WorldWideScience

Sample records for immunity gene silencing

  1. Silencing the Honey Bee (Apis mellifera) Naked Cuticle Gene (nkd) Improves Host Immune Function and Reduces Nosema ceranae Infections

    Science.gov (United States)

    Li, Wenfeng; Evans, Jay D.; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M.; Webster, Thomas C.; Su, Songkun

    2016-01-01

    ABSTRACT Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. IMPORTANCE Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors

  2. Silencing the Honey Bee (Apis mellifera) Naked Cuticle Gene (nkd) Improves Host Immune Function and Reduces Nosema ceranae Infections.

    Science.gov (United States)

    Li, Wenfeng; Evans, Jay D; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M; Webster, Thomas C; Su, Songkun; Chen, Yan Ping

    2016-11-15

    Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors. Here, we demonstrate

  3. Antisense gene silencing

    DEFF Research Database (Denmark)

    Nielsen, Troels T; Nielsen, Jørgen E

    2013-01-01

    Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

  4. Silence of the Genes

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:

  5. Silencing of the Rice Gene LRR1 Compromises Rice Xa21 Transcript Accumulation and XA21-Mediated Immunity.

    Science.gov (United States)

    Caddell, Daniel F; Park, Chang-Jin; Thomas, Nicholas C; Canlas, Patrick E; Ronald, Pamela C

    2017-12-01

    The rice immune receptor XA21 confers resistance to Xanthomonas oryzae pv. oryzae (Xoo), the causal agent of bacterial leaf blight. We previously demonstrated that an auxilin-like protein, XA21 BINDING PROTEIN 21 (XB21), positively regulates resistance to Xoo. To further investigate the function of XB21, we performed a yeast two-hybrid screen. We identified 22 unique XB21 interacting proteins, including LEUCINE-RICH REPEAT PROTEIN 1 (LRR1), which we selected for further analysis. Silencing of LRR1 in the XA21 genetic background (XA21-LRR1Ri) compromises resistance to Xoo compared with control XA21 plants. XA21-LRR1Ri plants have reduced Xa21 transcript levels and reduced expression of genes that serve as markers of XA21-mediated activation. Overexpression of LRR1 is insufficient to alter resistance to Xoo in rice lines lacking XA21. Taken together, our results indicate that LRR1 is required for wild-type Xa21 transcript expression and XA21-mediated immunity.

  6. Co-silencing of tomato S-adenosylhomocysteine hydrolase genes confers increased immunity against Pseudomonas syringae pv. tomato DC3000 and enhanced tolerance to drought stress

    Directory of Open Access Journals (Sweden)

    Li Xiao Hui

    2015-09-01

    Full Text Available S-adenosylhomocysteine hydrolase (SAHH, catalyzing the reversible hydrolysis of S-adenosylhomocysteine to adenosine and homocysteine, is a key enzyme that maintain the cellular methylation potential in all organisms. We report here the biological functions of tomato SlSAHHs in stress response. The tomato genome contains three SlSAHH genes that encode SlSAHH proteins with high level of sequence identity. qRT-PCR analysis revealed that SlSAHHs responded with distinct expression induction patterns to Pseudomonas syringae pv. tomato (Pst DC3000 and Botrytis cinerea as well as to defense signaling hormones such as salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-based knockdown of individual SlSAHH gene did not affect the growth performance and the response to Pst DC3000. However, co-silencing of three SlSAHH genes using a conserved sequence led to significant inhibition of vegetable growth. The SlSAHH-co-silenced plants displayed increased resistance to Pst DC3000 but did not alter the resistance to B. cinerea. Co-silencing of SlSAHHs resulted in constitutively activated defense responses including elevated SA level, upregulated expression of defense-related and PAMP-triggered immunity marker genes and increased callose deposition and H2O2 accumulation. Furthermore, the SlSAHH-co-silenced plants also exhibited enhanced drought stress tolerance although they had relatively small roots. These data demonstrate that, in addition to the functions in growth and development, SAHHs also play important roles in regulating biotic and abiotic stress responses in plants.

  7. Silence of the Genes

    Indian Academy of Sciences (India)

    Srimath

    a gene in the opposite orientation in a cultured plant cell line and observed that the ..... started emerging in early 1990s from the work carried out by the. It is believed that ... cause human diseases such as cervical cancer, hepatitis, measles.

  8. Solanum venturii, a suitable model system for virus-induced gene silencing studies in potato reveals StMKK6 as an important player in plant immunity

    NARCIS (Netherlands)

    Dobnik, David; Lazar, Ana; Stare, Tjaša; Gruden, Kristina; Vleeshouwers, Vivianne G.A.A.; Žel, Jana

    2016-01-01

    Background: Virus-induced gene silencing (VIGS) is an optimal tool for functional analysis of genes in plants, as the viral vector spreads throughout the plant and causes reduced expression of selected gene over the whole plant. Potato (Solanum tuberosum) is one of the most important food crops,

  9. Homology-dependent Gene Silencing in Paramecium

    Science.gov (United States)

    Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa

    1998-01-01

    Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

  10. Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.

    Directory of Open Access Journals (Sweden)

    Sirjana Devi Shrestha

    Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.

  11. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    2007-08-01

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  12. Virus-induced gene silencing in diverse maize lines using the Brome Mosaic virus-based silencing vector

    Science.gov (United States)

    Virus-induced gene silencing (VIGS) is a widely used tool for gene function studies in many plant species, though its use in monocots has been limited. Using a Brome mosaic virus (BMV) vector designed to silence the maize phytoene desaturase gene, a genetically diverse set of maize inbred lines was ...

  13. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  14. Identification and characterization of a silencer regulatory element in the 3'-flanking region of the murine CD46 gene.

    Science.gov (United States)

    Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T

    2000-01-01

    The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821

  15. Simultaneous Silencing of Xylanase Genes in Botrytis cinerea

    Directory of Open Access Journals (Sweden)

    Néstor García

    2017-12-01

    Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.

  16. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    Science.gov (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  17. LNA-antisense rivals siRNA for gene silencing

    DEFF Research Database (Denmark)

    Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

    2004-01-01

    Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...

  18. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  19. Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.

    Science.gov (United States)

    Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad

    2009-01-01

    RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.

  20. Strategies for Improving siRNA-Induced Gene Silencing Efficiency.

    Science.gov (United States)

    Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad

    2017-12-01

    Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.

  1. Whole genome DNA methylation: beyond genes silencing

    OpenAIRE

    Tirado-Magallanes, Roberto; Rebbani, Khadija; Lim, Ricky; Pradhan, Sriharsa; Benoukraf, Touati

    2016-01-01

    The combination of DNA bisulfite treatment with high-throughput sequencing technologies has enabled investigation of genome-wide DNA methylation at near base pair level resolution, far beyond that of the kilobase-long canonical CpG islands that initially revealed the biological relevance of this covalent DNA modification. The latest high-resolution studies have revealed a role for very punctual DNA methylation in chromatin plasticity, gene regulation and splicing. Here, we aim to outline the ...

  2. Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells

    Directory of Open Access Journals (Sweden)

    Tatiana I Novobrantseva

    2012-01-01

    Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.

  3. Activation of silenced cytokine gene promoters by the synergistic effect of TBP-TALE and VP64-TALE activators.

    Science.gov (United States)

    Anthony, Kim; More, Abhijit; Zhang, Xiaoliu

    2014-01-01

    Recent work has shown that the combinatorial use of multiple TALE activators can selectively activate certain cellular genes in inaccessible chromatin regions. In this study, we aimed to interrogate the activation potential of TALEs upon transcriptionally silenced immune genes in the context of non-immune cells. We designed a unique strategy, in which a single TALE fused to the TATA-box binding protein (TBP-TALE) is coupled with multiple VP64-TALE activators. We found that our strategy is significantly more potent than multiple TALE activators alone in activating expression of IL-2 and GM-CSF in diverse cell origins in which both genes are otherwise completely silenced. Chromatin analysis revealed that the gene activation was due in part to displacement of a distinctly positioned nucleosome. These studies provide a novel epigenetic mechanism for artificial gene induction and have important implications for targeted cancer immunotherapy, DNA vaccine development, as well as rational design of TALE activators.

  4. Thermodynamic control of small RNA-mediated gene silencing

    Directory of Open Access Journals (Sweden)

    Kumiko eUi-Tei

    2012-06-01

    Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.

  5. Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

    Directory of Open Access Journals (Sweden)

    Dacheng Liang

    2014-12-01

    Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

  6. An intronic microRNA silences genes that are functionally antagonistic to its host gene.

    Science.gov (United States)

    Barik, Sailen

    2008-09-01

    MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.

  7. Strategy of gene silencing in cassava for validation of resistance genes

    International Nuclear Information System (INIS)

    Cortes, Simon; Lopez, Camilo

    2010-01-01

    Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

  8. The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.

    Science.gov (United States)

    Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C

    2013-12-23

    Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure

  9. Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

    Science.gov (United States)

    Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

    2016-03-01

    Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016

  10. Silencing of copine genes confers common wheat enhanced resistance to powdery mildew.

    Science.gov (United States)

    Zou, Baohong; Ding, Yuan; Liu, He; Hua, Jian

    2018-06-01

    Powdery mildew, caused by the biotrophic fungal pathogen Blumeria graminis f. sp. tritici (Bgt), is a major threat to the production of wheat (Triticum aestivum). It is of great importance to identify new resistance genes for the generation of Bgt-resistant or Bgt-tolerant wheat varieties. Here, we show that the wheat copine genes TaBON1 and TaBON3 negatively regulate wheat disease resistance to Bgt. Two copies of TaBON1 and three copies of TaBON3, located on chromosomes 6AS, 6BL, 1AL, 1BL and 1DL, respectively, were identified from the current common wheat genome sequences. The expression of TaBON1 and TaBON3 is responsive to both pathogen infection and temperature changes. Knocking down of TaBON1 or TaBON3 by virus-induced gene silencing (VIGS) induces the up-regulation of defence responses in wheat. These TaBON1- or TaBON3-silenced plants exhibit enhanced wheat disease resistance to Bgt, accompanied by greater accumulation of hydrogen peroxide and heightened cell death. In addition, high temperature has little effect on the up-regulation of defence response genes conferred by the silencing of TaBON1 or TaBON3. Our study shows a conserved function of plant copine genes in plant immunity and provides new genetic resources for the improvement of resistance to powdery mildew in wheat. © 2017 BSPP AND JOHN WILEY & SONS LTD.

  11. Flexible tools for gene expression and silencing in tomato.

    Science.gov (United States)

    Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre

    2009-12-01

    As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.

  12. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

    Science.gov (United States)

    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

    2016-10-13

    PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  13. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  14. Reduced rates of gene loss, gene silencing, and gene mutation in Dnmt1-deficient embryonic stem cells

    NARCIS (Netherlands)

    Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.

    2001-01-01

    Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by

  15. Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms

    Directory of Open Access Journals (Sweden)

    Mueller Nancy

    2005-10-01

    Full Text Available Abstract Background Human T-cell leukemia virus type I (HTLV-I causes adult T-cell leukemia (ATL after a long latent period. Among accessory genes encoded by HTLV-I, the tax gene is thought to play a central role in oncogenesis. However, Tax expression is disrupted by several mechanims including genetic changes of the tax gene, deletion/hypermethylation of 5'-LTR. To clarify the role of epigenetic changes, we analyzed DNA methylation and histone modification in the whole HTLV-I provirus genome. Results The gag, pol and env genes of HTLV-I provirus were more methylated than pX region, whereas methylation of 5'-LTR was variable and 3'-LTR was not methylated at all. In ATL cell lines, complete DNA methylation of 5'-LTR was associated with transcriptional silencing of viral genes. HTLV-I provirus was more methylated in primary ATL cells than in carrier state, indicating the association with disease progression. In seroconvertors, DNA methylation was already observed in internal sequences of provirus just after seroconversion. Taken together, it is speculated that DNA methylation first occurs in the gag, pol and env regions and then extends in the 5' and 3' directions in vivo, and when 5'-LTR becomes methylated, viral transcription is silenced. Analysis of histone modification in the HTLV-I provirus showed that the methylated provirus was associated with hypoacetylation. However, the tax gene transcript could not be detected in fresh ATL cells regardless of hyperacetylated histone H3 in 5'-LTR. The transcription rapidly recovered after in vitro culture in such ATL cells. Conclusion These results showed that epigenetic changes of provirus facilitated ATL cells to evade host immune system by suppressing viral gene transcription. In addition, this study shows the presence of another reversible mechanism that suppresses the tax gene transcription without DNA methylation and hypoacetylated histone.

  16. The potential of virus-induced gene silencing for speeding up functional characterization of plant genes

    NARCIS (Netherlands)

    Benedito, V.A.; Visser, P.B.; Angenent, G.C.; Krens, F.A.

    2004-01-01

    Virus-induced gene silencing (VIGS) has been shown to be of great potential in plant reverse genetics. Advantages of VIGS over other approaches, such as T-DNA or transposon tagging, include the circumvention of plant transformation, methodological simplicity and robustness, and speedy results. These

  17. Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.

    Science.gov (United States)

    Panwar, Vinay; Bakkeren, Guus

    2017-01-01

    Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.

  18. Simultaneous silencing of multiple genes in the apple scab fungus, Venturia inaequalis, by expression of RNA with chimeric inverted repeats

    NARCIS (Netherlands)

    Fitzgerald, A.; Kan, van J.A.L.; Plummer, K.M.

    2004-01-01

    RNA-mediated gene silencing has been demonstrated in plants, animals, and more recently in filamentous fungi. Here, we report high frequency, RNA-mediated gene silencing in the apple scab fungus, Venturia inaequalis. The green fluorescent protein (GFP) transgene was silenced in a GFP-expressing

  19. DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.

    Science.gov (United States)

    Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard

    2003-04-24

    Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.

  20. Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.

    Science.gov (United States)

    Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J

    2016-01-01

    Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.

  1. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    Science.gov (United States)

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  2. Protocol: using virus-induced gene silencing to study the arbuscular mycorrhizal symbiosis in Pisum sativum

    DEFF Research Database (Denmark)

    Grønlund, Mette; Olsen, Anne; Johansen, Elisabeth

    2010-01-01

    , the available PEBV-VIGS protocols are inadequate for studying genes involved in the symbiosis with arbuscular mycorrhizal fungi (AMF). Here we describe a PEBV-VIGS protocol suitable for reverse genetics studies in pea of genes involved in the symbiosis with AMF and show its effectiveness in silencing genes...... involved in the early and late stages of AMF symbiosis....

  3. Development of a gene silencing DNA vector derived from a broad host range geminivirus

    Directory of Open Access Journals (Sweden)

    Hancock Leandria C

    2009-07-01

    Full Text Available Abstract Background Gene silencing is proving to be a powerful tool for genetic, developmental, and physiological analyses. The use of viral induced gene silencing (VIGS offers advantages to transgenic approaches as it can be potentially applied to non-model systems for which transgenic techniques are not readily available. However, many VIGS vectors are derived from Gemini viruses that have limited host ranges. We present a new, unipartite vector that is derived from a curtovirus that has a broad host range and will be amenable to use in many non-model systems. Results The construction of a gene silencing vector derived from the geminivirus Beet curly top virus (BCTV, named pWSRi, is reported. Two versions of the vector have been developed to allow application by biolistic techniques or by agro-infiltration. We demonstrate its ability to silence nuclear genes including ribulose bisphosphate carboxylase small subunit (rbcS, transketolase, the sulfur allele of magnesium chelatase (ChlI, and two homeotic transcription factors in spinach or tomato by generating gene-specific knock-down phenotypes. Onset of phenotypes occurred 3 to 12 weeks post-inoculation, depending on the target gene, in organs that developed after the application. The vector lacks movement genes and we found no evidence for significant spread from the site of inoculation. However, viral amplification in inoculated tissue was detected and is necessary for systemic silencing, suggesting that signals generated from active viral replicons are efficiently transported within the plant. Conclusion The unique properties of the pWSRi vector, the ability to silence genes in meristem tissue, the separation of virus and silencing phenotypes, and the broad natural host range of BCTV, suggest that it will have wide utility.

  4. Surface functionalisation of PLGA nanoparticles for gene silencing

    DEFF Research Database (Denmark)

    Andersen, Morten Østergaard; Lichawska, Agata; Arpanaei, Ayyoob

    2010-01-01

    . In addition, particles containing cetylated-PEI achieved 64% silencing of TNFα in J774.1 cells. This rapid method for surface modification of PLGA nanoparticles promotes its application for alternative cetylated functional derivatives as a strategy to control specific biological properties of nanoparticles....

  5. Development of Agrobacterium-mediated virus-induced gene silencing and performance evaluation of four marker genes in Gossypium barbadense.

    Directory of Open Access Journals (Sweden)

    Jinhuan Pang

    Full Text Available Gossypiumbarbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species. These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G. barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G. barbadense. In this study, we had successfully introduced a virus-induced gene silencing (VIGS system into three cultivars of G. barbadense by inserting marker genes into the tobacco rattle virus (TRV vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G. barbadense. The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G. barbadense, and help to contribute desirable traits for breeding of G. barbadense and G. hirsutum.

  6. Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato

    Science.gov (United States)

    Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo

    2016-12-01

    Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato.

  7. Smuggling gold nanoparticles across cell types - A new role for exosomes in gene silencing.

    Science.gov (United States)

    Roma-Rodrigues, Catarina; Pereira, Francisca; Alves de Matos, António P; Fernandes, Marta; Baptista, Pedro V; Fernandes, Alexandra R

    2017-05-01

    Once released to the extracellular space, exosomes enable the transfer of proteins, lipids and RNA between different cells, being able to modulate the recipient cells' phenotypes. Members of the Rab small GTP-binding protein family, such as RAB27A, are responsible for the coordination of several steps in vesicle trafficking, including budding, mobility, docking and fusion. The use of gold nanoparticles (AuNPs) for gene silencing is considered a cutting-edge technology. Here, AuNPs were functionalized with thiolated oligonucleotides anti-RAB27A (AuNP@PEG@anti-RAB27A) for selective silencing of the gene with a consequent decrease of exosomes´ release by MCF-7 and MDA-MB-453 cells. Furthermore, communication between tumor and normal cells was observed both in terms of alterations in c-Myc gene expression and transportation of the AuNPs, mediating gene silencing in secondary cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.

    Science.gov (United States)

    Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert

    2018-01-01

    Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.

  9. Development of a virus-induced gene silencing (VIGS) system for Spinacia oleracea L

    DEFF Research Database (Denmark)

    Lee, Jungmin; Cao, Dang Viet; Kim, Jiwon

    2017-01-01

    Virus-induced gene silencing (VIGS) is known as a rapid and efficient system for studying functions of interesting genes in plants. Tobacco rattle virus (TRV) is widely applied for the gene silencing of many plants. Although spinach is a TRV-susceptible plant, a TRV-based VIGS system has not yet ...

  10. Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.

    Science.gov (United States)

    Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

    2017-01-01

    RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.

  11. Host-Induced Gene Silencing of Rice Blast Fungus Magnaporthe oryzae Pathogenicity Genes Mediated by the Brome Mosaic Virus.

    Science.gov (United States)

    Zhu, Lin; Zhu, Jian; Liu, Zhixue; Wang, Zhengyi; Zhou, Cheng; Wang, Hong

    2017-09-26

    Magnaporthe oryzae is a devastating plant pathogen, which has a detrimental impact on rice production worldwide. Despite its agronomical importance, some newly-emerging pathotypes often overcome race-specific disease resistance rapidly. It is thus desirable to develop a novel strategy for the long-lasting resistance of rice plants to ever-changing fungal pathogens. Brome mosaic virus (BMV)-induced RNA interference (RNAi) has emerged as a useful tool to study host-resistance genes for rice blast protection. Planta-generated silencing of targeted genes inside biotrophic pathogens can be achieved by expression of M. oryzae -derived gene fragments in the BMV-mediated gene silencing system, a technique termed host-induced gene silencing (HIGS). In this study, the effectiveness of BMV-mediated HIGS in M. oryzae was examined by targeting three predicted pathogenicity genes, MoABC1, MoMAC1 and MoPMK1 . Systemic generation of fungal gene-specific small interfering RNA (siRNA) molecules induced by inoculation of BMV viral vectors inhibited disease development and reduced the transcription of targeted fungal genes after subsequent M. oryzae inoculation. Combined introduction of fungal gene sequences in sense and antisense orientation mediated by the BMV silencing vectors significantly enhanced the efficiency of this host-generated trans-specific RNAi, implying that these fungal genes played crucial roles in pathogenicity. Collectively, our results indicated that BMV-HIGS system was a great strategy for protecting host plants against the invasion of pathogenic fungi.

  12. Transgene-induced gene silencing is not affected by a change in ploidy level.

    Directory of Open Access Journals (Sweden)

    Daniela Pignatta

    Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.

  13. Klotho gene silencing promotes pathology in the mdx mouse model of Duchenne muscular dystrophy

    Science.gov (United States)

    Wehling-Henricks, Michelle; Li, Zhenzhi; Lindsey, Catherine; Wang, Ying; Welc, Steven S.; Ramos, Julian N.; Khanlou, Négar; Kuro-o, Makoto; Tidball, James G.

    2016-01-01

    Duchenne muscular dystrophy (DMD) is a lethal muscle disease involving progressive loss of muscle regenerative capacity and increased fibrosis. We tested whether epigenetic silencing of the klotho gene occurs in the mdx mouse model of DMD and whether klotho silencing is an important feature of the disease. Our findings show that klotho undergoes muscle-specific silencing at the acute onset of mdx pathology. Klotho experiences increased methylation of CpG sites in its promoter region, which is associated with gene silencing, and increases in a repressive histone mark, H3K9me2. Expression of a klotho transgene in mdx mice restored their longevity, reduced muscle wasting, improved function and greatly increased the pool of muscle-resident stem cells required for regeneration. Reductions of fibrosis in late, progressive stages of the mdx pathology achieved by transgene expression were paralleled by reduced expression of Wnt target genes (axin-2), transforming growth factor-beta (TGF-β1) and collagens types 1 and 3, indicating that Klotho inhibition of the profibrotic Wnt/TGFβ axis underlies its anti-fibrotic effect in aging, dystrophic muscle. Thus, epigenetic silencing of klotho during muscular dystrophy contributes substantially to lost regenerative capacity and increased fibrosis of dystrophic muscle during late progressive stages of the disease. PMID:27154199

  14. Simultaneous gene silencing of Bcl-2, XIAP and Survivin re-sensitizes pancreatic cancer cells towards apoptosis

    International Nuclear Information System (INIS)

    Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian

    2010-01-01

    Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells

  15. Host-Induced Silencing of Pathogenicity Genes Enhances Resistance to Fusarium oxysporum Wilt in Tomato.

    Science.gov (United States)

    Bharti, Poonam; Jyoti, Poonam; Kapoor, Priya; Sharma, Vandana; Shanmugam, V; Yadav, Sudesh Kumar

    2017-08-01

    This study presents a novel approach of controlling vascular wilt in tomato by RNAi expression directed to pathogenicity genes of Fusarium oxysporum f. sp. lycopersici. Vascular wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici leads to qualitative and quantitative loss of the crop. Limitation in the existing control measures necessitates the development of alternative strategies to increase resistance in the plants against pathogens. Recent findings paved way to RNAi, as a promising method for silencing of pathogenicity genes in fungus and provided effective resistance against fungal pathogens. Here, two important pathogenicity genes FOW2, a Zn(II)2Cys6 family putative transcription regulator, and chsV, a putative myosin motor and a chitin synthase domain, were used for host-induced gene silencing through hairpinRNA cassettes of these genes against Fusarium oxysporum f. sp. lycopersici. HairpinRNAs were assembled in appropriate binary vectors and transformed into tomato plant targeting FOW2 and chsV genes, for two highly pathogenic strains of Fusarium oxysporum viz. TOFOL-IHBT and TOFOL-IVRI. Transgenic tomatoes were analyzed for possible attainment of resistance in transgenic lines against fungal infection. Eight transgenic lines expressing hairpinRNA cassettes showed trivial disease symptoms after 6-8 weeks of infection. Hence, the host-induced posttranscriptional gene silencing of pathogenicity genes in transgenic tomato plants has enhanced their resistance to vascular wilt disease caused by Fusarium oxysporum.

  16. Addiction, adolescence, and innate immune gene induction

    Directory of Open Access Journals (Sweden)

    Fulton T Crews

    2011-04-01

    Full Text Available Repeated drug use/abuse amplifies psychopathology, progressively reducing frontal lobe behavioral control and cognitive flexibility while simultaneously increasing limbic temporal lobe negative emotionality. The period of adolescence is a neurodevelopmental stage characterized by poor behavioral control as well as strong limbic reward and thrill seeking. Repeated drug abuse and/or stress during this stage increase the risk of addiction and elevate activator innate immune signaling in the brain. Nuclear factor-kappa-light-chain-enhancer of activated B cells (NF-κB is a key glial transcription factor that regulates proinflammatory chemokines, cytokines, oxidases, proteases, and other innate immune genes. Induction of innate brain immune gene expression (e.g., NF-κB facilitates negative affect, depression-like behaviors, and inhibits hippocampal neurogenesis. In addition, innate immune gene induction alters cortical neurotransmission consistent with loss of behavioral control. Studies with anti-oxidant, anti-inflammatory, and anti-depressant drugs as well as opiate antagonists link persistent innate immune gene expression to key behavioral components of addiction, e.g. negative affect-anxiety and loss of frontal cortical behavioral control. This review suggests that persistent and progressive changes in innate immune gene expression contribute to the development of addiction. Innate immune genes may represent a novel new target for addiction therapy.

  17. CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs

    DEFF Research Database (Denmark)

    Mandegar, Mohammad A.; Huebsch, Nathaniel; Frolov, Ekaterina B.

    2016-01-01

    repression system is tunable and has the potential to silence single alleles. Compared with CRISPR nuclease (CRISPRn), CRISPRi gene repression is more efficient and homogenous across cell populations. The CRISPRi system in iPSCs provides a powerful platform to perform genome-scale screens in a wide range...

  18. Gene dosage induction of silencing directed against an Arabidopsis Myb transgene in tobacco

    Science.gov (United States)

    An unexpected reduction in petal pigmentation on petunia plants genetically engineered for enhanced flower color was one of the first experimental demonstrations of the natural process of RNA-associated gene silencing. The obvious visual nature of such alterations to pigment patterns of transgenic ...

  19. A systemic gene silencing method suitable for high throughput, reverse genetic analyses of gene function in fern gametophytes

    Directory of Open Access Journals (Sweden)

    Tanurdzic Milos

    2004-04-01

    Full Text Available Abstract Background Ceratopteris richardii is a useful experimental system for studying gametophyte development and sexual reproduction in plants. However, few tools for cloning mutant genes or disrupting gene function exist for this species. The feasibility of systemic gene silencing as a reverse genetics tool was examined in this study. Results Several DNA constructs targeting a Ceratopteris protoporphyrin IX magnesium chelatase (CrChlI gene that is required for chlorophyll biosynthesis were each introduced into young gametophytes by biolistic delivery. Their transient expression in individual cells resulted in a colorless cell phenotype that affected most cells of the mature gametophyte, including the meristem and gametangia. The colorless phenotype was associated with a 7-fold decrease in the abundance of the endogenous transcript. While a construct designed to promote the transient expression of a CrChlI double stranded, potentially hairpin-forming RNA was found to be the most efficient in systemically silencing the endogenous gene, a plasmid containing the CrChlI cDNA insert alone was sufficient to induce silencing. Bombarded, colorless hermaphroditic gametophytes produced colorless embryos following self-fertilization, demonstrating that the silencing signal could be transmitted through gametogenesis and fertilization. Bombardment of young gametophytes with constructs targeting the Ceratopteris filamentous temperature sensitive (CrFtsZ and uroporphyrin dehydrogenase (CrUrod genes also produced the expected mutant phenotypes. Conclusion A method that induces the systemic silencing of target genes in the Ceratopteris gametophyte is described. It provides a simple, inexpensive and rapid means to test the functions of genes involved in gametophyte development, especially those involved in cellular processes common to all plants.

  20. Proteinase 3 on apoptotic cells disrupts immune silencing in autoimmune vasculitis

    Science.gov (United States)

    Millet, Arnaud; Martin, Katherine R.; Bonnefoy, Francis; Saas, Philippe; Mocek, Julie; Alkan, Manal; Terrier, Benjamin; Kerstein, Anja; Tamassia, Nicola; Satyanarayanan, Senthil Kumaran; Ariel, Amiram; Ribeil, Jean-Antoine; Guillevin, Loïc; Cassatella, Marco A.; Mueller, Antje; Thieblemont, Nathalie; Lamprecht, Peter; Mouthon, Luc; Perruche, Sylvain; Witko-Sarsat, Véronique

    2015-01-01

    Granulomatosis with polyangiitis (GPA) is a systemic necrotizing vasculitis that is associated with granulomatous inflammation and the presence of anti-neutrophil cytoplasmic antibodies (ANCAs) directed against proteinase 3 (PR3). We previously determined that PR3 on the surface of apoptotic neutrophils interferes with induction of antiinflammatory mechanisms following phagocytosis of these cells by macrophages. Here, we demonstrate that enzymatically active membrane-associated PR3 on apoptotic cells triggered secretion of inflammatory cytokines, including granulocyte CSF (G-CSF) and chemokines. This response required the IL-1R1/MyD88 signaling pathway and was dependent on the synthesis of NO, as macrophages from animals lacking these pathways did not exhibit a PR3-associated proinflammatory response. The PR3-induced microenvironment facilitated recruitment of inflammatory cells, such as macrophages, plasmacytoid DCs (pDCs), and neutrophils, which were observed in close proximity within granulomatous lesions in the lungs of GPA patients. In different murine models of apoptotic cell injection, the PR3-induced microenvironment instructed pDC-driven Th9/Th2 cell generation. Concomitant injection of anti-PR3 ANCAs with PR3-expressing apoptotic cells induced a Th17 response, revealing a GPA-specific mechanism of immune polarization. Accordingly, circulating CD4+ T cells from GPA patients had a skewed distribution of Th9/Th2/Th17. These results reveal that PR3 disrupts immune silencing associated with clearance of apoptotic neutrophils and provide insight into how PR3 and PR3-targeting ANCAs promote GPA pathophysiology. PMID:26436651

  1. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong

    2010-01-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  2. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian

    2010-07-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  3. Phenotyping of VIGS-mediated gene silencing in rice using a vector derived from a DNA virus.

    Science.gov (United States)

    Kant, Ravi; Dasgupta, Indranil

    2017-07-01

    Target genes in rice can be optimally silenced if inserted in antisense or hairpin orientation in the RTBV-derived VIGS vector and plants grown at 28 °C and 80% humidity after inoculation. Virus induced gene silencing (VIGS) is a method used to transiently silence genes in dicot as well as monocot plants. For the important monocot species rice, the Rice tungro bacilliform virus (RTBV)-derived VIGS system (RTBV-VIGS), which uses agroinoculation to initiate silencing, has not been standardized for optimal use. Here, using RTBV-VIGS, three sets of conditions were tested to achieve optimal silencing of the rice marker gene phytoene desaturase (pds). The effect of orientation of the insert in the RTBV-VIGS plasmid (sense, antisense and hairpin) on the silencing of the target gene was then evaluated using rice magnesium chelatase subunit H (chlH). Finally, the rice Xa21 gene, conferring resistance against bacterial leaf blight disease (BLB) was silenced using RTBV-VIGS system. In each case, real-time PCR-based assessment indicated approximately 40-80% fall in the accumulation levels of the transcripts of pds, chlH and Xa21. In the case of pds, the appearance of white streaks in the emerging leaves, and for chlH, chlorophyll levels and F v /F m ratio were assessed as phenotypes for silencing. For Xa21, the resistance levels to BLB were assessed by measuring the lesion length and the percent diseased areas of leaves, following challenge inoculation with Xanthomonas oryzae. In each case, the RTBV-MVIGS system gave rise to a discernible phenotype indicating the silencing of the respective target gene using condition III (temperature 28 °C, humidity 80% and 1 mM MES and 20 µM acetosyringone in secondary agrobacterium culture), which revealed the robustness of this gene silencing system for rice.

  4. A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.

    Science.gov (United States)

    Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A

    2016-06-01

    Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.

  5. A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize1[OPEN

    Science.gov (United States)

    Mei, Yu; Kernodle, Bliss M.; Hill, John H.

    2016-01-01

    Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. PMID:27208311

  6. MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense

    Directory of Open Access Journals (Sweden)

    Sheng-Rui Liu

    2017-09-01

    Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.

  7. Genes misregulated in C. elegans deficient in Dicer, RDE-4, or RDE-1 are enriched for innate immunity genes.

    Science.gov (United States)

    Welker, Noah C; Habig, Jeffrey W; Bass, Brenda L

    2007-07-01

    We describe the first microarray analysis of a whole animal containing a mutation in the Dicer gene. We used adult Caenorhabditis elegans and, to distinguish among different roles of Dicer, we also performed microarray analyses of animals with mutations in rde-4 and rde-1, which are involved in silencing by siRNA, but not miRNA. Surprisingly, we find that the X chromosome is greatly enriched for genes regulated by Dicer. Comparison of all three microarray data sets indicates the majority of Dicer-regulated genes are not dependent on RDE-4 or RDE-1, including the X-linked genes. However, all three data sets are enriched in genes important for innate immunity and, specifically, show increased expression of innate immunity genes.

  8. Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.

    Science.gov (United States)

    Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert

    2017-11-30

    Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Epigenetic silencing of host cell defense genes enhances intracellular survival of the rickettsial pathogen Anaplasma phagocytophilum.

    Directory of Open Access Journals (Sweden)

    Jose C Garcia-Garcia

    2009-06-01

    Full Text Available Intracellular bacteria have evolved mechanisms that promote survival within hostile host environments, often resulting in functional dysregulation and disease. Using the Anaplasma phagocytophilum-infected granulocyte model, we establish a link between host chromatin modifications, defense gene transcription and intracellular bacterial infection. Infection of THP-1 cells with A. phagocytophilum led to silencing of host defense gene expression. Histone deacetylase 1 (HDAC1 expression, activity and binding to the defense gene promoters significantly increased during infection, which resulted in decreased histone H3 acetylation in infected cells. HDAC1 overexpression enhanced infection, whereas pharmacologic and siRNA HDAC1 inhibition significantly decreased bacterial load. HDAC2 does not seem to be involved, since HDAC2 silencing by siRNA had no effect on A. phagocytophilum intracellular propagation. These data indicate that HDAC up-regulation and epigenetic silencing of host cell defense genes is required for A. phagocytophilum infection. Bacterial epigenetic regulation of host cell gene transcription could be a general mechanism that enhances intracellular pathogen survival while altering cell function and promoting disease.

  10. The RNA silencing enzyme RNA polymerase v is required for plant immunity.

    Directory of Open Access Journals (Sweden)

    Ana López

    2011-12-01

    Full Text Available RNA-directed DNA methylation (RdDM is an epigenetic control mechanism driven by small interfering RNAs (siRNAs that influence gene function. In plants, little is known of the involvement of the RdDM pathway in regulating traits related to immune responses. In a genetic screen designed to reveal factors regulating immunity in Arabidopsis thaliana, we identified NRPD2 as the OVEREXPRESSOR OF CATIONIC PEROXIDASE 1 (OCP1. NRPD2 encodes the second largest subunit of the plant-specific RNA Polymerases IV and V (Pol IV and Pol V, which are crucial for the RdDM pathway. The ocp1 and nrpd2 mutants showed increases in disease susceptibility when confronted with the necrotrophic fungal pathogens Botrytis cinerea and Plectosphaerella cucumerina. Studies were extended to other mutants affected in different steps of the RdDM pathway, such as nrpd1, nrpe1, ago4, drd1, rdr2, and drm1drm2 mutants. Our results indicate that all the mutants studied, with the exception of nrpd1, phenocopy the nrpd2 mutants; and they suggest that, while Pol V complex is required for plant immunity, Pol IV appears dispensable. Moreover, Pol V defective mutants, but not Pol IV mutants, show enhanced disease resistance towards the bacterial pathogen Pseudomonas syringae DC3000. Interestingly, salicylic acid (SA-mediated defenses effective against PsDC3000 are enhanced in Pol V defective mutants, whereas jasmonic acid (JA-mediated defenses that protect against fungi are reduced. Chromatin immunoprecipitation analysis revealed that, through differential histone modifications, SA-related defense genes are poised for enhanced activation in Pol V defective mutants and provide clues for understanding the regulation of gene priming during defense. Our results highlight the importance of epigenetic control as an additional layer of complexity in the regulation of plant immunity and point towards multiple components of the RdDM pathway being involved in plant immunity based on genetic evidence

  11. The RNA silencing enzyme RNA polymerase v is required for plant immunity.

    Science.gov (United States)

    López, Ana; Ramírez, Vicente; García-Andrade, Javier; Flors, Victor; Vera, Pablo

    2011-12-01

    RNA-directed DNA methylation (RdDM) is an epigenetic control mechanism driven by small interfering RNAs (siRNAs) that influence gene function. In plants, little is known of the involvement of the RdDM pathway in regulating traits related to immune responses. In a genetic screen designed to reveal factors regulating immunity in Arabidopsis thaliana, we identified NRPD2 as the OVEREXPRESSOR OF CATIONIC PEROXIDASE 1 (OCP1). NRPD2 encodes the second largest subunit of the plant-specific RNA Polymerases IV and V (Pol IV and Pol V), which are crucial for the RdDM pathway. The ocp1 and nrpd2 mutants showed increases in disease susceptibility when confronted with the necrotrophic fungal pathogens Botrytis cinerea and Plectosphaerella cucumerina. Studies were extended to other mutants affected in different steps of the RdDM pathway, such as nrpd1, nrpe1, ago4, drd1, rdr2, and drm1drm2 mutants. Our results indicate that all the mutants studied, with the exception of nrpd1, phenocopy the nrpd2 mutants; and they suggest that, while Pol V complex is required for plant immunity, Pol IV appears dispensable. Moreover, Pol V defective mutants, but not Pol IV mutants, show enhanced disease resistance towards the bacterial pathogen Pseudomonas syringae DC3000. Interestingly, salicylic acid (SA)-mediated defenses effective against PsDC3000 are enhanced in Pol V defective mutants, whereas jasmonic acid (JA)-mediated defenses that protect against fungi are reduced. Chromatin immunoprecipitation analysis revealed that, through differential histone modifications, SA-related defense genes are poised for enhanced activation in Pol V defective mutants and provide clues for understanding the regulation of gene priming during defense. Our results highlight the importance of epigenetic control as an additional layer of complexity in the regulation of plant immunity and point towards multiple components of the RdDM pathway being involved in plant immunity based on genetic evidence, but whether

  12. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Science.gov (United States)

    Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

    2015-01-01

    In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  13. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Directory of Open Access Journals (Sweden)

    Sha Lu

    Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  14. Functional gene silencing mediated by chitosan/siRNA nanocomplexes

    Energy Technology Data Exchange (ETDEWEB)

    Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F [Department of Pharmaceutical Science, Zhujiang Hospital, Southern Medical University, Guangzhou 510282 (China); Yang, B, E-mail: andrewfxu1998@gmail.co [Department of Chemistry, Indiana University-Bloomington, Bloomington, IN 47405 (United States)

    2009-10-07

    Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

  15. Functional gene silencing mediated by chitosan/siRNA nanocomplexes

    International Nuclear Information System (INIS)

    Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F; Yang, B

    2009-01-01

    Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

  16. Agrobacterium Mediated Transient Gene Silencing (AMTS) in Stevia rebaudiana: Insights into Steviol Glycoside Biosynthesis Pathway

    Science.gov (United States)

    Guleria, Praveen; Yadav, Sudesh Kumar

    2013-01-01

    Background Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi) based Agrobacterium mediated transient gene silencing (AMTS) approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. Methodology/Principal Findings RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3) content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. Conclusions SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route. PMID:24023961

  17. Agrobacterium mediated transient gene silencing (AMTS in Stevia rebaudiana: insights into steviol glycoside biosynthesis pathway.

    Directory of Open Access Journals (Sweden)

    Praveen Guleria

    Full Text Available Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins.RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes.SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.

  18. The development and application of a multiple gene co-silencing system using endogenous URA3 as a reporter gene in Ganoderma lucidum.

    Directory of Open Access Journals (Sweden)

    Dashuai Mu

    Full Text Available Ganoderma lucidum is one of the most important medicinal mushrooms; however, molecular genetics research on this species has been limited due to a lack of reliable reverse genetic tools. In this study, the endogenous orotidine 5'-monophosphate decarboxylase gene (URA3 was cloned as a silencing reporter, and four gene-silencing methods using hairpin, sense, antisense, and dual promoter constructs, were introduced into G. lucidum through a simple electroporation procedure. A comparison and evaluation of silencing efficiency demonstrated that all of the four methods differentially suppressed the expression of URA3. Our data unequivocally indicate that the dual promoter silencing vector yields the highest rate of URA3 silencing compared with other vectors (up to 81.9%. To highlight the advantages of the dual promoter system, we constructed a co-silencing system based on the dual promoter method and succeeded in co-silencing URA3 and laccase in G. lucidum. The reduction of the mRNA levels of the two genes were correlated. Thus, the screening efficiency for RNAi knockdown of multiple genes may be improved by the co-silencing of an endogenous reporter gene. The molecular tools developed in this study should facilitate the isolation of genes and the characterization of the functions of multiple genes in this pharmaceutically important species, and these tools should be highly useful for the study of other basidiomycetes.

  19. Hydrogel-Assisted Antisense LNA Gapmer Delivery for In Situ Gene Silencing in Spinal Cord Injury

    DEFF Research Database (Denmark)

    Moreno, Pedro M.D.; Ferreira, Ana R.; Salvador, Daniela

    2018-01-01

    )-modified AON gapmers in combination with a fibrin hydrogel bridging material to induce gene silencing in situ at a SCI lesion site. LNA gapmers were effectively developed against two promising gene targets aiming at enhancing axonal regeneration—RhoA and GSK3β. The fibrin-matrix-assisted AON delivery system......After spinal cord injury (SCI), nerve regeneration is severely hampered due to the establishment of a highly inhibitory microenvironment at the injury site, through the contribution of multiple factors. The potential of antisense oligonucleotides (AONs) to modify gene expression at different levels...

  20. Inhibition of human esophageal squamous cell carcinomas by targeted silencing of tumor enhancer genes: an overview

    International Nuclear Information System (INIS)

    Islamian, Jalil Pirayesh; Mohammadi, Mohsen; Baradaran, Behzad

    2014-01-01

    Esophageal cancer has been reported as the ninth most common malignancy and ranks as the sixth most frequent cause of death worldwide. Esophageal cancer treatment involves surgery, chemotherapy, radiation therapy, or combination therapy. Novel strategies are needed to boost the oncologic outcome. Recent advances in the molecular biology of esophageal cancer have documented the role of genetic alterations in tumorigenesis. Oncogenes serve a pivotal function in tumorigenesis. Targeted therapies are directed at the unique molecular signature of cancer cells for enhanced efficacy with low toxicity. RNA interference (RNAi) technology is a powerful tool for silencing endogenous or exogenous genes in mammalian cells. Related results have shown that targeting oncogenes with siRNAs, specifically the mRNA, effectively reduces tumor cell proliferation and induces apoptotic cell death. This article will briefly review studies on silencing tumor enhancer genes related to the induction of esophageal cancer

  1. Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine.

    Science.gov (United States)

    Tang, Wei; Newton, Ronald J; Weidner, Douglas A

    2007-01-01

    An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.

  2. Immune genes undergo more adaptive evolution than non-immune system genes in Daphnia pulex

    Directory of Open Access Journals (Sweden)

    McTaggart Seanna J

    2012-05-01

    Full Text Available Abstract Background Understanding which parts of the genome have been most influenced by adaptive evolution remains an unsolved puzzle. Some evidence suggests that selection has the greatest impact on regions of the genome that interact with other evolving genomes, including loci that are involved in host-parasite co-evolutionary processes. In this study, we used a population genetic approach to test this hypothesis by comparing DNA sequences of 30 putative immune system genes in the crustacean Daphnia pulex with 24 non-immune system genes. Results In support of the hypothesis, results from a multilocus extension of the McDonald-Kreitman (MK test indicate that immune system genes as a class have experienced more adaptive evolution than non-immune system genes. However, not all immune system genes show evidence of adaptive evolution. Additionally, we apply single locus MK tests and calculate population genetic parameters at all loci in order to characterize the mode of selection (directional versus balancing in the genes that show the greatest deviation from neutral evolution. Conclusions Our data are consistent with the hypothesis that immune system genes undergo more adaptive evolution than non-immune system genes, possibly as a result of host-parasite arms races. The results of these analyses highlight several candidate loci undergoing adaptive evolution that could be targeted in future studies.

  3. Virus-induced gene silencing (VIGS) as a reverse genetic tool to study development of symbiotic root nodules

    DEFF Research Database (Denmark)

    Kjær, Gabriela Didina Constantin; Grønlund, Mette; Stougaard, Jens

    2008-01-01

    Virus-induced gene silencing (VIGS) can provide a shortcut to plants with altered expression of specific genes. Here, we report that VIGS of the Nodule inception gene (Nin) can alter the nodulation phenotype and Nin gene expression in Pisum sativum. PsNin was chosen as target because of the disti...

  4. Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma

    Science.gov (United States)

    Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.

    2012-01-01

    Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009

  5. Bone marrow mesenchymal stem cells with Nogo-66 receptor gene silencing for repair of spinal cord injury

    Science.gov (United States)

    Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong

    2014-01-01

    We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group. PMID:25206893

  6. Plasmodium falciparum var Gene Silencing Is Determined by cis DNA Elements That Form Stable and Heritable Interactions ▿

    Science.gov (United States)

    Swamy, Lakshmi; Amulic, Borko; Deitsch, Kirk W.

    2011-01-01

    Antigenic variation in the human malaria parasite Plasmodium falciparum depends on the transcriptional regulation of the var gene family. In each individual parasite, mRNA is expressed exclusively from 1 var gene out of ∼60, while the rest of the genes are transcriptionally silenced. Both modifications to chromatin structure and DNA regulatory elements associated with each var gene have been implicated in the organization and maintenance of the silent state. Whether silencing is established at the level of entire chromosomal regions via heterochromatin spreading or at the level of individual var promoters through the action of a silencing element within each var intron has been debated. Here, we consider both possibilities, using clonal parasite lines carrying chromosomally integrated transgenes. We confirm a previous finding that the loss of an adjacent var intron results in var promoter activation and further show that transcriptional activation of a var promoter within a cluster does not affect the transcriptional activity of neighboring var promoters. Our results provide more evidence for the hypothesis that var genes are primarily silenced at the level of an individual gene, rather than by heterochromatin spreading. We also tested the intrinsic directionality of an intron's silencing effect on upstream or downstream var promoters. We found that an intron is capable of silencing in either direction and that, once established, a var promoter-intron pair is stably maintained through many generations, suggesting a possible role in epigenetic memory. This study provides insights into the regulation of endogenous var gene clusters. PMID:21317310

  7. In planta assays involving epigenetically silenced genes reveal inhibition of cytosine methylation by genistein

    Directory of Open Access Journals (Sweden)

    Arase Sachiko

    2012-03-01

    Full Text Available Abstract Background Cytosine methylation is involved in epigenetic control of gene expression in a wide range of organisms. An increasing number of examples indicate that changing the frequency of cytosine methylation in the genome is a feasible tool to engineer novel traits in plants. Although demethylating effects of compounds have been analyzed in human cultured cells in terms of suppressing cancer, their effect in plant cells has not been analyzed extensively. Here, we developed in planta assay systems to detect inhibition of cytosine methylation using plants that contain a transgene transcriptionally silenced by an epigenetic mechanism. Results Seeds of two transgenic plants were used: a petunia line that has been identified as a revertant of the co-suppression of the chalcone synthase-A (CHS-A gene and contains CHS-A transgenes whose transcription is repressed; Nicotiana benthamiana plants that contain the green fluorescent protein (GFP reporter gene whose transcription is repressed through virus-induced transcriptional gene silencing. Seeds of these plants were sown on a medium that contained a demethylating agent, either 5-azacytidine or trichostatin A, and the restoration of the transcriptionally active state of the transgene was detected in seedlings. Using these systems, we found that genistein, a major isoflavonoid compound, inhibits cytosine methylation, thus restoring transgene transcription. Genistein also restored the transcription of an epigenetically silenced endogenous gene in Arabidopsis plants. Conclusions Our assay systems allowed us to assess the inhibition of cytosine methylation, in particular of maintenance of methylation, by compounds in plant cells. These results suggest a novel role of flavonoids in plant cells and that genistein is useful for modifying the epigenetic state of plant genomes.

