antibodies directed against H. pylori proteins. In addition to line blots, multiplex assay platforms provide smart solutions for the simultaneous analysis of antibody responses towards several H. pylori proteins. We used seven H. pylori proteins (FliD, gGT, GroEL, HpaA, CagA, VacA, and HP0231 and an H. pylori lysate for the development of a multiplex serological assay on a novel microfluidic platform. The reaction limited binding regime in the microfluidic channels allows for a short incubation time of 35 min. The developed assay showed very high sensitivity (99% and specificity (100%. Besides sensitivity and specificity, the technical validation (intra-assay CV = 3.7 ± 1.2% and inter-assay CV = 5.5 ± 1.2% demonstrates that our assay is also a robust tool for the analysis of the H. pylori-specific antibody response. The integration of the virulence factors CagA and VacA allow for the assessment of the risk for gastric cancer development. The short assay time and the performance of the platform shows the potential for implementation of such assays in a clinical setting.
Bagdonas, Dovydas
2017-01-01
Aim: to analyse the possible relationship between liquor IgG oligoclonal bands assay and other laboratory assays in neurological patients. Objectives: to determine the frequency of oligoclonal bands in neurological patients; to compare the results between serum and liquor laboratory assays in dependence of oligoclonal bands assay results; to evaluate the relationships between oligoclonal bands assay and serological-immunological assays for infectious diseases, gender, age and neurological ...
Yu, Haijie; Huang, Bin; Zhuo, Xunhui; Chen, Xueqiu; Du, Aifang
2013-11-08
Real-time PCR-based detection of Toxoplasma gondii is very sensitive and convenient for diagnosing toxoplasmosis. However, the performance of the PCR assays could be influenced by the target gene chosen. Here we evaluate a real-time PCR assay using double-stranded DNA dyes (SYBR(®) Green I assay) with a new set of primers targeting the SAG1 gene for the fast and specific detection of T. gondii. The assay showed higher sensitivity than conventional PCR protocols using T. gondii DNA as template. The detection limit of the developed real-time PCR assay was in the order of 1 tachyzoite. The assay was also assessed by experimentally infected mice and showed positive results for blood (25%), spleen (50%) and lung (50%) as early as 1 dpi. The specificity of the assay was confirmed by using DNA from Neospora caninum, Escherichia coli, Babesia bovis, Trypanosoma brucei, Cryptosporidium parvum, and Toxocara canis. Assay applicability was successfully tested in blood samples collected from slaughtered pigs. These results indicate that, based on SYBR(®) green I, the quantitative SAG1 assay may also be useful in the study of the pathogenicity, immunoprophylaxis, and treatment of T. gondii. Copyright © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Wei Xu
2010-08-01
Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
Endogenous Locus Reporter Assays.
Liu, Yaping; Hermes, Jeffrey; Li, Jing; Tudor, Matthew
2018-01-01
Reporter gene assays are widely used in high-throughput screening (HTS) to identify compounds that modulate gene expression. Traditionally a reporter gene assay is built by cloning an endogenous promoter sequence or synthetic response elements in the regulatory region of a reporter gene to monitor transcriptional activity of a specific biological process (exogenous reporter assay). In contrast, an endogenous locus reporter has a reporter gene inserted in the endogenous gene locus that allows the reporter gene to be expressed under the control of the same regulatory elements as the endogenous gene, thus more accurately reflecting the changes seen in the regulation of the actual gene. In this chapter, we introduce some of the considerations behind building a reporter gene assay for high-throughput compound screening and describe the methods we have utilized to establish 1536-well format endogenous locus reporter and exogenous reporter assays for the screening of compounds that modulate Myc pathway activity.
Baxter, C G; Denning, D W; Jones, A M; Todd, A; Moore, C B; Richardson, M D
2013-04-01
Detection of Aspergillus IgG antibodies is important in the diagnosis of chronic pulmonary aspergillosis and allergic bronchopulmonary aspergillosis. Immunoprecipitation techniques to detect these antibodies appear to lack sensitivity and accurate quantitation compared with enzyme immunoassays (EIA). This study assessed the performance of two commercial EIAs compared with counterimmunoelectrophoresis (CIE). This was a prospective cohort study of 175 adult patients with chronic or allergic pulmonary aspergillosis. Aspergillus IgG antibodies were detected using CIE, Phadia ImmunoCap Aspergillus IgG and Bio-Rad Platelia Aspergillus IgG. Inter-assay reproducibility was determined for each method and 25 patients had two serum samples analysed within a 6-month interval. When compared with CIE, both ImmunoCap and Platelia Aspergillus IgG had good sensitivity (97 and 93%, respectively) for detection of Aspergillus IgG antibodies. The level of agreement between the two EIAs for positive results was good, but the concentration of antibodies was not correlated between the tests or with CIE titre. ImmunoCap IgG inter-assay coefficient of variation was 5%, whereas Platelia IgG was 33%. Median ImmunoCap IgG values for CPA and allergic aspergillosis were 95 and 32 mg/L, respectively, whereas Platelia IgG values were >80 and 6 AU/mL. The direction of CIE titre change over 6 months was mirrored by ImmunoCap IgG levels in 92% of patients, and by Platelia IgG in 72% of patients. Both ImmunoCap and Platelia Aspergillus IgG EIAs are sensitive measures of Aspergillus IgG antibodies compared with CIE. However, ImmunoCap appears to have better reproducibility and may be more suitable for monitoring patient disease. © 2012 The Authors Clinical Microbiology and Infection © 2012 European Society of Clinical Microbiology and Infectious Diseases.
Solid-phase peptide quantitation assay using labeled monoclonal antibody and glutaraldehyde fixation
International Nuclear Information System (INIS)
Kasprzyk, P.G.; Cuttitta, F.; Avis, I.; Nakanishi, Y.; Treston, A.; Wong, H.; Walsh, J.H.; Mulshine, J.L.
1988-01-01
A solid-phase radioimmunoassay utilizing iodinated peptide-specific monoclonal antibody as a detection system instead of labeled peptide has been developed. Regional specific monoclonal antibodies to either gastrin-releasing peptide or gastrin were used as models to validate the general application of our modified assay. Conditions for radioactive labeling of the monoclonal antibody were determined to minimize oxidant damage, which compromises the sensitivity of other reported peptide quantitation assays. Pretreatment of 96-well polyvinyl chloride test plates with a 5% glutaraldehyde solution resulted in consistent retention of sufficient target peptide on the solid-phase matrix to allow precise quantitation. This quantitative method is completed within 1 h of peptide solid phasing. Pretreatment of assay plates with glutaraldehyde increased binding of target peptide and maximized antibody binding by optimizing antigen presentation. The hypothesis that glutaraldehyde affects both peptide binding to the plate and orientation of the peptide was confirmed by analysis of several peptide analogs. These studies indicate that peptide binding was mediated through a free amino group leaving the carboxy-terminal portion of the target peptide accessible for antibody binding. It was observed that the length of the peptide also affects the amount of monoclonal antibody that will bind. Under the optimal conditions, results from quantitation of gastrin-releasing peptide in relevant samples agree well with those from previously reported techniques. Thus, we report here a modified microplate assay which may be generally applied for the rapid and sensitive quantitation of peptide hormones
Sharma, Deepa K; Nalavade, Uma P; Deshpande, Jagadish M
2015-10-01
The poliovirus serotype identification and intratypic differentiation by real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay is suitable for serotype mixtures but not for intratypic mixtures of wild and vaccine poliovirus strains. This study was undertaken to develop wild poliovirus 1 and 3 (WPV1 and WPV3) specific rRT-PCR assays for use. Specific primers and probes for rRT-PCR were designed based on VP1 sequences of WPV1 and WPV3 isolated in India since 2000. The specificity of the rRT-PCR assays was evaluated using WPV1 and WPV3 of different genetic lineages, non-polio enteroviruses (NPEVs) and mixtures of wild/wild and wild/Sabin vaccine strains. The sensitivity of the assays was determined by testing serial 10-fold dilutions of wild poliovirus 1 and 3 stock suspensions of known titre. No cross-reactivity with Sabin strains, intertypic wild poliovirus isolates or 27 types of NPEVs across all the four Enterovirus species was found for both the wild poliovirus 1 and 3 rRT-PCR assays. All WPV1 and WPV3 strains isolated since 2000 were successfully amplified. The rRT-PCR assays detected 10 4.40 CCID 50 /ml of WPV1 and 10 4.00 CCID 50 /ml of WPV3, respectively either as single isolate or mixture with Sabin vaccine strains or intertypic wild poliovirus. rRT-PCR assays for WPV1 and WPV3 have been validated to detect all the genetic variations of the WPV1 and WPV3 isolated in India for the last decade. When used in combination with the current rRT-PCR assay testing was complete for confirmation of the presence of wild poliovirus in intratypic mixtures.
Directory of Open Access Journals (Sweden)
Yu-Chieh Wu
Full Text Available BACKGROUND: Type I insulin-like growth factor receptor (IGF-1R and insulin receptor (INSR are highly homologous molecules, which can heterodimerize to form an IGF-1R/INSR hybrid (Hybrid-R. The presence and biological significance of the Hybrid-R in human corneal epithelium has not yet been established. In addition, while nuclear localization of IGF-1R was recently reported in cancer cells and human corneal epithelial cells, the function and profile of nuclear IGF-1R is unknown. In this study, we characterized the nuclear localization and function of the Hybrid-R and the role of IGF-1/IGF-1R and Hybrid-R signaling in the human corneal epithelium. METHODOLOGY/PRINCIPLE FINDINGS: IGF-1-mediated signaling and cell growth were examined in a human telomerized corneal epithelial (hTCEpi cell line using co-immunoprecipitation, immunoblotting and cell proliferation assays. The presence of Hybrid-R in hTCEpi and primary cultured human corneal epithelial cells was confirmed by immunofluorescence and reciprocal immunoprecipitation of whole cell lysates. We found that IGF-1 stimulated Akt and promoted cell growth through IGF-1R activation, which was independent of the Hybrid-R. The presence of Hybrid-R, but not IGF-1R/IGF-1R, was detected in nuclear extracts. Knockdown of INSR by small interfering RNA resulted in depletion of the INSR/INSR and preferential formation of Hybrid-R. Chromatin-immunoprecipitation sequencing assay with anti-IGF-1R or anti-INSR was subsequently performed to identify potential genomic targets responsible for critical homeostatic regulatory pathways. CONCLUSION/SIGNIFICANCE: In contrast to previous reports on nuclear localized IGF-1R, this is the first report identifying the nuclear localization of Hybrid-R in an epithelial cell line. The identification of a nuclear Hybrid-R and novel genomic targets suggests that IGF-1R traffics to the nucleus as an IGF-1R/INSR heterotetrameric complex to regulate corneal epithelial homeostatic
Yusrina, Falah; Chua, Cui Wen; Lee, Chun Kiat; Chiu, Lily; Png, Tracy Si-Yu; Khoo, Mui Joo; Yan, Gabriel; Lee, Guan Huei; Yan, Benedict; Lee, Hong Kai
2018-05-01
Correct identification of infecting hepatitis C virus (HCV) genotype is helpful for targeted antiviral therapy. Here, we compared the HCV genotyping performance of the cobas HCV GT assay against the Versant HCV Genotype 2.0 (LiPA) assay, using 97 archived serum samples. In the event of discrepant or indeterminate results produced by either assay, the core and NS5B regions were sequenced. Of the 97 samples tested by the cobas, 25 (26%) were deemed indeterminate. Sequencing analyses confirmed 21 (84%) of the 25 samples as genotype 6 viruses with either subtype 6m, 6n, 6v, 6xa, or unknown subtype. Of the 97 samples tested by the LiPA, thirteen (13%) were deemed indeterminate. Seven (7%) were assigned with genotype 1, with unavailable/inconclusive results from the core region of the LiPA. Notably, the 7 samples were later found to be either genotype 3 or 6 by sequencing analyses. Moreover, 1 sample by the LiPA was assigned as genotypes 4 (cobas: indeterminate) but were later found to be genotype 3 by sequencing analyses, highlighting its limitation in assigning the correct genotype. The cobas showed similar or slightly higher accuracy (100%; 95% CI 94-100%) compared to the LiPA (99%; 95% CI 92-100%). Twenty-six percent of the 97 samples tested by the cobas had indeterminate results, mainly due to its limitation in identifying genotype 6 other than subtypes 6a and 6b. This presents a significant assay limitation in Southeast Asia, where genotype 6 infection is highly prevalent. Copyright © 2018 Elsevier B.V. All rights reserved.
ΔNp73 enhances promoter activity of TGF-β induced genes.
Directory of Open Access Journals (Sweden)
Maarten Niemantsverdriet
Full Text Available The p53 homolog p73 is frequently overexpressed in cancers. Especially the transactivation domain truncated isoform ΔNp73 has oncogenic properties and its upregulation is associated with poor patient survival. It has been shown that ΔNp73 has an inhibitory effect on the transactivation capacity of p53 and other p73 isoforms. Here, we confirm this finding but surprisingly find that ΔNp73 may also stimulate the expression of TGF-β signaling targets. Promoter-reporter analysis indicated that the presence of Smad Binding Elements (SBE in the promoter is sufficient for stimulation of gene expression by ΔNp73. TGF-β signaling was less efficient in ΔNp73 downregulated cells, whereas tetracycline induced ΔNp73 increased expression of endogenous TGF-β regulated genes PAI-1 and Col1a1. Pull-down assays with SBE DNA suggest that ΔNp73 enhances smad3/4 binding to SBEs, thereby stimulating TGF-β signaling. Chromatin immunoprecipitation assays confirmed a direct interaction between ΔNp73 and SBE. Given the role of TGF-β signaling in carcinogenesis, tumor invasion and metastasis via targets like PAI-1 and Col1a1, our data suggest a model on how this effect of ΔNp73 could be a contributing factor in cancer progression.
Kokovic, Ira; Novakovic, Barbara Jezersek; Cerkovnik, Petra; Novakovic, Srdjan
2014-01-01
Background Clonality determination in patients with lymphoproliferative disorders can improve the final diagnosis. The aim of our study was to evaluate the applicative value of standardized BIOMED-2 gene clonality assay protocols for the analysis of clonality of lymphocytes in a group of different lymphoid proliferations. Materials and methods. With this purpose, 121 specimens from 91 patients with suspected lymphoproliferations submitted for routine diagnostics from January to December 2011 were retrospectively analyzed. According to the final diagnosis, our series comprised 32 cases of B-cell lymphomas, 38 cases of non-Hodgkin’s T-cell lymphomas and 51 cases of reactive lymphoid proliferations. Clonality testing was performed using the BIOMED-2 clonality assays. Results The determined sensitivity of the TCR assay was 91.9%, while the sensitivity of the IGH assay was 74.2%. The determined specificity of the IGH assay was 73.3% in the group of lymphomas and 87.2% in the group of reactive lesions. The determined specificity of the TCR assay was 62.5% in the group of lymphomas and 54.3% in the group of reactive lesions. Conclusions In the present study, we confirmed the utility of standardized BIOMED-2 clonality assays for the detection of clonality in a routine diagnostical setting of non-Hodgkin’s lymphomas. Reactions for the detection of the complete IGH rearrangements and reactions for the detection of the TCR rearrangements are a good choice for clonality testing of a wide range of lymphoid proliferations and specimen types while the reactions for the detection of incomplete IGH rearrangements have not shown any additional diagnostic value. PMID:24991205
Brychkova, Galina; Yarmolinsky, Dmitry; Sagi, Moshe
2012-09-01
Adenosine 5'-phosphosulfate (APS) reductase (APR; EC 1.8.4.9) catalyzes the two-electron reduction of APS to sulfite and AMP, a key step in the sulfate assimilation pathway in higher plants. In spite of the importance of this enzyme, methods currently available for detection of APR activity rely on radioactive labeling and can only be performed in a very few specially equipped laboratories. Here we present two novel kinetic assays for detecting in vitro APR activity that do not require radioactive labeling. In the first assay, APS is used as substrate and reduced glutathione (GSH) as electron donor, while in the second assay APS is replaced by an APS-regenerating system in which ATP sulfurylase catalyzes APS in the reaction medium, which employs sulfate and ATP as substrates. Both kinetic assays rely on fuchsin colorimetric detection of sulfite, the final product of APR activity. Incubation of the desalted protein extract, prior to assay initiation, with tungstate that inhibits the oxidation of sulfite by sulfite oxidase activity, resulted in enhancement of the actual APR activity. The reliability of the two methods was confirmed by assaying leaf extract from Arabidopsis wild-type and APR mutants with impaired or overexpressed APR2 protein, the former lacking APR activity and the latter exhibiting much higher activity than the wild type. The assays were further tested on tomato leaves, which revealed a higher APR activity than Arabidopsis. The proposed APR assays are highly specific, technically simple and readily performed in any laboratory.
Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.
Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S
2016-02-01
Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.
Rapid assay of resveratrol in red wine by paper spray tandem mass spectrometry and isotope dilution.
Di Donna, Leonardo; Taverna, Domenico; Indelicato, Serena; Napoli, Anna; Sindona, Giovanni; Mazzotti, Fabio
2017-08-15
A rapid analytical approach for the assay of resveratrol in red wines, based on Paper Spray Mass Spectrometry (PS-MS) and Multiple Reaction Monitoring (MRM) is described. The assay involves the use of the stable isotope dilution method. The analytical parameters calculated analyzing fortified samples confirm the reliability of the proposed approach, with accuracy values about 100%, and LOD and LOQ values calculated at 0.5 and 0.8μg/mL, respectively. Furthermore, both the recovery, which was quantitative for the analyte, and the reproducibility (RSD%), checked on different days on the same wine, always below 7%, highlighted the consistency of the methodology. Copyright © 2017 Elsevier Ltd. All rights reserved.
Slight hypercalcemia is not associated with positive responses in the Comet Assay in male rat liver.
Thiel, Anette; Hamel, Annie; Schaefer, Katrien; Cardoso, Renato; Beilstein, Paul
2017-08-01
Maintenance of physiological levels of intracellular and extracellular calcium is essential for life. Increased intracellular calcium levels are involved in cell death (apoptosis and necrosis) and are associated with positive responses in the Comet assay in vitro. In addition, high calcium and vitamin D intakes were reported to induce apoptosis in adipose tissue in obese mice and to increase DNA-migration in the Comet assay. To investigate increased serum concentration of calcium as a potential confounding factor in the regulatory Comet assay in vivo, we induced mild hypercalcemia in male Wistar rats by 3-day continuous intravenous infusion of calcium gluconate and performed the Comet assay in the liver in line with regulatory guidelines. The results of the study showed that mild increases in serum calcium concentration (up to 1.4 times above the concurrent control) and increased urinary calcium concentration (up to 27.8 times above the concurrent control) results in clinical signs like mild tremor, faster respiration rate and decreased activity in a few animals. However, under the conditions of the study, no increase in the %Tail DNA in the Comet assay and no indication of liver damage as determined by histopathological means were observed. Thus, mild increases in plasma calcium did not lead to positive results in a genotoxicity assessment by the Comet assay in the rat liver. This result is important as it confirms the reliability of this assay for regulatory evaluation of safety. Copyright © 2017 DSM Nutritional Products AG. Published by Elsevier B.V. All rights reserved.
[Clinical evaluation of a novel HBsAg quantitative assay].
Takagi, Kazumi; Tanaka, Yasuhito; Naganuma, Hatsue; Hiramatsu, Kumiko; Iida, Takayasu; Takasaka, Yoshimitsu; Mizokami, Masashi
2007-07-01
The clinical implication of the hepatitis B surface antigen (HBsAg) concentrations in HBV-infected individuals remains unclear. The aim of this study was to evaluate a novel fully automated Chemiluminescence Enzyme Immunoassay (Sysmex HBsAg quantitative assay) by comparative measurements of the reference serum samples versus two independent commercial assays (Lumipulse f or Architect HBsAg QT). Furthermore, clinical usefulness was assessed for monitoring of the serum HBsAg levels during antiviral therapy. A dilution test using 5 reference-serum samples showed linear correlation curve in range from 0.03 to 2,360 IU/ml. The HBsAg was measured in total of 400 serum samples and 99.8% had consistent results between Sysmex and Lumipulse f. Additionally, a positive linear correlation was observed between Sysmex and Architect. To compare the Architect and Sysmex, both methods were applied to quantify the HBsAg in serum samples with different HBV genotypes/subgenotypes, as well as in serum contained HBV vaccine escape mutants (126S, 145R). Correlation between the methods was observed in results for escape mutants and common genotypes (A, B, C) in Japan. Observed during lamivudine therapy, an increase in HBsAg and HBV DNA concentrations preceded the aminotransferase (ALT) elevation associated with drug-resistant HBV variant emergence (breakthrough hepatitis). In conclusion, reliability of the Sysmex HBsAg quantitative assay was confirmed for all HBV genetic variants common in Japan. Monitoring of serum HBsAg concentrations in addition to HBV DNA quantification, is helpful in evaluation of the response to lamivudine treatment and diagnosis of the breakthrough hepatitis.
Pooley, Hannah B.; de Silva, Kumudika; Purdie, Auriol C.; Begg, Douglas J.; Whittington, Richard J.
2016-01-01
ABSTRACT Determining the viability of bacteria is a key outcome of in vitro cellular infection assays. Currently, this is done by culture, which is problematic for fastidious slow-growing bacteria such as Mycobacterium avium subsp. paratuberculosis, where it can take up to 4 months to confirm growth. This study aimed to identify an assay that can rapidly quantify the number of viable M. avium subsp. paratuberculosis cells in a cellular sample. Three commercially available bacterial viability assays along with a modified liquid culture method coupled with high-throughput quantitative PCR growth detection were assessed. Criteria for assessment included the ability of each assay to differentiate live and dead M. avium subsp. paratuberculosis organisms and their accuracy at low bacterial concentrations. Using the culture-based method, M. avium subsp. paratuberculosis growth was reliably detected and quantified within 2 weeks. There was a strong linear association between the 2-week growth rate and the initial inoculum concentration. The number of viable M. avium subsp. paratuberculosis cells in an unknown sample was quantified based on the growth rate, by using growth standards. In contrast, none of the commercially available viability assays were suitable for use with samples from in vitro cellular infection assays. IMPORTANCE Rapid quantification of the viability of Mycobacterium avium subsp. paratuberculosis in samples from in vitro cellular infection assays is important, as it allows these assays to be carried out on a large scale. In vitro cellular infection assays can function as a preliminary screening tool, for vaccine development or antimicrobial screening, and also to extend findings derived from experimental animal trials. Currently, by using culture, it takes up to 4 months to obtain quantifiable results regarding M. avium subsp. paratuberculosis viability after an in vitro infection assay; however, with the quantitative PCR and liquid culture method
Use of the microculture kinetic assay of apoptosis to determine chemosensitivities of leukemias.
Kravtsov, V D; Greer, J P; Whitlock, J A; Koury, M J
1998-08-01
Chemotherapeutic agents exert their antitumor effects by inducing apoptosis. The microculture kinetic (MiCK) assay provides an automated, continuous means of monitoring apoptosis in a cell population. We used the MiCK assay to determine the chemosensitivities of the human promyelocytic HL-60 and lymphoblastic CEM cell lines and leukemia cells freshly isolated from patients with acute nonlymphocytic (ANLL) or acute lymphocytic (ALL) leukemias. Continuous monitoring of apoptosis in the MiCK assay permits determination of the time to the maximum apoptosis (Tm) and its two components which are initiation time (Ti) and development time (Td). Duration of the three timing components of apoptosis varies from hours to days depending on the drug, drug concentration, and type of target cells. In the MiCK assay, the extent of apoptosis is reported in kinetic units of apoptosis. Kinetic units are determined by the slope of the curve created when optical density caused by cell blebbing is plotted as a function of time. Using the leukemia cell lines, we define the relationship between kinetic units determined by the MiCK assay and the percentage of morphologically apoptotic cells in the culture. Flow cytometry analysis of apoptosis in Annexin-V-fluorescein isothiocyanate-labeled preparations of HL-60 and CEM cells was also used to compare with data obtained by the MiCK assay. The feasibility of the MiCK assay of apoptosis as a chemosensitivity test was confirmed by its comparison with a 3H-thymidine incorporation assay. We show that samples from 10 ANLL and ALL patients patients tested for sensitivity to various doses of idarubicin (IDR), daunorubicin (DNR), or mitoxantrone (MTA) gave the same percentages of apoptotic cells when calculated by the MiCK assay as when determined by morphological analysis. The MiCK assay was used for dose-response analyses of the sensitivities to IDR, DNR, and MTA of leukemia cells from 4 other patients (2 ANLL and 2 ALL). The results from both cell
International Nuclear Information System (INIS)
Ratcliffe, W.A.; Corrie, J.E.T.; Dalziel, A.H.; Macpherson, J.S.
1982-01-01
Two direct radioimmunoassays for progesterone in 50 μL of unextracted serum or plasma with assays involving extraction of serum were compared. The direct assays include the use of either danazol at pH 7.4 or 8-anilino-1-naphthalenesulfonic acid at pH 4.0 to displace progesterone from serum binding-proteins. Progesterone is then assayed by using an antiserum to a progesterone 11α-hemisuccinyl conjugate and the radioligand 125 I-labeled progesterone 11α-glucuronyl tyramine, with separation by double-antibody techniques. Direct assays with either displacing agent gave good analytical recovery of progesterone added to human serum, and progesterone values for patients' specimens correlated well (r > 0.96) with results of assays involving extraction of serum. Precision was similar with each displacing agent over the working range 2.5-100 nmol/L and superior to that of extraction assays. We conclude that these direct assays of progesterone are analytically valid and more robust, precise, and technically convenient than many conventional methods involving extraction of serum
Absolute nuclear material assay
Prasad, Manoj K [Pleasanton, CA; Snyderman, Neal J [Berkeley, CA; Rowland, Mark S [Alamo, CA
2010-07-13
A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.
Antibody-based assay discriminates Zika virus infection from other flaviviruses.
Balmaseda, Angel; Stettler, Karin; Medialdea-Carrera, Raquel; Collado, Damaris; Jin, Xia; Zambrana, José Victor; Jaconi, Stefano; Cameroni, Elisabetta; Saborio, Saira; Rovida, Francesca; Percivalle, Elena; Ijaz, Samreen; Dicks, Steve; Ushiro-Lumb, Ines; Barzon, Luisa; Siqueira, Patricia; Brown, David W G; Baldanti, Fausto; Tedder, Richard; Zambon, Maria; de Filippis, A M Bispo; Harris, Eva; Corti, Davide
2017-08-01
Zika virus (ZIKV) is a mosquito-borne flavivirus that emerged recently as a global health threat, causing a pandemic in the Americas. ZIKV infection mostly causes mild disease, but is linked to devastating congenital birth defects and Guillain-Barré syndrome in adults. The high level of cross-reactivity among flaviviruses and their cocirculation has complicated serological approaches to differentially detect ZIKV and dengue virus (DENV) infections, accentuating the urgent need for a specific and sensitive serological test. We previously generated a ZIKV nonstructural protein 1 (NS1)-specific human monoclonal antibody, which we used to develop an NS1-based competition ELISA. Well-characterized samples from RT-PCR-confirmed patients with Zika and individuals exposed to other flavivirus infections or vaccination were used in a comprehensive analysis to determine the sensitivity and specificity of the NS1 blockade-of-binding (BOB) assay, which was established in laboratories in five countries (Nicaragua, Brazil, Italy, United Kingdom, and Switzerland). Of 158 sera/plasma from RT-PCR-confirmed ZIKV infections, 145 (91.8%) yielded greater than 50% inhibition. Of 171 patients with primary or secondary DENV infections, 152 (88.9%) scored negative. When the control group was extended to patients infected by other flaviviruses, other viruses, or healthy donors ( n = 540), the specificity was 95.9%. We also analyzed longitudinal samples from DENV-immune and DENV-naive ZIKV infections and found inhibition was achieved within 10 d postonset of illness and maintained over time. Thus, the Zika NS1 BOB assay is sensitive, specific, robust, simple, low-cost, and accessible, and can detect recent and past ZIKV infections for surveillance, seroprevalence studies, and intervention trials.
WRKY Transcription Factors Involved in Activation of SA Biosynthesis Genes
Directory of Open Access Journals (Sweden)
Bol John F
2011-05-01
Full Text Available Abstract Background Increased defense against a variety of pathogens in plants is achieved through activation of a mechanism known as systemic acquired resistance (SAR. The broad-spectrum resistance brought about by SAR is mediated through salicylic acid (SA. An important step in SA biosynthesis in Arabidopsis is the conversion of chorismate to isochorismate through the action of isochorismate synthase, encoded by the ICS1 gene. Also AVRPPHB SUSCEPTIBLE 3 (PBS3 plays an important role in SA metabolism, as pbs3 mutants accumulate drastically reduced levels of SA-glucoside, a putative storage form of SA. Bioinformatics analysis previously performed by us identified WRKY28 and WRKY46 as possible regulators of ICS1 and PBS3. Results Expression studies with ICS1 promoter::β-glucuronidase (GUS genes in Arabidopsis thaliana protoplasts cotransfected with 35S::WRKY28 showed that over expression of WRKY28 resulted in a strong increase in GUS expression. Moreover, qRT-PCR analyses indicated that the endogenous ICS1 and PBS3 genes were highly expressed in protoplasts overexpressing WRKY28 or WRKY46, respectively. Electrophoretic mobility shift assays indentified potential WRKY28 binding sites in the ICS1 promoter, positioned -445 and -460 base pairs upstream of the transcription start site. Mutation of these sites in protoplast transactivation assays showed that these binding sites are functionally important for activation of the ICS1 promoter. Chromatin immunoprecipitation assays with haemagglutinin-epitope-tagged WRKY28 showed that the region of the ICS1 promoter containing the binding sites at -445 and -460 was highly enriched in the immunoprecipitated DNA. Conclusions The results obtained here confirm results from our multiple microarray co-expression analyses indicating that WRKY28 and WRKY46 are transcriptional activators of ICS1 and PBS3, respectively, and support this in silico screening as a powerful tool for identifying new components of stress
Lin, Y; Liu, H; Yang, C; Gu, J; Shen, G; Zhang, H; Chen, E; Han, C; Zhang, Y; Xu, Y; Wu, J; Xia, Q
2017-10-01
Vitellogenin (Vg) is a source of nutrition for embryo development. Our previous study showed that the silkworm (Bombyx mori) transcription factor broad complex isoform 2 (BmBrC-Z2) regulates gene expression of the Vg gene (BmVg) by induction with 20-hydroxyecdysone (20E). However, the mechanism by which 20E regulates BmVg expression was not clarified. In this study, cell transfection experiments showed that the BmVg promoter containing the POU homeodomain transcription factor POUM2 (POUM2) and BrC-Z2 cis-response elements (CREs) showed a more significant response to 20E than that harbouring only the BrC-Z2 or POUM2 CRE. An electrophoretic mobility shift assay and chromatin immunoprecipitation assay showed that BmPOUM2 could bind to the POUM2 CRE of the BmVg promoter. Over-expression of BmPOUM2 and BmBrC-Z2 in B. mori embryo-derived cell line (BmE) could enhance the activity of the BmVg promoter carrying both the POUM2 and BrC-Z2 CREs following 20E induction. Quantitative PCR and immunofluorescence histochemistry showed that the expression pattern and tissue localization of BmPOUM2 correspond to those of BmVg. Glutathione S-transferase pull-down and co-immunoprecipitation assays confirmed that BmPOUM2 interacts only with BmBrC-Z2 to regulate BmVg expression. Down-regulation of BmPOUM2 in female silkworm by RNA interference significantly reduced BmVg expression, leading to abnormal egg formation. In summary, these results indicate that BmPOUM2 binds only to BmBrC-Z2 to collaboratively regulate BmVg expression by 20E induction to control vitellogenesis and egg formation in the silkworm. Moreover, these findings suggest that homeodomain protein POUM2 plays a novel role in regulating insect vitellogenesis. © 2017 The Royal Entomological Society.
Tetratricopeptide repeat domain 9A is an interacting protein for tropomyosin Tm5NM-1
International Nuclear Information System (INIS)
Cao, Shenglan; Ho, Gay Hui; Lin, Valerie CL
2008-01-01
Tetratricopeptide repeat domain 9A (TTC9A) protein is a recently identified protein which contains three tetratricopeptide repeats (TPRs) on its C-terminus. In our previous studies, we have shown that TTC9A was a hormonally-regulated gene in breast cancer cells. In this study, we found that TTC9A was over-expressed in breast cancer tissues compared with the adjacent controls (P < 0.00001), suggesting it might be involved in the breast cancer development process. The aim of the current study was to further elucidate the function of TTC9A. Breast samples from 25 patients including the malignant breast tissues and the adjacent normal tissues were processed for Southern blot analysis. Yeast-two-hybrid assay, GST pull-down assay and co-immunoprecipitation were used to identify and verify the interaction between TTC9A and other proteins. Tropomyosin Tm5NM-1 was identified as one of the TTC9A partner proteins. The interaction between TTC9A and Tm5NM-1 was further confirmed by GST pull-down assay and co-immunoprecipitation in mammalian cells. TTC9A domains required for the interaction were also characterized in this study. The results suggested that the first TPR domain and the linker fragment between the first two TPR domains of TTC9A were important for the interaction with Tm5NM-1 and the second and the third TPR might play an inhibitory role. Since the primary function of tropomyosin is to stabilize actin filament, its interaction with TTC9A may play a role in cell shape and motility. In our previous results, we have found that progesterone-induced TTC9A expression was associated with increased cell motility and cell spreading. We speculate that TTC9A acts as a chaperone protein to facilitate the function of tropomyosins in stabilizing microfilament and it may play a role in cancer cell invasion and metastasis
Optimal use of tandem biotin and V5 tags in ChIP assays
Directory of Open Access Journals (Sweden)
Krpic Sanja
2009-02-01
Full Text Available Abstract Background Chromatin immunoprecipitation (ChIP assays coupled to genome arrays (Chip-on-chip or massive parallel sequencing (ChIP-seq lead to the genome wide identification of binding sites of chromatin associated proteins. However, the highly variable quality of antibodies and the availability of epitopes in crosslinked chromatin can compromise genomic ChIP outcomes. Epitope tags have often been used as more reliable alternatives. In addition, we have employed protein in vivo biotinylation tagging as a very high affinity alternative to antibodies. In this paper we describe the optimization of biotinylation tagging for ChIP and its coupling to a known epitope tag in providing a reliable and efficient alternative to antibodies. Results Using the biotin tagged erythroid transcription factor GATA-1 as example, we describe several optimization steps for the application of the high affinity biotin streptavidin system in ChIP. We find that the omission of SDS during sonication, the use of fish skin gelatin as blocking agent and choice of streptavidin beads can lead to significantly improved ChIP enrichments and lower background compared to antibodies. We also show that the V5 epitope tag performs equally well under the conditions worked out for streptavidin ChIP and that it may suffer less from the effects of formaldehyde crosslinking. Conclusion The combined use of the very high affinity biotin tag with the less sensitive to crosslinking V5 tag provides for a flexible ChIP platform with potential implications in ChIP sequencing outcomes.
Optimal use of tandem biotin and V5 tags in ChIP assays
Kolodziej, Katarzyna E; Pourfarzad, Farzin; de Boer, Ernie; Krpic, Sanja; Grosveld, Frank; Strouboulis, John
2009-01-01
Background Chromatin immunoprecipitation (ChIP) assays coupled to genome arrays (Chip-on-chip) or massive parallel sequencing (ChIP-seq) lead to the genome wide identification of binding sites of chromatin associated proteins. However, the highly variable quality of antibodies and the availability of epitopes in crosslinked chromatin can compromise genomic ChIP outcomes. Epitope tags have often been used as more reliable alternatives. In addition, we have employed protein in vivo biotinylation tagging as a very high affinity alternative to antibodies. In this paper we describe the optimization of biotinylation tagging for ChIP and its coupling to a known epitope tag in providing a reliable and efficient alternative to antibodies. Results Using the biotin tagged erythroid transcription factor GATA-1 as example, we describe several optimization steps for the application of the high affinity biotin streptavidin system in ChIP. We find that the omission of SDS during sonication, the use of fish skin gelatin as blocking agent and choice of streptavidin beads can lead to significantly improved ChIP enrichments and lower background compared to antibodies. We also show that the V5 epitope tag performs equally well under the conditions worked out for streptavidin ChIP and that it may suffer less from the effects of formaldehyde crosslinking. Conclusion The combined use of the very high affinity biotin tag with the less sensitive to crosslinking V5 tag provides for a flexible ChIP platform with potential implications in ChIP sequencing outcomes. PMID:19196479
International Nuclear Information System (INIS)
1977-01-01
Methods are described for measuring catecholamine levels in human and animal body fluids and tissues using the catechol-O-methyl-transferase (COMT) radioassay. The assay involves incubating the biological sample with COMT and the tritiated methyl donor, S-adenosyl-L-methionine( 3 H)-methyl. The O-methylated ( 3 H) epinephrine and/or norepinephrine are extracted and oxidised to vanillin- 3 H which in turn is extracted and its radioactivity counted. When analysing dopamine levels the assay is extended by vanillin- 3 H and raising the pH of the aqueous periodate phase from which O-methylated ( 3 H) dopamine is extracted and counted. The assay may be modified depending on whether measurements of undifferentiated total endogenous catecholamine levels or differential analyses of the catecholamine levels are being performed. The sensitivity of the assay can be as low as 5 picograms for norepinephrine and epinephrine and 12 picograms for dopamine. The assemblance of the essential components of the assay into a kit for use in laboratories is also described. (U.K.)