  8. RNAi-mediated Gene Silencing of Mutant Myotilin Improves Myopathy in LGMD1A Mice

    Directory of Open Access Journals (Sweden)

    Jian Liu

    2014-01-01

    Full Text Available Recent progress suggests gene therapy may one day be an option for treating some forms of limb girdle muscular dystrophy (LGMD. Nevertheless, approaches targeting LGMD have so far focused on gene replacement strategies for recessive forms of the disease. In contrast, no attempts have been made to develop molecular therapies for any of the eight dominantly inherited forms of LGMD. Importantly, the emergence of RNA interference (RNAi therapeutics in the last decade provided new tools to combat dominantly inherited LGMDs with molecular therapy. In this study, we describe the first RNAi-based, preclinical gene therapy approach for silencing a gene associated with dominant LGMD. To do this, we developed adeno-associated viral vectors (AAV6 carrying designed therapeutic microRNAs targeting mutant myotilin (MYOT, which is the underlying cause of LGMD type 1A (LGMD1A. Our best MYOT-targeted microRNA vector (called miMYOT significantly reduced mutant myotilin mRNA and soluble protein expression in muscles of LGMD1A mice (the TgT57I model both 3 and 9 months after delivery, demonstrating short- and long-term silencing effects. This MYOT gene silencing subsequently decreased deposition of MYOT-seeded intramuscular protein aggregates, which is the hallmark feature of LGMD1A. Histological improvements were accompanied by significant functional correction, as miMYOT-treated animals showed increased muscle weight and improved specific force in the gastrocnemius, which is one of the most severely affected muscles in TgT57I mice and patients with dominant myotilin mutations. These promising results in a preclinical model of LGMD1A support the further development of RNAi-based molecular therapy as a prospective treatment for LGMD1A. Furthermore, this study sets a foundation that may be refined and adapted to treat other dominant LGMD and related disorders.

  9. Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

    Directory of Open Access Journals (Sweden)

    Jiangyu Wu

    2013-01-01

    Full Text Available RNA interference (RNAi was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc. of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system.

  10. Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

    Science.gov (United States)

    Huang, Weizhe; He, Ziying

    2013-01-01

    RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

  11. RNAi dynamics in Juvenile Fasciola spp. Liver flukes reveals the persistence of gene silencing in vitro.

    Directory of Open Access Journals (Sweden)

    Paul McVeigh

    2014-09-01

    Full Text Available Fasciola spp. liver fluke cause pernicious disease in humans and animals. Whilst current control is unsustainable due to anthelmintic resistance, gene silencing (RNA interference, RNAi has the potential to contribute to functional validation of new therapeutic targets. The susceptibility of juvenile Fasciola hepatica to double stranded (dsRNA-induced RNAi has been reported. To exploit this we probe RNAi dynamics, penetrance and persistence with the aim of building a robust platform for reverse genetics in liver fluke. We describe development of standardised RNAi protocols for a commercially-available liver fluke strain (the US Pacific North West Wild Strain, validated via robust transcriptional silencing of seven virulence genes, with in-depth experimental optimisation of three: cathepsin L (FheCatL and B (FheCatB cysteine proteases, and a σ-class glutathione transferase (FheσGST.Robust transcriptional silencing of targets in both F. hepatica and Fasciola gigantica juveniles is achievable following exposure to long (200-320 nt dsRNAs or 27 nt short interfering (siRNAs. Although juveniles are highly RNAi-susceptible, they display slower transcript and protein knockdown dynamics than those reported previously. Knockdown was detectable following as little as 4h exposure to trigger (target-dependent and in all cases silencing persisted for ≥25 days following long dsRNA exposure. Combinatorial silencing of three targets by mixing multiple long dsRNAs was similarly efficient. Despite profound transcriptional suppression, we found a significant time-lag before the occurrence of protein suppression; FheσGST and FheCatL protein suppression were only detectable after 9 and 21 days, respectively.In spite of marked variation in knockdown dynamics, we find that a transient exposure to long dsRNA or siRNA triggers robust RNAi penetrance and persistence in liver fluke NEJs supporting the development of multiple-throughput phenotypic screens for control

  12. Increasing the amylose content of durum wheat through silencing of the SBEIIa genes

    Directory of Open Access Journals (Sweden)

    Masci Stefania

    2010-07-01

    Full Text Available Abstract Background High amylose starch has attracted particular interest because of its correlation with the amount of Resistant Starch (RS in food. RS plays a role similar to fibre with beneficial effects for human health, providing protection from several diseases such as colon cancer, diabetes, obesity, osteoporosis and cardiovascular diseases. Amylose content can be modified by a targeted manipulation of the starch biosynthetic pathway. In particular, the inactivation of the enzymes involved in amylopectin synthesis can lead to the increase of amylose content. In this work, genes encoding starch branching enzymes of class II (SBEIIa were silenced using the RNA interference (RNAi technique in two cultivars of durum wheat, using two different methods of transformation (biolistic and Agrobacterium. Expression of RNAi transcripts was targeted to the seed endosperm using a tissue-specific promoter. Results Amylose content was markedly increased in the durum wheat transgenic lines exhibiting SBEIIa gene silencing. Moreover the starch granules in these lines were deformed, possessing an irregular and deflated shape and being smaller than those present in the untransformed controls. Two novel granule bound proteins, identified by SDS-PAGE in SBEIIa RNAi lines, were investigated by mass spectrometry and shown to have strong homologies to the waxy proteins. RVA analysis showed new pasting properties associated with high amylose lines in comparison with untransformed controls. Finally, pleiotropic effects on other starch genes were found by semi-quantitative and Real-Time reverse transcription-polymerase chain reaction (RT-PCR. Conclusion We have found that the silencing of SBEIIa genes in durum wheat causes obvious alterations in granule morphology and starch composition, leading to high amylose wheat. Results obtained with two different methods of transformation and in two durum wheat cultivars were comparable.

  13. Silencing SlMED18, tomato Mediator subunit 18 gene, restricts internode elongation and leaf expansion.

    Science.gov (United States)

    Wang, Yunshu; Hu, Zongli; Zhang, Jianling; Yu, XiaoHui; Guo, Jun-E; Liang, Honglian; Liao, Changguang; Chen, Guoping

    2018-02-19

    Mediator complex, a conserved multi-protein, is necessary for controlling RNA polymerase II (Pol II) transcription in eukaryotes. Given little is known about them in tomato, a tomato Mediator subunit 18 gene was isolated and named SlMED18. To further explore the function of SlMED18, the transgenic tomato plants targeting SlMED18 by RNAi-mediated gene silencing were generated. The SlMED18-RNAi lines exhibited multiple developmental defects, including smaller size and slower growth rate of plant and significantly smaller compound leaves. The contents of endogenous bioactive GA 3 in SlMED18 silenced lines were slightly less than that in wild type. Furthermore, qRT-PCR analysis indicated that expression of gibberellins biosynthesis genes such as SlGACPS and SlGA20x2, auxin transport genes (PIN1, PIN4, LAX1 and LAX2) and several key regulators, KNOX1, KNOX2, PHAN and LANCEOLATE(LA), which involved in the leaf morphogenesis were significantly down-regulated in SlMED18-RNAi lines. These results illustrated that SlMED18 plays an essential role in regulating plant internode elongation and leaf expansion in tomato plants and it acts as a key positive regulator of gibberellins biosynthesis and signal transduction as well as auxin proper transport signalling. These findings are the basis for understanding the function of the individual Mediator subunits in tomato.

  14. Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.

    Science.gov (United States)

    Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E

    2010-12-15

    N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.

  15. Methylation and silencing of the retinoic acid receptor-β2 gene in cervical cancer

    International Nuclear Information System (INIS)

    Ivanova, Tatyana; Petrenko, Anatolii; Gritsko, Tatyana; Vinokourova, Svetlana; Eshilev, Ernest; Kobzeva, Vera; Kisseljov, Fjodor; Kisseljova, Natalia

    2002-01-01

    Expression of the retinoic acid receptor β2 (RAR-β2), a putative tumor suppressor gene, is reduced in various human cancers, including squamous cell carcinomas (SCC) of the uterine cervix. The mechanism of the inhibition of RAR-β2 expression remains obscure. We examined whether methylation of RAR-β2 gene could be responsible for this silencing in cervical SCC. Expression of RAR-β2 mRNA and methylation status of the 5' region of RAR-β2 gene were examined in 20 matched specimens from patients with cervical SCC and in three cervical cancer cell lines by Northern blot analysis and methylation-specific PCR (MSP) assay or Southern blot analysis respectively. In 8 out 20 cervical SCC (40%) the levels of RAR-β2 mRNA were decreased or undetectable in comparison with non-neoplastic cervix tissues. All 8 tumors with reduced levels of RAR-β2 mRNA expression showed methylation of the promoter and the first exon expressed in the RAR-β2 transcript. The RAR-β2 gene from non-neoplastic cervical tissues was mostly unmethylated and expressed, but methylated alleles of the gene were found in three samples of the morphologically normal tissues adjacent to the tumors. Three cervical cancer cell lines with extremely low level of RAR-β2 mRNA expression, SiHA, HeLA and CaSki, also showed methylation of this region of the RAR-β2 gene. These findings suggest that methylation of the 5' region of RAR-β2 gene may contribute to gene silencing and that methylation of this region may be an important and early event in cervical carcinogenesis. These findings may be useful to make retinoids more effective as preventive and therapeutic agents in combination with inhibitors of DNA methylation

  16. Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Maciej Pietrzak

    Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.

  17. Paramutation of tobacco transgenes by small RNA-mediated transcriptional gene silencing

    Czech Academy of Sciences Publication Activity Database

    Crhák Khaitová, Lucie; Fojtová, M.; Křížová, Kateřina; Lunerová Bedřichová, Jana; Fulneček, Jaroslav; Depicker, A.; Kovařík, Aleš

    2011-01-01

    Roč. 6, č. 5 (2011), s. 650-660 ISSN 1559-2294 R&D Projects: GA ČR(CZ) GD204/09/H002; GA MŠk(CZ) LC06004 Grant - others:GA ČR(CZ) GPP501/11/P667 Program:GP Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : transcriptional gene silencing * transgene epialleles * DNA methylation Subject RIV: BO - Biophysics Impact factor: 4.318, year: 2011

  18. Validation of RNAi Silencing Efficiency Using Gene Array Data shows 18.5% Failure Rate across 429 Independent Experiments

    Directory of Open Access Journals (Sweden)

    Gyöngyi Munkácsy

    2016-01-01

    Full Text Available No independent cross-validation of success rate for studies utilizing small interfering RNA (siRNA for gene silencing has been completed before. To assess the influence of experimental parameters like cell line, transfection technique, validation method, and type of control, we have to validate these in a large set of studies. We utilized gene chip data published for siRNA experiments to assess success rate and to compare methods used in these experiments. We searched NCBI GEO for samples with whole transcriptome analysis before and after gene silencing and evaluated the efficiency for the target and off-target genes using the array-based expression data. Wilcoxon signed-rank test was used to assess silencing efficacy and Kruskal–Wallis tests and Spearman rank correlation were used to evaluate study parameters. All together 1,643 samples representing 429 experiments published in 207 studies were evaluated. The fold change (FC of down-regulation of the target gene was above 0.7 in 18.5% and was above 0.5 in 38.7% of experiments. Silencing efficiency was lowest in MCF7 and highest in SW480 cells (FC = 0.59 and FC = 0.30, respectively, P = 9.3E−06. Studies utilizing Western blot for validation performed better than those with quantitative polymerase chain reaction (qPCR or microarray (FC = 0.43, FC = 0.47, and FC = 0.55, respectively, P = 2.8E−04. There was no correlation between type of control, transfection method, publication year, and silencing efficiency. Although gene silencing is a robust feature successfully cross-validated in the majority of experiments, efficiency remained insufficient in a significant proportion of studies. Selection of cell line model and validation method had the highest influence on silencing proficiency.

  19. Innate immune genes including a mucin-like gene, mul-1, induced by ionizing radiation in Caenorhabditis elegans.

    Science.gov (United States)

    Kimura, Takafumi; Takanami, Takako; Sakashita, Tetsuya; Wada, Seiichi; Kobayashi, Yasuhiko; Higashitani, Atsushi

    2012-10-01

    The effect of radiation on the intestine has been studied for more than one hundred years. It remains unclear, however, whether this organ uses specific defensive mechanisms against ionizing radiation. The infection with Pseudomonas aeruginosa (PA14) in Caenorhabditis elegans induces up-regulation of innate immune response genes. Here, we found that exposure to ionizing radiation also induces certain innate immune response genes such as F49F1.6 (termed mul-1), clec-4, clec-67, lys-1 and lys-2 in the intestine. Moreover, pre-treatment with ionizing radiation before seeding on PA14 lawn plate significantly increased survival rate in the nematode. We also studied transcription pathway of the mul-1 in response to ionizing radiation. Induction of mul-1 gene was highly dependent on the ELT-2 transcription factor and p38 MAPK. Moreover, the insulin/IGF-1 signal pathway works to enhance induction of this gene. The mul-1 gene showed a different induction pattern from the DNA damage response gene, ced-13, which implies that the expression of this gene might be triggered as an indirect effect of radiation. Silencing of the mul-1 gene led to growth retardation after treatment with ionizing radiation. We describe the cross-tolerance between the response to radiation exposure and the innate immune system.

  20. Dissecting epigenetic silencing complexity in the mouse lung cancer suppressor gene Cadm1.

    Directory of Open Access Journals (Sweden)

    Stella Marie Reamon-Buettner

    Full Text Available Disease-oriented functional analysis of epigenetic factors and their regulatory mechanisms in aberrant silencing is a prerequisite for better diagnostics and therapy. Yet, the precise mechanisms are still unclear and complex, involving the interplay of several effectors including nucleosome positioning, DNA methylation, histone variants and histone modifications. We investigated the epigenetic silencing complexity in the tumor suppressor gene Cadm1 in mouse lung cancer progenitor cell lines, exhibiting promoter hypermethylation associated with transcriptional repression, but mostly unresponsive to demethylating drug treatments. After predicting nucleosome positions and transcription factor binding sites along the Cadm1 promoter, we carried out single-molecule mapping with DNA methyltransferase M.SssI, which revealed in silent promoters high nucleosome occupancy and occlusion of transcription factor binding sites. Furthermore, M.SssI maps of promoters varied within and among the different lung cancer cell lines. Chromatin analysis with micrococcal nuclease also indicated variations in nucleosome positioning to have implications in the binding of transcription factors near nucleosome borders. Chromatin immunoprecipitation showed that histone variants (H2A.Z and H3.3, and opposing histone modification marks (H3K4me3 and H3K27me3 all colocalized in the same nucleosome positions that is reminiscent of epigenetic plasticity in embryonic stem cells. Altogether, epigenetic silencing complexity in the promoter region of Cadm1 is not only defined by DNA hypermethylation, but high nucleosome occupancy, altered nucleosome positioning, and 'bivalent' histone modifications, also likely contributed in the transcriptional repression of this gene in the lung cancer cells. Our results will help define therapeutic intervention strategies using epigenetic drugs in lung cancer.

  1. Investigations of barley stripe mosaic virus as a gene silencing vector in barley roots and in Brachypodium distachyon and oat

    DEFF Research Database (Denmark)

    Pacak, Andrzej; Geisler, Katrin; Jørgensen, Bodil

    2010-01-01

    -expressed genes we wanted to explore the potential of BSMV for silencing genes in root tissues. Furthermore, the newly completed genome sequence of the emerging cereal model species Brachypodium distachyon as well as the increasing amount of EST sequence information available for oat (Avena species) have created...

  2. Down-regulation of osmotin (PR5) gene by virus-induced gene silencing (VIGS) leads to susceptibility of resistant Piper colubrinum Link. to the oomycete pathogen Phytophthora capsici Leonian.

    Science.gov (United States)

    Anu, K; Jessymol, K K; Chidambareswaren, M; Gayathri, G S; Manjula, S

    2015-06-01

    Piper colubrinum Link., a distant relative of Piper nigrum L., is immune to the oomycete pathogen Phytophthora capsici Leonian that causes 'quick wilt' in cultivated black pepper (P. nigrum). The osmotin, PR5 gene homologue, earlier identified from P. colubrinum, showed significant overexpression in response to pathogen and defense signalling molecules. The present study focuses on the functional validation of P. colubrinum osmotin (PcOSM) by virus induced gene silencing (VIGS) using Tobacco Rattle Virus (TRV)-based vector. P. colubrinum plants maintained under controlled growth conditions in a growth chamber were infiltrated with Agrobacterium carrying TRV empty vector (control) and TRV vector carrying PcOSM. Three weeks post infiltration, viral movement was confirmed in newly emerged leaves of infiltrated plants by RT-PCR using TRV RNA1 and TRV RNA2 primers. Semi-quantitative RT-PCR confirmed significant down-regulation of PcOSM gene in TRV-PcOSM infiltrated plant compared with the control plants. The control and silenced plants were challenged with Phytophthora capsici which demonstrated that knock-down of PcOSM in P. colubrinum leads to increased fungal mycelial growth in silenced plants compared to control plants, which was accompanied by decreased accumulation of H2O2 as indicated by 3,3'-diaminobenzidine (DAB) staining. Thus, in this study, we demonstrated that Piper colubrinum osmotin gene is required for resisting P. capsici infection and has possible role in hypersensitive cell death response and oxidative burst signaling during infection.

  3. Manipulation of Cell Physiology Enables Gene Silencing in Well-differentiated Airway Epithelia

    Directory of Open Access Journals (Sweden)

    Sateesh Krishnamurthy

    2012-01-01

    Full Text Available The application of RNA interference-based gene silencing to the airway surface epithelium holds great promise to manipulate host and pathogen gene expression for therapeutic purposes. However, well-differentiated airway epithelia display significant barriers to double-stranded small-interfering RNA (siRNA delivery despite testing varied classes of nonviral reagents. In well-differentiated primary pig airway epithelia (PAE or human airway epithelia (HAE grown at the air–liquid interface (ALI, the delivery of a Dicer-substrate small-interfering RNA (DsiRNA duplex against hypoxanthine–guanine phosphoribosyltransferase (HPRT with several nonviral reagents showed minimal uptake and no knockdown of the target. In contrast, poorly differentiated cells (2–5-day post-seeding exhibited significant oligonucleotide internalization and target knockdown. This finding suggested that during differentiation, the barrier properties of the epithelium are modified to an extent that impedes oligonucleotide uptake. We used two methods to overcome this inefficiency. First, we tested the impact of epidermal growth factor (EGF, a known enhancer of macropinocytosis. Treatment of the cells with EGF improved oligonucleotide uptake resulting in significant but modest levels of target knockdown. Secondly, we used the connectivity map (Cmap database to correlate gene expression changes during small molecule treatments on various cells types with genes that change upon mucociliary differentiation. Several different drug classes were identified from this correlative assessment. Well-differentiated epithelia treated with DsiRNAs and LY294002, a PI3K inhibitor, significantly improved gene silencing and concomitantly reduced target protein levels. These novel findings reveal that well-differentiated airway epithelia, normally resistant to siRNA delivery, can be pretreated with small molecules to improve uptake of synthetic oligonucleotide and RNA interference (RNAi responses.

  4. Phosphorus starvation induces post-transcriptional CHS gene silencing in Petunia corolla.

    Science.gov (United States)

    Hosokawa, Munetaka; Yamauchi, Takayoshi; Takahama, Masayoshi; Goto, Mariko; Mikano, Sachiko; Yamaguchi, Yuki; Tanaka, Yoshiyuki; Ohno, Sho; Koeda, Sota; Doi, Motoaki; Yazawa, Susumu

    2013-05-01

    The corolla of Petunia 'Magic Samba' exhibits unstable anthocyanin expression depending on its phosphorus content. Phosphorus deficiency enhanced post-transcriptional gene silencing of chalcone synthase - A in the corolla. Petunia (Petunia hybrida) 'Magic Samba' has unstable red-white bicolored corollas that respond to nutrient deficiency. We grew this cultivar hydroponically using solutions that lacked one or several nutrients to identify the specific nutrient related to anthocyanin expression in corolla. The white area of the corolla widened under phosphorus (P)-deficient conditions. When the P content of the corolla grown under P-deficient conditions dropped to 40 corollas until the plants died. Other elemental deficiencies had no clear effects on anthocyanin suppression in the corolla. After phosphate was resupplied to the P-deficient plants, anthocyanin was restored in the corollas. The expression of chalcone synthase-A (CHS-A) was suppressed in the white area that widened under P-suppressed conditions, whereas the expression of several other genes related to anthocyanin biosynthesis was enhanced more in the white area than in the red area. Reddish leaves and sepals developed under the P-deficient condition, which is a typical P-deficiency symptom. Two genes related to anthocyanin biosynthesis were enhanced in the reddish organs. Small interfering RNA analysis of CHS-A showed that the suppression resulted from post-transcriptional gene silencing (PTGS). Thus, it was hypothesized that the enhancement of anthocyanin biosynthetic gene expression due to P-deficiency triggered PTGS of CHS-A, which resulted in white corolla development.

  5. Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects

    International Nuclear Information System (INIS)

    Huang, Shang-Lang; Chao, Chuck C.-K.

    2015-01-01

    A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug

  6. Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Shang-Lang [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Chao, Chuck C.-K., E-mail: cckchao@mail.cgu.edu.tw [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Graduate Institute of Biomedical Sciences, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Department of Medical Research and Development, Chang Gung Memorial Hospital, Taoyuan 333, Taiwan (China)

    2015-06-16

    A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug.

  7. Involvement of Multiple Gene-Silencing Pathways in a Paramutation-like Phenomenon in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Zhimin Zheng

    2015-05-01

    Full Text Available Paramutation is an epigenetic phenomenon that has been observed in a number of multicellular organisms. The epigenetically silenced state of paramutated alleles is not only meiotically stable but also “infectious” to active homologous alleles. The molecular mechanism of paramutation remains unclear, but components involved in RNA-directed DNA methylation (RdDM are required. Here, we report a multi-copy pRD29A-LUC transgene in Arabidopsis thaliana that behaves like a paramutation locus. The silent state of LUC is induced by mutations in the DNA glycosylase gene ROS1. The silent alleles of LUC are not only meiotically stable but also able to transform active LUC alleles into silent ones, in the absence of ros1 mutations. Maintaining silencing at the LUC gene requires action of multiple pathways besides RdDM. Our study identified specific factors that are involved in the paramutation-like phenomenon and established a model system for the study of paramutation in Arabidopsis.

  8. Systematic Evaluation of Promising Clinical Trials-Gene Silencing for the Treatment of Glioblastoma.

    Science.gov (United States)

    Karaarslan, Numan; Yilmaz, Ibrahim; Ozbek, Hanefi; Caliskan, Tezcan; Topuk, Savas; Sirin, Duygu Yasar; Ates, Ozkan

    2018-04-06

    The aim of this study was to systematically investigate the role of artificial small interfering RNA (siRNA) molecules in glioblastoma treatment and to give a detailed overview of the literature concerning studies performed in this field worldwide in the last 31 years. Articles about clinical trials conducted between December 1, 1949 and November 8, 2017, were identified from the Cochrane Collaboration, the Cochrane Library, Ovid MEDLINE, ProQuest, the National Library of Medicine, and PubMed electronic databases, using the terms "post transcriptional gene silencing," "small interfering RNA," "siRNA," and "glioblastoma," either individually or combined (\\"OR\\" and \\"AND"), without language and country restrictions. Articles that met the examination criteria were included in the study. After descriptive statistical evaluation, the results were reported in frequency (%). After scanning 2.752 articles, five articles were found that met the research criteria. Examination of full texts of the five identified articles provided no sufficient evidence for research conducted with regard to the use of gene silencing via siRNAs in glioblastoma treatment. To be able to evaluate the clinical use of siRNAs, there is an urgent need for in-vivo studies and for trials with randomized, controlled, and clinical designs that provide long-term functional outcomes.

  9. HC-Pro silencing suppressor significantly alters the gene expression profile in tobacco leaves and flowers

    Directory of Open Access Journals (Sweden)

    Lehto Kirsi

    2011-04-01

    Full Text Available Abstract Background RNA silencing is used in plants as a major defence mechanism against invasive nucleic acids, such as viruses. Accordingly, plant viruses have evolved to produce counter defensive RNA-silencing suppressors (RSSs. These factors interfere in various ways with the RNA silencing machinery in cells, and thereby disturb the microRNA (miRNA mediated endogene regulation and induce developmental and morphological changes in plants. In this study we have explored these effects using previously characterized transgenic tobacco plants which constitutively express (under CaMV 35S promoter the helper component-proteinase (HC-Pro derived from a potyviral genome. The transcript levels of leaves and flowers of these plants were analysed using microarray techniques (Tobacco 4 × 44 k, Agilent. Results Over expression of HC-Pro RSS induced clear phenotypic changes both in growth rate and in leaf and flower morphology of the tobacco plants. The expression of 748 and 332 genes was significantly changed in the leaves and flowers, respectively, in the HC-Pro expressing transgenic plants. Interestingly, these transcriptome alterations in the HC-Pro expressing tobacco plants were similar as those previously detected in plants infected with ssRNA-viruses. Particularly, many defense-related and hormone-responsive genes (e.g. ethylene responsive transcription factor 1, ERF1 were differentially regulated in these plants. Also the expression of several stress-related genes, and genes related to cell wall modifications, protein processing, transcriptional regulation and photosynthesis were strongly altered. Moreover, genes regulating circadian cycle and flowering time were significantly altered, which may have induced a late flowering phenotype in HC-Pro expressing plants. The results also suggest that photosynthetic oxygen evolution, sugar metabolism and energy levels were significantly changed in these transgenic plants. Transcript levels of S

  10. The rde-1 gene, RNA interference, and transposon silencing in C. elegans.

    Science.gov (United States)

    Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C

    1999-10-15

    Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.

  11. RNAi Mediated curcin precursor gene silencing in Jatropha (Jatropha curcas L.).

    Science.gov (United States)

    Patade, Vikas Yadav; Khatri, Deepti; Kumar, Kamal; Grover, Atul; Kumari, Maya; Gupta, Sanjay Mohan; Kumar, Devender; Nasim, Mohammed

    2014-07-01

    Curcin, a type I ribosomal inhibiting protein-RIP, encoded by curcin precursor gene, is a phytotoxin present in Jatropha (Jatropha curcas L.). Here, we report designing of RNAi construct for the curcin precursor gene and further its genetic transformation of Jatropha to reduce its transcript expression. Curcin precursor gene was first cloned from Jatropha strain DARL-2 and part of the gene sequence was cloned in sense and antisense orientation separated by an intron sequence in plant expression binary vector pRI101 AN. The construction of the RNAi vector was confirmed by double digestion and nucleotide sequencing. The vector was then mobilized into Agrobacterium tumefaciens strain GV 3101 and used for tissue culture independent in planta transformation protocol optimized for Jatropha. Germinating seeds were injured with a needle before infection with Agrobacterium and then transferred to sterilized sand medium. The seedlings were grown for 90 days and genomic DNA was isolated from leaves for transgenic confirmation based on real time PCR with NPT II specific dual labeled probe. Result of the transgenic confirmation analysis revealed presence of the gene silencing construct in ten out of 30 tested seedlings. Further, quantitative transcript expression analysis of the curcin precursor gene revealed reduction in the transcript abundance by more than 98% to undetectable level. The transgenic plants are being grown in containment for further studies on reduction in curcin protein content in Jatropha seeds.

  12. Gene silencing of indoleamine 2,3-dioxygenase 2 in melanoma cells induces apoptosis through the suppression of NAD+ and inhibits in vivo tumor growth.

    Science.gov (United States)

    Liu, Yanling; Zhang, Yujuan; Zheng, Xiufen; Zhang, Xusheng; Wang, Hongmei; Li, Qin; Yuan, Keng; Zhou, Nanjing; Yu, Yanrong; Song, Na; Fu, Jiamin; Min, Weiping

    2016-05-31

    Indoleamine 2,3-dioxygenase 2 (IDO2) is a newly discovered enzyme that catalyzes the initial and rate-limiting step in the degradation of tryptophan. As a homologous protein of IDO1, IDO2 plays an inhibitory role in T cell proliferation, and it is essential for regulatory T cell (Treg) generation in healthy conditions. Little is known about the immune-independent functions of IDO2 relevant to its specific contributions to physiology and pathophysiology in cancer cells. The purpose of this study was to assess the impact of IDO2 gene silencing as a way to inhibit B16-BL6 cancer cells in a murine model. Here, for the first time, we show that knockdown of IDO2 using small interfering RNA (siRNA) inhibits cancer cell proliferation, arrests cell cycle in G1, induces greater cell apoptosis, and reduces cell migration in vitro. Knockdown of IDO2 decreased the generation of nicotinamide adenine dinucleotide (NAD+) while increasing the generation of reactive oxygen species (ROS). We further demonstrate that cell apoptosis, induced by IDO2 downregulation, can be weakened by addition of exogenous NAD+, suggesting a novel mechanism by which IDO2 promotes tumor growth through its metabolite product NAD+. In addition to in vitro findings, we also demonstrate that IDO2 silencing in tumor cells using short hairpin RNA (shRNA) delayed tumor formation and arrested tumor growth in vivo. In conclusion, this study demonstrates a new non-immune-associated mechanism of IDO2 in vitro and IDO2 expression in B16-BL6 cells contributes to cancer development and progression. Our research provides evidence of a novel target for gene silencing that has the potential to enhance cancer therapy.

  13. An RNA-seq transcriptome analysis of histone modifiers and RNA silencing genes in soybean during floral initiation process.

    Directory of Open Access Journals (Sweden)

    Lim Chee Liew

    Full Text Available Epigenetics has been recognised to play vital roles in many plant developmental processes, including floral initiation through the epigenetic regulation of gene expression. The histone modifying proteins that mediate these modifications involve the SET domain-containing histone methyltransferases, JmjC domain-containing demethylase, acetylases and deacetylases. In addition, RNA interference (RNAi-associated genes are also involved in epigenetic regulation via RNA-directed DNA methylation and post-transcriptional gene silencing. Soybean, a major crop legume, requires a short day to induce flowering. How histone modifications regulate the plant response to external cues that initiate flowering is still largely unknown. Here, we used RNA-seq to address the dynamics of transcripts that are potentially involved in the epigenetic programming and RNAi mediated gene silencing during the floral initiation of soybean. Soybean is a paleopolyploid that has been subjected to at least two rounds of whole genome duplication events. We report that the expanded genomic repertoire of histone modifiers and RNA silencing genes in soybean includes 14 histone acetyltransferases, 24 histone deacetylases, 47 histone methyltransferases, 15 protein arginine methyltransferases, 24 JmjC domain-containing demethylases and 47 RNAi-associated genes. To investigate the role of these histone modifiers and RNA silencing genes during floral initiation, we compared the transcriptional dynamics of the leaf and shoot apical meristem at different time points after a short-day treatment. Our data reveal that the extensive activation of genes that are usually involved in the epigenetic programming and RNAi gene silencing in the soybean shoot apical meristem are reprogrammed for floral development following an exposure to inductive conditions.

  14. H3K9me-independent gene silencing in fission yeast heterochromatin by Clr5 and histone deacetylases

    DEFF Research Database (Denmark)

    Hansen, Klavs R; Hazan, Idit; Shanker, Sreenath

    2011-01-01

    organisms such as fission yeast. In spite of numerous studies, the relative contributions of the various heterochromatic histone marks to the properties of heterochromatin remain largely undefined. Here, we report that silencing of the fission yeast mating-type cassettes, which are located in a well......, our results point to histone deacetylases as prominent repressors of gene expression in fission yeast heterochromatin. These deacetylases can act in concert with, or independently of, the widely studied H3K9me mark to influence gene silencing at heterochromatic loci....

  15. Reactivation of CDX2 in Gastric Cancer as Mark for Gene Silencing Memory

    International Nuclear Information System (INIS)

    Kameoka, Yuri; Kitazawa, Riko; Ariasu, Kanazu; Tachibana, Ryosuke; Mizuno, Yosuke; Haraguchi, Ryuma; Kitazawa, Sohei

    2015-01-01

    To explore the epigenetic mechanism that reactivates CDX2 (a homeobox transcription factor that serves as a tumor-suppressor gene) in intestinal-type gastric cancer during cancer progression, we examined the methylation status of the CDX2 gene promoter and the expression pattern of methyl-CpG binding protein-2 (MeCP2). From archives of the pathology records of surgically excised advanced stomach cancer cases in the Department of Molecular Pathology, Ehime University in a past decate (n=265), 10 cases of intestinal-type tubular adenocarcinoma, well-differentiated type (wel) with minor poorly-differentiated adenocarcinoma (por) components were selected. The expression pattern of CDX2, MUC2 and MeCP2 in these 10 cases was analyzed by immunohistochemistry. The cancerous and non-cancerous areas were selectively obtained by microdissection, and the methylation status of the CDX2 promoter of each area was assessed by methylation-specific polymerase chain reaction (MSP). In all 10 cases, CDX2 expression was clearly observed in the nucleus of the non-cancerous background of the intestinal metaplasic area, where the unmethylation pattern of the CDX2 gene promoter prevailed with reduced MeCP2 expression. In this metaplastic area, CDX2 expression was co-localized with its target gene, MUC2. CDX2 expression then disappeared from the deep invasive wel area. Reflecting the reduced CDX2 expression, microdissected samples from all the wel areas showed hypermethylation of the CDX2 gene promoter by MSP, with prominent MeCP2 expression. Interestingly, while hypermethylation of the CDX2 gene promoter was maintained in the por area in 8 of the 10 cases, CDX2 expression was restored in por areas where MeCP2 expression was markedly and selectively reduced. The other two cases, however, showed a constant MeCP2 expression level comparable to the surrounding deep invasive wel area with negative CDX2 expression. Therefore, gene silencing by hypermethylation may be overcome by the reduction of

  16. Stunned Silence: Gene Expression Programs in Human Cells Infected with Monkeypox or Vaccinia Virus

    Science.gov (United States)

    Rubins, Kathleen H.; Hensley, Lisa E.; Relman, David A.; Brown, Patrick O.

    2011-01-01

    Poxviruses use an arsenal of molecular weapons to evade detection and disarm host immune responses. We used DNA microarrays to investigate the gene expression responses to infection by monkeypox virus (MPV), an emerging human pathogen, and Vaccinia virus (VAC), a widely used model and vaccine organism, in primary human macrophages, primary human fibroblasts and HeLa cells. Even as the overwhelmingly infected cells approached their demise, with extensive cytopathic changes, their gene expression programs appeared almost oblivious to poxvirus infection. Although killed (gamma-irradiated) MPV potently induced a transcriptional program characteristic of the interferon response, no such response was observed during infection with either live MPV or VAC. Moreover, while the gene expression response of infected cells to stimulation with ionomycin plus phorbol 12-myristate 13-acetate (PMA), or poly (I-C) was largely unimpaired by infection with MPV, a cluster of pro-inflammatory genes were a notable exception. Poly(I-C) induction of genes involved in alerting the innate immune system to the infectious threat, including TNF-alpha, IL-1 alpha and beta, CCL5 and IL-6, were suppressed by infection with live MPV. Thus, MPV selectively inhibits expression of genes with critical roles in cell-signaling pathways that activate innate immune responses, as part of its strategy for stealthy infection. PMID:21267444

  17. Stunned silence: gene expression programs in human cells infected with monkeypox or vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Kathleen H Rubins

    2011-01-01

    Full Text Available Poxviruses use an arsenal of molecular weapons to evade detection and disarm host immune responses. We used DNA microarrays to investigate the gene expression responses to infection by monkeypox virus (MPV, an emerging human pathogen, and Vaccinia virus (VAC, a widely used model and vaccine organism, in primary human macrophages, primary human fibroblasts and HeLa cells. Even as the overwhelmingly infected cells approached their demise, with extensive cytopathic changes, their gene expression programs appeared almost oblivious to poxvirus infection. Although killed (gamma-irradiated MPV potently induced a transcriptional program characteristic of the interferon response, no such response was observed during infection with either live MPV or VAC. Moreover, while the gene expression response of infected cells to stimulation with ionomycin plus phorbol 12-myristate 13-acetate (PMA, or poly (I-C was largely unimpaired by infection with MPV, a cluster of pro-inflammatory genes were a notable exception. Poly(I-C induction of genes involved in alerting the innate immune system to the infectious threat, including TNF-alpha, IL-1 alpha and beta, CCL5 and IL-6, were suppressed by infection with live MPV. Thus, MPV selectively inhibits expression of genes with critical roles in cell-signaling pathways that activate innate immune responses, as part of its strategy for stealthy infection.

  18. Synthesis and Gene Silencing Properties of siRNAs Containing Terminal Amide Linkages

    Directory of Open Access Journals (Sweden)

    Maria Gaglione

    2014-01-01

    Full Text Available The active components of the RNAi are 21 nucleotides long dsRNAs containing a 2 nucleotide overhang at the 3′ end, carrying 5′-phosphate and 3′-hydroxyl groups (siRNAs. Structural analysis revealed that the siRNA is functionally bound at both ends to RISC. Terminal modifications are considered with interest as the introduction of chemical moieties interferes with the 3′ overhang recognition by the PAZ domain and the 5′-phosphate recognition by the MID and PIWI domains of RISC. Herein, we report the synthesis of modified siRNAs containing terminal amide linkages by introducing hydroxyethylglycine PNA (hegPNA moieties at 5′, and at 3′ positions and on both terminals. Results of gene silencing studies highlight that some of these modifications are compatible with the RNAi machinery and markedly increase the resistance to serum-derived nucleases even after 24 h of incubation. Molecular docking simulations were attained to give at atomistic level a clearer picture of the effect of the most performing modifications on the interactions with the human Argonaute 2 PAZ, MID, and PIWI domains. This study adds another piece to the puzzle of the heterogeneous chemical modifications that can be attained to enhance the silencing efficiency of siRNAs.

  19. Efficient transformation and artificial miRNA gene silencing in Lemna minor.

    Science.gov (United States)

    Cantó-Pastor, A; Mollá-Morales, A; Ernst, E; Dahl, W; Zhai, J; Yan, Y; Meyers, B C; Shanklin, J; Martienssen, R

    2015-01-01

    Despite rapid doubling time, simple architecture and ease of metabolic labelling, a lack of genetic tools in the Lemnaceae (duckweed) has impeded the full implementation of this organism as a model for biological research. Here, we present technologies to facilitate high-throughput genetic studies in duckweed. We developed a fast and efficient method for producing Lemna minor stable transgenic fronds via Agrobacterium-mediated transformation and regeneration from tissue culture. Additionally, we engineered an artificial microRNA (amiRNA) gene silencing system. We identified a Lemna gibba endogenous miR166 precursor and used it as a backbone to produce amiRNAs. As a proof of concept we induced the silencing of CH42, a magnesium chelatase subunit, using our amiRNA platform. Expression of CH42 in transgenic L. minor fronds was significantly reduced, which resulted in reduction of chlorophyll pigmentation. The techniques presented here will enable tackling future challenges in the biology and biotechnology of Lemnaceae. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  20. Simultaneous silencing of two arginine decarboxylase genes alters development in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Diana eSánchez-Rangel

    2016-03-01

    Full Text Available Polyamines (PAs are small aliphatic polycations that are found ubiquitously in all organisms. In plants, PAs are involved in diverse biological processes such as growth, development, and stress responses. In Arabidopsis thaliana, the arginine decarboxylase enzymes (ADC1 and 2 catalyze the first step of PA biosynthesis. For a better understanding of PA biological functions, mutants in PA biosynthesis have been generated; however, the double adc1/adc2 mutant is not viable in A. thaliana. In this study, we generated non-lethal A. thaliana lines through an artificial microRNA that simultaneously silenced the two ADC genes (amiR:ADC. The generated transgenic lines (amiR:ADC-L1 and -L2 showed reduced AtADC1 and AtADC2 transcript levels. For further analyses the amiR:ADC-L2 line was selected. We found that the amiR:ADC-L2 line showed a significant decrease of their PA levels. The co-silencing revealed a stunted growth in A. thaliana seedlings, plantlets and delay in its flowering rate; these phenotypes were reverted with PA treatment. In addition, amiR:ADC-L2 plants displayed two seed phenotypes, such as yellow and brownish seeds. The yellow mutant seeds were smaller than adc1, adc2 mutants and wild type seeds; however, the brownish were the smallest seeds with arrested embryos at the torpedo stage. These data reinforce the importance of PA homeostasis in the plant development processes.

  1. Silencing the alarms: innate immune antagonism by rotavirus NSP1 and VP3

    Science.gov (United States)

    Morelli, Marco; Ogden, Kristen M.; Patton, John T.

    2016-01-01

    The innate immune response involves a broad array of pathogen sensors that stimulate the production of interferons (IFN) to induce an antiviral state. Rotavirus, a significant cause of childhood gastroenteritis and a member of the Reoviridae family of segmented, double-stranded RNA viruses, encodes at least two direct antagonists of host innate immunity: NSP1 and VP3. NSP1, a putative E3 ubiquitin ligase, mediates the degradation of cellular factors involved in both IFN induction and downstream signaling. VP3, the viral capping enzyme, utilizes a 2H-phosphodiesterase domain to prevent activation of the cellular oligoadenylate synthase (OAS)-RNase L pathway. Computational, molecular, and biochemical studies have provided key insights into the structural and mechanistic basis of innate immune antagonism by NSP1 and VP3 of group A rotaviruses (RVA). Future studies with non-RVA isolates will be essential to understand how other RV species evade host innate immune responses. PMID:25724417

  2. Effects of gene silencing of CypB on gastric cancer cells.

    Science.gov (United States)

    Guo, Feng; Zhang, Ying; Zhao, Chun-Na; Li, Lin; Guo, Yan-Jun

    2015-04-01

    To determine the effect of gene silencing of cyclophilin B (CypB) on growth and proliferation of gastric cancer cells. CypB siRNA lentivirus (LV-CypB-si) and control lentivirus (LV-si-con) were produced. CypB expression in gastric cancer cell lines was detected by Western blot. BGC823 and SGC7901 cells were chosen to be infected with LV-si-con and LV-CypB-si, and stable transfectants were isolated. The cell groups transfected with LV-CypB-siRNA, LV-siRNA-con and transfected no carrier were served as the experimental group, the implicit control group and the blank control group respectively. MTT and colony formation assays were used to examine the effect of CypB on the cell growth and proliferation in vitro. Cell cycle was analyzed with flow cytometry. The expression of VEGFR of BGC823-si and SGC7901-si was detected by Western blot. Gene silencing of CypB can inhibit gastric cancer cell growth, proliferation, cell cycle progress and tumorigenesis. CypB expression level was obviously higher in SGC7901 and BGC823 than MKN28 and GES. These two cell lines were infected with LV-si-con and LV-CypB-si respectively. MTT and cloney formation assays showed a significantly decreased rate of cell proliferation from the forth day or the fifth day in cells transfected with LV-CypB-si (PCypB resulted in slightly decreased percentage of S phase and increased percentage of G1 (PCypB could promote the G1-S transition of gastric cancer cell. In addition, the expression of VEGF of BGC823 and SGC7901 transfected with CypB siRNA was reduced in comparison with the implicit control group and the blank control group. Gene silencing of CypB decreases gastric cancer cells proliferation and in vivo tumorigenesis. These findings indiccate CypB could be a potential biomarker and therapeutic target for gastric cancer. Copyright © 2015 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.

  3. ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

    Directory of Open Access Journals (Sweden)

    de Souza Emanuel M

    2009-03-01

    Full Text Available Abstract Background ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. Methods First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP. Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. Results The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM; tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC was 76.2% compared with 25.5% in invasive ductal carcinoma

  4. ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

    International Nuclear Information System (INIS)

    Seniski, Gerusa G; Zanata, Silvio M; Costa, Fabrício F; Klassen, Giseli; Camargo, Anamaria A; Ierardi, Daniela F; Ramos, Edneia AS; Grochoski, Mariana; Ribeiro, Enilze SF; Cavalli, Iglenir J; Pedrosa, Fabio O; Souza, Emanuel M de

    2009-01-01

    ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR) treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP). Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR) demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM); tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC) was 76.2% compared with 25.5% in invasive ductal carcinoma (IDC), and this difference was

  5. An Optimized Protocol to Increase Virus-Induced Gene Silencing Efficiency and Minimize Viral Symptoms in Petunia

    OpenAIRE

    Broderick, Shaun R.; Jones, Michelle L.

    2013-01-01

    Virus-induced gene silencing (VIGS) is used to down-regulate endogenous plant genes. VIGS efficiency depends on viral proliferation and systemic movement throughout the plant. Although tobacco rattle virus (TRV)-based VIGS has been successfully used in petunia (Petunia × hybrida), the protocol has not been thoroughly optimized for efficient and uniform gene down-regulation in this species. Therefore, we evaluated six parameters that improved VIGS in petunia. Inoculation of mechanically wounde...

  6. Differential Cotton leaf crumple virus-VIGS-mediated gene silencing and viral genome localization in different Gossypium hirsutum genetic backgrounds

    KAUST Repository

    Idris, Ali

    2010-12-01

    A Cotton leaf crumple virus (CLCrV)-based gene silencing vector containing a fragment of the Gossypium hirsutum Magnesium chelatase subunit I was used to establish endogenous gene silencing in cotton of varied genetic backgrounds. Biolistic inoculation resulted in systemic and persistent photo-bleaching of the leaves and bolls of the seven cultivars tested, however, the intensity of silencing was variable. CLCrV-VIGS-mediated expression of green fluorescent protein was used to monitor the in planta distribution of the vector, indicating successful phloem invasion in all cultivars tested. Acala SJ-1, one of the cotton cultivars, was identified as a particularly optimal candidate for CLCrV-VIGS-based cotton reverse-genetics. © 2010 Elsevier Ltd.

  7. Sperm competition, immunity, selfish genes and cancer.

    Science.gov (United States)

    Lewis, Z; Price, T A R; Wedell, N

    2008-10-01

    Sperm competition is widespread and has played an important role in shaping male reproductive characters such as testis size and numbers of sperm produced, and this is reflected in the rapid evolution of many reproductive genes. Additionally, sperm competition has been implicated in the rapid evolution of seminal fluids. However, our understanding of the molecular basis of many traits thought to be important in sperm competition is rudimentary. Furthermore, links between sperm competition and a range of issues not directly related to reproduction are only just beginning to be explored. These include associations between sperm competition and selfish genes, immunity and diseases such as cancer.We briefly review these topics and suggest areas we consider worthy of additional research.

  8. Normalization of Overexpressed α-Synuclein Causing Parkinson's Disease By a Moderate Gene Silencing With RNA Interference

    Directory of Open Access Journals (Sweden)

    Masaki Takahashi

    2015-01-01

    Full Text Available The α-synuclein (SNCA gene is a responsible gene for Parkinson's disease (PD; and not only nucleotide variations but also overexpression of SNCA appears to be involved in the pathogenesis of PD. A specific inhibition against mutant SNCA genes carrying nucleotide variations may be feasible by a specific silencing such as an allele-specific RNA interference (RNAi; however, there is no method for restoring the SNCA overexpression to a normal level. Here, we show that an atypical RNAi using small interfering RNAs (siRNAs that confer a moderate level of gene silencing is capable of controlling overexpressed SNCA genes to return to a normal level; named “expression-control RNAi” (ExCont-RNAi. ExCont-RNAi exhibited little or no significant off-target effects in its treated PD patient's fibroblasts that carry SNCA triplication. To further assess the therapeutic effect of ExCont-RNAi, PD-model flies that carried the human SNCA gene underwent an ExCont-RNAi treatment. The treated PD-flies demonstrated a significant improvement in their motor function. Our current findings suggested that ExCont-RNAi might be capable of becoming a novel therapeutic procedure for PD with the SNCA overexpression, and that siRNAs conferring a moderate level of gene silencing to target genes, which have been abandoned as useless siRNAs so far, might be available for controlling abnormally expressed disease-causing genes without producing adverse effects.

  9. Deletion of an X-inactivation boundary disrupts adjacent gene silencing.

    Directory of Open Access Journals (Sweden)

    Lindsay M Horvath

    2013-11-01

    Full Text Available In mammalian females, genes on one X are largely silenced by X-chromosome inactivation (XCI, although some "escape" XCI and are expressed from both Xs. Escapees can closely juxtapose X-inactivated genes and provide a tractable model for assessing boundary function at epigenetically regulated loci. To delimit sequences at an XCI boundary, we examined female mouse embryonic stem cells carrying X-linked BAC transgenes derived from an endogenous escape locus. Previously we determined that large BACs carrying escapee Kdm5c and flanking X-inactivated transcripts are properly regulated. Here we identify two lines with truncated BACs that partially and completely delete the distal Kdm5c XCI boundary. This boundary is not required for escape, since despite integrating into regions that are normally X inactivated, transgenic Kdm5c escapes XCI, as determined by RNA FISH and by structurally adopting an active conformation that facilitates long-range preferential association with other escapees. Yet, XCI regulation is disrupted in the transgene fully lacking the distal boundary; integration site genes up to 350 kb downstream of the transgene now inappropriately escape XCI. Altogether, these results reveal two genetically separable XCI regulatory activities at Kdm5c. XCI escape is driven by a dominant element(s retained in the shortest transgene that therefore lies within or upstream of the Kdm5c locus. Additionally, the distal XCI boundary normally plays an essential role in preventing nearby genes from escaping XCI.

  10. Illuminating the gateway of gene silencing: perspective of RNA interference technology in clinical therapeutics.

    Science.gov (United States)

    Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok

    2012-07-01

    A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.

  11. H Ferritin Gene Silencing in a Human Metastatic Melanoma Cell Line: A Proteomic Analysis

    DEFF Research Database (Denmark)

    Di Sanzo, Maddalena; Gaspari, Marco; Misaggi, Roberta

    2011-01-01

    Ferritin, the major intracellular iron-storage protein, is made of 24 subunits of two types, H and L. Besides regulating intracellular iron homeostasis, it has been found that ferritin, in particular the H subunit (FHC), is involved in different biological events such as cell differentiation...... and pathologic states (i.e., neurodegeneration and cancer). This study is aimed at investigating the whole-cell proteome of FHC-expressing and sh-RNA-silenced human metastatic melanoma cells (MM07(m)) in the attempt to identify and classify the highest number of proteins directly or indirectly controlled...... of H ferritin signaling pathways and lend support to the hypothesis that specific targeting of this gene might be an attractive and potentially effective strategy for the management of metastatic melanoma....

  12. RNA-mediated gene silencing signals are not graft transmissible from the rootstock to the scion in greenhouse-grown apple plants Malus sp.

    Science.gov (United States)

    Flachowsky, Henryk; Tränkner, Conny; Szankowski, Iris; Waidmann, Sascha; Hanke, Magda-Viola; Treutter, Dieter; Fischer, Thilo C

    2012-01-01

    RNA silencing describes the sequence specific degradation of RNA targets. Silencing is a non-cell autonomous event that is graft transmissible in different plant species. The present study is the first report on systemic acquired dsRNA-mediated gene silencing of transgenic and endogenous gene sequences in a woody plant like apple. Transgenic apple plants overexpressing a hairpin gene construct of the gusA reporter gene were produced. These plants were used as rootstocks and grafted with scions of the gusA overexpressing transgenic apple clone T355. After grafting, we observed a reduction of the gusA gene expression in T355 scions in vitro, but not in T355 scions grown in the greenhouse. Similar results were obtained after silencing of the endogenous Mdans gene in apple that is responsible for anthocyanin biosynthesis. Subsequently, we performed grafting experiments with Mdans silenced rootstocks and red leaf scions of TNR31-35 in order to evaluate graft transmitted silencing of the endogenous Mdans. The results obtained suggested a graft transmission of silencing signals in in vitro shoots. In contrast, no graft transmission of dsRNA-mediated gene silencing signals was detectable in greenhouse-grown plants and in plants grown in an insect protection tent.

  13. Disruption of plant carotenoid biosynthesis through virus-induced gene silencing affects oviposition behaviour of the butterfly Pieris rapae

    NARCIS (Netherlands)

    Zheng, S.J.; Snoeren, T.A.L.; Hogewoning, S.W.; Loon, van J.J.A.; Dicke, M.

    2010-01-01

    Optical plant characteristics are important cues to plant-feeding insects. In this article, we demonstrate for the first time that silencing the phytoene desaturase (PDS) gene, encoding a key enzyme in plant carotenoid biosynthesis, affects insect oviposition site selection behaviour. Virus-induced

  14. Virus-induced gene silencing in Medicago truncatula and Lathyrus odorata

    DEFF Research Database (Denmark)

    Grønlund, Mette; Kjær, Gabriela Didina Constantin; Piednoir, Elodie

    2008-01-01

    Virus-induced gene silencing (VIGS) has become an important reverse genetics tool for functional genomics. VIGS vectors based on Pea early browning virus (PEBV, genus Tobravirus) and Bean pod mottle virus (genus Comovirus) are available for the legume species Pisum sativum and Glycine max, respec...

  15. An Algorithm for Generating Small RNAs Capable of Epigenetically Modulating Transcriptional Gene Silencing and Activation in Human Cells

    Directory of Open Access Journals (Sweden)

    Amanda Ackley

    2013-01-01

    Full Text Available Small noncoding antisense RNAs (sasRNAs guide epigenetic silencing complexes to target loci in human cells and modulate gene transcription. When these targeted loci are situated within a promoter, long-term, stable epigenetic silencing of transcription can occur. Recent studies suggest that there exists an endogenous form of such epigenetic regulation in human cells involving long noncoding RNAs. In this article, we present and validate an algorithm for the generation of highly effective sasRNAs that can mimic the endogenous noncoding RNAs involved in the epigenetic regulation of gene expression. We validate this algorithm by targeting several oncogenes including AKT-1, c-MYC, K-RAS, and H-RAS. We also target a long antisense RNA that mediates the epigenetic repression of the tumor suppressor gene DUSP6, silenced in pancreatic cancer. An algorithm that can efficiently design small noncoding RNAs for the epigenetic transcriptional silencing or activation of specific genes has potential therapeutic and experimental applications.

  16. The silencing effect of miR-30a on ITGA4 gene expression in vitro: an approach for gene therapy.

    Science.gov (United States)

    Darzi, Leila; Boshtam, Maryam; Shariati, Laleh; Kouhpayeh, Shirin; Gheibi, Azam; Mirian, Mina; Rahimmanesh, Ilnaz; Khanahmad, Hossein; Tabatabaiefar, Mohammad Amin

    2017-12-01

    Integrins are adhesion molecules which play crucial roles in cell-cell and cell-extracellular matrix interactions. Very late antigen-4 or α4β1 and lymphocyte Peyer's patch adhesion molecule-1 or α4β7, are key factors in the invasion of tumor cells and metastasis. Based on the previous reports, integrin α4 ( ITGA4 ) is overexpressed in some immune disorders and cancers. Thus, inhibition of ITGA4 could be a therapeutic strategy. In the present study, miR-30a was selected in order to suppress ITGA4 expression. The ITGA4 3' UTR was amplified, cloned in the Z2827-M67-( ITGA4 ) plasmid and named as Z2827-M67/3'UTR. HeLa cells were divided into five groups; (1) untreated without any transfection, (2) mock with Z2827-M67/3'UTR transfection and X-tremeGENE reagent, (3) negative control with Z2827-M67/3'UTR transfection alone, (4) test with miR-30a mimic and Z2827-M67/3'UTR transfection and (5) scramble with miR-30a scramble and Z2827-M67/3'UTR transfection. The MTT assay was performed to evaluate cell survival and cytotoxicity in each group. Real-time RT-PCR was applied for the ITGA4 expression analysis. The findings of this study showed that miR-30a downregulated ITGA4 expression and had no effect on the cell survival. Due to the silencing effect of miR-30a on the ITGA4 gene expression, this agent could be considered as a potential tool for cancer and immune disorders therapy.

  17. Senataxin plays an essential role with DNA damage response proteins in meiotic recombination and gene silencing.

    Directory of Open Access Journals (Sweden)

    Olivier J Becherel

    2013-04-01

    Full Text Available Senataxin, mutated in the human genetic disorder ataxia with oculomotor apraxia type 2 (AOA2, plays an important role in maintaining genome integrity by coordination of transcription, DNA replication, and the DNA damage response. We demonstrate that senataxin is essential for spermatogenesis and that it functions at two stages in meiosis during crossing-over in homologous recombination and in meiotic sex chromosome inactivation (MSCI. Disruption of the Setx gene caused persistence of DNA double-strand breaks, a defect in disassembly of Rad51 filaments, accumulation of DNA:RNA hybrids (R-loops, and ultimately a failure of crossing-over. Senataxin localised to the XY body in a Brca1-dependent manner, and in its absence there was incomplete localisation of DNA damage response proteins to the XY chromosomes and ATR was retained on the axial elements of these chromosomes, failing to diffuse out into chromatin. Furthermore persistence of RNA polymerase II activity, altered ubH2A distribution, and abnormal XY-linked gene expression in Setx⁻/⁻ revealed an essential role for senataxin in MSCI. These data support key roles for senataxin in coordinating meiotic crossing-over with transcription and in gene silencing to protect the integrity of the genome.

  18. Rescue of Metabolic Alterations in AR113Q Skeletal Muscle by Peripheral Androgen Receptor Gene Silencing

    Directory of Open Access Journals (Sweden)

    Elisa Giorgetti

    2016-09-01

    Full Text Available Spinal and bulbar muscular atrophy (SBMA, a progressive degenerative disorder, is caused by a CAG/glutamine expansion in the androgen receptor (polyQ AR. Recent studies demonstrate that skeletal muscle is an important site of toxicity that contributes to the SBMA phenotype. Here, we sought to identify critical pathways altered in muscle that underlie disease manifestations in AR113Q mice. This led to the unanticipated identification of gene expression changes affecting regulators of carbohydrate metabolism, similar to those triggered by denervation. AR113Q muscle exhibits diminished glycolysis, altered mitochondria, and an impaired response to exercise. Strikingly, the expression of genes regulating muscle energy metabolism is rescued following peripheral polyQ AR gene silencing by antisense oligonucleotides (ASO, a therapeutic strategy that alleviates disease. Our data establish the occurrence of a metabolic imbalance in SBMA muscle triggered by peripheral expression of the polyQ AR and indicate that alterations in energy utilization contribute to non-neuronal disease manifestations.

  19. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    Directory of Open Access Journals (Sweden)

    Tatsuya eKon

    2014-11-01

    Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

  20. An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Zheng, Zhimin

    2010-01-06

    RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

  1. HvCKX2 gene silencing by biolistic or Agrobacterium-mediated transformation in barley leads to different phenotypes.

    Science.gov (United States)

    Zalewski, Wojciech; Orczyk, Wacław; Gasparis, Sebastian; Nadolska-Orczyk, Anna

    2012-11-07

    CKX genes encode cytokinin dehydrogenase enzymes (CKX), which metabolize cytokinins in plants and influence developmental processes. The genes are expressed in different tissues and organs during development; however, their exact role in barley is poorly understood. It has already been proven that RNA interference (RNAi)-based silencing of HvCKX1 decreased the CKX level, especially in those organs which showed the highest expression, i.e. developing kernels and roots, leading to higher plant productivity and higher mass of the roots [1]. The same type of RNAi construct was applied to silence HvCKX2 and analyze the function of the gene. Two cultivars of barley were transformed with the same silencing and selection cassettes by two different methods: biolistic and via Agrobacterium. The mean Agrobacterium-mediated transformation efficiency of Golden Promise was 3.47% (±2.82). The transcript level of HvCKX2 in segregating progeny of T(1) lines was decreased to 34%. The reduction of the transcript in Agrobacterium-derived plants resulted in decreased CKX activity in the developing and developed leaves as well as in 7 DAP (days after pollination) spikes. The final phenotypic effect was increased productivity of T(0) plants and T(1) lines. Higher productivity was the result of the higher number of seeds and higher grain yield. It was also correlated with the higher 1000 grain weight, increased (by 7.5%) height of the plants and higher (from 0.5 to 2) numbers of spikes. The transformation efficiency of Golden Promise after biolistic transformation was more than twice as low compared to Agrobacterium. The transcript level in segregating progeny of T(1) lines was decreased to 24%. Otherwise, the enzyme activity found in the leaves of the lines after biolistic transformation, especially in cv. Golden Promise, was very high, exceeding the relative level of the control lines. These unbalanced ratios of the transcript level and the activity of the CKX enzyme negatively

  2. An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing.

    Science.gov (United States)

    Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A

    2016-06-28

    Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    Science.gov (United States)

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  4. Systemic virus-induced gene silencing allows functional characterization of maize genes during biotrophic interaction with Ustilago maydis.

    Science.gov (United States)

    van der Linde, Karina; Kastner, Christine; Kumlehn, Jochen; Kahmann, Regine; Doehlemann, Gunther

    2011-01-01

    Infection of maize (Zea mays) plants with the corn smut fungus Ustilago maydis leads to the formation of large tumors on the stem, leaves and inflorescences. In this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed massive and stage-specific changes in host gene expression during disease progression. To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a virus-induced gene silencing (VIGS) system based on the brome mosaic virus (BMV) for maize. Conditions were established that allowed successful U. maydis infection of BMV-preinfected maize plants. This set-up enabled quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (qRT-PCR)-based readout. In proof-of-principle experiments, an U. maydis-induced terpene synthase was shown to negatively regulate disease development while a protein involved in cell death inhibition was required for full virulence of U. maydis. The results suggest that this system is a versatile tool for the rapid identification of maize genes that determine compatibility with U. maydis. © (2010) Max Planck Society. Journal compilation © New Phytologist Trust (2010).

  5. Silencing of mitochondrial NADP+-dependent isocitrate dehydrogenase gene enhances glioma radiosensitivity

    International Nuclear Information System (INIS)

    Kim, Sung Youl; Yoo, Young Hyun; Park, Jeen-Woo

    2013-01-01

    Highlights: •Silencing of the IDPm gene enhances IR-induced autophagy in glioma cells. •Autophagy inhibition augmented apoptosis of irradiated glioma cells. •Results offer a redox-active therapeutic strategy for the treatment of cancer. -- Abstract: Reactive oxygen species (ROS) levels are elevated in organisms that have been exposed to ionizing radiation and are protagonists in the induction of cell death. Recently, we demonstrated that the control of mitochondrial redox balance and the cellular defense against oxidative damage are primary functions of mitochondrial NADP + -dependent isocitrate dehydrogenase (IDPm) via the supply of NADPH for antioxidant systems. In the present study, we report an autophagic response to ionizing radiation in A172 glioma cells transfected with small interfering RNA (siRNA) targeting the IDPm gene. Autophagy in A172 transfectant cells was associated with enhanced autophagolysosome formation and GFP–LC3 punctuation/aggregation. Furthermore, we found that the inhibition of autophagy by chloroquine augmented apoptotic cell death of irradiated A172 cells transfected with IDPm siRNA. Taken together, our data suggest that autophagy functions as a survival mechanism in A172 cells against ionizing radiation-induced apoptosis and the sensitizing effect of IDPm siRNA and autophagy inhibitor on the ionizing radiation-induced apoptotic cell death of glioma cells offers a novel redox-active therapeutic strategy for the treatment of cancer

  6. Human γ-globin genes silenced independently of other genes in the β-globin locus.

    NARCIS (Netherlands)

    N.O. Dillon (Niall); F.G. Grosveld (Frank)

    1991-01-01

    textabstractErythropoiesis during human development is characterized by switches in expression of beta-like globin genes during the transition from the embryonic through fetal to adult stages. Activation and high-level expression of the genes is directed by the locus control region (LCR), located 5'

  7. A Convenient In Vivo Model Using Small Interfering RNA Silencing to Rapidly Assess Skeletal Gene Function.

    Directory of Open Access Journals (Sweden)

    Wen Zhang

    Full Text Available It is difficult to study bone in vitro because it contains various cell types that engage in cross-talk. Bone biologically links various organs, and it has thus become increasingly evident that skeletal physiology must be studied in an integrative manner in an intact animal. We developed a model using local intraosseous small interfering RNA (siRNA injection to rapidly assess the effects of a target gene on the local skeletal environment. In this model, 160-g male Sprague-Dawley rats were treated for 1-2 weeks. The left tibia received intraosseous injection of a parathyroid hormone 1 receptor (Pth1r or insulin-like growth factor 1 receptor (Igf-1r siRNA transfection complex loaded in poloxamer 407 hydrogel, and the right tibia received the same volume of control siRNA. All the tibias received an intraosseous injection of recombinant human parathyroid hormone (1-34 (rhPTH (1-34 or insulin-like growth factor-1 (IGF-1. Calcein green and alizarin red were injected 6 and 2 days before euthanasia, respectively. IGF-1R and PTH1R expression levels were detected via RT-PCR assays and immunohistochemistry. Bone mineral density (BMD, microstructure, mineral apposition rates (MARs, and strength were determined by dual-energy X-ray absorptiometry, micro-CT, histology and biomechanical tests. The RT-PCR and immunohistochemistry results revealed that IGF-1R and PTH1R expression levels were dramatically diminished in the siRNA-treated left tibias compared to the right tibias (both p<0.05. Using poloxamer 407 hydrogel as a controlled-release system prolonged the silencing effect of a single dose of siRNA; the mRNA expression levels of IGF-1R were lower at two weeks than at one week (p<0.01. The BMD, bone microstructure parameters, MAR and bone strength were significantly decreased in the left tibias compared to the right tibias (all p<0.05. This simple and convenient local intraosseous siRNA injection model achieved gene silencing with very small quantities of

  8. Modulation of histone methylation and MLH1 gene silencing by hexavalent chromium

    International Nuclear Information System (INIS)

    Sun Hong; Zhou Xue; Chen Haobin; Li Qin; Costa, Max

    2009-01-01

    Hexavalent chromium [Cr(VI)] is a mutagen and carcinogen, and occupational exposure can lead to lung cancers and other adverse health effects. Genetic changes resulting from DNA damage have been proposed as an important mechanism that mediates chromate's carcinogenicity. Here we show that chromate exposure of human lung A549 cells increased global levels of di- and tri-methylated histone H3 lysine 9 (H3K9) and lysine 4 (H3K4) but decreased the levels of tri-methylated histone H3 lysine 27 (H3K27) and di-methylated histone H3 arginine 2 (H3R2). Most interestingly, H3K9 dimethylation was enriched in the human MLH1 gene promoter following chromate exposure and this was correlated with decreased MLH1 mRNA expression. Chromate exposure increased the protein as well as mRNA levels of G9a a histone methyltransferase that specifically methylates H3K9. This Cr(VI)-induced increase in G9a may account for the global elevation of H3K9 dimethylation. Furthermore, supplementation with ascorbate, the primary reductant of Cr(VI) and also an essential cofactor for the histone demethylase activity, partially reversed the H3K9 dimethylation induced by chromate. Thus our studies suggest that Cr(VI) may target histone methyltransferases and demethylases, which in turn affect both global and gene promoter specific histone methylation, leading to the silencing of specific tumor suppressor genes such as MLH1.

  9. DNA alkylating agents alleviate silencing of class II transactivator gene expression in L1210 lymphoma cells.

    Science.gov (United States)

    Murphy, Shawn P; Holtz, Renae; Lewandowski, Nicole; Tomasi, Thomas B; Fuji, Hiroshi

    2002-09-15

    MHC class II (Ia) Ag expression is inversely correlated with tumorigenicity and directly correlated with immunogenicity in clones of the mouse L1210 lymphoma (1 ). Understanding the mechanisms by which class II Ag expression is regulated in L1210 lymphoma may facilitate the development of immunotherapeutic approaches for the treatment of some types of lymphoma and leukemia. This study demonstrates that the variation in MHC class II Ag expression among clones of L1210 lymphoma is due to differences in the expression of the class II transactivator (CIITA). Analysis of stable hybrids suggests that CIITA expression is repressed by a dominant mechanism in class II-negative L1210 clones. DNA-alkylating agents such as ethyl methanesulfonate and the chemotherapeutic drug melphalan activate CIITA and class II expression in class II negative L1210 cells, and this effect appears to be restricted to transformed cell lines derived from the early stages of B cell ontogeny. Transient transfection assays demonstrated that the CIITA type III promoter is active in class II(-) L1210 cells, despite the fact that the endogenous gene is not expressed, which suggests that these cells have all of the transacting factors necessary for CIITA transcription. An inverse correlation between methylation of the CIITA transcriptional regulatory region and CIITA expression was observed among L1210 clones. Furthermore, 5-azacytidine treatment activated CIITA expression in class II-negative L1210 cells. Collectively, our results suggest that 1) CIITA gene expression is repressed in class II(-) L1210 cells by methylation of the CIITA upstream regulatory region, and 2) treatment with DNA-alkylating agents overcomes methylation-based silencing of the CIITA gene in L1210 cells.

  10. Epigenetic silencing of MAL, a putative tumor suppressor gene, can contribute to human epithelium cell carcinoma

    Directory of Open Access Journals (Sweden)

    Zhang Jun

    2010-11-01

    Full Text Available Abstract Background To identify new and useful candidate biomarkers in head and neck squamous cell carcinoma (HNSCC, we performed a genome-wide survey and found that Myelin and lymphocyte-associated protein (MAL was a gene that was markedly down-regulated in HNSCC. Hence, we investigated the mechanism of MAL silencing and the effects of MAL on the proliferation, invasion, and apoptotic potential in HNSCC. Results MAL was significantly down-regulated in 91.7% of HNSCC specimens at the mRNA level as compared with adjacent normal tissues (P = 0.0004. Moreover, the relative transcript levels of the MAL gene were remarkably decreased by five-fold in nine HNSCC cell lines as compared with normal head and neck epithelium cells. MAL gene expression was restored in 44%, 67%, and 89% in HNSCC cell lines treated with TSA, 5-Aza-dC, and TSA plus 5-Aza-dC, respectively. Furthermore, bisulfate-treated DNA sequencing demonstrated that the two CpG islands (that is, M1 and M2 located in MAL promoter region were completely methylated in the HNSCC cell lines (CpG methylated ratio was more than 90%, and only one CpG island (that is, M1 was partially methylated in HNSCC tissues (CpG methylated ratio between 20% and 90%. A significant reduction in cell proliferation and a change in the cell cycle profile were also observed in MAL transfectants. Matrigel assay demonstrated that the invasiveness of HNSCC cells significantly decreased. A significant increase in the population of apoptotic cells was observed in MAL transfected cells. The exogenous expression of the MAL gene suppressed malignant phenotypes, while the cell death induced by MAL gene transfer was a result of apoptosis as demonstrated by the induction of cleavage of the poly (that is, ADP-ribose polymerase. Additionally, tumor growth was suppressed in cells expressing MAL as compared with cells not expressing MAL. Conclusion Our data suggest that the epigenetic inactivation of MAL, as a candidate tumor

  11. Characterization of a Brome mosaic virus strain and its use as a vector for gene silencing in monocotyledonous hosts.

    Science.gov (United States)

    Ding, Xin Shun; Schneider, William L; Chaluvadi, Srinivasa Rao; Mian, M A Rouf; Nelson, Richard S

    2006-11-01

    Virus-induced gene silencing (VIGS) is used to analyze gene function in dicotyledonous plants but less so in monocotyledonous plants (particularly rice and corn), partially due to the limited number of virus expression vectors available. Here, we report the cloning and modification for VIGS of a virus from Festuca arundinacea Schreb. (tall fescue) that caused systemic mosaic symptoms on barley, rice, and a specific cultivar of maize (Va35) under greenhouse conditions. Through sequencing, the virus was determined to be a strain of Brome mosaic virus (BMV). The virus was named F-BMV (F for Festuca), and genetic determinants that controlled the systemic infection of rice were mapped to RNAs 1 and 2 of the tripartite genome. cDNA from RNA 3 of the Russian strain of BMV (R-BMV) was modified to accept inserts from foreign genes. Coinoculation of RNAs 1 and 2 from F-BMV and RNA 3 from R-BMV expressing a portion of a plant gene to leaves of barley, rice, and maize plants resulted in visual silencing-like phenotypes. The visual phenotypes were correlated with decreased target host transcript levels in the corresponding leaves. The VIGS visual phenotype varied from maintained during silencing of actin 1 transcript expression to transient with incomplete penetration through affected tissue during silencing of phytoene desaturase expression. F-BMV RNA 3 was modified to allow greater accumulation of virus while minimizing virus pathogenicity. The modified vector C-BMV(A/G) (C for chimeric) was shown to be useful for VIGS. These BMV vectors will be useful for analysis of gene function in rice and maize for which no VIGS system is reported.

  12. Morphological regulation of Aspergillus niger to improve citric acid production by chsC gene silencing.

    Science.gov (United States)

    Sun, Xiaowen; Wu, Hefang; Zhao, Genhai; Li, Zhemin; Wu, Xihua; Liu, Hui; Zheng, Zhiming

    2018-04-02

    The mycelial morphology of Aspergillus niger, a major filamentous fungus used for citric acid production, is important for citric acid synthesis during submerged fermentation. To investigate the involvement of the chitin synthase gene, chsC, in morphogenesis and citric acid production in A. niger, an RNAi system was constructed to silence chsC and the morphological mutants were screened after transformation. The compactness of the mycelial pellets was obviously reduced in the morphological mutants, with lower proportion of dispersed mycelia. These morphological changes have caused a decrease in viscosity and subsequent improvement in oxygen and mass transfer efficiency, which may be conducive for citric acid accumulation. All the transformants exhibited improvements in citric acid production; in particular, chsC-3 showed 42.6% higher production than the original strain in the shake flask. Moreover, the high-yield strain chsC-3 exhibited excellent citric acid production potential in the scale-up process.The citric acid yield and the conversion rate of glucose of chsC-3 were both improved by 3.6%, when compared with that of the original strain in the stirred tank bioreactor.

  13. The Silencing of RECK Gene is Associated with Promoter Hypermethylation and Poor Survival in Hepatocellular Carcinoma

    Science.gov (United States)

    Zhang, Changsong; Ling, Yang; Zhang, Chenghui; Xu, Yun; Gao, Lu; Li, Rong; Zhu, Jing; Fan, Lieying; Wei, Lixin

    2012-01-01

    Background: To evaluate the promoter methylation status of RECK gene and mRNA expression in patients with hepatocellular carcinoma (HCC). Methods: We analyzed RECK methylation by MSP, and RECK mRNA by real-time PCR in 74 HCC. The liver cell lines (7721, Chang and Hep-G2) were treated with 5-Aza-CdR and TSA. Results: RECK mRNA were lower in HCC tissues (Mean -∆Ct = -3.29) than that in Non-Hcc tissues (Mean -∆Ct = -2.42). Expression of RECK was elevated in only 24 (32.43%) of the 74 HCC patients but decreased (-∆∆Ct=0.5) (Mean -∆∆Ct = -1.75) than those with demethylation (∆MI<0.5) (Mean -∆∆Ct = 0.05), and there is a decreased tendency for RECK mRNA in HCC patients with promoter hypermethylation (p = 0.002). There was a significantly correlation found between RECK mRNA and poor survival after surgery. After treated by 5-Aza-CdR and TSA, we found that RECK mRNA induced different changes in 7721, Chang and Hep-G2 cells. And RECK demethylation also induced by epigenetic inhibitors. Conclusion: The results suggested that the hypermethylation may lead to promoter silencing of RECK mRNA and associated with poor survival in HCC. PMID:22419890

  14. Loss of Major DNase I Hypersensitive Sites in Duplicatedglobin Gene Cluster Incompletely Silences HBB Gene Expression

    Czech Academy of Sciences Publication Activity Database

    Reading, N. S.; Shooter, C.; Song, J.; Miller, R.; Agarwal, A.; Láníková, Lucie; Clark, B.; Thein, S.L.; Divoký, V.; Prchal, J.T.

    2016-01-01

    Roč. 37, č. 11 (2016), s. 1153-1156 ISSN 1059-7794 R&D Projects: GA MŠk(CZ) LH15223 Institutional support: RVO:68378050 Keywords : globin genes * regulation * sickle cell disease * HBB duplication Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.601, year: 2016

  15. Charged residues in the H-NS linker drive DNA binding and gene silencing in single cells.

    Science.gov (United States)

    Gao, Yunfeng; Foo, Yong Hwee; Winardhi, Ricksen S; Tang, Qingnan; Yan, Jie; Kenney, Linda J

    2017-11-21

    Nucleoid-associated proteins (NAPs) facilitate chromosome organization in bacteria, but the precise mechanism remains elusive. H-NS is a NAP that also plays a major role in silencing pathogen genes. We used genetics, single-particle tracking in live cells, superresolution microscopy, atomic force microscopy, and molecular dynamics simulations to examine H-NS/DNA interactions in single cells. We discovered a role for the unstructured linker region connecting the N-terminal oligomerization and C-terminal DNA binding domains. In the present work we demonstrate that linker amino acids promote engagement with DNA. In the absence of linker contacts, H-NS binding is significantly reduced, although no change in chromosome compaction is observed. H-NS is not localized to two distinct foci; rather, it is scattered all around the nucleoid. The linker makes DNA contacts that are required for gene silencing, while chromosome compaction does not appear to be an important H-NS function.

  16. RNA-mediated gene silencing in Candida albicans: inhibition of hyphae formation by use of RNAi technology.

    Science.gov (United States)

    Moazeni, Maryam; Khoramizadeh, Mohammad Reza; Kordbacheh, Parivash; Sepehrizadeh, Zargham; Zeraati, Hojat; Noorbakhsh, Fatemeh; Teimoori-Toolabi, Ladan; Rezaie, Sassan

    2012-09-01

    The introduction of RNA silencing machinery in fungi has led to the promising application of RNAi methodology to knock down essential vital factor or virulence factor genes in the microorganisms. Efg1p is required for development of a true hyphal growth form which is known to be essential for interactions with human host cells and for the yeast's pathogenesis. In this paper, we describe the development of a system for presenting and studying the RNAi function on the EFG1 gene in C. albicans. The 19-nucleotide siRNA was designed on the basis of the cDNA sequence of the EFG1 gene in C. albicans and transfection was performed by use of a modified-PEG/LiAc method. To investigate EFG1 gene silencing in siRNA-treated cells, the yeasts were grown in human serum; to induce germ tubes a solid medium was used with the serum. Quantitative changes in expression of the EFG1 gene were analyzed by measuring the cognate EFG1 mRNA level by use of a quantitative real-time RT-PCR assay. Compared with the positive control, true hyphae formation was significantly reduced by siRNA at concentrations of 1 μM, 500 nM, and 100 nM (P < 0.05). In addition, siRNA at a concentration of 1 μM was revealed to inhibit expression of the EFG1 gene effectively (P < 0.05). On the basis of the potential of post-transcriptional gene silencing to control the expression of specific genes, these techniques may be regarded as promising means of drug discovery, with applications in biomedicine and functional genomics analysis.

  17. 6-Thioguanine Reactivates Epigenetically Silenced Genes in Acute Lymphoblastic Leukemia Cells by Facilitating Proteasome-mediated Degradation of DNMT1

    OpenAIRE

    Yuan, Bifeng; Zhang, Jing; Wang, Hongxia; Xiong, Lei; Cai, Qian; Wang, Tina; Jacobsen, Steven; Pradhan, Sriharsa; Wang, Yinsheng

    2011-01-01

    Thiopurines including 6-thioguanine (SG), 6-mercaptopurine and azathioprine are effective anticancer agents with remarkable success in clinical practice, especially in effective treatment of acute lymphoblastic leukemia (ALL). SG is understood to act as a DNA hypomethylating agent in ALL cells, however, the underlying mechanism leading to global cytosine demethylation remains unclear. Here we report that SG treatment results in reactivation of epigenetically silenced genes in T leukemia cells...

  18. Inhibition of Androgen-Independent Growth of Prostate Cancer by siRNA- Mediated Androgen Receptor Gene Silencing

    Science.gov (United States)

    2008-02-01

    and then photographed using a digital camera . AAV production and infection. To silence AR gene expression, a hairpin- structured expression vector...Sandusky GE, Vessella RL, Neubauer BL. Increased AKT activity contributes to prostate cancer progression by dramatically accelerating prostate tumor...HeNe laser. The spectrograph has an f/2.0 Czerny–Turner imaging spec- trometer plus a thermo-electrically cooled Kodak 0401 CCD camera . The fiberoptic

  19. Dimethylated H3K27 Is a Repressive Epigenetic Histone Mark in the Protist Entamoeba histolytica and Is Significantly Enriched in Genes Silenced via the RNAi Pathway*

    Science.gov (United States)

    Foda, Bardees M.; Singh, Upinder

    2015-01-01

    RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5′-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. PMID:26149683

  20. Dimethylated H3K27 Is a Repressive Epigenetic Histone Mark in the Protist Entamoeba histolytica and Is Significantly Enriched in Genes Silenced via the RNAi Pathway.

    Science.gov (United States)

    Foda, Bardees M; Singh, Upinder

    2015-08-21

    RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5'-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Virus-Induced Silencing of Key Genes Leads to Differential Impact on Withanolide Biosynthesis in the Medicinal Plant, Withania somnifera.

    Science.gov (United States)

    Agarwal, Aditya Vikram; Singh, Deeksha; Dhar, Yogeshwar Vikram; Michael, Rahul; Gupta, Parul; Chandra, Deepak; Trivedi, Prabodh Kumar

    2018-02-01

    Withanolides are a collection of naturally occurring, pharmacologically active, secondary metabolites synthesized in the medicinally important plant, Withania somnifera. These bioactive molecules are C28-steroidal lactone triterpenoids and their synthesis is proposed to take place via the mevalonate (MVA) and 2-C-methyl-d-erythritol-4-phosphate (MEP) pathways through the sterol pathway using 24-methylene cholesterol as substrate flux. Although the phytochemical profiles as well as pharmaceutical activities of Withania extracts have been well studied, limited genomic information and difficult genetic transformation have been a major bottleneck towards understanding the participation of specific genes in withanolide biosynthesis. In this study, we used the Tobacco rattle virus (TRV)-mediated virus-induced gene silencing (VIGS) approach to study the participation of key genes from MVA, MEP and triterpenoid biosynthesis for their involvement in withanolide biosynthesis. TRV-infected W. somnifera plants displayed unique phenotypic characteristics and differential accumulation of total Chl as well as carotenoid content for each silenced gene suggesting a reduction in overall isoprenoid synthesis. Comprehensive expression analysis of putative genes of withanolide biosynthesis revealed transcriptional modulations conferring the presence of complex regulatory mechanisms leading to withanolide biosynthesis. In addition, silencing of genes exhibited modulated total and specific withanolide accumulation at different levels as compared with control plants. Comparative analysis also suggests a major role for the MVA pathway as compared with the MEP pathway in providing substrate flux for withanolide biosynthesis. These results demonstrate that transcriptional regulation of selected Withania genes of the triterpenoid biosynthetic pathway critically affects withanolide biosynthesis, providing new horizons to explore this process further, in planta.

  2. Identification of an attenuated barley stripe mosaic virus for the virus-induced gene silencing of pathogenesis-related wheat genes

    OpenAIRE

    Buhrow, Leann M.; Clark, Shawn M.; Loewen, Michele C.

    2016-01-01

    Background Virus-induced gene silencing (VIGS) has become an emerging technology for the rapid, efficient functional genomic screening of monocot and dicot species. The barley stripe mosaic virus (BSMV) has been described as an effective VIGS vehicle for the evaluation of genes involved in wheat and barley phytopathogenesis; however, these studies have been obscured by BSMV-induced phenotypes and defense responses. The utility of BSMV VIGS may be improved using a BSMV genetic background which...

  3. Silencing of vacuolar invertase and asparagine synthetase genes and its impact on acrylamide formation of fried potato products.

    Science.gov (United States)

    Zhu, Xiaobiao; Gong, Huiling; He, Qunyan; Zeng, Zixian; Busse, James S; Jin, Weiwei; Bethke, Paul C; Jiang, Jiming

    2016-02-01

    Acrylamide is produced in a wide variety of carbohydrate-rich foods during high-temperature cooking. Dietary acrylamide is a suspected human carcinogen, and health concerns related to dietary acrylamide have been raised worldwide. French fries and potato chips contribute a significant proportion to the average daily intake of acrylamide, especially in developed countries. One way to mitigate health concerns related to acrylamide is to develop potato cultivars that have reduced contents of the acrylamide precursors asparagine, glucose and fructose in tubers. We generated a large number of silencing lines of potato cultivar Russet Burbank by targeting the vacuolar invertase gene VInv and the asparagine synthetase genes StAS1 and StAS2 with a single RNA interference construct. The transcription levels of these three genes were correlated with reducing sugar (glucose and fructose) and asparagine content in tubers. Fried potato products from the best VInv/StAS1/StAS2-triple silencing lines contained only one-fifteenth of the acrylamide content of the controls. Interestingly, the extent of acrylamide reduction of the best triple silencing lines was similar to that of the best VInv-single silencing lines developed previously from the same potato cultivar Russet Burbank. These results show that an acrylamide mitigation strategy focused on developing potato cultivars with low reducing sugars is likely to be an effective and sufficient approach for minimizing the acrylamide-forming potential of French fry processing potatoes. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  4. Apple latent spherical virus vectors for reliable and effective virus-induced gene silencing among a broad range of plants including tobacco, tomato, Arabidopsis thaliana, cucurbits, and legumes

    International Nuclear Information System (INIS)

    Igarashi, Aki; Yamagata, Kousuke; Sugai, Tomokazu; Takahashi, Yukari; Sugawara, Emiko; Tamura, Akihiro; Yaegashi, Hajime; Yamagishi, Noriko; Takahashi, Tsubasa; Isogai, Masamichi; Takahashi, Hideki; Yoshikawa, Nobuyuki

    2009-01-01

    Apple latent spherical virus (ALSV) vectors were evaluated for virus-induced gene silencing (VIGS) of endogenous genes among a broad range of plant species. ALSV vectors carrying partial sequences of a subunit of magnesium chelatase (SU) and phytoene desaturase (PDS) genes induced highly uniform knockout phenotypes typical of SU and PDS inhibition on model plants such as tobacco and Arabidopsis thaliana, and economically important crops such as tomato, legume, and cucurbit species. The silencing phenotypes persisted throughout plant growth in these plants. In addition, ALSV vectors could be successfully used to silence a meristem gene, proliferating cell nuclear antigen and disease resistant N gene in tobacco and RCY1 gene in A. thaliana. As ALSV infects most host plants symptomlessly and effectively induces stable VIGS for long periods, the ALSV vector is a valuable tool to determine the functions of interested genes among a broad range of plant species.

  5. TGIF1 Gene Silencing in Tendon-Derived Stem Cells Improves the Tendon-to-Bone Insertion Site Regeneration

    Directory of Open Access Journals (Sweden)

    Liyang Chen

    2015-11-01

    Full Text Available Background/Aims: The slow healing process of tendon-to-bone junctions can be accelerated via implanted tendon-derived stem cells (TDSCs with silenced transforming growth interacting factor 1 (TGIF1 gene. Tendon-to-bone insertion site is the special form of connective tissues derivatives of common connective progenitors, where TGF-β plays bidirectional effects (chondrogenic or fibrogenic through different signaling pathways at different stages. A recent study revealed that TGF-β directly induces the chondrogenic gene Sox9. However, TGIF1 represses the expression of the cartilage master Sox9 gene and changes its expression rate against the fibrogenesis gene Scleraxis (Scx. Methods: TGIF1 siRNA was transduced or TGIF1 was over-expressed in tendon-derived stem cells. Following suprapinatus tendon repair, rats were either treated with transduced TDSCs or nontransduced TDSCs. Histologic examination and Western blot were performed in both groups. Results: In this study, the silencing of TGIF1 significantly upregulated the chondrogenic genes and markers. Similarly, TGIF1 inhibited TDSC differentiation into cartilage via interactions with TGF-β-activated Smad2 and suppressed the phosphorylation of Smad2. The area of fibrocartilage at the tendon-bone interface was significantly increased in the TGIF1 (- group compared with the control and TGIF1-overexpressing groups in the early stages of the animal model. The interface between the tendon and bone showed a increase of new bone and fibrocartilage in the TGIF1 (- group at 4 weeks. Fibrovascular scar tissue was observed in the TGIF1-overexpressing group and the fibrin glue only group. Low levels of fibrocartilage and fibrovascular scar tissue were found in the TDSCs group. Conclusion: Collectively, this study shows that the tendon-derived stem cell modified with TGIF1 gene silencing has promising effects on tendon-to-bone healing which can be further explored as a therapeutic tool in regenerative medicine.

  6. Establishment of an efficient virus-induced gene silencing (VIGS) assay in Arabidopsis by Agrobacterium-mediated rubbing infection.

    Science.gov (United States)

    Manhães, Ana Marcia E de A; de Oliveira, Marcos V V; Shan, Libo

    2015-01-01

    Several VIGS protocols have been established for high-throughput functional genomic screens as it bypasses the time-consuming and laborious process of generation of transgenic plants. The silencing efficiency in this approach is largely hindered by a technically demanding step in which the first pair of newly emerged true leaves at the 2-week-old stage are infiltrated with a needleless syringe. To further optimize VIGS efficiency and achieve rapid inoculation for a large-scale functional genomic study, here we describe a protocol of an efficient VIGS assay in Arabidopsis using Agrobacterium-mediated rubbing infection. The Agrobacterium inoculation is performed by simply rubbing the leaves with Filter Agent Celite(®) 545. The highly efficient and uniform silencing effect was indicated by the development of a visibly albino phenotype due to silencing of the Cloroplastos alterados 1 (CLA1) gene in the newly emerged leaves. In addition, the albino phenotype could be observed in stems and flowers, indicating its potential application for gene functional studies in the late vegetative development and flowering stages.

  7. AGO6 functions in RNA-mediated transcriptional gene silencing in shoot and root meristems in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Changho Eun

    Full Text Available RNA-directed DNA methylation (RdDM is a small interfering RNA (siRNA-mediated epigenetic modification that contributes to transposon silencing in plants. RdDM requires a complex transcriptional machinery that includes specialized RNA polymerases, named Pol IV and Pol V, as well as chromatin remodelling proteins, transcription factors, RNA binding proteins, and other plant-specific proteins whose functions are not yet clarified. In Arabidopsis thaliana, DICER-LIKE3 and members of the ARGONAUTE4 group of ARGONAUTE (AGO proteins are involved, respectively, in generating and using 24-nt siRNAs that trigger methylation and transcriptional gene silencing of homologous promoter sequences. AGO4 is the main AGO protein implicated in the RdDM pathway. Here we report the identification of the related AGO6 in a forward genetic screen for mutants defective in RdDM and transcriptional gene silencing in shoot and root apical meristems in Arabidopsis thaliana. The identification of AGO6, and not AGO4, in our screen is consistent with the primary expression of AGO6 in shoot and root growing points.

  8. [Small interfering RNA-mediated COX-2 gene silencing enhances chemosensitivity of KB/VCR cells by suppressing MDR-1 gene expression and P-glycoprotein activity].

    Science.gov (United States)

    Mo, Xianchao; Li, Weizhong

    2014-05-01

    To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.

  9. A selfish gene chastened: Tribolium castaneum Medea M4 is silenced by a complementary gene.

    Science.gov (United States)

    Thomson, M Scott

    2014-04-01

    Maternal-effect dominant embryonic arrest (Medea) of Tribolium castaneum are autosomal factors that act maternally to cause the death of any progeny that do not inherit them. This selfish behavior is thought to result from a maternally expressed poison and zygotically expressed antidote. Medea factors and the hybrid incompatibility factor, H, have a negative interaction consistent with complementary genes of the Dobzhansky-Muller model for post-zygotic isolation. This negative interaction may result from H suppression of Medea zygotic antidote, leaving zygotes incompletely protected from maternal poison. I report here a test of the hypothesis that H also suppresses the Medea maternal poison. Viable F1 females were generated from a cross of Medea M4 strain males to H strain females. These females, heterozygous for both M4 and H, failed to express M4 maternal lethal activity when crossed to their male sibs. Transmission of non-M4 homologues from these females was confirmed using a dominant transgenic enhanced green fluorescent protein eye color marker, tightly linked in cis to M4. M4 beetles, lacking H, were selected from the F2 population. Female descendants of these clearly expressed M4 maternal lethal activity, indicating restoration of this activity after H was segregated away. I conclude that H, or a factor tightly linked to H, suppresses Medea M4 maternal poison.

  10. SGS3 Cooperates with RDR6 in Triggering Geminivirus-Induced Gene Silencing and in Suppressing Geminivirus Infection in Nicotiana Benthamiana

    Directory of Open Access Journals (Sweden)

    Fangfang Li

    2017-09-01

    Full Text Available RNA silencing has an important role in defending against virus infection in plants. Plants with the deficiency of RNA silencing components often show enhanced susceptibility to viral infections. RNA-dependent RNA polymerase (RDRs mediated-antiviral defense has a pivotal role in resistance to many plant viruses. In RDR6-mediated defense against viral infection, a plant-specific RNA binding protein, Suppressor of Gene Silencing 3 (SGS3, was also found to fight against some viruses in Arabidopsis. In this study, we showed that SGS3 from Nicotiana benthamiana (NbSGS3 is required for sense-RNA induced post-transcriptional gene silencing (S-PTGS and initiating sense-RNA-triggered systemic silencing. Further, the deficiency of NbSGS3 inhibited geminivirus-induced endogenous gene silencing (GIEGS and promoted geminivirus infection. During TRV-mediated NbSGS3 or N. benthamiana RDR6 (NbRDR6 silencing process, we found that their expression can be effectively fine-tuned. Plants with the knock-down of both NbSGS3 and NbRDR6 almost totally blocked GIEGS, and were more susceptible to geminivirus infection. These data suggest that NbSGS3 cooperates with NbRDR6 against GIEGS and geminivirus infection in N. benthamiana, which provides valuable information for breeding geminivirus-resistant plants.

  11. Epigenetic silencing of the DNA mismatch repair gene, MLH1, induced by hypoxic stress in a pathway dependent on the histone demethylase, LSD1

    Science.gov (United States)

    Lu, Yuhong; Wajapeyee, Narendra; Turker, Mitchell S.; Glazer, Peter M.

    2014-01-01

    SUMMARY Silencing of the MLH1 gene is frequently seen in sporadic cancers. We report that hypoxia causes decreased H3K4 methylation at the MLH1 promoter via the H3K4 demethylases, LSD1 and PLU-1, and promotes long-term silencing of the promoter in a pathway that requires LSD1. Knockdown of LSD1 or its co-repressor, CoREST, also prevents the re-silencing (and cytosine DNA methylation) of the endogenous MLH1 promoter in RKO colon cancer cells following transient reactivation by the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (5-aza-dC). The results demonstrate that hypoxia is a critical driving force for silencing of MLH1 through chromatin modification and indicate that the LSD1/CoREST complex is essential for MLH1 silencing. PMID:25043185

  12. Silencing of a Germin-Like Gene in Nicotiana attenuata Improves Performance of Native Herbivores1[W

    Science.gov (United States)

    Lou, Yonggen; Baldwin, Ian T.