Directory of Open Access Journals (Sweden)
Dawn N Birdsell
Full Text Available Francisella tularensis, the etiologic agent of tularemia and a Class A Select Agent, is divided into three subspecies and multiple subpopulations that differ in virulence and geographic distribution. Given these differences, there is a need to rapidly and accurately determine if a strain is F. tularensis and, if it is, assign it to subspecies and subpopulation. We designed TaqMan real-time PCR genotyping assays using eleven single nucleotide polymorphisms (SNPs that were potentially specific to closely related groups within the genus Francisella, including numerous subpopulations within F. tularensis species. We performed extensive validation studies to test the specificity of these SNPs to particular populations by screening the assays across a set of 565 genetically and geographically diverse F. tularensis isolates and an additional 21 genetic near-neighbor (outgroup isolates. All eleven assays correctly determined the genetic groups of all 565 F. tularensis isolates. One assay differentiates F. tularensis, F. novicida, and F. hispaniensis from the more genetically distant F. philomiragia and Francisella-like endosymbionts. Another assay differentiates F. tularensis isolates from near neighbors. The remaining nine assays classify F. tularensis-confirmed isolates into F. tularensis subspecies and subpopulations. The genotyping accuracy of these nine assays diminished when tested on outgroup isolates (i.e. non F. tularensis, therefore a hierarchical approach of assay usage is recommended wherein the F. tularensis-specific assay is used before the nine downstream assays. Among F. tularensis isolates, all eleven assays were highly sensitive, consistently amplifying very low concentrations of DNA. Altogether, these eleven TaqMan real-time PCR assays represent a highly accurate, rapid, and sensitive means of identifying the species, subspecies, and subpopulation of any F. tularensis isolate if used in a step-wise hierarchical scheme. These assays
Nguyen-Duc, Trong; Peeters, Eveline; Muyldermans, Serge; Charlier, Daniel; Hassanzadeh-Ghassabeh, Gholamreza
2013-01-01
Nanobodies® are single-domain antibody fragments derived from camelid heavy-chain antibodies. Because of their small size, straightforward production in Escherichia coli, easy tailoring, high affinity, specificity, stability and solubility, nanobodies® have been exploited in various biotechnological applications. A major challenge in the post-genomics and post-proteomics era is the identification of regulatory networks involving nucleic acid–protein and protein–protein interactions. Here, we apply a nanobody® in chromatin immunoprecipitation followed by DNA microarray hybridization (ChIP-chip) for genome-wide identification of DNA–protein interactions. The Lrp-like regulator Ss-LrpB, arguably one of the best-studied specific transcription factors of the hyperthermophilic archaeon Sulfolobus solfataricus, was chosen for this proof-of-principle nanobody®-assisted ChIP. Three distinct Ss-LrpB-specific nanobodies®, each interacting with a different epitope, were generated for ChIP. Genome-wide ChIP-chip with one of these nanobodies® identified the well-established Ss-LrpB binding sites and revealed several unknown target sequences. Furthermore, these ChIP-chip profiles revealed auxiliary operator sites in the open reading frame of Ss-lrpB. Our work introduces nanobodies® as a novel class of affinity reagents for ChIP. Taking into account the unique characteristics of nanobodies®, in particular, their short generation time, nanobody®-based ChIP is expected to further streamline ChIP-chip and ChIP-Seq experiments, especially in organisms with no (or limited) possibility of genetic manipulation. PMID:23275538
Jacobs, K R; Guillemin, G J; Lovejoy, D B
2018-02-01
Kynurenine 3-monooxygenase (KMO) is a well-validated therapeutic target for the treatment of neurodegenerative diseases, including Alzheimer's disease (AD) and Huntington's disease (HD). This work reports a facile fluorescence-based KMO assay optimized for high-throughput screening (HTS) that achieves a throughput approximately 20-fold higher than the fastest KMO assay currently reported. The screen was run with excellent performance (average Z' value of 0.80) from 110,000 compounds across 341 plates and exceeded all statistical parameters used to describe a robust HTS assay. A subset of molecules was selected for validation by ultra-high-performance liquid chromatography, resulting in the confirmation of a novel hit with an IC 50 comparable to that of the well-described KMO inhibitor Ro-61-8048. A medicinal chemistry program is currently underway to further develop our novel KMO inhibitor scaffolds.
A New Serum Biomarker for Lung Cancer - Transthyretin
Directory of Open Access Journals (Sweden)
Liyun LIU
2009-04-01
Full Text Available Background and objective Lung cancer is the leading cause of cancer death worldwide and very few specific biomarkers could be used in clinical diagnosis at present. The aim of this study is to find novel potential serum biomarkers for lung cancer using Surface Enhanced Laser Desorption/Ionization (SELDI technique. Methods Serumsample of 227 cases including 146 lung cancer, 13 pneumonia, 28 tuberculous pleurisy and 40 normal individuals were analyzed by CM10 chips. The candidate biomarkers were identified by ESI/MS-MS and database searching, and further confirmed by immunoprecipitation. The same sets of serum sample from all groups were re-measured by ELISA assay. Results Three protein peaks with the molecular weight 13.78 kDa, 13.90 kDa and 14.07 kDa were found significantlydecreased in lung cancer serum compared to the other groups and were all automatically selected as specific biomarkers by Biomarker Wizard software. The candidate biomarkers obtained from 1-D SDS gel bands by matching the molecular weight with peaks on CM10 chips were identified by Mass spectrometry as the native transthyretin (nativeTTR, cysTTR and glutTTR, and the identity was further validated by immunoprecipitation using commercial TTR antibodies. Downregulated of TTR was found in both ELISA and SELDI analysis. Conclusion TTRs acted as the potentially useful biomarkers for lung cancer by SELDI technique.
2003-01-01
The CERN Council held its 125th session on 20 June. Highlights of the meeting included confirmation that the LHC is on schedule for a 2007 start-up, and the announcement of a new organizational structure in 2004.
DEFF Research Database (Denmark)
Guldager, Daniel Kring Rasmussen; von Stemann, Jakob Hjorth; Larsen, Rune
2015-01-01
suitable for larger screenings. Based on confirmed antibody binding characteristics and the resultant reactivity in this multiplex assay, a classification of the c-aAb levels was suggested. The screening results of the recipients who received blood transfusions indicate that more studies are needed...... plasma samples and pooled normal immunoglobulin preparations were used to validate the assay. Plasma samples from 98 transfusion recipients, half of whom presented with febrile reactions, were tested by the assay. RESULTS: The assay detected specific and saturable immunoglobulin G (IgG) binding to each...... cytokine autoantibodies quantities in the negative plasma samples ranged between 80% and 125%. The analytical intra- and inter-assay variations were 4% and 11%, respectively. Varying c-aAb levels were detectable in the transfusion recipients. There was no difference in c-aAb frequency between the patients...
Directory of Open Access Journals (Sweden)
Johannes Karl-Mark Knobloch
Full Text Available Transmission of bacteria from inanimate surfaces in healthcare associated environments is an important source of hospital acquired infections. A number of commercially available medical devices promise to fulfill antibacterial activity to reduce environmental contamination. In this study we developed a touch transfer assay modeling fingerprint transmission to investigate the antibacterial activity of surfaces, with confirmed antibacterial activity by a modified ISO 22196 (JIS Z 2801 assay to test such surfaces under more realistic conditions. Bacteria were taken up from a dry standardized primary contaminated surface (PCS with disinfected fingers or fingers covered with sterile and moistened cotton gloves. Subsequently, bacteria were transferred by pressing on secondary contaminated surfaces (SCS with or without potential antibacterial activity and the relative reduction rate was determined after 24 h. A stable transmission rate between PCS and SCS was observed using moistened sterile gloves. A copper containing alloy displayed at least a tenfold reduction of the bacterial load consistently reaching less than 2.5 cfu/cm2. In contrast, no significant reduction of bacterial contamination by silver containing surfaces and matured pure silver was observed in the touch transfer assay. With the touch transfer assay we successfully established a new reproducible method modeling cross contamination. Using the new method we were able to demonstrate that several surfaces with confirmed antimicrobial activity in a modified ISO 22196 (JIS Z 2801 assay lacked effectiveness under defined ambient conditions. This data indicate that liquid based assays like the ISO 22196 should be critically reviewed before claiming antibacterial activity for surfaces in the setting of contamination of dry surfaces by contact to the human skin. We suggest the newly developed touch transfer assay as a new additional tool for the assessment of potential antimicrobial surfaces
Expert system for transuranic waste assay
Energy Technology Data Exchange (ETDEWEB)
Zoolalian, M.L.; Gibbs, A.; Kuhns, J.D.
1989-01-01
Transuranic wastes are generated at the Savannah River Site (SRS) as a result of routine production of nuclear materials. These wastes contain Pu-238 and Pu-239 and are placed into lined 55-gallon waste drums. The drums are placed on monitored storage pads pending shipment to the Waste Isolation Pilot Plant in New Mexico. A passive-active neutron (PAN) assay system is used to determine the mass of the radioactive material within the waste drums. Assay results are used to classify the wastes as either low-level or transuranic (TRU). During assays, the PAN assay system communicates with an IBM-AT computer. A Fortran computer program, called NEUT, controls and performs all data analyses. Unassisted, the NEUT program cannot adequately interpret assay results. To eliminate this limitation, an expert system shell was used to write a new algorithm, called the Transuranic Expert System (TRUX), to drive the NEUT program and add decision making capabilities for analysis of the assay results. The TRUX knowledge base was formulated by consulting with human experts in the field of neutron assay, by direct experimentation on the PAN assay system, and by observing operations on a daily basis. TRUX, with its improved ability to interpret assay results, has eliminated the need for close supervision by a human expert, allowing skilled technicians to operate the PAN assay system. 4 refs., 1 fig., 4 tabs.
Expert system for transuranic waste assay
International Nuclear Information System (INIS)
Zoolalian, M.L.; Gibbs, A.; Kuhns, J.D.
1989-01-01
Transuranic wastes are generated at the Savannah River Site (SRS) as a result of routine production of nuclear materials. These wastes contain Pu-238 and Pu-239 and are placed into lined 55-gallon waste drums. The drums are placed on monitored storage pads pending shipment to the Waste Isolation Pilot Plant in New Mexico. A passive-active neutron (PAN) assay system is used to determine the mass of the radioactive material within the waste drums. Assay results are used to classify the wastes as either low-level or transuranic (TRU). During assays, the PAN assay system communicates with an IBM-AT computer. A Fortran computer program, called NEUT, controls and performs all data analyses. Unassisted, the NEUT program cannot adequately interpret assay results. To eliminate this limitation, an expert system shell was used to write a new algorithm, called the Transuranic Expert System (TRUX), to drive the NEUT program and add decision making capabilities for analysis of the assay results. The TRUX knowledge base was formulated by consulting with human experts in the field of neutron assay, by direct experimentation on the PAN assay system, and by observing operations on a daily basis. TRUX, with its improved ability to interpret assay results, has eliminated the need for close supervision by a human expert, allowing skilled technicians to operate the PAN assay system. 4 refs., 1 fig., 4 tabs
Higashimoto, Makiko; Takahashi, Masahiko; Jokyu, Ritsuko; Syundou, Hiromi; Saito, Hidetsugu
2007-11-01
A HCV core antigen (Ag) detection assay system, Lumipulse Ortho HCV Ag has been developed and is commercially available in Japan with a lower detection level limit of 50 fmol/l, which is equivalent to 20 KIU/ml in PCR quantitative assay. HCV core Ag assay has an advantage of broader dynamic range compared with PCR assay, however the sensitivity is lower than PCR. We developed a novel HCV core Ag concentration method using polyethylene glycol (PEG), which can improve the sensitivity five times better than the original assay. The reproducibility was examined by consecutive five-time measurement of HCV patients serum, in which the results of HCV core Ag original and concentrated method were 56.8 +/- 8.1 fmol/l (mean +/- SD), CV 14.2% and 322.9 +/- 45.5 fmol/l CV 14.0%, respectively. The assay results of HCV negative samples in original HCV core Ag were all 0.1 fmol/l and the results were same even in the concentration method. The results of concentration method were 5.7 times higher than original assay, which was almost equal to theoretical rate as expected. The assay results of serially diluted samples were also as same as expected data in both original and concentration assay. We confirmed that the sensitivity of HCV core Ag concentration method had almost as same sensitivity as PCR high range assay in the competitive assay study using the serially monitored samples of five HCV patients during interferon therapy. A novel concentration method using PEG in HCV core Ag assay system seems to be useful for assessing and monitoring interferon treatment for HCV.
Evans, Christopher C; Moorhead, Andrew R; Storey, Bobby E; Blagburn, Byron L; Wolstenholme, Adrian J; Kaplan, Ray M
2017-11-15
Anthelmintics of the macrocyclic lactone (ML) drug class are widely used as preventives against the canine heartworm (Dirofilaria immitis). Over the past several years, however, reports of ML lack of efficacy (LOE) have emerged, in which dogs develop mature heartworm infection despite the administration of monthly prophylactics. More recently, isolates from LOE cases have been used to infect laboratory dogs and the resistant phenotype has been confirmed by the establishment of adult worms in the face of ML treatment at normally preventive dosages. Testing for and monitoring resistance in D. immitis requires a validated biological or molecular diagnostic assay. In this study, we assessed a larval migration inhibition assay (LMIA) that we previously optimized for use with D. immitis third-stage larvae (L 3 ). We used this assay to measure the in vitro ML susceptibilities of a known-susceptible laboratory strain of D. immitis and three highly suspected ML-resistant isolates originating from three separate LOE cases; progeny from two of these isolates have been confirmed ML-resistant by treatment of an infected dog in a controlled setting. A nonlinear regression model was fit to the dose-response data, from which IC 50 values were calculated. The D. immitis LMIA yielded consistent and reproducible dose-response data; however, no statistically significant differences in drug susceptibility were observed between control and LOE parasites. Additionally, the drug concentrations needed to paralyze the L 3 were much higher than those third- and fourth-stage larvae would experience in vivo. IC 50 values ranged from 1.57 to 5.56μM (p≥0.19). These data could suggest that ML resistance in this parasite is not mediated through a reduced susceptibility of L 3 to the paralytic effects of ML drugs, and therefore motility-based assays are likely not appropriate for measuring the effects of MLs against D. immitis in this target stage. Published by Elsevier B.V.
Enzymatic assays for the diagnosis of bradykinin-dependent angioedema.
Directory of Open Access Journals (Sweden)
Federica Defendi
Full Text Available BACKGROUND: The kinins (primarily bradykinin, BK represent the mediators responsible for local increase of vascular permeability in hereditary angioedema (HAE, HAE I-II associated with alterations of the SERPING1 gene and HAE with normal C1-Inhibitor function (HAE-nC1INH. Besides C1-Inhibitor function and concentration, no biological assay of kinin metabolism is actually available to help physicians for the diagnosis of angioedema (AE. We describe enzymatic tests on the plasma for diagnosis of BK-dependent AE. METHODS: The plasma amidase assays are performed using the Pro-Phe-Arg-p-nitroanilide peptide substrate to evaluate the spontaneous amidase activity and the proenzyme activation. We analyzed data of 872 patients presenting with BK-dependent AE or BK-unrelated diseases, compared to 303 controls. Anti-high MW kininogen (HK immunoblot was achieved to confirm HK cleavage in exemplary samples. Reproducibility, repeatability, limit of blank, limit of detection, precision, linearity and receiver operating characteristics (ROC were used to calculate the diagnostic performance of the assays. RESULTS: Spontaneous amidase activity was significantly increased in all BK-dependent AE, associated with the acute phase of disease in HAE-nC1INH, but preserved in BK-unrelated disorders. The increase of the amidase activity was associated to HK proteolysis, indicating its relevance to identify kininogenase activity. The oestrogens, known for precipitating AE episodes, were found as triggers of enzymatic activity. Calculations from ROC curves gave the optimum diagnostic cut-off for women (9.3 nmol⋅min(-1⋅mL(-1, area under curve [AUC] 92.1%, sensitivity 80.0%, and specificity 90.1% and for men (6.6 nmol·min(-1⋅mL(-1, AUC 91.0%, sensitivity 87.0% and specificity 81.2%. CONCLUSION: The amidase assay represents a diagnostic tool to help physicians in the decision to distinguish between BK-related and -unrelated AE.
Ilesanmi, A O; Adeleye, J A; Osotimehin, B O
1995-03-01
Infertility remains a medico-social problem in Nigeria and it accounts for a large percentage of outpatient gynecological consultations. The evaluation of the infertile couple remains a continuing challenge to the practising doctor in this part of the world. The need to evaluate the two methods commonly used for determining ovulation in these patients is indicated. Endometrial biopsy specimen and a single sample for serum progesterone estimation were obtained simultaneously in the luteal phase from 50 normally menstruating infertile Nigerian women. Subsequent analysis showed that a serum progesterone value of 6.6 nmol/l (2.2 ng/ml) or above was always associated with a secretory endometrium. Forty-six cycles yielded sufficient information to compare the two methods for confirmation of ovulation. Patients who ovulated with a progesterone value of 6.6 nmol/l (2.2 ng/ml) were 91.3% (42/46) or above, while 89% (41/46) showed secretory endometrium. Forty-six of the cases 86.9% (40/46) were judged to have ovulated by both parameters while 6.5% demonstrated anovulatory cycle using both criteria. From the study, a significant correlation was obtained between endometrial biopsy and progesterone assay methods in confirming ovulation.
Directory of Open Access Journals (Sweden)
Mindy I Davis
Full Text Available Phosphoinositide kinases regulate diverse cellular functions and are important targets for therapeutic development for diseases, such as diabetes and cancer. Preparation of the lipid substrate is crucial for the development of a robust and miniaturizable lipid kinase assay. Enzymatic assays for phosphoinositide kinases often use lipid substrates prepared from lyophilized lipid preparations by sonication, which result in variability in the liposome size from preparation to preparation. Herein, we report a homogeneous 1536-well luciferase-coupled bioluminescence assay for PI5P4Kα. The substrate preparation is novel and allows the rapid production of a DMSO-containing substrate solution without the need for lengthy liposome preparation protocols, thus enabling the scale-up of this traditionally difficult type of assay. The Z'-factor value was greater than 0.7 for the PI5P4Kα assay, indicating its suitability for high-throughput screening applications. Tyrphostin AG-82 had been identified as an inhibitor of PI5P4Kα by assessing the degree of phospho transfer of γ-(32P-ATP to PI5P; its inhibitory activity against PI5P4Kα was confirmed in the present miniaturized assay. From a pilot screen of a library of bioactive compounds, another tyrphostin, I-OMe tyrphostin AG-538 (I-OMe-AG-538, was identified as an ATP-competitive inhibitor of PI5P4Kα with an IC(50 of 1 µM, affirming the suitability of the assay for inhibitor discovery campaigns. This homogeneous assay may apply to other lipid kinases and should help in the identification of leads for this class of enzymes by enabling high-throughput screening efforts.
First results with a radioreceptor-assay (TRAK-Assay) for TSH-receptor-autoantibodies
International Nuclear Information System (INIS)
Becker, W.; Reiners, C.; Boerner, W.
1983-01-01
A new radioreceptor-assay (TRAK-assay) for autoantibodies against TSH-receptors was tested in 48 untreated thyrotoxic patients (26 regional autonomies, 22 toxic diffuse goiters). None of the 26 patients with regional autonomy showed positive autoantibody-titers. 4 patients with toxic diffuse goiter and thyrotoxic exophthalmos were TRAK-positive. Positive titers of microsomal and thyreoglobulin autoantibodies could be seen in 8 of 9 patients with positive TRAK-titers. In accordance with the conventional methods for detecting thyroid-stimulating immunoglobulins the new TRAK-assay seems to be suited for differentiating between immunogenic toxic diffuse goiter (Graves' disease) and goiter with disseminated autonomy as well as for prediction of relapse. (orig.) [de
Evaluation of the performance of the reduced local lymph node assay for skin sensitization testing.
Ezendam, Janine; Muller, Andre; Hakkert, Betty C; van Loveren, Henk
2013-06-01
The local lymph node assay (LLNA) is the preferred method for classification of sensitizers within REACH. To reduce the number of mice for the identification of sensitizers the reduced LLNA was proposed, which uses only the high dose group of the LLNA. To evaluate the performance of this method for classification, LLNA data from REACH registrations were used and classification based on all dose groups was compared to classification based on the high dose group. We confirmed previous examinations of the reduced LLNA showing that this method is less sensitive compared to the LLNA. The reduced LLNA misclassified 3.3% of the sensitizers identified in the LLNA and misclassification occurred in all potency classes and that there was no clear association with irritant properties. It is therefore not possible to predict beforehand which substances might be misclassified. Another limitation of the reduced LLNA is that skin sensitizing potency cannot be assessed. For these reasons, it is not recommended to use the reduced LLNA as a stand-alone assay for skin sensitization testing within REACH. In the future, the reduced LLNA might be of added value in a weight of evidence approach to confirm negative results obtained with non-animal approaches. Copyright © 2013 Elsevier Inc. All rights reserved.
Immunological assays employed for the elucidation of an histoplasmosis outbreak in São Paulo, SP
Directory of Open Access Journals (Sweden)
Angela Noronha Passos
2014-12-01
Full Text Available Several reports showed outbreaks of histoplasmosis acquired while bat-inhabited caves were visited by tourists, miners or researchers. We evaluated the performance of double immunodifusion (DI and immunoblotting (IB assays, employed for the histoplasmosis outbreak elucidation occurred in Vale do Paraíba, São Paulo. The existence of epidemiologic link, four patients with clinical signs suggestive of histoplasmosis and mycological confirmation has made that all 35 individuals involved to the cave visit were subjected to serological evaluation. By DI, we observed reactivity against H. capsulatum antigen in a single serum examined nearly 20 days after exposure to fungal propagules. On the other hand, IB showed reactivity against H and M fractions in 50% of samples evaluated. The analysis of the second sample batch, collected two months after the exposure showed that 96.7% were reactive by DI with antibodies titers ranging from 1 to 16 and 100% of reactivity against H and M fractions, by IB, suggesting an acute infection. The analysis of the overall agreement between the methods showed to be reasonable (κ = 0.37. This study confirms the importance and efficacy of more sensitive methodologies, such as IB assay, to early elucidation of disease, especially in cases of patients without mycological information.
Ribas-Maynou, J; García-Peiró, A; Fernández-Encinas, A; Abad, C; Amengual, M J; Prada, E; Navarro, J; Benet, J
2013-09-01
Sperm DNA fragmentation (SDF) is becoming an important test to assess male infertility. Several different tests are available, but no consensus has yet been reached as to which tests are most predictive of infertility. Few publications have reported a comprehensive analysis comparing these methods within the same population. The objective of this study was to analyze the differences between the five most common methodologies, to study their correlations and to establish their cut-off values, sensitivity and specificity in predicting male infertility. We found differences in SDF between fertile donors and infertile patients in TUNEL, SCSA, SCD and alkaline Comet assays, but none with the neutral Comet assay. The alkaline COMET assay was the best in predicting male infertility followed by TUNEL, SCD and SCSA, whereas the neutral COMET assay had no predictive power. For our patient population, threshold values for infertility were 20.05% for TUNEL assay, 18.90% for SCSA, 22.75% for the SCD test, 45.37% for alkaline Comet and 34.37% for neutral Comet. This work establishes in a comprehensive study that the all techniques except neutral Comet are useful to distinguish fertile and infertile men. © 2013 American Society of Andrology and European Academy of Andrology.
International Nuclear Information System (INIS)
Gheuens, E.E.O.; Bruijn, E.A. de; Van der Heyden, S.; Van Oosterom, A.T.; Lagarde, P.; Pooter, C.M.J. de; Chomy, F.
1995-01-01
This paper describes the adaptation of the MTT assay to hypoxic conditions in order to test the in vitro effect of piracetam on hypoxic cells and particularly on the radiosensitivity of hypoxic cells since this drug has shown clinical effect on acute and chronic hypoxia. The V79 cell line was selected by reference to preliminary hypoxic experiments using clonogenic assay and euoxic experiments using clonogenic and MTT assays. Cell growth and survival in our hypoxic conditions were assessed using MTT assay with an enclosure and special 48-well plates both made of glass. Growth curves on glass plates after 1-hour exposure to nitrogen versus air were comparable, so there is no bias effect due to gas composition. Survival curves using MTT versus reference clonogenic assay were comparable after radiation exposure in eu- and hypoxic conditions, and confirm the validity of our original technique for creating hypoxia. The Oxygen Enhancement Ratio was of about 3 for 1-hour hypoxic exposure. Piracetam gave no cytotoxic effect up to 10 mM of piracetam. Growth curves after continuous drug exposure and 1-hour euoxic versus hypoxic exposure gave no cytotoxic effect up to 10 mM of piracetam. Survival curves after continuous drug exposure to 10 mM of piracetam gave no significant effect on the radiosensitivity of hypoxic V79 cells using MTT or clonogenic assay. (author). 32 refs., 6 figs
Rapid molecular assays for the detection of yellow fever virus in low-resource settings.
Escadafal, Camille; Faye, Oumar; Sall, Amadou Alpha; Faye, Ousmane; Weidmann, Manfred; Strohmeier, Oliver; von Stetten, Felix; Drexler, Josef; Eberhard, Michael; Niedrig, Matthias; Patel, Pranav
2014-03-01
Yellow fever (YF) is an acute viral hemorrhagic disease transmitted by Aedes mosquitoes. The causative agent, the yellow fever virus (YFV), is found in tropical and subtropical areas of South America and Africa. Although a vaccine is available since the 1930s, YF still causes thousands of deaths and several outbreaks have recently occurred in Africa. Therefore, rapid and reliable diagnostic methods easy to perform in low-resources settings could have a major impact on early detection of outbreaks and implementation of appropriate response strategies such as vaccination and/or vector control. The aim of this study was to develop a YFV nucleic acid detection method applicable in outbreak investigations and surveillance studies in low-resource and field settings. The method should be simple, robust, rapid and reliable. Therefore, we adopted an isothermal approach and developed a recombinase polymerase amplification (RPA) assay which can be performed with a small portable instrument and easy-to-use lyophilized reagents. The assay was developed in three different formats (real-time with or without microfluidic semi-automated system and lateral-flow assay) to evaluate their application for different purposes. Analytical specificity and sensitivity were evaluated with a wide panel of viruses and serial dilutions of YFV RNA. Mosquito pools and spiked human plasma samples were also tested for assay validation. Finally, real-time RPA in portable format was tested under field conditions in Senegal. The assay was able to detect 20 different YFV strains and demonstrated no cross-reactions with closely related viruses. The RPA assay proved to be a robust, portable method with a low detection limit (<21 genome equivalent copies per reaction) and rapid processing time (<20 min). Results from real-time RPA field testing were comparable to results obtained in the laboratory, thus confirming our method is suitable for YFV detection in low-resource settings.
Rapid molecular assays for the detection of yellow fever virus in low-resource settings.
Directory of Open Access Journals (Sweden)
Camille Escadafal
2014-03-01
Full Text Available BACKGROUND: Yellow fever (YF is an acute viral hemorrhagic disease transmitted by Aedes mosquitoes. The causative agent, the yellow fever virus (YFV, is found in tropical and subtropical areas of South America and Africa. Although a vaccine is available since the 1930s, YF still causes thousands of deaths and several outbreaks have recently occurred in Africa. Therefore, rapid and reliable diagnostic methods easy to perform in low-resources settings could have a major impact on early detection of outbreaks and implementation of appropriate response strategies such as vaccination and/or vector control. METHODOLOGY: The aim of this study was to develop a YFV nucleic acid detection method applicable in outbreak investigations and surveillance studies in low-resource and field settings. The method should be simple, robust, rapid and reliable. Therefore, we adopted an isothermal approach and developed a recombinase polymerase amplification (RPA assay which can be performed with a small portable instrument and easy-to-use lyophilized reagents. The assay was developed in three different formats (real-time with or without microfluidic semi-automated system and lateral-flow assay to evaluate their application for different purposes. Analytical specificity and sensitivity were evaluated with a wide panel of viruses and serial dilutions of YFV RNA. Mosquito pools and spiked human plasma samples were also tested for assay validation. Finally, real-time RPA in portable format was tested under field conditions in Senegal. CONCLUSION/SIGNIFICANCE: The assay was able to detect 20 different YFV strains and demonstrated no cross-reactions with closely related viruses. The RPA assay proved to be a robust, portable method with a low detection limit (<21 genome equivalent copies per reaction and rapid processing time (<20 min. Results from real-time RPA field testing were comparable to results obtained in the laboratory, thus confirming our method is suitable for
Directory of Open Access Journals (Sweden)
Masayuki Saijo
2012-10-01
Full Text Available The family Arenaviridae, genus Arenavirus, consists of two phylogenetically independent groups: Old World (OW and New World (NW complexes. The Lassa and Lujo viruses in the OW complex and the Guanarito, Junin, Machupo, Sabia, and Chapare viruses in the NW complex cause viral hemorrhagic fever (VHF in humans, leading to serious public health concerns. These viruses are also considered potential bioterrorism agents. Therefore, it is of great importance to detect these pathogens rapidly and specifically in order to minimize the risk and scale of arenavirus outbreaks. However, these arenaviruses are classified as BSL-4 pathogens, thus making it difficult to develop diagnostic techniques for these virus infections in institutes without BSL-4 facilities. To overcome these difficulties, antibody detection systems in the form of an enzyme-linked immunosorbent assay (ELISA and an indirect immunofluorescence assay were developed using recombinant nucleoproteins (rNPs derived from these viruses. Furthermore, several antigen-detection assays were developed. For example, novel monoclonal antibodies (mAbs to the rNPs of Lassa and Junin viruses were generated. Sandwich antigen-capture (Ag-capture ELISAs using these mAbs as capture antibodies were developed and confirmed to be sensitive and specific for detecting the respective arenavirus NPs. These rNP-based assays were proposed to be useful not only for an etiological diagnosis of VHFs, but also for seroepidemiological studies on VHFs. We recently developed arenavirus neutralization assays using vesicular stomatitis virus (VSV-based pseudotypes bearing arenavirus recombinant glycoproteins. The goal of this article is to review the recent advances in developing laboratory diagnostic assays based on recombinant viral proteins for the diagnosis of VHFs and epidemiological studies on the VHFs caused by arenaviruses.
Directory of Open Access Journals (Sweden)
Cho In-Cheol
2007-11-01
Full Text Available Abstract Background Aside from single nucleotide polymorphisms, copy number variations (CNVs are the most important factors in susceptibility to genetic disorders because they affect expression levels of genes. In previous studies, pyrosequencing, mini-sequencing, real-time PCR, invader assays and other techniques have been used to detect CNVs. However, the higher the copy number in a genome, the more difficult it is to resolve the copies, so a more accurate method for measuring CNVs and assigning genotype is needed. Results PCR followed by a quantitative oligonucleotide ligation assay (qOLA was developed for quantifying CNVs. The accuracy and precision of the assay were evaluated for porcine KIT, which was selected as a model locus. Overall, the root mean squares of bias and standard deviation of qOLA were 2.09 and 0.45, respectively. These values are less than half of those in the published pyrosequencing assay for analyzing CNV in porcine KIT. Using a combined method of qOLA and another pyrosequencing for quantitative analysis of KIT copies with spliced forms, we confirmed the segregation of KIT alleles in 145 F1 animals with pedigree information and verified the correct assignment of genotypes. In a diagnostic test on 100 randomly sampled commercial pigs, there was perfect agreement between the genotypes obtained by grouping observations on a scatter plot and by clustering using the nearest centroid sorting method implemented in PROC FASTCLUS of the SAS package. In a test on 159 Large White pigs, there were only two discrepancies between genotypes assigned by the two clustering methods (98.7% agreement, confirming that the quantitative ligation assay established here makes genotyping possible through the accurate measurement of high KIT copy numbers (>4 per diploid genome. Moreover, the assay is sensitive enough for use on DNA from hair follicles, indicating that DNA from various sources could be used. Conclusion We have established a high
Directory of Open Access Journals (Sweden)
Soheil eKeihan Falsafi
2015-10-01
Full Text Available GABAB receptors are heterodimeric G-protein coupled receptors known to be involved in learning and memory. Although a role for GABAB receptors in cognitive processes is evident, there is no information on hippocampal GABAB receptor complexes in a multiple T maze (MTM task, a robust paradigm for evaluation of spatial learning.Trained or untrained (yoked control C57BL/6J male mice (n=10/group were subjected to the MTM task and sacrificed 6 hours following their performance. Hippocampi were taken, membrane proteins extracted and run on blue native PAGE followed by immunoblotting with specific antibodies against GABAB1, GABAB1a and GABAB2. Immunoprecipitation with subsequent mass spectrometric identification of co-precipitates was carried out to show if GABAB1 and GABAB2 as well as other interacting proteins co-precipitate. An antibody shift assay (ASA and a proximity ligation assay (PLA were also used to see if the two GABAB subunits are present in the receptor complex.Single bands were observed on Western blots, each representing GABAB1, GABAB1a or GABAB2 at an apparent molecular weight of approximately 100 kDa. Subsequently, densitometric analysis revealed that levels of GABAB1 and GABAB1a but not GABAB2- containing receptor complexes were significantly higher in trained than untrained groups. Immunoprecipitation followed by mass spectrometric studies confirmed the presence of GABAB1, GABAB2, calcium calmodulin kinases I and II, GluA1 and GluA2 as constituents of the complex. ASA and PLA also showed the presence of the two subunits of GABAB receptor within the complex. It is shown that increased levels of GABAB1 subunit-containing complexes are paralleling performance in a land maze.
Directory of Open Access Journals (Sweden)
Anil K Singh
2010-03-01
Full Text Available Resistin is a cysteine rich protein, mainly expressed and secreted by circulating human mononuclear cells. While several factors responsible for transcription of mouse resistin gene have been identified, not much is known about the factors responsible for the differential expression of human resistin.We show that the minimal promoter of human resistin lies within approximately 80 bp sequence upstream of the transcriptional start site (-240 whereas binding sites for cRel, CCAAT enhancer binding protein alpha (C/EBP-alpha, activating transcription factor 2 (ATF-2 and activator protein 1 (AP-1 transcription factors, important for induced expression, are present within sequences up to -619. Specificity Protein 1(Sp1 binding site (-276 to -295 is also present and an interaction of Sp1 with peroxisome proliferator activating receptor gamma (PPARgamma is necessary for constitutive expression in U937 cells. Indeed co-immunoprecipitation assay demonstrated a direct physical interaction of Sp1 with PPARgamma in whole cell extracts of U937 cells. Phorbol myristate acetate (PMA upregulated the expression of resistin mRNA in U937 cells by increasing the recruitment of Sp1, ATF-2 and PPARgamma on the resistin gene promoter. Furthermore, PMA stimulation of U937 cells resulted in the disruption of Sp1 and PPARgamma interaction. Chromatin immunoprecipitation (ChIP assay confirmed the recruitment of transcription factors phospho ATF-2, Sp1, Sp3, PPARgamma, chromatin modifier histone deacetylase 1 (HDAC1 and the acetylated form of histone H3 but not cRel, C/EBP-alpha and phospho c-Jun during resistin gene transcription.Our findings suggest a complex interplay of Sp1 and PPARgamma along with other transcription factors that drives the expression of resistin in human monocytic U937 cells.
Skrlin, Ana; Kosor Krnic, Ela; Gosak, Darko; Prester, Berislav; Mrsa, Vladimir; Vuletic, Marko; Runac, Domagoj
2010-11-02
In vivo and in vitro potency assays have always been a critical tool for confirmation of protein activity. However, due to their complexity and time consuming procedures, it remains a challenge to find an alternative analytical approach that would enable their replacement with no impact on the quality of provided information. The goal of this research was to determine if a correlation between liquid chromatography assays and in vitro biological assay could be established for filgrastim (recombinant human granulocyte-colony stimulating factor, rhG-CSF) samples containing various amounts of related impurities. For that purpose, relevant filgrastim related impurities were purified to homogeneity and characterized by liquid chromatography and mass spectrometry. A significant correlation (R(2)>0.90) between the two types of assays was revealed. Potency of oxidized filgrastim was determined to be approximately 25% of filgrastim stated potency (1 x 10(8)IU/mg of protein). Formyl-methionine filgrastim had potency of 89% of the filgrastim stated potency, while filgrastim dimer had 67% of filgrastim stated potency. A mathematical model for the estimation of biological activity of filgrastim samples from chromatography data was established and a significant correlation between experimental potency values and potency values estimated by the mathematical model was obtained (R(2)=0.92). Based on these results a conclusion was made that reversed phase high performance liquid chromatography could be used as an alternative for the in vitro biological assay for potency assessment of filgrastim samples. Such an alternative model would enable substitution of a complex and time consuming biological assay with a robust and precise instrumental method in many practical cases. Copyright (c) 2010 Elsevier B.V. All rights reserved.
The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.
Directory of Open Access Journals (Sweden)
Aili Cui
Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.
Syndecan-4 associates with alpha-actinin
DEFF Research Database (Denmark)
Greene, Daniel K; Tumova, Sarka; Couchman, John R
2002-01-01
during the formation of focal adhesions. To date, a direct link between syndecan-4 and the cytoskeleton has remained elusive. We now demonstrate by Triton X-100 extraction immunoprecipitation and in vitro binding assays that the focal adhesion component alpha-actinin interacts with syndecan-4 in a beta...
Measurement of antiacetylcholine receptor auto-antibodies in ...
African Journals Online (AJOL)
Two different acetylcholine receptor (AChR) preparations derived from amputated human muscle (AChRAMP) and from the human rhabdomyosarcoma cell line TE671 (AChRTE67,) were compared in radio-immunoprecipitation assays for the detection of AChR auto-antibodies in serum specimens from 20 patients with ...
EB1 and EB3 promote cilia biogenesis by several centrosome-related mechanisms
DEFF Research Database (Denmark)
Schrøder, Jacob M; Larsen, Jesper; Komarova, Yulia
2011-01-01
surrounded by vesicles. Further, GST pull-down assays, mass spectrometry and immunoprecipitation indicated that EB1 and EB3 interact with proteins implicated in MT minus-end anchoring or vesicular trafficking to the cilia base, suggesting that EB1 and EB3 promote ciliogenesis by facilitating such trafficking...
Potential gene regulatory role for cyclin D3 in muscle cells
Indian Academy of Sciences (India)
Using chromatin immunoprecipitation assays, we demonstrated that expression of cyclin D3 in undifferentiated myoblasts altered histone epigenetic marks at promoters of muscle-specific genes like MyoD, Pax7, myogenin and muscle creatine kinase but not non-muscle genes. Cyclin D3 expression also reduced the mRNA ...