    2006-01-01

    Germins and germin-like proteins (GLPs) are known to function in pathogen resistance, but their involvement in defense against insect herbivores is poorly understood. In the native tobacco Nicotiana attenuata, attack from the specialist herbivore Manduca sexta or elicitation by adding larval oral secretions (OS) to wounds up-regulates transcripts of a GLP. To understand the function of this gene, which occurs as a single copy, we cloned the full-length NaGLP and silenced its expression in N. attenuata by expressing a 250-bp fragment in an antisense orientation with an Agrobacterium-based transformation system and by virus-induced gene silencing (VIGS). Homozygous lines harboring a single insert and VIGS plants had significantly reduced constitutive (measured in roots) and elicited NaGLP transcript levels (in leaves). Silencing NaGLP improved M. sexta larval performance and Tupiocoris notatus preference, two native herbivores of N. attenuata. Silencing NaGLP also attenuated the OS-induced hydrogen peroxide (H2O2), diterpene glycosides, and trypsin proteinase inhibitor responses, which may explain the observed susceptibility of antisense or VIGS plants to herbivore attack and increased nicotine contents, but did not influence the OS-elicited jasmonate and salicylate bursts, or the release of the volatile organic compounds (limonene, cis-α-bergamotene, and germacrene-A) that function as an indirect defense. This suggests that NaGLP is involved in H2O2 production and might also be related to ethylene production and/or perception, which in turn influences the defense responses of N. attenuata via H2O2 and ethylene-signaling pathways. PMID:16461381

  13. GW182-Free microRNA Silencing Complex Controls Post-transcriptional Gene Expression during Caenorhabditis elegans Embryogenesis.

    Directory of Open Access Journals (Sweden)

    Guillaume Jannot

    2016-12-01

    Full Text Available MicroRNAs and Argonaute form the microRNA induced silencing complex or miRISC that recruits GW182, causing mRNA degradation and/or translational repression. Despite the clear conservation and molecular significance, it is unknown if miRISC-GW182 interaction is essential for gene silencing during animal development. Using Caenorhabditis elegans to explore this question, we examined the relationship and effect on gene silencing between the GW182 orthologs, AIN-1 and AIN-2, and the microRNA-specific Argonaute, ALG-1. Homology modeling based on human Argonaute structures indicated that ALG-1 possesses conserved Tryptophan-binding Pockets required for GW182 binding. We show in vitro and in vivo that their mutations severely altered the association with AIN-1 and AIN-2. ALG-1 tryptophan-binding pockets mutant animals retained microRNA-binding and processing ability, but were deficient in reporter silencing activity. Interestingly, the ALG-1 tryptophan-binding pockets mutant phenocopied the loss of alg-1 in worms during larval stages, yet was sufficient to rescue embryonic lethality, indicating the dispensability of AINs association with the miRISC at this developmental stage. The dispensability of AINs in miRNA regulation is further demonstrated by the capacity of ALG-1 tryptophan-binding pockets mutant to regulate a target of the embryonic mir-35 microRNA family. Thus, our results demonstrate that the microRNA pathway can act independently of GW182 proteins during C. elegans embryogenesis.

  14. Silencing the Girdin gene enhances radio-sensitivity of hepatocellular carcinoma via suppression of glycolytic metabolism.

    Science.gov (United States)

    Yu, Li; Sun, Yifan; Li, Jingjing; Wang, Yan; Zhu, Yuxing; Shi, Yong; Fan, Xiaojun; Zhou, Jianda; Bao, Ying; Xiao, Jie; Cao, Ke; Cao, Peiguo

    2017-08-15

    Radiotherapy has been used increasingly to treat primary hepatocellular carcinoma. Clinically, the main cause of radiotherapy failure is cellular radioresistance, conferred via glycolytic metabolism. Our previous study demonstrated that Girdin is upregulated in primary hepatocellular carcinoma and promotes the invasion and metastasis of tumor cells. However, whether Girdin underlies the radio-sensitivity of hepatocellular carcinoma remains unclear. A short hairpin RNA (shRNA) was used to silence CCDC88A (encoding Girdin), and real-time PCR was performed to determine CCDC88A mRNA expression. Then, cell proliferation, colony formation, flow cytometric, scratch, and transwell assays were to examine the influence of Girdin silencing on cellular radiosensitivity. Glycolysis assays were conducted to exam cell glycolysis process. Western blotting was performed to explore the signaling pathway downstream of Girdin. Finally, animal experiments were performed to demonstrate the effect of CCDC88A silencing on the radiosensitivity of hepatoma in vivo. shRNA-induced Girdin silencing suppressed glycolysis and enhanced the radio-sensitivity of hepatic cell lines, HepG2 and Huh-7. Furthermore, silencing of Girdin inhibited the PI3K/AKT/HIF-1α signaling pathway, which is a central regulator of glycolysis. Girdin can regulate glycolysis in hepatocellular carcinoma cells through the PI3K/AKT/HIF-1α signaling pathway, which decreases the sensitivity of tumor cells to radiotherapy.

  15. RNAi-based therapeutic nanostrategy: IL-8 gene silencing in pancreatic cancer cells using gold nanorods delivery vehicles

    International Nuclear Information System (INIS)

    Panwar, Nishtha; Yang, Chengbin; Yin, Feng; Chuan, Tjin Swee; Yong, Ken-Tye; Yoon, Ho Sup

    2015-01-01

    RNA interference (RNAi)-based gene silencing possesses great ability for therapeutic intervention in pancreatic cancer. Among various oncogene mutations, Interleukin-8 (IL-8) gene mutations are found to be overexpressed in many pancreatic cell lines. In this work, we demonstrate IL-8 gene silencing by employing an RNAi-based gene therapy approach and this is achieved by using gold nanorods (AuNRs) for efficient delivery of IL-8 small interfering RNA (siRNA) to the pancreatic cell lines of MiaPaCa-2 and Panc-1. Upon comparing to Panc-1 cells, we found that the dominant expression of the IL-8 gene in MiaPaCa-2 cells resulted in an aggressive behavior towards the processes of cell invasion and metastasis. We have hence investigated the suitability of using AuNRs as novel non-viral nanocarriers for the efficient uptake and delivery of IL-8 siRNA in realizing gene knockdown of both MiaPaCa-2 and Panc-1 cells. Flow cytometry and fluorescence imaging techniques have been applied to confirm transfection and release of IL-8 siRNA. The ratio of AuNRs and siRNA has been optimized and transfection efficiencies as high as 88.40 ± 2.14% have been achieved. Upon successful delivery of IL-8 siRNA into cancer cells, the effects of IL-8 gene knockdown are quantified in terms of gene expression, cell invasion, cell migration and cell apoptosis assays. Statistical comparative studies for both MiaPaCa-2 and Panc-1 cells are presented in this work. IL-8 gene silencing has been demonstrated with knockdown efficiencies of 81.02 ± 10.14% and 75.73 ± 6.41% in MiaPaCa-2 and Panc-1 cells, respectively. Our results are then compared with a commercial transfection reagent, Oligofectamine, serving as positive control. The gene knockdown results illustrate the potential role of AuNRs as non-viral gene delivery vehicles for RNAi-based targeted cancer therapy applications. (paper)

  16. Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

    Science.gov (United States)

    Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

    2011-12-01

    Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  17. Silencing of Soybean Raffinose Synthase Gene Reduced Raffinose Family Oligosaccharides and Increased True Metabolizable Energy of Poultry Feed

    Directory of Open Access Journals (Sweden)

    Michelle F. Valentine

    2017-05-01

    Full Text Available Soybean [Glycine max (L. Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2, to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets.

  18. Silencing of Soybean Raffinose Synthase Gene Reduced Raffinose Family Oligosaccharides and Increased True Metabolizable Energy of Poultry Feed

    Science.gov (United States)

    Valentine, Michelle F.; De Tar, Joann R.; Mookkan, Muruganantham; Firman, Jeffre D.; Zhang, Zhanyuan J.

    2017-01-01

    Soybean [Glycine max (L.) Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2), to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME) in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets. PMID:28559898

  19. Inter-genomic DNA Exchanges and Homeologous Gene Silencing Shaped the Nascent Allopolyploid Coffee Genome (Coffea arabica L.

    Directory of Open Access Journals (Sweden)

    Philippe Lashermes

    2016-09-01

    Full Text Available Allopolyploidization is a biological process that has played a major role in plant speciation and evolution. Genomic changes are common consequences of polyploidization, but their dynamics over time are still poorly understood. Coffea arabica, a recently formed allotetraploid, was chosen to study genetic changes that accompany allopolyploid formation. Both RNA-seq and DNA-seq data were generated from two genetically distant C. arabica accessions. Genomic structural variation was investigated using C. canephora, one of its diploid progenitors, as reference genome. The fate of 9047 duplicate homeologous genes was inferred and compared between the accessions. The pattern of SNP density along the reference genome was consistent with the allopolyploid structure. Large genomic duplications or deletions were not detected. Two homeologous copies were retained and expressed in 96% of the genes analyzed. Nevertheless, duplicated genes were found to be affected by various genomic changes leading to homeolog loss or silencing. Genetic and epigenetic changes were evidenced that could have played a major role in the stabilization of the unique ancestral allotetraploid and its subsequent diversification. While the early evolution of C. arabica mainly involved homeologous crossover exchanges, the later stage appears to have relied on more gradual evolution involving gene conversion and homeolog silencing.

  20. Gene silencing of stearoyl-ACP desaturase enhances the stearic acid content in Chlamydomonas reinhardtii

    NARCIS (Netherlands)

    Jaeger, de L.; Springer, J.; Wolbert, E.J.H.; Martens, D.E.; Eggink, G.; Wijffels, R.H.

    2017-01-01

    In this study, stearoyl-ACP desaturase (SAD), the enzyme that converts stearic acid into oleic acid, is silenced by artificial microRNA in the green microalga Chlamydomonas reinhardtii. Two different constructs, which target different positions on the mRNA of stearoyl-ACP desaturase, were tested.

  1. Targeted transfection increases siRNA uptake and gene silencing of primary endothelial cells in vitro--a quantitative study.

    Science.gov (United States)

    Asgeirsdóttir, Sigridur A; Talman, Eduard G; de Graaf, Inge A; Kamps, Jan A A M; Satchell, Simon C; Mathieson, Peter W; Ruiters, Marcel H J; Molema, Grietje

    2010-01-25

    Applications of small-interfering RNA (siRNA) call for specific and efficient delivery of siRNA into particular cell types. We developed a novel, non-viral targeting system to deliver siRNA specifically into inflammation-activated endothelial cells. This was achieved by conjugating the cationic amphiphilic lipid SAINT to antibodies recognizing the inflammatory cell adhesion molecule E-selectin. These anti-E-selectin-SAINT lipoplexes (SAINTarg) maintained antigen recognition capacity of the parental antibody in vitro, and ex vivo in human kidney tissue slices subjected to inflammatory conditions. Regular SAINT mediated transfection resulted in efficient gene silencing in human microvascular endothelial cells (HMEC-1) and conditionally immortalized glomerular endothelial cells (ciGEnC). However, primary human umbilical vein endothelial cells (HUVEC) transfected poorly, a phenomenon that we could quantitatively correlate with a cell-type specific capacity to facilitate siRNA uptake. Importantly, SAINTarg increased siRNA uptake and transfection specificity for activated endothelial cells. Transfection with SAINTarg delivered significantly more siRNA into activated HUVEC, compared to transfection with non-targeted SAINT. The enhanced uptake of siRNA was corroborated by improved silencing of both gene- and protein expression of VE-cadherin in activated HUVEC, indicating that SAINTarg delivered functionally active siRNA into endothelial cells. The obtained results demonstrate a successful design of a small nucleotide carrier system with improved and specific siRNA delivery into otherwise difficult-to-transfect primary endothelial cells, which in addition reduced considerably the amount of siRNA needed for gene silencing. Copyright 2009 Elsevier B.V. All rights reserved.

  2. Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots.

    Science.gov (United States)

    Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T

    2014-12-01

    Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.

  3. Multi-gene epigenetic silencing of tumor suppressor genes in T-cell lymphoma cells; delayed expression of the p16 protein upon reversal of the silencing

    DEFF Research Database (Denmark)

    Nagasawa, T; Zhang, Q; Raghunath, P N

    2006-01-01

    To understand better T-cell lymphomagenesis, we examined promoter CpG methylation and mRNA expression of closely related genes encoding p16, p15, and p14 tumor suppressor genes in cultured malignant T-cells that were derived from cutaneous, adult type, and anaplastic lymphoma kinase (ALK)-express...

  4. Helicobacter pylori gene silencing in vivo demonstrates urease is essential for chronic infection.

    Science.gov (United States)

    Debowski, Aleksandra W; Walton, Senta M; Chua, Eng-Guan; Tay, Alfred Chin-Yen; Liao, Tingting; Lamichhane, Binit; Himbeck, Robyn; Stubbs, Keith A; Marshall, Barry J; Fulurija, Alma; Benghezal, Mohammed

    2017-06-01

    Helicobacter pylori infection causes chronic active gastritis that after many years of infection can develop into peptic ulceration or gastric adenocarcinoma. The bacterium is highly adapted to surviving in the gastric environment and a key adaptation is the virulence factor urease. Although widely postulated, the requirement of urease expression for persistent infection has not been elucidated experimentally as conventional urease knockout mutants are incapable of colonization. To overcome this constraint, conditional H. pylori urease mutants were constructed by adapting the tetracycline inducible expression system that enabled changing the urease phenotype of the bacteria during established infection. Through tight regulation we demonstrate that urease expression is not only required for establishing initial colonization but also for maintaining chronic infection. Furthermore, successful isolation of tet-escape mutants from a late infection time point revealed the strong selective pressure on this gastric pathogen to continuously express urease in order to maintain chronic infection. In addition to mutations in the conditional gene expression system, escape mutants were found to harbor changes in other genes including the alternative RNA polymerase sigma factor, fliA, highlighting the genetic plasticity of H. pylori to adapt to a changing niche. The tet-system described here opens up opportunities to studying genes involved in the chronic stage of H. pylori infection to gain insight into bacterial mechanisms promoting immune escape and life-long infection. Furthermore, this genetic tool also allows for a new avenue of inquiry into understanding the importance of various virulence determinants in a changing biological environment when the bacterium is put under duress.

  5. Helicobacter pylori gene silencing in vivo demonstrates urease is essential for chronic infection.

    Directory of Open Access Journals (Sweden)

    Aleksandra W Debowski

    2017-06-01

    Full Text Available Helicobacter pylori infection causes chronic active gastritis that after many years of infection can develop into peptic ulceration or gastric adenocarcinoma. The bacterium is highly adapted to surviving in the gastric environment and a key adaptation is the virulence factor urease. Although widely postulated, the requirement of urease expression for persistent infection has not been elucidated experimentally as conventional urease knockout mutants are incapable of colonization. To overcome this constraint, conditional H. pylori urease mutants were constructed by adapting the tetracycline inducible expression system that enabled changing the urease phenotype of the bacteria during established infection. Through tight regulation we demonstrate that urease expression is not only required for establishing initial colonization but also for maintaining chronic infection. Furthermore, successful isolation of tet-escape mutants from a late infection time point revealed the strong selective pressure on this gastric pathogen to continuously express urease in order to maintain chronic infection. In addition to mutations in the conditional gene expression system, escape mutants were found to harbor changes in other genes including the alternative RNA polymerase sigma factor, fliA, highlighting the genetic plasticity of H. pylori to adapt to a changing niche. The tet-system described here opens up opportunities to studying genes involved in the chronic stage of H. pylori infection to gain insight into bacterial mechanisms promoting immune escape and life-long infection. Furthermore, this genetic tool also allows for a new avenue of inquiry into understanding the importance of various virulence determinants in a changing biological environment when the bacterium is put under duress.

  6. An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing

    DEFF Research Database (Denmark)

    Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria

    2016-01-01

    /2 12 min (naked) to t1/2 45 min (single cholesteryl) and t1/2 71 min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing......HSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies...

  7. Mitochondrial damage and cholesterol storage in human hepatocellular carcinoma cells with silencing of UBIAD1 gene expression

    Directory of Open Access Journals (Sweden)

    Carlos R. Morales

    2014-01-01

    Full Text Available Heterozygous mutations in the UBIAD1 gene cause Schnyder corneal dystrophy characterized by abnormal cholesterol and phospholipid deposits in the cornea. Ubiad1 protein was recently identified as Golgi prenyltransferase responsible for biosynthesis of vitamin K2 and CoQ10, a key protein in the mitochondrial electron transport chain. Our study shows that silencing UBIAD1 in cultured human hepatocellular carcinoma cells causes dramatic morphological changes and cholesterol storage in the mitochondria, emphasizing an important role of UBIAD1 in mitochondrial function.

  8. siRNA-mediated Erc gene silencing suppresses tumor growth in Tsc2 mutant renal carcinoma model.

    Science.gov (United States)

    Imamura, Osamu; Okada, Hiroaki; Takashima, Yuuki; Zhang, Danqing; Kobayashi, Toshiyuki; Hino, Okio

    2008-09-18

    Silencing of gene expression by small interfering RNAs (siRNAs) is rapidly becoming a powerful tool for genetic analysis and represents a potential strategy for therapeutic product development. However, there are no reports of systemic delivery of siRNAs for stable treatment except short hairpin RNAs (shRNAs). On the other hand, there are many reports of systemic delivery of siRNAs for transient treatment using liposome carriers and others. With regard to shRNAs, a report showed fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Therefore, we decided to use original siRNA microspheres instead of shRNA for stable treatment of disease. In this study, we designed rat-specific siRNA sequences for Erc/mesothelin, which is a tumor-specific gene expressed in the Eker (Tsc2 mutant) rat model of hereditary renal cancer and confirmed the efficacy of gene silencing in vitro. Then, by using siRNA microspheres, we found that the suppression of Erc/mesothelin caused growth inhibition of Tsc2 mutant renal carcinoma cells in tumor implantation experiments in mice.

  9. Identification and gene-silencing of a putative odorant receptor transcription factor in Varroa destructor: possible role in olfaction.

    Science.gov (United States)

    Singh, N K; Eliash, N; Stein, I; Kamer, Y; Ilia, Z; Rafaeli, A; Soroker, V

    2016-04-01

    The ectoparasitic mite Varroa destructor is one of the major threats to apiculture. Using a behavioural choice bioassay, we determined that phoretic mites were more successful in reaching a bee than reproductive mites, suggesting an energy trade-off between reproduction and host selection. We used both chemo-ecological and molecular strategies to identify the regulation of the olfactory machinery of Varroa and its association with reproduction. We focused on transcription regulation. Using primers designed to the conserved DNA binding region of transcription factors, we identified a gene transcript in V. destructor homologous to the pheromone receptor transcription factor (PRTF) gene of Pediculus humanus corporis. Quantitative PCR (qPCR) revealed that this PRTF-like gene transcript is expressed in the forelegs at higher levels than in the body devoid of forelegs. Subsequent comparative qPCR analysis showed that transcript expression was significantly higher in the phoretic as compared to the reproductive stage. Electrophysiological and behavioural studies revealed a reduction in the sensitivity of PRTF RNA interference-silenced mites to bee headspace, consistent with a reduction in the mites' ability to reach a host. In addition, vitellogenin expression was stimulated in PRTF-silenced mites to similar levels as found in reproductive mites. These data shed light upon the regulatory mechanism of host chemosensing in V. destructor. © 2016 The Royal Entomological Society.

  10. Transient GFP expression in Nicotiana plumbaginifolia suspension cells: the role of gene silencing, cell death and T-DNA loss.

    Science.gov (United States)

    Weld, R; Heinemann, J; Eady, C

    2001-03-01

    The transient nature of T-DNA expression was studied with a gfp reporter gene transferred to Nicotiana plumbaginifolia suspension cells from Agrobacterium tumefaciens. Individual GFP-expressing protoplasts were isolated after 4 days' co-cultivation. The protoplasts were cultured without selection and 4 weeks later the surviving proto-calluses were again screened for GFP expression. Of the proto-calluses initially expressing GFP, 50% had lost detectable GFP activity during the first 4 weeks of culture. Multiple T-DNA copies of the gfp gene were detected in 10 of 17 proto-calluses lacking visible GFP activity. The remaining 7 cell lines contained no gfp sequences. Our results confirm that transiently expressed T-DNAs can be lost during growth of somatic cells and demonstrate that transiently expressing cells frequently integrate multiple T-DNAs that become silenced. In cells competent for DNA uptake, cell death and gene silencing were more important barriers to the recovery of stably expressing transformants than lack of T-DNA integration.

  11. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

    Science.gov (United States)

    Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

    2007-09-01

    The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

  12. Concurrent epigenetic silencing of wnt/β-catenin pathway inhibitor genes in B cell chronic lymphocytic leukaemia

    International Nuclear Information System (INIS)

    Moskalev, Evgeny A; Pötz, Oliver; Joos, Thomas O; Hoheisel, Jörg D; Luckert, Katrin; Vorobjev, Ivan A; Mastitsky, Sergey E; Gladkikh, Aleena A; Stephan, Achim; Schrenk, Marita; Kaplanov, Kamil D; Kalashnikova, Olga B

    2012-01-01

    The Wnt/β-catenin signalling is aberrantly activated in primary B cell chronic lymphocytic leukaemia (CLL). Epigenetic silencing of pathway inhibitor genes may be a mechanism for its activation. In this study, we investigated systematically and quantitatively the methylation status of 12 Wnt/β-catenin pathway inhibitor genes – CDH1, DACT1, DKK1, DKK2, DKK3, DKK4, SFRP1, SFRP2, SFRP3, SFRP4, SFRP5 and WIF1 – in the cell lines EHEB and MEC-1 as well as patient samples. Quantification of DNA methylation was performed by means of bisulphite pyrosequencing and confirmed by bisulphite Sanger sequencing. Gene expression was analysed by qPCR using GAPDH as internal control. E-cadherin and β-catenin protein quantification was carried out by microsphere-based immunoassays. Methylation differences observed between the patient and control groups were tested using generalised least squares models. For 10 genes, a higher methylation level was observed in tumour material. Only DKK4 exhibited similarly high methylation levels in both tumour and normal specimens, while DACT1 was always essentially unmethylated. However, also for these inhibitors, treatment of cells with the demethylating agent 5-aza-2´-deoxycytidine resulted in an induction of their expression, as shown by quantitative PCR, suggesting an indirect epigenetic control of activity. While the degree of demethylation and its transcriptional consequences differed between the genes, there was an overall high correlation of demethylation and increased activity. Protein expression studies revealed that no constitutive Wnt/β-catenin signalling occurred in the cell lines, which is in discrepancy with results from primary CLL. However, treatment with 5-aza-2´-deoxycytidine caused accumulation of β-catenin. Simultaneously, E-cadherin expression was strongly induced, leading to the formation of a complex with β-catenin and thus demonstrating its epigenetically regulated inhibition effect. The results suggest an

  13. Expression of cancer stem markers could be influenced by silencing of p16 gene in HeLa cervical carcinoma cells.

    Science.gov (United States)

    Wu, H; Zhang, J; Shi, H

    2016-01-01

    Effect of the tumor suppression gene p16 on the biological characteristics of HeLa cervical carcinoma cells was explored. The expression of p16 protein was increased in HeLa tumor sphere cells, and no significant difference in tumor spheres from the first to the fourth passages. Compared with those of parental HeLa cells, the proportion of CD44+/CD24- and ABCG2+ cells increased significantly in tumor spheres. However after the cells were silenced by the p16-sh289 vector, expression of P16 protein and the cell number of CD44+/CD24- and ABCG2+ decreased. Moreover, HeLa cells with p16 gene silencing showed decreased abilities of sphere formation and matrigel invasion. More HeLa cells with p16 gene silence were needed for tumor formation in nude mice. Tumor size and weight in mouse model established with p16 gene silenced HeLa cells were less than those with HeLa parental cell model. The present results indicate that silencing of the p16 gene inhibits expression of cancer stem cell markers and tumorigenic ability of HeLa cells.

  14. Dimerization site 2 of the bacterial DNA-binding protein H-NS is required for gene silencing and stiffened nucleoprotein filament formation.

    Science.gov (United States)

    Yamanaka, Yuki; Winardhi, Ricksen S; Yamauchi, Erika; Nishiyama, So-Ichiro; Sowa, Yoshiyuki; Yan, Jie; Kawagishi, Ikuro; Ishihama, Akira; Yamamoto, Kaneyoshi

    2018-06-15

    The bacterial nucleoid-associated protein H-NS is a DNA-binding protein, playing a major role in gene regulation. To regulate transcription, H-NS silences genes, including horizontally acquired foreign genes. Escherichia coli H-NS is 137 residues long and consists of two discrete and independent structural domains: an N-terminal oligomerization domain and a C-terminal DNA-binding domain, joined by a flexible linker. The N-terminal oligomerization domain is composed of two dimerization sites, dimerization sites 1 and 2, which are both required for H-NS oligomerization, but the exact role of dimerization site 2 in gene silencing is unclear. To this end, we constructed a whole set of single amino acid substitution variants spanning residues 2 to 137. Using a well-characterized H-NS target, the slp promoter of the glutamic acid-dependent acid resistance (GAD) cluster promoters, we screened for any variants defective in gene silencing. Focusing on the function of dimerization site 2, we analyzed four variants, I70C/I70A and L75C/L75A, which all could actively bind DNA but are defective in gene silencing. Atomic force microscopy analysis of DNA-H-NS complexes revealed that all of these four variants formed condensed complexes on DNA, whereas WT H-NS formed rigid and extended nucleoprotein filaments, a conformation required for gene silencing. Single-molecule stretching experiments confirmed that the four variants had lost the ability to form stiffened filaments. We conclude that dimerization site 2 of H-NS plays a key role in the formation of rigid H-NS nucleoprotein filament structures required for gene silencing. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Silencing of SARS-CoV spike gene by small interfering RNA in HEK 293T cells

    International Nuclear Information System (INIS)

    Qin Zhaoling; Zhao Ping; Zhang Xiaolian; Yu Jianguo; Cao Mingmei; Zhao Lanjuan; Luan Jie; Qi Zhongtian

    2004-01-01

    Two candidate small interfering RNAs (siRNAs) corresponding to severe acute respiratory syndrome-associated coronavirus (SARS-CoV) spike gene were designed and in vitro transcribed to explore the possibility of silencing SARS-CoV S gene. The plasmid pEGFP-optS, which contains the codon-optimized SARS-CoV S gene and expresses spike-EGFP fusion protein (S-EGFP) as silencing target and expressing reporter, was transfected with siRNAs into HEK 293T cells. At various time points of posttransfection, the levels of S-EGFP expression and amounts of spike mRNA transcript were detected by fluorescence microscopy, flow cytometry, Western blot, and real-time quantitative PCR, respectively. The results showed that the cells transfected with pEGFP-optS expressed S-EGFP fusion protein at a higher level compared with those transfected with pEGFP-S, which contains wildtype SARS-CoV spike gene sequence. The green fluorescence, mean fluorescence intensity, and SARS-CoV S RNA transcripts were found significantly reduced, and the expression of SARS-CoV S glycoprotein was strongly inhibited in those cells co-transfected with either EGFP- or S-specific siRNAs. Our findings demonstrated that the S-specific siRNAs used in this study were able to specifically and effectively inhibit SARS-CoV S glycoprotein expression in cultured cells through blocking the accumulation of S mRNA, which may provide an approach for studies on the functions of SARS-CoV S gene and development of novel prophylactic or therapeutic agents for SARS-CoV

  16. big bang gene modulates gut immune tolerance in Drosophila.

    Science.gov (United States)

    Bonnay, François; Cohen-Berros, Eva; Hoffmann, Martine; Kim, Sabrina Y; Boulianne, Gabrielle L; Hoffmann, Jules A; Matt, Nicolas; Reichhart, Jean-Marc

    2013-02-19

    Chronic inflammation of the intestine is detrimental to mammals. Similarly, constant activation of the immune response in the gut by the endogenous flora is suspected to be harmful to Drosophila. Therefore, the innate immune response in the gut of Drosophila melanogaster is tightly balanced to simultaneously prevent infections by pathogenic microorganisms and tolerate the endogenous flora. Here we describe the role of the big bang (bbg) gene, encoding multiple membrane-associated PDZ (PSD-95, Discs-large, ZO-1) domain-containing protein isoforms, in the modulation of the gut immune response. We show that in the adult Drosophila midgut, BBG is present at the level of the septate junctions, on the apical side of the enterocytes. In the absence of BBG, these junctions become loose, enabling the intestinal flora to trigger a constitutive activation of the anterior midgut immune response. This chronic epithelial inflammation leads to a reduced lifespan of bbg mutant flies. Clearing the commensal flora by antibiotics prevents the abnormal activation of the gut immune response and restores a normal lifespan. We now provide genetic evidence that Drosophila septate junctions are part of the gut immune barrier, a function that is evolutionarily conserved in mammals. Collectively, our data suggest that septate junctions are required to maintain the subtle balance between immune tolerance and immune response in the Drosophila gut, which represents a powerful model to study inflammatory bowel diseases.

  17. The SNF2-family member Fun30 promotes gene silencing in heterochromatic loci.

    Directory of Open Access Journals (Sweden)

    Ana Neves-Costa

    2009-12-01

    Full Text Available Chromatin regulates many key processes in the nucleus by controlling access to the underlying DNA. SNF2-like factors are ATP-driven enzymes that play key roles in the dynamics of chromatin by remodelling nucleosomes and other nucleoprotein complexes. Even simple eukaryotes such as yeast contain members of several subfamilies of SNF2-like factors. The FUN30/ETL1 subfamily of SNF2 remodellers is conserved from yeasts to humans, but is poorly characterized. We show that the deletion of FUN30 leads to sensitivity to the topoisomerase I poison camptothecin and to severe cell cycle progression defects when the Orc5 subunit is mutated. We demonstrate a role of FUN30 in promoting silencing in the heterochromatin-like mating type locus HMR, telomeres and the rDNA repeats. Chromatin immunoprecipitation experiments demonstrate that Fun30 binds at the boundary element of the silent HMR and within the silent HMR. Mapping of nucleosomes in vivo using micrococcal nuclease demonstrates that deletion of FUN30 leads to changes of the chromatin structure at the boundary element. A point mutation in the ATP-binding site abrogates the silencing function of Fun30 as well as its toxicity upon overexpression, indicating that the ATPase activity is essential for these roles of Fun30. We identify by amino acid sequence analysis a putative CUE motif as a feature of FUN30/ETL1 factors and show that this motif assists Fun30 activity. Our work suggests that Fun30 is directly involved in silencing by regulating the chromatin structure within or around silent loci.

  18. Silence multiple

    DEFF Research Database (Denmark)

    Søndergaard, Katia Dupret

    The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...

  19. Utilizing virus-induced gene silencing for the functional characterization of maize genes during infection with the fungal pathogen Ustilago maydis.

    Science.gov (United States)

    van der Linde, Karina; Doehlemann, Gunther

    2013-01-01

    While in dicotyledonous plants virus-induced gene silencing (VIGS) is well established to study plant-pathogen interaction, in monocots only few examples of efficient VIGS have been reported so far. One of the available systems is based on the brome mosaic virus (BMV) which allows gene silencing in different cereals including barley (Hordeum vulgare), wheat (Triticum aestivum), and maize (Zea mays).Infection of maize plants by the corn smut fungus Ustilago maydis leads to the formation of large tumors on stem, leaves, and inflorescences. During this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed comprehensive and stage-specific changes in host gene expression during disease progression.To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a VIGS system based on the Brome mosaic virus (BMV) to maize at conditions that allow successful U. maydis infection of BMV pre-infected maize plants. This setup enables quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (q(RT)-PCR)-based readout.

  20. Silencing the SpMPK1, SpMPK2, and SpMPK3 Genes in Tomato Reduces Abscisic Acid—Mediated Drought Tolerance

    Directory of Open Access Journals (Sweden)

    Yan Liang

    2013-11-01

    Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.

  1. Deep sequencing uncovers commonality in small RNA profiles between transgene-induced and naturally occurring RNA silencing of chalcone synthase-A gene in petunia.

    Science.gov (United States)

    Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira

    2013-01-30

    Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the

  2. An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene.

    Science.gov (United States)

    Cui, Hongguang; Wang, Aiming

    2017-03-01

    RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  3. Delivery of chitosan/dsRNA nanoparticles for silencing of wing development vestigial (vg) gene in Aedes aegypti mosquitoes.

    Science.gov (United States)

    Ramesh Kumar, D; Saravana Kumar, P; Gandhi, M Rajiv; Al-Dhabi, Naif Abdullah; Paulraj, M Gabriel; Ignacimuthu, S

    2016-05-01

    RNA interference (RNAi) has been used as a gene silencing strategy by the introduction of long double stranded RNA (dsRNA) for the control of pest insects. The aim of the present study was to examine whether the expression of vg gene which is responsible for wing development, can be repressed by chitosan/dsRNA based nanoparticles in Aedes aegypti. The vestigial gene (vg) was amplified from adult mosquito and cloned in pLitmus28i vector. Genetically engineered recombinant plasmid was transformed into RNase III deficient strain for synthesis of bacterially expressed dsRNA. Nanoparticles were prepared via electrostatic interaction between cationic polymer chitosan and anionic nucleic acids (dsRNA). The formation of chitosan/dsRNAnanoparticles and their size were confirmed by Atomic force microscopy (AFM). Chitosan/dsRNA mediated knockdown of Enhanced Green Fluorescence Protein (EGFP) was demonstrated in Sf21 cells. Further, we tested whether such an approach could be used to target vg gene in Ae. aegypti. The results showed that chitosan/dsRNA caused significant mortality, delayed growth development and caused adult wing-malformation. A qRT-PCR analysis confirmed that the chitosan/dsRNA mediated transcriptional level was downregulated. Our findings suggest that vg gene intervention strategies through RNAi can emerge as viable option for pest control. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Silencing of DNase Colicin E8 Gene Expression by a Complex Nucleoprotein Assembly Ensures Timely Colicin Induction.

    Directory of Open Access Journals (Sweden)

    Simona Kamenšek

    2015-06-01

    Full Text Available Colicins are plasmid-encoded narrow spectrum antibiotics that are synthesized by strains of Escherichia coli and govern intraspecies competition. In a previous report, we demonstrated that the global transcriptional factor IscR, co dependently with the master regulator of the DNA damage response, LexA, delays induction of the pore forming colicin genes after SOS induction. Here we show that IscR is not involved in the regulation of nuclease colicins, but that the AsnC protein is. We report that AsnC, in concert with LexA, is the key controller of the temporal induction of the DNA degrading colicin E8 gene (cea8, after DNA damage. We demonstrate that a large AsnC nucleosome-like structure, in conjunction with two LexA molecules, prevent cea8 transcription initiation and that AsnC binding activity is directly modulated by L asparagine. We show that L-asparagine is an environmental factor that has a marked impact on cea8 promoter regulation. Our results show that AsnC also modulates the expression of several other DNase and RNase colicin genes but does not substantially affect pore-forming colicin K gene expression. We propose that selection pressure has "chosen" highly conserved regulators to control colicin expression in E. coli strains, enabling similar colicin gene silencing among bacteria upon exchange of colicinogenic plasmids.

  5. Silencing of a putative immunophilin gene in the cattle tick Rhipicephalus (Boophilus microplus increases the infection rate of Babesia bovis in larval progeny

    Directory of Open Access Journals (Sweden)

    Knowles Donald P

    2009-11-01

    Full Text Available Abstract Background The cattle tick Rhipicephalus (Boophilus microplus is involved in the transmission of the protozoan Babesia bovis, the etiological agent of bovine babesiosis. Interactions between ticks and protozoa are poorly understood and the investigation of tick genes that affect tick fitness and protozoan infection can set the stage for dissecting the molecular interactions between the two species. Results In this study, RNA interference was used to silence R. microplus genes that had been previously shown to be up-regulated in response to B. bovis infection. The silencing of a putative immunophilin gene (Imnp in female ticks fed on a calf acutely infected with B. bovis decreased the hatching rate and survival of larval progeny. Interestingly, Imnp was up-regulated significantly in ovaries of R. microplus in response to B. bovis infection and its silencing in female ticks significantly increased the infection rate of the protozoan in larval progeny. The results also showed that the silencing of a putative Kunitz-type serine protease inhibitor (Spi gene and a putative lipocalin (Lpc gene decreased the fitness of R. microplus females, but had no significant effect on the infection rate of B. bovis in larval progeny. Conclusion The silencing of the Imnp, Spi or Lpc genes decreased the fitness of R. microplus females fed on a calf during acute B. bovis infection. The Imnp gene data suggest that this putative immunophilin gene is involved in the defense system of R. microplus against B. bovis and may play a role in controlling the protozoan infection in tick ovaries and larval progeny.

  6. E-cadherin is transcriptionally activated via suppression of ZEB1 transcriptional repressor by small RNA-mediated gene silencing.

    Directory of Open Access Journals (Sweden)

    Minami Mazda

    Full Text Available RNA activation has been reported to be induced by small interfering RNAs (siRNAs that act on the promoters of several genes containing E-cadherin. In this study, we present an alternative mechanism of E-cadherin activation in human PC-3 cells by siRNAs previously reported to possess perfect-complementary sequences to E-cadherin promoter. We found that activation of E-cadherin can be also induced via suppression of ZEB1, which is a transcriptional repressor of E-cadherin, by seed-dependent silencing mechanism of these siRNAs. The functional seed-complementary sites of the siRNAs were found in the coding region in addition to the 3' untranslated region of ZEB1 mRNA. Promoter analyses indicated that E-boxes, which are ZEB1-binding sites, in the upstream promoter region are indispensable for E-cadherin transcription by the siRNAs. Thus, the results caution against ignoring siRNA seed-dependent silencing effects in genome-wide transcriptional regulation. In addition, members of miR-302/372/373/520 family, which have the same seed sequences with one of the siRNAs containing perfect-complementarity to E-cadherin promoter, are also found to activate E-cadherin transcription. Thus, E-cadherin could be upregulated by the suppression of ZEB1 transcriptional repressor by miRNAs in vivo.

  7. Gene Network Polymorphism Illuminates Loss and Retention of Novel RNAi Silencing Components in the Cryptococcus Pathogenic Species Complex.

    Directory of Open Access Journals (Sweden)

    Marianna Feretzaki

    2016-03-01

    Full Text Available RNAi is a ubiquitous pathway that serves central functions throughout eukaryotes, including maintenance of genome stability and repression of transposon expression and movement. However, a number of organisms have lost their RNAi pathways, including the model yeast Saccharomyces cerevisiae, the maize pathogen Ustilago maydis, the human pathogen Cryptococcus deuterogattii, and some human parasite pathogens, suggesting there may be adaptive benefits associated with both retention and loss of RNAi. By comparing the RNAi-deficient genome of the Pacific Northwest Outbreak C. deuterogattii strain R265 with the RNAi-proficient genomes of the Cryptococcus pathogenic species complex, we identified a set of conserved genes that were lost in R265 and all other C. deuterogattii isolates examined. Genetic and molecular analyses reveal several of these lost genes play roles in RNAi pathways. Four novel components were examined further. Znf3 (a zinc finger protein and Qip1 (a homolog of N. crassa Qip were found to be essential for RNAi, while Cpr2 (a constitutive pheromone receptor and Fzc28 (a transcription factor are involved in sex-induced but not mitosis-induced silencing. Our results demonstrate that the mitotic and sex-induced RNAi pathways rely on the same core components, but sex-induced silencing may be a more specific, highly induced variant that involves additional specialized or regulatory components. Our studies further illustrate how gene network polymorphisms involving known components of key cellular pathways can inform identification of novel elements and suggest that RNAi loss may have been a core event in the speciation of C. deuterogattii and possibly contributed to its pathogenic trajectory.

  8. SiRNAs conjugated with aromatic compounds induce RISC-mediated antisense strand selection and strong gene-silencing activity

    Energy Technology Data Exchange (ETDEWEB)

    Kubo, Takanori, E-mail: kubo-t@yasuda-u.ac.jp [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan); Yanagihara, Kazuyoshi [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan); Division of Genetics, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Takei, Yoshifumi [Department of Biochemistry, Nagoya University Graduate School of Medicine, 65 Tsurumi-cho, Showa-ku, Nagoya 466-8550 (Japan); Mihara, Keichiro [Department of Hematology and Oncology, Research Institute for Radiation Biology and Medicine, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8553 (Japan); Sato, Yuichiro; Seyama, Toshio [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan)

    2012-10-05

    Highlights: Black-Right-Pointing-Pointer SiRNAs conjugated with aromatic compounds (Ar-siRNAs) at 5 Prime -sense strand were synthesized. Black-Right-Pointing-Pointer Ar-siRNAs increased resistance against nuclease degradation. Black-Right-Pointing-Pointer Ar-siRNAs were thermodynamically stable compared with the unmodified siRNA. Black-Right-Pointing-Pointer High levels of cellular uptake and cytoplasmic localization were found. Black-Right-Pointing-Pointer Strong gene-silencing efficacy was exhibited in the Ar-siRNAs. -- Abstract: Short interference RNA (siRNA) is a powerful tool for suppressing gene expression in mammalian cells. In this study, we focused on the development of siRNAs conjugated with aromatic compounds in order to improve the potency of RNAi and thus to overcome several problems with siRNAs, such as cellular delivery and nuclease stability. The siRNAs conjugated with phenyl, hydroxyphenyl, naphthyl, and pyrenyl derivatives showed strong resistance to nuclease degradation, and were thermodynamically stable compared with unmodified siRNA. A high level of membrane permeability in HeLa cells was also observed. Moreover, these siRNAs exhibited enhanced RNAi efficacy, which exceeded that of locked nucleic acid (LNA)-modified siRNAs, against exogenous Renilla luciferase in HeLa cells. In particular, abundant cytoplasmic localization and strong gene-silencing efficacy were found in the siRNAs conjugated with phenyl and hydroxyphenyl derivatives. The novel siRNAs conjugated with aromatic compounds are promising candidates for a new generation of modified siRNAs that can solve many of the problems associated with RNAi technology.

  9. STAT3 Gene Silencing by Aptamer-siRNA Chimera as Selective Therapeutic for Glioblastoma

    Directory of Open Access Journals (Sweden)

    Carla Lucia Esposito

    2018-03-01

    Full Text Available Glioblastoma (GBM is the most frequent and aggressive primary brain tumor in adults, and despite advances in neuro-oncology, the prognosis for patients remains dismal. The signal transducer and activator of transcription-3 (STAT3 has been reported as a key regulator of the highly aggressive mesenchymal GBM subtype, and its direct silencing (by RNAi oligonucleotides has revealed a great potential as an anti-cancer therapy. However, clinical use of oligonucleotide-based therapies is dependent on safer ways for tissue-specific targeting and increased membrane penetration. The objective of this study is to explore the use of nucleic acid aptamers as carriers to specifically drive a STAT3 siRNA to GBM cells in a receptor-dependent manner. Using an aptamer that binds to and antagonizes the oncogenic receptor tyrosine kinase PDGFRβ (Gint4.T, here we describe the design of a novel aptamer-siRNA chimera (Gint4.T-STAT3 to target STAT3. We demonstrate the efficient delivery and silencing of STAT3 in PDGFRβ+ GBM cells. Importantly, the conjugate reduces cell viability and migration in vitro and inhibits tumor growth and angiogenesis in vivo in a subcutaneous xenograft mouse model. Our data reveals Gint4.T-STAT3 conjugate as a novel molecule with great translational potential for GBM therapy.

  10. Varroa destructor induces changes in the expression of immunity-related genes during the development of Apis mellifera worker and drone broods.

    Science.gov (United States)

    Zaobidna, Ewa A; Żółtowska, Krystyna; Łopieńska-Biernat, Elżbieta

    2017-12-20

    The ectoparasitic mite Varroa destructor has emerged as the major pest of honeybees. Despite extensive research efforts, the pathogenesis of varroosis has not been fully explained. Earlier studies suggested that V. destructor infestation leads to the suppression of the host's immune system. The aim of this study was to analyze the immune responses of 14 genes in the Toll signal transduction pathways, including effector genes of antimicrobial peptides (AMPs), in developing Apis mellifera workers and drones infested with V. destructor. Four developmental stages (L5 larvae, prepupae, and 2 pupal stages) and newly emerged imagines were analyzed. In workers, the most significant changes were observed in L5 larvae in the initial stages of infestation. A significant increase in the relative expression of 10 of the 14 analyzed genes, including defensin-1 and defensin-2, was observed in infested bees relative to non-infested individuals. The immune response in drones developed at a slower rate. The expression of genes regulating cytoplasmic signal transduction increased in prepupae, whereas the expression of defensin-1 and defensin-2 effector genes increased in P3 pupae with red eyes. The expression of many immunity-related genes was silenced in successive life stages and in imagines, and it was more profound in workers than in drones. The results indicate that V. destructor significantly influences immune responses regulated by the Toll signal transduction pathway in bees. In infested bees, the observed changes in Toll pathway genes varied between life stages and the sexes.

  11. Update on gene therapy of inherited immune deficiencies.

    Science.gov (United States)

    Engel, Barbara C; Kohn, Donald B; Podsakoff, Greg M

    2003-10-01

    Gene therapy has been under development as a way to correct inborn errors for many years. Recently, patients with two forms of inherited severe combined immunodeficiency (SCID), adenosine deaminase and X-linked, treated by three different clinical investigative teams, have shown significant immune reconstitution leading to protective immunity. These advances irrefutably prove the concept that hematopoietic progenitor cell gene therapy can ameliorate these diseases. However, due to proviral insertional oncogenesis, two individuals in one of the X-SCID studies developed T-cell leukemia more than two years after the gene transfer. Depending upon the results of long-term follow-up, the successes together with the side effects highlight the relative merits of this therapeutic approach.

  12. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3' untranslated region and intronic cis-elements.

    Science.gov (United States)

    Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A

    2009-11-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var

  13. Silencing of the CaCP Gene Delays Salt- and Osmotic-Induced Leaf Senescence in Capsicum annuum L.

    Directory of Open Access Journals (Sweden)

    Huai-Juan Xiao

    2014-05-01

    Full Text Available Cysteine proteinases have been known to participate in developmental processes and in response to stress in plants. Our present research reported that a novel CP gene, CaCP, was involved in leaf senescence in pepper (Capsicum annuum L.. The full-length CaCP cDNA is comprised of 1316 bp, contains 1044 nucleotides in open reading frame (ORF, and encodes a 347 amino acid protein. The deduced protein belongs to the papain-like cysteine proteases (CPs superfamily, containing a highly conserved ERFNIN motif, a GCNGG motif and a conserved catalytic triad. This protein localized to the vacuole of plant cells. Real-time quantitative PCR analysis revealed that the expression level of CaCP gene was dramatically higher in leaves and flowers than that in roots, stems and fruits. Moreover, CaCP transcripts were induced upon during leaf senescence. CaCP expression was upregulated by plant hormones, especially salicylic acid. CaCP was also significantly induced by abiotic and biotic stress treatments, including high salinity, mannitol and Phytophthora capsici. Loss of function of CaCP using the virus-induced gene-silencing technique in pepper plants led to enhanced tolerance to salt- and osmotic-induced stress. Taken together, these results suggest that CaCP is a senescence-associated gene, which is involved in developmental senescence and regulates salt- and osmotic-induced leaf senescence in pepper.

  14. Silencing of the CaCP Gene Delays Salt- and Osmotic-Induced Leaf Senescence in Capsicum annuum L.

    Science.gov (United States)

    Xiao, Huai-Juan; Yin, Yan-Xu; Chai, Wei-Guo; Gong, Zhen-Hui

    2014-01-01

    Cysteine proteinases have been known to participate in developmental processes and in response to stress in plants. Our present research reported that a novel CP gene, CaCP, was involved in leaf senescence in pepper (Capsicum annuum L.). The full-length CaCP cDNA is comprised of 1316 bp, contains 1044 nucleotides in open reading frame (ORF), and encodes a 347 amino acid protein. The deduced protein belongs to the papain-like cysteine proteases (CPs) superfamily, containing a highly conserved ERFNIN motif, a GCNGG motif and a conserved catalytic triad. This protein localized to the vacuole of plant cells. Real-time quantitative PCR analysis revealed that the expression level of CaCP gene was dramatically higher in leaves and flowers than that in roots, stems and fruits. Moreover, CaCP transcripts were induced upon during leaf senescence. CaCP expression was upregulated by plant hormones, especially salicylic acid. CaCP was also significantly induced by abiotic and biotic stress treatments, including high salinity, mannitol and Phytophthora capsici. Loss of function of CaCP using the virus-induced gene-silencing technique in pepper plants led to enhanced tolerance to salt- and osmotic-induced stress. Taken together, these results suggest that CaCP is a senescence-associated gene, which is involved in developmental senescence and regulates salt- and osmotic-induced leaf senescence in pepper. PMID:24823878

  15. Silencing abnormal wing disc gene of the Asian citrus psyllid, Diaphorina citri disrupts adult wing development and increases nymph mortality.