Safeguards and Non-destructive Assay
International Nuclear Information System (INIS)
Carchon, R.; Bruggeman, M.
2001-01-01
SCK-CEN's programme on safeguards and non-destructive assay includes: (1) various activities to assure nuclear materials accountancy; (2) contributes to the implementation of Integrated Safeguards measures in Belgium and to assist the IAEA through the Belgian Support Programme; (3) renders services to internal and external customers in the field of safeguards; (4) improves passive neutron coincidence counting techniques for waste assay and safeguards verification measurements by R and D on correlation algorithms implemented via software or dedicated hardware; (5) improves gamma assay techniques for waste assay by implementing advanced scanning techniques and different correlation algorithms; and (6) develops numerical calibration techniques. Major achievements in these areas in 2000 are reported
Effective implementation of novel MET pharmacodynamic assays in translational studies.
Srivastava, Apurva K; Navas, Tony; Herrick, William G; Hollingshead, Melinda G; Bottaro, Donald P; Doroshow, James H; Parchment, Ralph E
2017-01-01
MET tyrosine kinase (TK) dysregulation is significantly implicated in many types of cancer. Despite over 20 years of drug development to target MET in cancers, a pure anti-MET therapeutic has not yet received market approval. The failure of two recently concluded phase III trials point to a major weakness in biomarker strategies to identify patients who will benefit most from MET therapies. The capability to interrogate oncogenic mutations in MET via circulating tumor DNA (ctDNA) provides an important advancement in identification and stratification of patients for MET therapy. However, a wide range in type and frequency of these mutations suggest there is a need to carefully link these mutations to MET dysregulation, at least in proof-of-concept studies. In this review, we elaborate how we can utilize recently developed and validated pharmacodynamic biomarkers of MET not only to show target engagement, but more importantly to quantitatively measure MET dysregulation in tumor tissues. The MET assay endpoints provide evidence of both canonical and non-canonical MET signaling, can be used as "effect markers" to define biologically effective doses (BEDs) for molecularly targeted drugs, confirm mechanism-of-action in testing combination of drugs, and establish whether a diagnostic test is reporting MET dysregulation. We have established standard operating procedures for tumor biopsy collections to control pre-analytical variables that have produced valid results in proof-of-concept studies. The reagents and procedures are made available to the research community for potential implementation on multiple platforms such as ELISA, quantitative immunofluorescence assay (qIFA), and immuno-MRM assays.
Ali, Amjad; Nisar, Muhammad; Idrees, Muhammad; Rafique, Shazia; Iqbal, Muhammad
2015-05-01
Early diagnosis of HCV infection is based on detection of antibodies against HCV proteins using recombinant viral antigens. The present study was designed to select, clone and express the antigenic regions of Core and E2 genes from local HCV-3a genotype and to utilize the antigenic recombinant proteins (Core & E2) to develop highly sensitive, specific and economical diagnostic assays for detection of HCV infection. The antigenic sites were determined within Core and E2 genes and were then cloned in pET-28a expression vector. The right orientation of the desired inserted fragments of Core and E2 were confirmed via sequencing prior to expression and were then transformed in BL21 (DE3) pLysS strains of E. coli and induced with 0.5mM Isopropyl-b-D-thiogalactopyranoside (IPTG) for the production of antigenic recombinant proteins. The produced truncated antigens were then purified by Nickel affinity chromatography and were confirmed by western blotting, immunoblotting and enzyme-linked immunosorbent assay (ELISA). The expressed Core and E2 recombinant antigens were used to develop immunoblotting assay for the detection of anti-HCV antibodies in sera. With immunoblotting, a total of 93-HCV infected sera and 35-HCV negative individuals were tested for the presence of anti-HCV antibodies to the Core and E2 antigens. Recombinant antigen showed 100% reactivity against HCV infected sera, with no cross reactivity against HCV-negative sera. The immunoblot assay mixture of recombinant antigens (Core+E2) showed a strong reaction intensity in the test area (TA) as compared to the individual truncated Core and E2 recombinant antigens. In the in-house ELISA assay, mixed Core and E2 recombinant antigens showed 100% reactivity against a standardized panel of 150-HCV-positive sera and non reactivity against a standardized panel of 150 HCV-negative sera while also being non reactive to sera positive for other viral infections. The antigenic recombinant antigens also were tested for the
Lavoie, S; Caswell, D; Gill, M J; Kadkhoda, K; Charlton, C L; Levett, P N; Hatchette, T; Garceau, R; Maregmen, J; Mazzulli, T; Needle, R; Kadivar, K; Kim, J
2018-04-12
False-reactivity in HIV-negative specimens has been detected in HIV fourth-generation antigen/antibody or 'combo' assays which are able to detect both anti-HIV-1/HIV-2 antibodies and HIV-1 antigen. We sought to characterize these specimens and determine the effect of heterophilic interference. Specimens previously testing as false-reactive on the Abbott ARCHITECT HIV Ag/Ab combo assay and re-tested on a different (Siemens ADVIA Centaur HIV Ag/Ab) assay. A subset of these specimens were also pre-treated with heterophilic blocking agents and re-tested on the Abbott assay. Here we report that 95% (252/264) of clinical specimens that were repeatedly reactive on the Abbott ARCHITECT HIV Ag/Ab combo assay (S/Co range, 0.94-678) were negative when re-tested on a different fourth generation HIV combo assay (Siemens ADVIA Centaur HIV Ag/Ab). All 264 samples were subsequently confirmed to be HIV negative. On a small subset (57) of specimens with available volume, pre-treatment with two different reagents (HBT; Heterophilic Blocking Tube, NABT; Non-Specific Blocking Tube) designed to block heterophilic antibody interference either eliminated (HBT) or reduced (NABT) the false reactivity when re-tested on the ARCHITECT HIV Ag/Ab combo assay. Our results suggest that the Abbott ARCHITECT HIV Ag/Ab combo assay can be prone to heterophilic antibody interference. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.
Bacteriologically confirmed tuberculosis in children
International Nuclear Information System (INIS)
Ozere, I.; Sele, A.; Ozolina, A.
2005-01-01
Tuberculosis in children and adults is a growing problem with important public health implications. In Latvia the incidence of tuberculosis (TB) in children up to age 14 has increased from 7,1 per 100000 in 1992 to 28,8 per 100000 in 2003. The diagnosis of TB is confirmed by isolation and identification of M. tuberculosis (MT) from clinical specimen. Confirmation of the disease, however, is difficult in children due to poor bacilli excretion and even under the best circumstances only about 30-40% of pediatric TB cases are proved bacteriologically. Of the 370 pediatric TB cases diagnosed between January 1, 2001 and December 1, 2003 in Latvia, 53 (14,3%) were confirmed bacteriologically. The clinical, radiological, immunological and anamnestic features of confirmed TB can serve as cornerstones for diagnosing of TB, when culture is not available. Objective To evaluate the sensitivity of diagnostic criteria of TB, clinical and radiological manifestation of TB and drug susceptibility of MT isolated also. Methods All consecutive children (53 in total) up to age 14 diagnosed with bacteriologically confirmed TB during 01.01.2001. -01.12.2003. were prospectively evaluated for reasons mentioned above. Results Of the 53 children identified all but one had respiratory tract TB. 17(32,1 %) children were under 4 years of age, 9 (17%) children were 5-9 years old, but 27 (50,9%) patients were 10-14 years old. During evaluation data on TB source case were found in addition in 13 children and total TB contact history was positive in 37 (69,8%) patients. All clinical and radiographical forms of respiratory tract TB were diagnosed. The most common encountered forms were intrathoracic adenopathy in 10 (18,9%) cases and TB pneumonia in 6 (11,3%) cases in children aged 10-14 years. lnthrathoracic adenopathy associated with segmental parenchymal lesion was the most common form in children under 4 years of age -7 (13,2%) cases respectively. Conclusions 1. The clinical and radiological
Radioactive wastes assay technique and equipment
International Nuclear Information System (INIS)
Lee, K. M.; Hong, D. S; Kim, T. K.; Bae, S. M.; Shon, J. S.; Hong, K. P.
2004-12-01
The waste inventory records such as the activities and radio- nuclides contained in the waste packages are to be submitted with the radioactive wastes packages for the final disposal. The nearly around 10,000 drums of waste stocked in KAERI now should be assayed for the preparation of the waste inventory records too. For the successive execution of the waste assay, the investigation into the present waste assay techniques and equipment are to be taken first. Also the installation of the waste assay equipment through the comprehensive design, manufacturing and procurement should be proceeded timely. As the characteristics of the KAERI-stocked wastes are very different from that of the nuclear power plant and those have no regular waste streams, the application of the in-direct waste assay method using the scaling factors are not effective for the KAERI-generated wastes. Considering for the versal conveniency including the accuracy over the wide range of waste forms and the combination of assay time and sensitivity, the TGS(Tomographic Gamma Scanner) is appropriate as for the KAERI -generated radioactive waste assay equipment
Role of the Na(+)/K(+)-ATPase beta-subunit in peptide-mediated transdermal drug delivery.
Wang, Changli; Ruan, Renquan; Zhang, Li; Zhang, Yunjiao; Zhou, Wei; Lin, Jun; Ding, Weiping; Wen, Longping
2015-04-06
In this work, we discovered that the Na(+)/K(+)-ATPase beta-subunit (ATP1B1) on epidermal cells plays a key role in the peptide-mediated transdermal delivery of macromolecular drugs. First, using a yeast two-hybrid assay, we screened candidate proteins that have specific affinity for the short peptide TD1 (ACSSSPSKHCG) identified in our previous work. Then, we verified the specific binding of TD1 to ATP1B1 in yeast and mammalian cells by a pull-down ELISA and an immunoprecipitation assay. Finally, we confirmed that TD1 mainly interacted with the C-terminus of ATP1B1. Our results showed that the interaction between TD1 and ATP1B1 affected not only the expression and localization of ATP1B1, but also the epidermal structure. In addition, this interaction could be antagonized by the exogenous competitor ATP1B1 or be inhibited by ouabain, which results in the decreased delivery of macromolecular drugs across the skin. The discovery of a critical role of ATP1B1 in the peptide-mediated transdermal drug delivery is of great significance for the future development of new transdermal peptide enhancers.
DEFF Research Database (Denmark)
Nordentoft, Steen; Kabell, Susanne; Pedersen, Karl
2011-01-01
of Chlamydiaceae and differentiate the most prevalent veterinary Chlamydophila species: Cp. psittaci, Cp. abortus, Cp. felis, and Cp. caviae. By adding bovine serum albumin to the master mixes, target DNA could be detected directly in crude lysates of enzymatically digested conjunctival or pharyngeal swabs...... or tissue specimens from heart, liver, and spleen without further purification. The assays were evaluated on veterinary specimens where all samples were screened using a family-specific PCR, and positive samples were further tested using species-specific PCRs. Cp. psittaci was detected in 47 birds, Cp...... with a highly sensitive family-specific PCR, we were able to screen for Chlamydiaceae in veterinary specimens and confirm the species in positive samples with additional PCR assays....
PERFORMANCE CONFIRMATION IN-SITU INSTRUMENTATION
International Nuclear Information System (INIS)
N.T. Raczka
2000-01-01
The purpose of this document is to identify and analyze the types of in-situ instruments and methods that could be used in support of the data acquisition portion of the Performance Confirmation (PC) program at the potential nuclear waste repository at Yucca Mountain. The PC program will require geomechanical , geophysical, thermal, and hydrologic instrumentation of several kinds. This analysis is being prepared to document the technical issues associated with each type of measurement during the PC period. This analysis utilizes the ''Performance Confirmation Input Criteria'' (CRWMS M andO 1999a) as its starting point. The scope of this analysis is primarily on the period after the start of waste package emplacement and before permanent closure of the repository, a period lasting between 15 and 300 years after last package emplacement (Stroupe 2000, Attachment 1, p. 1). The primary objectives of this analysis are to: (1) Review the design criteria as presented in the ''Performance Confirmation Input Criteria'' (CRWMS M andO 1999a). The scope of this analysis will be limited to the instrumentation related to parameters that require continuous monitoring of the conditions underground. (2) Preliminary identification and listing of the data requirements and parameters as related to the current repository layout in support of PC monitoring. (3) Preliminary identification of methods and instrumentation for the acquisition of the required data. Although the ''Performance Confirmation Input Criteria'' (CRWMS M andO 1999a) defines a broad range of data that must be obtained from a variety of methods, the focus of this analysis is on instrumentation related to the performance of the rock mass and the formation of water in the repository environment, that is obtainable from in-situ observation, testing, and monitoring
Radioactive waste package assay facility. Volume 1. Application of assay technology
International Nuclear Information System (INIS)
Findlay, D.J.S.; Green, T.H.; Molesworth, T.V.; Staniforth, D.; Strachan, N.R.; Rogers, J.D.; Wise, M.O.; Forrest, K.R.
1992-01-01
This report, in three volumes, covers the work carried out by Taylor Woodrow Construction Ltd., and two major sub-contractors: Harwell Laboratory (AEA Technology) and Siemens Plessey Controls Ltd., on the development of a radioactive waste package assay facility, for cemented 500 litre intermediate level waste drums. In volume 1, the reasons for assay are considered together with the various techniques that can be used, and the information that can be obtained. The practical problems associated with the use of the various techniques in an integrated assay facility are identified, and the key parameters defined. Engineering and operational features are examined and provisional designs proposed for facilities at three throughput levels: 15,000, 750 and 30 drums per year respectively. The capital and operating costs for such facilities have been estimated. A number of recommendations are made for further work. 16 refs., 14 figs., 13 tabs
Willi, Barbara; Meli, Marina L; Lüthy, Ruedi; Honegger, Hanspeter; Wengi, Nicole; Hoelzle, Ludwig E; Reusch, Claudia E; Lutz, Hans; Hofmann-Lehmann, Regina
2009-12-01
Hemotropic mycoplasmas (hemoplasmas) are the causative agents of infectious anemia in several mammalian species. Their zoonotic potential has recently been substantiated by the identification of a feline hemoplasma isolate in an immunocompromised human patient. Although species-specific diagnostic molecular methods have been developed, their application as screening tools is limited due to the species diversity of hemoplasmas. The goals of this study were to develop a universal hemoplasma screening assay with broad specificity based on the SYBR green PCR principle, to compare the assay with hemoplasma-specific TaqMan PCR, and to analyze potential tick vectors and human blood samples to address the zoonotic potential. The newly developed PCR assay based on the 16S rRNA gene amplified feline, canine, bovine, porcine, camelid, and murine hemoplasmas, as well as Mycoplasma penetrans and Mycoplasma pneumoniae. The lower detection limit for feline and canine hemoplasmas was 1 to 10 copies/PCR. The assay exhibited 98.2% diagnostic sensitivity and 92.1% diagnostic specificity for feline hemoplasmas. All 1,950 Ixodes ticks were PCR negative, suggesting that Ixodes ticks are not relevant vectors for the above-mentioned hemoplasma species in Switzerland. None of the 414 blood samples derived from anemic or immunocompromised human patients revealed a clear positive result. The SYBR green PCR assay described here is a suitable tool to screen for known and so-far-undiscovered hemoplasma species. Positive results should be confirmed by specific TaqMan PCR or sequencing.
Automation of the dicentric chromosome assay and related assays
International Nuclear Information System (INIS)
Balajee, Adayabalam S.; Dainiak, Nicholas
2016-01-01
Dicentric Chromosome Assay (DCA) is considered to be the 'gold standard' for personalized dose assessment in humans after accidental or incidental radiation exposure. Although this technique is superior to other cytogenetic assays in terms of specificity and sensitivity, its potential application to radiation mass casualty scenarios is highly restricted because DCA is time consuming and labor intensive when performed manually. Therefore, it is imperative to develop high throughput automation techniques to make DCA suitable for radiological triage scenarios. At the Cytogenetic Biodosimetry Laboratory in Oak Ridge, efforts are underway to develop high throughput automation of DCA. Current status on development of various automated cytogenetic techniques in meeting the biodosimetry needs of radiological/nuclear incident(s) will be discussed
Bresters, D.; Zaaijer, H. L.; Cuypers, H. T.; Reesink, H. W.; Winkel, I. N.; van Exel-Oehlers, P. J.; van Drimmelen, A. A.; Jansen, P. L.; van der Poel, C. L.; Lelie, P. N.
1993-01-01
To establish the value of the second-generation recombinant immunoblot assay (RIBA-2) and cDNA polymerase chain reaction (cDNA PCR) for confirmation of hepatitis C virus (HCV) infection, anti-HCV reaction patterns and the presence of HCV RNA were examined in 610 blood donors and 255 non-A, non-B
Radiometric assays for glycerol, glucose, and glycogen
International Nuclear Information System (INIS)
Bradley, D.C.; Kaslow, H.R.
1989-01-01
We have developed radiometric assays for small quantities of glycerol, glucose and glycogen, based on a technique described by Thorner and Paulus for the measurement of glycerokinase activity. In the glycerol assay, glycerol is phosphorylated with [32P]ATP and glycerokinase, residual [32P]ATP is hydrolyzed by heating in acid, and free [32P]phosphate is removed by precipitation with ammonium molybdate and triethylamine. Standard dose-response curves were linear from 50 to 3000 pmol glycerol with less than 3% SD in triplicate measurements. Of the substances tested for interference, only dihydroxyacetone gave a slight false positive signal at high concentration. When used to measure glycerol concentrations in serum and in media from incubated adipose tissue, the radiometric glycerol assay correlated well with a commonly used spectrophotometric assay. The radiometric glucose assay is similar to the glycerol assay, except that glucokinase is used instead of glycerokinase. Dose response was linear from 5 to 3000 pmol glucose with less than 3% SD in triplicate measurements. Glucosamine and N-acetylglucosamine gave false positive signals when equimolar to glucose. When glucose concentrations in serum were measured, the radiometric glucose assay agreed well with hexokinase/glucose-6-phosphate dehydrogenase (H/GDH)-based and glucose oxidase/H2O2-based glucose assays. The radiometric method for glycogen measurement incorporates previously described isolation and digestion techniques, followed by the radiometric assay of free glucose. When used to measure glycogen in mouse epididymal fat pads, the radiometric glycogen assay correlated well with the H/GDH-based glycogen assay. All three radiometric assays offer several practical advantages over spectral assays
Harmonization of radiobiological assays: why and how?
International Nuclear Information System (INIS)
Prasanna, Pataje G.
2014-01-01
The International Atomic Energy Agency has made available a technical manual for cytogenetic biodosimetry assays (dicentric chromosome aberration (DCA) and cytokinesis-block micronucleus (CBMN) assays) used for radiation dose assessment in radiation accidents. The International Standardization Organization, which develops standards and guidelines, also provides an avenue for laboratory accreditation, has developed guidelines and recommendations for performing cytogenetic biodosimetry assays. Harmonization of DCA and CBMN assays, has improved their accuracy. Double-blinded inter-laboratory comparison studies involving several networks have further validated DCA and CBMN assays and improved the confidence in their potential use for radiation dose assessment in mass casualties. This kind of international harmonization is lacking for pre-clinical radiobiology assays. The widely used pre-clinical assays that are relatively important to set stage for clinical trials include clonogenic assays, flow-cytometry assays, apoptotic assays, and tumor regression and growth delay assays. However, significant inter-laboratory variations occur with respect to data among laboratories. This raises concerns on the reliability and reproducibility of preclinical data that drives further development and translation. Lack of reproducibility may stem from a variety of factors such as poor scientist training, less than optimal experimental design, inadequate description of methodology, and impulse to publish only the positive data etc. Availability of technical manuals, standard operating procedures, accreditation avenues for laboratories performing such assays, inter-laboratory comparisons, and use of standardized protocols are necessary to enhance reliability and reproducibility. Thus, it is important that radiobiological assays are harmonized for laboratory protocols to ensure successful translation of pre-clinical research on radiation effect modulators to help design clinic trials with
Performance Confirmation Data Acquisition System
International Nuclear Information System (INIS)
D.W. Markman
2000-01-01
The purpose of this analysis is to identify and analyze concepts for the acquisition of data in support of the Performance Confirmation (PC) program at the potential subsurface nuclear waste repository at Yucca Mountain. The scope and primary objectives of this analysis are to: (1) Review the criteria for design as presented in the Performance Confirmation Data Acquisition/Monitoring System Description Document, by way of the Input Transmittal, Performance Confirmation Input Criteria (CRWMS M and O 1999c). (2) Identify and describe existing and potential new trends in data acquisition system software and hardware that would support the PC plan. The data acquisition software and hardware will support the field instruments and equipment that will be installed for the observation and perimeter drift borehole monitoring, and in-situ monitoring within the emplacement drifts. The exhaust air monitoring requirements will be supported by a data communication network interface with the ventilation monitoring system database. (3) Identify the concepts and features that a data acquisition system should have in order to support the PC process and its activities. (4) Based on PC monitoring needs and available technologies, further develop concepts of a potential data acquisition system network in support of the PC program and the Site Recommendation and License Application
A New Way to Confirm Planet Candidates
Kohler, Susanna
2016-05-01
What was the big deal behind the Kepler news conference yesterday? Its not just that the number of confirmed planets found by Kepler has more than doubled (though thats certainly exciting news!). Whats especially interesting is the way in which these new planets were confirmed.Number of planet discoveries by year since 1995, including previous non-Kepler discoveries (blue), previous Kepler discoveries (light blue) and the newly validated Kepler planets (orange). [NASA Ames/W. Stenzel; Princeton University/T. Morton]No Need for Follow-UpBefore Kepler, the way we confirmed planet candidates was with follow-up observations. The candidate could be validated either by directly imaging (which is rare) or obtaining a large number radial-velocity measurements of the wobble of the planets host star due to the planets orbit. But once Kepler started producing planet candidates, these approaches to validation became less feasible. A lot of Kepler candidates are small and orbit faint stars, making follow-up observations difficult or impossible.This problem is what inspired the development of whats known as probabilistic validation, an analysis technique that involves assessing the likelihood that the candidates signal is caused by various false-positive scenarios. Using this technique allows astronomers to estimate the likelihood of a candidate signal being a true planet detection; if that likelihood is high enough, the planet candidate can be confirmed without the need for follow-up observations.A breakdown of the catalog of Kepler Objects of Interest. Just over half had previously been identified as false positives or confirmed as candidates. 1284 are newly validated, and another 455 have FPP of1090%. [Morton et al. 2016]Probabilistic validation has been used in the past to confirm individual planet candidates in Kepler data, but now Timothy Morton (Princeton University) and collaborators have taken this to a new level: they developed the first code thats designed to do fully
Schmitt, Sebastian; Höfner, Georg; Wanner, Klaus T
2014-08-05
Transport assays for neurotransmitters based on radiolabeled substrates are widely spread and often indispensable in basic research and the drug development process, although the use of radioisotopes is inherently coupled to issues concerning radioactive waste and safety precautions. To overcome these disadvantages, we developed mass spectrometry (MS)-based transport assays for γ-aminobutyric acid (GABA), which is the major inhibitory neurotransmitter in the central nervous system (CNS). These "MS Transport Assays" provide all capabilities of [(3)H]GABA transport assays and therefore represent the first substitute for the latter. The performance of our approach is demonstrated for GAT1, the most important GABA transporter (GAT) subtype. As GABA is endogenously present in COS-7 cells employed as hGAT1 expression system, ((2)H6)GABA was used as a substrate to differentiate transported from endogenous GABA. To record transported ((2)H6)GABA, a highly sensitive, short, robust, and reliable HILIC-ESI-MS/MS quantification method using ((2)H2)GABA as an internal standard was developed and validated according to the Center for Drug Evaluation and Research (CDER) guidelines. Based on this LC-MS quantification, a setup to characterize hGAT1 mediated ((2)H6)GABA transport in a 96-well format was established, that enables automated processing and avoids any sample preparation. The K(m) value for ((2)H6)GABA determined for hGAT1 is in excellent agreement with results obtained from [(3)H]GABA uptake assays. In addition, the established assay format enables efficient determination of the inhibitory potency of GAT1 inhibitors, is capable of identifying those inhibitors transported as substrates, and furthermore allows characterization of efflux. The approach described here combines the strengths of LC-MS/MS with the high efficiency of transport assays based on radiolabeled substrates and is applicable to all GABA transporter subtypes.
Directory of Open Access Journals (Sweden)
Mohammod Jobayer Chisti
Full Text Available Severe malnutrition is a risk factor for pneumonia due to a wide range of pathogens but aetiological data are limited and the role of Mycobacterium tuberculosis is uncertain.We prospectively investigated severely malnourished young children (<5 years with radiological pneumonia admitted over a 15-month period. Investigations included blood culture, sputa for microscopy and mycobacterial culture. Xpert MTB/RIF assay was introduced during the study. Study children were followed for 12 weeks following their discharge from the hospital.405 eligible children were enrolled, with a median age of 10 months. Bacterial pathogens were isolated from blood culture in 18 (4.4% children, of which 72% were Gram negatives. Tuberculosis was confirmed microbiologically in 7% (27/396 of children that provided sputum - 10 by culture, 21 by Xpert MTB/RIF assay, and 4 by both tests. The diagnostic yield from induced sputum was 6% compared to 3.5% from gastric aspirate. Sixty (16% additional children had tuberculosis diagnosed clinically that was not microbiologically confirmed. Most confirmed tuberculosis cases did not have a positive contact history or positive tuberculin test. The sensitivity and specificity of Xpert MTB/RIF assay compared to culture was 67% (95% CI: 24-94 and 92% (95% CI: 87-95 respectively. Overall case-fatality rate was 17% and half of the deaths occurred in home following discharge from the hospital.TB was common in severely malnourished Bangladeshi children with pneumonia. X-pert MTB/RIF assay provided higher case detection rate compared to sputum microscopy and culture. The high mortality among the study children underscores the need for further research aimed at improved case detection and management for better outcomes.
Clonogenic assay: adherent cells.
Rafehi, Haloom; Orlowski, Christian; Georgiadis, George T; Ververis, Katherine; El-Osta, Assam; Karagiannis, Tom C
2011-03-13
The clonogenic (or colony forming) assay has been established for more than 50 years; the original paper describing the technique was published in 1956. Apart from documenting the method, the initial landmark study generated the first radiation-dose response curve for X-ray irradiated mammalian (HeLa) cells in culture. Basically, the clonogenic assay enables an assessment of the differences in reproductive viability (capacity of cells to produce progeny; i.e. a single cell to form a colony of 50 or more cells) between control untreated cells and cells that have undergone various treatments such as exposure to ionising radiation, various chemical compounds (e.g. cytotoxic agents) or in other cases genetic manipulation. The assay has become the most widely accepted technique in radiation biology and has been widely used for evaluating the radiation sensitivity of different cell lines. Further, the clonogenic assay is commonly used for monitoring the efficacy of radiation modifying compounds and for determining the effects of cytotoxic agents and other anti-cancer therapeutics on colony forming ability, in different cell lines. A typical clonogenic survival experiment using adherent cells lines involves three distinct components, 1) treatment of the cell monolayer in tissue culture flasks, 2) preparation of single cell suspensions and plating an appropriate number of cells in petri dishes and 3) fixing and staining colonies following a relevant incubation period, which could range from 1-3 weeks, depending on the cell line. Here we demonstrate the general procedure for performing the clonogenic assay with adherent cell lines with the use of an immortalized human keratinocyte cell line (FEP-1811). Also, our aims are to describe common features of clonogenic assays including calculation of the plating efficiency and survival fractions after exposure of cells to radiation, and to exemplify modification of radiation-response with the use of a natural antioxidant
DEFF Research Database (Denmark)
Hakhverdyan, Mikhayil; Hägglund, Sara; Larsen, Lars Erik
2005-01-01
understanding of the virus. In this study, a BRSV fluorogenic reverse transcription PCR (fRT-PCR) assay, based on TaqMan principle, was developed and evaluated on a large number of clinical samples, representing various cases of natural and experimental BRSV infections. By using a single-step closed-tube format......, the turn-around time was shortened drastically and results were obtained with minimal risk for cross-contamination. According to comparative analyses, the detection limit of the fRT-PCR was on the same level as that of a nested PCR and the sensitivity relatively higher than that of a conventional PCR......, antigen ELISA (Ag-ELISA) and virus isolation (VI). Interspersed negative control samples, samples from healthy animals and eight symptomatically or genetically related viruses were all negative, confirming a high specificity of the assay. Taken together, the data indicated that the fRT-PCR assay can...
Directory of Open Access Journals (Sweden)
Zsolt Czimmerer
Full Text Available Short regulatory RNA-s have been identified as key regulators of gene expression in eukaryotes. They have been involved in the regulation of both physiological and pathological processes such as embryonal development, immunoregulation and cancer. One of their relevant characteristics is their high stability, which makes them excellent candidates for use as biomarkers. Their number is constantly increasing as next generation sequencing methods reveal more and more details of their synthesis. These novel findings aim for new detection methods for the individual short regulatory RNA-s in order to be able to confirm the primary data and characterize newly identified subtypes in different biological conditions. We have developed a flexible method to design RT-qPCR assays that are very sensitive and robust. The newly designed assays were tested extensively in samples from plant, mouse and even human formalin fixed paraffin embedded tissues. Moreover, we have shown that these assays are able to quantify endogenously generated shRNA molecules. The assay design method is freely available for anyone who wishes to use a robust and flexible system for the quantitative analysis of matured regulatory RNA-s.
International Nuclear Information System (INIS)
Ravanshad, M.; Sabahi, F.; Mahboudi, F.; Sabahi, F.
2006-01-01
The Western blot (WB) assay is the most widely accepted confirmatory assay for the detection and confirmation of antibodies to human immunodeficiency virus type 1 (HIV-1) and 2 (HIV-2). However, indeterminate WB reactivity to HIV-1 and HIV-2 proteins may occur in individuals who do not appear to be infected with HIV. In this study, we describe the results of indeterminate WB reactivity in Iranian patients with discordant screening assays. The samples were obtained from Iranian Blood Transfusion Center, Tehran, Iran and evaluated in the Biotechnology Process Development Center, Pasteur Institute of Iran, Tehran, Iran between 2003 and 2004. A total of 4707 were tested for the presence of HIV-1 antibodies. Six hundred and four (12.8%) patients tested for HIV were positive for HIV-1 antibody. Nine (1.49%) have discordant results among screening assays and indeterminate WB results as interpreted by Centers for Disease Control and Prevention (CDC) criteria. Most (66.7%) of these indeterminate WB results were due to p24 reactivity. However, 2(22.2%) display reactivity to both gp41 and gp120 proteins [Positive by World Health Organization (WHO) criteria]. Of 9 WB assays initially indeterminate by the CDC criteria and with follow-up samples 8(88.8%) became negative when retested subsequently while one (11.1%) remained indeterminate for more than a year and were thus considered negative. In addition all the indeterminate samples were negative when assessed by polymerase chain reaction assay. In general, there were was an 88.8% concordance between the CDC and WHO criteria for an indeterminate WB result. The CDC II criteria for an indeterminate WB result. The CDC II criteria best met the specified objectives for diagnosis in our setting. (author)
Multicentre comparison of a diagnostic assay
DEFF Research Database (Denmark)
Waters, Patrick; Reindl, Markus; Saiz, Albert
2016-01-01
) assays in neuromyelitis optica spectrum disorders (NMOSD). METHODS: Coded samples from patients with neuromyelitis optica (NMO) or NMOSD (101) and controls (92) were tested at 15 European diagnostic centres using 21 assays including live (n=3) or fixed cell-based assays (n=10), flow cytometry (n=4...
An ultrafiltration assay for lysyl oxidase
International Nuclear Information System (INIS)
Shackleton, D.R.; Hulmes, D.J.
1990-01-01
A modification of the original microdistillation assay for lysyl oxidase is described in which Amicon C-10 microconcentrators are used to separate, by ultrafiltration, the 3H-labeled products released from a [4,5-3H]-lysine-labeled elastin substrate. Enzyme activity is determined by scintillation counting of the ultrafiltrate, after subtraction of radioactivity released in the presence of beta-aminopropionitrile, a specific inhibitor of the enzyme. Conditions are described which optimize both the sensitivity and the efficient use of substrate. The assay shows linear inhibition of activity in up to 1 M urea; hence, as the enzyme is normally diluted in the assay, samples in 6 M urea can be assayed directly, without prior dialysis, and corrected for partial inhibition. Comparable results are obtained when enzyme activity is assayed by ultrafiltration or microdistillation. The assay is simple and convenient and, by using disposable containers throughout, it eliminates the need for time-consuming decontamination of radioactive glassware
Moon, Jaewoong; Liu, Z Lewis
2015-04-01
The aldehyde reductase gene ARI1 is a recently characterized member of an intermediate subfamily within the short-chain dehydrogenase/reductase (SDR) superfamily that clarified mechanisms of in situ detoxification of 2-furaldehyde and 5-hydroxymethyl-2-furaldehyde by Saccharomyces cerevisiae. Uncharacterized open reading frames (ORFs) are common among tolerant candidate genes identified for lignocellulose-to-advanced biofuels conversion. This study presents partially purified proteins of two ORFs, YDR541C and YGL039W, and direct enzyme assay evidence against aldehyde-inhibitory compounds commonly encountered during lignocellulosic biomass fermentation processes. Each of the partially purified proteins encoded by these ORFs showed a molecular mass of approximately 38 kDa, similar to Ari1p, a protein encoded by aldehyde reductase gene. Both proteins demonstrated strong aldehyde reduction activities toward 14 aldehyde substrates, with high levels of reduction activity for Ydr541cp toward both aromatic and aliphatic aldehydes. While Ydr541cp was observed to have a significantly higher specific enzyme activity at 20 U/mg using co-factor NADPH, Ygl039wp displayed a NADH preference at 25 U/mg in reduction of butylaldehyde. Amino acid sequence analysis identified a characteristic catalytic triad, Ser, Tyr and Lys; a conserved catalytic motif of Tyr-X-X-X-Lys; and a cofactor-binding sequence motif, Gly-X-X-Gly-X-X-Ala, near the N-terminus that are shared by Ydr541cp, Ygl039wp, Yol151wp/GRE2 and Ari1p. Findings of aldehyde reductase genes contribute to the yeast gene annotation and aids development of the next-generation biocatalyst for advanced biofuels production. Copyright © 2015 John Wiley & Sons, Ltd.
Schoppee Bortz, Pamela D.; Wamhoff, Brian R.
2011-01-01
The “quantitative” ChIP, a tool commonly used to study protein-DNA interactions in cells and tissue, is a difficult assay often plagued with technical error. We present, herein, the process required to merge multiple protocols into a quick, reliable and easy method and an approach to accurately quantify ChIP DNA prior to performing PCR. We demonstrate that high intensity sonication for at least 30 min is required for full cellular disruption and maximum DNA recovery because ChIP lysis buffers fail to lyse formaldehyde-fixed cells. In addition, extracting ChIP DNA with chelex-100 yields samples that are too dilute for evaluation of shearing efficiency or quantification via nanospectrophotometry. However, DNA extracted from the Mock-ChIP supernatant via the phenol-chloroform-isoamyl alcohol (PCIA) method can be used to evaluate DNA shearing efficiency and used as the standard in a fluorescence-based microplate assay. This enabled accurate quantification of DNA in chelex-extracted ChIP samples and normalization to total DNA concentration prior to performing real-time PCR (rtPCR). Thus, a quick ChIP assay that can be completed in nine bench hours over two days has been validated along with a rapid, accurate and repeatable way to quantify ChIP DNA. The resulting rtPCR data more accurately depicts treatment effects on protein-DNA interactions of interest. PMID:22046253
False-Positive TDxFLx urine Amphetamine/Metamphetamine II assay from Ofloxacin
International Nuclear Information System (INIS)
Nomier, Mahmoud A.; Al-Huseini, Hani K.
2004-01-01
Immunoassays are widely used in testing urine for illicit drugs. Ofloaxcin and a number of other quinolones were found to induce false-positive opiates (OP) urine immunoassays. This can result in misleading conclusions in the concept of drug abuse The aim of present study was to evaluate the effects of ofloxacin in theraputic doses on the induction of false-positive urine immunoassays for common drugs of abuse in healthy male volunteers. The study was conducted on 6 healthy male volunteers, aging between 35-45 years. Two doses of 400 mg ofloxacin each, were given orally to each volunteer at 12 hours interval and urine samples were collected before ofloaxcin administration and 5-7.5 hours after the second dose. Urine samples were subjected for OP, amphetamine/methamphetamine II (AM/MA II), cocaine and cannabinoids assays on TDxFLx analyzer. Ofloxacin produced significant increase (P cutoff) for AM/MA II assays, were found in all volunteers after ofloaxcin administration. The study recomends strongly the confirmation of positive urine immunoassay results for drugs of abuseby a more specific methodology e.g. gas chromatography/ mass spectroscopy (GC/MS). (author)
Kim, Young Ah; Lee, Eun-Hye; Kim, Kwang-Ok; Lee, Yong Tae; Hammock, Bruce D.; Lee, Hye-Sung
2014-01-01
An immunochromatographic assay (ICA) based on competitive antigen-coated format using colloidal gold as the label was developed for the detection of the organophosphorus insecticide chlorpyrifos. The ICA test strip consisted of a membrane with a detection zone, a sample pad and an absorbent pad. The membrane was separately coated with chlorpyrifos hapten-OVA conjugate (test line) and anti-mouse IgG (control line). Based on the fact that the competition is between the migrating analyte in the sample and the analyte hapten immobilized on the test strip for the binding sites of the antibody-colloidal gold (Ab-CG) conjugate migrating on the test strip, this study suggests that the relative migration speed between the two migrating substances is a critically important factor for the sensitive detection by competitive ICA. This criterion was utilized for the confirmation of appropriateness of a nitrocellulose (NC) membrane for chlorpyrifos ICA. The detection limit of the ICA for chlorpyrifos standard and chlorpyrifos spiked into agricultural samples were 10 and 50 ng mL−1, respectively. The assay time for the ICA test was less than 10 min, suitable for rapid on-site testing of chlorpyrifos. PMID:21504817
Application of the DNA comet assay for detection of irradiated meat
International Nuclear Information System (INIS)
Kruszewski, M.; Iwanenko, T.; Wojewodzka, M.; Malec-Czechowska, K.; Dancewicz, A. M.; Szot, Z.
1998-01-01
Radiation induces damage to the DNA. This damage (fragmentation) can be assessed in the irradiated food using Single Cell Gel Electrophoresis (SCGE), known as DNA comet assay. Fragmentation of DNA may also be caused by improper storage of meat and repeated freezing and thawing. This makes identification of irradiated meat by this assay not reliable enough. In order to know the scale of the processes imitating radiation effects in DNA of the comets, their shape and lengths were examined in both irradiated and unirradiated fresh meat (D = 1.5 or 3.0 kGy) stored at 4 o C or frozen (-21 o ) up to 5 months. Comets formed upon SCGE were stained with DAPI or silver and examined in fluorescent or light microscope. They were divided arbitrarily into 4 classes. Comets of IV class were found quite often in fresh meat stored at 4 o C. In meat samples that were irradiated and stored frozen, comets of class I, II and III were observed. The negative comet test is univocal. Positive comet test, however, needs confirmation. The meat should be subjected to further analysis with other validated methods. (author)
Scrapping of student bursaries confirmed.
Longhurst, Chris
2016-07-27
Student bursaries for nurses will be scrapped from next year, the government has confirmed. Undergraduate nursing and midwifery students in England will now face tuition fees and student loans from August 2017.
Radioreceptor assay for insulin
Energy Technology Data Exchange (ETDEWEB)
Suzuki, Kazuo [Tokyo Univ. (Japan). Faculty of Medicine
1975-04-01
Radioreceptor assay of insulin was discussed from the aspects of the measuring method, its merits and problems to be solved, and its clinical application. Rat liver 10 x g pellet was used as receptor site, and enzymatic degradation of insulin by the system contained in this fraction was inhibited by adding 1 mM p-CMB. /sup 125/I-labelled porcine insulin was made by lactoperoxidase method under overnight incubation at 4/sup 0/C and later purification by Sephadex G-25 column and Whatman CF-11 cellulose powder. Dog pancreatic vein serum insulin during and after the glucose load was determined by radioreceptor assay and radioimmunoassay resulting that both measurements accorded considerably. Radioreceptor assay would clarify the pathology of disorders of glucose metabolism including diabetes.
Fluorescent Receptor Binding Assay for Detecting Ciguatoxins in Fish.
Hardison, D Ransom; Holland, William C; McCall, Jennifer R; Bourdelais, Andrea J; Baden, Daniel G; Darius, H Taiana; Chinain, Mireille; Tester, Patricia A; Shea, Damian; Quintana, Harold A Flores; Morris, James A; Litaker, R Wayne
2016-01-01
Ciguatera fish poisoning is an illness suffered by > 50,000 people yearly after consumption of fish containing ciguatoxins (CTXs). One of the current methodologies to detect ciguatoxins in fish is a radiolabeled receptor binding assay (RBA(R)). However, the license requirements and regulations pertaining to radioisotope utilization can limit the applicability of the RBA(R) in certain labs. A fluorescence based receptor binding assay (RBA(F)) was developed to provide an alternative method of screening fish samples for CTXs in facilities not certified to use radioisotopes. The new assay is based on competition binding between CTXs and fluorescently labeled brevetoxin-2 (BODIPY®-PbTx-2) for voltage-gated sodium channel receptors at site 5 instead of a radiolabeled brevetoxin. Responses were linear in fish tissues spiked from 0.1 to 1.0 ppb with Pacific ciguatoxin-3C (P-CTX-3C) with a detection limit of 0.075 ppb. Carribean ciguatoxins were confirmed in Caribbean fish by LC-MS/MS analysis of the regional biomarker (C-CTX-1). Fish (N = 61) of six different species were screened using the RBA(F). Results for corresponding samples analyzed using the neuroblastoma cell-based assay (CBA-N2a) correlated well (R2 = 0.71) with those of the RBA(F), given the low levels of CTX present in positive fish. Data analyses also showed the resulting toxicity levels of P-CTX-3C equivalents determined by CBA-N2a were consistently lower than the RBA(F) affinities expressed as % binding equivalents, indicating that a given amount of toxin bound to the site 5 receptors translates into corresponding lower cytotoxicity. Consequently, the RBA(F), which takes approximately two hours to perform, provides a generous estimate relative to the widely used CBA-N2a which requires 2.5 days to complete. Other RBA(F) advantages include the long-term (> 5 years) stability of the BODIPY®-PbTx-2 and having similar results as the commonly used RBA(R). The RBA(F) is cost-effective, allows high sample
Fluorescent Receptor Binding Assay for Detecting Ciguatoxins in Fish.
Directory of Open Access Journals (Sweden)
D Ransom Hardison
Full Text Available Ciguatera fish poisoning is an illness suffered by > 50,000 people yearly after consumption of fish containing ciguatoxins (CTXs. One of the current methodologies to detect ciguatoxins in fish is a radiolabeled receptor binding assay (RBA(R. However, the license requirements and regulations pertaining to radioisotope utilization can limit the applicability of the RBA(R in certain labs. A fluorescence based receptor binding assay (RBA(F was developed to provide an alternative method of screening fish samples for CTXs in facilities not certified to use radioisotopes. The new assay is based on competition binding between CTXs and fluorescently labeled brevetoxin-2 (BODIPY®-PbTx-2 for voltage-gated sodium channel receptors at site 5 instead of a radiolabeled brevetoxin. Responses were linear in fish tissues spiked from 0.1 to 1.0 ppb with Pacific ciguatoxin-3C (P-CTX-3C with a detection limit of 0.075 ppb. Carribean ciguatoxins were confirmed in Caribbean fish by LC-MS/MS analysis of the regional biomarker (C-CTX-1. Fish (N = 61 of six different species were screened using the RBA(F. Results for corresponding samples analyzed using the neuroblastoma cell-based assay (CBA-N2a correlated well (R2 = 0.71 with those of the RBA(F, given the low levels of CTX present in positive fish. Data analyses also showed the resulting toxicity levels of P-CTX-3C equivalents determined by CBA-N2a were consistently lower than the RBA(F affinities expressed as % binding equivalents, indicating that a given amount of toxin bound to the site 5 receptors translates into corresponding lower cytotoxicity. Consequently, the RBA(F, which takes approximately two hours to perform, provides a generous estimate relative to the widely used CBA-N2a which requires 2.5 days to complete. Other RBA(F advantages include the long-term (> 5 years stability of the BODIPY®-PbTx-2 and having similar results as the commonly used RBA(R. The RBA(F is cost-effective, allows high sample
LENUS (Irish Health Repository)
Jones, S
2011-01-01
Norovirus is a leading cause of infectious non-bacterial gastroenteritis. The virus is highly contagious and has multiple modes of transmission, presenting a growing challenge to hospital-based healthcare. In this study, a total of 120 stool samples are tested for the presence of norovirus GI and GII by the Roche two-step Lightcycler 2.0 assay incorporating primers and probes produced by TIB Molbiol, and the results are compared with results from the National Virus Reference Laboratory. The Roche\\/TIB Molbiol assay produced 51 positive results and 69 negative results. Discrepancy analysis was performed for six conflicting results using a second real-time polymerase chain reaction (PCR) assay (Roche\\/TIB Molbiol) and this confirmed that four of the five discrepant positive results were true positives. A single discrepant negative result generated by the Roche assay remained negative using the second assay. Sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) were calculated to be 98%, 98.6%, 98.0% and 98.6%, respectively. Melting curve analysis was used to differentiate genogroups I and II and this showed that 92% of strains belonged to genogroup II.
Directory of Open Access Journals (Sweden)
Dawn M Roellig
Full Text Available Cryptosporidium is a common cause of sporadic diarrheal disease and outbreaks in the United States. Increasingly, immunochromatography-based rapid cartridge assays (RCAs are providing community laboratories with a quick cryptosporidiosis diagnostic method. In the current study, the Centers for Disease Control and Prevention (CDC, the Association of Public Health Laboratories (APHL, and four state health departments evaluated RCA-positive samples obtained during routine Cryptosporidium testing. All samples underwent "head to head" re-testing using both RCA and direct fluorescence assay (DFA. Community level results from three sites indicated that 54.4% (166/305 of Meridian ImmunoCard STAT! positives and 87.0% (67/77 of Remel Xpect positives were confirmed by DFA. When samples were retested by RCA at state laboratories and compared with DFA, 83.3% (155/186 of Meridian ImmunoCard STAT! positives and 95.2% (60/63 of Remel Xpect positives were confirmed. The percentage of confirmed community results varied by site: Minnesota, 39.0%; New York, 63.9%; and Wisconsin, 72.1%. The percentage of confirmed community results decreased with patient age; 12.5% of community positive tests could be confirmed by DFA for patients 60 years of age or older. The percentage of confirmed results did not differ significantly by sex, storage temperature, time between sample collection and testing, or season. Findings from this study demonstrate a lower confirmation rate of community RCA positives when compared to RCA positives identified at state laboratories. Elucidating the causes of decreased test performance in order to improve overall community laboratory performance of these tests is critical for understanding the epidemiology of cryptosporidiosis in the United States (US.
Nano-immunosafety: issues in assay validation
International Nuclear Information System (INIS)
Boraschi, Diana; Italiani, Paola; Oostingh, Gertie J; Duschl, Albert; Casals, Eudald; Puntes, Victor F; Nelissen, Inge
2011-01-01
Assessing the safety of engineered nanomaterials for human health must include a thorough evaluation of their effects on the immune system, which is responsible for defending the integrity of our body from damage and disease. An array of robust and representative assays should be set up and validated, which could be predictive of the effects of nanomaterials on immune responses. In a trans-European collaborative work, in vitro assays have been developed to this end. In vitro tests have been preferred for their suitability to standardisation and easier applicability. Adapting classical assays to testing the immunotoxicological effects of nanoparticulate materials has raised a series of issues that needed to be appropriately addressed in order to ensure reliability of results. Besides the exquisitely immunological problem of selecting representative endpoints predictive of the risk of developing disease, assay results turned out to be significantly biased by artefactual interference of the nanomaterials or contaminating agents with the assay protocol. Having addressed such problems, a series of robust and representative assays have been developed that describe the effects of engineered nanoparticles on professional and non-professional human defence cells. Two of such assays are described here, one based on primary human monocytes and the other employing human lung epithelial cells transfected with a reporter gene.
A Mass Spectrometry-Based Predictive Strategy Reveals ADAP1 is Phosphorylated at Tyrosine 364
Energy Technology Data Exchange (ETDEWEB)
Littrell, BobbiJo R [National Renewable Energy Laboratory (NREL), Golden, CO (United States)
2018-04-16
The goal of this work was to identify phosphorylation sites within the amino acid sequence of human ADAP1. Using traditional mass spectrometry-based techniques we were unable to produce interpretable spectra demonstrating modification by phosphorylation. This prompted us to employ a strategy in which phosphorylated peptides were first predicted using peptide mapping followed by targeted MS/MS acquisition. ADAP1 was immunoprecipitated from extracts of HEK293 cells stably-transfected with ADAP1 cDNA. Immunoprecipitated ADAP1 was digested with proteolytic enzymes and analyzed by LC-MS in MS1 mode by high-resolution quadrupole time-of-flight mass spectrometry (QTOF-MS). Peptide molecular features were extracted using an untargeted data mining algorithm. Extracted peptide neutral masses were matched against the ADAP1 amino acid sequence with phosphorylation included as a predicted modification. Peptides with predicted phosphorylation sites were analyzed by targeted LC-MS2. Acquired MS2 spectra were then analyzed using database search engines to confirm phosphorylation. Spectra of phosphorylated peptides were validated by manual interpretation. Further confirmation was performed by manipulating phospho-peptide abundance using calf intestinal phosphatase (CIP) and the phorbol ester, phorbol 12-myristate 13-acetate (PMA). Of five predicted phosphopeptides, one, comprised of the sequence AVDRPMLPQEYAVEAHFK, was confirmed to be phosphorylated on a Tyrosine at position 364. Pre-treatment of cells with PMA prior to immunoprecipitation increased the ratio of phosphorylated to unphosphorylated peptide as determined by area counts of extracted ion chromatograms (EIC). Addition of CIP to immunoprecipitation reactions eliminated the phosphorylated form. A novel phosphorylation site was identified at Tyrosine 364. Phosphorylation at this site is increased by treatment with PMA. PMA promotes membrane translocation and activation of protein kinase C (PKC), indicating that Tyrosine 364
Data transformation methods for multiplexed assays
Tammero, Lance F. Bentley; Dzenitis, John M; Hindson, Benjamin J
2013-07-23
Methods to improve the performance of an array assay are described. A correlation between fluorescence intensity-related parameters and negative control values of the assay is determined. The parameters are then adjusted as a function of the correlation. As a result, sensitivity of the assay is improved without changes in its specificity.
International Nuclear Information System (INIS)
Lin, W.-N.; Luo, S.-F.; Wu, C.-B.; Lin, C.-C.; Yang, C.-M.
2008-01-01
In our previous study, LPS has been shown to induce vascular cell adhesion molecule-1(VCAM-1) expression through MAPKs and NF-κB in human tracheal smooth muscle cells (HTSMCs). In addition to these pathways, the non-receptor tyrosine kinases (Src), EGF receptor (EGFR), and phosphatidylinositol 3-kinase (PI3K) have been shown to be implicated in the expression of several inflammatory target proteins. Here, we reported that LPS-induced up-regulation of VCAM-1 enhanced the adhesion of neutrophils onto HTSMC monolayer, which was inhibited by LY294002 and wortmannin. LPS stimulated phosphorylation of protein tyrosine kinases including Src, PYK2, and EGFR, which were further confirmed using specific anti-phospho-Src, PYK2, or EGFR Ab, respectively, revealed by Western blotting. LPS-stimulated Src, PYK2, EGFR, and Akt phosphorylation and VCAM-1 expression were attenuated by the inhibitors of Src (PP1), EGFR (AG1478), PI3-K (LY294002 and wortmannin), and Akt (SH-5), respectively, or transfection with siRNAs of Src or Akt and shRNA of p110. LPS-induced VCAM-1 expression was also blocked by pretreatment with curcumin (a p300 inhibitor) or transfection with p300 siRNA. LPS-stimulated Akt activation translocated into nucleus and associated with p300 and VCAM-1 promoter region was further confirmed by immunofluorescence, immunoprecipitation, and chromatin immunoprecipitation assays. This association of Akt and p300 to VCAM-1 promoter was inhibited by pretreatment with PP1, AG1478, wortmannin, and SH-5. LPS-induced p300 activation enhanced VCAM-1 promoter activity and VCAM-1 mRNA expression. These results suggested that in HTSMCs, Akt phosphorylation mediated through transactivation of Src/PYK2/EGFR promoted the transcriptional p300 activity and eventually led to VCAM-1 expression induced by LPS
International Nuclear Information System (INIS)
Soares, Carlos R.J.
1995-01-01
An immunoradiometric assay (IRMA) for the determination of multiple antigens was set up in order to quantify E. coli (ECP) in lots of purified recombinant human growth hormone (rec-hGH). SDS-PAGE and Western Blotting techniques were carried out, in parallel, to confirm the results obtained by IRMA and to provide more information about the contaminants. Anti-ECP antibodies were obtained by rabbit immunization with ECP, which were submitted to the same purification process utilized for rec-hGH with the exception of the last step. A strain-process-specific assay was thus set up. The antiserum obtained was purified through an affinity column prepared with the same ECP used for immunization, this provided an highly sensitive assay (0,03 ng ECP/mL). This IRMA was shown to be specific, not presenting any cross reaction with hGH and studies carried out on precision, accuracy and linearity of response with dilution confirmed its validity as one of the fundamental purity tests for rec-hGH produced at IPEN-CNEN/SP, whose principles can be easily extended to the analysis of other similar products. These studies have also shown that the utilization of an affinity column, prepared with the described anti-ECP antiserum was very effective, providing rec-hGH lots with less then 10 parts per million (0,001%) of contaminating proteins. (author). 45 refs., 15 figs., 11 tabs
Garcia, Jean-Michel; Gao, Anhui; He, Pei-Lan; Choi, Joyce; Tang, Wei; Bruzzone, Roberto; Schwartz, Olivier; Naya, Hugo; Nan, Fa-Jun; Li, Jia; Altmeyer, Ralf; Zuo, Jian-Ping
2009-03-01
Two decades after its discovery the human immunodeficiency virus (HIV) is still spreading worldwide and killing millions. There are 25 drugs formally approved for HIV currently on the market, but side effects as well as the emergence of HIV strains showing single or multiple resistances to current drug-therapy are causes for concern. Furthermore, these drugs target only 4 steps of the viral cycle, hence the urgent need for new drugs and also new targets. In order to tackle this problem, we have devised a cell-based assay using lentiviral particles to look for post-entry inhibitors of HIV-1. We report here the assay development, validation as well as confirmation of the hits using both wild-type and drug-resistant HIV-1 viruses. The screening was performed on an original library, rich in natural compounds and pure molecules from Traditional Chinese Medicine pharmacopoeia, which had never been screened for anti-HIV activity. The identified hits belong to four chemical sub-families that appear to be all non-nucleoside reverse transcriptase inhibitors (NNRTIs). Secondary tests with live viruses showed that there was good agreement with pseudotyped particles, confirming the validity of this approach for high-throughput drug screens. This assay will be a useful tool that can be easily adapted to screen for inhibitors of viral entry.
DEFF Research Database (Denmark)
Gobom, J; Kraeuter, K O; Persson, R
2000-01-01
A method was developed for mass spectrometric detection of neurotensin (NT)-like immunoreactivity and quantification of NT in human brain tissue. The method is based on immunoprecipitation followed by analysis using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF......-MS). The identity of the major component of the immunoprecipitates as neurotensin was confirmed by fragment ion analysis on an electrospray ionization quadrupole time-of-flight instrument. MALDI-TOF-MS quantification of NT was achieved using stable-isotope-labeled NT as the internal standard, yielding an error...
Hermanrud, Christina; Ryner, Malin; Luft, Thomas; Jensen, Poul Erik; Ingenhoven, Kathleen; Rat, Dorothea; Deisenhammer, Florian; Sørensen, Per Soelberg; Pallardy, Marc; Sikkema, Dan; Bertotti, Elisa; Kramer, Daniel; Creeke, Paul; Fogdell-Hahn, Anna
2016-03-01
Neutralizing anti-drug antibodies (NAbs) against therapeutic interferon beta (IFNβ) in people with multiple sclerosis (MS) are measured with cell-based bioassays. The aim of this study was to redevelop and validate two luciferase reporter-gene bioassays, LUC and iLite, using a cut-point approach to identify NAb positive samples. Such an approach is favored by the pharmaceutical industry and governmental regulatory agencies as it has a clear statistical basis and overcomes the limitations of the current assays based on the Kawade principle. The work was conducted following the latest assay guidelines. The assays were re-developed and validated as part of the "Anti-Biopharmaceutical Immunization: Prediction and analysis of clinical relevance to minimize the risk" (ABIRISK) consortium and involved a joint collaboration between four academic laboratories and two pharmaceutical companies. The LUC assay was validated at Innsbruck Medical University (LUCIMU) and at Rigshospitalet (LUCRH) Copenhagen, and the iLite assay at Karolinska Institutet, Stockholm. For both assays, the optimal serum sample concentration in relation to sensitivity and recovery was 2.5% (v/v) in assay media. A Shapiro-Wilk test indicated a normal distribution for the majority of runs, allowing a parametric approach for cut-point calculation to be used, where NAb positive samples could be identified with 95% confidence. An analysis of means and variances indicated that a floating cut-point should be used for all assays. The assays demonstrated acceptable sensitivity for being cell-based assays, with a confirmed limit of detection in neat serum of 1519 ng/mL for LUCIMU, 814 ng/mL for LUCRH, and 320 ng/mL for iLite. Use of the validated cut-point assay, in comparison with the previously used Kawade method, identified 14% more NAb positive samples. In conclusion, implementation of the cut-point design resulted in increased sensitivity to detect NAbs. However, the clinical significance of these low
Spectrophotometric Enzyme Assays for High-Throughput Screening
Directory of Open Access Journals (Sweden)
Jean-Louis Reymond
2004-01-01
Full Text Available This paper reviews high-throughput screening enzyme assays developed in our laboratory over the last ten years. These enzyme assays were initially developed for the purpose of discovering catalytic antibodies by screening cell culture supernatants, but have proved generally useful for testing enzyme activities. Examples include TLC-based screening using acridone-labeled substrates, fluorogenic assays based on the β-elimination of umbelliferone or nitrophenol, and indirect assays such as the back-titration method with adrenaline and the copper-calcein fluorescence assay for aminoacids.
Radioenzymatic assay of DOPA (3,4-dihydroxyphenylalanine)
International Nuclear Information System (INIS)
Johnson, G.A.; Gren, J.M.; Kupiecki, R.
1978-01-01
We modified the single-isotope radioenzymatic assay for catecholamines [Life Sci. 21, 625(1977)] to assay 3,4-dihydroxyphenylalanine (DOPA). DOPA decarboxylase is used to convert DOPA to dopamine, which concurrently is converted to [ 3 H]-3-O-methyldopamine in the presence of catechol-O-methyltransferase and [methyl- 3 H]-S-adenosylmethionine and assayed radioenzymatically. For assay of plasma DOPA, 50 μl of untreated plasma is added directly into the incubation mixture. A duplicate mixture containing an internal standard requires a second 50-μl aliquot of plasma. Because the assay measures both DOPA and endogenous dopamine, two additional aliquots of plasma must be assayed for dopamine in the absence of the decarboxylase by the differential assay; DOPA is estimated by difference. The assay is sensitive to 25 pg (500 ng/liter of plasma). Analysis of DOPA (DOPA plus dopamine) and the concurrent differential assay of catecholamines in at least 10 samples can be done in a single working day. Plasma DOPA concentrations for 42 normotensive adults were 1430 +- 19 ng/liter (mean +- SEM). In contrast, dopamine concentrations for these same subjects averaged 23 +- 20 ng/liter. Values for the 24 women subjects (1510 +- 62 ng/liter) significantly (P = 0.04) exceeded those for the men
RAS - Screens & Assays - Drug Discovery
The RAS Drug Discovery group aims to develop assays that will reveal aspects of RAS biology upon which cancer cells depend. Successful assay formats are made available for high-throughput screening programs to yield potentially effective drug compounds.
The fluorometric microculture cytotoxicity assay.
Lindhagen, Elin; Nygren, Peter; Larsson, Rolf
2008-01-01
The fluorometric microculture cytotoxicity assay (FMCA) is a nonclonogenic microplate-based cell viability assay used for measurement of the cytotoxic and/or cytostatic effect of different compounds in vitro. The assay is based on hydrolysis of the probe, fluorescein diacetate (FDA) by esterases in cells with intact plasma membranes. The assay is available as both a semiautomated 96-well plate setup and a 384-well plate version fully adaptable to robotics. Experimental plates are prepared with a small amount of drug solution and can be stored frozen. Cells are seeded on the plates and cell viability is evaluated after 72 h. The protocol described here is applicable both for cell lines and freshly prepared tumor cells from patients and is suitable both for screening in drug development and as a basis for a predictive test for individualization of anticancer drug therapy.
Solution assay instrument operations manual
International Nuclear Information System (INIS)
Li, T.K.; Marks, T.; Parker, J.L.
1983-09-01
An at-line solution assay instrument (SAI) has been developed and installed in a plutonium purification and americium recovery process area in the Los Alamos Plutonium Processing Facility. The instrument was designed for accurate, timely, and simultaneous nondestructive analysis of plutonium and americium in process solutions that have a wide range of concentrations and americium/plutonium ratios and for routine operation by process technicians who lack instrumentation background. The SAI, based on transmission-corrected, high-resolution gamma-ray spectroscopy, has two measurement stations attached to a single multichannel analyzer/computer system. To ensure the quality of assay results, the SAI has an internal measurement control program, which requires daily and weekly check runs and monitors key aspects of all assay runs. For a 25-ml sample, the assay precision is 5 g/l within a 2000-s count time
Making transuranic assay measurements using modern controllers
International Nuclear Information System (INIS)
Kuckertz, T.H.; Caldwell, J.T.; Medvick, P.A.; Kunz, W.E.; Hastings, R.D.
1987-01-01
This paper describes methodology and computer-controlled instrumentation developed at the Los Alamos National Laboratory that accurately performs nondestructive assays of large containers bearing transuranic wastes and nonradioactive matrix materials. These assay systems can measure fissile isotopes with 1-mg sensitivity and spontaneous neutron-emitting isotopes at a 10-mg sensitivity. The assays are performed by neutron interrogation, detection, and counting in a custom assay chamber. An International Business Machines Personal Computer (IBM-PC) is used to control the CAMAC-based instrumentation system that acquires the assay data. 6 refs., 7 figs
Time-resolved immunofluorometric assay of serum ferritin
Energy Technology Data Exchange (ETDEWEB)
Yan, Yao [China Inst. of Atomic Energy, Beijing (China)
2007-06-15
This assay is a solid phase, two-site fluoroimmunometric assay based on the direct sandwish technique. Standards or samples containing ferritin are first reacted with immobilized anti-ferritin antibodies. Then the europium-lablled antibodies are reacted with the bound antigen. The range of this assay is 2-1000 ng/mL. The analytical sentivity is better than 0.05 ng/mL. The intra-assay variation and inter-assay variation are both below 5%; This kit was compared with Wallac DELFIA kit. The correlation is r=0.96. (authors)
Selective enrichment of volatiles confirmed
de Pater, Imke
2018-05-01
Hydrogen sulfide gas is detected above Uranus's main cloud deck, confirming the prevalence of H2S ice particles as the main cloud component and a strongly unbalanced nitrogen/sulfur ratio in the planet's deep atmosphere.
International Nuclear Information System (INIS)
Hart, H.
1980-01-01
In a method of immunological assay two different classes of particles which interact at short distances to produce characteristic detectable signals are employed in a modification of the usual latex fixation test. In one embodiment an aqueous suspension of antigen coated tritiated latex particles (LH) and antigen coated polystyrene scintillant particles (L*) is employed to assay antibody in the aqueous medium. The amount of (LH) (L*) dimer formation and higher order aggregation induced and therefore the concentration of antibody (or antigen) present which caused the aggregation can be determined by using standard liquid scintillation counting equipment. (author)
Ku, Y R; Chang, Y S; Wen, K C; Ho, L K
1999-07-02
Six synthetic anorexics, clobenzorex, diethylpropion, fenfluramine, methamphetamine, phenylpropanolamine and phentermine, which can be found as adulterants in traditional Chinese medicines were assayed simultaneously by high-performance capillary electrophoresis. The electrolyte was a buffer solution containing 120 mM phosphate buffer (NaH2PO4/H3PO4, pH 2.0) and 15% acetonitrile. Applied voltage was 16 kV and temperature was 30 degrees C. Fluoren-2,7-diammonium chloride was used as an internal standard and detector set at 200 nm. The recoveries of the synthetic anorexic adulterants in traditional Chinese medicinal formula using C8-SCX mixed solid-phase extraction were studied. Several traditional Chinese medicinal powders obtained from clinics were also studied by the above HPCE method and confirmed by GC-MS. Clobenzorex, diethylpropion and fenfluramine were found and determine in these samples.
Zhao, Liang; Sun, Hongwei; Kong, Hongru; Chen, Zongjing; Chen, Bicheng; Zhou, Mengtao
2017-01-01
Pancreatic carcinoma (PC) is the one of the most common and malignant cancers worldwide. LncRNA taurine upregulated gene 1 (TUG1) was initially identified as a transcript upregulated by taurine, and the abnormal expression of TUG1 has been reported in many cancers. However, the biological role and molecular mechanism of TUG1 in PC still needs further investigation. Quantitative real-time PCR (qRT-PCR) was performed to measure the expression of TUG1 in PC cell lines and tissues. MTT and colony formation assays were used to measure the effect of TUG1 on cell proliferation. A wound healing assay, transwell assay and western blot assay were employed to determine the effect of TUG1 on cell migration and the epithelial mesenchymal transition (EMT) phenotype. RNA-binding protein immunoprecipitation (RIP) and a biotin-avidin pulldown system were performed to confirm the interaction between miR-328 and TUG1. A gene expression array analysis using clinical samples and RT-qPCR suggested that enhancer of zeste homolog 2 (EZH2) was a target of miR-382 in PC. In this study, we reported that TUG1 was overexpressed in PC tissues and cell lines, and high expression of TUG1 predicted poor prognosis. Further experiments revealed that overexpressed TUG1 promoted cell proliferation, migration and contributed to EMT formation, whereas silenced TUG1 led to opposing results. Additionally, luciferase reporter assays, an RIP assay and an RNA-pulldown assay demonstrated that TUG1 could competitively sponge miR-382 and thereby regulate EZH2. Collectively, these findings revealed that TUG1 functions as an oncogenic lncRNA that promotes tumor progression, at least partially, by functioning as an endogenous 'sponge' and competing for miR-382 binding to the miRNA target EZH2. © 2017 The Author(s). Published by S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
Liang Zhao
2017-08-01
Full Text Available Background/Aims: Pancreatic carcinoma (PC is the one of the most common and malignant cancers worldwide. LncRNA taurine upregulated gene 1 (TUG1 was initially identified as a transcript upregulated by taurine, and the abnormal expression of TUG1 has been reported in many cancers. However, the biological role and molecular mechanism of TUG1 in PC still needs further investigation. Methods: Quantitative real-time PCR (qRT-PCR was performed to measure the expression of TUG1 in PC cell lines and tissues. MTT and colony formation assays were used to measure the effect of TUG1 on cell proliferation. A wound healing assay, transwell assay and western blot assay were employed to determine the effect of TUG1 on cell migration and the epithelial mesenchymal transition (EMT phenotype. RNA-binding protein immunoprecipitation (RIP and a biotin-avidin pulldown system were performed to confirm the interaction between miR-328 and TUG1. A gene expression array analysis using clinical samples and RT-qPCR suggested that enhancer of zeste homolog 2 (EZH2 was a target of miR-382 in PC. Results: In this study, we reported that TUG1 was overexpressed in PC tissues and cell lines, and high expression of TUG1 predicted poor prognosis. Further experiments revealed that overexpressed TUG1 promoted cell proliferation, migration and contributed to EMT formation, whereas silenced TUG1 led to opposing results. Additionally, luciferase reporter assays, an RIP assay and an RNA-pulldown assay demonstrated that TUG1 could competitively sponge miR-382 and thereby regulate EZH2. Conclusion: Collectively, these findings revealed that TUG1 functions as an oncogenic lncRNA that promotes tumor progression, at least partially, by functioning as an endogenous ‘sponge’ and competing for miR-382 binding to the miRNA target EZH2.
Chisti, Mohammod Jobayer; Graham, Stephen M.; Duke, Trevor; Ahmed, Tahmeed; Ashraf, Hasan; Faruque, Abu Syed Golam; La Vincente, Sophie; Banu, Sayera; Raqib, Rubhana; Salam, Mohammed Abdus
2014-01-01
Background Severe malnutrition is a risk factor for pneumonia due to a wide range of pathogens but aetiological data are limited and the role of Mycobacterium tuberculosis is uncertain. Methods We prospectively investigated severely malnourished young children (<5 years) with radiological pneumonia admitted over a 15-month period. Investigations included blood culture, sputa for microscopy and mycobacterial culture. Xpert MTB/RIF assay was introduced during the study. Study children were followed for 12 weeks following their discharge from the hospital. Results 405 eligible children were enrolled, with a median age of 10 months. Bacterial pathogens were isolated from blood culture in 18 (4.4%) children, of which 72% were Gram negatives. Tuberculosis was confirmed microbiologically in 7% (27/396) of children that provided sputum - 10 by culture, 21 by Xpert MTB/RIF assay, and 4 by both tests. The diagnostic yield from induced sputum was 6% compared to 3.5% from gastric aspirate. Sixty (16%) additional children had tuberculosis diagnosed clinically that was not microbiologically confirmed. Most confirmed tuberculosis cases did not have a positive contact history or positive tuberculin test. The sensitivity and specificity of Xpert MTB/RIF assay compared to culture was 67% (95% CI: 24–94) and 92% (95% CI: 87–95) respectively. Overall case-fatality rate was 17% and half of the deaths occurred in home following discharge from the hospital. Conclusion and Significance TB was common in severely malnourished Bangladeshi children with pneumonia. X-pert MTB/RIF assay provided higher case detection rate compared to sputum microscopy and culture. The high mortality among the study children underscores the need for further research aimed at improved case detection and management for better outcomes. PMID:24695758
International Nuclear Information System (INIS)
Hsia, Chu Chieh; Chizhikov, Vladimir E.; Yang, Amy X.; Selvapandiyan, Angamuthu; Hewlett, Indira; Duncan, Robert; Puri, Raj K.; Nakhasi, Hira L.; Kaplan, Gerardo G.
2007-01-01
Hepatitis B virus (HBV), hepatitis C virus (HCV), and human immunodeficiency virus type-1 (HIV-1) are transfusion-transmitted human pathogens that have a major impact on blood safety and public health worldwide. We developed a microarray multiplex assay for the simultaneous detection and discrimination of these three viruses. The microarray consists of 16 oligonucleotide probes, immobilized on a silylated glass slide. Amplicons from multiplex PCR were labeled with Cy-5 and hybridized to the microarray. The assay detected 1 International Unit (IU), 10 IU, 20 IU of HBV, HCV, and HIV-1, respectively, in a single multiplex reaction. The assay also detected and discriminated the presence of two or three of these viruses in a single sample. Our data represent a proof-of-concept for the possible use of highly sensitive multiplex microarray assay to screen and confirm the presence of these viruses in blood donors and patients
Energy Technology Data Exchange (ETDEWEB)
Vrijsen, R.; Rombaut, B.; Boeye, A. (Brussels Univ. (Belgium))
1983-04-29
Staphylococcus aureus (Cowan strain I) was used to absorb immune complexes from antiserum to poliovirus to which labeled N or H poliovirus antigens had been added, and the radioactivity in the pelleted organisms and in the supernatant was measured. Excellent agreement was obtained between values calculated separately from the pellet and supernatant readings, validating the use of supernatant measurements from a microtitration plate method.
Assessing sediment contamination using six toxicity assays
Directory of Open Access Journals (Sweden)
Allen G. BURTON Jr.
2001-08-01
Full Text Available An evaluation of sediment toxicity at Lake Orta, Italy was conducted to compare a toxicity test battery of 6 assays and to evaluate the extent of sediment contamination at various sediment depths. Lake Orta received excessive loadings of copper and ammonia during the 1900’s until a large remediation effort was conducted in 1989-90 using lime addition. Since that time, the lake has shown signs of a steady recovery of biological communities. The study results showed acute toxicity still exists in sediments at a depth of 5 cm and greater. Assays that detected the highest levels of toxicity were two whole sediment exposures (7 d using Hyalella azteca and Ceriodaphnia dubia. The MicrotoxR assay using pore water was the third most sensitive assay. The Thamnotox, Rototox, Microtox solid phase, and Seed Germination-Root Elongation (pore and solid phase assays showed occasional to no toxicity. Based on similarity of responses and assay sensitivity, the two most useful assays were the C. dubia (or H. azteca and Microtox pore water. These assays were effective at describing sediment toxicity in a weight-of-evidence approach.
Nuclear γ-tubulin associates with nucleoli and interacts with tumor suppressor protein C53.
Hořejší, Barbora; Vinopal, Stanislav; Sládková, Vladimíra; Dráberová, Eduarda; Sulimenko, Vadym; Sulimenko, Tetyana; Vosecká, Věra; Philimonenko, Anatoly; Hozák, Pavel; Katsetos, Christos D; Dráber, Pavel
2012-01-01
γ-Tubulin is assumed to be a typical cytosolic protein necessary for nucleation of microtubules from microtubule organizing centers. Using immunolocalization and cell fractionation techniques in combination with siRNAi and expression of FLAG-tagged constructs, we have obtained evidence that γ-tubulin is also present in nucleoli of mammalian interphase cells of diverse cellular origins. Immunoelectron microscopy has revealed γ-tubulin localization outside fibrillar centers where transcription of ribosomal DNA takes place. γ-Tubulin was associated with nucleolar remnants after nuclear envelope breakdown and could be translocated to nucleoli during mitosis. Pretreatment of cells with leptomycin B did not affect the distribution of nuclear γ-tubulin, making it unlikely that rapid active transport via nuclear pores participates in the transport of γ-tubulin into the nucleus. This finding was confirmed by heterokaryon assay and time-lapse imaging of photoconvertible protein Dendra2 tagged to γ-tubulin. Immunoprecipitation from nuclear extracts combined with mass spectrometry revealed an association of γ-tubulin with tumor suppressor protein C53 located at multiple subcellular compartments including nucleoli. The notion of an interaction between γ-tubulin and C53 was corroborated by pull-down and co-immunoprecipitation experiments. Overexpression of γ-tubulin antagonized the inhibitory effect of C53 on DNA damage G(2) /M checkpoint activation. The combined results indicate that aside from its known role in microtubule nucleation, γ-tubulin may also have nuclear-specific function(s). Copyright © 2011 Wiley Periodicals, Inc.