    Directory of Open Access Journals (Sweden)

    Ibrahim El-Shesheny

    Full Text Available Huanglongbing (HLB causes considerable economic losses to citrus industries worldwide. Its management depends on controlling of the Asian citrus Psyllid (ACP, the vector of the bacterium, Candidatus Liberibacter asiaticus (CLas, the causal agent of HLB. Silencing genes by RNA interference (RNAi is a promising tool to explore gene functions as well as control pests. In the current study, abnormal wing disc (awd gene associated with wing development in insects is used to interfere with the flight of psyllids. Our study showed that transcription of awd is development-dependent and the highest level was found in the last instar (5(th of the nymphal stage. Micro-application (topical application of dsRNA to 5(th instar of nymphs caused significant nymphal mortality and adult wing-malformation. These adverse effects in ACP were positively correlated with the amounts of dsRNA used. A qRT-PCR analysis confirmed the dsRNA-mediated transcriptional down-regulation of the awd gene. Significant down-regulation was required to induce a wing-malformed phenotype. No effect was found when dsRNA-gfp was used, indicating the specific effect of dsRNA-awd. Our findings suggest a role for awd in ACP wing development and metamorphosis. awd could serve as a potential target for insect management either via direct application of dsRNA or by producing transgenic plants expressing dsRNA-awd. These strategies will help to mitigate HLB by controlling ACP.

  16. A new piece of the Shigella Pathogenicity puzzle: spermidine accumulation by silencing of the speG gene [corrected].

    Directory of Open Access Journals (Sweden)

    Marialuisa Barbagallo

    Full Text Available The genome of Shigella, a gram negative bacterium which is the causative agent of bacillary dysentery, shares strong homologies with that of its commensal ancestor, Escherichia coli. The acquisition, by lateral gene transfer, of a large plasmid carrying virulence determinants has been a crucial event in the evolution towards the pathogenic lifestyle and has been paralleled by the occurrence of mutations affecting genes, which negatively interfere with the expression of virulence factors. In this context, we have analysed to what extent the presence of the plasmid-encoded virF gene, the major activator of the Shigella regulon for invasive phenotype, has modified the transcriptional profile of E. coli. Combining results from transcriptome assays and comparative genome analyses we show that in E. coli VirF, besides being able to up-regulate several chromosomal genes, which potentially influence bacterial fitness within the host, also activates genes which have been lost by Shigella. We have focused our attention on the speG gene, which encodes spermidine acetyltransferase, an enzyme catalysing the conversion of spermidine into the physiologically inert acetylspermidine, since recent evidence stresses the involvement of polyamines in microbial pathogenesis. Through identification of diverse mutations, which prevent expression of a functional SpeG protein, we show that the speG gene has been silenced by convergent evolution and that its inactivation causes the marked increase of intracellular spermidine in all Shigella spp. This enhances the survival of Shigella under oxidative stress and allows it to better face the adverse conditions it encounters inside macrophage. This is supported by the outcome of infection assays performed in mouse peritoneal macrophages and of a competitive-infection assay on J774 macrophage cell culture. Our observations fully support the pathoadaptive nature of speG inactivation in Shigella and reveal that the accumulation

  17. Enhancement of antiproliferative activity of interferons by RNA interference-mediated silencing of SOCS gene expression in tumor cells.

    Science.gov (United States)

    Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2008-08-01

    The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.

  18. Identification of an attenuated barley stripe mosaic virus for the virus-induced gene silencing of pathogenesis-related wheat genes.

    Science.gov (United States)

    Buhrow, Leann M; Clark, Shawn M; Loewen, Michele C

    2016-01-01

    Virus-induced gene silencing (VIGS) has become an emerging technology for the rapid, efficient functional genomic screening of monocot and dicot species. The barley stripe mosaic virus (BSMV) has been described as an effective VIGS vehicle for the evaluation of genes involved in wheat and barley phytopathogenesis; however, these studies have been obscured by BSMV-induced phenotypes and defense responses. The utility of BSMV VIGS may be improved using a BSMV genetic background which is more tolerable to the host plant especially upon secondary infection of highly aggressive, necrotrophic pathogens such as Fusarium graminearum. BSMV-induced VIGS in Triticum aestivum (bread wheat) cv. 'Fielder' was assessed for the study of wheat genes putatively related to Fusarium Head Blight (FHB), the necrotrophism of wheat and other cereals by F. graminearum. Due to the lack of 'Fielder' spike viability and increased accumulation of Fusarium-derived deoxynivalenol contamination upon co-infection of BSMV and FHB, an attenuated BSMV construct was generated by the addition of a glycine-rich, C-terminal peptide to the BSMV γ b protein. This attenuated BSMV effectively silenced target wheat genes while limiting disease severity, deoxynivalenol contamination, and yield loss upon Fusarium co-infection compared to the original BSMV construct. The attenuated BSMV-infected tissue exhibited reduced abscisic, jasmonic, and salicylic acid defense phytohormone accumulation upon secondary Fusarium infection. Finally, the attenuated BSMV was used to investigate the role of the salicylic acid-responsive pathogenesis-related 1 in response to FHB. The use of an attenuated BSMV may be advantageous in characterizing wheat genes involved in phytopathogenesis, including Fusarium necrotrophism, where minimal viral background effects on defense are required. Additionally, the attenuated BSMV elicits reduced defense hormone accumulation, suggesting that this genotype may have applications for the

  19. Grape seed proanthocyanidins reactivate silenced tumor suppressor genes in human skin cancer cells by targeting epigenetic regulators

    International Nuclear Information System (INIS)

    Vaid, Mudit; Prasad, Ram; Singh, Tripti; Jones, Virginia; Katiyar, Santosh K.

    2012-01-01

    Grape seed proanthocyanidins (GSPs) have been shown to have anti-skin carcinogenic effects in in vitro and in vivo models. However, the precise epigenetic molecular mechanisms remain unexplored. This study was designed to investigate whether GSPs reactivate silenced tumor suppressor genes following epigenetic modifications in skin cancer cells. For this purpose, A431 and SCC13 human squamous cell carcinoma cell lines were used as in vitro models. The effects of GSPs on DNA methylation, histone modifications and tumor suppressor gene expressions were studied in these cell lines using enzyme activity assays, western blotting, dot-blot analysis and real-time polymerase chain reaction (RT-PCR). We found that treatment of A431 and SCC13 cells with GSPs decreased the levels of: (i) global DNA methylation, (ii) 5-methylcytosine, (iii) DNA methyltransferase (DNMT) activity and (iv) messenger RNA (mRNA) and protein levels of DNMT1, DNMT3a and DNMT3b in these cells. Similar effects were noted when these cancer cells were treated identically with 5-aza-2′-deoxycytidine, an inhibitor of DNA methylation. GSPs decreased histone deacetylase activity, increased levels of acetylated lysines 9 and 14 on histone H3 (H3-Lys 9 and 14) and acetylated lysines 5, 12 and 16 on histone H4, and reduced the levels of methylated H3-Lys 9. Further, GSP treatment resulted in re-expression of the mRNA and proteins of silenced tumor suppressor genes, RASSF1A, p16 INK4a and Cip1/p21. Together, this study provides a new insight into the epigenetic mechanisms of GSPs and may have significant implications for epigenetic therapy in the treatment/prevention of skin cancers in humans. -- Highlights: ►Epigenetic modulations have been shown to have a role in cancer risk. ►Proanthocyanidins decrease the levels of DNA methylation and histone deacetylation. ►Proanthocyanidins inhibit histone deacetylase activity in skin cancer cells. ►Proanthocyanidins reactivate tumor suppressor genes in skin

  20. Identifying genes that mediate anthracyline toxicity in immune cells

    Directory of Open Access Journals (Sweden)

    Amber eFrick

    2015-04-01

    Full Text Available The role of the immune system in response to chemotherapeutic agents remains elusive. The interpatient variability observed in immune and chemotherapeutic cytotoxic responses is likely, at least in part, due to complex genetic differences. Through the use of a panel of genetically diverse mouse inbred strains, we developed a drug screening platform aimed at identifying genes underlying these chemotherapeutic cytotoxic effects on immune cells. Using genome-wide association studies (GWAS, we identified four genome-wide significant quantitative trait loci (QTL that contributed to the sensitivity of doxorubicin and idarubicin in immune cells. Of particular interest, a locus on chromosome 16 was significantly associated with cell viability following idarubicin administration (p = 5.01x10-8. Within this QTL lies App, which encodes amyloid beta precursor protein. Comparison of dose-response curves verified that T-cells in App knockout mice were more sensitive to idarubicin than those of C57BL/6J control mice (p < 0.05.In conclusion, the cellular screening approach coupled with GWAS led to the identification and subsequent validation of a gene involved in T-cell viability after idarubicin treatment. Previous studies have suggested a role for App in in vitro and in vivo cytotoxicity to anticancer agents; the overexpression of App enhances resistance, while the knockdown of this gene is deleterious to cell viability. Thus, further investigations should include performing mechanistic studies, validating additional genes from the GWAS, including Ppfia1 and Ppfibp1, and ultimately translating the findings to in vivo and human studies.

  1. Characterization of white shrimp Litopenaeus vannamei integrin β and its role in immunomodulation by dsRNA-mediated gene silencing.

    Science.gov (United States)

    Lin, Yong-Chin; Chen, Jiann-Chu; Chen, Yu-Yuan; Liu, Chun-Hung; Cheng, Winton; Hsu, Chih-Hung; Tsui, Wen-Ching

    2013-06-01

    The full sequence of white shrimp Litopenaeus vannamei integrin β (LV-B) is 2879bp which encodes 787 amino acids (aa) of the open reading frame (ORF). The mature protein (764 aa) contains (1) an extracellular domain (ED) of 692 aa, (2) a transmembrane domain (TD) of 23 aa, and (3) a cytoplasmic domain (CD) of 49 aa. The cloned LV-B grouped together with crayfish Pacifastacus leniusculus integrin β (PL-B1), but was far away from vertebrate integrin β1, β3, β5, β6, β7, and β8, and another L. vannamei integrin β (LV). A Southern blot analysis indicated that the cloned LV-B was a single copy of genomic DNA. LV-B mRNA was expressed in all tissues, and was highly expressed in haemocytes. LV-B was downregulated in shrimp 24 and 96h after having received white spot syndrome virus (WSSV). LV-B expression by haemocytes of shrimp was higher in the postmoult (A and B) stage, and lower in the premoult (D2/D3) stage. LV-B expression was significantly higher by shrimp reared in 2.5‰ and 5‰ salinities. Shrimp injected with integrin β dsRNA showed gene silencing of integrin β after 36h. LV-B-silenced shrimp showed decreased hyaline cells (HCs), granular cells (GCs, including semi-granular cells), the total haemocyte count (THC), respiratory bursts (RBs), and lysozyme activity, but showed increased RB/HC, superoxide dismutase (SOD) activity/HC, and the phenoloxidase (PO) activity/GC. LV-B-silenced shrimp showed upregulated expressions of lipopolysaccharide- and β-glucan-binding protein (LGBP), peroxinectin (PX), prophenoloxidase I (proPO I), proPO II, proPO-activating enzyme (ppA), α2-macroglobulin (α2-M), cytMnSOD, mtMnSOD, and heat shock protein 70 (HSP70). It was concluded that integrin β plays important roles in proPO activation, phagocytosis, and the antioxidant system for immunomodulation in shrimp. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Structural basis of transcriptional gene silencing mediated by Arabidopsis MOM1.

    Directory of Open Access Journals (Sweden)

    Taisuke Nishimura

    2012-02-01

    Full Text Available Shifts between epigenetic states of transcriptional activity are typically correlated with changes in epigenetic marks. However, exceptions to this rule suggest the existence of additional, as yet uncharacterized, layers of epigenetic regulation. MOM1, a protein of 2,001 amino acids that acts as a transcriptional silencer, represents such an exception. Here we define the 82 amino acid domain called CMM2 (Conserved MOM1 Motif 2 as a minimal MOM1 fragment capable of transcriptional regulation. As determined by X-ray crystallography, this motif folds into an unusual hendecad-based coiled-coil. Structure-based mutagenesis followed by transgenic complementation tests in plants demonstrate that CMM2 and its dimerization are effective for transcriptional suppression at chromosomal loci co-regulated by MOM1 and the siRNA pathway but not at loci controlled by MOM1 in an siRNA-independent fashion. These results reveal a surprising separation of epigenetic activities that enable the single, large MOM1 protein to coordinate cooperating mechanisms of epigenetic regulation.

  3. Structural basis of transcriptional gene silencing mediated by Arabidopsis MOM1.

    Science.gov (United States)

    Nishimura, Taisuke; Molinard, Guillaume; Petty, Tom J; Broger, Larissa; Gabus, Caroline; Halazonetis, Thanos D; Thore, Stéphane; Paszkowski, Jerzy

    2012-02-01

    Shifts between epigenetic states of transcriptional activity are typically correlated with changes in epigenetic marks. However, exceptions to this rule suggest the existence of additional, as yet uncharacterized, layers of epigenetic regulation. MOM1, a protein of 2,001 amino acids that acts as a transcriptional silencer, represents such an exception. Here we define the 82 amino acid domain called CMM2 (Conserved MOM1 Motif 2) as a minimal MOM1 fragment capable of transcriptional regulation. As determined by X-ray crystallography, this motif folds into an unusual hendecad-based coiled-coil. Structure-based mutagenesis followed by transgenic complementation tests in plants demonstrate that CMM2 and its dimerization are effective for transcriptional suppression at chromosomal loci co-regulated by MOM1 and the siRNA pathway but not at loci controlled by MOM1 in an siRNA-independent fashion. These results reveal a surprising separation of epigenetic activities that enable the single, large MOM1 protein to coordinate cooperating mechanisms of epigenetic regulation.

  4. Silencing of meiosis-critical genes for engineering male sterility in plants

    Science.gov (United States)

    Engineering sterile traits in plants through the tissue-specific expression of a cytotoxic gene provides an effective way for containing transgene flow; however, the microbial origin of cytotoxic genes has raised concerns. In an attempt to develop a safe alternative, we have chosen the meiosis-crit...

  5. Gene Silencing Triggers Polycomb Repressive Complex 2 Recruitment to CpG Islands Genome Wide

    DEFF Research Database (Denmark)

    Riising, Eva Madi; Vacher-Comet, Itys; Leblanc, Benjamin Olivier

    2014-01-01

    -wide ectopic PRC2 recruitment to endogenous PcG target genes found in other tissues. PRC2 binding analysis shows that it is restricted to nucleosome-free CpG islands (CGIs) of untranscribed genes. Our results show that it is the transcriptional state that governs PRC2 binding, and we propose that it binds...

  6. Double silencing of relevant genes suggests the existence of the direct link between DNA replication/repair and central carbon metabolism in human fibroblasts.

    Science.gov (United States)

    Wieczorek, Aneta; Fornalewicz, Karolina; Mocarski, Łukasz; Łyżeń, Robert; Węgrzyn, Grzegorz

    2018-04-15

    Genetic evidence for a link between DNA replication and glycolysis has been demonstrated a decade ago in Bacillus subtilis, where temperature-sensitive mutations in genes coding for replication proteins could be suppressed by mutations in genes of glycolytic enzymes. Then, a strong influence of dysfunctions of particular enzymes from the central carbon metabolism (CCM) on DNA replication and repair in Escherichia coli was reported. Therefore, we asked if such a link occurs only in bacteria or it is a more general phenomenon. Here, we demonstrate that effects of silencing (provoked by siRNA) of expression of genes coding for proteins involved in DNA replication and repair (primase, DNA polymerase ι, ligase IV, and topoisomerase IIIβ) on these processes (less efficient entry into the S phase of the cell cycle and decreased level of DNA synthesis) could be suppressed by silencing of specific genes of enzymes from CMM. Silencing of other pairs of replication/repair and CMM genes resulted in enhancement of the negative effects of lower expression levels of replication/repair genes. We suggest that these results may be proposed as a genetic evidence for the link between DNA replication/repair and CMM in human cells, indicating that it is a common biological phenomenon, occurring from bacteria to humans. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

    2012-01-01

    Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

  8. Tospovirus : induction and suppression of RNA silencing

    NARCIS (Netherlands)

    Hedil, Marcio

    2016-01-01

    While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,

  9. Gene Silencing in Skin After Deposition of Self-Delivery siRNA With a Motorized Microneedle Array Device

    Directory of Open Access Journals (Sweden)

    Robyn P Hickerson

    2013-01-01

    Full Text Available Despite the development of potent siRNAs that effectively target genes responsible for skin disorders, translation to the clinic has been hampered by inefficient delivery through the stratum corneum barrier and into the live cells of the epidermis. Although hypodermic needles can be used to transport siRNA through the stratum corneum, this approach is limited by pain caused by the injection and the small volume of tissue that can be accessed by each injection. The use of microneedle arrays is a less painful method for siRNA delivery, but restricted payload capacity limits this approach to highly potent molecules. To address these challenges, a commercially available motorized microneedle array skin delivery device was evaluated. This device combines the positive elements of both hypodermic needles and microneedle array technologies with little or no pain to the patient. Application of fluorescently tagged self-delivery (sd-siRNA to both human and murine skin resulted in distribution throughout the treated skin. In addition, efficient silencing (78% average reduction of reporter gene expression was achieved in a transgenic fluorescent reporter mouse skin model. These results indicate that this device effectively delivers functional sd-siRNA with an efficiency that predicts successful clinical translation.

  10. Social isolation stress induces ATF-7 phosphorylation and impairs silencing of the 5-HT 5B receptor gene

    Science.gov (United States)

    Maekawa, Toshio; Kim, Seungjoon; Nakai, Daisuke; Makino, Chieko; Takagi, Tsuyoshi; Ogura, Hiroo; Yamada, Kazuyuki; Chatton, Bruno; Ishii, Shunsuke

    2010-01-01

    Many symptoms induced by isolation rearing of rodents may be relevant to neuropsychiatric disorders, including depression. However, identities of transcription factors that regulate gene expression in response to chronic social isolation stress remain elusive. The transcription factor ATF-7 is structurally related to ATF-2, which is activated by various stresses, including inflammatory cytokines. Here, we report that Atf-7-deficient mice exhibit abnormal behaviours and increased 5-HT receptor 5B (Htr5b) mRNA levels in the dorsal raphe nuclei. ATF-7 silences the transcription of Htr5B by directly binding to its 5′-regulatory region, and mediates histone H3-K9 trimethylation via interaction with the ESET histone methyltransferase. Isolation-reared wild-type (WT) mice exhibit abnormal behaviours that resemble those of Atf-7-deficient mice. Upon social isolation stress, ATF-7 in the dorsal raphe nucleus is phosphorylated via p38 and is released from the Htr5b promoter, leading to the upregulation of Htr5b. Thus, ATF-7 may have a critical role in gene expression induced by social isolation stress. PMID:19893493

  11. Telomerase Reverse Transcriptase Deficiency Prevents Neointima Formation Through Chromatin Silencing of E2F1 Target Genes.

    Science.gov (United States)

    Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis

    2017-02-01

    Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.

  12. Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning

    2016-04-22

    The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatin immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.

  13. Chromatin status of apoptosis genes correlates with sensitivity to chemo-, immune- and radiation therapy in colorectal cancer cell lines.

    Science.gov (United States)

    Benard, Anne; Janssen, Connie M; van den Elsen, Peter J; van Eggermond, Marja C J A; Hoon, Dave S B; van de Velde, Cornelis J H; Kuppen, Peter J K

    2014-12-01

    The apoptosis pathway of programmed cell death is frequently deregulated in cancer. An intact apoptosis pathway is required for proper response to anti-cancer treatment. We investigated the chromatin status of key apoptosis genes in the apoptosis pathway in colorectal cancer cell lines in relation to apoptosis induced by chemo-, immune- or radiation therapy. Using chromatin immunoprecipitation (ChIP), we measured the presence of transcription-activating histone modifications H3Ac and H3K4me3 and silencing modifications H3K9me3 and H3K27me3 at the gene promoter regions of key apoptosis genes Bax, Bcl2, Caspase-9, Fas (CD95) and p53. Cell lines DLD1, SW620, Colo320, Caco2, Lovo and HT29 were treated with cisplatin, anti-Fas or radiation. The apoptotic response was measured by flow cytometry using propidium iodide and annexin V-FITC. The chromatin status of the apoptosis genes reflected the activation status of the intrinsic (Bax, Bcl2, Caspase-9 and p53) and extrinsic (Fas) pathways. An active intrinsic apoptotic pathway corresponded to sensitivity to cisplatin and radiation treatment of cell lines DLD1, SW620 and Colo320. An active Fas promoter corresponded to an active extrinsic apoptotic pathway in cell line DLD1. mRNA expression data correlated with the chromatin status of the apoptosis genes as measured by ChIP. In conclusion, the results presented in this study indicate that the balance between activating and silencing histone modifications, reflecting the chromatin status of apoptosis genes, can be used to predict the response of tumor cells to different anti-cancer therapies and could provide a novel target to sensitize tumors to obtain adequate treatment responses.

  14. Manipulation of saponin biosynthesis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean.

    Science.gov (United States)

    Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao

    2011-10-01

    Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.

  15. Global methylation silencing of clustered proto-cadherin genes in cervical cancer: serving as diagnostic markers comparable to HPV

    International Nuclear Information System (INIS)

    Wang, Kai-Hung; Lin, Cuei-Jyuan; Liu, Chou-Jen; Liu, Dai-Wei; Huang, Rui-Lan; Ding, Dah-Ching; Weng, Ching-Feng; Chu, Tang-Yuan

    2015-01-01

    Epigenetic remodeling of cell adhesion genes is a common phenomenon in cancer invasion. This study aims to investigate global methylation of cell adhesion genes in cervical carcinogenesis and to apply them in early detection of cancer from cervical scraping. Genome-wide methylation array was performed on an investigation cohort, including 16 cervical intraepithelial neoplasia 3 (CIN3) and 20 cervical cancers (CA) versus 12 each of normal, inflammation and CIN1 as controls. Twelve members of clustered proto-cadherin (PCDH) genes were collectively methylated and silenced, which were validated in cancer cells of the cervix, endometrium, liver, head and neck, breast, and lung. In an independent cohort including 107 controls, 66 CIN1, 85 CIN2/3, and 38 CA, methylated PCDHA4 and PCDHA13 were detected in 2.8%, 24.2%, 52.9%, and 84.2% (P < 10 −25 ), and 2.8%, 24.2%, 50.6%, and 94.7% (P < 10 −29 ), respectively. In diagnosis of CIN2 or more severe lesion of the cervix, a combination test of methylated PCDHA4 or PCDHA13 from cervical scraping had a sensitivity, specificity, positive predictive value, and negative predictive value of 74.8%, 80.3%, 73%, and 81.8%, respectively. Testing of this combination from cervical scraping is equally sensitive but more specific than human papillomavirus (HPV) test in diagnosis of CIN2 or more severe lesions. The study disclosed a collective methylation of PCDH genes in cancer of cervix and other sites. At least two of them can be promising diagnostic markers for cervical cancer noninferior to HPV

  16. Effects of RNAi-mediated cathepsin L gene silencing on bionomics ...

    African Journals Online (AJOL)

    USER

    2010-08-02

    Aug 2, 2010 ... melanoma, gastric cancer, and pancreatic cancer. The main function of ... successfully applied in various areas of biological research, and its main ... molecule, the corresponding target gene mRNA is cut under RNA-induced ...

  17. Gene Expression by PBMC in Primary Sclerosing Cholangitis: Evidence for Dysregulation of Immune Mediated Genes

    Directory of Open Access Journals (Sweden)

    Christopher A. Aoki

    2006-01-01

    Full Text Available Primary sclerosing cholangitis (PSC is a chronic disease of the bile ducts characterized by an inflammatory infiltrate and obliterative fibrosis. The precise role of the immune system in the pathogenesis of PSC remains unknown. We used RNA microarray analysis to identify immune-related genes and pathways that are differentially expressed in PSC. Messenger RNA (mRNA from peripheral blood mononuclear cells (PBMC was isolated from both patients with PSC and age and sex matched healthy controls. Samples from 5 PSC patients and 5 controls were analyzed by microarray and based upon rigorous statistical analysis of the data, relevant genes were chosen for confirmation by RT-PCR in 10 PSC patients and 10 controls. Using unsupervised hierarchical clustering, gene expression in PSC was statistically different from our control population. Interestingly, genes within the IL-2 receptor beta, IL-6 and MAP Kinase pathways were found to be differently expressed in patients with PSC compared to controls. Further, individual genes, TNF-α induced protein 6 (TNFaip6 and membrane-spanning 4-domains, subfamily A (ms4a were found to be upregulated in PSC while similar to Mothers against decapentaplegic homolog 5 (SMAD 5 was downregulated. In conclusion, several immune-related pathways and genes were differentially expressed in PSC compared to control patients, giving further evidence that this disease is systemic and immune-mediated.

  18. Performative Silences

    DEFF Research Database (Denmark)

    Dupret, Katia

    2018-01-01

    static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...

  19. Tailoring the Immune Response via Customization of Pathogen Gene Expression.

    Science.gov (United States)

    Runco, Lisa M; Stauft, Charles B; Coleman, J Robert

    2014-01-01

    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.

  20. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

    Science.gov (United States)

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

    2016-01-01

    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

  1. Reconstruction of gene regulatory modules from RNA silencing of IFN-α modulators: experimental set-up and inference method.

    Science.gov (United States)

    Grassi, Angela; Di Camillo, Barbara; Ciccarese, Francesco; Agnusdei, Valentina; Zanovello, Paola; Amadori, Alberto; Finesso, Lorenzo; Indraccolo, Stefano; Toffolo, Gianna Maria

    2016-03-12

    Inference of gene regulation from expression data may help to unravel regulatory mechanisms involved in complex diseases or in the action of specific drugs. A challenging task for many researchers working in the field of systems biology is to build up an experiment with a limited budget and produce a dataset suitable to reconstruct putative regulatory modules worth of biological validation. Here, we focus on small-scale gene expression screens and we introduce a novel experimental set-up and a customized method of analysis to make inference on regulatory modules starting from genetic perturbation data, e.g. knockdown and overexpression data. To illustrate the utility of our strategy, it was applied to produce and analyze a dataset of quantitative real-time RT-PCR data, in which interferon-α (IFN-α) transcriptional response in endothelial cells is investigated by RNA silencing of two candidate IFN-α modulators, STAT1 and IFIH1. A putative regulatory module was reconstructed by our method, revealing an intriguing feed-forward loop, in which STAT1 regulates IFIH1 and they both negatively regulate IFNAR1. STAT1 regulation on IFNAR1 was object of experimental validation at the protein level. Detailed description of the experimental set-up and of the analysis procedure is reported, with the intent to be of inspiration for other scientists who want to realize similar experiments to reconstruct gene regulatory modules starting from perturbations of possible regulators. Application of our approach to the study of IFN-α transcriptional response modulators in endothelial cells has led to many interesting novel findings and new biological hypotheses worth of validation.

  2. Trans-specific gene silencing of acetyl-CoA carboxylase in a root-parasitic plant.

    Science.gov (United States)

    Bandaranayake, Pradeepa C G; Yoder, John I

    2013-05-01

    Parasitic species of the family Orobanchaceae are devastating agricultural pests in many parts of the world. The control of weedy Orobanchaceae spp. is challenging, particularly due to the highly coordinated life cycles of the parasite and host plants. Although host genetic resistance often provides the foundation of plant pathogen management, few genes that confer resistance to root parasites have been identified and incorporated into crop species. Members of the family Orobanchaceae acquire water, nutrients, macromolecules, and oligonucleotides from host plants through haustoria that connect parasite and host plant roots. We are evaluating a resistance strategy based on using interfering RNA (RNAi) that is made in the host but inhibitory in the parasite as a parasite-derived oligonucleotide toxin. Sequences from the cytosolic acetyl-CoA carboxylase (ACCase) gene from Triphysaria versicolor were cloned in hairpin conformation and introduced into Medicago truncatula roots by Agrobacterium rhizogenes transformation. Transgenic roots were recovered for four of five ACCase constructions and infected with T. versicolor against parasitic weeds. In all cases, Triphysaria root viability was reduced up to 80% when parasitizing a host root bearing the hairpin ACCase. Triphysaria root growth was recovered by exogenous application of malonate. Reverse-transcriptase polymerase chain reaction (RT-PCR) showed that ACCase transcript levels were dramatically decreased in Triphysaria spp. parasitizing transgenic Medicago roots. Northern blot analysis identified a 21-nucleotide, ACCase-specific RNA in transgenic M. truncatula and in T. versicolor attached to them. One hairpin ACCase construction was lethal to Medicago spp. unless grown in media supplemented with malonate. Quantitative RT-PCR showed that the Medicago ACCase was inhibited by the Triphysaria ACCase RNAi. This work shows that ACCase is an effective target for inactivation in parasitic plants by trans-specific gene

  3. Development of male sterility by silencing Bcp1 gene of Arabidopsis ...

    African Journals Online (AJOL)

    Transgenic plants were phenotypically indistinguishable from nontransgenic plants and by crossing with non-transgenic fertile pollens successful seed set was observed. The Bcp1 gene was also amplified from chilies, tomato and brassica. The present study resulted in developing male sterile A. thaliana (Eco. Columbia) ...

  4. Advances in highly specific plant gene silencing by artificial miRNAs

    African Journals Online (AJOL)

    SAM

    2014-05-07

    May 7, 2014 ... transcribed sense and antisense RNAs (Wesley et al.,. 2001; Chuang and Meyerowitz, 2000). MicroRNAs (miRNA), which negatively regulate gene expression, are endogenous single-stranded small RNA molecules 21 to 23 nucleotides long. They were first dis- covered in the Victor Ambros Laboratory ...

  5. Antisense silencing of the creA gene in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Bautista, L. F.; Aleksenko, Alexei Y.; Hentzer, Morten

    2000-01-01

    Antisense expression of a portion of the gene encoding the major carbon catabolite repressor CREA in Aspergillus nidulans resulted in a substantial increase in the levels of glucose-repressible enzymes, both endogenous and heterologous, in the presence of glucose. The derepression effect was appr...

  6. Targeted Gene-Silencing Reveals the Functional Significance of Myocardin Signaling in the Failing Heart

    Science.gov (United States)

    Torrado, Mario; Iglesias, Raquel; Centeno, Alberto; López, Eduardo; Mikhailov, Alexander T.

    2011-01-01

    Background Myocardin (MYOCD), a potent transcriptional coactivator of smooth muscle (SM) and cardiac genes, is upregulated in failing myocardium in animal models and human end-stage heart failure (HF). However, the molecular and functional consequences of myocd upregulation in HF are still unclear. Methodology/Principal Findings The goal of the present study was to investigate if targeted inhibition of upregulated expression of myocd could influence failing heart gene expression and function. To this end, we used the doxorubicin (Dox)-induced diastolic HF (DHF) model in neonatal piglets, in which, as we show, not only myocd but also myocd-dependent SM-marker genes are highly activated in failing left ventricular (LV) myocardium. In this model, intra-myocardial delivery of short-hairpin RNAs, designed to target myocd variants expressed in porcine heart, leads on day 2 post-delivery to: (1) a decrease in the activated expression of myocd and myocd-dependent SM-marker genes in failing myocardium to levels seen in healthy control animals, (2) amelioration of impaired diastolic dysfunction, and (3) higher survival rates of DHF piglets. The posterior restoration of elevated myocd expression (on day 7 post-delivery) led to overexpression of myocd-dependent SM-marker genes in failing LV-myocardium that was associated with a return to altered diastolic function. Conclusions/Significance These data provide the first evidence that a moderate inhibition (e.g., normalization) of the activated MYOCD signaling in the diseased heart may be promising from a therapeutic point of view. PMID:22028870

  7. Targeted gene-silencing reveals the functional significance of myocardin signaling in the failing heart.

    Directory of Open Access Journals (Sweden)

    Mario Torrado

    Full Text Available BACKGROUND: Myocardin (MYOCD, a potent transcriptional coactivator of smooth muscle (SM and cardiac genes, is upregulated in failing myocardium in animal models and human end-stage heart failure (HF. However, the molecular and functional consequences of myocd upregulation in HF are still unclear. METHODOLOGY/PRINCIPAL FINDINGS: The goal of the present study was to investigate if targeted inhibition of upregulated expression of myocd could influence failing heart gene expression and function. To this end, we used the doxorubicin (Dox-induced diastolic HF (DHF model in neonatal piglets, in which, as we show, not only myocd but also myocd-dependent SM-marker genes are highly activated in failing left ventricular (LV myocardium. In this model, intra-myocardial delivery of short-hairpin RNAs, designed to target myocd variants expressed in porcine heart, leads on day 2 post-delivery to: (1 a decrease in the activated expression of myocd and myocd-dependent SM-marker genes in failing myocardium to levels seen in healthy control animals, (2 amelioration of impaired diastolic dysfunction, and (3 higher survival rates of DHF piglets. The posterior restoration of elevated myocd expression (on day 7 post-delivery led to overexpression of myocd-dependent SM-marker genes in failing LV-myocardium that was associated with a return to altered diastolic function. CONCLUSIONS/SIGNIFICANCE: These data provide the first evidence that a moderate inhibition (e.g., normalization of the activated MYOCD signaling in the diseased heart may be promising from a therapeutic point of view.

  8. Growth inhibition of head and neck squamous cell carcinoma cells by sgRNA targeting the cyclin D1 mRNA based on TRUE gene silencing.

    Directory of Open Access Journals (Sweden)

    Satoshi Iizuka

    Full Text Available Head and neck squamous cell carcinoma (HNSCC exhibits increased expression of cyclin D1 (CCND1. Previous studies have shown a correlation between poor prognosis of HNSCC and cyclin D1 overexpression. tRNase ZL-utilizing efficacious gene silencing (TRUE gene silencing is one of the RNA-mediated gene expression control technologies that have therapeutic potential. This technology is based on a unique enzymatic property of mammalian tRNase ZL, which is that it can cleave any target RNA at any desired site by recognizing a pre-tRNA-like complex formed between the target RNA and an artificial small guide RNA (sgRNA. In this study, we designed several sgRNAs targeting human cyclin D1 mRNA to examine growth inhibition of HNSCC cells. Transfection of certain sgRNAs decreased levels of cyclin D1 mRNA and protein in HSC-2 and HSC-3 cells, and also inhibited their proliferation. The combination of these sgRNAs and cisplatin showed more than additive inhibition of cancer cell growth. These findings demonstrate that TRUE gene silencing of cyclin D1 leads to inhibition of the growth of HNSCC cells and suggest that these sgRNAs alone or combined with cisplatin may be a useful new therapy for HNSCCs.

  9. RNA interference silences Microplitis demolitor bracovirus genes and implicates glc1.8 in disruption of adhesion in infected host cells

    International Nuclear Information System (INIS)

    Beck, Markus; Strand, Michael R.

    2003-01-01

    The family Polydnaviridae consists of ds-DNA viruses that are symbiotically associated with certain parasitoid wasps. PDVs are transmitted vertically but also are injected by wasps into hosts where they cause several physiological alterations including immunosuppression. The PDV genes responsible for mediating immunosuppression and other host alterations remain poorly characterized in large measure because viral mutants cannot be produced to study gene function. Here we report the use of RNA interference (RNAi) to specifically silence the glc1.8 and egf1.0 genes from Microplitis demolitor bracovirus (MdBV) in High Five cells derived from the lepidopteran Trichoplusia ni. Dose-response studies indicated that MdBV infects High Five cells and blocks the ability of these cells to adhere to culture plates. This response was very similar to what occurs in two classes of hemocytes, granular cells, and plasmatocytes, after infection by MdBV. Screening of monoclonal antibody (mAb) markers that distinguish different classes of lepidopteran hemocytes indicated that High Five cells cross-react with three mAbs that recognize granular cells from T. ni. Double-stranded RNA (dsRNA) complementary to glc1.8 specifically silenced glc1.8 expression and rescued the adhesive phenotype of High Five cells. Reciprocally, dsRNA complementary to egf1.0 silenced egf1.0 expression but had no effect on adhesion. The simplicity and potency of RNAi could be extremely useful for analysis of other PDV genes

  10. Identification of distal silencing elements in the murine interferon-A11 gene promoter.

    Science.gov (United States)

    Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G

    1996-08-01

    The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.

  11. Post-transcriptional gene silencing is involved in resistance of transgenic papayas to Papaya Ringspot Virus

    Czech Academy of Sciences Publication Activity Database

    Ruanjan, P.; Kertbundit, Sunee; Juříček, Miloslav

    2007-01-01

    Roč. 51, č. 3 (2007), s. 517-520 ISSN 0006-3134 Grant - others:BIOTEC, NASDA(TH) BT-B-06-PG-14-4503 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : Carica papaya * reverse transcription PCR * COAT PROTEIN GENE Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.259, year: 2007

  12. Silencing of IFN-stimulated gene transcription is regulated by histone H1 and its chaperone TAF-I.

    Science.gov (United States)

    Kadota, Shinichi; Nagata, Kyosuke

    2014-07-01

    Chromatin structure and its alteration play critical roles in the regulation of transcription. However, the transcriptional silencing mechanism with regard to the chromatin structure at an unstimulated state of the interferon (IFN)-stimulated gene (ISG) remains unclear. Here we investigated the role of template activating factor-I (TAF-I, also known as SET) in ISG transcription. Knockdown (KD) of TAF-I increased ISG transcript and simultaneously reduced the histone H1 level on the ISG promoters during the early stages of transcription after IFN stimulation from the unstimulated state. The transcription factor levels on the ISG promoters were increased in TAF-I KD cells only during the early stages of transcription. Furthermore, histone H1 KD also increased ISG transcript. TAF-I and histone H1 double KD did not show the additive effect in ISG transcription, suggesting that TAF-I and histone H1 may act on the same regulatory pathway to control ISG transcription. In addition, TAF-I KD and histone H1 KD affected the chromatin structure near the ISG promoters. On the basis of these findings, we propose that TAF-I and its target histone H1 are key regulators of the chromatin structure at the ISG promoter to maintain the silent state of ISG transcription. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Development of Gold Nanoparticle towards Radioenhancement Therapy, Renal Clearance, siRNA Delivery and Light-Controlled Gene Silencing

    Science.gov (United States)

    Wang, Jianxin

    Gold nanoparticles (GNPs) have been widely studied and used in research for diagnostic, prophylactic or therapeutic purposes. However, they still face many technical challenges before they can be used to effectively address unmet biomedical needs. The theme of this dissertation is focused on addressing challenges of GNPs in clinical translation, and to improve their potential for application in radioenhancement therapy and siRNA delivery. We demonstrate the facile self-assembly of micellar gold nanocapsules using zwitterionic surfactants, with hydrodynamic diameters below 10 nm, which holds promise for good renal clearance to promote the excretion of GNPs in human body. We also prepared PEI- and PEG-coated GNPs and demonstrated their uptake into HeLa cells with exposure to soft X-rays (120 kVp), based on the consideration that the proximity of GNPs to nuclear DNA may be beneficial for enhancing low-energy ionizing radiotherapy. GNP-mediated siRNA delivery may be challenged by nonspecific siRNA desorption during circulation, which can cause off-target effects and immunogenicity. The use of gold nanorods (GNRs) for siRNA delivery also faces challenges like reduced dispersion stability during siRNA functionalization. We developed an effective way to load siRNA onto GNRs at high density, using oleylsulfobetaine (OSB) as an intermediate surfactant and dithiocarbamates (DTCs) as desorption-resistant anchors for siRNA. The GNR?siRNA complexes provided excellent control for laser-triggered gene silencing.

  14. Allele-specific Gene Silencing of Mutant mRNA Restores Cellular Function in Ullrich Congenital Muscular Dystrophy Fibroblasts

    Directory of Open Access Journals (Sweden)

    Satoru Noguchi

    2014-01-01

    Full Text Available Ullrich congenital muscular dystrophy (UCMD is an inherited muscle disorder characterized clinically by muscle weakness, distal joint hyperlaxity, and proximal joint contractures. Sporadic and recessive mutations in the three collagen VI genes, COL6A1, COL6A2, and COL6A3, are reported to be causative. In the sporadic forms, a heterozygous point mutation causing glycine substitution in the triple helical domain has been identified in higher rate. In this study, we examined the efficacy of siRNAs, which target point mutation site, on specific knockdown toward transcripts from mutant allele and evaluated consequent cellular phenotype of UCMD fibroblasts. We evaluated the effect of siRNAs targeted to silence-specific COL6A1 alleles in UCMD fibroblasts, where simultaneous expression of both wild-type and mutant collagen VI resulted in defective collagen localization. Addition of mutant-specific siRNAs allowed normal extracellular localization of collagen VI surrounding fibroblasts, suggesting selective inhibition of mutant collagen VI. Targeting the single-nucleotide COL6A1 c.850G>A (p.G284R mutation responsible a sporadic autosomal dominant form of UCMD can potently and selectively block expression of mutant collagen VI. These results suggest that allele-specific knockdown of the mutant mRNA can potentially be considered as a therapeutic procedure in UCMD due to COL6A1 point mutations.

  15. Transgenic Sugarcane Resistant to Sorghum mosaic virus Based on Coat Protein Gene Silencing by RNA Interference

    Directory of Open Access Journals (Sweden)

    Jinlong Guo

    2015-01-01

    Full Text Available As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV and/or Sorghum mosaic virus (SrMV, with additional differences in viral strains. RNA interference (RNAi is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms.

  16. Telomerase Inhibition by Everolimus Suppresses Smooth Muscle Cell Proliferation and Neointima Formation Through Epigenetic Gene Silencing

    Directory of Open Access Journals (Sweden)

    Jun Aono, MD, PhD

    2016-01-01

    Full Text Available Proliferation of smooth muscle cells (SMCs during neointima formation is prevented by drug-eluting stents. The replicative capacity of mammalian cells is enhanced by telomerase expression; however, the contribution of telomerase to the proliferative response underlying neointima formation and its potential role as a pharmacological target are unknown. The present study investigated the mechanisms underlying the mitogenic function of telomerase, and tested the hypothesis that everolimus, which is commonly used on drug-eluting stents, suppresses SMC proliferation by targeting telomerase. Inhibition of neointima formation by everolimus was lost in mice overexpressing telomerase reverse transcriptase (TERT, indicating that repression of telomerase confers the anti-proliferative efficacy of everolimus. Everolimus reduced TERT expression in SMC through an Ets-1-dependent inhibition of promoter activation. The inhibition of TERT-dependent SMC proliferation by everolimus occurred in the absence of telomere shortening but rather as a result of a G1→S-phase arrest. Although everolimus failed to inhibit phosphorylation of the retinoblastoma protein as the gatekeeper of S-phase entry, it potently repressed downstream target genes. Chromatin immunoprecipitation assays demonstrated that TERT induced E2F binding to S-phase gene promoters and supported histone acetylation. These effects were sensitive to inhibition by everolimus. These results characterize telomerase as a previously unrecognized target for the antiproliferative activity of everolimus, and further identify a novel mitogenic pathway in SMC that depends on the epigenetic activation of S-phase gene promoters by TERT.

  17. Nicotiana plumbaginifolia plants silenced for the ATP-binding cassette transporter gene NpPDR1 show increased susceptibility to a group of fungal and oomycete pathogens.

    Science.gov (United States)

    Bultreys, Alain; Trombik, Tomasz; Drozak, Anna; Boutry, Marc

    2009-09-01

    SUMMARY The behaviour of Nicotiana plumbaginifolia plants silenced for the ATP-binding cassette transporter gene NpPDR1 was investigated in response to fungal and oomycete infections. The importance of NpPDR1 in plant defence was demonstrated for two organs in which NpPDR1 is constitutively expressed: the roots and the petal epidermis. The roots of the plantlets of two lines silenced for NpPDR1 expression were clearly more sensitive than those of controls to the fungal pathogens Botrytis cinerea, Fusarium oxysporum sp., F. oxysporum f. sp. nicotianae, F. oxysporum f. sp. melonis and Rhizoctonia solani, as well as to the oomycete pathogen Phytophthora nicotianae race 0. The Ph gene-linked resistance of N. plumbaginifolia to P. nicotianae race 0 was totally ineffective in NpPDR1-silenced lines. In addition, the petals of the NpPDR1-silenced lines were spotted 15%-20% more rapidly by B. cinerea than were the controls. The rapid induction (after 2-4 days) of NpPDR1 expression in N. plumbaginifolia and N. tabacum mature leaves in response to pathogen presence was demonstrated for the first time with fungi and one oomycete: R. solani, F. oxysporum and P. nicotianae. With B. cinerea, such rapid expression was not observed in healthy mature leaves. NpPDR1 expression was not observed during latent infections of B. cinerea in N. plumbaginifolia and N. tabacum, but was induced when conditions facilitated B. cinerea development in leaves, such as leaf ageing or an initial root infection. This work demonstrates the increased sensitivity of NpPDR1-silenced N. plumbaginifolia plants to all of the fungal and oomycete pathogens investigated.

  18. Silencing of acidic pathogenesis-related PR-1 genes increases extracellular beta-(1 -> 3)-glucanase activity at the onset of tobacco defence reactions

    DEFF Research Database (Denmark)

    Riviere, M.P.; Marais, A.; Ponchet, M.

    2008-01-01

    silenced. Plants lacking extracellular PR-1s were more susceptible than wild-type plants to the oomycete Phytophthora parasitica but displayed unaffected systemic acquired resistance and developmental resistance to this pathogen. Treatment with salicylic acid up-regulates the PR-1g gene, encoding a basic...... protein of the PR-1 family, in PR-1-deficient tobacco, indicating that PR-1 expression may repress that of PR-1g. This shows that acidic PR-1s are dispensable for expression of salicylic acid-dependent acquired resistances against P. parasitica and may reveal a functional overlap in tobacco defence......The class 1 pathogenesis-related (PR) proteins are thought to be involved in plant defence responses, but their molecular functions are unknown. The function of PR-1 was investigated in tobacco by generating stable PR-1a-silenced lines in which other acidic PR-1 genes (PR-1b and PR-1c) were...

  19. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements

    Science.gov (United States)

    Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.

    2009-01-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of

  20. Optimisation of tomato Micro-tom regeneration and selection on glufosinate/Basta and dependency of gene silencing on transgene copy number.

    Science.gov (United States)

    Khuong, Thi Thu Huong; Crété, Patrice; Robaglia, Christophe; Caffarri, Stefano

    2013-09-01

    An efficient protocol of transformation and selection of transgenic lines of Micro-tom, a widespread model cultivar for tomato, is reported. RNA interference silencing efficiency and stability have been investigated and correlated with the number of insertions. Given its small size and ease of cultivation, the tomato (Solanum lycopersicon) cultivar Micro-tom is of widespread use as a model tomato plant. To create and screen transgenic plants, different selectable markers are commonly used. The bar marker carrying the resistance to the herbicide glufosinate/Basta, has many advantages, but it has been little utilised and with low efficiency for identification of tomato transgenic plants. Here we describe a procedure for accurate selection of transgenic Micro-tom both in vitro and in soil. Immunoblot, Southern blot and phenotypic analyses showed that 100 % of herbicide-resistant plants were transgenic. In addition, regeneration improvement has been obtained by using 2 mg/l Gibberellic acid in the shoot elongation medium; rooting optimisation on medium containing 1 mg/l IAA allowed up to 97 % of shoots developing strong and very healthy roots after only 10 days. Stable transformation frequency by infection of leaf explants with Agrobacterium reached 12 %. Shoots have been induced by combination of 1 mg/l zeatin-trans and 0.1 mg/l IAA. Somatic embryogenesis of cotyledon on medium containing 1 mg/l zeatin + 2 mg/l IAA is described in Micro-tom. The photosynthetic psbS gene has been used as reporter gene for RNA silencing studies. The efficiency of gene silencing has been found equivalent using three different target gene fragments of 519, 398 and 328 bp. Interestingly, silencing efficiency decreased from T0 to the T3 generation in plants containing multiple copies of the inserted T-DNA, while it was stable in plants containing a single insertion.

  1. Gene silencing of beta-catenin in melanoma cells retards their growth but promotes the formation of pulmonary metastasis in mice.