STAT3-Activated GM-CSFRα Translocates to the Nucleus and Protects CLL Cells from Apoptosis
Li, Ping; Harris, David; Liu, Zhiming; Rozovski, Uri; Ferrajoli, Alessandra; Wang, Yongtao; Bueso-Ramos, Carlos; Hazan-Halevy, Inbal; Grgurevic, Srdana; Wierda, William; Burger, Jan; O'Brien, Susan; Faderl, Stefan; Keating, Michael; Estrov, Zeev
2014-01-01
Here it was determined that Chronic Lymphocytic Leukemia (CLL) cells express the α-subunit but not the β-subunit of the granulocyte-macrophage colony-stimulating factor receptor (GM-CSFR/CSF3R). GM-CSFRα was detected on the surface, in the cytosol, and the nucleus of CLL cells via confocal microscopy, cell fractionation, and GM-CSFRα antibody epitope mapping. Because STAT3 is frequently activated in CLL and the GM-CSFRα promoter harbors putative STAT3 consensus binding sites, MM1 cells were transfected with truncated forms of the GM-CSFRα promoter, then stimulated with IL-6 to activate STAT3 to identify STAT3 binding sites. Chromatin immunoprecipitation (ChIP) and an electoromobility shift assay (EMSA) confirmed STAT3 occupancy to those promoter regions in both IL-6 stimulated MM1 and CLL cells. Transfection of MM1 cells with STAT3 siRNA or CLL cells with STAT3 shRNA significantly down-regulated GM-CSFRα mRNA and protein levels. RNA transcripts, involved in regulating cell-survival pathways, and the proteins KAP1 (TRIM28) and ISG15 co-immunoprecipitated with GM-CSFRα. GM-CSFRα-bound KAP1 enhanced the transcriptional activity of STAT3, whereas ISG15 inhibited the NF-κB pathway. Nevertheless, overexpression of GM-CSFRα protected MM1 cells from dexamethasone-induced apoptosis, and GM-CSFRα knockdown induced apoptosis in CLL cells, suggesting that GM-CSFRα provides a ligand-independent survival advantage. PMID:24836891
Chen, Qixia; An, Jingna; Rao, Chenli; Wang, Tingting; Li, Dongdong; Feng, Shu; Tao, Chuanmin
2016-01-01
Syphilis is a major concern to global public health with increasing incidence. So its screening test should have sufficient sensitivity and specificity. We evaluated the performance of the Lumipulse G TP-N assay detection for syphilis screening and compared it with the InTec ELISA test kit for TP, which is widely used. Samples of several patient groups including 133 clinical and serologically characterized syphilitic sera, 175 samples containing potentially interfering agents, and 2290 unselected samples submitted for routine screening were detected by both the Lumipulse G TP-N assay and the InTec ELISA test kit for TP. Inconsistent samples were confirmed by RecomLine Treponema IgG, IgM immunoblot. Coefficient of variations of the Lumipulseo G TP-N assay at both levels were below 5% and of the InTec ELISA test kit for TP both over 5%. The sensitivity of the Lumipulse G TP-N assay and the InTec ELISA test kit for TP were 100% for all stages of syphilis. The two methods had consistent analytical specificity of 100% (95% CI: 97.21 - 100.00), while the clinical specificity was 100% (95% CI: 99.79 - 100.00) and 99.82% (95% CI: 99.51 - 99.94), respectively. Between them, Spearman's correlation coefficient was 0.455 and kappa value was 0.986. The overall sensitivity and specificity of the Lumipulse G TP-N assay was higher than the InTec ELISA test kit for TP (sensitivity: 100.0 versus 99.5, specificity: 100.0 versus 99.8). The automated Lumipulse G TP-N assay demonstrated excellent diagnostic sensitivity and specificity when evaluated as a screening test for syphilis. Thus, it can be an alternative to the treponemal screening test.
Morton, C Oliver; White, P Lewis; Barnes, Rosemary A; Klingspor, Lena; Cuenca-Estrella, Manuel; Lagrou, Katrien; Bretagne, Stéphane; Melchers, Willem; Mengoli, Carlo; Caliendo, Angela M; Cogliati, Massimo; Debets-Ossenkopp, Yvette; Gorton, Rebecca; Hagen, Ferry; Halliday, Catriona; Hamal, Petr; Harvey-Wood, Kathleen; Jaton, Katia; Johnson, Gemma; Kidd, Sarah; Lengerova, Martina; Lass-Florl, Cornelia; Linton, Chris; Millon, Laurence; Morrissey, C Orla; Paholcsek, Melinda; Talento, Alida Fe; Ruhnke, Markus; Willinger, Birgit; Donnelly, J Peter; Loeffler, Juergen
2017-06-01
A wide array of PCR tests has been developed to aid the diagnosis of invasive aspergillosis (IA), providing technical diversity but limiting standardisation and acceptance. Methodological recommendations for testing blood samples using PCR exist, based on achieving optimal assay sensitivity to help exclude IA. Conversely, when testing more invasive samples (BAL, biopsy, CSF) emphasis is placed on confirming disease, so analytical specificity is paramount. This multicenter study examined the analytical specificity of PCR methods for detecting IA by blind testing a panel of DNA extracted from a various fungal species to explore the range of Aspergillus species that could be detected, but also potential cross reactivity with other fungal species. Positivity rates were calculated and regression analysis was performed to determine any associations between technical specifications and performance. The accuracy of Aspergillus genus specific assays was 71.8%, significantly greater (P Aspergillus species (47.2%). For genus specific assays the most often missed species were A. lentulus (25.0%), A. versicolor (24.1%), A. terreus (16.1%), A. flavus (15.2%), A. niger (13.4%), and A. fumigatus (6.2%). There was a significant positive association between accuracy and using an Aspergillus genus PCR assay targeting the rRNA genes (P = .0011). Conversely, there was a significant association between rRNA PCR targets and false positivity (P = .0032). To conclude current Aspergillus PCR assays are better suited for detecting A. fumigatus, with inferior detection of most other Aspergillus species. The use of an Aspergillus genus specific PCR assay targeting the rRNA genes is preferential. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Clinical utility of the cryptococcal antigen lateral flow assay in a diagnostic mycology laboratory.
Directory of Open Access Journals (Sweden)
Brendan J McMullan
Full Text Available BACKGROUND: Cryptococcus neoformans causes life-threatening meningitis. A recently introduced lateral flow immunoassay (LFA to detect cryptococcal antigen (CRAG is reportedly more rapid and convenient than standard latex agglutination (LA, but has not yet been evaluated in a diagnostic laboratory setting. METHODS: One hundred and six serum, 42 cerebrospinal fluid (CSF, and 20 urine samples from 92 patients with known or suspected cryptococcosis were tested by LA and LFA, and titres were compared. Results were correlated with laboratory-confirmed cryptococcosis. Serial samples were tested in nine treated patients. RESULTS: Twenty-five of 92 patients had confirmed cryptococcosis; all sera (n = 56 from these patients were positive by LFA (sensitivity 100%, 95% confidence interval (CI 93.6-100% compared with 51/56 positive by LA (sensitivity 91.1%, 95% CI 80.7-96.1%. Fifty sera from 67 patients without cryptococcosis tested negative in both assays. While LA yielded more false negative results (5/56 this did not reach statistical significance (p = 0.063. Nine CSF samples from patients with cryptococcal meningitis yielded positive results using both assays while 17/18 urine samples from patients with cryptococcosis were positive by the LFA. The LFA detected CRAG in C. gattii infection (n = 4 patients. Agreement between titres obtained by both methods (n = 38 samples was imperfect; correlation between log-transformed titres (r was 0.84. Turn-around-time was 20 minutes for the LFA and 2 h for LA. The cost per qualitative sample was 18USD and 91 USD, respectively and per quantitative sample was 38USD and 144USD, respectively. CONCLUSIONS: Qualitative agreement between the LFA and LA assays performed on serum and CSF was good but agreement between titres was imperfect. Ease of performance of the LFA and the capacity for testing urine suggest it has a role in the routine laboratory as a rapid diagnostic test or point-of-care test.
Computational prediction and molecular confirmation of Helitron transposons in the maize genome
Directory of Open Access Journals (Sweden)
He Limei
2008-01-01
Full Text Available Abstract Background Helitrons represent a new class of transposable elements recently uncovered in plants and animals. One remarkable feature of Helitrons is their ability to capture gene sequences, which makes them of considerable potential evolutionary importance. However, because Helitrons lack the typical structural features of other DNA transposable elements, identifying them is a challenge. Currently, most researchers identify Helitrons manually by comparing sequences. With the maize whole genome sequencing project underway, an automated computational Helitron searching tool is needed. The characterization of Helitron activities in maize needs to be addressed in order to better understand the impact of Helitrons on the organization of the genome. Results We developed and implemented a heuristic searching algorithm in PERL for identifying Helitrons. Our HelitronFinder program will (i take FASTA-formatted DNA sequences as input and identify the hairpin looping patterns, and (ii exploit the consensus 5' and 3' end sequences of known Helitrons to identify putative ends. We randomly selected five predicted Helitrons from the program's high quality output for molecular verification. Four out of the five predicted Helitrons were confirmed by PCR assays and DNA sequencing in different maize inbred lines. The HelitronFinder program identified two head-to-head dissimilar Helitrons in a maize BAC sequence. Conclusion We have identified 140 new Helitron candidates in maize with our computational tool HelitronFinder by searching maize DNA sequences currently available in GenBank. Four out of five candidates were confirmed to be real by empirical methods, thus validating the predictions of HelitronFinder. Additional points to emerge from our study are that Helitrons do not always insert at an AT dinucleotide in the host sequences, that they can insert immediately adjacent to an existing Helitron, and that their movement may cause changes in the flanking
Wang, F; Samudio, I; Safe, S
2001-01-01
The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.
Godwin, Rosamond M; Morgan, Jess A T
2014-02-01
Coccidiosis is a costly worldwide enteric disease of chickens caused by parasites of the genus Eimeria. At present, there are seven described species that occur globally and a further three undescribed, operational taxonomic units (OTUs X, Y, and Z) that are known to infect chickens from Australia. Species of Eimeria have both overlapping morphology and pathology and frequently occur as mixed-species infections. This makes definitive diagnosis with currently available tests difficult and, to date, there is no test for the detection of the three OTUs. This paper describes the development of a PCR-based assay that is capable of detecting all ten species of Eimeria, including OTUs X, Y, and Z in field samples. The assay is based on a single set of generic primers that amplifies a single diagnostic fragment from the mitochondrial genome of each species. This one-tube assay is simple, low-cost, and has the capacity to be high throughput. It will therefore be of great benefit to the poultry industry for Eimeria detection and control, and the confirmation of identity and purity of vaccine strains. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Jessica L. Kevill
2017-10-01
Full Text Available Deformed wing virus (DWV is one of the most prevalent honey bee viral pathogens in the world. Typical of many RNA viruses, DWV is a quasi-species, which is comprised of a large number of different variants, currently consisting of three master variants: Type A, B, and C. Little is known about the impact of each variant or combinations of variants upon the biology of individual hosts. Therefore, we have developed a new set of master variant-specific DWV primers and a set of standards that allow for the quantification of each of the master variants. Competitive reverse transcriptase polymerase chain reaction (RT-PCR experimental design confirms that each new DWV primer set is specific to the retrospective master variant. The sensitivity of the ABC assay is dependent on whether DNA or RNA is used as the template and whether other master variants are present in the sample. Comparison of the overall proportions of each master variant within a sample of known diversity, as confirmed by next-generation sequence (NGS data, validates the efficiency of the ABC assay. The ABC assay was used on archived material from a Devon overwintering colony loss (OCL 2006–2007 study; further implicating DWV type A and, for the first time, possibly C in the untimely collapse of honey bee colonies. Moreover, in this study DWV type B was not associated with OCL. The use of the ABC assay will allow researchers to quickly and cost effectively pre-screen for the presence of DWV master variants in honey bees.
Screening and identification of host factors interacting with UL14 of herpes simplex virus 1.
Wu, Fuqing; Xing, Junji; Wang, Shuai; Li, Meili; Zheng, Chunfu
2011-08-01
The UL14 protein of herpes simplex virus type 1 (HSV-1) is highly conserved in herpesvirus family. However, its exact function during the HSV-1 replication cycle is little known. In the present study, a high throughput yeast two-hybrid system was employed to screen the cellular factors interacting with UL14, and five target candidates were yielded: (1) TSC22 domain family protein 3 (TSC22D3); (2) Mediator of RNA polymerase II transcription subunit 8 isoform 1(MED8); (3) Runt-related transcription factor 3 (RUNX3); (4) Arrestin beta-2 (ARRB2); (5) Cereblon (CRBN). Indirect immunofluorescent assay showed that both TSC22D3 and MED8 co-localized with UL14. Co-immunoprecipitation assay demonstrated that UL14 could be immunoprecipitated by TSC22D3, suggesting that UL14 interacted with TSC22D3 under physiological condition. In summary, this study opened up new avenues toward delineating the function and physiological significance of UL14 during the HSV-1 replication cycle.
Pinon, J M; Thoannes, H; Gruson, N
1985-02-28
Enzyme-linked immuno-filtration assay is carried out on a micropore membrane. This doubly analytical technique permits simultaneous study of antibody specificity by immunoprecipitation and characterisation of antibody isotypes by immuno-filtration with enzyme-labelled antibodies. Recognition of the same T. gondii antigenic constituent by IgG, IgA, IgM or IgE antibodies produces couplets (IgG-IgM; IgG-IgA) or triplets (IgG-IgM-IgA; IgG-IgM-IgE) which identify the functional fractions of the toxoplasmosis antigen. In acquired toxoplasmosis, the persistence of IgM antibody long after infestation puts in question the implication of recent infestation normally linked to detection of this isotype. For sera of comparable titres, comparison of immunological profiles by the method described demonstrates disparities in the composition of the specific antibody content as expressed in international units. Use of the same method to detect IgM antibodies or distinguish between transmitted maternal IgG and IgG antibodies synthesised by the foetus or neonate makes a diagnosis of congenital toxoplasmosis possible in 85% of cases during the first few days of life. With the method described the diagnosis may be made on average 5 months earlier than with classical techniques. In the course of surveillance for latent congenital toxoplasmosis, the appearance of IgM or IgE antibodies raises the possibility of complications (hydrocephalus, chorioretinitis). After cessation of treatment, a rise in IgG antibodies indicating persistence of infection is detected earlier by the present than by classical methods.
Consumer satisfaction and confirmation of habits of comprehension
DEFF Research Database (Denmark)
Sørensen, Bent; Andersen, Christian; Andersen, Morten Purup
2014-01-01
the formation of consumer satisfaction; the perspective is that of the confirmation paradigm within advertisement research. Inductive advertisements support cognitive habit formation through confirmation, and the confirmation paradigm explains exactly consumer satisfaction with reference to confirmation. Hence......The purpose of this article is twofold: First, within a Peircean framework it shall be demonstrated how there is a relation between the compositional structure of certain types of print advertisements and their bringing about inductive comprehension, and how the consumer can be understood...... as a bundle of habits. It is the assumption that advertising that supports an inductive effect particularly appeals to the cognitive tendency of habit formation in the consumer. Second, it is asked whether advertisements that predominantly invite inductive processes of comprehension also influence...
Chen, Xun; Stout, Steven; Mueller, Uwe; Boykow, George; Visconti, Richard; Siliphaivanh, Phieng; Spencer, Kerrie; Presland, Jeremy; Kavana, Michael; Basso, Andrea D; McLaren, David G; Myers, Robert W
2017-08-01
We have developed and validated label-free, liquid chromatography-mass spectrometry (LC-MS)-based equilibrium direct and competition binding assays to quantitate small-molecule antagonist binding to recombinant human and mouse BLT1 receptors expressed in HEK 293 cell membranes. Procedurally, these binding assays involve (1) equilibration of the BLT1 receptor and probe ligand, with or without a competitor; (2) vacuum filtration through cationic glass fiber filters to separate receptor-bound from free probe ligand; and (3) LC-MS analysis in selected reaction monitoring mode for bound probe ligand quantitation. Two novel, optimized probe ligands, compounds 1 and 2, were identified by screening 20 unlabeled BLT1 antagonists for direct binding. Saturation direct binding studies confirmed the high affinity, and dissociation studies established the rapid binding kinetics of probe ligands 1 and 2. Competition binding assays were established using both probe ligands, and the affinities of structurally diverse BLT1 antagonists were measured. Both binding assay formats can be executed with high specificity and sensitivity and moderate throughput (96-well plate format) using these approaches. This highly versatile, label-free method for studying ligand binding to membrane-associated receptors should find broad application as an alternative to traditional methods using labeled ligands.
Directory of Open Access Journals (Sweden)
Kok Siong Poon BSc
2015-08-01
Full Text Available Loss-of-function mutations in the p hosphate regulating gene with h omologies to e ndopeptidases on the X -chromosome ( PHEX have been causally associated with X-linked hypophosphatemic rickets (XLHR. The early diagnosis of XLHR in infants is challenging when it is based solely on clinical features and biochemical findings. We report a 7-month-old boy with a family history of hypophosphatemic rickets., who demonstrated early clinical evidence of rickets, although serial biochemical findings could not definitively confirm rickets. A sequencing assay targeting the PHEX gene was first performed on the mother’s DNA to screen for mutations in the 5′UTR, 22 coding exons, and the exon-intron junctions. Targeted mutation analysis and mRNA studies were subsequently performed on the boys’ DNA to investigate the pathogenicity of the identified mutation. Genetic screening of the PHEX gene revealed a novel mutation, c.1080-2A>C, at the splice acceptor site in intron 9. The detection of an aberrant mRNA transcript with skipped (loss of exon 10 establishes its pathogenicity and confirms the diagnosis of XLHR in this infant. Genetic testing of the PHEX gene resulted in early diagnosis of XLHR, thus enabling initiation of therapy and prevention of progressive rachitic changes in the infant.
A multiwell format assay for heparanase.
Behzad, Farhad; Brenchley, Paul E C
2003-09-15
This assay employs a biotinylated heparan sulfate glycosaminoglycan (HSGAG) substrate that is covalently linked to the surface of 96-well immunoassay plates. The ratio of biotin:HSGAG and the coating concentration of substrate bound to the wells have been optimized and allow removal of biotin HSGAG within 60 min of incubation at 37 degrees C in assay buffer with a standard dilution of bacterial heparitinase or platelet heparanase. Loss of biotin signal from the well surface is detected on incubation with peroxidase-streptavidin followed by color development using 3,3',5,5'-tetramethylbenzidine as the peroxidase substrate. The new assay allows specific detection of heparanase activity in multiple samples in a total time of 3 h including a 1-h substrate digestion step and is a significant improvement with regard to sensitivity, specificity, and ease of handling of multiple samples compared to other described assays. Heparanase specifically degrades the biotinylated HSGAG substrate, when used with an optimized assay buffer. A range of enzymes including collagenase, trypsin, plasmin, pepsin, chondroitinases, hyaluronidase, and neuraminidase show no effect on the substrate under optimized assay conditions. The covalent linkage of the substrate to the well prevents leaching of substrate and allows preparation and long-term storage of substrate-coated plates. The assay can be used to detect heparanase levels in clinical samples and cell culture supernatants and is ideal as a screening method for antagonists of enzyme activity.
A quantitative comet infection assay for influenza virus
Lindsay, Stephen M.; Timm, Andrea; Yin, John
2011-01-01
Summary The virus comet assay is a cell-based virulence assay used to evaluate an antiviral drug or antibody against a target virus. The comet assay differs from the plaque assay in allowing spontaneous flows in 6-well plates to spread virus. When implemented quantitatively the comet assay has been shown to have an order-of-magnitude greater sensitivity to antivirals than the plaque assay. In this study, a quantitative comet assay for influenza virus is demonstrated, and is shown to have a 13-fold increase in sensitivity to ribavirin. AX4 cells (MDCK cells with increased surface concentration of α2–6 sialic acid, the influenza virus receptor) have reduced the comet size variability relative to MDCK cells, making them a better host cell for use in this assay. Because of enhanced antiviral sensitivity in flow-based assays, less drug is required, which could lead to lower reagent costs, reduced cytotoxicity, and fewer false-negative drug screen results. The comet assay also serves as a readout of flow conditions in the well. Observations from comets formed at varying humidity levels indicate a role for evaporation in the mechanism of spontaneous fluid flow in wells. PMID:22155578
Assay development status report for total cyanide
International Nuclear Information System (INIS)
Simpson, B.C.; Jones, T.E.; Pool, K.H.
1993-02-01
A validated cyanide assay that is applicable to a variety of tank waste matrices is necessary to resolve certain waste tank safety issues and for purposes of overall waste characterization. The target for this effort is an assay with an applicable range of greater than 1,000 ppM (0.10 wt%) total cyanide and a confidence level greater than 80%. Figure 1 illustrates the operating regime of the proposed cyanide assay method. The Assay Development Status Report for Total Cyanide will summarize the past experience with cyanide analyses on-tank waste matrices and will rate the status of the analytical methods used to assay total cyanide (CN - ion) in the tank waste matrices as acceptable or unacceptable. This paper will also briefly describe the current efforts for improving analytical resolution of the assays and the attempts at speciation
Confirmation of Essure placement using transvaginal ultrasound.
Veersema, Sebastiaan; Vleugels, Michel; Koks, Caroline; Thurkow, Andreas; van der Vaart, Huub; Brölmann, Hans
2011-01-01
To evaluate the protocol for confirmation of satisfactory Essure placement using transvaginal ultrasound. Prospective multicenter cohort study (Canadian Task Force classification II-2). Outpatient departments of 4 teaching hospitals in the Netherlands. Eleven hundred forty-five women who underwent hysteroscopic sterilization using the Essure device between March 2005 and December 2007. Transvaginal ultrasound examination 12 weeks after uncomplicated successful bilateral placement or as indicated according to the transvaginal ultrasound protocol after 4 weeks, and hysterosalpingography (HSG) at 12 weeks to confirm correct placement of the device after 3 months. The rate of successful placement was 88.4% initially. In 164 women (15%), successful placement was confirmed at HSG according the protocol. In 9 patients (0.84%), incorrect position of the device was observed at HSG. The cumulative pregnancy rate after 18 months was 3.85 per thousand women. Transvaginal ultrasound should be the first diagnostic test used to confirm the adequacy of hysteroscopic Essure sterilization because it is minimally invasive, averts ionizing radiation, and does not decrease the effectiveness of the Essure procedure. Copyright © 2011 AAGL. Published by Elsevier Inc. All rights reserved.
Prospects for cellular mutational assays in human populations
International Nuclear Information System (INIS)
Mendelsohn, M.L.
1984-01-01
Practical, sensitive, and effective human cellular assays for detecting somatic and germinal mutations would have great value in environmental mutagenesis and carcinogenesis studies. Such assays would fill the void between human mutagenicity and the data that exist from short-term tests and from mutagenicity in other species. This paper discusses the following possible human cellular assays: (1) HPRT (hypoxanthine phosphoribosyltransferase) somatic cell mutation based on 6-thioguanine resistance; (2) hemoglobin somatic cell mutation assay; (3) glycophorin somatic cell mutation assay; and (4) LDH-X sperm cell mutation assay. 18 references
Prospects for cellular mutational assays in human populations
Energy Technology Data Exchange (ETDEWEB)
Mendelsohn, M.L.
1984-06-29
Practical, sensitive, and effective human cellular assays for detecting somatic and germinal mutations would have great value in environmental mutagenesis and carcinogenesis studies. Such assays would fill the void between human mutagenicity and the data that exist from short-term tests and from mutagenicity in other species. This paper discusses the following possible human cellular assays: (1) HPRT (hypoxanthine phosphoribosyltransferase) somatic cell mutation based on 6-thioguanine resistance; (2) hemoglobin somatic cell mutation assay; (3) glycophorin somatic cell mutation assay; and (4) LDH-X sperm cell mutation assay. 18 references.
A radiochemical assay for biotin in biological materials
International Nuclear Information System (INIS)
Hood, R.L.
1975-01-01
A radiochemical assay for biotin is described. The assay was sensitive to one nanogram and simple enough for routine biotin analyses. The assay yielded results which were comparable to those obtained from a microbiological assay using Lactobacillus plantarum. (author)
Directory of Open Access Journals (Sweden)
Jonathan A Lee
Full Text Available Phenotypic assays have a proven track record for generating leads that become first-in-class therapies. Whole cell assays that inform on a phenotype or mechanism also possess great potential in drug repositioning studies by illuminating new activities for the existing pharmacopeia. The National Center for Advancing Translational Sciences (NCATS pharmaceutical collection (NPC is the largest reported collection of approved small molecule therapeutics that is available for screening in a high-throughput setting. Via a wide-ranging collaborative effort, this library was analyzed in the Open Innovation Drug Discovery (OIDD phenotypic assay modules publicly offered by Lilly. The results of these tests are publically available online at www.ncats.nih.gov/expertise/preclinical/pd2 and via the PubChem Database (https://pubchem.ncbi.nlm.nih.gov/ (AID 1117321. Phenotypic outcomes for numerous drugs were confirmed, including sulfonylureas as insulin secretagogues and the anti-angiogenesis actions of multikinase inhibitors sorafenib, axitinib and pazopanib. Several novel outcomes were also noted including the Wnt potentiating activities of rotenone and the antifolate class of drugs, and the anti-angiogenic activity of cetaben.
Linearization of the Bradford Protein Assay
Ernst, Orna; Zor, Tsaffrir
2010-01-01
Determination of microgram quantities of protein in the Bradford Coomassie brilliant blue assay is accomplished by measurement of absorbance at 590 nm. This most common assay enables rapid and simple protein quantification in cell lysates, cellular fractions, or recombinant protein samples, for the purpose of normalization of biochemical measurements. However, an intrinsic nonlinearity compromises the sensitivity and accuracy of this method. It is shown that under standard assay conditions, t...
New automated pellet/powder assay system
International Nuclear Information System (INIS)
Olsen, R.N.
1975-01-01
This paper discusses an automated, high precision, pellet/ powder assay system. The system is an active assay system using a small isotopic neutron source and a coincidence detection system. The handling of the pellet powder samples has been automated and a programmable calculator has been integrated into the system to provide control and data analysis. The versatile system can assay uranium or plutonium in either active or passive modes
Passive nondestructive assay of nuclear materials
International Nuclear Information System (INIS)
Reilly, D.; Ensslin, N.; Smith, H. Jr.; Kreiner, S.
1991-03-01
The term nondestructive assay (NDA) is applied to a series of measurement techniques for nuclear fuel materials. The techniques measure radiation induced or emitted spontaneously from the nuclear material; the measurements are nondestructive in that they do not alter the physical or chemical state of the nuclear material. NDA techniques are characterized as passive or active depending on whether they measure radiation from the spontaneous decay of the nuclear material or radiation induced by an external source. This book emphasizes passive NDA techniques, although certain active techniques like gamma-ray absorption densitometry and x-ray fluorescence are discussed here because of their intimate relation to passive assay techniques. The principal NDA techniques are classified as gamma-ray assay, neutron assay, and calorimetry. Gamma-ray assay techniques are treated in Chapters 1--10. Neutron assay techniques are the subject of Chapters 11--17. Chapters 11--13 cover the origin of neutrons, neutron interactions, and neutron detectors. Chapters 14--17 cover the theory and applications of total and coincidence neutron counting. Chapter 18 deals with the assay of irradiated nuclear fuel, which uses both gamma-ray and neutron assay techniques. Chapter 19 covers perimeter monitoring, which uses gamma-ray and neutron detectors of high sensitivity to check that no unauthorized nuclear material crosses a facility boundary. The subject of Chapter 20 is attribute and semiquantitative measurements. The goal of these measurements is a rapid verification of the contents of nuclear material containers to assist physical inventory verifications. Waste and holdup measurements are also treated in this chapter. Chapters 21 and 22 cover calorimetry theory and application, and Chapter 23 is a brief application guide to illustrate which techniques can be used to solve certain measurement problems
Opinion dynamics with confirmation bias.
Directory of Open Access Journals (Sweden)
Armen E Allahverdyan
Full Text Available Confirmation bias is the tendency to acquire or evaluate new information in a way that is consistent with one's preexisting beliefs. It is omnipresent in psychology, economics, and even scientific practices. Prior theoretical research of this phenomenon has mainly focused on its economic implications possibly missing its potential connections with broader notions of cognitive science.We formulate a (non-Bayesian model for revising subjective probabilistic opinion of a confirmationally-biased agent in the light of a persuasive opinion. The revision rule ensures that the agent does not react to persuasion that is either far from his current opinion or coincides with it. We demonstrate that the model accounts for the basic phenomenology of the social judgment theory, and allows to study various phenomena such as cognitive dissonance and boomerang effect. The model also displays the order of presentation effect-when consecutively exposed to two opinions, the preference is given to the last opinion (recency or the first opinion (primacy -and relates recency to confirmation bias. Finally, we study the model in the case of repeated persuasion and analyze its convergence properties.The standard Bayesian approach to probabilistic opinion revision is inadequate for describing the observed phenomenology of persuasion process. The simple non-Bayesian model proposed here does agree with this phenomenology and is capable of reproducing a spectrum of effects observed in psychology: primacy-recency phenomenon, boomerang effect and cognitive dissonance. We point out several limitations of the model that should motivate its future development.
Cheng, Keding; Sloan, Angela; Avery, Kristen M; Coulthart, Michael; Carpenter, Michael; Knox, J David
2014-01-01
Real-time quaking-induced conversion (RT-QuIC), a highly specific and sensitive assay able to detect low levels of the disease-inducing isoform of the prion protein (PrP(d)) in brain tissue biopsies and cerebral spinal fluid, has great potential to become a method for diagnosing prion disease ante mortem. In order to standardize the assay method for routine analysis, an understanding of how physical and chemical factors affect the stability of the recombinant prion protein (rPrP) substrate and the RT-QuIC assay's sensitivity, specificity, and reproducibility is required. In this study, using sporadic Creutzfeldt-Jakob Disease brain homogenate to seed the reactions and an in vitro-expressed recombinant prion protein, hamster rPrP, as the substrate, the following factors affecting the RT-QuIC assay were examined: salt and substrate concentrations, substrate storage, and pH. Results demonstrated that both the generation of the quality and quantities of rPrP substrate critical to the reaction, as well as the RT-QuIC reaction itself required strict adherence to specific physical and chemical conditions. Once optimized, the RT-QuIC assay was confirmed to be a very specific and sensitive assay method for sCJD detection. Findings in this study indicate that further optimization and standardization of RT-QuIC assay is required before it can be adopted as a routine diagnostic test.
Directory of Open Access Journals (Sweden)
David Metzgar
Full Text Available In 2007, the Centers for Disease Control and Prevention (CDC reported that Human adenovirus type 14 (HAdV-14 infected 106 military personnel and was responsible for the death of one U.S. soldier at Lackland Air Force Base in Texas. Identification of the responsible adenovirus, which had not previously been seen in North America and for which rapid diagnostic tools were unavailable, required retrospective analysis at reference laboratories. Initial quarantine measures were also reliant on relatively slow traditional PCR analysis at other locations. To address this problem, we developed a real-time PCR assay that detects a 225 base pair sequence in the HAdV-14a hexon gene. Fifty-one oropharyngeal swab specimens from the Naval Health Research Center, San Diego, CA and Advanced Diagnostic Laboratory, Lackland AFB, TX were used to validate the new assay. The described assay detected eight of eight and 19 of 19 confirmed HAdV-14a clinical isolates in two separate cohorts from respiratory disease outbreaks. The real-time PCR assay had a wide dynamic range, detecting from 10(2 to 10(7 copies of genomic DNA per reaction. The assay did not cross-react with other adenoviruses, influenza, respiratory syncytial virus, or common respiratory tract bacteria. The described assay is easy to use, sensitive and specific for HAdV-14a in clinical throat swab specimens, and very rapid since turnaround time is less than four hours to obtain an answer.
The tumor suppressor gene hypermethylated in cancer 1 is transcriptionally regulated by E2F1
DEFF Research Database (Denmark)
Jenal, Mathias; Trinh, Emmanuelle; Britschgi, Christian
2009-01-01
to the HIC1 promoter was shown by chromatin immunoprecipitation assays in human TIG3 fibroblasts expressing tamoxifen-activated E2F1. In agreement, activation of E2F1 in TIG3-E2F1 cells markedly increased HIC1 expression. Interestingly, expression of E2F1 in the p53(-/-) hepatocellular carcinoma cell line...
International Nuclear Information System (INIS)
Akers, D.W.; Stoots, C.M.; Kraft, N.C.; Marts, D.J.
1997-01-01
The Rover Waste Assay System (RWAS) is a nondestructive assay system designed for the rapid assay of highly-enriched 235 U contaminated piping, tank sections, and debris from the Rover nuclear rocket fuel processing facility at the Idaho Chemical Processing Plant. A scanning system translates a NaI(Tl) detector/collimator system over the structural components where both relative and calibrated measurements for 137 Cs are made. Uranium-235 concentrations are in operation and is sufficiently automated that most functions are performed by the computer system. These functions include system calibration, problem identification, collimator control, data analysis, and reporting. Calibration of the system was done through a combination of measurements on calibration standards and benchmarked modeling. A description of the system is presented along with the methods and uncertainties associated with the calibration and analysis of the system for components from the Rover facility. 4 refs., 2 figs., 4 tabs
Locke, Andrea; Deutz, Nicolaas; Coté, Gerard
2018-02-01
Research toward development of point-of-care (POC) technologies is emerging as a means for diagnosis and monitoring of patients outside the hospital. These POC devices typically utilize assays capable of detecting low level biomarkers indicative of specific diseases. L-citrulline, an α-amino acid produced in the intestinal mucosa cells, is one such biomarker typically found circulating within the plasma at physiological concentrations of 40 μM. Researchers have found that intestinal enterocyte malfunction causes its level to be significantly lowered, establishing it as a potential diagnostic biomarker for gut function. Our research group has proposed the development of a surface enhanced Raman spectroscopy (SERS) based assay, using vertical flow paper fluidics, for citrulline detection. The assay consists of a fluorescently active, Raman reporter labeled aptamer conjugated on gold nanoparticles. The aptamer changes its confirmation on binding to its target, which in turn changes the distance between the Raman active molecule and the nanoparticle surface. These particles were embedded within a portable chip consisting of cellulose-based paper. After the chips were loaded with different concentrations of free L-citrulline in phosphate buffer, time was given for the assay to interact with the sample. A handheld Raman spectrometer (638 nm; Ocean Optics) was used to measure the SERS intensity. Results showed decrease in intensity with increasing concentration of L-citrulline (0-50μM).
International Nuclear Information System (INIS)
Farrington, K.J.
1985-12-01
High pressure liquid chromatography (HPLC) is used for the assay of nanogram quantities of technetium and to determine technetium in decayed pharmaceutical products, derived from three methods of manufacture. These methods of manufacture give comparably low levels of technetium-99, at the time of collection of the solution. However, when the solutions are used to produce ready-to-inject technetium-99m, high levels of technetium-99 are present at the time of calibration, which is the day after the collection date. Where sensitive reagent kits are to be labelled, freshly collected solutions of technetium-99m should be used. The HPLC assay is a valuable technique for the quality control of technetium-based radiopharmaceuticals, and for investigation of methods of manufacture of technetium-99m. Experimental studies confirmed the findings of previous workers
Raudonis, Raimondas; Raudone, Lina; Jakstas, Valdas; Janulis, Valdimaras
2012-04-13
ABTS and FRAP post-column techniques evaluate the antioxidant characteristics of HPLC separated compounds with specific reagents. ABTS characterize their ability to scavenge free radicals by electron-donating antioxidants, resulting in the absorbance decrease of the chromophoric radical. FRAP - is based on the reduction of Fe(III)-tripyridyltriazine complex to Fe(II)-tripyridyltriazine at low pH by electron-donating antioxidants, resulting in an absorbance increase. Both post-column assays were evaluated and compared according to the following validation parameters: specificity, precision, limit of detection (LoD), limit of quantitation (LoQ) and linearity. ABTS and FRAP post-column assays were specific, repeatable and sensitive and thus can be used for the evaluation of antioxidant active compounds. Antioxidant active compounds were quantified according to TEAC for each assay and ABTS/FRAP ratio was derived. No previous records of antioxidative activity of leaves and fruits of strawberries (Fragaria viridis, Fragaria moschata) research have been found. The research results confirm the reliability of ABTS and FRAP post-column assays for screening of antioxidants in complex mixtures and the determination of radical scavenging and ferric reducing ability by their TEAC values. Copyright © 2012 Elsevier B.V. All rights reserved.
Kerényi, Adrienne; Beke Debreceni, Ildikó; Oláh, Zsolt; Ilonczai, Péter; Bereczky, Zsuzsanna; Nagy, Béla; Muszbek, László; Kappelmayer, János
2017-09-01
Heparin-induced thrombocytopenia (HIT) is a severe side effect of heparin treatment caused by platelet activating IgG antibodies generated against the platelet factor 4 (PF4)-heparin complex. Thrombocytopenia and thrombosis are the leading clinical symptoms of HIT. The clinical pretest probability of HIT was evaluated by the 4T score system. Laboratory testing of HIT was performed by immunological detection of antibodies against PF4-heparin complex (EIA) and two functional assays. Heparin-dependent activation of donor platelets by patient plasma was detected by flow cytometry. Increased binding of Annexin-V to platelets and elevated number of platelet-derived microparticles (PMP) were the indicators of platelet activation. EIA for IgG isotype HIT antibodies was performed in 405 suspected HIT patients. Based on negative EIA results, HIT was excluded in 365 (90%) of cases. In 40 patients with positive EIA test result functional tests were performed. Platelet activating antibodies were detected in 17 cases by Annexin V binding. PMP count analysis provided nearly identical results. The probability of a positive flow cytometric assay result was higher in patients with elevated antibody titer. 71% of patients with positive EIA and functional assay had thrombosis. EIA is an important first line laboratory test in the diagnosis of HIT; however, HIT must be confirmed by a functional test. Annexin V binding and PMP assays using flow cytometry are functional HIT tests convenient in a clinical diagnostic laboratory. The positive results of functional assays may predict the onset of thrombosis. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.
Radioreceptor assay: theory and applications to pharmacology
International Nuclear Information System (INIS)
Perret, G.; Simon, P.
1984-01-01
The aim of the first part of this work is to present the theory of the radioreceptor assay and to compare it to the other techniques of radioanalysis (radioimmunoassay, competitive protein binding assays). The technology of the radioreceptor assay is then presented and its components (preparation of the receptors, radioligand, incubation medium) are described. The analytical characteristics of the radioreceptor assay (specificity, sensitivity, reproductibility, accuracy) and the pharmacological significance of the results are discussed. The second part is devoted to the description of the radioreceptor assays of some pharmacological classes (neuroleptics, tricyclic antidepressants, benzodiazepines, β-blockers, anticholinergic drugs) and to their use in therapeutic drug monitoring. In conclusion, by their nature, radioreceptor assays are highly sensitive, reliable, precise, accurate and simple to perform. Their chief disadvantage relates to specificity, since any substance having an appreciable affinity to the receptor site will displace the specifically bound radioligand. Paradoxically in some cases, this lack of specificity may be advantageous in that it allows for the detection of not only the apparent compound but of active metabolites and endogenous receptor agonists as well and in that radioreceptors assays can be devised for a whole pharmacological class and not only for one drug as it is the case for classical physico-chemical techniques. For all these reasons future of radioreceptor assay in pharmacology appears promising [fr
Assay optimization for molecular detection of Zika virus
Corman, Victor M.; Rasche, Andrea; Baronti, Cecile; Aldabbagh, Souhaib; Cadar, Daniel; Reusken, Chantal Bem; Pas, Suzan D.; Goorhuis, Abraham; Schinkel, Janke; Molenkamp, Richard; Kümmerer, Beate M.; Bleicker, Tobias; Brünink, Sebastian; Eschbach-Bludau, Monika; Eis-Hübinger, Anna M.; Koopmans, Marion P.; Schmidt-Chanasit, Jonas; Grobusch, Martin P.; de Lamballerie, Xavier; Drosten, Christian; Drexler, Jan Felix
2016-01-01
To examine the diagnostic performance of real-time reverse transcription (RT)-polymerase chain reaction (PCR) assays for Zika virus detection. We compared seven published real-time RT-PCR assays and two new assays that we have developed. To determine the analytical sensitivity of each assay, we
Andres, Oliver; Eber, Stefan; Speer, Christian P
2015-12-01
Exact diagnosis of hereditary spherocytosis (HS) is widely considered unreliable around birth. However, early postnatal diagnosis at the beginning of congenital hemolysis may be essential for managing neonatal anemia and hemolytic icterus, identifying those at high risk for severe hyperbilirubinemia, irreversible kernicterus, or sudden need for red cell transfusion. We analyzed 37 blood samples from neonates or infants up to six weeks of life that had been collected in-house or shipped to our laboratory due to suspected red cell membrane disorder. By combining assessment of red cell morphology, acidified glycerol lysis test (AGLT), and eosin-5'-maleimide (EMA) binding assay, we were able to clearly exclude HS in 22 and confirm HS in 10 patients, of which one had undergone red cell transfusion prior to blood sampling. Assessment of red cell morphology and normal test results allowed diagnosis of infantile pyknocytosis or Heinz body anemia in three neonates. Re-evaluation of five patients with inconsistent results of AGLT and EMA binding led to confirmation of HS in two cases. Automated analysis of hematologic parameters revealed elevated proportion of hyperdense cells to be a highly significant indicator for HS in neonatal infants. We showed that assessment of red cell morphology in combination with AGLT and EMA binding assay is a reliable basis for confirming or rejecting suspected diagnosis of HS even in neonates. Our data underline the necessity for blood sampling and laboratory exploration in suspected red cell membrane or enzyme defects at the earliest occasion.
Netzel, Brian C; Grebe, Stefan K G; Carranza Leon, B Gisella; Castro, M Regina; Clark, Penelope M; Hoofnagle, Andrew N; Spencer, Carole A; Turcu, Adina F; Algeciras-Schimnich, Alicia
2015-08-01
Measurement of thyroglobulin (Tg) by mass spectrometry (Tg-MS) is emerging as a tool for accurate Tg quantification in patients with anti-Tg autoantibodies (TgAbs). The objective of the study was to perform analytical and clinical evaluations of two Tg-MS assays in comparison with immunometric Tg assays (Tg-IAs) and Tg RIAs (Tg-RIAs) in a cohort of thyroid cancer patients. A total of 589 samples from 495 patients, 243 TgAb-/252 TgAb+, were tested by Beckman, Roche, Siemens-Immulite, and Thermo-Brahms Tg and TgAb assays, two Tg-RIAs, and two Tg-MS assays. The frequency of TgAb+ was 58%, 41%, 27%, and 39% for Roche, Beckman, Siemens-Immulite, and Thermo-Brahms, respectively. In TgAb- samples, clinical sensitivities and specificities of 100% and 74%-100%, respectively, were observed across all assays. In TgAb+ samples, all Tg-IAs demonstrated assay-dependent Tg underestimation, ranging from 41% to 86%. In TgAb+ samples, the use of a common cutoff (0.5 ng/mL) for the Tg-MS, three Tg-IAs, and the USC-RIA improved the sensitivity for the Tg-MSs and Tg-RIAs when compared with the Tg-IAs. In up to 20% of TgAb+ cases, Tg-IAs failed to detect Tg that was detectable by Tg-MS. In Tg-RIAs false-high biases were observed in TgAb+ samples containing low Tg concentrations. Tg-IAs remain the method of choice for Tg quantitation in TgAb- patients. In TgAb+ patients with undetectable Tg by immunometric assay, the Tg-MS will detect Tg in up to 20% additional cases. The Tg-RIA will detect Tg in approximately 35% cases, but a significant proportion of these will be clinical false-positive results. The undetectable Tg-MS seen in approximately 40% of TgAb+ cases in patients with disease need further evaluation.
Directory of Open Access Journals (Sweden)
Candido Angela
2012-06-01
Full Text Available Abstract Background The impact of hepatitis E in developed countries, like Italy, still requires a clear definition. In the present study, we evaluated HEV infection in patients with acute non-A-C hepatitis by an approach comparing data from Real-time PCR and serological assays. Methods In a first analysis, sera from 52 patients hospitalized with a diagnosis of acute viral non-A-C hepatitis in Italy were tested by in-house Real-Time PCR assay for identification of Hepatitis E Virus (HEV RNA and by anti-HEV IgM and IgG assays. In a subsequent analysis, selected samples were evaluated by additional IgM tests to confirm diagnosis. Results Among the 52 samples, 21 showed positive results for all three markers (IgM, IgG and HEV RNA. One patient showed HEV RNA as single marker. Uncertain results were found in 8 samples while the remaining 22 were negative for all markers. Further analysis of the 8 undefined samples by additional IgM tests confirmed HEV infection in 1 patient. Overall, acute HEV infections were reliably identified in 23 (44.2% out of 52 patients. Conclusions In the present paper, we performed a study evaluating HEV infection in 52 sporadic non-A-C acute hepatitis cases. All samples were collected from 2004 to 2010 in Italy. By a diagnostic strategy based on genomic and serological assays we identified HEV infections in 23 out of 52 patients (44.2%, a percentage higher than previous estimates. Thus, the actual impact of HEV infections in Italy needs to be further evaluated on a national scale by a diagnostic strategy based on multiple and last generation assays.
An improved assay for the determination of Huntington`s disease allele size
Energy Technology Data Exchange (ETDEWEB)
Reeves, C.; Klinger, K.; Miller, G. [Intergrated Genetics, Framingham, MA (United States)
1994-09-01
The hallmark of Huntington`s disease (HD) is the expansion of a polymorphic (CAG)n repeat. Several methods have been published describing PCR amplification of this region. Most of these assays require a complex PCR reaction mixture to amplify this GC-rich region. A consistent problem with trinucleotide repeat PCR amplification is the presence of a number of {open_quotes}stutter bands{close_quotes} which may be caused by primer or amplicon slippage during amplification or insufficient polymerase processivity. Most assays for HD arbitrarily select a particular band for diagnostic purposes. Without a clear choice for band selection such an arbitrary selection may result in inconsistent intra- or inter-laboratory findings. We present an improved protocol for the amplification of the HD trinucleotide repeat region. This method simplifies the PCR reaction buffer and results in a set of easily identifiable bands from which to determine allele size. HD alleles were identified by selecting bands of clearly greater signal intensity. Stutter banding was much reduced thus permitting easy identification of the most relevant PCR product. A second set of primers internal to the CCG polymorphism was used in selected samples to confirm allele size. The mechanism of action of N,N,N trimethylglycine in the PCR reaction is not clear. It may be possible that the minimal isostabilizing effect of N,N,N trimethylglycine at 2.5 M is significant enough to affect primer specificity. The use of N,N,N trimethylglycine in the PCR reaction facilitated identification of HD alleles and may be appropriate for use in other assays of this type.
A reverse transcriptase-PCR assay for detecting filarial infective larvae in mosquitoes.
Directory of Open Access Journals (Sweden)
Sandra J Laney
2008-06-01
Full Text Available Existing molecular assays for filarial parasite DNA in mosquitoes cannot distinguish between infected mosquitoes that contain any stage of the parasite and infective mosquitoes that harbor third stage larvae (L3 capable of establishing new infections in humans. We now report development of a molecular L3-detection assay for Brugia malayi in vectors based on RT-PCR detection of an L3-activated gene transcript.Candidate genes identified by bioinformatics analysis of EST datasets across the B. malayi life cycle were initially screened by PCR using cDNA libraries as templates. Stage-specificity was confirmed using RNA isolated from infected mosquitoes. Mosquitoes were collected daily for 14 days after feeding on microfilaremic cat blood. RT-PCR was performed with primer sets that were specific for individual candidate genes. Many promising candidates with strong expression in the L3 stage were excluded because of low-level transcription in less mature larvae. One transcript (TC8100, which encodes a particular form of collagen was only detected in mosquitoes that contained L3 larvae. This assay detects a single L3 in a pool of 25 mosquitoes.This L3-activated gene transcript, combined with a control transcript (tph-1, accession # U80971 that is constitutively expressed by all vector-stage filarial larvae, can be used to detect filarial infectivity in pools of mosquito vectors. This general approach (detection of stage-specific gene transcripts from eukaryotic pathogens may also be useful for detecting infective stages of other vector-borne parasites.
DEFF Research Database (Denmark)
Møller, Peter; Möller, Lennart; Godschalk, Roger W L
2010-01-01
The alkaline single cell gel electrophoresis (comet) assay has become a widely used method for the detection of DNA damage and repair in cells and tissues. Still, it has been difficult to compare results from different investigators because of differences in assay conditions and because the data...... are reported in different units. The European Comet Assay Validation Group (ECVAG) was established for the purpose of validation of the comet assay with respect to measures of DNA damage formation and its repair. The results from this inter-laboratory validation trail showed a large variation in measured level...... reliability for the measurement of DNA damage by the comet assay but there is still a need for further validation to reduce both assay and inter-laboratory variation....
Anti-signal recognition particle autoantibody ELISA validation and clinical associations.
Aggarwal, Rohit; Oddis, Chester V; Goudeau, Danielle; Fertig, Noreen; Metes, Ilinca; Stephens, Chad; Qi, Zengbiao; Koontz, Diane; Levesque, Marc C
2015-07-01
The aim of this study was to develop and validate a quantitative anti-signal recognition particle (SRP) autoantibody serum ELISA in patients with myositis and longitudinal association with myositis disease activity. We developed a serum ELISA using recombinant purified full-length human SRP coated on ELISA plates and a secondary antibody that bound human IgG to detect anti-SRP binding. Protein immunoprecipitation was used as the gold standard for the presence of anti-SRP. Serum samples from three groups were analysed: SRP(+) myositis subjects by immunoprecipitation, SRP(-) myositis subjects by immunoprecipitation and non-myositis controls. The ELISA's sensitivity, specificity, positive predictive value and negative predictive value were evaluated. Percentage agreement and test-retest reliability were assessed. Serial samples from seven SRP immunoprecipitation-positive subjects were also tested, along with serum muscle enzymes and manual muscle testing. Using immunoprecipitation, we identified 26 SRP(+) myositis patients and 77 SRP(-) controls (including 38 patients with necrotizing myopathy). Non-myositis control patients included SLE (n = 4) and SSc (n = 7) patients. Anti-SRP positivity by ELISA showed strong agreement (97.1%) with immunoprecipitation (κ = 0.94). The sensitivity, specificity, positive predictive value, and negative predictive value of the anti-SRP ELISA were 88, 100, 100 and 96, respectively. The area under the curve was 0.94, and test-retest reliability was strong (r = 0.91, P < 0.001). Serial samples showed that anti-SRP levels paralleled changes in muscle enzymes and manual muscle testing. We developed a quantitative ELISA for detecting serum anti-SRP autoantibodies and validated the assay in myositis. Longitudinal assessment of SRP levels by ELISA may be a useful biomarker for disease activity. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions
Braun, Patrick; Delgado, Rafael; Drago, Monica; Fanti, Diana; Fleury, Hervé; Hofmann, Jörg; Izopet, Jacques; Kühn, Sebastian; Lombardi, Alessandra; Mancon, Alessandro; Marcos, Mª Angeles; Mileto, Davide; Sauné, Karine; O'Shea, Siobhan; Pérez-Rivilla, Alfredo; Ramble, John; Trimoulet, Pascale; Vila, Jordi; Whittaker, Duncan; Artus, Alain; Rhodes, Daniel
2017-07-01
Viral load monitoring is essential for patients under treatment for HIV. Beckman Coulter has developed the VERIS HIV-1 Assay for use on the novel, automated DxN VERIS Molecular Diagnostics System. ¥ OBJECTIVES: Evaluation of the clinical performance of the new quantitative VERIS HIV-1 Assay at multiple EU laboratories. Method comparison with the VERIS HIV-1 Assay was performed with 415 specimens at 5 sites tested with COBAS ® AmpliPrep/COBAS ® TaqMan ® HIV-1 Test, v2.0, 169 specimens at 3 sites tested with RealTime HIV-1 Assay, and 202 specimens from 2 sites tested with VERSANT HIV-1 Assay. Patient monitoring sample results from 4 sites were also compared. Bland-Altman analysis showed the average bias between VERIS HIV-1 Assay and COBAS HIV-1 Test, RealTime HIV-1 Assay, and VERSANT HIV-1 Assay to be 0.28, 0.39, and 0.61 log 10 cp/mL, respectively. Bias at low end levels below 1000cp/mL showed predicted bias to be <0.3 log 10 cp/mL for VERIS HIV-1 Assay versus COBAS HIV-1 Test and RealTime HIV-1 Assay, and <0.5 log 10 cp/mL versus VERSANT HIV-1 Assay. Analysis on 174 specimens tested with the 0.175mL volume VERIS HIV-1 Assay and COBAS HIV-1 Test showed average bias of 0.39 log 10 cp/mL. Patient monitoring results using VERIS HIV-1 Assay demonstrated similar viral load trends over time to all comparators. The VERIS HIV-1 Assay for use on the DxN VERIS System demonstrated comparable clinical performance to COBAS ® HIV-1 Test, RealTime HIV-1 Assay, and VERSANT HIV-1 Assay. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Fleury, B.
1981-10-01
A solid phase method of radioimmunoassay utilizing a second antibody adsorbed onto tubes was developed. Polyethylene tubes were selected for their adsorption capacity. The following topics were emphasized: the rate of labelled antigen uptake on the second antibody adsorbed on the tubes through the medium of the first antibody; the influence of the second antibody on the antigen-first antibody reaction and comparison with the immunoprecipiting technique; the various factors able to influence the calibration curve and applications to assay optimization; the performances of hFSH AND hLH assays [fr
Solid phase radioimmunoassays using labelled antibodies: a conceptual framework for designing assays
International Nuclear Information System (INIS)
Kalmakoff, J.; Parkinson, A.J.; Crawford, A.M.; Williams, B.R.G.
1977-01-01
A simple theoretical model for the antigen-antibody reaction is presented and used to evaluate the optimum conditions for designing solid phase radioimmunoassays (RIA) using labelled antibodies. Both theoretical and experimental data are presented, using a wide variety of antigens and their corresponding antibodies. The types of RIA described include the direct, the indirect, the direct sandwich assays for detecting either antigen or antibody. The experimental results confirm in a semiquantitative manner that the greatest sensitivity of the RIA is achieved when the smallest amount of labelled antibody is used, that whenever possible the antigen/antibody ratio should be greater than unity(>1), and that the formation of the antigen-antibody complex is dependent on the mass action effect
Model confirmation in climate economics
Millner, Antony; McDermott, Thomas K. J.
2016-01-01
Benefit–cost integrated assessment models (BC-IAMs) inform climate policy debates by quantifying the trade-offs between alternative greenhouse gas abatement options. They achieve this by coupling simplified models of the climate system to models of the global economy and the costs and benefits of climate policy. Although these models have provided valuable qualitative insights into the sensitivity of policy trade-offs to different ethical and empirical assumptions, they are increasingly being used to inform the selection of policies in the real world. To the extent that BC-IAMs are used as inputs to policy selection, our confidence in their quantitative outputs must depend on the empirical validity of their modeling assumptions. We have a degree of confidence in climate models both because they have been tested on historical data in hindcasting experiments and because the physical principles they are based on have been empirically confirmed in closely related applications. By contrast, the economic components of BC-IAMs often rely on untestable scenarios, or on structural models that are comparatively untested on relevant time scales. Where possible, an approach to model confirmation similar to that used in climate science could help to build confidence in the economic components of BC-IAMs, or focus attention on which components might need refinement for policy applications. We illustrate the potential benefits of model confirmation exercises by performing a long-run hindcasting experiment with one of the leading BC-IAMs. We show that its model of long-run economic growth—one of its most important economic components—had questionable predictive power over the 20th century. PMID:27432964
Cui, Heying; Loftus, Kyle M; Noell, Crystal R; Solmaz, Sozanne R
2018-05-03
Cyclin-dependent kinase 1 (Cdk1) is a master controller for the cell cycle in all eukaryotes and phosphorylates an estimated 8 - 13% of the proteome; however, the number of identified targets for Cdk1, particularly in human cells is still low. The identification of Cdk1-specific phosphorylation sites is important, as they provide mechanistic insights into how Cdk1 controls the cell cycle. Cell cycle regulation is critical for faithful chromosome segregation, and defects in this complicated process lead to chromosomal aberrations and cancer. Here, we describe an in vitro kinase assay that is used to identify Cdk1-specific phosphorylation sites. In this assay, a purified protein is phosphorylated in vitro by commercially available human Cdk1/cyclin B. Successful phosphorylation is confirmed by SDS-PAGE, and phosphorylation sites are subsequently identified by mass spectrometry. We also describe purification protocols that yield highly pure and homogeneous protein preparations suitable for the kinase assay, and a binding assay for the functional verification of the identified phosphorylation sites, which probes the interaction between a classical nuclear localization signal (cNLS) and its nuclear transport receptor karyopherin α. To aid with experimental design, we review approaches for the prediction of Cdk1-specific phosphorylation sites from protein sequences. Together these protocols present a very powerful approach that yields Cdk1-specific phosphorylation sites and enables mechanistic studies into how Cdk1 controls the cell cycle. Since this method relies on purified proteins, it can be applied to any model organism and yields reliable results, especially when combined with cell functional studies.
Immune chromatography: a quantitative radioimmunological assay
International Nuclear Information System (INIS)
Davis, J.W.; Demetriades, M.; Bowen, J.M.
1984-01-01
Immune chromatography, a radioimmunological binding assay, employs paper chromatography to separate immune complexes from free antigen and antibodies. During chromatography free antigen and antibodies become distributed throughout the paper, while immune complexes remain near the bottoms of the strips. The chromatographic differences can be made quantitative by using either iodinated antigens or antibodies. Under these conditions nanogram quantities of antigen can be detected or antibodies in sera diluted several 1000-fold. The immune chromatography assay can also be performed as an indirect assay, since the paper strips are cut from nitrocellulose paper. In this case the immune components are absorbed by the paper during chromatography. Antigen is then detected with an iodinated second antibody. The indirect immune chromatography assay is particularly useful for identifying different sera that react with the same antigen. Reaction with the first serum before chromatography reduces the amount of antigen available to the second serum following chromatography. In addition to characterizing the immune chromatography procedure, we discuss the possible applications of chromatography assays for the quantitation of other types of molecular binding interactions. (Auth.)
Introducing MINA--The Molecularly Imprinted Nanoparticle Assay.
Shutov, Roman V; Guerreiro, Antonio; Moczko, Ewa; de Vargas-Sansalvador, Isabel Perez; Chianella, Iva; Whitcombe, Michael J; Piletsky, Sergey A
2014-03-26
A new ELISA- (enzyme-linked immunosorbent assay)-like assay is demonstrated in which no elements of biological origin are used for molecular recognition or signaling. Composite imprinted nanoparticles that contain a catalytic core and which are synthesized by using a solid-phase approach can simultaneously act as recognition/signaling elements, and be used with minimal modifications to standard assay protocols. This assay provides a new route towards replacement of unstable biomolecules in immunoassays. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Energy Technology Data Exchange (ETDEWEB)
Akers, D.W.; Stoots, C.M.; Kraft, N.C.; Marts, D.J. [Idaho National Engineering Lab., Idaho Falls, ID (United States)
1997-11-01
The Rover Waste Assay System (RWAS) is a nondestructive assay system designed for the rapid assay of highly-enriched {sup 235}U contaminated piping, tank sections, and debris from the Rover nuclear rocket fuel processing facility at the Idaho Chemical Processing Plant. A scanning system translates a NaI(Tl) detector/collimator system over the structural components where both relative and calibrated measurements for {sup 137}Cs are made. Uranium-235 concentrations are in operation and is sufficiently automated that most functions are performed by the computer system. These functions include system calibration, problem identification, collimator control, data analysis, and reporting. Calibration of the system was done through a combination of measurements on calibration standards and benchmarked modeling. A description of the system is presented along with the methods and uncertainties associated with the calibration and analysis of the system for components from the Rover facility. 4 refs., 2 figs., 4 tabs.
Romolo, Francesco Saverio; Ferri, Elida; Mirasoli, Mara; D'Elia, Marcello; Ripani, Luigi; Peluso, Giuseppe; Risoluti, Roberta; Maiolini, Elisabetta; Girotti, Stefano
2015-01-01
immunoassays confirmed that they were suitable to detect post-blast residues in soil and target materials and post transfer residues on hands, allowing further confirmation by more selective techniques. ELISA and LFIAs results obtained from the same solution were consistently in good agreement, and were confirmed by gas chromatography coupled to mass spectrometry (GC-MS). The reported immunoassays data demonstrates the suitability of LFIAs as on-site rapid and effective assays to detect TNT traces. The CL-ELISA proved useful in obtaining very sensitive detection in forensic investigations and testing, while CL-LFIA had performances in between LFIA and CL-ELISA. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
International Nuclear Information System (INIS)
Patzke, J.B.; Rosenberg, B.J.
1984-01-01
The accuracy of assays for monitoring concentrations of basic drugs in biological fluids containing a 1 -acid glycoproteins, such as blood (serum or plasma), is improved by the addition of certain organic phosphate compounds to minimize the ''protein effect.'' Kits containing the elements of the invention are also disclosed
Directory of Open Access Journals (Sweden)
Schulze Katja
2011-11-01
Full Text Available Abstract Background Currently established methods to identify viable and non-viable cells of cyanobacteria are either time-consuming (eg. plating or preparation-intensive (eg. fluorescent staining. In this paper we present a new and fast viability assay for unicellular cyanobacteria, which uses red chlorophyll fluorescence and an unspecific green autofluorescence for the differentiation of viable and non-viable cells without the need of sample preparation. Results The viability assay for unicellular cyanobacteria using red and green autofluorescence was established and validated for the model organism Synechocystis sp. PCC 6803. Both autofluorescence signals could be observed simultaneously allowing a direct classification of viable and non-viable cells. The results were confirmed by plating/colony count, absorption spectra and chlorophyll measurements. The use of an automated fluorescence microscope and a novel ImageJ based image analysis plugin allow a semi-automated analysis. Conclusions The new method simplifies the process of viability analysis and allows a quick and accurate analysis. Furthermore results indicate that a combination of the new assay with absorption spectra or chlorophyll concentration measurements allows the estimation of the vitality of cells.
Directory of Open Access Journals (Sweden)
Selwyn A. Headley
2012-12-01
Full Text Available Molecular findings that confirmed the participation of ovine herpesvirus 2 (OVH-2 in the lesions that were consistent with those observed in malignant catarrhal fever of cattle are described. Three mixed-breed cattle from Rio Grande do Norte state demonstrated clinical manifestations that included mucopurulent nasal discharge, corneal opacity and motor incoordination. Routine necropsy examination demonstrated ulcerations and hemorrhage of the oral cavity, corneal opacity, and lymph node enlargement. Significant histopathological findings included widespread necrotizing vasculitis, non-suppurative meningoencephalitis, lymphocytic interstitial nephritis and hepatitis, and thrombosis. PCR assay performed on DNA extracted from kidney and mesenteric lymph node of one animal amplified a product of 423 base pairs corresponding to a target sequence within the ovine herpesvirus 2 (OVH-2 tegument protein gene. Direct sequencing of the PCR products, from extracted DNA of the kidney and mesenteric lymph node of one cow, amplified the partial nucleotide sequences (423 base pairs of OVH-2 tegument protein gene. Blast analysis confirmed that these sequences have 98-100% identity with similar OVH-2 sequences deposited in GenBank. Phylogenetic analyses, based on the deduced amino acid sequences, demonstrated that the strain of OVH-2 circulating in ruminants from the Brazilian states of Rio Grande do Norte and Minas Gerais are similar to that identified in other geographical locations. These findings confirmed the active participation of OVH-2 in the classical manifestations of sheep associated malignant catarrhal fever.
2017-07-27
The Food and Drug Administration (FDA, Agency, or we) is classifying the assayed quality control material for clinical microbiology assays into class II (special controls). The special controls that will apply to the device are identified in this order and will be part of the codified language for the assayed quality control material for clinical microbiology assays' classification. The Agency is classifying the device into class II (special controls) to provide a reasonable assurance of safety and effectiveness of the device.
Zhou, Chunxia; Ye, Lincai; Jiang, Chuan; Bai, Jie; Chi, Yongbin; Zhang, Haibo
2015-12-01
Despite the fact that great advances have been made in the management of non-small cell lung cancer (NSCLC), the prognosis of advanced NSCLC remains very poor. HOX transcript antisense intergenic RNA (HOTAIR) has been identified as an oncogenic long noncoding RNA (lncRNA) that is involved in the progression of a variety of carcinomas and acts as a negative prognostic biomarker. Yet, little is known about the effect of HOTAIR in the hypoxic microenvironment of NSCLC. The expression and promoter activity of HOTAIR were measured by quantitative real-time polymerase chain reaction (qRT-PCR) and luciferase reporter assay. The function of the hypoxia-inducible factor-1α (HIF-1α) binding site to hypoxia-responsive elements (HREs) in the HOTAIR promoter region was tested by luciferase reporter assay with nucleotide substitutions. The binding of HIF-1α to the HOTAIR promoter in vivo was confirmed by chromatin immunoprecipitation assay (CHIP) and electrophoretic mobility shift assay (EMSA). The effect of HIF-1α suppression by small interference RNA or YC-1 on HOTAIR expression was also determined. In the present study, we demonstrated that HOTAIR was upregulated by hypoxia in NSCLC cells. HOTAIR is a direct target of HIF-1α through interaction with putative HREs in the upstream region of HOTAIR in NSCLC cells. Furthermore, HIF-1α knockdown or inhibition could prevent HOTAIR upregulation under hypoxic conditions. Under hypoxic conditions, HOTAIR enhanced cancer cell proliferation, migration, and invasion. These data suggested that suppression of HOTAIR upon hypoxia of NSCLC could be a novel therapeutic strategy.
Sugiura, Aya; Iwahara, Kunihiro; Suga, Yasuyuki; Uchiyama, Sachinori; Maekawa, Masato
2012-09-01
We compared the ECLusys Anti-HCV (ECL) reagent to the Lumipulse f (LPf) and HISCL (HIS) HCV assays. In a correlation test using 210 routine clinical specimens measured using the Lumipulse method (96 positive and 114 negative), most of the results were consistent for all specimens. In a dilution sensitivity test using three different routine positive specimens, the ECL assay enabled detection at higher levels of sensitivity than either the LPf or the HIS assay. Moreover, when the distribution of the cut-off index (C.O.I.) values of the routine LPf negative specimens were compared to those on the ECL and HIS assays, it was found that on the ECL assay, most of the specimens had cut-off index values < 0.1, indicating a more clear-cut distribution. In a specificity test using high RF positive specimens(n = 33), pregnancy specimens (n = 35), cytomegalovirus (CMV) antibody positive specimens (n = 36), and high M protein positive specimens (n = 21), the ECL assay yielded positive results for a CMV antibody positive specimen and three high M protein positive specimens. Further testing using samples from the same patients collected on different days than these four samples resulted in a second positive result for the CMV positive specimen, and single antigen measurement yielded a Core/NS3 positive result, as well, suggesting past infection. However, since negative results were obtained for the three M protein positive specimens, the possibility of this being a ECLusys non-specific reaction could not be ruled out. The above results confirmed that the ECL assay provides superior fundamental performance, and possesses test performance nearly identical to that of the existing measurement methods that are widely used at a large number of facilities, and would therefore be a suitable assay for use in routine HCV antibody screening.
Capillary Electrophoresis Analysis of Conventional Splicing Assays
DEFF Research Database (Denmark)
de Garibay, Gorka Ruiz; Acedo, Alberto; García-Casado, Zaida
2014-01-01
of these assays is often challenging. Here, we explore this issue by conducting splicing assays in 31 BRCA2 genetic variants. All variants were assessed by RT-PCR followed by capillary electrophoresis and direct sequencing. If assays did not produce clear-cut outputs (Class-2 or Class-5 according to analytical...
Controlling variation in the comet assay
Directory of Open Access Journals (Sweden)
Andrew Richard Collins
2014-10-01
Full Text Available Variability of the comet assay is a serious issue, whether it occurs from experiment to experiment in the same laboratory, or between different laboratories analysing identical samples. Do we have to live with high variability, just because the comet assay is a biological assay rather than analytical chemistry? Numerous attempts have been made to limit variability by standardising the assay protocol, and the critical steps in the assay have been identified; agarose concentration, duration of alkaline incubation, and electrophoresis conditions (time, temperature and voltage gradient are particularly important. Even when these are controlled, variation seems to be inevitable. It is helpful to include in experiments reference standards, i.e. cells with a known amount of specific damage to the DNA. They can be aliquots frozen from a single large batch of cells, either untreated (negative controls or treated with, for example, H2O2 or X-rays to induce strand breaks (positive control for the basic assay, or photosensitiser plus light to oxidise guanine (positive control for Fpg- or OGG1-sensitive sites. Reference standards are especially valuable when performing a series of experiments over a long period - for example, analysing samples of white blood cells from a large human biomonitoring trial - to check that the assay is performing consistently, and to identify anomalous results necessitating a repeat experiment. The reference values of tail intensity can also be used to iron out small variations occurring from day to day. We present examples of the use of reference standards in human trials, both within one laboratory and between different laboratories, and describe procedures that can be used to control variation.
Kang, Shin Myung; Park, Moo Suk; Chang, Joon; Kim, Se Kyu; Kim, Haeryoung; Shin, Dong-Hwan; Chung, Kyung Young; Kim, Dae Joon; Sohn, Joo Hyuk; Choi, Sung Ho; Kim, Jeongmi; Yoon, Eun Jin; Kim, Joo-Hang
2005-08-01
A chemosensitivity test can reflect the differences in responses of individual cancer patients to chemotherapeutic agents. The adenosine triphosphate-based chemotherapy response assay (ATP-CRA) is an accurate method, which does not require a large amount of tissue specimen. So far, no studies have evaluated the utility of the ATP-CRA in Korea. Therefore, we investigated the clinical usefulness of the ATP-CRA in 53 patients with lung cancer. Tumor tissues were obtained from bronchoscopic biopsies or surgical resections. The validity of ATP-CRA was assessed focusing on the success rate, experimental error level (intraassay mean coefficient of variation [CV]) and reproducibility. The overall success rate of ATP-CRA was 90.6% (48/53). Normal cells were effectively eliminated from the tumor tissues with the use of ficoll gradient centrifugation and immunomagnetic separation, which was confirmed using loss of heterozygosity analysis of the 3p deletion. The mean CV of ATP assays was 10.5+/-4.6%. The reproducibility of ATP assays was 94+/-3.8%. The results of the ATP assays were reported to physicians within 7 days of specimen collection. More than 6 anticancer drugs were tested on the tumor specimens obtained from bronchoscopic biopsies. The ATP-CRA is a stable, accurate and potentially practical chemosensitivity test in patients with lung cancer.
Goff, Will L.; McElwain, Terry F.; Suarez, Carlos E.; Johnson, Wendell C.; Brown, Wendy C.; Norimine, Junzo; Knowles, Donald P.
2003-01-01
The competitive enzyme-linked immunosorbent assay (cELISA) format has proven to be an accurate, reliable, easily standardized, and high-throughput method for detecting hemoparasite infections. In the present study, a species-specific, broadly conserved, and tandemly repeated B-cell epitope within the C terminus of the rhoptry-associated protein 1 of the hemoparasite Babesia bovis was cloned and expressed as a histidine-tagged thioredoxin fusion peptide and used as antigen in a cELISA. The assay was optimized with defined negative and positive bovine sera, where positive sera inhibited the binding of the epitope-specific monoclonal antibody BABB75A4. The cELISA accurately differentiated animals with B. bovis-specific antibodies from uninfected animals and from animals with antibodies against other tick-borne hemoparasites (98.7% specificity). In addition, B. bovis-specific sera from Australia, Argentina, Bolivia, Puerto Rico, and Morocco inhibited the binding of BABB75A4, confirming conservation of the epitope. The assay first detected experimentally infected animals between 13 and 17 days postinfection, and with sera from naturally infected carrier cattle, was comparable to indirect immunofluorescence (98.3% concordance). The assay appears to have the characteristics necessary for an epidemiologic and disease surveillance tool. PMID:12522037
Li, Qiong-Yan; Hu, Wen-Bo; Zhou, Meng-Ting; Nie, Hong-Yi; Zhang, Yin-Xia; Peng, Zhang-Chuan; Zhao, Ping; Xia, Qing-You
2014-01-01
Silk glands are specialized in the synthesis of several secretory proteins. Expression of genes encoding the silk proteins in Bombyx mori silk glands with strict territorial and developmental specificities is regulated by many transcription factors. In this study, we have characterized B. mori sage, which is closely related to sage in the fruitfly Drosophila melanogaster. It is termed Bmsage; it encodes transcription factor Bmsage, which belongs to the Mesp subfamily, containing a basic helix–loop–helix motif. Bmsage transcripts were detected specifically in the silk glands of B. mori larvae through RT-PCR analysis. Immunoblotting analysis confirmed the Bmsage protein existed exclusively in B. mori middle and posterior silk gland cells. Bmsage has a low level of expression in the 4th instar molting stages, which increases gradually in the 5th instar feeding stages and then declines from the wandering to the pupation stages. Quantitative PCR analysis suggested the expression level of Bmsage in a high silk strain was higher compared to a lower silk strain on day 3 of the larval 5th instar. Furthermore, far western blotting and co-immunoprecipitation assays showed the Bmsage protein interacted with the fork head transcription factor silk gland factor 1 (SGF1). An electrophoretic mobility shift assay showed the complex of Bmsage and SGF1 proteins bound to the A and B elements in the promoter of fibroin H-chain gene(fib-H), respectively. Luciferase reporter gene assays confirmed the complex of Bmsage and SGF1 proteins increased the expression of fib-H. Together, these results suggest Bmsage is involved in the regulation of the expression of fib-H by being together with SGF1 in B. mori PSG cells. PMID:24740008
Pang, Lijuan; Qiu, Tao; Cao, Xu; Wan, Mei
2011-07-01
Smad4, originally isolated from the human chromosome 18q21, is a key factor in transducing the signals of the TGF-β superfamily of growth hormones and plays a pivotal role in mediating antimitogenic and proapoptotic effects of TGF-β, but the mechanisms by which Smad4 induces apoptosis are elusive. Here we report that Smad4 directly translocates to the mitochondria of apoptotic cells. Smad4 gene silencing by siRNA inhibits TGF-β-induced apoptosis in Hep3B cells and UV-induced apoptosis in PANC-1 cells. Cell fractionation assays demonstrated that a fraction of Smad4 translocates to mitochondria after long time TGF-β treatment or UV exposure, during which the cells were under apoptosis. Smad4 mitochondria translocation during apoptosis was also confirmed by fluorescence observation of Smad4 colocalization with MitoTracker Red. We searched for mitochondria proteins that have physical interactions with Smad4 using yeast two-hybrid screening approach. DNA sequence analysis identified 34 positive clones, five of which encoded subunits in mitochondria complex IV, i.e., one clone encoded cytochrome c oxidase COXII, three clones encoded COXIII and one clone encoded COXVb. Strong interaction between Smad4 with COXII, an important apoptosis regulator, was verified in yeast by β-gal activity assays and in mammalian cells by immunoprecipitation assays. Further, mitochondrial portion of cells was isolated and the interaction between COXII and Smad4 in mitochondria upon TGF-β treatment or UV exposure was confirmed. Importantly, targeting Smad4 to mitochondria using import leader fusions enhanced TGF-β-induced apoptosis. Collectively, the results suggest that Smad4 promote apoptosis of the cells through its mitochondrial translocation and association with mitochondria protein COXII. Copyright © 2011 Elsevier Inc. All rights reserved.
233U Assay A Neutron NDA System
International Nuclear Information System (INIS)
Hensley, D.C.; Lucero, A.J.; Pierce, L.
1998-01-01
The assay of highly enriched 233 U material presents some unique challenges. Techniques which apply to the assay of materials of Pu or enriched 235 U do not convert easily over to the assay of 233 U. A specialized neutron assay device is being fabricated to exploit the singles neutron signal, the weak correlated neutron signal, and an active correlated signal. These pieces of information when combined with γ ray isotopics information should give a good overall determination of 233 U material now stored in bldg. 3019 at the Oak Ridge National Laboratory
International Nuclear Information System (INIS)
Yoon, W.Y.; Meachum, T.R.; Blackwood, L.G.; Harker, Y.D.