    Science.gov (United States)

    Takahashi, Yuki; Nishikawa, Makiya; Suehara, Tetsuya; Takiguchi, Naomi; Takakura, Yoshinobu

    2008-11-15

    Altered expression of beta-catenin, a key component of the Wnt signaling pathway, is involved in a variety of cancers because increased levels of beta-catenin protein are frequently associated with enhanced cellular proliferation. Although our previous study demonstrated that gene silencing of beta-catenin in melanoma B16-BL6 cells by plasmid DNA (pDNA) expressing short-hairpin RNA targeting the gene (pshbeta-catenin) markedly suppressed their growth in vivo, gene silencing of beta-catenin could promote tumor metastasis by the rearranging cell adhesion complex. In this study, we investigated how silencing of beta-catenin affects metastatic aspects of melanoma cells. Transfection of B16-BL6 cells with pshbeta-catenin significantly reduced the amount of cadherin protein, a cell adhesion molecule binding to beta-catenin, with little change in its mRNA level. Cadherin-derived fragments were detected in culture media of B16-BL6 cells transfected with pshbeta-catenin, suggesting that cadherin is shed from the cell surface when the expression of beta-catenin is reduced. The mobility of B16-BL6 cells transfected with pshbeta-catenin was greater than that of cells transfected with any of the control pDNAs. B16-BL6 cells stably transfected with pshbeta-catenin (B16/pshbeta-catenin) formed less or an equal number of tumor nodules in the lung than cells stably transfected with other plasmids when injected into mice via the tail vein. However, when subcutaneously inoculated, B16/pshbeta-catenin cells formed more nodules in the lung than the other stably transfected cells. These results raise concerns about the gene silencing of beta-catenin for inhibiting tumor growth, because it promotes tumor metastasis by reducing the amount of cadherin in tumor cells. (c) 2008 Wiley-Liss, Inc.

  2. Comparative nucleic acid transfection efficacy in primary hepatocytes for gene silencing and functional studies

    Directory of Open Access Journals (Sweden)

    Morral Núria

    2011-01-01

    Full Text Available Abstract Background Primary hepatocytes are the best resource for in vitro studies directed at understanding hepatic processes at the cellular and molecular levels, necessary for novel drug development to treat highly prevalent diseases such as non-alcoholic steatohepatitis, cardiovascular disease and type 2 diabetes. There is a need to identify simple methods to genetically manipulate primary hepatocytes and conduct functional studies with plasmids, small interfering RNA (siRNA or microRNA (miRNA. New lipofection reagents are available that have the potential to yield higher levels of transfection with reduced toxicity. Findings We have tested several liposome-based transfection reagents used in molecular biology research. We show that transfection efficiency with one of the most recently developed formulations, Metafectene Pro, is high with plasmid DNA (>45% cells as well as double stranded RNA (>90% with siRNA or microRNA. In addition, negligible cytotoxicity was present with all of these nucleic acids, even if cells were incubated with the DNA:lipid complex for 16 hours. To provide the proof of concept that these conditions can be used not only for overexpression of a gene of interest, but also in RNA interference applications, we targeted two liver expressed genes, Sterol Regulatory Element-Binding Protein-1 and Fatty Acid Binding Protein 5 using plasmid-mediated short hairpin RNA expression. In addition, similar transfection conditions were used to optimally deliver siRNA and microRNA. Conclusions We have identified a lipid-based reagent for primary hepatocyte transfection of nucleic acids currently used in molecular biology laboratories. The conditions described here can be used to expedite a large variety of research applications, from gene function studies to microRNA target identification.

  3. Telomerase Inhibition by Everolimus Suppresses Smooth Muscle Cell Proliferation and Neointima Formation Through Epigenetic Gene Silencing.

    Science.gov (United States)

    Aono, Jun; Ruiz-Rodriguez, Ernesto; Qing, Hua; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis

    2016-01-01

    The present study sought to investigate the mechanisms underlying the mitogenic function of telomerase and to test the hypothesis that everolimus, commonly used on drug-eluting stents, suppresses smooth muscle cells (SMC) proliferation by targeting telomerase. Proliferation of SMC during neointima formation is prevented by drug-eluting stents. Although the replicative capacity of mammalian cells is enhanced by telomerase expression, the contribution of telomerase to the proliferative response underlying neointima formation and its potential role as a pharmacological target remain to be investigated. We first employed constitutive expression of telomerase reverse transcriptase (TERT) in cell systems to study transcriptional mechanisms by which telomerase activates a mitogenic program. Second, overexpression of telomerase in mice provided a model to study the role of telomerase as a drug target for the antiproliferative efficacy of everolimus. Inhibition of neointima formation by everolimus is lost in mice overexpressing TERT, indicating that repression of telomerase confers the antiproliferative efficacy of everolimus. Everolimus reduces TERT expression in SMC through an Ets-1-dependent inhibition of promoter activation. The inhibition of TERT-dependent SMC proliferation by everolimus occurred in the absence of telomere shortening but rather as a result of a G1→S phase arrest. Although everolimus failed to inhibit phosphorylation of the retinoblastoma protein as the gatekeeper of S-phase entry, it potently repressed downstream target genes. Using chromatin immunoprecipitation assays, we finally demonstrate that TERT induces E2F binding to S-phase gene promoters and supports histone acetylation, effects that are inhibited by everolimus and mediate its antiproliferative activity. These results characterize telomerase as a previously unrecognized target for the antiproliferative activity of everolimus. Our studies further identify a novel mitogenic pathway in SMC

  4. Immuno-Oncology-The Translational Runway for Gene Therapy: Gene Therapeutics to Address Multiple Immune Targets.

    Science.gov (United States)

    Weß, Ludger; Schnieders, Frank

    2017-12-01

    Cancer therapy is once again experiencing a paradigm shift. This shift is based on extensive clinical experience demonstrating that cancer cannot be successfully fought by addressing only single targets or pathways. Even the combination of several neo-antigens in cancer vaccines is not sufficient for successful, lasting tumor eradication. The focus has therefore shifted to the immune system's role in cancer and the striking abilities of cancer cells to manipulate and/or deactivate the immune system. Researchers and pharma companies have started to target the processes and cells known to support immune surveillance and the elimination of tumor cells. Immune processes, however, require novel concepts beyond the traditional "single-target-single drug" paradigm and need parallel targeting of diverse cells and mechanisms. This review gives a perspective on the role of gene therapy technologies in the evolving immuno-oncology space and identifies gene therapy as a major driver in the development and regulation of effective cancer immunotherapy. Present challenges and breakthroughs ranging from chimeric antigen receptor T-cell therapy, gene-modified oncolytic viruses, combination cancer vaccines, to RNA therapeutics are spotlighted. Gene therapy is recognized as the most prominent technology enabling effective immuno-oncology strategies.

  5. RNAi-mediated silencing of vitellogenin gene function turns honeybee ( Apis mellifera) workers into extremely precocious foragers

    Science.gov (United States)

    Marco Antonio, David Santos; Guidugli-Lazzarini, Karina Rosa; Do Nascimento, Adriana Mendes; Simões, Zilá Luz Paulino; Hartfelder, Klaus

    2008-10-01

    The switch from within-hive activities to foraging behavior is a major transition in the life cycle of a honeybee ( Apis mellifera) worker. A prominent regulatory role in this switch has long been attributed to juvenile hormone (JH), but recent evidence also points to the yolk precursor protein vitellogenin as a major player in behavioral development. In the present study, we injected vitellogenin double-stranded RNA (dsVg) into newly emerged worker bees of Africanized genetic origin and introduced them together with controls into observation hives to record flight behavior. RNA interference-mediated silencing of vitellogenin gene function shifted the onset of long-duration flights (>10 min) to earlier in life (by 3 4 days) when compared with sham and untreated control bees. In fact, dsVg bees were observed conducting such flights extremely precociously, when only 3 days old. Short-duration flights (<10 min), which bees usually perform for orientation and cleaning, were not affected. Additionally, we found that the JH titer in dsVg bees collected after 7 days was not significantly different from the controls. The finding that depletion of the vitellogenin titer can drive young bees to become extremely precocious foragers could imply that vitellogenin is the primary switch signal. At this young age, downregulation of vitellogenin gene activity apparently had little effect on the JH titer. As this unexpected finding stands in contrast with previous results on the vitellogenin/JH interaction at a later age, when bees normally become foragers, we propose a three-step sequence in the constellation of physiological parameters underlying behavioral development.

  6. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)

    2013-01-06

    Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

  7. MIWI2 as an Effector of DNA Methylation and Gene Silencing in Embryonic Male Germ Cells

    Directory of Open Access Journals (Sweden)

    Kanako Kojima-Kita

    2016-09-01

    Full Text Available During the development of mammalian embryonic germ cells, global demethylation and de novo DNA methylation take place. In mouse embryonic germ cells, two PIWI family proteins, MILI and MIWI2, are essential for the de novo DNA methylation of retrotransposons, presumably through PIWI-interacting RNAs (piRNAs. Although piRNA-associated MIWI2 has been reported to play critical roles in the process, its molecular mechanisms have remained unclear. To identify the mechanism, transgenic mice were produced; they contained a fusion protein of MIWI2 and a zinc finger (ZF that recognized the promoter region of a type A LINE-1 gene. The ZF-MIWI2 fusion protein brought about DNA methylation, suppression of the type A LINE-1 gene, and a partial rescue of the impaired spermatogenesis of MILI-null mice. In addition, ZF-MIWI2 was associated with the proteins involved in DNA methylation. These data indicate that MIWI2 functions as an effector of de novo DNA methylation of the retrotransposon.

  8. Changes in Oleic Acid Content of Transgenic Soybeans by Antisense RNA Mediated Posttranscriptional Gene Silencing

    Directory of Open Access Journals (Sweden)

    Ling Zhang

    2014-01-01

    Full Text Available The Delta-12 oleate desaturase gene (FAD2-1, which converts oleic acid into linoleic acid, is the key enzyme determining the fatty acid composition of seed oil. In this study, we inhibited the expression of endogenous Delta-12 oleate desaturase GmFad2-1b gene by using antisense RNA in soybean Williams 82. By employing the soybean cotyledonary-node method, a part of the cDNA of soybean GmFad2-1b 801 bp was cloned for the construction of a pCAMBIA3300 vector under the soybean seed promoter BCSP. Leaf painting, LibertyLink strip, PCR, Southern blot, qRT-PCR, and fatty acid analysis were used to detect the insertion and expression of GmFad2-1b in the transgenic soybean lines. The results indicate that the metabolically engineered plants exhibited a significant increase in oleic acid (up to 51.71% and a reduction in palmitic acid (to <3% in their seed oil content. No structural differences were observed between the fatty acids of the transgenic and the nontransgenic oil extracts.

  9. The essential function of B. subtilis RNase III is to silence foreign toxin genes.

    Directory of Open Access Journals (Sweden)

    Sylvain Durand

    Full Text Available RNase III-related enzymes play key roles in cleaving double-stranded RNA in many biological systems. Among the best-known are RNase III itself, involved in ribosomal RNA maturation and mRNA turnover in bacteria, and Drosha and Dicer, which play critical roles in the production of micro (mi-RNAs and small interfering (si-RNAs in eukaryotes. Although RNase III has important cellular functions in bacteria, its gene is generally not essential, with the remarkable exception of that of Bacillus subtilis. Here we show that the essential role of RNase III in this organism is to protect it from the expression of toxin genes borne by two prophages, Skin and SPβ, through antisense RNA. Thus, while a growing number of organisms that use RNase III or its homologs as part of a viral defense mechanism, B. subtilis requires RNase III for viral accommodation to the point where the presence of the enzyme is essential for cell survival. We identify txpA and yonT as the two toxin-encoding mRNAs of Skin and SPβ that are sensitive to RNase III. We further explore the mechanism of RNase III-mediated decay of the txpA mRNA when paired to its antisense RNA RatA, both in vivo and in vitro.

  10. Silencing cathepsin S gene expression inhibits growth, invasion and angiogenesis of human hepatocellular carcinoma in vitro

    International Nuclear Information System (INIS)

    Fan, Qi; Wang, Xuedi; Zhang, Hanguang; Li, Chuanwei; Fan, Junhua; Xu, Jing

    2012-01-01

    Highlights: ► Cat S is highly expressed in HCC cells with high metastatic potential. ► Knockdown of Cat S inhibits growth and invasion of HCC cells. ► Knockdown of Cat S inhibits HCC-associated angiogenesis. ► Cat S might be a potential target for HCC therapy. -- Abstract: Cathepsin S (Cat S) plays an important role in tumor invasion and metastasis by its ability to degrade extracellular matrix (ECM). Our previous study suggested there could be a potential association between Cat S and hepatocellular carcinoma (HCC) metastasis. The present study was designed to determine the role of Cat S in HCC cell growth, invasion and angiogenesis, using RNA interference technology. Small interfering RNA (siRNA) sequences for the Cat S gene were synthesized and transfected into human HCC cell line MHCC97-H. The Cat S gene targeted siRNA-mediated knockdown of Cat S expression, leading to potent suppression of MHCC97-H cell proliferation, invasion and angiogenesis. These data suggest that Cat S might be a potential target for HCC therapy.

  11. Identification of the TaBTF3 gene in wheat (Triticum aestivum L.) and the effect of its silencing on wheat chloroplast, mitochondria and mesophyll cell development.

    Science.gov (United States)

    Ma, Hong-Zhen; Liu, Guo-Qin; Li, Cheng-Wei; Kang, Guo-Zhang; Guo, Tian-Cai

    2012-10-05

    The full-length cDNA (882bp) and DNA (1742bp) sequences encoding a basic transcription factor 3, designated as TaBTF3, were first isolated from common wheat (Triticum aestivum L.). Subcellular localization studies revealed that the TaBTF3 protein was mainly located in the cytoplasm and nucleus. In TaBTF3-silenced transgenic wheat seedlings obtained using the Virus-induced gene silencing (VIGS) method, the chlorophyll pigment content was markedly reduced. However, the malonaldehyde (MDA) and H(2)O(2) contents were enhanced, and the structure of the wheat mesophyll cell was seriously damaged. Furthermore, transcripts of the chloroplast- and mitochondrial-encoded genes were significantly reduced in TaBTF3-silenced transgenic wheat plants. These results suggest that the TaBTF3 gene might function in the development of the wheat chloroplast, mitochondria and mesophyll cell. This paper is the first report to describe the involvement of TaBTF3 in maintaining the normal plant mesophyll cell structure. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. High-Throughput Screening Using iPSC-Derived Neuronal Progenitors to Identify Compounds Counteracting Epigenetic Gene Silencing in Fragile X Syndrome.

    Science.gov (United States)

    Kaufmann, Markus; Schuffenhauer, Ansgar; Fruh, Isabelle; Klein, Jessica; Thiemeyer, Anke; Rigo, Pierre; Gomez-Mancilla, Baltazar; Heidinger-Millot, Valerie; Bouwmeester, Tewis; Schopfer, Ulrich; Mueller, Matthias; Fodor, Barna D; Cobos-Correa, Amanda

    2015-10-01

    Fragile X syndrome (FXS) is the most common form of inherited mental retardation, and it is caused in most of cases by epigenetic silencing of the Fmr1 gene. Today, no specific therapy exists for FXS, and current treatments are only directed to improve behavioral symptoms. Neuronal progenitors derived from FXS patient induced pluripotent stem cells (iPSCs) represent a unique model to study the disease and develop assays for large-scale drug discovery screens since they conserve the Fmr1 gene silenced within the disease context. We have established a high-content imaging assay to run a large-scale phenotypic screen aimed to identify compounds that reactivate the silenced Fmr1 gene. A set of 50,000 compounds was tested, including modulators of several epigenetic targets. We describe an integrated drug discovery model comprising iPSC generation, culture scale-up, and quality control and screening with a very sensitive high-content imaging assay assisted by single-cell image analysis and multiparametric data analysis based on machine learning algorithms. The screening identified several compounds that induced a weak expression of fragile X mental retardation protein (FMRP) and thus sets the basis for further large-scale screens to find candidate drugs or targets tackling the underlying mechanism of FXS with potential for therapeutic intervention. © 2015 Society for Laboratory Automation and Screening.

  13. Gene silencing in primary and metastatic tumors by small interfering RNA delivery in mice: quantitative analysis using melanoma cells expressing firefly and sea pansy luciferases.

    Science.gov (United States)

    Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu

    2005-07-20

    Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.

  14. Genetic and epigenetic silencing of the beclin 1 gene in sporadic breast tumors

    International Nuclear Information System (INIS)

    Li, Zidong; Chen, Bo; Wu, Yiqing; Jin, Feng; Xia, Yongjing; Liu, Xiangjun

    2010-01-01

    Beclin 1, an important autophagy-related protein in human cells, is involved in cell death and cell survival. Beclin 1 mapped to human chromosome 17q21. It is widely expressed in normal mammary epithelial cells. Although down-regulated expression with mono-allelic deletions of beclin 1 gene was frequently observed in breast tumors, whether there was other regulatory mechanism of beclin 1 was to be investigated. We studied the expression of beclin 1 and explored the possible regulatory mechanisms on its expression in breast tumors. 20 pairs of tumors and adjacent normal tissues from patients with sporadic breast invasive ductal cancer (IDCs) were collected. The mRNA expression of beclin 1 was detected by real-time quantitative RT-PCR. Loss of heterozygosity (LOH) was determined by real-time quantitative PCR and microsatellite methods. The protein expression of beclin 1, p53, BRCA1 and BRCA2 was assessed by immunohistochemistry. CpG islands in 5' genomic region of beclin 1 gene were identified using MethylPrimer Program. Sodium bisulfite sequencing was used in examining the methylation status of each CpG island. Decreased beclin 1 mRNA expression was detected in 70% of the breast tumors, and the protein levels were co-related to the mRNA levels. Expression of beclin 1 mRNA was demonstrated to be much higher in the BRCA1 positive tumors than that in the BRCA1 negative ones. Loss of heterozygosity was detected in more than 45% of the breast tumors, and a dense cluster of CpG islands was found from the 5' end to the intron 2 of the beclin 1 gene. Methylation analysis showed that the promoter and the intron 2 of beclin 1 were aberrantly methylated in the tumors with decreased expression. These data indicated that LOH and aberrant DNA methylation might be the possible reasons of the decreased expression of beclin 1 in the breast tumors. The findings here shed some new light on the regulatory mechanisms of beclin 1 in breast cancer

  15. Flg22-Triggered Immunity Negatively Regulates Key BR Biosynthetic Genes.

    Science.gov (United States)

    Jiménez-Góngora, Tamara; Kim, Seong-Ki; Lozano-Durán, Rosa; Zipfel, Cyril

    2015-01-01

    In plants, activation of growth and activation of immunity are opposing processes that define a trade-off. In the past few years, the growth-promoting hormones brassinosteroids (BR) have emerged as negative regulators of pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI), promoting growth at the expense of defense. The crosstalk between BR and PTI signaling was described as negative and unidirectional, since activation of PTI does not affect several analyzed steps in the BR signaling pathway. In this work, we describe that activation of PTI by the bacterial PAMP flg22 results in the reduced expression of BR biosynthetic genes. This effect does not require BR perception or signaling, and occurs within 15 min of flg22 treatment. Since the described PTI-induced repression of gene expression may result in a reduction in BR biosynthesis, the crosstalk between PTI and BR could actually be negative and bidirectional, a possibility that should be taken into account when considering the interaction between these two pathways.

  16. SREBP-1c Gene Silencing can Decrease Lipid Deposits in Bovine Hepatocytes Cultured in Vitro

    Directory of Open Access Journals (Sweden)

    Qinghua Deng

    2014-05-01

    Full Text Available Background: Fatty liver is a major metabolic disorder that occurs during early lactation in high-producing dairy cows. Sterol regulatory element-binding protein-1c (SREBP-1c is an important transcription factor that regulates lipid synthesis by regulating the expression of lipid metabolism genes. Methods: In this study, we reduced the expression of SREBP-1c by adenovirus-mediated SREBP-1c with a low expression vector (AD-GFP-SREBP-1c to study the effects of SREBP-1c on lipid deposits in bovine hepatocytes. The expression levels and enzyme activities of SERBP-1c and its target genes were determined by real-time PCR, western blot, and ELISA. Results: These results showed that Ad-GFP-SREBP-1c could inhibit SREBP-1c expression. The expression of the lipid synthesis enzyme acetyl-CoA carboxylase (ACC was down-regulated. The expression levels of the lipid oxidation enzymes long-chain fatty acyl-COA synthetase (ACSL-1, carnitine palmitoyltransferase І (CPT-І, carnitine palmitoyltransferase II (CPT- II, and β-hydroxyacyl-CoA-DH (HADH were significantly elevated. Furthermore, the expression levels of factors involved in the assembly and transport of very low-density lipoproteins (VLDLs, such as apolipoprotein B100 (ApoB, apolipoprotein E (ApoE, and microsomal triglyceride transfer protein (MTTP were decreased comparison with the negative control and the blank control groups, but the low-density lipoprotein receptor (LDLR was elevated. The concentrations of TG (triglyceride and VLDL were also reduced. Conclusion: These data suggest that low SREBP-1c expression can decrease lipid synthesis, increase lipid oxidation, and decrease the TG and VLDL content in bovine hepatocytes.

  17. Differential Cotton leaf crumple virus-VIGS-mediated gene silencing and viral genome localization in different Gossypium hirsutum genetic backgrounds

    KAUST Repository

    Idris, Ali; Tuttle, John Richard; Robertson, Dominique Niki; Haigler, Candace H.; Brown, Judith K.

    2010-01-01

    inoculation resulted in systemic and persistent photo-bleaching of the leaves and bolls of the seven cultivars tested, however, the intensity of silencing was variable. CLCrV-VIGS-mediated expression of green fluorescent protein was used to monitor

  18. The silence.

    Science.gov (United States)

    Millenson, Michael L

    2003-01-01

    Despite several well-crafted Institute of Medicine (IOM) reports, there remains within health care a persistent refusal to confront providers' responsibility for severe quality problems. There is a silence of deed--failing to take corrective actions--and of word--failing to discuss openly the true consequences of that inertia. These silences distort public policy, delay change, and, by leading (albeit inadvertently) to thousands of patient deaths, undermine professionalism. The IOM quality committee, to retain its moral authority, should forgo issuing more reports and instead lead an emergency corrective-action campaign comparable to Flexner's crusade against charlatan medical schools.

  19. Gene silencing of HPV16 E6/E7 induced by promoter-targeting siRNA in SiHa cells

    OpenAIRE

    Hong, D; Lu, W; Ye, F; Hu, Y; Xie, X

    2009-01-01

    Background: Recently, transcriptional gene silencing induced by small interfering RNA (siRNA) was found in mammalian and human cells. However, previous studies focused on endogenous genes. Methods: In this study, we designed siRNA targeting the promoter of human papillomavirus 16 E6/E7 and transfected it into the cervical cancer cell line, SiHa. E6 and E7 mRNA and protein expression were detected in cells treated by promoter-targeting siRNA. Futhermore, cellular growth, proliferation, apoptos...

  20. The silencing of cathepsin K used in gene therapy for periodontal disease reveals the role of cathepsin K in chronic infection and inflammation.

    Science.gov (United States)

    Chen, W; Gao, B; Hao, L; Zhu, G; Jules, J; MacDougall, M J; Wang, J; Han, X; Zhou, X; Li, Y-P

    2016-10-01

    Periodontitis is a severe chronic inflammatory disease and one of the most prevalent non-communicable chronic diseases that affects the majority of the world's adult population. While great efforts have been devoted toward understanding the pathogenesis of periodontitis, there remains a pressing need for developing potent therapeutic strategies for targeting this dreadful disease. In this study, we utilized adeno-associated virus (AAV) expressing cathepsin K (Ctsk) small hairpin (sh)RNA (AAV-sh-Ctsk) to silence Ctsk in vivo and subsequently evaluated its impact in periodontitis as a potential therapeutic strategy for this disease. We used a known mouse model of periodontitis, in which wild-type BALB/cJ mice were infected with Porphyromonas gingivalis W50 in the maxillary and mandibular periodontium to induce the disease. AAV-sh-Ctsk was then administrated locally into the periodontal tissues in vivo, followed by analyses to assess progression of the disease. AAV-mediated Ctsk silencing drastically protected mice (> 80%) from P. gingivalis-induced bone resorption by osteoclasts. In addition, AAV-sh-Ctsk administration drastically reduced inflammation by impacting the expression of many inflammatory cytokines as well as T-cell and dendritic cell numbers in periodontal lesions. AAV-mediated Ctsk silencing can simultaneously target both the inflammation and bone resorption associated with periodontitis through its inhibitory effect on immune cells and osteoclast function. Thereby, AAV-sh-Ctsk administration can efficiently protect against periodontal tissue damage and alveolar bone loss, establishing this AAV-mediated local silencing of Ctsk as an important therapeutic strategy for effectively treating periodontal disease. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Silencing of BCR/ABL Chimeric Gene in Human Chronic Myelogenous Leukemia Cell Line K562 by siRNA-Nuclear Export Signal Peptide Conjugates.

    Science.gov (United States)

    Shinkai, Yasuhiro; Kashihara, Shinichi; Minematsu, Go; Fujii, Hirofumi; Naemura, Madoka; Kotake, Yojiro; Morita, Yasutaka; Ohnuki, Koichiro; Fokina, Alesya A; Stetsenko, Dmitry A; Filichev, Vyacheslav V; Fujii, Masayuki

    2017-06-01

    Herein we described the synthesis of siRNA-NES (nuclear export signal) peptide conjugates by solid phase fragment coupling and the application of them to silencing of bcr/abl chimeric gene in human chronic myelogenous leukemia cell line K562. Two types of siRNA-NES conjugates were prepared, and both sense strands at 5' ends were covalently linked to a NES peptide derived from TFIIIA and HIV-1 REV, respectively. Significant enhancement of silencing efficiency was observed for both of them. siRNA-TFIIIA NES conjugate suppressed the expression of BCR/ABL gene to 8.3% at 200 nM and 11.6% at 50 nM, and siRNA-HIV-1REV NES conjugate suppressed to 4.0% at 200 nM and 6.3% at 50 nM, whereas native siRNA suppressed to 36.3% at 200 nM and 30.2% at 50 nM. We could also show complex of siRNA-NES conjugate and designed amphiphilic peptide peptideβ7 could be taken up into cells with no cytotoxicity and showed excellent silencing efficiency. We believe that the complex siRNA-NES conjugate and peptideβ7 is a promising candidate for in vivo use and therapeutic applications.

  2. Effective gene silencing activity of prodrug-type 2'-O-methyldithiomethyl siRNA compared with non-prodrug-type 2'-O-methyl siRNA.

    Science.gov (United States)

    Hayashi, Junsuke; Nishigaki, Misa; Ochi, Yosuke; Wada, Shun-Ichi; Wada, Fumito; Nakagawa, Osamu; Obika, Satoshi; Harada-Shiba, Mariko; Urata, Hidehito

    2018-07-01

    Small interfering RNAs (siRNAs) are an active agent to induce gene silencing and they have been studied for becoming a biological and therapeutic tool. Various 2'-O-modified RNAs have been extensively studied to improve the nuclease resistance. However, the 2'-O-modified siRNA activities were often decreased by modification, since the bulky 2'-O-modifications inhibit to form a RNA-induced silencing complex (RISC). We developed novel prodrug-type 2'-O-methyldithiomethyl (MDTM) siRNA, which is converted into natural siRNA in an intracellular reducing environment. Prodrug-type 2'-O-MDTM siRNAs modified at the 5'-end side including 5'-end nucleotide and the seed region of the antisense strand exhibited much stronger gene silencing effect than non-prodrug-type 2'-O-methyl (2'-O-Me) siRNAs. Furthermore, the resistances for nuclease digestion of siRNAs were actually enhanced by 2'-O-MDTM modifications. Our results indicate that 2'-O-MDTM modifications improve the stability of siRNA in serum and they are able to be introduced at any positions of siRNA. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

    Science.gov (United States)

    Pompey, Justine M; Foda, Bardees; Singh, Upinder

    2015-01-01

    Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

  4. A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

    Directory of Open Access Journals (Sweden)

    Justine M Pompey

    Full Text Available Dicer enzymes process double-stranded RNA (dsRNA into small RNAs that target gene silencing through the RNA interference (RNAi pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

  5. CXCL12 gene silencing down-regulates metastatic potential via blockage of MAPK/PI3K/AP-1 signaling pathway in colon cancer.

    Science.gov (United States)

    Ma, J; Su, H; Yu, B; Guo, T; Gong, Z; Qi, J; Zhao, X; Du, J

    2018-01-05

    To investigate the effect of CXCL12 gene silencing on proliferation,invasion, angiogenesis and the relationship of MAPK/PI3K/AP-1 signaling pathway in colon cancer cells. RT-PCR and Western-blot were used to detect the expression of CXCL12 mRNA and protein in four colon cancer cell lines. Human colon cancer cells were transfected with CXCL12 siRNA carrying by Lipofectamine 2000. The expression of CXCL12 protein was confirmed by immunoblotting. WST-1, invasion and angiogenesis assay were used to examine the effect on proliferation, invasion and angiogenesis in colon cancer cells after CXCL12 siRNA silence, respectively. The phosphorylation of MAPK/PI3K/AP-1 protein levels was detected by Western blotting in CXCL12 siRNA suppression DLD-1 cell. CXCL12 mRNA and proteins were only expressed in DLD-1 colon cancer cell lines. CXCL12 siRNA were transfected into DLD-1 cells, the expression CXCL12 proteins was significantly inhibited (P colon cancer cell. The silencing CXCL12 gene significantly inhibits the proliferation, invasion and angiogenesis ability of some types colon carcinoma cells through down-regulation of MAPK/PI3K/AP-1 signaling pathway.

  6. GENETIC SUSCEPTIBILITY TO RESPIRATORY SYNCYTIAL VIRUS BRONCHIOLITIS IN PRETERM CHILDREN IS ASSOCIATED WITH AIRWAY REMODELING GENES AND INNATE IMMUNE GENES

    NARCIS (Netherlands)

    Siezen, Christine L. E.; Bont, Louis; Hodemaekers, Hennie M.; Ermers, Marieke J.; Doornbos, Gerda; van't Slot, Ruben; Wijmenga, Ciska; van Hottwelingen, Hans C.; Kimpen, Jan L. L.; Kimman, Tjeerd G.; Hoebee, Barbara; Janssen, Riny

    Prematurity is a risk factor for severe respiratory syncytial virus bronchiolitis. We show that genetic factors in innate immune genes (IFNA13, IFNAR2, STAT2. IL27, NFKBIA, C3, IL1RN, TLR5), in innate and adaptive immunity (IFNG), and in airway remodeling genes (ADAM33 and TGFBR1), affect disease

  7. The identification of immune genes in the milk transcriptome of the Tasmanian devil (Sarcophilus harrisii

    Directory of Open Access Journals (Sweden)

    Rehana V. Hewavisenti

    2016-01-01

    Full Text Available Tasmanian devil (Sarcophilus harrisii pouch young, like other marsupials, are born underdeveloped and immunologically naïve, and are unable to mount an adaptive immune response. The mother’s milk provides nutrients for growth and development as well as providing passive immunity. To better understand immune response in this endangered species, we set out to characterise the genes involved in passive immunity by sequencing and annotating the transcriptome of a devil milk sample collected during mid-lactation. At mid-lactation we expect the young to have heightened immune responses, as they have emerged from the pouch, encountering new pathogens. A total of 233,660 transcripts were identified, including approximately 17,827 unique protein-coding genes and 846 immune genes. The most highly expressed transcripts were dominated by milk protein genes such as those encoding early lactation protein, late lactation proteins, α-lactalbumin, α-casein and β-casein. There were numerous highly expressed immune genes including lysozyme, whey acidic protein, ferritin and major histocompatibility complex I and II. Genes encoding immunoglobulins, antimicrobial peptides, chemokines and immune cell receptors were also identified. The array of immune genes identified in this study reflects the importance of the milk in providing immune protection to Tasmanian devil young and provides the first insight into Tasmanian devil milk.

  8. Disruption of prefoldin-2 protein synthesis in root-knot nematodes via host-mediated gene silencing efficiently reduces nematode numbers and thus protects plants.

    Science.gov (United States)

    Ajjappala, Hemavathi; Chung, Ha Young; Sim, Joon-Soo; Choi, Inchan; Hahn, Bum-Soo

    2015-03-01

    The aim of this study is to demonstrate the feasibility of down-regulating endogeneous prefoldin-2 root-knot nematode transcripts by expressing dsRNA with sequence identity to the nematode gene in tobacco roots under the influence of strong Arabidopsis ubiquitin (UBQ1) promoter. Root-knot nematodes (RKNs) are sedentary endoparasites infecting a wide range of plant species. They parasitise the root system, thereby disrupting water and nutrient uptake and causing major reductions in crop yields. The most reliable means of controlling RKNs is via the use of soil fumigants such as methyl bromide. With the emergence of RNA interference (RNAi) technology, which permits host-mediated nematode gene silencing, a new strategy to control plant pathogens has become available. In the present study, we investigated host-induced RNAi gene silencing of prefoldin-2 in transgenic Nicotiana benthamiana. Reductions in prefoldin-2 mRNA transcript levels were observed when nematodes were soaked in a dsRNA solution in vitro. Furthermore, nematode reproduction was suppressed in RNAi transgenic lines, as evident by reductions in the numbers of root knots (by 34-60 % in independent RNAi lines) and egg masses (by 33-58 %). Endogenous expression of prefoldin-2, analysed via real-time polymerase chain reaction and Western blotting, revealed that the gene was strongly expressed in the pre-parasitic J2 stage. Our observations demonstrate the relevance and potential importance of targeting the prefoldin gene during the nematode life cycle. The work also suggests that further improvements in silencing efficiency in economically important crops can be accomplished using RNAi directed against plant-parasitic nematodes.

  9. Antisense targeting of 3' end elements involved in DUX4 mRNA processing is an efficient therapeutic strategy for facioscapulohumeral dystrophy: a new gene-silencing approach.

    Science.gov (United States)

    Marsollier, Anne-Charlotte; Ciszewski, Lukasz; Mariot, Virginie; Popplewell, Linda; Voit, Thomas; Dickson, George; Dumonceaux, Julie

    2016-04-15

    Defects in mRNA 3'end formation have been described to alter transcription termination, transport of the mRNA from the nucleus to the cytoplasm, stability of the mRNA and translation efficiency. Therefore, inhibition of polyadenylation may lead to gene silencing. Here, we choose facioscapulohumeral dystrophy (FSHD) as a model to determine whether or not targeting key 3' end elements involved in mRNA processing using antisense oligonucleotide drugs can be used as a strategy for gene silencing within a potentially therapeutic context. FSHD is a gain-of-function disease characterized by the aberrant expression of the Double homeobox 4 (DUX4) transcription factor leading to altered pathogenic deregulation of multiple genes in muscles. Here, we demonstrate that targeting either the mRNA polyadenylation signal and/or cleavage site is an efficient strategy to down-regulate DUX4 expression and to decrease the abnormally high-pathological expression of genes downstream of DUX4. We conclude that targeting key functional 3' end elements involved in pre-mRNA to mRNA maturation with antisense drugs can lead to efficient gene silencing and is thus a potentially effective therapeutic strategy for at least FSHD. Moreover, polyadenylation is a crucial step in the maturation of almost all eukaryotic mRNAs, and thus all mRNAs are virtually eligible for this antisense-mediated knockdown strategy. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. Silencing of the violaxanthin de-epoxidase gene in the diatom Phaeodactylum tricornutum reduces diatoxanthin synthesis and non-photochemical quenching.

    Directory of Open Access Journals (Sweden)

    Johann Lavaud

    Full Text Available Diatoms are a major group of primary producers ubiquitous in all aquatic ecosystems. To protect themselves from photooxidative damage in a fluctuating light climate potentially punctuated with regular excess light exposures, diatoms have developed several photoprotective mechanisms. The xanthophyll cycle (XC dependent non-photochemical chlorophyll fluorescence quenching (NPQ is one of the most important photoprotective processes that rapidly regulate photosynthesis in diatoms. NPQ depends on the conversion of diadinoxanthin (DD into diatoxanthin (DT by the violaxanthin de-epoxidase (VDE, also called DD de-epoxidase (DDE. To study the role of DDE in controlling NPQ, we generated transformants of P. tricornutum in which the gene (Vde/Dde encoding for DDE was silenced. RNA interference was induced by genetic transformation of the cells with plasmids containing either short (198 bp or long (523 bp antisense (AS fragments or, alternatively, with a plasmid mediating the expression of a self-complementary hairpin-like construct (inverted repeat, IR. The silencing approaches generated diatom transformants with a phenotype clearly distinguishable from wildtype (WT cells, i.e. a lower degree as well as slower kinetics of both DD de-epoxidation and NPQ induction. Real-time PCR based quantification of Dde transcripts revealed differences in transcript levels between AS transformants and WT cells but also between AS and IR transformants, suggesting the possible presence of two different gene silencing mediating mechanisms. This was confirmed by the differential effect of the light intensity on the respective silencing efficiency of both types of transformants. The characterization of the transformants strengthened some of the specific features of the XC and NPQ and confirmed the most recent mechanistic model of the DT/NPQ relationship in diatoms.

  11. Silencing of the Violaxanthin De-Epoxidase Gene in the Diatom Phaeodactylum tricornutum Reduces Diatoxanthin Synthesis and Non-Photochemical Quenching

    Science.gov (United States)

    Vugrinec, Sascha; Kroth, Peter G.

    2012-01-01

    Diatoms are a major group of primary producers ubiquitous in all aquatic ecosystems. To protect themselves from photooxidative damage in a fluctuating light climate potentially punctuated with regular excess light exposures, diatoms have developed several photoprotective mechanisms. The xanthophyll cycle (XC) dependent non-photochemical chlorophyll fluorescence quenching (NPQ) is one of the most important photoprotective processes that rapidly regulate photosynthesis in diatoms. NPQ depends on the conversion of diadinoxanthin (DD) into diatoxanthin (DT) by the violaxanthin de-epoxidase (VDE), also called DD de-epoxidase (DDE). To study the role of DDE in controlling NPQ, we generated transformants of P. tricornutum in which the gene (Vde/Dde) encoding for DDE was silenced. RNA interference was induced by genetic transformation of the cells with plasmids containing either short (198 bp) or long (523 bp) antisense (AS) fragments or, alternatively, with a plasmid mediating the expression of a self-complementary hairpin-like construct (inverted repeat, IR). The silencing approaches generated diatom transformants with a phenotype clearly distinguishable from wildtype (WT) cells, i.e. a lower degree as well as slower kinetics of both DD de-epoxidation and NPQ induction. Real-time PCR based quantification of Dde transcripts revealed differences in transcript levels between AS transformants and WT cells but also between AS and IR transformants, suggesting the possible presence of two different gene silencing mediating mechanisms. This was confirmed by the differential effect of the light intensity on the respective silencing efficiency of both types of transformants. The characterization of the transformants strengthened some of the specific features of the XC and NPQ and confirmed the most recent mechanistic model of the DT/NPQ relationship in diatoms. PMID:22629333

  12. Discovering Host Genes Involved in the Infection by the Tomato Yellow Leaf Curl Virus Complex and in the Establishment of Resistance to the Virus Using Tobacco Rattle Virus-based Post Transcriptional Gene Silencing

    Directory of Open Access Journals (Sweden)

    Rosa Lozano-Durán

    2013-03-01

    Full Text Available The development of high-throughput technologies allows for evaluating gene expression at the whole-genome level. Together with proteomic and metabolomic studies, these analyses have resulted in the identification of plant genes whose function or expression is altered as a consequence of pathogen attacks. Members of the Tomato yellow leaf curl virus (TYLCV complex are among the most important pathogens impairing production of agricultural crops worldwide. To understand how these geminiviruses subjugate plant defenses, and to devise counter-measures, it is essential to identify the host genes affected by infection and to determine their role in susceptible and resistant plants. We have used a reverse genetics approach based on Tobacco rattle virus-induced gene silencing (TRV-VIGS to uncover genes involved in viral infection of susceptible plants, and to identify genes underlying virus resistance. To identify host genes with a role in geminivirus infection, we have engineered a Nicotiana benthamiana line, coined 2IRGFP, which over-expresses GFP upon virus infection. With this system, we have achieved an accurate description of the dynamics of virus replication in space and time. Upon silencing selected N. benthamiana genes previously shown to be related to host response to geminivirus infection, we have identified eighteen genes involved in a wide array of cellular processes. Plant genes involved in geminivirus resistance were studied by comparing two tomato lines: one resistant (R, the other susceptible (S to the virus. Sixty-nine genes preferentially expressed in R tomatoes were identified by screening cDNA libraries from infected and uninfected R and S genotypes. Out of the 25 genes studied so far, the silencing of five led to the total collapse of resistance, suggesting their involvement in the resistance gene network. This review of our results indicates that TRV-VIGS is an exquisite reverse genetics tool that may provide new insights into the

  13. Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

    Directory of Open Access Journals (Sweden)

    Yao Han

    Full Text Available MIGS (miRNA-induced gene silencing is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs. MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase and PDS (phytoene desaturase gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant

  14. Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

    Science.gov (United States)

    Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong

    2015-01-01

    MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.

  15. Genome-wide analysis of histone H3 acetylation patterns in AML identifies PRDX2 as an epigenetically silenced tumor suppressor gene

    DEFF Research Database (Denmark)

    Agrawal-Singh, Shuchi; Isken, Fabienne; Agelopoulos, Konstantin

    2012-01-01

    to have lower H3Ac levels in AML compared with progenitor cells, which suggested that a large number of genes are epigenetically silenced in AML. Intriguingly, we identified peroxiredoxin 2 (PRDX2) as a novel potential tumor suppressor gene in AML. H3Ac was decreased at the PRDX2 gene promoter in AML......With the use of ChIP on microarray assays in primary leukemia samples, we report that acute myeloid leukemia (AML) blasts exhibit significant alterations in histone H3 acetylation (H3Ac) levels at > 1000 genomic loci compared with CD34+ progenitor cells. Importantly, core promoter regions tended......, which correlated with low mRNA and protein expression. We also observed DNA hypermethylation at the PRDX2 promoter in AML. Low protein expression of the antioxidant PRDX2 gene was clinically associated with poor prognosis in patients with AML. Functionally, PRDX2 acted as inhibitor of myeloid cell...

  16. Transcriptional changes in epigenetic modifiers associated with gene silencing in the intestine of the sea cucumber, Apostichopus japonicus (Selenka), during aestivation

    Science.gov (United States)

    Wang, Tianming; Yang, Hongsheng; Zhao, Huan; Chen, Muyan; Wang, Bing

    2011-11-01

    The sea cucumber, Apostichopus japonicus, undergoes aestivation to improve survival during periods of high-temperature. During aestivation, the metabolic rate is depressed to reduce the consumption of reserved energy. We evaluated the role of epigenetic modification on global gene silencing during metabolic rate depression in the sea cucumber. We compared the expression of epigenetic modifiers in active and aestivating sea cucumbers. The expression of three genes involved in DNA methylation and chromatin remodeling (DNA (cytosine-5)-methyltransferase 1, Methyl-CpG-binding domain protein 2), and Chromodomain-helicase-DNA-binding protein 5) was significantly higher during aestivation (Days 20 and 40). Similarly, we observed an increase in the expression of genes involved in histone acetylation (Histone deacetylase 3) and Histone-binding protein RBBP4) during the early (Days 5 and 10) and late phases (Days 20 and 40) of aestivation. There was no change in the expression of KAT2B, a histone acetyltransferase. However, the expression of histone methylation associated modifiers (Histone-arginine methyltransferase CARMER and Histone-lysine N-methyltransferase MLL5) was significantly higher after 5 d in the aestivating group. The results suggest that the expression of epigenetic modifiers involved in DNA methylation, chromatin remodeling, histone acetylation, and histone methylation is upregulated during aestivation. We hypothesize that these changes regulate global gene silencing during aestivation in A. japonicus.

  17. Microarray expression analysis of genes involved in innate immune memory in peritoneal macrophages

    Directory of Open Access Journals (Sweden)

    Keisuke Yoshida

    2016-03-01

    Full Text Available Immunological memory has been believed to be a feature of the adaptive immune system for long period, but recent reports suggest that the innate immune system also exhibits memory-like reaction. Although evidence of innate immune memory is accumulating, no in vivo experimental data has clearly implicated a molecular mechanism, or even a cell-type, for this phenomenon. In this study of data deposited into Gene Expression Omnibus (GEO under GSE71111, we analyzed the expression profile of peritoneal macrophages isolated from mice pre-administrated with toll-like receptor (TLR ligands, mimicking pathogen infection. In these macrophages, increased expression of a group of innate immunity-related genes was sustained over a long period of time, and these genes overlapped with ATF7-regulated genes. We conclude that ATF7 plays an important role in innate immune memory in macrophages. Keywords: Macrophage, ATF7, Innate immune memory, Microarray

  18. Differential expression of immune and stress genes in the skin of Atlantic cod (Gadus morhua)

    NARCIS (Netherlands)

    Caipang, C.M.A.; Lazado, C.C.; Brinchmann, M.; Rombout, J.H.W.M.; Kiron, V.

    2011-01-01

    The present study describes the transcriptional profiles of selected immune and stress genes with putative important roles in the cutaneous immune defense of Atlantic cod (Gadus morhua). In addition it shows differential expression of many genes at the dorsal and ventral sides of fish, in general

  19. Baltic salmon activates immune relevant genes in fin tissue when responding to Gyrodactylus salaris infection

    DEFF Research Database (Denmark)

    Kania, Per Walther; Larsen, Thomas Bjerre; Ingerslev, Hans C.

    2007-01-01

    A series of immune relevant genes are expressed when the Baltic salmon responds on infections with the ectoparasite Gyrodactylus salaris which leads to a decrease of the parasite infection......A series of immune relevant genes are expressed when the Baltic salmon responds on infections with the ectoparasite Gyrodactylus salaris which leads to a decrease of the parasite infection...

  20. Silencing the expression of Cbl-b enhances the immune activation of T lymphocytes against RM-1 prostate cancer cells in vitro

    Directory of Open Access Journals (Sweden)

    Shu-Kui Zhou

    2014-12-01

    Conclusion: Silencing Cbl-b significantly enhanced T lymphocyte function and T lymphocyte cytotoxicity activity against a model prostate cancer cell line in vitro. This study suggests a potentially novel immunotherapeutic strategy against prostate cancer.

  1. Transplantation of Nogo-66 receptor gene-silenced cells in a poly(D,L-lactic-co-glycolic acid) scaffold for the treatment of spinal cord injury★

    Science.gov (United States)

    Wang, Dong; Fan, Yuhong; Zhang, Jianjun

    2013-01-01

    Inhibition of neurite growth, which is in large part mediated by the Nogo-66 receptor, affects neural regeneration following bone marrow mesenchymal stem cell transplantation. The tissue engineering scaffold poly(D,L-lactide-co-glycolic acid) has good histocompatibility and can promote the growth of regenerating nerve fibers. The present study used small interfering RNA to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells and Schwann cells, which were subsequently transplanted with poly(D,L-lactide-co-glycolic acid) into the spinal cord lesion regions in rats. Simultaneously, rats treated with scaffold only were taken as the control group. Hematoxylin-eosin staining and immunohistochemistry revealed that at 4 weeks after transplantation, rats had good motor function of the hind limb after treatment with Nogo-66 receptor gene-silenced cells plus the poly(D,L-lactide-co-glycolic acid) scaffold compared with rats treated with scaffold only, and the number of bone marrow mesenchymal stem cells and neuron-like cells was also increased. At 8 weeks after transplantation, horseradish peroxidase tracing and transmission electron microscopy showed a large number of unmyelinated and myelinated nerve fibers, as well as intact regenerating axonal myelin sheath following spinal cord hemisection injury. These experimental findings indicate that transplantation of Nogo-66 receptor gene-silenced bone marrow mesenchymal stem cells and Schwann cells plus a poly(D,L-lactide-co-glycolic acid) scaffold can significantly enhance axonal regeneration of spinal cord neurons and improve motor function of the extremities in rats following spinal cord injury. PMID:25206713

  2. ETS transcription factors control transcription of EZH2 and epigenetic silencing of the tumor suppressor gene Nkx3.1 in prostate cancer.

    Directory of Open Access Journals (Sweden)

    Paolo Kunderfranco

    2010-05-01

    Full Text Available ETS transcription factors regulate important signaling pathways involved in cell differentiation and development in many tissues and have emerged as important players in prostate cancer. However, the biological impact of ETS factors in prostate tumorigenesis is still debated.We performed an analysis of the ETS gene family using microarray data and real-time PCR in normal and tumor tissues along with functional studies in normal and cancer cell lines to understand the impact in prostate tumorigenesis and identify key targets of these transcription factors. We found frequent dysregulation of ETS genes with oncogenic (i.e., ERG and ESE1 and tumor suppressor (i.e., ESE3 properties in prostate tumors compared to normal prostate. Tumor subgroups (i.e., ERG(high, ESE1(high, ESE3(low and NoETS tumors were identified on the basis of their ETS expression status and showed distinct transcriptional and biological features. ERG(high and ESE3(low tumors had the most robust gene signatures with both distinct and overlapping features. Integrating genomic data with functional studies in multiple cell lines, we demonstrated that ERG and ESE3 controlled in opposite direction transcription of the Polycomb Group protein EZH2, a key gene in development, differentiation, stem cell biology and tumorigenesis. We further demonstrated that the prostate-specific tumor suppressor gene Nkx3.1 was controlled by ERG and ESE3 both directly and through induction of EZH2.These findings provide new insights into the role of the ETS transcriptional network in prostate tumorigenesis and uncover previously unrecognized links between aberrant expression of ETS factors, deregulation of epigenetic effectors and silencing of tumor suppressor genes. The link between aberrant ETS activity and epigenetic gene silencing may be relevant for the clinical management of prostate cancer and design of new therapeutic strategies.

  3. Development of marker-free transgenic Jatropha curcas producing curcin-deficient seeds through endosperm-specific RNAi-mediated gene silencing.

    Science.gov (United States)

    Gu, Keyu; Tian, Dongsheng; Mao, Huizhu; Wu, Lifang; Yin, Zhongchao

    2015-10-08

    Jatropha curcas L. is a potential biofuel plant and its seed oil is suitable for biodiesel production. Despite this promising application, jatropha seeds contain two major toxic components, namely phorbol esters and curcins. These compounds would reduce commercial value of seed cake and raise safety and environment concerns on jatropha plantation and processing. Curcins are Type I ribosome inactivating proteins. Several curcin genes have been identified in the jatropha genome. Among which, the Curcin 1 (C1) gene is identified to be specifically expressed in endosperm, whereas the Curcin 2A (C2A) is mainly expressed in young leaves. A marker-free RNAi construct carrying a β-estradiol-regulated Cre/loxP system and a C1 promoter-driven RNAi cassette for C1 gene was made and used to generate marker-free transgenic RNAi plants to specifically silence the C1 gene in the endosperm of J. curcas. Plants of transgenic line L1, derived from T0-1, carry two copies of marker-free RNAi cassette, whereas plants of L35, derived from T0-35, harbored one copy of marker-free RNAi cassette and three copies of closely linked and yet truncated Hpt genes. The C1 protein content in endosperm of L1 and L35 seeds was greatly reduced or undetectable, while the C2A proteins in young leaves of T0-1 and T0-35 plants were unaffected. In addition, the C1 mRNA transcripts were undetectable in the endosperm of T3 seeds of L1 and L35. The results demonstrated that the expression of the C1 gene was specifically down-regulated or silenced by the double-stranded RNA-mediated RNA interference generated from the RNAi cassette. The C1 promoter-driven RNAi cassette for the C1 gene in transgenic plants was functional and heritable. Both C1 transcripts and C1 proteins were greatly down-regulated or silenced in the endosperm of transgenic J. curcas. The marker-free transgenic plants and curcin-deficient seeds developed in this study provided a solution for the toxicity of curcins in jatropha seeds and

  4. Genome-wide analysis of immune system genes by EST profiling

    Science.gov (United States)

    Giallourakis, Cosmas; Benita, Yair; Molinie, Benoit; Cao, Zhifang; Despo, Orion; Pratt, Henry E.; Zukerberg, Lawrence R.; Daly, Mark J.; Rioux, John D.; Xavier, Ramnik J.

    2013-01-01

    Profiling studies of mRNA and miRNA, particularly microarray-based studies, have been extensively used to create compendia of genes that are preferentially expressed in the immune system. In some instances, functional studies have been subsequently pursued. Recent efforts such as ENCODE have demonstrated the benefit of coupling RNA-Seq analysis with information from expressed sequence tags (ESTs) for transcriptomic analysis. However, the full characterization and identification of transcripts that function as modulators of human immune responses remains incomplete. In this study, we demonstrate that an integrated analysis of human ESTs provides a robust platform to identify the immune transcriptome. Beyond recovering a reference set of immune-enriched genes and providing large-scale cross-validation of previous microarray studies, we discovered hundreds of novel genes preferentially expressed in the immune system, including non-coding RNAs. As a result, we have established the Immunogene database, representing an integrated EST “road map” of gene expression in human immune cells, which can be used to further investigate the function of coding and non-coding genes in the immune system. Using this approach, we have uncovered a unique metabolic gene signature of human macrophages and identified PRDM15 as a novel overexpressed gene in human lymphomas. Thus we demonstrate the utility of EST profiling as a basis for further deconstruction of physiologic and pathologic immune processes. PMID:23616578

  5. Epstein-Barr Virus (EBV) Latent Protein EBNA3A Directly Targets and Silences the STK39 Gene in B Cells Infected by EBV.

    Science.gov (United States)

    Bazot, Quentin; Paschos, Kostas; Allday, Martin J

    2018-04-01

    Epstein-Barr virus (EBV) establishes latent infection in human B cells and is associated with a wide range of cancers. The EBV nuclear antigen 3 (EBNA3) family proteins are critical for B cell transformation and function as transcriptional regulators. It is well established that EBNA3A and EBNA3C cooperate in the regulation of cellular genes. Here, we demonstrate that the gene STK39 is repressed only by EBNA3A. This is the first example of a gene regulated only by EBNA3A in EBV-transformed lymphoblastoid cell lines (LCLs) without the help of EBNA3C. This was demonstrated using a variety of LCLs carrying either knockout, revertant, or conditional EBNA3 recombinants. Investigating the kinetics of EBNA3A-mediated changes in STK39 expression showed that STK39 becomes derepressed quickly after EBNA3A inactivation. This derepression is reversible as EBNA3A reactivation represses STK39 in the same cells expressing a conditional EBNA3A. STK39 is silenced shortly after primary B cell infection by EBV, and no STK39 -encoded protein (SPAK) is detected 3 weeks postinfection. Chromatin immunoprecipitation (ChIP) analysis indicates that EBNA3A directly binds to a regulatory region downstream of the STK39 transcription start site. For the first time, we demonstrated that the polycomb repressive complex 2 with the deposition of the repressive mark H3K27me3 is not only important for the maintenance of an EBNA3A target gene ( STK39 ) but is also essential for the initial establishment of its silencing. Finally, we showed that DNA methyltransferases are involved in the EBNA3A-mediated repression of STK39 IMPORTANCE EBV is well known for its ability to transform B lymphocytes to continuously proliferating lymphoblastoid cell lines. This is achieved in part by the reprogramming of cellular gene transcription by EBV transcription factors, including the EBNA3 proteins that play a crucial role in this process. In the present study, we found that EBNA3A epigenetically silences STK39 This

  6. High-level HIV-1 Nef transient expression in Nicotiana benthamiana using the P19 gene silencing suppressor protein of Artichoke Mottled Crinckle Virus

    Directory of Open Access Journals (Sweden)

    Bianco Linda

    2009-11-01

    Full Text Available Abstract Background In recent years, different HIV antigens have been successfully expressed in plants by either stable transformation or transient expression systems. Among HIV proteins, Nef is considered a promising target for the formulation of a multi-component vaccine due to its implication in the first steps of viral infection. Attempts to express Nef as a single protein product (not fused to a stabilizing protein in transgenic plants resulted in disappointingly low yields (about 0.5% of total soluble protein. In this work we describe a transient expression system based on co-agroinfiltration of plant virus gene silencing suppressor proteins in Nicotiana benthamiana, followed by a two-step affinity purification protocol of plant-derived Nef. Results The effect of three gene silencing viral suppressor proteins (P25 of Potato Virus X, P19 of either Artichoke Mottled Crinckle virus and Tomato Bushy Stunt virus on Nef transient expression yield was evaluated. The P19 protein of Artichoke Mottled Crinckle virus (AMCV-P19 gave the highest expression yield in vacuum co-agroinfiltration experiments reaching 1.3% of total soluble protein, a level almost three times higher than that previously reported in stable transgenic plants. The high yield observed in the co-agroinfiltrated plants was correlated to a remarkable decrease of Nef-specific small interfering RNAs (siRNAs indicating an effective modulation of RNA silencing mechanisms by AMCV-P19. Interestingly, we also showed that expression levels in top leaves of vacuum co-agroinfiltrated plants were noticeably reduced compared to bottom leaves. Moreover, purification of Nef from agroinfiltrated tissue was achieved by a two-step immobilized metal ion affinity chromatography protocol with yields of 250 ng/g of fresh tissue. Conclusion We demonstrated that expression level of HIV-1 Nef in plant can be improved using a transient expression system enhanced by the AMCV-P19 gene silencing suppressor

  7. The interaction between endogenous 30S ribosomal subunit protein S11 and Cucumber mosaic virus LS2b protein affects viral replication, infection and gene silencing suppressor activity.

    Directory of Open Access Journals (Sweden)

    Ruilin Wang

    Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.

  8. Silencing of the integrin-linked kinase gene suppresses the proliferation, migration and invasion of pancreatic cancer cells (Panc-1).

    Science.gov (United States)

    Zhu, Xiang-Yu; Liu, Ning; Liu, Wei; Song, Shao-Wei; Guo, Ke-Jian

    2012-04-01

    Integrin-linked kinase (ILK) is an ankyrin repeat-containing serine-threonine protein kinase that is involved in the regulation of integrin-mediated processes such as cancer cell proliferation, migration and invasion. In this study, we examined the effect of a lentivirus-mediated knockdown of ILK on the proliferation, migration and invasion of pancreatic cancer (Panc-1) cells. Immunohistochemical staining showed that ILK expression was enhanced in pancreatic cancer tissue. The silencing of ILK in human Panc-1 cells led to cell cycle arrest in the G0/G1 phase and delayed cell proliferation, in addition to down-regulating cell migration and invasion. The latter effects were mediated by up-regulating the expression of E-cadherin, a key protein in cell adhesion. These findings indicate that ILK may be a new diagnostic marker for pancreatic cancer and that silencing ILK could be a potentially useful therapeutic approach for treating pancreatic cancer.

  9. Silencing of the integrin-linked kinase gene suppresses the proliferation, migration and invasion of pancreatic cancer cells (Panc-1

    Directory of Open Access Journals (Sweden)

    Xiang-Yu Zhu

    2012-01-01

    Full Text Available Integrin-linked kinase (ILK is an ankyrin repeat-containing serine-threonine protein kinase that is involved in the regulation of integrin-mediated processes such as cancer cell proliferation, migration and invasion. In this study, we examined the effect of a lentivirus-mediated knockdown of ILK on the proliferation, migration and invasion of pancreatic cancer (Panc-1 cells. Immunohistochemical staining showed that ILK expression was enhanced in pancreatic cancer tissue. The silencing of ILK in human Panc-1 cells led to cell cycle arrest in the G0/G1 phase and delayed cell proliferation, in addition to down-regulating cell migration and invasion. The latter effects were mediated by up-regulating the expression of E-cadherin, a key protein in cell adhesion. These findings indicate that ILK may be a new diagnostic marker for pancreatic cancer and that silencing ILK could be a potentially useful therapeutic approach for treating pancreatic cancer.

  10. Tobacco rattle virus (TRV) based silencing of cotton enoyl-CoA reductase (ECR) gene and the role of very long chain fatty acids in normal leaf development and resistance to wilt disease

    Science.gov (United States)

    A Tobacco rattle virus (TRV) based virus-induced gene silencing (VIGS) assay was employed as a reverse genetic approach to study gene function in cotton (Gossypium hirsutum). This approach was used to investigate the function of Enoyl-CoA reductase (GhECR) in pathogen defense. Amino acid sequence al...

  11. Effect of the linkers between the zinc fingers in zinc finger protein 809 on gene silencing and nuclear localization

    Energy Technology Data Exchange (ETDEWEB)

    Ichida, Yu, E-mail: ichida-y@ncchd.go.jp; Utsunomiya, Yuko; Onodera, Masafumi

    2016-03-18

    Zinc finger protein 809 (ZFP809) belongs to the Kruppel-associated box-containing zinc finger protein (KRAB-ZFP) family and functions in repressing the expression of Moloney murine leukemia virus (MoMLV). ZFP809 binds to the primer-binding site (PBS)located downstream of the MoMLV-long terminal repeat (LTR) and induces epigenetic modifications at integration sites, such as repressive histone modifications and de novo DNA methylation. KRAB-ZFPs contain consensus TGEKP linkers between C2H2 zinc fingers. The phosphorylation of threonine residues within linkers leads to the inactivation of zinc finger binding to target sequences. ZFP809 also contains consensus linkers between zinc fingers. However, the function of ZFP809 linkers remains unknown. In the present study, we constructed ZFP809 proteins containing mutated linkers and examined their ability to silence transgene expression driven by MLV, binding ability to MLV PBS, and cellular localization. The results of the present study revealed that the linkers affected the ability of ZFP809 to silence transgene expression. Furthermore, this effect could be partly attributed to changes in the localization of ZFP809 proteins containing mutated linkers. Further characterization of ZFP809 linkers is required for understanding the functions and features of KRAB-ZFP-containing linkers. - Highlights: • ZFP809 has three consensus linkers between the zinc fingers. • Linkers are required for ZFP809 to silence transgene expression driven by MLV-LTR. • Linkers affect the precise nuclear localization of ZFP809.

  12. Intron-exon organization of the active human protein S gene PS. alpha. and its pseudogene PS. beta. : Duplication and silencing during primate evolution

    Energy Technology Data Exchange (ETDEWEB)

    Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.; Bertina, R.M. (University Hospital, Leiden (Netherlands))

    1990-08-28

    The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing of an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.

  13. Host-induced silencing of essential genes in Puccinia triticina through transgenic expression of RNAi sequences reduces severity of leaf rust infection in wheat.

    Science.gov (United States)

    Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus

    2018-05-01

    Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  14. Trichodiene Production in a Trichoderma harzianum erg1-Silenced Strain Provides Evidence of the Importance of the Sterol Biosynthetic Pathway in Inducing Plant Defense-Related Gene Expression.

    Science.gov (United States)

    Malmierca, M G; McCormick, S P; Cardoza, R E; Monte, E; Alexander, N J; Gutiérrez, S

    2015-11-01

    Trichoderma species are often used as biocontrol agents against plant-pathogenic fungi. A complex molecular interaction occurs among the biocontrol agent, the antagonistic fungus, and the plant. Terpenes and sterols produced by the biocontrol fungus have been found to affect gene expression in both the antagonistic fungus and the plant. The terpene trichodiene (TD) elicits the expression of genes related to tomato defense and to Botrytis virulence. We show here that TD itself is able to induce the expression of Botrytis genes involved in the synthesis of botrydial (BOT) and also induces terpene gene expression in Trichoderma spp. The terpene ergosterol, in addition to its role as a structural component of the fungal cell membranes, acts as an elicitor of defense response in plants. In the present work, using a transformant of T. harzianum, which is silenced in the erg1 gene and accumulates high levels of squalene, we show that this ergosterol precursor also acts as an important elicitor molecule of tomato defense-related genes and induces Botrytis genes involved in BOT biosynthesis, in both cases, in a concentration-dependent manner. Our data emphasize the importance of a balance of squalene and ergosterol in fungal interactions as well as in the biocontrol activity of Trichoderma spp.

  15. [On the role of selective silencer Freud-1 in the regulation of the brain 5-HT(1A) receptor gene expression].

    Science.gov (United States)

    Naumenko, V S; Osipova, D V; Tsybko, A S

    2010-01-01

    Selective 5-HT(1A) receptor silencer (Freud-1) is known to be one of the main factors for transcriptional regulation of brain serotonin 5-HT(1A) receptor. However, there is a lack of data on implication of Freud-1 in the mechanisms underlying genetically determined and experimentally altered 5-HT(1A) receptor system state in vivo. In the present study we have found a difference in the 5-HT(1A) gene expression in the midbrain of AKR and CBA inbred mouse strains. At the same time no distinction in Freud-1 expression was observed. We have revealed 90.3% of homology between mouse and rat 5-HT(1A) receptor DRE-element, whereas there was no difference in DRE-element sequence between AKR and CBA mice. This indicates the absence of differences in Freud-1 binding site in these mouse strains. In the model of 5-HT(1A) receptor desensitization produced by chronic 5-HT(1A) receptor agonist administration, a significant reduction of 5-HT(1A) receptor gene expression together with considerable increase of Freud-1 expression were found. These data allow us to conclude that the selective silencer of 5-HT(1A) receptor, Freud-1, is involved in the compensatory mechanisms that modulate the functional state of brain serotonin system, although it is not the only factor for 5-HT(1A) receptor transcriptional regulation.

  16. Citrus tristeza virus-based RNAi in citrus plants induces gene silencing in Diaphorina citri, a phloem-sap sucking insect vector of citrus greening disease (Huanglongbing).

    Science.gov (United States)

    Hajeri, Subhas; Killiny, Nabil; El-Mohtar, Choaa; Dawson, William O; Gowda, Siddarame

    2014-04-20

    A transient expression vector based on Citrus tristeza virus (CTV) is unusually stable. Because of its stability it is being considered for use in the field to control Huanglongbing (HLB), which is caused by Candidatus Liberibacter asiaticus (CLas) and vectored by Asian citrus psyllid, Diaphorina citri. In the absence of effective control strategies for CLas, emphasis has been on control of D. citri. Coincident cohabitation in phloem tissue by CLas, D. citri and CTV was exploited to develop a novel method to mitigate HLB through RNA interference (RNAi). Since CTV has three RNA silencing suppressors, it was not known if CTV-based vector could induce RNAi in citrus. Yet, expression of sequences targeting citrus phytoene desaturase gene by CTV-RNAi resulted in photo-bleaching phenotype. CTV-RNAi vector, engineered with truncated abnormal wing disc (Awd) gene of D. citri, induced altered Awd expression when silencing triggers ingested by feeding D. citri nymphs. Decreased Awd in nymphs resulted in malformed-wing phenotype in adults and increased adult mortality. This impaired ability of D. citri to fly would potentially limit the successful vectoring of CLas bacteria between citrus trees in the grove. CTV-RNAi vector would be relevant for fast-track screening of candidate sequences for RNAi-mediated pest control. Copyright © 2014. Published by Elsevier B.V.

  17. Histone Methylation and Epigenetic Silencing in Breast Cancer

    National Research Council Canada - National Science Library

    Simon, Jeffrey A; Lange, Carol A

    2008-01-01

    .... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...

  18. UV-C-Induced alleviation of transcriptional gene silencing through plant–plant communication: Key roles of jasmonic acid and salicylic acid pathways

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Wei; Wang, Ting [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China); Xu, Shaoxin [School of physics and materials science, Anhui University, Hefei, Anhui, 230601 (China); Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China); Bian, Po, E-mail: bianpo@ipp.ac.cn [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China)

    2016-08-15

    Highlights: • Transcriptional gene silencing (TGS) in plants can be epigenetically alleviated by volatile signals from UV-C- irradiated neighboring plants. • Alleviation of TGS can be induced by UV-C irradiation through plant–plant–plant communication. • JA and SA signals take part in interplant communication for alleviation of TGS. - Abstract: Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant–plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant–plant and plant–plant–plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant–plant and plant–plant–plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant–plant–plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA.

  19. Gene silencing of mannose 6-phosphate reductase in the parasitic weed Orobanche aegyptiaca through the production of homologous dsRNA sequences in the host plant.

    Science.gov (United States)

    Aly, Radi; Cholakh, Hila; Joel, Daniel M; Leibman, Diana; Steinitz, Benjamin; Zelcer, Aaron; Naglis, Anna; Yarden, Oded; Gal-On, Amit

    2009-08-01

    Orobanche spp. (broomrape) are parasitic plants which subsist on the roots of a wide range of hosts, including tomato, causing severe losses in yield quality and quantity. Large amounts of mannitol accumulate in this parasitic weed during development. Mannose 6-phosphate reductase (M6PR) is a key enzyme in mannitol biosynthesis, and it has been suggested that mannitol accumulation may be very important for Orobanche development. Therefore, the Orobanche M6PR gene is a potential target for efforts to control this parasite. Transgenic tomato plants were produced bearing a gene construct containing a specific 277-bp fragment from Orobanche aegyptiaca M6PR-mRNA, in an inverted-repeat configuration. M6PR-siRNA was detected in three independent transgenic tomato lines in the R1 generation, but was not detected in the parasite. Quantitative RT-PCR analysis showed that the amount of endogenous M6PR mRNA in the tubercles and underground shoots of O. aegyptiaca grown on transgenic host plants was reduced by 60%-80%. Concomitant with M6PR mRNA suppression, there was a significant decrease in mannitol level and a significant increase in the percentage of dead O. aegyptiaca tubercles on the transgenic host plants. The detection of mir390, which is involved with cytoplasmic dsRNA processing, is the first indication of the existence of gene-silencing mechanisms in Orobanche spp. Gene silencing mechanisms are probably involved with the production of decreased levels of M6PR mRNA in the parasites grown on the transformed tomato lines.

  20. Small RNAs were involved in homozygous state-associated silencing of a marker gene (Neomycin phosphotransferase II: nptII) in transgenic tomato plants.

    Science.gov (United States)

    Deng, Lei; Pan, Yu; Chen, Xuqing; Chen, Guoping; Hu, Zongli

    2013-07-01

    Homozygous state-associated co-suppression is not a very common phenomenon. In our experiments, two transgenic plants 3A29 and 1195A were constructed by being transformed with the constructs pBIN-353A and pBIN119A containing nptII gene as a marker respectively. The homozygous progeny from these two independent transgenic lines 3A29 and 1195A, displayed kanamycin-sensitivity and produced a short main root without any lateral roots as untransformed control (wild-type) seedlings when germinated on kanamycin media. For the seedlings derived from putative hemizygous plants, the percentage of the seedlings showing normal growth on kanamycin media was about 50% and lower than the expected percentage (75%). Southern analysis of the genomic DNA confirmed that the homozygous and hemizygous plants derived from the same lines contained the same multiple nptII transgenes, which were located on the same site of chromosome. Northern analysis suggested that the marker nptII gene was expressed in the primary and the hemizygous transformants, but it was silenced in the homozygous transgenic plants. Further Northern analysis indicated that antisense and sense small nptII-derived RNAs were present in the transgenic plants and the blotting signal of nptII-derived small RNA was much higher in the homozygous transgenic plants than that of hemizygous transgenic plants. Additionally, read-through transcripts from the TRAMP gene to the nptII gene were detected. These results suggest that the read-through transcripts may be involved in homozygous state-associated silencing of the nptII transgene in transgenic tomato plants and a certain threshold level of the nptII-derived small RNAs is required for the homozygous state-associated co-suppression of the nptII transgene. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  1. UV-C-Induced alleviation of transcriptional gene silencing through plant–plant communication: Key roles of jasmonic acid and salicylic acid pathways

    International Nuclear Information System (INIS)

    Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po

    2016-01-01

    Highlights: • Transcriptional gene silencing (TGS) in plants can be epigenetically alleviated by volatile signals from UV-C- irradiated neighboring plants. • Alleviation of TGS can be induced by UV-C irradiation through plant–plant–plant communication. • JA and SA signals take part in interplant communication for alleviation of TGS. - Abstract: Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant–plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant–plant and plant–plant–plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant–plant and plant–plant–plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant–plant–plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA.

  2. Surface coating of siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers: enhanced gene silencing and reduced adverse effects in vitro

    Science.gov (United States)

    Zeng, Xianghui; de Groot, Anne Marit; Sijts, Alice J. A. M.; Broere, Femke; Oude Blenke, Erik; Colombo, Stefano; van Eden, Willem; Franzyk, Henrik; Nielsen, Hanne Mørck; Foged, Camilla

    2015-11-01

    Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine and homoarginine residues was shown to self-assemble with small interfering RNA (siRNA). The resulting well-defined nanocomplexes were coated with anionic lipids giving rise to net anionic liposomes. These complexes and the corresponding liposomes were optimized towards efficient gene silencing and low adverse effects. The optimal anionic liposomes mediated a high silencing effect, which was comparable to that of the control (cationic Lipofectamine 2000), and did not display any noticeable cytotoxicity and immunogenicity in vitro. In contrast, the corresponding nanocomplexes mediated a reduced silencing effect with a more narrow safety window. The surface coating with anionic lipid bilayers led to partial decomplexation of the siRNA-peptidomimetic nanocomplex core of the liposomes, which facilitated siRNA release. Additionally, the optimal anionic liposomes showed efficient intracellular uptake and endosomal escape. Therefore, these findings suggest that a more efficacious and safe formulation can be achieved by surface coating of the siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers.Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine

  3. Changing expression of vertebrate immunity genes in an anthropogenic environment: a controlled experiment.

    Science.gov (United States)

    Hablützel, Pascal I; Brown, Martha; Friberg, Ida M; Jackson, Joseph A

    2016-09-01

    The effect of anthropogenic environments on the function of the vertebrate immune system is a problem of general importance. For example, it relates to the increasing rates of immunologically-based disease in modern human populations and to the desirability of identifying optimal immune function in domesticated animals. Despite this importance, our present understanding is compromised by a deficit of experimental studies that make adequately matched comparisons between wild and captive vertebrates. We transferred post-larval fishes (three-spined sticklebacks), collected in the wild, to an anthropogenic (captive) environment. We then monitored, over 11 months, how the systemic expression of immunity genes changed in comparison to cohort-matched wild individuals in the originator population (total n = 299). We found that a range of innate (lyz, defbl2, il1r-like, tbk1) and adaptive (cd8a, igmh) immunity genes were up-regulated in captivity, accompanied by an increase in expression of the antioxidant enzyme, gpx4a. For some genes previously known to show seasonality in the wild, this appeared to be reduced in captive fishes. Captive fishes tended to express immunity genes, including igzh, foxp3b, lyz, defbl2, and il1r-like, more variably. Furthermore, although gene co-expression patterns (analyzed through gene-by-gene correlations and mutual information theory based networks) shared common structure in wild and captive fishes, there was also significant divergence. For one gene in particular, defbl2, high expression was associated with adverse health outcomes in captive fishes. Taken together, these results demonstrate widespread regulatory changes in the immune system in captive populations, and that the expression of immunity genes is more constrained in the wild. An increase in constitutive systemic immune activity, such as we observed here, may alter the risk of immunopathology and contribute to variance in health in vertebrate populations exposed to

  4. The immune gene repertoire of an important viral reservoir, the Australian black flying fox

    Directory of Open Access Journals (Sweden)

    Papenfuss Anthony T

    2012-06-01

    Full Text Available Abstract Background Bats are the natural reservoir host for a range of emerging and re-emerging viruses, including SARS-like coronaviruses, Ebola viruses, henipaviruses and Rabies viruses. However, the mechanisms responsible for the control of viral replication in bats are not understood and there is little information available on any aspect of antiviral immunity in bats. Massively parallel sequencing of the bat transcriptome provides the opportunity for rapid gene discovery. Although the genomes of one megabat and one microbat have now been sequenced to low coverage, no transcriptomic datasets have been reported from any bat species. In this study, we describe the immune transcriptome of the Australian flying fox, Pteropus alecto, providing an important resource for identification of genes involved in a range of activities including antiviral immunity. Results Towards understanding the adaptations that have allowed bats to coexist with viruses, we have de novo assembled transcriptome sequence from immune tissues and stimulated cells from P. alecto. We identified about 18,600 genes involved in a broad range of activities with the most highly expressed genes involved in cell growth and maintenance, enzyme activity, cellular components and metabolism and energy pathways. 3.5% of the bat transcribed genes corresponded to immune genes and a total of about 500 immune genes were identified, providing an overview of both innate and adaptive immunity. A small proportion of transcripts found no match with annotated sequences in any of the public databases and may represent bat-specific transcripts. Conclusions This study represents the first reported bat transcriptome dataset and provides a survey of expressed bat genes that complement existing bat genomic data. In addition, these data provide insight into genes relevant to the antiviral responses of bats, and form a basis for examining the roles of these molecules in immune response to viral infection.

  5. The tumor suppressors p33ING1 and p33ING2 interact with alien in vivo and enhance alien-mediated gene silencing.

    Science.gov (United States)

    Fegers, Inga; Kob, Robert; Eckey, Maren; Schmidt, Oliver; Goeman, Frauke; Papaioannou, Maria; Escher, Niko; von Eggeling, Ferdinand; Melle, Christian; Baniahmad, Aria

    2007-11-01

    The tumor suppressor p33ING1 is involved in DNA repair and cell cycle regulation. Furthermore, p33ING1 is a transcriptional silencer that recognizes the histone mark for trimethylated lysine 4 at histone H3. Interestingly, expression of p33ING1 and p33ING2 is able to induce premature senescence in primary human fibroblasts. The corepressor Alien is involved in gene silencing mediated by selected members of nuclear hormone receptors. In addition, Alien acts as a corepressor for E2F1, a member of the E2F cell cycle regulatory family. Furthermore, recent findings suggest that Alien is complexed with transcription factors participating in DNA repair and chromatin. Here, using a proteomic approach by surface-enhanced laser desorption ionization and mass spectrometry (SELDI-MS) combined with immunological techniques, we show that Alien interacts in vivo with the tumor suppressor p33ING1 as well as with the related tumor suppressor candidate p33ING2. The interaction of Alien with p33ING1 and p33ING2 was confirmed in vitro with GST-pull-down, suggesting a direct binding of Alien to these factors. The binding domain was mapped to a central region of Alien. Functionally, the expression of p33ING1 or p33ING2 enhances the Alien-mediated silencing, suggesting that the interaction plays a role in transcriptional regulation. Thus, the findings suggest that the identified interaction between Alien and the tumor suppressors p33ING1 and p33ING2 reveals a novel cellular protein network.

  6. The Drosophila Su(var)3-7 gene is required for oogenesis and female fertility, genetically interacts with piwi and aubergine, but impacts only weakly transposon silencing.

    Science.gov (United States)

    Basquin, Denis; Spierer, Anne; Begeot, Flora; Koryakov, Dmitry E; Todeschini, Anne-Laure; Ronsseray, Stéphane; Vieira, Cristina; Spierer, Pierre; Delattre, Marion

    2014-01-01

    Heterochromatin is made of repetitive sequences, mainly transposable elements (TEs), the regulation of which is critical for genome stability. We have analyzed the role of the heterochromatin-associated Su(var)3-7 protein in Drosophila ovaries. We present evidences that Su(var)3-7 is required for correct oogenesis and female fertility. It accumulates in heterochromatic domains of ovarian germline and somatic cells nuclei, where it co-localizes with HP1. Homozygous mutant females display ovaries with frequent degenerating egg-chambers. Absence of Su(var)3-7 in embryos leads to defects in meiosis and first mitotic divisions due to chromatin fragmentation or chromosome loss, showing that Su(var)3-7 is required for genome integrity. Females homozygous for Su(var)3-7 mutations strongly impair repression of P-transposable element induced gonadal dysgenesis but have minor effects on other TEs. Su(var)3-7 mutations reduce piRNA cluster transcription and slightly impact ovarian piRNA production. However, this modest piRNA reduction does not correlate with transposon de-silencing, suggesting that the moderate effect of Su(var)3-7 on some TE repression is not linked to piRNA production. Strikingly, Su(var)3-7 genetically interacts with the piwi and aubergine genes, key components of the piRNA pathway, by strongly impacting female fertility without impairing transposon silencing. These results lead us to propose that the interaction between Su(var)3-7 and piwi or aubergine controls important developmental processes independently of transposon silencing.

  7. The Drosophila Su(var)3–7 Gene Is Required for Oogenesis and Female Fertility, Genetically Interacts with piwi and aubergine, but Impacts Only Weakly Transposon Silencing

    Science.gov (United States)

    Begeot, Flora; Koryakov, Dmitry E.; Todeschini, Anne-Laure; Ronsseray, Stéphane; Vieira, Cristina; Spierer, Pierre; Delattre, Marion

    2014-01-01

    Heterochromatin is made of repetitive sequences, mainly transposable elements (TEs), the regulation of which is critical for genome stability. We have analyzed the role of the heterochromatin-associated Su(var)3–7 protein in Drosophila ovaries. We present evidences that Su(var)3–7 is required for correct oogenesis and female fertility. It accumulates in heterochromatic domains of ovarian germline and somatic cells nuclei, where it co-localizes with HP1. Homozygous mutant females display ovaries with frequent degenerating egg-chambers. Absence of Su(var)3–7 in embryos leads to defects in meiosis and first mitotic divisions due to chromatin fragmentation or chromosome loss, showing that Su(var)3–7 is required for genome integrity. Females homozygous for Su(var)3–7 mutations strongly impair repression of P-transposable element induced gonadal dysgenesis but have minor effects on other TEs. Su(var)3–7 mutations reduce piRNA cluster transcription and slightly impact ovarian piRNA production. However, this modest piRNA reduction does not correlate with transposon de-silencing, suggesting that the moderate effect of Su(var)3–7 on some TE repression is not linked to piRNA production. Strikingly, Su(var)3–7 genetically interacts with the piwi and aubergine genes, key components of the piRNA pathway, by strongly impacting female fertility without impairing transposon silencing. These results lead us to propose that the interaction between Su(var)3–7 and piwi or aubergine controls important developmental processes independently of transposon silencing. PMID:24820312

  8. Enhancement of allele discrimination by introduction of nucleotide mismatches into siRNA in allele-specific gene silencing by RNAi.

    Directory of Open Access Journals (Sweden)

    Yusuke Ohnishi

    Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense

  9. Manipulating the in vivo immune response by targeted gene knockdown.

    Science.gov (United States)

    Lieberman, Judy

    2015-08-01

    Aptamers, nucleic acids selected for high affinity binding to proteins, can be used to activate or antagonize immune mediators or receptors in a location and cell-type specific manner and to enhance antigen presentation. They can also be linked to other molecules (other aptamers, siRNAs or miRNAs, proteins, toxins) to produce multifunctional compounds for targeted immune modulation in vivo. Aptamer-siRNA chimeras (AsiCs) that induce efficient cell-specific knockdown in immune cells in vitro and in vivo can be used as an immunological research tool or potentially as an immunomodulating therapeutic. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Silencing a sugar transporter gene reduces growth and fecundity in the brown planthopper, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae).

    Science.gov (United States)

    Ge, Lin-Quan; Jiang, Yi-Ping; Xia, Ting; Song, Qi-Sheng; Stanley, David; Kuai, Peng; Lu, Xiu-Li; Yang, Guo-Qing; Wu, Jin-Cai

    2015-07-17

    The brown planthopper (BPH), Nilaparvata lugens, sugar transporter gene 6 (Nlst6) is a facilitative glucose/fructose transporter (often called a passive carrier) expressed in midgut that mediates sugar transport from the midgut lumen to hemolymph. The influence of down regulating expression of sugar transporter genes on insect growth, development, and fecundity is unknown. Nonetheless, it is reasonable to suspect that transporter-mediated uptake of dietary sugar is essential to the biology of phloem-feeding insects. Based on this reasoning, we posed the hypothesis that silencing, or reducing expression, of a BPH sugar transporter gene would be deleterious to the insects. To test our hypothesis, we examined the effects of Nlst6 knockdown on BPH biology. Reducing expression of Nlst6 led to profound effects on BPHs. It significantly prolonged the pre-oviposition period, shortened the oviposition period, decreased the number of eggs deposited and reduced body weight, compared to controls. Nlst6 knockdown also significantly decreased fat body and ovarian (particularly vitellogenin) protein content as well as vitellogenin gene expression. Experimental BPHs accumulated less fat body glucose compared to controls. We infer that Nlst6 acts in BPH growth and fecundity, and has potential as a novel target gene for control of phloem-feeding pest insects.

  11. The identification of a gene (Cwp1), silenced during Solanum evolution, which causes cuticle microfissuring and dehydration when expressed in tomato fruit.

    Science.gov (United States)

    Hovav, Ran; Chehanovsky, Noam; Moy, Michal; Jetter, Reinhard; Schaffer, Arthur A

    2007-11-01

    One of the most intriguing phenomena of fleshy fruit is the ability to maintain high water content at maturity, even following harvest. This is accomplished by a fruit cuticle that is highly impermeable to water diffusion. In this paper, we report on a novel genotype of tomato, developed via introgression from the wild species Solanum habrochaites, which is characterized by microfissuring of the fruit cuticle and dehydration of the mature fruit. The microfissure/dehydration phenotype is inherited as a single gene, termed Cwp1 (cuticular water permeability). The gene was fine mapped, and its identity was determined by map-based cloning and differential expression analysis in near-isogenic lines. Causality of the Cwp1 gene was shown by the heterologous transgenic expression of the gene in the cultivated tomato, which caused a microfissured fruit cuticle leading to dehydrated fruit. Cwp1 encodes for a protein of unidentified function in the DUF833 domain family. The gene is expressed in the fruit epidermis of the dehydrating genotype harbouring the wild-species introgression, but not in the cultivated tomato. It is expressed only in the primitive green-fruited wild tomato species, but is not expressed in the cultivated Solanum lycopersicum and the closely related Solanum cheesmaniae and Solanum pimpinellifolium, indicating a pre-adaptive role for Cwp1 silencing in the evolution and domestication of the cultivated tomato.

  12. Identification of Immunity Related Genes to Study the Physalis peruviana – Fusarium oxysporum Pathosystem

    Science.gov (United States)

    Enciso-Rodríguez, Felix E.; González, Carolina; Rodríguez, Edwin A.; López, Camilo E.; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

    2013-01-01

    The Cape gooseberry ( Physalis peruviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P . peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC–NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance. PMID:23844210

  13. Identification of immunity related genes to study the Physalis peruviana--Fusarium oxysporum pathosystem.

    Science.gov (United States)

    Enciso-Rodríguez, Felix E; González, Carolina; Rodríguez, Edwin A; López, Camilo E; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

    2013-01-01

    The Cape gooseberry (Physalisperuviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P. peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC-NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance.

  14. Identification of immunity related genes to study the Physalis peruviana--Fusarium oxysporum pathosystem.

    Directory of Open Access Journals (Sweden)

    Felix E Enciso-Rodríguez

    Full Text Available The Cape gooseberry (Physalisperuviana L is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site, CC (Coiled-Coil, TIR (Toll/Interleukin-1 Receptor. We identified 74 immunity related gene candidates in P. peruviana which have the typical resistance gene (R-gene architecture, 17 Receptor like kinase (RLKs candidates related to PAMP-Triggered Immunity (PTI, eight (TIR-NBS-LRR, or TNL and nine (CC-NBS-LRR, or CNL candidates related to Effector-Triggered Immunity (ETI genes among others. These candidate genes were categorized by molecular function (98%, biological process (85% and cellular component (79% using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance.

  15. Epigenetic silencing of apoptosis-inducing gene expression can be efficiently overcome by combined SAHA and TRAIL treatment in uterine sarcoma cells.

    Directory of Open Access Journals (Sweden)

    Leopold F Fröhlich

    Full Text Available The lack of knowledge about molecular pathology of uterine sarcomas with a representation of 3-7% of all malignant uterine tumors prevents the establishment of effective therapy protocols. Here, we explored advanced therapeutic options to the previously discovered antitumorigenic effects of the histone deacetylase (HDAC inhibitor suberoylanilide hydroxamic acid (SAHA by combined treatment with the tumor necrosis factor-related apoptosis-inducing ligand (TRAIL/Apo-2L. In addition, we investigated the uterine sarcoma cell lines, MES-SA and ESS-1, regarding the underlying molecular mechanisms of SAHA and TRAIL-induced apoptosis and their resistance towards TRAIL. Compared to single SAHA or TRAIL treatment, the combination of SAHA with TRAIL led to complete cell death of both tumor cell lines after 24 to 48 hours. In contrast to single SAHA treatment, apoptosis occured faster and was more pronounced in ESS-1 cells than in MES-SA cells. Induction of SAHA- and TRAIL-induced apoptosis was accompanied by upregulation of the intrinsic apoptotic pathway via reduction of mitochondrial membrane potential, caspase-3, -6, and -7 activation, and PARP cleavage, but was also found to be partially caspase-independent. Apoptosis resistance was caused by reduced expression of caspase-8 and DR 4/TRAIL-R1 in ESS-1 and MES-SA cells, respectively, due to epigenetic silencing by DNA hypermethylation of gene promoter sequences. Treatment with the demethylating agent 5-Aza-2'-deoxycytidine or gene transfer therefore restored gene expression and increased the sensitivity of both cell lines against TRAIL-induced apoptosis. Our data provide evidence that deregulation of epigenetic silencing by histone acetylation and DNA hypermethylation might play a fundamental role in the origin of uterine sarcomas. Therefore, tumor growth might be efficiently overcome by a cytotoxic combinatorial treatment of HDAC inhibitors with TRAIL.

  16. Computational analysis of siRNA recognition by the Ago2 PAZ domain and identification of the determinants of RNA-induced gene silencing.

    Directory of Open Access Journals (Sweden)

    Mahmoud Kandeel

    Full Text Available RNA interference (RNAi is a highly specialized process of protein-siRNA interaction that results in the regulation of gene expression and cleavage of target mRNA. The PAZ domain of the Argonaute proteins binds to the 3' end of siRNA, and during RNAi the attaching end of the siRNA switches between binding and release from its binding pocket. This biphasic interaction of the 3' end of siRNA with the PAZ domain is essential for RNAi activity; however, it remains unclear whether stronger or weaker binding with PAZ domain will facilitate or hinder the overall RNAi process. Here we report the correlation between the binding of modified siRNA 3' overhang analogues and their in vivo RNAi efficacy. We found that higher RNAi efficacy was associated with the parameters of lower Ki value, lower total intermolecular energy, lower free energy, higher hydrogen bonding, smaller total surface of interaction and fewer van der Waals interactions. Electrostatic interaction was a minor contributor to compounds recognition, underscoring the presence of phosphate groups in the modified analogues. Thus, compounds with lower binding affinity are associated with better gene silencing. Lower binding strength along with the smaller interaction surface, higher hydrogen bonding and fewer van der Waals interactions were among the markers for favorable RNAi activity. Within the measured parameters, the interaction surface, van der Waals interactions and inhibition constant showed a statistically significant correlation with measured RNAi efficacy. The considerations provided in this report will be helpful in the design of new compounds with better gene silencing ability.

  17. Genetic variability and evolutionary implications of RNA silencing suppressor genes in RNA1 of sweet potato chlorotic stunt virus isolates infecting sweetpotato and related wild species.

    Directory of Open Access Journals (Sweden)

    Arthur K Tugume

    Full Text Available BACKGROUND: The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae encodes a Class 1 RNase III (RNase3, a putative hydrophobic protein (p7 and a 22-kDa protein (p22 from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. METHODOLOGY/PRINCIPAL FINDINGS: Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b encoding an RNase3 homolog (<56% identity to SPCSV RNase3 able to suppresses sense-mediated RNA silencing was detected in I. sinensis. CONCLUSIONS/SIGNIFICANCE: SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in

  18. Double-stranded RNA uptake through topical application, mediates silencing of five CYP4 genes and suppresses insecticide resistance in Diaphorina citri.

    Science.gov (United States)

    Killiny, Nabil; Hajeri, Subhas; Tiwari, Siddharth; Gowda, Siddarame; Stelinski, Lukasz L

    2014-01-01

    Silencing of genes through RNA interference (RNAi) in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4) in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa) in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.

  19. Double-stranded RNA uptake through topical application, mediates silencing of five CYP4 genes and suppresses insecticide resistance in Diaphorina citri.

    Directory of Open Access Journals (Sweden)

    Nabil Killiny

    Full Text Available Silencing of genes through RNA interference (RNAi in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4 in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.

  20. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  1. Inducible defenses stay up late: temporal patterns of immune gene expression in Tenebrio molitor.

    Science.gov (United States)

    Johnston, Paul R; Makarova, Olga; Rolff, Jens

    2013-12-06

    The course of microbial infection in insects is shaped by a two-stage process of immune defense. Constitutive defenses, such as engulfment and melanization, act immediately and are followed by inducible defenses, archetypically the production of antimicrobial peptides, which eliminate or suppress the remaining microbes. By applying RNAseq across a 7-day time course, we sought to characterize the long-lasting immune response to bacterial challenge in the mealworm beetle Tenebrio molitor, a model for the biochemistry of insect immunity and persistent bacterial infection. By annotating a hybrid de novo assembly of RNAseq data, we were able to identify putative orthologs for the majority of components of the conserved insect immune system. Compared with Tribolium castaneum, the most closely related species with a reference genome sequence and a manually curated immune system annotation, the T. molitor immune gene count was lower, with lineage-specific expansions of genes encoding serine proteases and their countervailing inhibitors accounting for the majority of the deficit. Quantitative mapping of RNAseq reads to the reference assembly showed that expression of genes with predicted functions in cellular immunity, wound healing, melanization, and the production of reactive oxygen species was transiently induced immediately after immune challenge. In contrast, expression of genes encoding antimicrobial peptides or components of the Toll signaling pathway and iron sequestration response remained elevated for at least 7 days. Numerous genes involved in metabolism and nutrient storage were repressed, indicating a possible cost of immune induction. Strikingly, the expression of almost all antibacterial peptides followed the same pattern of long-lasting induction, regardless of their spectra of activity, signaling possible interactive roles in vivo. Copyright © 2014 Johnston et al.

  2. Analysis of immune-related genes during Nora virus infection of Drosophila melanogaster using next generation sequencing.

    Science.gov (United States)

    Lopez, Wilfredo; Page, Alexis M; Carlson, Darby J; Ericson, Brad L; Cserhati, Matyas F; Guda, Chittibabu; Carlson, Kimberly A

    2018-01-01

    Drosophila melanogaster depends upon the innate immune system to regulate and combat viral infection. This is a complex, yet widely conserved process that involves a number of immune pathways and gene interactions. In addition, expression of genes involved in immunity are differentially regulated as the organism ages. This is particularly true for viruses that demonstrate chronic infection, as is seen with Nora virus. Nora virus is a persistent non-pathogenic virus that replicates in a horizontal manner in D. melanogaster . The genes involved in the regulation of the immune response to Nora virus infection are largely unknown. In addition, the temporal response of immune response genes as a result of infection has not been examined. In this study, D. melanogaster either infected with Nora virus or left uninfected were aged for 2, 10, 20 and 30 days. The RNA from these samples was analyzed by next generation sequencing (NGS) and the resulting immune-related genes evaluated by utilizing both the PANTHER and DAVID databases, as well as comparison to lists of immune related genes and FlyBase. The data demonstrate that Nora virus infected D. melanogaster exhibit an increase in immune related gene expression over time. In addition, at day 30, the data demonstrate that a persistent immune response may occur leading to an upregulation of specific immune response genes. These results demonstrate the utility of NGS in determining the potential immune system genes involved in Nora virus replication, chronic infection and involvement of antiviral pathways.