2000-01-01
The Idaho National Engineering and Environmental Laboratory Stored Waste Examination Pilot Plant (SWEPP) passive active neutron (PAN) radioassay system is used to certify transuranic (TRU) waste drums in terms of quantifying plutonium and other TRU element activities. Depending on the waste form involved, significant systematic and random errors need quantification in addition to the counting statistics. To determine the total uncertainty of the radioassay results, a statistical sampling and verification approach has been developed. In this approach, the total performance of the PAN nondestructive assay system is simulated using the computer models of the assay system, and the resultant output is compared with the known input to assess the total uncertainty. The supporting steps in performing the uncertainty analysis for the passive assay measurements in particular are as follows: (1) Create simulated waste drums and associated conditions; (2) Simulate measurements to determine the basic counting data that would be produced by the PAN assay system under the conditions specified; and (3) Apply the PAN assay system analysis algorithm to the set of counting data produced by simulating measurements to determine the measured plutonium mass. The validity of this simulation approach was verified by comparing simulated output against results from actual measurements using known plutonium sources and surrogate waste drums. The computer simulation of the PAN system performance uses the Monte Carlo N-Particle (MCNP) Code System to produce a neutron transport calculation for a simulated waste drum. Specifically, the passive system uses the neutron coincidence counting technique, utilizing the spontaneous fission of 240 Pu. MCNP application to the SWEPP PAN assay system uncertainty analysis has been very useful for a variety of waste types contained in 208-ell drums measured by a passive radioassay system. The application of MCNP to the active radioassay system is also feasible
DEFF Research Database (Denmark)
Aabye, Martine G.; Ravn, Pernille; PrayGod, George
2009-01-01
pulmonary tuberculosis (PTB) in a TB- and HIV-endemic population and the effect of HIV-infection and CD4 cell count on test performance. METHODOLOGY/PRINCIPAL FINDINGS: 161 patients with sputum culture confirmed PTB were subjected to HIV- and QFT-IT testing and measurement of CD4 cell count. The QFT......BACKGROUND: The performance of the tuberculosis specific Interferon Gamma Release Assays (IGRAs) has not been sufficiently documented in tuberculosis- and HIV-endemic settings. This study evaluated the sensitivity of the QuantiFERON TB-Gold In-Tube (QFT-IT) in patients with culture confirmed...
Computer-determined assay time based on preset precision
International Nuclear Information System (INIS)
Foster, L.A.; Hagan, R.; Martin, E.R.; Wachter, J.R.; Bonner, C.A.; Malcom, J.E.
1994-01-01
Most current assay systems for special nuclear materials (SNM) operate on the principle of a fixed assay time which provides acceptable measurement precision without sacrificing the required throughput of the instrument. Waste items to be assayed for SNM content can contain a wide range of nuclear material. Counting all items for the same preset assay time results in a wide range of measurement precision and wastes time at the upper end of the calibration range. A short time sample taken at the beginning of the assay could optimize the analysis time on the basis of the required measurement precision. To illustrate the technique of automatically determining the assay time, measurements were made with a segmented gamma scanner at the Plutonium Facility of Los Alamos National Laboratory with the assay time for each segment determined by counting statistics in that segment. Segments with very little SNM were quickly determined to be below the lower limit of the measurement range and the measurement was stopped. Segments with significant SNM were optimally assays to the preset precision. With this method the total assay time for each item is determined by the desired preset precision. This report describes the precision-based algorithm and presents the results of measurements made to test its validity
Serotype determination of Salmonella by xTAG assay.
Zheng, Zhibei; Zheng, Wei; Wang, Haoqiu; Pan, Jincao; Pu, Xiaoying
2017-10-01
Currently, no protocols or commercial kits are available to determine the serotypes of Salmonella by using Luminex MAGPIX®. In this study, an xTAG assay for serotype determination of Salmonella suitable for Luminex MAGPIX® is described and 228 Salmonella isolates were serotype determined by this xTAG assay. The xTAG assay consists of two steps: 1) Multiplex PCR to amplify simultaneously O, H and Vi antigen genes of Salmonella, and 2) Magplex-TAG™ microsphere hybridization to identify accurately the specific PCR products of different antigens. Compared with the serotyping results of traditional serum agglutination test, the sensitivity and specificity of the xTAG assay were 95.1% and 100%, respectively. The agreement rate of these two assays was 95.2%. Compared with Luminex xMAP® Salmonella Serotyping Assay (SSA) kit, the advantages of this xTAG assay are: First, the magnetic beads make it applicable to both the Luminex®100/200™ and MAGPIX® systems. Second, only primers rather than both primers and probes are needed in the xTAG assay, and the process of coupling antigen-specific oligonucleotide probes to beads is circumvented, which make the xTAG assay convenient to be utilized by other laboratories. The xTAG assay may serve as a rapid alternative or complementary method for traditional Salmonella serotyping tests, especially for laboratories that utilize the MAGPIX® systems. Copyright © 2017 Elsevier B.V. All rights reserved.
The comet assay: ready for 30 more years.
Møller, Peter
2018-02-24
During the last 30 years, the comet assay has become widely used for the measurement of DNA damage and repair in cells and tissues. A landmark achievement was reached in 2016 when the Organization for Economic Co-operation and Development adopted a comet assay guideline for in vivo testing of DNA strand breaks in animals. However, the comet assay has much more to offer than being an assay for testing DNA strand breaks in animal organs. The use of repair enzymes increases the range of DNA lesions that can be detected with the assay. It can also be modified to measure DNA repair activity. Still, despite the long-term use of the assay, there is a need for studies that assess the impact of variation in specific steps of the procedure. This is particularly important for the on-going efforts to decrease the variation between experiments and laboratories. The articles in this Special Issue of Mutagenesis cover important technical issues of the comet assay procedure, nanogenotoxicity and ionising radiation sensitivity on plant cells. The included biomonitoring studies have assessed seasonal variation and certain predictors for the basal level of DNA damage in white blood cells. Lastly, the comet assay has been used in studies on genotoxicity of environmental and occupational exposures in human biomonitoring studies and animal models. Overall, the articles in this Special Issue demonstrate the versatility of the comet assay and they hold promise that the assay is ready for the next 30 years.
Poul, J M; Huet, S; Godard, T; Sanders, P
2004-02-01
Iodine could be added to the diet of human population in the form of iodide or iodate but iodate had not been adequately tested for genotoxicity and carcinogenicity. In the present study, genotoxic effects of potassium iodate were evaluated in vitro using the alkaline comet assay and the cytokinesis-block micronucleus assay on CHO cells and compared to halogenate salt analogues potassium bromate and chlorate and also to their respective reduced forms (potassium iodide, bromide and chloride). The results showed that the comet assay failed to detect the presence of DNA damage after a treatment of cells by potassium iodate for concentrations up to 10 mM. This absence of primary DNA damage was confirmed in the cytokinesis-block micronucleus assay. In the same way, results showed that potassium chlorate as well as potassium iodide, bromide and chloride did not induced DNA damage in the alkaline comet assay for doses up to 10 mM. By contrast, potassium bromate exposure led to an increase in both DNA damage and frequency of micronucleated cells. The repair of bromate-induced DNA damage was incomplete 24 h after the end of treatment. These results seem to indicate that potassium bromate would induce DNA damage by several mechanisms besides oxidative stress.
Kim, Soung Min; Jeong, Dasul; Kim, Min Keun; Lee, Sang Shin; Lee, Suk Keun
2017-08-08
Oral squamous cell carcinoma (OSCC) is one of the most dangerous cancers in the body, producing serious complications with individual behaviors. Many different pathogenetic factors are involved in the carcinogenesis of OSCC. Cancer cells derived from oral keratinocytes can produce different carcinogenic signaling pathways through differences in protein expression, but their protein expression profiles cannot be easily explored with ordinary detection methods. The present study compared the protein expression profiles between two different types of OSCCs, which were analyzed through immunoprecipitation high-performance liquid chromatography (IP-HPLC). Two types of squamous cell carcinoma (SCC) occurred in a mandibular (SCC-1) and maxillary gingiva (SCC-2), but their clinical features and progression were quite different from each other. SCC-1 showed a large gingival ulceration with severe halitosis and extensive bony destruction, while SCC-2 showed a relatively small papillary gingival swelling but rapidly grew to form a large submucosal mass, followed by early cervical lymph node metastasis. In the histological observation, SCC-1 was relatively well differentiated with a severe inflammatory reaction, while SCC-2 showed severely infiltrative growth of each cancer islets accompanied with a mild inflammatory reaction. IP-HPLC analysis revealed contrary protein expression profiles analyzed by 72 different oncogenic proteins. SCC-1 showed more cellular apoptosis and invasive growth than SCC-2 through increased expression of caspases, MMPs, p53 signaling, FAS signaling, TGF-β1 signaling, and angiogenesis factors, while SCC-2 showed more cellular growth and survival than SCC-1 through the increased expression of proliferating factors, RAS signaling, eIF5A signaling, WNT signaling, and survivin. The increased trends of cellular apoptosis and invasiveness in the protein expression profiles of SCC-1 were implicative of its extensive gingival ulceration and bony destruction
Energy Technology Data Exchange (ETDEWEB)
Chen, Hang [Molecular Medicine Research Center, Chang Gung University, Taoyuan, Taiwan (China); Department of Cell Biology, Key Laboratory of Cell Biology, Ministry of Public Health, and Key Laboratory of Medical Cell Biology, Ministry of Education, China Medical University, Shenyang 110122 (China); Hsiao, Yung-Chin [Molecular Medicine Research Center, Chang Gung University, Taoyuan, Taiwan (China); Department of Surgery, Chang Gung Memorial Hospital, Linkou, Taiwan (China); Chiang, Sum-Fu [Division of Colon and Rectal Surgery, Chang Gung Memorial Hospital, Linkou, Taiwan (China); Graduate Institute of Clinical Medical Sciences, College of Medicine, Chang Gung University, Taoyuan, Taiwan (China); Wu, Chia-Chun; Lin, Yu-Tsun [Graduate Institute of Biomedical Sciences, College of Medicine, Chang Gung University, Taoyuan, Taiwan (China); Liu, Hsuan [Molecular Medicine Research Center, Chang Gung University, Taoyuan, Taiwan (China); Division of Colon and Rectal Surgery, Chang Gung Memorial Hospital, Linkou, Taiwan (China); Graduate Institute of Biomedical Sciences, College of Medicine, Chang Gung University, Taoyuan, Taiwan (China); Department of Cell and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan, Taiwan (China); Zhao, Hong [Experimental Center of Functional Subjects, College of Basic Medicine, China Medical University, Shenyang, Liaoning 110122 (China); Chen, Jinn-Shiun [Division of Colon and Rectal Surgery, Chang Gung Memorial Hospital, Linkou, Taiwan (China); Chang, Yu-Sun [Molecular Medicine Research Center, Chang Gung University, Taoyuan, Taiwan (China); Department of Otolaryngology, Chang Gung Memorial Hospital, Linkou, Taiwan (China); and others
2016-08-24
The BRAF V600E mutation is one of the most common mutations implicated in the development of several types of cancer including colorectal cancer (CRC), where it is associated with aggressive disease phenotypes and poor outcomes. The status of the BRAF V600E mutation is frequently determined by direct DNA sequencing. However, no previous study has sought to quantify the BRAF V600E protein in cancer specimens. Here, we evaluated immunoenrichment coupled with two MS-based quantitative techniques, namely multiple reaction monitoring (MRM) and single ion monitoring conjugated accurate inclusion mass screening (SIM-AIMS), to detect and precisely quantify wild-type (WT) and V600E mutant BRAF proteins in DNA sequence-confirmed CRC tissue specimens. WT and V600E BRAF proteins were immunoprecipitated from a CRC cell line (HT-29), and their representative peptides ({sup 592}IGDFGLATVK{sup 601} and {sup 592}IGDFGLATEK{sup 601}, respectively) were confirmed by LC-MS/MS analysis and then quantified by MRM or SIM-AIMS with spiked stable isotope-labeled peptide standards. Both assays worked well for measuring WT BRAF from different amounts of HT-29 cell lysates, but the MRM assay was more sensitive than SIM-AIMS assay for quantifying lower levels of V600E BRAF. In protein extracts (2 mg) from 11 CRC tissue specimens, the MRM assay could measure WT BRAF in all 11 cases (0.32–1.66 ng) and the V600E BRAF in two cases (0.1–0.13 ng; mutant-to-WT ratio, 0.16–0.17). The SIM-AIMS assay could also detect WT and V600E BRAF in CRC specimens, but the measured levels of both targets were lower than those determined by MRM assay. Collectively, this study provides an effective method to precisely quantify WT and V600E BRAF proteins in complex biological samples using immunoenrichment-coupled targeted MS. Since the V600E BRAF protein has emerged as an important therapeutic target for cancer, the developed assay should facilitate future BRAF-related basic and clinical studies
Directory of Open Access Journals (Sweden)
Daniela Cajado-Carvalho
2017-11-01
Full Text Available Scorpion stings are the main cause of human envenomation in Brazil and, for the treatment of victims, the World Health Organization (WHO recommends the use of antivenoms. The first step to achieve effective antivenom is to use a good quality venom pool and to evaluate it, with LD50 determination as the most accepted procedure. It is, however, time-consuming and requires advanced technical training. Further, there are significant ethical concerns regarding the number of animals required for testing. Hence, we investigated the correspondence between LD50 results, in vitro assays, and a strong correlation with proteolytic activity levels was observed, showing, remarkably, that proteases are potential toxicity markers for Tityus serrulatus venom. The comparison of reversed-phase chromatographic profiles also has a potential application in venoms’ quality control, as there were fewer neurotoxins detected in the venom with high LD50 value. These results were confirmed by mass spectrometry analysis. Therefore, these methods could precede the LD50 assay to evaluate the venom excellence by discriminating—and discarding—poor-quality batches, and, consequently, with a positive impact on the number of animals used. Notably, proposed assays are fast and inexpensive, being technically and economically feasible in Tityus serrulatus venom quality control to produce effective antivenoms.
Sánchez-Seco, María-Paz; Echevarría, José-Manuel; Hernández, Lourdes; Estévez, Domingo; Navarro-Marí, José-María; Tenorio, Antonio
2003-09-01
Phleboviruses are a large and widespread group of viruses that are transmitted by arthropods. Toscana virus is one of the principal agents that causes meningitis in humans during the summer in Italy and, possibly, in other Mediterranean countries. Rift Valley Fever virus can cause serious illness in both animals and humans, leading to high morbidity and mortality, and is considered to be a potential agent for epizootics and human epidemics. Since information on this group of viruses is still scant, reliable laboratory tools for diagnosis and epidemiological surveillance must be developed, in order to ascertain their real impact on Public Health. Sequence data obtained from Spanish isolates of Toscana virus and other phleboviruses confirmed that natural genome variability may hamper the diagnosis of these agents by molecular methods, so this must be borne in mind when developing reliable assays. In view of the above, a novel and useful protocol has been developed for the detection and specific identification of every member of the phlebovirus genus present in a sample, including Toscana virus, based on a generic RT-nested-PCR, followed by sequencing of the amplified fragment. A change in this method also allowed specific direct detection and identification of wild isolates of Toscana virus of different geographical origin, using newly designed primers. Testing clinical samples with these assays confirmed the role of Toscana virus as an agent that causes acute aseptic meningitis in the central region of Spain. Copyright 2003 Wiley-Liss, Inc.
Assays for calcitonin receptors
International Nuclear Information System (INIS)
Teitelbaum, A.P.; Nissenson, R.A.; Arnaud, C.D.
1985-01-01
The assays for calcitonin receptors described focus on their use in the study of the well-established target organs for calcitonin, bone and kidney. The radioligand used in virtually all calcitonin binding studies is 125 I-labelled salmon calcitonin. The lack of methionine residues in this peptide permits the use of chloramine-T for the iodination reaction. Binding assays are described for intact bone, skeletal plasma membranes, renal plasma membranes, and primary kidney cell cultures of rats. Studies on calcitonin metabolism in laboratory animals and regulation of calcitonin receptors are reviewed
An in-house assay for BK polyomavirus quantification using the Abbott m2000 RealTime system.
Muldrew, Kenneth L; Lovett, Jennie L
2013-11-01
BK polyomavirus (BKPyV) quantification is useful for monitoring renal transplant patient response to therapy. The Abbott m2000 RealTime System employed by some clinical laboratories to perform US Food and Drug Administration-approved assays can also be used to develop in-house assays such as the one presented here. This study aimed to validate an in-house quantitative real-time PCR assay targeting the BKPyV major capsid VP1 gene for assessment of viral load using the Abbott m2000 RealTime System. BKPyV load was measured in 95 urine and plasma samples previously tested for BKPyV by one of three laboratories (46 BKPyV-positive samples consisting of 35 plasma and 11 urine samples; 49 samples negative for BKPyV consisting of 47 plasma and two urine samples). Two additional plasma specimens from the College of American Pathologists proficiency testing survey were also analysed. Precision studies were performed by diluting a high-viral-titre patient sample into BKPyV-negative pooled plasma to create high-positive (6.16 log10 copies ml(-1)) and low-positive (3.16 log10 copies ml(-1)) samples. For precision studies of inter-assay variability, a high-positive (7.0 log10 copies ml(-1)) and a low-positive (3.0 log10 copies ml(-1)) sample were measured in 20 separate runs. The assay's limit of quantification and limit of detection were 2.70 and 2.25 log10 copies ml(-1), respectively. The assay was linear from 2.70 to 9.26 log10 copies ml(-1). Of the 48 known positives, 43 were detected as positive, with three reported by the reference laboratory as values lower than the limit of detection. Two known positives at 3.27 and 3.80 log10 copies ml(-1) tested negative by the m2000 BKPyV assay. Of the 49 known negative samples, 48 were negative by the m2000 BKPyV load assay, with one sample confirmed positive by a reference laboratory. Qualitative analysis prior to discrepancy testing demonstrated a sensitivity of 89.58 % and a specificity of 97.96 %. Precision studies
Experience with confirmation measurement at Los Alamos
International Nuclear Information System (INIS)
Marshall, R.S.; Wagner, R.P.; Hsue, F.
1985-01-01
Confirmation measurements are used at Los Alamos in support of incoming and outgoing shipment accountibility and for support of both at 235 U and Pu inventories. Statistical data are presented to show the consistency of measurements on items of identical composition and on items measured at two facilitis using similar instruments. A description of confirmation measurement techniques used in support of 235 U and Pu inventories and a discussion on the ability of the measurements to identify items with misstated SNM are given
Experience with confirmation measurement at Los Alamos
International Nuclear Information System (INIS)
Marshall, R.S.; Wagner, R.P.
1985-01-01
Confirmation measurements are used at Los Alamos in support of incoming and outgoing shipment accountability and for support of both 235 U and Pu inventories. Statistical data are presented to show the consistency of measurements on items of identical composition and on items measured at two facilities using similar instruments. A description of confirmation measurement techniques used in support of 235 U and Pu inventories and a discussion on the ability of the measurements to identify items with misstated SNM are given
Troubleshooting Requests e-mail Confirmation
TS Department
2004-01-01
In an ongoing effort to improve quality of the repair requests, a new e-mail confirmation automatic system will be implemented starting from the 21st October. All repair requests transmitted to the TCR (72201) or the FM Helpdesk (77777) will be confirmed in an e-mail to the requestor, provided that the latter has a valid e-mail address in the HR database. The e-mail will contain a reference number, a brief description of the problem, the location and a contact where more information can be obtained. A second e-mail will be sent when the processing of the repair request is finished. We hope that this initiative will improve the transparency and quality of our service. Helpdesk Troubleshooting Requests (reminder) We remind you that all the repair requests and other communication concerning the CERN machine buildings have to be transmitted to the TCR via 72201, whereas the ones concerning tertiary buildings are handled directly by the FM helpdesk under the phone number 77777, i.e. problems on systems and equ...
Mouse homologue of yeast Prp19 interacts with mouse SUG1, the regulatory subunit of 26S proteasome
International Nuclear Information System (INIS)
Sihn, Choong-Ryoul; Cho, Si Young; Lee, Jeong Ho; Lee, Tae Ryong; Kim, Sang Hoon
2007-01-01
Yeast Prp19 has been shown to involve in pre-mRNA splicing and DNA repair as well as being an ubiquitin ligase. Mammalian homologue of yeast Prp19 also plays on similar functional activities in cells. In the present study, we isolated mouse SUG1 (mSUG1) as binding partner of mouse Prp19 (mPrp19) by the yeast two-hybrid system. We confirmed the interaction of mPrp9 with mSUG1 by GST pull-down assay and co-immunoprecipitation assay. The N-terminus of mPrp19 including U-box domain was associated with the C-terminus of mSUG1. Although, mSUG1 is a regulatory subunit of 26S proteasome, mPrp19 was not degraded in the proteasome-dependent pathway. Interestingly, GFP-mPrp19 fusion protein was co-localized with mSUG1 protein in cytoplasm as the formation of the speckle-like structures in the presence of a proteasome inhibitor MG132. In addition, the activity of proteasome was increased in cells transfected with mPrp19. Taken together, these results suggest that mPrp19 involves the regulation of protein turnover and may transport its substrates to 26S proteasome through mSUG1 protein
Seo, Woo-Duck; Lee, Ji Hae; Jia, Yaoyao; Wu, Chunyan; Lee, Sung-Joon
2015-11-15
This study investigated the molecular mechanism of saponarin, a flavone glucoside, in the regulation of insulin sensitivity. Saponarin suppressed the rate of gluconeogenesis and increased cellular glucose uptake in HepG2 and TE671 cells by regulating AMPK. Using an in vitro kinase assay, we showed that saponarin did not directly interact with the AMPK protein. Instead, saponarin increased intracellular calcium levels and induced AMPK phosphorylation, which was diminished by co-stimulation with STO-609, an inhibitor of CAMKKβ. Transcription of hepatic gluconeogenesis genes was upregulated by nuclear translocation of CRTC2 and HDAC5, coactivators of CREB and FoxO1 transcription factors, respectively. This nuclear translocation was inhibited by increased phosphorylation of CRTC2 and HDAC5 by saponarin-induced AMPK in HepG2 cells and suppression of CREB and FoxO1 transactivation activities in cells stimulated by saponarin. The results from a chromatin immunoprecipitation assay confirmed the reduced binding of CRTC2 on the PEPCK and G6Pase promoters. In TE671 cells, AMPK phosphorylated HDAC5, which suppressed nuclear penetration and upregulated GLUT4 transcription, leading to enhanced glucose uptake. Collectively, these results suggest that saponarin activates AMPK in a calcium-dependent manner, thus regulating gluconeogenesis and glucose uptake. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Jae-Moon Shin
Full Text Available OBJECTIVE: Melittin (MEL, a major component of bee venom, has been associated with various diseases including arthritis, rheumatism and various cancers. In this study, the anti-angiogenic effects of MEL in CaSki cells that were responsive to the epidermal growth factor (EGF were examined. METHODOLOGY/PRINCIPAL FINDINGS: MEL decreased the EGF-induced hypoxia-inducible factor-1α (HIF-1α protein and significantly regulated angiogenesis and tumor progression. We found that inhibition of the HIF-1α protein level is due to the shortened half-life by MEL. Mechanistically, MEL specifically inhibited the EGF-induced HIF-1α expression by suppressing the phosphorylation of ERK, mTOR and p70S6K. It also blocked the EGF-induced DNA binding activity of HIF-1α and the secretion of the vascular endothelial growth factor (VEGF. Furthermore, the chromatin immunoprecipitation (ChIP assay revealed that MEL reduced the binding of HIF-1α to the VEGF promoter HRE region. The anti-angiogenesis effects of MEL were confirmed through a matrigel plus assay. CONCLUSIONS: MEL specifically suppressed EGF-induced VEGF secretion and new blood vessel formation by inhibiting HIF-1α. These results suggest that MEL may inhibit human cervical cancer progression and angiogenesis by inhibiting HIF-1α and VEGF expression.
Ngo, Tony; Coleman, James L J; Smith, Nicola J
2015-01-01
Orphan G protein-coupled receptors represent an underexploited resource for drug discovery but pose a considerable challenge for assay development because their cognate G protein signaling pathways are often unknown. In this methodological chapter, we describe the use of constitutive activity, that is, the inherent ability of receptors to couple to their cognate G proteins in the absence of ligand, to inform the development of high-throughput screening assays for a particular orphan receptor. We specifically focus on a two-step process, whereby constitutive G protein coupling is first determined using yeast Gpa1/human G protein chimeras linked to growth and β-galactosidase generation. Coupling selectivity is then confirmed in mammalian cells expressing endogenous G proteins and driving accumulation of transcription factor-fused luciferase reporters specific to each of the classes of G protein. Based on these findings, high-throughput screening campaigns can be performed on the already miniaturized mammalian reporter system.
Integrated bioassays in microfluidic devices: botulinum toxin assays.
Mangru, Shakuntala; Bentz, Bryan L; Davis, Timothy J; Desai, Nitin; Stabile, Paul J; Schmidt, James J; Millard, Charles B; Bavari, Sina; Kodukula, Krishna
2005-12-01
A microfluidic assay was developed for screening botulinum neurotoxin serotype A (BoNT-A) by using a fluorescent resonance energy transfer (FRET) assay. Molded silicone microdevices with integral valves, pumps, and reagent reservoirs were designed and fabricated. Electrical and pneumatic control hardware were constructed, and software was written to automate the assay protocol and data acquisition. Detection was accomplished by fluorescence microscopy. The system was validated with a peptide inhibitor, running 2 parallel assays, as a feasibility demonstration. The small footprint of each bioreactor cell (0.5 cm2) and scalable fluidic architecture enabled many parallel assays on a single chip. The chip is programmable to run a dilution series in each lane, generating concentration-response data for multiple inhibitors. The assay results showed good agreement with the corresponding experiments done at a macroscale level. Although the system has been developed for BoNT-A screening, a wide variety of assays can be performed on the microfluidic chip with little or no modification.
Comet assay on mice testicular cells
Directory of Open Access Journals (Sweden)
Anoop Kumar Sharma
2015-05-01
Full Text Available Heritable mutations may result in a variety of adverse outcomes including genetic disease in the offspring. In recent years the focus on germ cell mutagenicity has increased and the “Globally Harmonized System of Classification and Labelling of Chemicals (GHS” has published classification criteria for germ cell mutagens (Speit et al., 2009. The in vivo Comet assay is considered a useful tool for investigating germ cell genotoxicity. In the present study DNA strand breaks in testicular cells of mice were investigated. Different classes of chemicals were tested in order to evaluate the sensitivity of the comet assay in testicular cells. The chemicals included environmentally relevant substances such as Bisphenol A, PFOS and Tetrabrombisphenol A. Statistical power calculations will be presented to aid in the design of future Comet assay studies on testicular cells. Power curves were provided with different fold changes in % tail DNA, different number of cells scored and different number of gels (Hansen et al., 2014. An example is shown in Figure 1. A high throughput version of the Comet assay was used. Samples were scored with a fully automatic comet assay scoring system that provided faster scoring of randomly selected cells.
233U Assay A Neutron NDA System
Energy Technology Data Exchange (ETDEWEB)
Hensley, D.C.; Lucero, A.J.; Pierce, L.
1998-11-17
The assay of highly enriched {sup 233}U material presents some unique challenges. Techniques which apply to the assay of materials of Pu or enriched {sup 235}U do not convert easily over to the assay of {sup 233}U. A specialized neutron assay device is being fabricated to exploit the singles neutron signal, the weak correlated neutron signal, and an active correlated signal. These pieces of information when combined with {gamma} ray isotopics information should give a good overall determination of {sup 233}U material now stored in bldg. 3019 at the Oak Ridge National Laboratory.
Braga, P C; Antonacci, R; Wang, Y Y; Lattuada, N; Dal Sasso, M; Marabini, L; Fibiani, M; Lo Scalzo, R
2013-01-01
The Vaccinium (V.) spp. berries are considered a source of antioxidants, mainly belonging to polyphenols, specifically flavonoids and anthocyanins. Wild genotypes generally contain more antioxidants than cultivated counterparts. So, seven different antioxidants assays on extracts from cultivated and wild Vaccinium berries were performed, to evaluate their difference in terms of bioactivity on oxidative protection and minimum dosage to have a significant action. Four cell-free antioxidant assays (ABTS radical scavenging and electronic paramagnetic resonance using Fremy's salt, superoxide anion and hydroxyl radical), and three assays on human cells (two luminol amplified chemiluminescence, LACL, one on DNA damage, COMET) were used to measure the effects of cultivated blueberry (V. corymbosum) and wild bilberry (V. myrtillus) on the differently induced oxidative stress. Concentrations vs activity patterns were obtained by successive dilutions of extracts in order to identify both EC50 and minimum significant activity (MSA). All the assays (except for the hydroxyl radical scavenging) showed a good relationship mainly with anthocyanin and polyphenol content and the significant greater activity of wild Vaccinium extracts. In fact, LACL data gave an EC50 of 11.8 and an MSA of 5.2 g were calculated as fresh weight dosage in cultivated berries, compared with lower doses in wild berries, EC50 of 5.7 g and MSA of 3.4 g. Wild Vaccinium extracts averaged 3.04 and 2.40 fold more activity than cultivated extracts by EC50 and MSA, respectively. COMET assay confirmed the stronger action on DNA protection in wild samples.
Nanoparticle-assay marker interaction: effects on nanotoxicity assessment
International Nuclear Information System (INIS)
Zhao, Xinxin; Xiong, Sijing; Huang, Liwen Charlotte; Ng, Kee Woei; Loo, Say Chye Joachim
2015-01-01
Protein-based cytotoxicity assays such as lactate dehydrogenase (LDH) and tumor necrosis factor-alpha (TNF-α) are commonly used in cytotoxic evaluation of nanoparticles (NPs) despite numerous reports on possible interactions with protein markers in these assays that can confound the results obtained. In this study, conventional cytotoxicity assays where assay markers may (LDH and TNF- α) or may not (PicoGreen and WST-8) come into contact with NPs were used to evaluate the cytotoxicity of NPs. The findings revealed selective interactions between negatively charged protein assay markers (LDH and TNF- α) and positively charged ZnO NPs under abiotic conditions. The adsorption and interaction with these protein assay markers were strongly influenced by surface charge, concentration, and specific surface area of the NPs, thereby resulting in less than accurate cytotoxic measurements, as observed from actual cell viability measurements. An improved protocol for LDH assay was, therefore, proposed and validated by eliminating any effects associated with protein–particle interactions. In view of this, additional measures and precautions should be taken when evaluating cytotoxicity of NPs with standard protein-based assays, particularly when they are of opposite charges
Nanoparticle-assay marker interaction: effects on nanotoxicity assessment
Energy Technology Data Exchange (ETDEWEB)
Zhao, Xinxin; Xiong, Sijing; Huang, Liwen Charlotte; Ng, Kee Woei, E-mail: kwng@ntu.edu.sg; Loo, Say Chye Joachim, E-mail: joachimloo@ntu.edu.sg [Nanyang Technological University, School of Materials Science and Engineering (Singapore)
2015-01-15
Protein-based cytotoxicity assays such as lactate dehydrogenase (LDH) and tumor necrosis factor-alpha (TNF-α) are commonly used in cytotoxic evaluation of nanoparticles (NPs) despite numerous reports on possible interactions with protein markers in these assays that can confound the results obtained. In this study, conventional cytotoxicity assays where assay markers may (LDH and TNF- α) or may not (PicoGreen and WST-8) come into contact with NPs were used to evaluate the cytotoxicity of NPs. The findings revealed selective interactions between negatively charged protein assay markers (LDH and TNF- α) and positively charged ZnO NPs under abiotic conditions. The adsorption and interaction with these protein assay markers were strongly influenced by surface charge, concentration, and specific surface area of the NPs, thereby resulting in less than accurate cytotoxic measurements, as observed from actual cell viability measurements. An improved protocol for LDH assay was, therefore, proposed and validated by eliminating any effects associated with protein–particle interactions. In view of this, additional measures and precautions should be taken when evaluating cytotoxicity of NPs with standard protein-based assays, particularly when they are of opposite charges.
Nanoparticle-assay marker interaction: effects on nanotoxicity assessment
Zhao, Xinxin; Xiong, Sijing; Huang, Liwen Charlotte; Ng, Kee Woei; Loo, Say Chye Joachim
2015-01-01
Protein-based cytotoxicity assays such as lactate dehydrogenase (LDH) and tumor necrosis factor-alpha (TNF-α) are commonly used in cytotoxic evaluation of nanoparticles (NPs) despite numerous reports on possible interactions with protein markers in these assays that can confound the results obtained. In this study, conventional cytotoxicity assays where assay markers may (LDH and TNF- α) or may not (PicoGreen and WST-8) come into contact with NPs were used to evaluate the cytotoxicity of NPs. The findings revealed selective interactions between negatively charged protein assay markers (LDH and TNF- α) and positively charged ZnO NPs under abiotic conditions. The adsorption and interaction with these protein assay markers were strongly influenced by surface charge, concentration, and specific surface area of the NPs, thereby resulting in less than accurate cytotoxic measurements, as observed from actual cell viability measurements. An improved protocol for LDH assay was, therefore, proposed and validated by eliminating any effects associated with protein-particle interactions. In view of this, additional measures and precautions should be taken when evaluating cytotoxicity of NPs with standard protein-based assays, particularly when they are of opposite charges.
Directory of Open Access Journals (Sweden)
Kazutoyo Miura
Full Text Available Vaccines that interrupt malaria transmission are of increasing interest and a robust functional assay to measure this activity would promote their development by providing a biologically relevant means of evaluating potential vaccine candidates. Therefore, we aimed to qualify the standard membrane-feeding assay (SMFA. The assay measures the transmission-blocking activity of antibodies by feeding cultured P. falciparum gametocytes to Anopheles mosquitoes in the presence of the test antibodies and measuring subsequent mosquito infection. The International Conference on Harmonisation (ICH Harmonised Tripartite Guideline Q2(R1 details characteristics considered in assay validation. Of these characteristics, we decided to qualify the SMFA for Precision, Linearity, Range and Specificity. The transmission-blocking 4B7 monoclonal antibody was tested over 6 feeding experiments at several concentrations to determine four suitable concentrations that were tested in triplicate in the qualification experiments (3 additional feeds to evaluate Precision, Linearity and Range. For Specificity, 4B7 was tested in the presence of normal mouse IgG. We determined intra- and inter-assay variability of % inhibition of mean oocyst intensity at each concentration of 4B7 (lower concentrations showed higher variability. We also showed that % inhibition was dependent on 4B7 concentration and the activity is specific to 4B7. Since obtaining empirical data is time-consuming, we generated a model using data from all 9 feeds and simulated the effects of different parameters on final readouts to improve the assay procedure and analytical methods for future studies. For example, we estimated the effect of number of mosquitoes dissected on variability of % inhibition, and simulated the relationship between % inhibition in oocyst intensity and % inhibition of prevalence of infected mosquitos at different mean oocysts in the control. SMFA is one of the few biological assays used in
Metal-amplified Density Assays, (MADAs), including a Density-Linked Immunosorbent Assay (DeLISA).
Subramaniam, Anand Bala; Gonidec, Mathieu; Shapiro, Nathan D; Kresse, Kayleigh M; Whitesides, George M
2015-02-21
This paper reports the development of Metal-amplified Density Assays, or MADAs - a method of conducting quantitative or multiplexed assays, including immunoassays, by using Magnetic Levitation (MagLev) to measure metal-amplified changes in the density of beads labeled with biomolecules. The binding of target analytes (i.e. proteins, antibodies, antigens) to complementary ligands immobilized on the surface of the beads, followed by a chemical amplification of the binding in a form that results in a change in the density of the beads (achieved by using gold nanoparticle-labeled biomolecules, and electroless deposition of gold or silver), translates analyte binding events into changes in density measureable using MagLev. A minimal model based on diffusion-limited growth of hemispherical nuclei on a surface reproduces the dynamics of the assay. A MADA - when performed with antigens and antibodies - is called a Density-Linked Immunosorbent Assay, or DeLISA. Two immunoassays provided a proof of principle: a competitive quantification of the concentration of neomycin in whole milk, and a multiplexed detection of antibodies against Hepatitis C virus NS3 protein and syphilis T. pallidum p47 protein in serum. MADAs, including DeLISAs, require, besides the requisite biomolecules and amplification reagents, minimal specialized equipment (two permanent magnets, a ruler or a capillary with calibrated length markings) and no electrical power to obtain a quantitative readout of analyte concentration. With further development, the method may be useful in resource-limited or point-of-care settings.
Chromosome aberration assays in Allium
Energy Technology Data Exchange (ETDEWEB)
Grant, W.F.
1982-01-01
The common onion (Allium cepa) is an excellent plant for the assay of chromosome aberrations after chemical treatment. Other species of Allium (A. cepa var. proliferum, A. carinatum, A. fistulosum and A. sativum) have also been used but to a much lesser extent. Protocols have been given for using root tips from either bulbs or seeds of Allium cepa to study the cytological end-points, such as chromosome breaks and exchanges, which follow the testing of chemicals in somatic cells. It is considered that both mitotic and meiotic end-points should be used to a greater extent in assaying the cytogenetic effects of a chemical. From a literature survey, 148 chemicals are tabulated that have been assayed in 164 Allium tests for their clastogenic effect. Of the 164 assays which have been carried out, 75 are reported as giving a positive reaction, 49 positive and with a dose response, 1 positive and temperature-related, 9 borderline positive, and 30 negative; 76% of the chemicals gave a definite positive response. It is proposed that the Allium test be included among those tests routinely used for assessing chromosomal damage induced by chemicals.
White blood cell-based detection of asymptomatic scrapie infection by ex vivo assays.
Directory of Open Access Journals (Sweden)
Sophie Halliez
Full Text Available Prion transmission can occur by blood transfusion in human variant Creutzfeldt-Jakob disease and in experimental animal models, including sheep. Screening of blood and its derivatives for the presence of prions became therefore a major public health issue. As infectious titer in blood is reportedly low, highly sensitive and robust methods are required to detect prions in blood and blood derived products. The objectives of this study were to compare different methods--in vitro, ex vivo and in vivo assays--to detect prion infectivity in cells prepared from blood samples obtained from scrapie infected sheep at different time points of the disease. Protein misfolding cyclic amplification (PMCA and bioassays in transgenic mice expressing the ovine prion protein were the most efficient methods to identify infected animals at any time of the disease (asymptomatic to terminally-ill stages. However scrapie cell and cerebellar organotypic slice culture assays designed to replicate ovine prions in culture also allowed detection of prion infectivity in blood cells from asymptomatic sheep. These findings confirm that white blood cells are appropriate targets for preclinical detection and introduce ex vivo tools to detect blood infectivity during the asymptomatic stage of the disease.
Directory of Open Access Journals (Sweden)
Yiyi Sun
Full Text Available Adiponectin, the adipose-derived hormone, plays an important role in the suppression of metabolic disorders that can result in type 2 diabetes, obesity, and atherosclerosis. It has been shown that up-regulation of adiponectin or adiponectin receptor has a number of therapeutic benefits. Given that it is hard to convert the full size adiponectin protein into a viable drug, adiponectin receptor agonists could be designed or identified using high-throughput screening. Here, we report on the development of a two-step screening process to identify adiponectin agonists. First step, we developed a high throughput screening assay based on fluorescence polarization to identify adiponectin ligands. The fluorescence polarization assay reported here could be adapted to screening against larger small molecular compound libraries. A natural product library containing 10,000 compounds was screened and 9 hits were selected for validation. These compounds have been taken for the second-step in vitro tests to confirm their agonistic activity. The most active adiponectin receptor 1 agonists are matairesinol, arctiin, (--arctigenin and gramine. The most active adiponectin receptor 2 agonists are parthenolide, taxifoliol, deoxyschizandrin, and syringin. These compounds may be useful drug candidates for hypoadiponectin related diseases.
International Nuclear Information System (INIS)
Curtis, A.; Szelke, M.; Fink, G.
1986-01-01
Large precursors have also been predicted using the immunoprecipitation technique which relies upon the identification of large immunoreactive molecules following in vitro translation of mRNA. The mRNA is presumed to represent the largest form of a nascent precursor polypeptide molecule irrespective of the number of biosynthetic cleavage steps which are necessary to liberate the active peptide. However, as has been shown for somatostatin, nonprotein modifications may be made which apparently increase molecular weight, such as glycosylation or phosphorylation of the molecule. The authors employed the immunoprecipitation technique to confirm earlier chromatographic studies that the hypothalamic decapeptide, luteinizing hormone releasing hormone (LHRH) is also synthesized by way of a large precursor form. The authors' finding show that the translation of hypothalamic mRNA produces a primary translation product with an apparent molecule weight of 28,000 which contains an amino acid sequence immunologically similar to that of biologically active LHRH. The procedure involved the incorporation of a radioactive amino acid into polypeptides synthesized by in vitro translation of hypothalamic messenger RNA. The resulting complex protein mixture was immunoprecipitated with a specific anti-LHRH serum, and the immunoprecipitate was identified by polyacrylamide gel electrophoresis and autoradiography
Hemizona Assay and Sperm Penetration Assay in the Prediction of IVF Outcome: A Systematic Review
Directory of Open Access Journals (Sweden)
Paraskevi Vogiatzi
2013-01-01
Full Text Available The limited predictive value of semen analysis in achieving natural conception or in IVF outcome confirms the need for sperm function tests to determine optimal management. We reviewed HZA and SPA predictive power in IVF outcome, with statistical significance of diagnostic power of the assays. HZA was readily efficient in predicting IVF outcome, while evident inconsistency among the studies analysed framed the SPA’s role in male fertility evaluation. Considerable variation was noted in the diagnostic accuracy values of SPA with wide sensitivity (52–100%, specificity (0–100%, and PPV (18–100% and NPV (0–100% together with fluctuation and notable differentiation in methodology and cutoff values employed by each group. HZA methodology was overall consistent with minor variation in cutoff values and oocyte source, while data analysis reported strong correlation between HZA results with IVF outcome, high sensitivity (75–100%, good specificity (57–100%, and high PPV (79–100% and NPV (68–100%. HZA correlated well with IVF outcome and demonstrated better sensitivity/specificity and positive/negative predictive power. Males with normal or slightly abnormal semen profiles could benefit by this intervention and could be evaluated prior to referral to assisted reproduction. HZA should be used in a sequential fashion with semen analysis and potentially other bioassays in an IVF setting.
Joseph, Priya; Calderón, Maritza M.; Gilman, Robert H.; Quispe, Monica L.; Cok, Jaime; Ticona, Eduardo; Chavez, Victor; Jimenez, Juan A.; Chang, Maria C.; Lopez, Martín J.; Evans, Carlton A.
2002-01-01
Toxoplasma gondii is a common life-threatening opportunistic infection. We used experimental murine T. gondii infection to optimize the PCR for diagnostic use, define its sensitivity, and characterize the time course and tissue distribution of experimental toxoplasmosis. PCR conditions were adjusted until the assay reliably detected quantities of DNA derived from less than a single parasite. Forty-two mice were inoculated intraperitoneally with T. gondii tachyzoites and sacrificed from 6 to 72 h later. Examination of tissues with PCR and histology revealed progression of infection from blood to lung, heart, liver, and brain, with PCR consistently detecting parasites earlier than microscopy and with no false-positive results. We then evaluated the diagnostic value of this PCR assay in human patients. We studied cerebrospinal fluid and serum samples from 12 patients with AIDS and confirmed toxoplasmic encephalitis (defined as positive mouse inoculation and/or all of the Centers for Disease Control clinical diagnostic criteria), 12 human immunodeficiency virus-infected patients with suspected cerebral toxoplasmosis who had neither CDC diagnostic criteria nor positive mouse inoculation, 26 human immunodeficiency virus-infected patients with other opportunistic infections and no signs of cerebral toxoplasmosis, and 18 immunocompetent patients with neurocysticercosis. Eleven of the 12 patients with confirmed toxoplasmosis had positive PCR results in either blood or cerebrospinal fluid samples (6 of 9 blood samples and 8 of 12 cerebrospinal fluid samples). All samples from control patients were negative. This study demonstrates the high sensitivity, specificity, and clinical utility of PCR in the diagnosis of toxoplasmic encephalitis in a resource-poor setting. PMID:12454142
Mugii, Naoki; Hasegawa, Minoru; Matsushita, Takashi; Hamaguchi, Yasuhito; Oohata, Sacihe; Okita, Hirokazu; Yahata, Tetsutarou; Someya, Fujiko; Inoue, Katsumi; Murono, Shigeyuki; Fujimoto, Manabu; Takehara, Kazuhiko
2016-01-01
Objective Dysphagia develops with low frequency in patients with dermatomyositis. Our objective was to determine the clinical and laboratory features that can estimate the development of dysphagia in dermatomyositis. Methods This study included 92 Japanese patients with adult-onset dermatomyositis. The associations between dysphagia and clinical and laboratory features including disease-specific autoantibodies determined by immunoprecipitation assays were analyzed. Results Videofluoroscopy sw...
Automation of cell-based drug absorption assays in 96-well format using permeable support systems.
Larson, Brad; Banks, Peter; Sherman, Hilary; Rothenberg, Mark
2012-06-01
Cell-based drug absorption assays, such as Caco-2 and MDCK-MDR1, are an essential component of lead compound ADME/Tox testing. The permeability and transport data they provide can determine whether a compound continues in the drug discovery process. Current methods typically incorporate 24-well microplates and are performed manually. Yet the need to generate absorption data earlier in the drug discovery process, on an increasing number of compounds, is driving the use of higher density plates. A simple, more efficient process that incorporates 96-well permeable supports and proper instrumentation in an automated process provides more reproducible data compared to manual methods. Here we demonstrate the ability to perform drug permeability and transport assays using Caco-2 or MDCKII-MDR1 cells. The assay procedure was automated in a 96-well format, including cell seeding, media and buffer exchanges, compound dispense, and sample removal using simple robotic instrumentation. Cell monolayer integrity was confirmed via transepithelial electrical resistance and Lucifer yellow measurements. Proper cell function was validated by analyzing apical-to-basolateral and basolateral-to-apical movement of rhodamine 123, a known P-glycoprotein substrate. Apparent permeability and efflux data demonstrate how the automated procedure provides a less variable method than manual processing, and delivers a more accurate assessment of a compound's absorption characteristics.
... this page: //medlineplus.gov/ency/article/003679.htm Factor IX assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...
... this page: //medlineplus.gov/ency/article/003678.htm Factor VIII assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...
... this page: //medlineplus.gov/ency/article/003674.htm Factor II assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...
... this page: //medlineplus.gov/ency/article/003676.htm Factor VII assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...
Multiplexing a high-throughput liability assay to leverage efficiencies.
Herbst, John; Anthony, Monique; Stewart, Jeremy; Connors, David; Chen, Taosheng; Banks, Martyn; Petrillo, Edward W; Agler, Michele
2009-06-01
In order to identify potential cytochrome P-450 3A4 (drug-metabolizing enzyme) inducers at an early stage of the drug discovery process, a cell-based transactivation high-throughput luciferase reporter assay for the human pregnane X receptor (PXR) in HepG2 cells has been implemented and multiplexed with a viability end point for data interpretation, as part of a Lead Profiling portfolio of assays. As a routine part of Lead Profiling operations, assays are periodically evaluated for utility as well as for potential improvements in technology or process. We used a recent evaluation of our PXR-transactivation assay as a model for the application of Lean Thinking-based process analysis to lab-bench assay optimization and automation. This resulted in the development of a 384-well multiplexed homogeneous assay simultaneously detecting PXR transactivation and HepG2 cell cytotoxicity. In order to multiplex fluorescent and luminescent read-outs, modifications to each assay were necessary, which included optimization of multiple assay parameters such as cell density, plate type, and reagent concentrations. Subsequently, a set of compounds including known cytotoxic compounds and PXR inducers were used to validate the multiplexed assay. Results from the multiplexed assay correlate well with those from the singleplexed assay formats measuring PXR transactivation and viability separately. Implementation of the multiplexed assay for routine compound profiling provides improved data quality, sample conservation, cost savings, and resource efficiencies.
de Waaij, Dewi J; Ouburg, Sander; Dubbink, Jan Henk; Peters, Remco P H; Morré, Servaas A
2016-08-01
This is an evaluation study of the Presto(plus) Assay for T. vaginalis by comparing to the TIB MOLBIOL LightMix Kit Trichomonas vaginalis Assay using 615 dry collected vaginal and rectal swabs. Discordant samples were analyzed by the Qiagen® Microbial DNA qPCR for TV Assay. Both assays showed comparable performances (McNemar p>0.05). Copyright © 2016 Elsevier B.V. All rights reserved.
Nondestructive assay methods for irradiated nuclear fuels
International Nuclear Information System (INIS)
Hsue, S.T.; Crane, T.W.; Talbert, W.L. Jr.; Lee, J.C.
1978-01-01
This report is a review of the status of nondestructive assay (NDA) methods used to determine burnup and fissile content of irradiated nuclear fuels. The gamma-spectroscopy method measures gamma activities of certain fission products that are proportional to the burnup. Problems associated with this method are migration of the fission products and gamma-ray attenuation through the relatively dense fuel material. The attenuation correction is complicated by generally unknown activity distributions within the assemblies. The neutron methods, which usually involve active interrogation and prompt or delayed signal counting, are designed to assay the fissile content of the spent-fuel elements. Systems to assay highly enriched spent-fuel assemblies have been tested extensively. Feasibility studies have been reported of systems to assay light-water reactor spent-fuel assemblies. The slowing-down spectrometer and neutron resonance absorption methods can distinguish between the uranium and plutonium fissile contents, but they are limited to the assay of individual rods. We have summarized the status of NDA techniques for spent-fuel assay and present some subjects in need of further investigation. Accuracy of the burnup calculations for power reactors is also reviewed
Directory of Open Access Journals (Sweden)
Haoyou Wang
2017-04-01
Full Text Available Background/Aims: Long non-coding RNAs (lncRNAs are key players in the development and progression of human cancers. The lncRNA XIST (X-inactive specific transcript has been shown to be upregulated in human non-small cell lung cancer (NSCLC; however, its role and molecular mechanisms in NSCLC cell progression remain unclear. Methods: qRT-PCR was conducted to assess the expression of XIST and miR-186. Cell proliferation was detected using MTT assay. Cell invasion and migration were evaluated using transwell assay. Cell cycle distribution and apoptosis rates were analyzed by flow cytometry. Luciferase reporter assay was used to identify the direct regulation of XIST and miR-186. A RNA immunoprecipitation was used to analyze whether XIST was associated with the RNA-induced silencing complex (RISC. Results: We confirmed that XIST was upregulated in NSCLC cell lines and tissues. Functionally, XIST knockdown inhibited cancer cell proliferation and invasion, and induced apoptosis in vitro, and suppressed subcutaneous tumor growth in vivo. Mechanistic investigations revealed a reciprocal repressive interaction between XIST and miR-186-5p. Furthermore, we showed that miR-186-5p has a binding site for XIST. Our data also indicated that XIST and miR-186-5p are likely in the same RNA induced silencing complex. Conclusion: Together, our data revealed that XIST knockdown confers suppressive function in NSCLC and XIST may be a novel therapeutic marker in this disease.
Directory of Open Access Journals (Sweden)
Qiang Liu
Full Text Available BACKGROUND: The presence of various levels of Adenovirus serotype 5 neutralizing antibodies (Ad5NAb is thought to contribute to the inconsistent clinical results obtained from vaccination and gene therapy studies. Currently, two platforms based on high-throughput technology are available for Ad5NAb quantification, chemiluminescence- and fluorescence-based assays. The aim of this study was to compare the results of two assays in the seroepidemiology of Ad5NAb in a local population of donors. METHODOLOGY/PRINCIPAL FINDINGS: The fluorescence-based neutralizing antibody detection test (FRNT using recombinant Ad5-EGFP virus and the chemiluminescence-based neutralizing antibody test (CLNT using Ad5-Fluc were developed and standardized for detecting the presence of Ad5NAb in serum samples from the population of donors in Beijing and Anhui provinces, China. First, the overall percentage of people positive for Ad5NAb performed by CLNT was higher than that obtained by FRNT (85.4 vs 69.9%, p<0.001. There was an 84.5% concordance between the two assays for the 206 samples tested (144 positive in both assays and 30 negative in both assays. All 32 discordant sera were CLNT-positive/FRNT-negative and were confirmed positive by western blot. Secondly, for all 144 sera positive by both assays, the two assays showed high correlation (r = 0.94, p<0.001 and close agreement (mean difference: 0.395 log(10, 95% CI: -0.054 log(10 to 0.845 log(10. Finally, it was found by both assays that there was no significant difference observed for titer or prevalence by gender (p = 0.503 vs 0.818, for two assays; however, age range (p = 0.049 vs 0.010 and geographic origin (p = 0.007 vs 0.011 were correlated with Ad5NAb prevalence in northern regions of China. CONCLUSION: The CLNT assay was relatively more simple and had higher sensitivity than the FRNT assay for determining Ad5NAb titers. It is strongly suggested that the CLNT assay be used for future
Bosserman, Linda; Prendergast, Franklyn; Herbst, Roy; Fleisher, Martin; Salom, Emery; Strickland, Steven; Raptis, Anastasios; Hallquist, Allan; Perree, Mathieu; Rajurkar, Swapnil; Karimi, Misagh; Rogers, Karl; Davidson, Dirk; Willis, Carl; Penalver, Manuel; Homesley, Howard; Burrell, Matthew; Garrett, Audrey; Rutledge, James; Chernick, Michael; Presant, Cary A
2012-08-15
A drug-induced apoptosis assay, termed the microculture-kinetic (MiCK) assay, has been developed. Blinded clinical trials have shown higher response rates and longer survival in groups of patients with acute myelocytic leukemia and epithelial ovarian cancer who have been treated with drugs that show high apoptosis in the MiCK assay. Unblinded clinical trials in multiple tumor types have shown that the assay will be used frequently by clinicians to determine treatment, and when used, results in higher response rates, longer times to relapse, and longer survivals. Model economic analyses suggest possible cost savings in clinical use based on increased generic drug use and single-agent substitution for combination therapies. Two initial studies with drugs in development are promising. The assay may help reduce costs and speed time to drug approval. Correlative studies with molecular biomarkers are planned. This assay may have a role both in personalized clinical therapy and in more efficient drug development. ©2012 AACR.
Korse, Catharina M; Buning-Kager, Johanna C G M; Linders, Theodora C; Heijboer, Annemieke C; van den Broek, Daan; Tesselaar, Margot E T; van Tellingen, Olaf; van Rossum, Huub H
2017-06-01
Serotonin is used for the diagnosis and follow-up of neuroendocrine tumors (NET). We describe the analytical and clinical validation of a liquid chromatography tandem mass spectrometry (LC-MS/MS) based serotonin assay for serum and platelet-rich plasma (PRP). An LC-MS/MS based method for serum and PRP serotonin was validated by determination of assay imprecision, carry-over, linearity, interference, recovery, sample stability and a matrix/method comparison of serum and PRP serotonin was made with whole blood serotonin. Furthermore, upper limits of normal were determined and serotonin concentrations of healthy individuals, 14 NET patients without evidence of disease and 51 NET patients with evidence of disease were compared. For serum and PRP fractions, total assay imprecision was serotonin upper limit of normal were 5.5nmol/10 9 platelet and 5.1nmol/10 9 platelet, respectively. NET patients with confirmed evidence of disease had significantly higher serum and PRP serotonin levels when compared to NET patients without evidence of disease and healthy volunteers. LC-MS/MS based serum and PRP serotonin assays were developed with suitable analytical characteristics. Furthermore, serum and PRP serotonin was found to be useful for monitoring NET patients. Copyright © 2017 Elsevier B.V. All rights reserved.
An essential GT motif in the lamin A promoter mediates activation by CREB-binding protein
International Nuclear Information System (INIS)
Janaki Ramaiah, M.; Parnaik, Veena K.
2006-01-01
Lamin A is an important component of nuclear architecture in mammalian cells. Mutations in the human lamin A gene lead to highly degenerative disorders that affect specific tissues. In studies directed towards understanding the mode of regulation of the lamin A promoter, we have identified an essential GT motif at -55 position by reporter gene assays and mutational analysis. Binding of this sequence to Sp transcription factors has been observed in electrophoretic mobility shift assays and by chromatin immunoprecipitation studies. Further functional analysis by co-expression of recombinant proteins and ChIP assays has shown an important regulatory role for CREB-binding protein in promoter activation, which is mediated by the GT motif
Response to challenging dose of x-rays as a predictive assay for molecular epidemiology
International Nuclear Information System (INIS)
Cebulska-Wasilewska, A.
2003-01-01
Human biomonitoring, as a tool to identify or quantify the potential risk from genotoxic exposures, has gained increasing interest especially in the areas of cancer risk assessment and diseases treatment. Chromosome aberrations resulting from direct DNA breakage or from inhibition of DNA repair or synthesis, measured in peripheral blood lymphocytes have been used in occupational health surveillance programs in order to assess risks from exposures. Many results in our human monitoring studies have shown influence of the environmental or occupational exposure on the cytogenetic damage detected in lymphocytes, confirming both, the association with adverse health outcome and the influence of life style related confounding factors. Susceptibility to the environmental agent actions was also evaluated in lymphocytes in the studies of variation between responses to the challenging dose of UV or X-rays followed by the evaluation of the repair capacity of the DNA damage induced by a challenging dose. The induced and residual DNA damage was analyzed with the use of SCGE assay. Susceptibility and repair capacities of healthy donors and cancer patients were compared. Studies have shown a good correlation between DNA damage induced in vivo or in vitro and cytogenetic measures. Results from studies on susceptibilities and repair competence performed in occupationally exposed and unexposed 475 healthy donors and patients with diagnosed cancer are discussed. Significantly lower efficiency of repair process was observed in cancer patients. The possible effects on repair competency of various occupational exposures and influence of the diet and other confounding factors is shown. Although in our preliminary studies comet assay failed to detect DNA damage repair disorders in a teratoma immature infant, though, prospective use of a challenging dose of radiation combined with the comet assay as a predictive assay is suggested and limitation discussed
Radioligand assay in reproductive biology
International Nuclear Information System (INIS)
Korenman, S.G.; Sherman, B.M.
1975-01-01
Radioligand assays have been developed for the principal reproductive steroids and peptide hormones. Specific binding reagents have included antibodies, plasma binders, and intracellular receptors. In each assay, problems of specificity, sensitivity, and nonspecific inhibitors were encountered. Many features of the endocrine physiology in childhood, during puberty, and in adulthood have been characterized. Hormonal evaluations of endocrine disorders of reproduction are characterized on the basis of their characteristic pathophysiologic alterations. (U.S.)
Partin, Alan W; Van Neste, Leander; Klein, Eric A; Marks, Leonard S; Gee, Jason R; Troyer, Dean A; Rieger-Christ, Kimberly; Jones, J Stephen; Magi-Galluzzi, Cristina; Mangold, Leslie A; Trock, Bruce J; Lance, Raymond S; Bigley, Joseph W; Van Criekinge, Wim; Epstein, Jonathan I
2014-10-01
The DOCUMENT multicenter trial in the United States validated the performance of an epigenetic test as an independent predictor of prostate cancer risk to guide decision making for repeat biopsy. Confirming an increased negative predictive value could help avoid unnecessary repeat biopsies. We evaluated the archived, cancer negative prostate biopsy core tissue samples of 350 subjects from a total of 5 urological centers in the United States. All subjects underwent repeat biopsy within 24 months with a negative (controls) or positive (cases) histopathological result. Centralized blinded pathology evaluation of the 2 biopsy series was performed in all available subjects from each site. Biopsies were epigenetically profiled for GSTP1, APC and RASSF1 relative to the ACTB reference gene using quantitative methylation specific polymerase chain reaction. Predetermined analytical marker cutoffs were used to determine assay performance. Multivariate logistic regression was used to evaluate all risk factors. The epigenetic assay resulted in a negative predictive value of 88% (95% CI 85-91). In multivariate models correcting for age, prostate specific antigen, digital rectal examination, first biopsy histopathological characteristics and race the test proved to be the most significant independent predictor of patient outcome (OR 2.69, 95% CI 1.60-4.51). The DOCUMENT study validated that the epigenetic assay was a significant, independent predictor of prostate cancer detection in a repeat biopsy collected an average of 13 months after an initial negative result. Due to its 88% negative predictive value adding this epigenetic assay to other known risk factors may help decrease unnecessary repeat prostate biopsies. Copyright © 2014 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
A high-throughput screening assay for eukaryotic elongation factor 2 kinase inhibitors
Directory of Open Access Journals (Sweden)
Ting Xiao
2016-10-01
Full Text Available Eukaryotic elongation factor 2 kinase (eEF2K inhibitors may aid in the development of new therapeutic agents to combat cancer. Purified human eEF2K was obtained from an Escherichia coli expression system and a luminescence-based high-throughput screening (HTS assay was developed using MH-1 peptide as the substrate. The luminescent readouts correlated with the amount of adenosine triphosphate remaining in the kinase reaction. This method was applied to a large-scale screening campaign against a diverse compound library and subsequent confirmation studies. Nine initial hits showing inhibitory activities on eEF2K were identified from 56,000 synthetic compounds during the HTS campaign, of which, five were chosen to test their effects in cancer cell lines.
Thermometric enzyme linked immunosorbent assay: TELISA.
Mattiasson, B; Borrebaeck, C; Sanfridson, B; Mosbach, K
1977-08-11
A new method, thermometric enzyme linked immunosorbent assay (TELISA), for the assay of endogenous and exogenous compounds in biological fluids is described. It is based on the previously described enzyme linked immunosorbent assay technique, ELISA, but utilizes enzymic heat formation which is measured in an enzyme thermistor unit. In the model system studied determination of human serum albumin down to a concentration of 10(-10) M (5 ng/ml) was achieved, with both normal and catalase labelled human serum albumin competing for the binding sites on the immunosorbent, which was rabbit antihuman serum albumin immobilized onto Sepharose CL-4B.
Directory of Open Access Journals (Sweden)
Marize Quinhones Pires
2014-04-01
Full Text Available Introduction During a diagnostic evaluation of canine visceral leishmaniasis (VL, two of seventeen dogs were found to be co-infected by Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi. Methods Specific polymerase chain reaction (PCR and restriction fragment length polymorphism-PCR (RFLP-PCR assays were performed. Results PCR assays for Leishmania subgenus identification followed by RFLP-PCR analysis in biopsies from cutaneous lesions and the spleen confirmed the presence of Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi in those fragments. Conclusions This report reinforces the importance of using serological and molecular techniques in the epidemiological surveillance of canine populations in endemic areas in which both diseases are known to co-exist. In such cases, a reassessment of the control measures is required.
Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao
2013-11-27
The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.
van Doorn, H. Rogier; Koelewijn, Rob; Hofwegen, Henk; Gilis, Henk; Wetsteyn, Jose C. F. M.; Wismans, Pieter J.; Sarfati, Claudine; Vervoort, Tony; van Gool, Tom
2007-01-01
A homemade enzyme-linked immunosorbent assay (ELISA) (Academic Medical Center ELISA [AMC-ELISA]) and a dipstick assay for the detection of anti-Strongyloides stercoralis antibodies in serum were developed and evaluated together with two commercially available ELISAs (IVD-ELISA [IVD Research, Inc.
International Nuclear Information System (INIS)
Nakamura, H.; Nakamichi, H.; Mukai, Y.; Yoshimoto, K.; Beddingfield, D.H.
2010-01-01
To reduce radioactivity of liquid waste generated at PCDF, a neutralization precipitation processes of radioactive nuclides by sodium hydroxide is used. We call the precipitate a 'sludge' after calcination. Pu mass in the sludge is normally determined by sampling and DA within the required uncertainty on DIQ. Annual yield of the mass is small but it accumulates and reaches to a few kilograms, so it is declared as retained waste and verified at PIV. A HM-5-based verification is applied for sludge verification. The sludge contains many chemical components. For example, Pu (-10wt%), U, Am, SUS components, halogens, NaNO 3 (main component), residual NaOH, and moisture. They are mixed together as an impure heterogeneous sludge sample. As a result, there is a large uncertainty in the sampling and DA that is currently used at PCDF. In order to improve the material accounting, we performed a feasibility study using neutron multiplicity assay for impure sludge samples. We have measured selected sludge samples using a multiplicity counter which is called FCAS (Fast Carton Assay System) which was designed by JAEA and Canberra. The PCDF sludge materials fall into the category of 'difficult to measure' because of the high levels of impurities, high alpha values and somewhat small Pu mass. For the sludge measurements, it was confirmed that good consistency between Pu mass in a pure sludge standard (PuO 2 -Na 2 U 2 O 7 , alpha=7) and the DA could be obtained. For unknown samples, using 14-hour measurements, we could obtain quite low statistical uncertainty on Doubles (-1%) and Triples (-10%) count rate although the alpha value was extremely high (15-25) and FCAS efficiency was relatively low (40%) for typical multiplicity counters. Despite the detector efficiency challenges and the material challenges (high alpha, low Pu mass, heterogeneous matrix), we have been able to obtain assay results that greatly exceed the accountancy requirements for retained waste materials. We have
Directory of Open Access Journals (Sweden)
Scott A Nabity
Full Text Available Diagnosis of leptospirosis by the gold standard serologic assay, the microscopic agglutination test (MAT, requires paired sera and is not widely available. We developed a rapid assay using immunodominant Leptospira immunoglobulin-like (Lig proteins in a Dual Path Platform (DPP. This study aimed to evaluate the assay's diagnostic performance in the setting of urban transmission.We determined test sensitivity using 446 acute and convalescent sera from MAT-confirmed case-patients with severe or mild leptospirosis in Brazil. We assessed test specificity using 677 sera from the following groups: healthy residents of a Brazilian slum with endemic transmission, febrile outpatients from the same slum, healthy blood donors, and patients with dengue, hepatitis A, and syphilis. Three operators independently interpreted visual results without knowing specimen status.The overall sensitivity for paired sera was 100% and 73% for severe and mild disease, respectively. In the acute phase, the assay achieved a sensitivity of 85% and 64% for severe and mild leptospirosis, respectively. Within seven days of illness onset, the assay achieved a sensitivity of 77% for severe disease and 60% for mild leptospirosis. Sensitivity of the DPP assay was similar to that for IgM-ELISA and increased with both duration of symptoms (chi-square regression P = 0.002 and agglutinating titer (Spearman ρ = 0.24, P<0.001. Specificity was ≥93% for dengue, hepatitis A, syphilis, febrile outpatients, and blood donors, while it was 86% for healthy slum residents. Inter-operator agreement ranged from very good to excellent (kappa: 0.82-0.94 and test-to-test reproducibility was also high (kappa: 0.89.The DPP assay performed acceptably well for diagnosis of severe acute clinical leptospirosis and can be easily implemented in hospitals and health posts where leptospirosis is a major public health problem. However, test accuracy may need improvement for mild disease and early stage
Development of the Performance Confirmation Program at Yucca Mountain, Nevada
International Nuclear Information System (INIS)
G.D. LeCain; D. Barr; D. Weaver; R. Snell; S.W. Goodin; F.D. Hansen
2006-01-01
The Yucca Mountain Performance Confirmation program consists of tests, monitoring activities, experiments, and analyses to evaluate the adequacy of assumptions, data, and analyses that form the basis of the conceptual and numerical models of flow and transport associated with a proposed radioactive waste repository at Yucca Mountain, Nevada. The Performance Confirmation program uses an eight-stage risk-informed, performance-based approach. Selection of the Performance Confirmation activities (a parameter and a test method) for inclusion in the Performance Confirmation program was done using a risk-informed performance-based decision analysis. The result of this analysis and review was a Performance Confirmation base portfolio that consists of 20 activities. The 20 Performance Confirmation activities include geologic, hydrologic, and construction/engineering testing. Several of the activities were initiated during site characterization and are ongoing. Others activities will commence during construction and/or post emplacement and will continue until repository closure
Parallel force assay for protein-protein interactions.
Aschenbrenner, Daniela; Pippig, Diana A; Klamecka, Kamila; Limmer, Katja; Leonhardt, Heinrich; Gaub, Hermann E
2014-01-01
Quantitative proteome research is greatly promoted by high-resolution parallel format assays. A characterization of protein complexes based on binding forces offers an unparalleled dynamic range and allows for the effective discrimination of non-specific interactions. Here we present a DNA-based Molecular Force Assay to quantify protein-protein interactions, namely the bond between different variants of GFP and GFP-binding nanobodies. We present different strategies to adjust the maximum sensitivity window of the assay by influencing the binding strength of the DNA reference duplexes. The binding of the nanobody Enhancer to the different GFP constructs is compared at high sensitivity of the assay. Whereas the binding strength to wild type and enhanced GFP are equal within experimental error, stronger binding to superfolder GFP is observed. This difference in binding strength is attributed to alterations in the amino acids that form contacts according to the crystal structure of the initial wild type GFP-Enhancer complex. Moreover, we outline the potential for large-scale parallelization of the assay.
Linearization of the bradford protein assay.
Ernst, Orna; Zor, Tsaffrir
2010-04-12
Determination of microgram quantities of protein in the Bradford Coomassie brilliant blue assay is accomplished by measurement of absorbance at 590 nm. This most common assay enables rapid and simple protein quantification in cell lysates, cellular fractions, or recombinant protein samples, for the purpose of normalization of biochemical measurements. However, an intrinsic nonlinearity compromises the sensitivity and accuracy of this method. It is shown that under standard assay conditions, the ratio of the absorbance measurements at 590 nm and 450 nm is strictly linear with protein concentration. This simple procedure increases the accuracy and improves the sensitivity of the assay about 10-fold, permitting quantification down to 50 ng of bovine serum albumin. Furthermore, the interference commonly introduced by detergents that are used to create the cell lysates is greatly reduced by the new protocol. A linear equation developed on the basis of mass action and Beer's law perfectly fits the experimental data.
Nondestructive assay of HTGR fuel rods
International Nuclear Information System (INIS)
Menlove, H.O.
1974-01-01
Performance characteristics of three different radioactive source NDA systems are compared for the assay of HTGR fuel rods and stacks of rods. These systems include the fast neutron Sb-Be assay system, the 252 Cf ''Shuffler,'' and the thermal neutron PAPAS assay system. Studies have been made to determinethe perturbation on the measurements from particle size, kernel Th/U ratio, thorium content, and hydrogen content. In addition to the total 235 U determination, the pellet-to-pellet or rod-to-rod uniformity of HTGR fuel rod stacks has been measured by counting the delayed gamma rays with a NaI through-hole in the PAPAS system. These measurements showed that rod substitutions can be detected easily in a fuel stack, and that detailed information is available on the loading variations in a uniform stack. Using a 1.0 mg 252 Cf source, assay rates of 2 to 4 rods/s are possible, thus facilitating measurement of 100 percent of a plant's throughput. (U.S.)
International Nuclear Information System (INIS)
Vrijsen, R.; Rombaut, B.; Boeye, A.
1983-01-01
Staphylococcus aureus (Cowan strain I) was used to absorb immune complexes from antiserum to poliovirus to which labeled N or H poliovirus antigens had been added, and the radioactivity in the pelleted organisms and in the supernatant was measured. Excellent agreement was obtained between values calculated separately from the pellet and supernatant readings, validating the use of supernatant measurements from a microtitration plate method. (Auth.)
Barcoded microchips for biomolecular assays.
Zhang, Yi; Sun, Jiashu; Zou, Yu; Chen, Wenwen; Zhang, Wei; Xi, Jianzhong Jeff; Jiang, Xingyu
2015-01-20
Multiplexed assay of analytes is of great importance for clinical diagnostics and other analytical applications. Barcode-based bioassays with the ability to encode and decode may realize this goal in a straightforward and consistent manner. We present here a microfluidic barcoded chip containing several sets of microchannels with different widths, imitating the commonly used barcode. A single barcoded microchip can carry out tens of individual protein/nucleic acid assays (encode) and immediately yield all assay results by a portable barcode reader or a smartphone (decode). The applicability of a barcoded microchip is demonstrated by human immunodeficiency virus (HIV) immunoassays for simultaneous detection of three targets (anti-gp41 antibody, anti-gp120 antibody, and anti-gp36 antibody) from six human serum samples. We can also determine seven pathogen-specific oligonucleotides by a single chip containing both positive and negative controls.
International Nuclear Information System (INIS)
Raymond, J.R.; Fargin, A.; Lohse, M.J.; Regan, J.W.; Senogles, S.E.; Lefkowitz, R.J.; Caron, M.G.
1989-01-01
The ligand-binding subunit of the human 5-hydroxytryptamine1A (5-HT1A) receptor transiently expressed in COS-7 cells and of the native human 5-HT1A receptor derived from hippocampus and frontal cortex were identified by photoaffinity labeling with N-(p-azido-m-[125I]iodophenethyl)spiperone [( 125I]N3-NAPS), previously characterized as a high affinity radioiodinated D2-dopamine receptor probe. The identity of the ligand-binding subunit was confirmed by immunoprecipitation with an antipeptide rabbit antiserum, JWR21, raised against a synthetic peptide derived from the predicted amino acid sequence of the putative third intracellular loop of the human 5-HT1A receptor. In transiently transfected COS-7 cells expressing 14 +/- 3 pmol/mg of protein human 5-HT1A receptors, a single broad 75-kDa band was photoaffinity labeled by [125I]N3-NAPS. This band displayed the expected pharmacology of the 5-HT1A receptor, as evidenced by the ability of a series of competing ligands to block [125I]N3-NAPS photoincorporation. Moreover, antiserum JWR21 specifically and quantitatively immunoprecipitated the 75-kDa photoaffinity-labeled band from a soluble extract of the transfected COS-7 cell membranes, further confirming its identity. Finally, utilizing a combination of photoaffinity labeling and immunoprecipitation, the native ligand-binding subunit of 62-64 kDa was identified in human hippocampus and frontal cortex. The availability of the high specific activity, high affinity, photoaffinity ligand [125I]N3-NAPS and of a potent immunoprecipitating antiserum (JWR21) should greatly facilitate the biochemical characterization of the human 5-HT1A receptor
Performance characteristics of the ARCHITECT anti-HCV assay.
Jonas, Gesa; Pelzer, Claudia; Beckert, Christian; Hausmann, Michael; Kapprell, Hans-Peter
2005-10-01
The ARCHITECT Anti-HCV assay is a fully automated high throughput chemiluminescent microparticle immunoassay (CMIA) for the detection of antibodies to structural and nonstructural proteins of the hepatitis C virus (HCV). To further enhance the performance of this test, the assay was modified to improve the specificity for blood donor specimens. The specificity of the enhanced ARCHITECT Anti-HCV assay was evaluated by screening blood donor samples randomly collected from various German blood banks, as well as hospitalized patient samples derived from Germany and the US. Additionally, antibody sensitivity was determined on commercially available anti-HCV seroconversion panels and on a commercially available worldwide anti-HCV genotype performance panel. Apparent specificity of the modified ARCHITECT Anti-HCV assay in a blood donor population consisting of 3811 specimens was 99.92%, compared to 99.76% for the current on-market assay. Additionally, antibody sensitivity was determined on commercially available anti-HCV seroconversion panels. Seroconversion sensitivity equivalent to or better than the current on-market product was observed by testing 33 seroconversion panels. This study demonstrates that the modified version of the ARCHITECT Anti-HCV assay shows improved specificity for blood donor specimens compared to the current assay on market without compromising sensitivity. With the availability of the improved ARCHITECT Anti-HCV assay and the recent launch of the ARCHITECT HIV Ag/Ab Combo assay, the ARCHITECT system now offers a full hepatitis/retrovirus menu with excellent performance on a high throughput, random access, automated analyzer, ideally suited for blood screening and diagnostic applications.
Short communication. Microculture syncytia assay for bovine leukemia virus
Energy Technology Data Exchange (ETDEWEB)
Paul, P.S.; Castro, A.E.; Pomeroy, K.A.; Johnson, D.W.; Muscoplat, C.C.
1978-01-01
A microculture syncytia assay for the detection of bovine leukemia virus (BLV) has been described and compared with the conventional macroculture assay. The microculture assay required fewer indicator cells, was as sensitive as the macroculture assay and provided a reproducible test for the detection and titration of BLV.