  3. Effects of PKM2 Gene Silencing on the Proliferation and Apoptosis of Colorectal Cancer LS-147T and SW620 Cells

    Directory of Open Access Journals (Sweden)

    Ran Ao

    2017-07-01

    Full Text Available Background/Aims: This paper aims to explore the effects of pyruvate kinase (PK M2 gene silencing on the proliferation and apoptosis of colorectal cancer (CRC LS-147T and SW620 cells. Methods: CRC LS-147T and SW620 cells highly expressing PKM2 were randomly selected by quantitative real-time polymerase chain reaction (qRT-PCR and then assigned into the blank (no transfection, PKM2-shRNA (transfection with shRNA and empty plasmid (transfection with empty plasmid groups. Immunofluorescence was applied to detect PKM2 protein expression. qRT-PCR and Western blotting were conducted to assess mRNA and protein expression of PKM2, p53 and p21. The cell counting kit-8 (CCK-8 assay was used to assess cell proliferation. Flow cytometry was used to assess the cell cycle and apoptosis rate, and a senescence-associated β-galactosidase staining kit was used to assess cell senescence. Results: PKM2 exhibited high mRNA expression among CRC LS-147T and SW620 cells with remarkable protein expression noted in the cytoplasm and nucleus. The PKM2-shRNA group exhibited reduced PKM2 mRNA and protein expression, whereas p53 and p21 expression was increased compared with the blank and empty plasmid groups. Cell proliferation in PKM2-shRNA cells decreased significantly compared with the blank group and empty plasmid groups. The PKM2-shRNA group exhibited more cells in the G1 phase and fewer cells in the G2/M phase compared with the blank and empty plasmid groups. In addition, the PKM2-shRNA group exhibited significantly increased apoptosis rates and β-galactosidase activity compared with the blank and empty plasmid groups. Conclusion: Our study demonstrates that PKM2 gene silencing suppresses proliferation and promotes apoptosis in LS-147T and SW620 cells.

  4. Silencing of HaAce1 gene by host-delivered artificial microRNA disrupts growth and development of Helicoverpa armigera.

    Science.gov (United States)

    Saini, Ravi Prakash; Raman, Venkat; Dhandapani, Gurusamy; Malhotra, Era Vaidya; Sreevathsa, Rohini; Kumar, Polumetla Ananda; Sharma, Tilak R; Pattanayak, Debasis

    2018-01-01

    The polyphagous insect-pest, Helicoverpa armigera, is a serious threat to a number of economically important crops. Chemical application and/or cultivation of Bt transgenic crops are the two strategies available now for insect-pest management. However, environmental pollution and long-term sustainability are major concerns against these two options. RNAi is now considered as a promising technology to complement Bt to tackle insect-pests menace. In this study, we report host-delivered silencing of HaAce1 gene, encoding the predominant isoform of H. armigera acetylcholinesterase, by an artificial microRNA, HaAce1-amiR1. Arabidopsis pre-miRNA164b was modified by replacing miR164b/miR164b* sequences with HaAce1-amiR1/HaAce1-amiR1* sequences. The recombinant HaAce1-preamiRNA1 was put under the control of CaMV 35S promoter and NOS terminator of plant binary vector pBI121, and the resultant vector cassette was used for tobacco transformation. Two transgenic tobacco lines expressing HaAce1-amiR1 was used for detached leaf insect feeding bioassays. Larval mortality of 25% and adult deformity of 20% were observed in transgenic treated insect group over that control tobacco treated insect group. The reduction in the steady-state level of HaAce1 mRNA was 70-80% in the defective adults compared to control. Our results demonstrate promise for host-delivered amiRNA-mediated silencing of HaAce1 gene for H. armigera management.

  5. Specific gene expression responses to parasite genotypes reveal redundancy of innate immunity in vertebrates.

    Directory of Open Access Journals (Sweden)

    David Haase

    Full Text Available Vertebrate innate immunity is the first line of defense against an invading pathogen and has long been assumed to be largely unspecific with respect to parasite/pathogen species. However, recent phenotypic evidence suggests that immunogenetic variation, i.e. allelic variability in genes associated with the immune system, results in host-parasite genotype-by-genotype interactions and thus specific innate immune responses. Immunogenetic variation is common in all vertebrate taxa and this reflects an effective immunological function in complex environments. However, the underlying variability in host gene expression patterns as response of innate immunity to within-species genetic diversity of macroparasites in vertebrates is unknown. We hypothesized that intra-specific variation among parasite genotypes must be reflected in host gene expression patterns. Here we used high-throughput RNA-sequencing to examine the effect of parasite genotypes on gene expression patterns of a vertebrate host, the three-spined stickleback (Gasterosteus aculeatus. By infecting naïve fish with distinct trematode genotypes of the species Diplostomum pseudospathaceum we show that gene activity of innate immunity in three-spined sticklebacks depended on the identity of an infecting macroparasite genotype. In addition to a suite of genes indicative for a general response against the trematode we also find parasite-strain specific gene expression, in particular in the complement system genes, despite similar infection rates of single clone treatments. The observed discrepancy between infection rates and gene expression indicates the presence of alternative pathways which execute similar functions. This suggests that the innate immune system can induce redundant responses specific to parasite genotypes.

  6. Silencing of the pollen-specific gene NTP303 and its family members in tobacco affects in vivo pollen tube growth and results in male sterile plants.

    Science.gov (United States)

    de Groot, Peter; Weterings, Koen; de Been, Mark; Wittink, Floyd; Hulzink, Raymond; Custers, Jan; van Herpen, Marinus; Wullems, George

    2004-07-01

    In seed plants, successful fertilization requires correct regulation of pollen tube growth. At germination and during growth, the pollen tube interacts with tissues from the pistil while the pollen tube extends via tip growth. Despite the fact that much research has been devoted to the mechanisms regulating pollen tube growth, many aspects are currently unknown. Previously, we have isolated a pollen-specific gene from tobacco--NTP303--that probably functions during pollen tube growth. NTP303 is part of a family of five members. Its expression is regulated both at the transcriptional and at the translational level. While NTP303 transcripts accumulate to high levels between early bi-cellular and mature pollen stages, NTP303 protein is hardly detectable until germination and pollen tube growth. In order to elucidate the role and function of NTP303 in the pollen tube, we studied the effect of NTP303 gene silencing on pollen function. Therefore, we have transformed tobacco plants with NTP303 co-suppression and anti-sense gene constructs. In these plants, the kanamycin resistance trait--which was linked to the NTP303-silencing gene--was not transmitted through the male gametophyte. This indicated that lowering the transcript level of NTP303 and/or its family members interferes with pollen function. Because we could not find a readily distinguishable phenotype in pollen from the hemizygous anti-sense and co-suppression plants, we rescued the defective pollen to produce doubled haploid plants that were homozygous for the NTP303 anti-sense gene. We found that in pollen from these plants the transcript levels of all NTP303 family members were reduced. Although pollen and pollen tubes from these plants appeared completely normal in vitro, the pollen tubes showed slower growth rates in vivo and arrested in the style before they reached the ovary, so that fertilization failed. These data demonstrate that NTP303 and its family members are essential for normal pollen tube growth

  7. Immunization

    Science.gov (United States)

    ... a lot worse. Some are even life-threatening. Immunization shots, or vaccinations, are essential. They protect against ... B, polio, tetanus, diphtheria, and pertussis (whooping cough). Immunizations are important for adults as well as children. ...

  8. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

    NARCIS (Netherlands)

    Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.

  9. Pre-silencing of genes involved in the electron transport chain (ETC) pathway is associated with responsiveness to abatacept in rheumatoid arthritis.

    Science.gov (United States)

    Derambure, C; Dzangue-Tchoupou, G; Berard, C; Vergne, N; Hiron, M; D'Agostino, M A; Musette, P; Vittecoq, O; Lequerré, T

    2017-05-25

    In the current context of personalized medicine, one of the major challenges in the management of rheumatoid arthritis (RA) is to identify biomarkers that predict drug responsiveness. From the European APPRAISE trial, our main objective was to identify a gene expression profile associated with responsiveness to abatacept (ABA) + methotrexate (MTX) and to understand the involvement of this signature in the pathophysiology of RA. Whole human genome microarrays (4 × 44 K) were performed from a first subset of 36 patients with RA. Data validation by quantitative reverse-transcription (qRT)-PCR was performed from a second independent subset of 32 patients with RA. Gene Ontology and WikiPathways database allowed us to highlight the specific biological mechanisms involved in predicting response to ABA/MTX. From the first subset of 36 patients with RA, a combination including 87 transcripts allowed almost perfect separation between responders and non-responders to ABA/MTX. Next, the second subset of patients 32 with RA allowed validation by qRT-PCR of a minimal signature with only four genes. This latter signature categorized 81% of patients with RA with 75% sensitivity, 85% specificity and 85% negative predictive value. This combination showed a significant enrichment of genes involved in electron transport chain (ETC) pathways. Seven transcripts from ETC pathways (NDUFA6, NDUFA4, UQCRQ, ATP5J, COX7A2, COX7B, COX6A1) were significantly downregulated in responders versus non-responders to ABA/MTX. Moreover, dysregulation of these genes was independent of inflammation and was specific to ABA response. Pre-silencing of ETC genes is associated with future response to ABA/MTX and might be a crucial key to susceptibility to ABA response.

  10. Concerted down-regulation of immune-system related genes predicts metastasis in colorectal carcinoma

    International Nuclear Information System (INIS)

    Fehlker, Marion; Huska, Matthew R; Jöns, Thomas; Andrade-Navarro, Miguel A; Kemmner, Wolfgang

    2014-01-01

    This study aimed at the identification of prognostic gene expression markers in early primary colorectal carcinomas without metastasis at the time point of surgery by analyzing genome-wide gene expression profiles using oligonucleotide microarrays. Cryo-conserved tumor specimens from 45 patients with early colorectal cancers were examined, with the majority of them being UICC stage II or earlier and with a follow-up time of 41–115 months. Gene expression profiling was performed using Whole Human Genome 4x44K Oligonucleotide Microarrays. Validation of microarray data was performed on five of the genes in a smaller cohort. Using a novel algorithm based on the recursive application of support vector machines (SVMs), we selected a signature of 44 probes that discriminated between patients developing later metastasis and patients with a good prognosis. Interestingly, almost half of the genes was related to the patients’ immune response and showed reduced expression in the metastatic cases. Whereas up to now gene signatures containing genes with various biological functions have been described for prediction of metastasis in CRC, in this study metastasis could be well predicted by a set of gene expression markers consisting exclusively of genes related to the MHC class II complex involved in immune response. Thus, our data emphasize that the proper function of a comprehensive network of immune response genes is of vital importance for the survival of colorectal cancer patients

  11. RNAi-mediated pinoresinol lariciresinol reductase gene silencing in flax (Linum usitatissimum L.) seed coat: consequences on lignans and neolignans accumulation.

    Science.gov (United States)

    Renouard, Sullivan; Tribalatc, Marie-Aude; Lamblin, Frederic; Mongelard, Gaëlle; Fliniaux, Ophélie; Corbin, Cyrielle; Marosevic, Djurdjica; Pilard, Serge; Demailly, Hervé; Gutierrez, Laurent; Hano, Christophe; Mesnard, François; Lainé, Eric

    2014-09-15

    RNAi technology was applied to down regulate LuPLR1 gene expression in flax (Linum usitatissimum L.) seeds. This gene encodes a pinoresinol lariciresinol reductase responsible for the synthesis of (+)-secoisolariciresinol diglucoside (SDG), the major lignan accumulated in the seed coat. If flax lignans biological properties and health benefits are well documented their roles in planta remain unclear. This loss of function strategy was developed to better understand the implication of the PLR1 enzyme in the lignan biosynthetic pathway and to provide new insights on the functions of these compounds. RNAi plants generated exhibited LuPLR1 gene silencing as demonstrated by quantitative RT-PCR experiments and the failed to accumulate SDG. The accumulation of pinoresinol the substrate of the PLR1 enzyme under its diglucosylated form (PDG) was increased in transgenic seeds but did not compensate the overall loss of SDG. The monolignol flux was also deviated through the synthesis of 8-5' linked neolignans dehydrodiconiferyl alcohol glucoside (DCG) and dihydro-dehydrodiconiferyl alcohol glucoside (DDCG) which were observed for the first time in flax seeds. Copyright © 2014 Elsevier GmbH. All rights reserved.

  12. UV-C-Induced alleviation of transcriptional gene silencing through plant-plant communication: Key roles of jasmonic acid and salicylic acid pathways.

    Science.gov (United States)

    Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po

    2016-08-01

    Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant-plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant-plant and plant-plant-plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant-plant and plant-plant-plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant-plant-plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Identification of Proteins Using iTRAQ and Virus-Induced Gene Silencing Reveals Three Bread Wheat Proteins Involved in the Response to Combined Osmotic-Cold Stress.

    Science.gov (United States)

    Zhang, Ning; Zhang, Lingran; Shi, Chaonan; Zhao, Lei; Cui, Dangqun; Chen, Feng

    2018-05-25

    Crops are often subjected to a combination of stresses in the field. To date, studies on the physiological and molecular responses of common wheat to a combination of osmotic and cold stresses, however, remain unknown. In this study, wheat seedlings exposed to osmotic-cold stress for 24 h showed inhibited growth, as well as increased lipid peroxidation, relative electrolyte leakage, and soluble sugar contents. iTRAQ-based quantitative proteome method was employed to determine the proteomic profiles of the roots and leaves of wheat seedlings exposed to osmotic-cold stress conditions. A total of 250 and 258 proteins with significantly altered abundance in the roots and leaves were identified, respectively, and the majority of these proteins displayed differential abundance, thereby revealing organ-specific differences in adaptation to osmotic-cold stress. Yeast two hybrid assay examined five pairs of stress/defense-related protein-protein interactions in the predicted protein interaction network. Furthermore, quantitative real-time PCR analysis indicated that abiotic stresses increased the expression of three candidate protein genes, i.e., TaGRP2, CDCP, and Wcor410c in wheat leaves. Virus-induced gene silencing indicated that three genes TaGRP2, CDCP, and Wcor410c were involved in modulating osmotic-cold stress in common wheat. Our study provides useful information for the elucidation of molecular and genetics bases of osmotic-cold combined stress in bread wheat.

  14. Virus-induced Gene Silencing-based Functional Analyses Revealed the Involvement of Several Putative Trehalose-6-Phosphate Synthase/Phosphatase Genes in Disease Resistance against Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000 in Tomato

    Directory of Open Access Journals (Sweden)

    Huijuan Zhang

    2016-08-01

    Full Text Available Trehalose and its metabolism have been demonstrated to play important roles in control of plant growth, development and stress responses. However, direct genetic evidence supporting the functions of trehalose and its metabolism in defense response against pathogens is lacking. In the present study, genome-wide characterization of putative trehalose-related genes identified 11 SlTPSs for trehalose-6-phosphate synthase, 8 SlTPPs for trehalose-6-phosphate phosphatase and one SlTRE1 for trehalase in tomato genome. Nine SlTPSs, 4 SlTPPs and SlTRE1 were selected for functional analyses to explore their involvement in tomato disease resistance. Some selected SlTPSs, SlTPPs and SlTRE1 responded with distinct expression induction patterns to Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst DC3000 as well as to defense signaling hormones (e.g. salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-mediated silencing of SlTPS3, SlTPS4 or SlTPS7 led to deregulation of ROS accumulation and attenuated the expression of defense-related genes upon pathogen infection and thus deteriorated the resistance against B. cinerea or Pst DC3000. By contrast, silencing of SlTPS5 or SlTPP2 led to an increased expression of the defense-related genes upon pathogen infection and conferred an increased resistance against Pst DC3000. Silencing of SlTPS3, SlTPS4, SlTPS5, SlTPS7 or SlTPP2 affected trehalose level in tomato plants with or without infection of B. cinerea or Pst DC3000. These results demonstrate that SlTPS3, SlTPS4, SlTPS5, SlTPS7 and SlTPP2 play roles in resistance against B. cinerea and Pst DC3000, implying the importance of trehalose and tis metabolism in regulation of defense response against pathogens in tomato.

  15. Transcriptional profiling of immune-related genes in Pacific white shrimp (Litopenaeus vannamei) during ontogenesis.

    Science.gov (United States)

    Quispe, Ruth L; Justino, Emily B; Vieira, Felipe N; Jaramillo, Michael L; Rosa, Rafael D; Perazzolo, Luciane M

    2016-11-01

    We have performed here a gene expression analysis to determine the developmental stage at the main genes involved in crustacean immune response begin to be expressed and their changes in mRNA abundance during shrimp development. By using a quantitative PCR-based approach, we have measured the mRNA abundance of 24 immune-related genes from different functional categories in twelve developmental stages ranging from fertilized eggs to larval and postlarval stages and also in juveniles. We showed for the first time that the main genes from the RNAi-based post-transcriptional pathway involved in shrimp antiviral immunity are transcribed in all developmental stages, but exhibit a diverse pattern of gene expression during shrimp ontogenesis. On the other hand, hemocyte-expressed genes mainly involved in antimicrobial defenses appeared to be transcribed in larval stages, indicating that hematopoiesis initiates early in development. Moreover, transcript levels of some genes were early detected in fertilized eggs at 0-4 h post-spawning, suggesting a maternal contribution of immune-related transcripts to shrimp progeny. Altogether, our results provide important clues regarding the ontogenesis of hemocytes as well the establishment of antiviral and antimicrobial defenses in shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Feminizing Wolbachia: a transcriptomics approach with insights on the immune response genes in Armadillidium vulgare

    Directory of Open Access Journals (Sweden)

    Chevalier Frédéric

    2012-01-01

    Full Text Available Abstract Background Wolbachia are vertically transmitted bacteria known to be the most widespread endosymbiont in arthropods. They induce various alterations of the reproduction of their host, including feminization of genetic males in isopod crustaceans. In the pill bug Armadillidium vulgare, the presence of Wolbachia is also associated with detrimental effects on host fertility and lifespan. Deleterious effects have been demonstrated on hemocyte density, phenoloxidase activity, and natural hemolymph septicemia, suggesting that infected individuals could have defective immune capacities. Since nothing is known about the molecular mechanisms involved in Wolbachia-A. vulgare interactions and its secondary immunocompetence modulation, we developed a transcriptomics strategy and compared A. vulgare gene expression between Wolbachia-infected animals (i.e., “symbiotic” animals and uninfected ones (i.e., “asymbiotic” animals as well as between animals challenged or not challenged by a pathogenic bacteria. Results Since very little genetic data is available on A. vulgare, we produced several EST libraries and generated a total of 28 606 ESTs. Analyses of these ESTs revealed that immune processes were over-represented in most experimental conditions (responses to a symbiont and to a pathogen. Considering canonical crustacean immune pathways, these genes encode antimicrobial peptides or are involved in pathogen recognition, detoxification, and autophagy. By RT-qPCR, we demonstrated a general trend towards gene under-expression in symbiotic whole animals and ovaries whereas the same gene set tends to be over-expressed in symbiotic immune tissues. Conclusion This study allowed us to generate the first reference transcriptome ever obtained in the Isopoda group and to identify genes involved in the major known crustacean immune pathways encompassing cellular and humoral responses. Expression of immune-related genes revealed a modulation of host

  17. Induction of innate immune genes in brain create the neurobiology of addiction.

    Science.gov (United States)

    Crews, F T; Zou, Jian; Qin, Liya

    2011-06-01

    Addiction occurs through repeated abuse of drugs that progressively reduce behavioral control and cognitive flexibility while increasing limbic negative emotion. Recent discoveries indicate neuroimmune signaling underlies addiction and co-morbid depression. Low threshold microglia undergo progressive stages of innate immune activation involving astrocytes and neurons with repeated drug abuse, stress, and/or cell damage signals. Increased brain NF-κB transcription of proinflammatory chemokines, cytokines, oxidases, proteases, TLR and other genes create loops amplifying NF-κB transcription and innate immune target gene expression. Human post-mortem alcoholic brain has increased NF-κB and NF-κB target gene message, increased microglial markers and chemokine-MCP1. Polymorphisms of human NF-κB1 and other innate immune genes contribute to genetic risk for alcoholism. Animal transgenic and genetic studies link NF-κB innate immune gene expression to alcohol drinking. Human drug addicts show deficits in behavioral flexibility modeled pre-clinically using reversal learning. Binge alcohol, chronic cocaine, and lesions link addiction neurobiology to frontal cortex, neuroimmune signaling and loss of behavioral flexibility. Addiction also involves increasing limbic negative emotion and depression-like behavior that is reflected in hippocampal neurogenesis. Innate immune activation parallels loss of neurogenesis and increased depression-like behavior. Protection against loss of neurogenesis and negative affect by anti-oxidant, anti-inflammatory, anti-depressant, opiate antagonist and abstinence from ethanol dependence link limbic affect to changes in innate immune signaling. The hypothesis that innate immune gene induction underlies addiction and affective disorders creates new targets for therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Transcriptional Silencing of Retroviral Vectors

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

    1996-01-01

    . Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...

  19. A systems biology analysis of the changes in gene expression via silencing of HPV-18 E1 expression in HeLa cells.

    Science.gov (United States)

    Castillo, Andres; Wang, Lu; Koriyama, Chihaya; Eizuru, Yoshito; Jordan, King; Akiba, Suminori

    2014-10-01

    Previous studies have reported the detection of a truncated E1 mRNA generated from HPV-18 in HeLa cells. Although it is unclear whether a truncated E1 protein could function as a replicative helicase for viral replication, it would still retain binding sites for potential interactions with different host cell proteins. Furthermore, in this study, we found evidence in support of expression of full-length HPV-18 E1 mRNA in HeLa cells. To determine whether interactions between E1 and cellular proteins play an important role in cellular processes other than viral replication, genome-wide expression profiles of HPV-18 positive HeLa cells were compared before and after the siRNA knockdown of E1 expression. Differential expression and gene set enrichment analysis uncovered four functionally related sets of genes implicated in host defence mechanisms against viral infection. These included the toll-like receptor, interferon and apoptosis pathways, along with the antiviral interferon-stimulated gene set. In addition, we found that the transcriptional coactivator E1A-binding protein p300 (EP300) was downregulated, which is interesting given that EP300 is thought to be required for the transcription of HPV-18 genes in HeLa cells. The observed changes in gene expression produced via the silencing of HPV-18 E1 expression in HeLa cells indicate that in addition to its well-known role in viral replication, the E1 protein may also play an important role in mitigating the host's ability to defend against viral infection.

  20. Silencing of Iron and Heme-Related Genes Revealed a Paramount Role of Iron in the Physiology of the Hematophagous Vector Rhodnius prolixus

    Directory of Open Access Journals (Sweden)

    Ana B. Walter-Nuno

    2018-02-01

    Full Text Available Iron is an essential element for most organisms However, free iron and heme, its complex with protoporphyrin IX, can be extremely cytotoxic, due to the production of reactive oxygen species, eventually leading to oxidative stress. Thus, eukaryotic cells control iron availability by regulating its transport, storage and excretion as well as the biosynthesis and degradation of heme. In the genome of Rhodnius prolixus, the vector of Chagas disease, we identified 36 genes related to iron and heme metabolism We performed a comprehensive analysis of these genes, including identification of homologous genes described in other insect genomes. We observed that blood-meal modulates the expression of ferritin, Iron Responsive protein (IRP, Heme Oxygenase (HO and the heme exporter Feline Leukemia Virus C Receptor (FLVCR, components of major pathways involved in the regulation of iron and heme metabolism, particularly in the posterior midgut (PM, where an intense release of free heme occurs during the course of digestion. Knockdown of these genes impacted the survival of nymphs and adults, as well as molting, oogenesis and embryogenesis at different rates and time-courses. The silencing of FLVCR caused the highest levels of mortality in nymphs and adults and reduced nymph molting. The oogenesis was mildly affected by the diminished expression of all of the genes whereas embryogenesis was dramatically impaired by the knockdown of ferritin expression. Furthermore, an intense production of ROS in the midgut of blood-fed insects occurs when the expression of ferritin, but not HO, was inhibited. In this manner, the degradation of dietary heme inside the enterocytes may represent an oxidative challenge that is counteracted by ferritins, conferring to this protein a major antioxidant role. Taken together these results demonstrate that the regulation of iron and heme metabolism is of paramount importance for R. prolixus physiology and imbalances in the levels of

  1. Candidate innate immune system gene expression in the ecological model Daphnia.

    Science.gov (United States)

    Decaestecker, Ellen; Labbé, Pierrick; Ellegaard, Kirsten; Allen, Judith E; Little, Tom J

    2011-10-01

    The last ten years have witnessed increasing interest in host-pathogen interactions involving invertebrate hosts. The invertebrate innate immune system is now relatively well characterised, but in a limited range of genetic model organisms and under a limited number of conditions. Immune systems have been little studied under real-world scenarios of environmental variation and parasitism. Thus, we have investigated expression of candidate innate immune system genes in the water flea Daphnia, a model organism for ecological genetics, and whose capacity for clonal reproduction facilitates an exceptionally rigorous control of exposure dose or the study of responses at many time points. A unique characteristic of the particular Daphnia clones and pathogen strain combinations used presently is that they have been shown to be involved in specific host-pathogen coevolutionary interactions in the wild. We choose five genes, which are strong candidates to be involved in Daphnia-pathogen interactions, given that they have been shown to code for immune effectors in related organisms. Differential expression of these genes was quantified by qRT-PCR following exposure to the bacterial pathogen Pasteuria ramosa. Constitutive expression levels differed between host genotypes, and some genes appeared to show correlated expression. However, none of the genes appeared to show a major modification of expression level in response to Pasteuria exposure. By applying knowledge from related genetic model organisms (e.g. Drosophila) to models for the study of evolutionary ecology and coevolution (i.e. Daphnia), the candidate gene approach is temptingly efficient. However, our results show that detection of only weak patterns is likely if one chooses target genes for study based on previously identified genome sequences by comparison to homologues from other related organisms. Future work on the Daphnia-Pasteuria system will need to balance a candidate gene approach with more comprehensive

  2. Genes involved in immunity and apoptosis are associated with human presbycusis based on microarray analysis.

    Science.gov (United States)

    Dong, Yang; Li, Ming; Liu, Puzhao; Song, Haiyan; Zhao, Yuping; Shi, Jianrong

    2014-06-01

    Genes involved in immunity and apoptosis were associated with human presbycusis. CCR3 and GILZ played an important role in the pathogenesis of presbycusis, probably through regulating chemokine receptor, T-cell apoptosis, or T-cell activation pathways. To identify genes associated with human presbycusis and explore the molecular mechanism of presbycusis. Hearing function was tested by pure-tone audiometry. Microarray analysis was performed to identify presbycusis-correlated genes by Illumina Human-6 BeadChip using the peripheral blood samples of subjects. To identify biological process categories and pathways associated with presbycusis-correlated genes, bioinformatics analysis was carried out by Gene Ontology Tree Machine (GOTM) and database for annotation, visualization, and integrated discovery (DAVID). Quantitative RT-PCR (qRT-PCR) was used to validate the microarray data. Microarray analysis identified 469 up-regulated genes and 323 down-regulated genes. Both the dominant biological processes by Gene Ontology (GO) analysis and the enriched pathways by Kyoto encyclopedia of genes and genomes (KEGG) and BIOCARTA showed that genes involved in immunity and apoptosis were associated with presbycusis. In addition, CCR3, GILZ, CXCL10, and CX3CR1 genes showed consistent difference between groups for both the gene chip and qRT-PCR data. The differences of CCR3 and GILZ between presbycusis patients and controls were statistically significant (p < 0.05).

  3. Extensive shared polymorphism at non-MHC immune genes in recently diverged North American prairie grouse

    Science.gov (United States)

    Minias, Piotr; Bateson, Zachary W.; Whittingham, Linda A.; Johnson, Jeff A.; Oyler-McCance, Sara J.; Dunn, Peter O.

    2018-01-01

    Gene polymorphisms shared between recently diverged species are thought to be widespread and most commonly reflect introgression from hybridization or retention of ancestral polymorphism through incomplete lineage sorting. Shared genetic diversity resulting from incomplete lineage sorting is usually maintained for a relatively short period of time, but under strong balancing selection it may persist for millions of years beyond species divergence (balanced trans-species polymorphism), as in the case of the major histocompatibility complex (MHC) genes. However, balancing selection is much less likely to act on non-MHC immune genes. The aim of this study was to investigate the patterns of shared polymorphism and selection at non-MHC immune genes in five grouse species from Centrocercus and Tympanuchus genera. For this purpose, we genotyped five non-MHC immune genes that do not interact directly with pathogens, but are involved in signaling and regulate immune cell growth. In contrast to previous studies with MHC, we found no evidence for balancing selection or balanced trans-species polymorphism among the non-MHC immune genes. No haplotypes were shared between genera and in most cases more similar allelic variants sorted by genus. Between species within genera, however, we found extensive shared polymorphism, which was most likely attributable to introgression or incomplete lineage sorting following recent divergence and large ancestral effective population size (i.e., weak genetic drift). Our study suggests that North American prairie grouse may have attained relatively low degree of reciprocal monophyly at nuclear loci and reinforces the rarity of balancing selection in non-MHC immune genes.

  4. Tsw gene-based resistance is triggered by a functional RNA silencing suppressor protein of the Tomato spotted wilt virus

    NARCIS (Netherlands)

    Ronde, de D.; Butterbach, P.B.E.; Lohuis, H.; Hedil, M.; Lent, van J.W.M.; Kormelink, R.J.M.

    2013-01-01

    As a result of contradictory reports, the avirulence (Avr) determinant that triggers Tsw gene-based resistance in Capsicum annuum against the Tomato spotted wilt virus (TSWV) is still unresolved. Here, the N and NSs genes of resistance-inducing (RI) and resistance-breaking (RB) isolates were cloned

  5. Epigenetic editing using programmable zinc ginger proteins : inherited silencing of endogenous gene expression by targeted DNA methylation

    NARCIS (Netherlands)

    Stolzenburg, Sabine

    2014-01-01

    Cancer development is not only the result of genetic mutations but also stems from modifications in the epigenetic code leading to an aberrant expression of genes relevant for cancer. The most studied epigenetic mark is DNA methylation of cytosines in the promoters of genes, which is associated with

  6. Influence of Immune Responses in Gene/Stem Cell Therapies for Muscular Dystrophies

    Directory of Open Access Journals (Sweden)

    Andrea Farini

    2014-01-01

    Full Text Available Muscular dystrophies (MDs are a heterogeneous group of diseases, caused by mutations in different components of sarcolemma, extracellular matrix, or enzymes. Inflammation and innate or adaptive immune response activation are prominent features of MDs. Various therapies under development are directed toward rescuing the dystrophic muscle damage using gene transfer or cell therapy. Here we discussed current knowledge about involvement of immune system responses to experimental therapies in MDs.

  7. Balancing selection on immunity genes: review of the current literature and new analysis in Drosophila melanogaster.

    Science.gov (United States)

    Croze, Myriam; Živković, Daniel; Stephan, Wolfgang; Hutter, Stephan

    2016-08-01

    Balancing selection has been widely assumed to be an important evolutionary force, yet even today little is known about its abundance and its impact on the patterns of genetic diversity. Several studies have shown examples of balancing selection in humans, plants or parasites, and many genes under balancing selection are involved in immunity. It has been proposed that host-parasite coevolution is one of the main forces driving immune genes to evolve under balancing selection. In this paper, we review the literature on balancing selection on immunity genes in several organisms, including Drosophila. Furthermore, we performed a genome scan for balancing selection in an African population of Drosophila melanogaster using coalescent simulations of a demographic model with and without selection. We find very few genes under balancing selection and only one novel candidate gene related to immunity. Finally, we discuss the possible causes of the low number of genes under balancing selection. Copyright © 2016 The Authors. Published by Elsevier GmbH.. All rights reserved.

  8. Expression of putative immune response genes during early ontogeny in the coral Acropora millepora.

    Directory of Open Access Journals (Sweden)

    Eneour Puill-Stephan

    Full Text Available Corals, like many other marine invertebrates, lack a mature allorecognition system in early life history stages. Indeed, in early ontogeny, when corals acquire and establish associations with various surface microbiota and dinoflagellate endosymbionts, they do not efficiently distinguish between closely and distantly related individuals from the same population. However, very little is known about the molecular components that underpin allorecognition and immunity responses or how they change through early ontogeny in corals.Patterns in the expression of four putative immune response genes (apextrin, complement C3, and two CELIII type lectin genes were examined in juvenile colonies of Acropora millepora throughout a six-month post-settlement period using quantitative real-time PCR (qPCR. Expression of a CELIII type lectin gene peaked in the fourth month for most of the coral juveniles sampled and was significantly higher at this time than at any other sampling time during the six months following settlement. The timing of this increase in expression levels of putative immune response genes may be linked to allorecognition maturation which occurs around this time in A. millepora. Alternatively, the increase may represent a response to immune challenges, such as would be involved in the recognition of symbionts (such as Symbiodinium spp. or bacteria during winnowing processes as symbioses are fine-tuned.Our data, although preliminary, are consistent with the hypothesis that lectins may play an important role in the maturation of allorecognition responses in corals. The co-expression of lectins with apextrin during development of coral juveniles also raises the possibility that these proteins, which are components of innate immunity in other invertebrates, may influence the innate immune systems of corals through a common pathway or system. However, further studies investigating the expression of these genes in alloimmune-challenged corals are

  9. Expression of putative immune response genes during early ontogeny in the coral Acropora millepora.

    Science.gov (United States)

    Puill-Stephan, Eneour; Seneca, François O; Miller, David J; van Oppen, Madeleine J H; Willis, Bette L

    2012-01-01

    Corals, like many other marine invertebrates, lack a mature allorecognition system in early life history stages. Indeed, in early ontogeny, when corals acquire and establish associations with various surface microbiota and dinoflagellate endosymbionts, they do not efficiently distinguish between closely and distantly related individuals from the same population. However, very little is known about the molecular components that underpin allorecognition and immunity responses or how they change through early ontogeny in corals. Patterns in the expression of four putative immune response genes (apextrin, complement C3, and two CELIII type lectin genes) were examined in juvenile colonies of Acropora millepora throughout a six-month post-settlement period using quantitative real-time PCR (qPCR). Expression of a CELIII type lectin gene peaked in the fourth month for most of the coral juveniles sampled and was significantly higher at this time than at any other sampling time during the six months following settlement. The timing of this increase in expression levels of putative immune response genes may be linked to allorecognition maturation which occurs around this time in A. millepora. Alternatively, the increase may represent a response to immune challenges, such as would be involved in the recognition of symbionts (such as Symbiodinium spp. or bacteria) during winnowing processes as symbioses are fine-tuned. Our data, although preliminary, are consistent with the hypothesis that lectins may play an important role in the maturation of allorecognition responses in corals. The co-expression of lectins with apextrin during development of coral juveniles also raises the possibility that these proteins, which are components of innate immunity in other invertebrates, may influence the innate immune systems of corals through a common pathway or system. However, further studies investigating the expression of these genes in alloimmune-challenged corals are needed to further

  10. Gene expression profiling provides insights into the immune mechanism of Plutella xylostella midgut to microbial infection.

    Science.gov (United States)

    Lin, Junhan; Xia, Xiaofeng; Yu, Xiao-Qiang; Shen, Jinhong; Li, Yong; Lin, Hailan; Tang, Shanshan; Vasseur, Liette; You, Minsheng

    2018-03-20

    Insect gut immunity plays a key role in defense against microorganism infection. The knowledge of insect gut immunity has been obtained mostly from Drosophila melanogaster. Little is known about gut immunity in the diamondback moth, Plutella xylostella (L.), a pest destroying cruciferous crops worldwide. In this study, expressions of the immune-related genes in the midgut of P. xylostella orally infected with Staphylococcus aureus, Escherichia coli and Pichia pastoris were profiled by RNA-seq and qRT-PCR approaches. The results revealed that the Toll, IMD, JNK and JAK-STAT pathways and possibly the prophenoloxidase activation system in P. xylostella could be activated by oral infections, and moricins, gloverins and lysozyme2 might act as important effectors against microorganisms. Subsequent knock-down of IMD showed that this gene was involved in regulating the expression of down-stream genes in the IMD pathway. Our work indicates that the Toll, IMD, JNK and JAK-STAT pathways may synergistically modulate immune responses in the P. xylostella midgut, implying a complex and diverse immune system in the midgut of insects. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Methylation and Expression of Immune and Inflammatory Genes in the Offspring of Bariatric Bypass Surgery Patients

    Directory of Open Access Journals (Sweden)

    Frédéric Guénard

    2013-01-01

    Full Text Available Background. Maternal obesity, excess weight gain and overnutrition during pregnancy increase risks of obesity, type 2 diabetes mellitus, and cardiovascular disease in the offspring. Maternal biliopancreatic diversion is an effective treatment for severe obesity and is beneficial for offspring born after maternal surgery (AMS. These offspring exhibit lower severe obesity prevalence and improved cardiometabolic risk factors including inflammatory marker compared to siblings born before maternal surgery (BMS. Objective. To assess relationships between maternal bariatric surgery and the methylation/expression of genes involved in the immune and inflammatory pathways. Methods. A differential gene methylation analysis was conducted in a sibling cohort of 25 BMS and 25 AMS offspring from 20 mothers. Following differential gene expression analysis (23 BMS and 23 AMS, pathway analysis was conducted. Correlations between gene methylation/expression and circulating inflammatory markers were computed. Results. Five immune and inflammatory pathways with significant overrepresentation of both differential gene methylation and expression were identified. In the IL-8 pathway, gene methylation correlated with both gene expression and plasma C-reactive protein levels. Conclusion. These results suggest that improvements in cardiometabolic risk markers in AMS compared to BMS offspring may be mediated through differential methylation of genes involved in immune and inflammatory pathways.

  12. Expression profile of immune response genes in patients with Severe Acute Respiratory Syndrome

    Directory of Open Access Journals (Sweden)

    Tai Dessmon

    2005-01-01

    Full Text Available Abstract Background Severe acute respiratory syndrome (SARS emerged in later February 2003, as a new epidemic form of life-threatening infection caused by a novel coronavirus. However, the immune-pathogenesis of SARS is poorly understood. To understand the host response to this pathogen, we investigated the gene expression profiles of peripheral blood mononuclear cells (PBMCs derived from SARS patients, and compared with healthy controls. Results The number of differentially expressed genes was found to be 186 under stringent filtering criteria of microarray data analysis. Several genes were highly up-regulated in patients with SARS, such as, the genes coding for Lactoferrin, S100A9 and Lipocalin 2. The real-time PCR method verified the results of the gene array analysis and showed that those genes that were up-regulated as determined by microarray analysis were also found to be comparatively up-regulated by real-time PCR analysis. Conclusions This differential gene expression profiling of PBMCs from patients with SARS strongly suggests that the response of SARS affected patients seems to be mainly an innate inflammatory response, rather than a specific immune response against a viral infection, as we observed a complete lack of cytokine genes usually triggered during a viral infection. Our study shows for the first time how the immune system responds to the SARS infection, and opens new possibilities for designing new diagnostics and treatments for this new life-threatening disease.

  13. Efficient and nontoxic biological response carrier delivering TNF-α shRNA for gene silencing in a murine model of rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Jialin Song

    2016-08-01

    Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.

  14. Timing sexual differentiation: full functional sex reversal achieved through silencing of a single insulin-like gene in the prawn, Macrobrachium rosenbergii.

    Science.gov (United States)

    Ventura, Tomer; Manor, Rivka; Aflalo, Eliahu D; Weil, Simy; Rosen, Ohad; Sagi, Amir

    2012-03-01

    In Crustacea, an early evolutionary group (∼50 000 species) inhabiting most ecological niches, sex differentiation is regulated by a male-specific androgenic gland (AG). The identification of AG-specific insulin-like factors (IAGs) and genomic sex markers offers an opportunity for a deeper understanding of the sexual differentiation mechanism in crustaceans and other arthropods. Here, we report, to our knowledge, the first full and functional sex reversal of male freshwater prawns (Macrobrachium rosenbergii) through the silencing of a single IAG-encoding gene. These "neofemales" produced all-male progeny, as proven by sex-specific genomic markers. This finding offers an insight regarding the biology and evolution of sex differentiation regulation, with a novel perspective for the evolution of insulin-like peptides. Our results demonstrate how temporal intervention with a key regulating gene induces a determinative, extreme phenotypic shift. Our results also carry tremendous ecological and commercial implications. Invasive and pest crustacean species represent genuine concerns worldwide without an apparent solution. Such efforts might, therefore, benefit from sexual manipulations, as has been successfully realized with other arthropods. Commercially, such manipulation would be significant in sexually dimorphic cultured species, allowing the use of nonbreeding, monosex populations while dramatically increasing yield and possibly minimizing the invasion of exotic cultured species into the environment.

  15. AGO1, QDE-2, and RDE-1 are related proteins required for post-transcriptional gene silencing in plants, quelling in fungi, and RNA interference in animals.

    Science.gov (United States)

    Fagard, M; Boutet, S; Morel, J B; Bellini, C; Vaucheret, H

    2000-10-10

    Introduction of transgene DNA may lead to specific degradation of RNAs that are homologous to the transgene transcribed sequence through phenomena named post-transcriptional gene silencing (PTGS) in plants, quelling in fungi, and RNA interference (RNAi) in animals. It was shown previously that PTGS, quelling, and RNAi require a set of related proteins (SGS2, QDE-1, and EGO-1, respectively). Here we report the isolation of Arabidopsis mutants impaired in PTGS which are affected at the Argonaute1 (AGO1) locus. AGO1 is similar to QDE-2 required for quelling and RDE-1 required for RNAi. Sequencing of ago1 mutants revealed one amino acid essential for PTGS that is also present in QDE-2 and RDE-1 in a highly conserved motif. Taken together, these results confirm the hypothesis that these processes derive from a common ancestral mechanism that controls expression of invading nucleic acid molecules at the post-transcriptional level. As opposed to rde-1 and qde-2 mutants, which are viable, ago1 mutants display several developmental abnormalities, including sterility. These results raise the possibility that PTGS, or at least some of its elements, could participate in the regulation of gene expression during development in plants.

  16. Functionalized graphene oxide mediated adriamycin delivery and miR-21 gene silencing to overcome tumor multidrug resistance in vitro.

    Directory of Open Access Journals (Sweden)

    Feng Zhi

    Full Text Available Multidrug resistance (MDR is a major impediment to successful cancer chemotherapy. Co-delivery of novel MDR-reversing agents and anticancer drugs to cancer cells holds great promise for cancer treatment. MicroRNA-21 (miR-21 overexpression is associated with the development and progression of MDR in breast cancer, and it is emerging as a novel and promising MDR-reversing target. In this study, a multifunctional nanocomplex, composed of polyethylenimine (PEI/poly(sodium 4-styrenesulfonates (PSS/graphene oxide (GO and termed PPG, was prepared using the layer-by-layer assembly method to evaluate the reversal effects of PPG as a carrier for adriamycin (ADR along with miR-21 targeted siRNA (anti-miR-21 in cancer drug resistance. ADR was firstly loaded onto the PPG surface (PPGADR by physical mixing and anti-miR-21 was sequentially loaded onto PPGADR through electric absorption to form (anti-miR-21PPGADR. Cell experiments showed that PPG significantly enhanced the accumulation of ADR in MCF-7/ADR cells (an ADR resistant breast cancer cell line and exhibited much higher cytotoxicity than free ADR, suggesting that PPG could effectively reverse ADR resistance of MCF-7/ADR. Furthermore, the enhanced therapeutic efficacy of PPG could be correlated with effective silencing of miR-21 and with increased accumulation of ADR in drug-resistant tumor cells. The endocytosis study confirmed that PPG could effectively carry drug molecules into cells via the caveolae and clathrin-mediated endocytosis pathways. These results suggest that this PPG could be a potential and efficient non-viral vector for reversing MDR, and the strategy of combining anticancer drugs with miRNA therapy to overcome MDR could be an attractive approach in cancer treatment.

  17. Complement C3 gene: Expression characterization and innate immune response in razor clam Sinonovacula constricta.

    Science.gov (United States)

    Peng, Maoxiao; Niu, Donghong; Wang, Fei; Chen, Zhiyi; Li, Jiale

    2016-08-01

    Complement component 3 (C3) is central to the complement system, playing an important role in immune defense, immune regulation and immune pathology. Several C3 genes have been characterized in invertebrates but very few in shellfish. The C3 gene was identified from the razor clam Sinonovacula constricta, referred to here as Sc-C3. It was found to be highly homologous with the C3 gene of Ruditapes decussatus. All eight model motifs of the C3 gene were found to be included in the thiolester bond and the C345C region. Sc-C3 was widely expressed in all healthy tissues with expression being highest in hemolymph. A significant difference in expression was revealed at the umbo larvae development stage. The expression of Sc-C3 was highly regulated in the hemolymph and liver, with a distinct response pattern being noted after a challenge with Micrococcus lysodeikticus and Vibrio parahemolyticus. It is therefore suggested that a complicated and unique response pathway may be present in S. constricta. Further, serum of S. constricta containing Sc-C3 was extracted. This was activated by LPS or bacterium for verification for function. The more obvious immune function of Sc-C3 was described as an effective membrane rupture in hemocyte cells of rabbit, V. parahemolyticus and Vibrio anguillarum. Thus, Sc-C3 plays an essential role in the immune defense of S. constricta. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Silencing of NADPH-Dependent Oxidoreductase Genes (yqhD and dkgA) in Furfural-Resistant Ethanologenic Escherichia coli▿

    Science.gov (United States)

    Miller, E. N.; Jarboe, L. R.; Yomano, L. P.; York, S. W.; Shanmugam, K. T.; Ingram, L. O.

    2009-01-01

    Low concentrations of furfural are formed as a side product during the dilute acid hydrolysis of hemicellulose. Growth is inhibited by exposure to furfural but resumes after the complete reduction of furfural to the less toxic furfuryl alcohol. Growth-based selection was used to isolate a furfural-resistant mutant of ethanologenic Escherichia coli LY180, designated strain EMFR9. Based on mRNA expression levels in the parent and mutant in response to furfural challenge, genes encoding 12 oxidoreductases were found to vary by more than twofold (eight were higher in EMFR9; four were higher in the parent). All 12 genes were cloned. When expressed from plasmids, none of the eight genes in the first group increased furfural tolerance in the parent (LY180). Expression of three of the silenced genes (yqhD, dkgA, and yqfA) in EMFR9 was found to decrease furfural tolerance compared to that in the parent. Purified enzymes encoded by yqhD and dkgA were shown to have NADPH-dependent furfural reductase activity. Both exhibited low Km values for NADPH (8 μM and 23 μM, respectively), similar to those of biosynthetic reactions. Furfural reductase activity was not associated with yqfA. Deleting yqhD and dkgA in the parent (LY180) increased furfural tolerance, but not to the same extent observed in the mutant EMFR9. Together, these results suggest that the process of reducing furfural by using an enzyme with a low Km for NADPH rather than a direct inhibitory action is the primary cause for growth inhibition by low concentrations of furfural. PMID:19429550

  19. Phenotypic silencing of cytoplasmic genes using sequence-specific double-stranded short interfering RNA and its application in the reverse genetics of wild type negative-strand RNA viruses

    Directory of Open Access Journals (Sweden)

    Barik Sailen

    2001-12-01

    Full Text Available Abstract Background Post-transcriptional gene silencing (PTGS by short interfering RNA has opened up new directions in the phenotypic mutation of cellular genes. However, its efficacy on non-nuclear genes and its effect on the interferon pathway remain unexplored. Since directed mutation of RNA genomes is not possible through conventional mutagenesis, we have tested sequence-specific 21-nucleotide long double-stranded RNAs (dsRNAs for their ability to silence cytoplasmic RNA genomes. Results Short dsRNAs were generated against specific mRNAs of respiratory syncytial virus, a nonsegmented negative-stranded RNA virus with a cytoplasmic life cycle. At nanomolar concentrations, the dsRNAs specifically abrogated expression of the corresponding viral proteins, and produced the expected mutant phenotype ex vivo. The dsRNAs did not induce an interferon response, and did not inhibit cellular gene expression. The ablation of the viral proteins correlated with the loss of the specific mRNAs. In contrast, viral genomic and antigenomic RNA, which are encapsidated, were not directly affected. Conclusions Synthetic inhibitory dsRNAs are effective in specific silencing of RNA genomes that are exclusively cytoplasmic and transcribed by RNA-dependent RNA polymerases. RNA-directed RNA gene silencing does not require cloning, expression, and mutagenesis of viral cDNA, and thus, will allow the generation of phenotypic null mutants of specific RNA viral genes under normal infection conditions and at any point in the infection cycle. This will, for the first time, permit functional genomic studies, attenuated infections, reverse genetic analysis, and studies of host-virus signaling pathways using a wild type RNA virus, unencumbered by any superinfecting virus.

  20. Forager bees (Apis mellifera) highly express immune and detoxification genes in tissues associated with nectar processing.

    Science.gov (United States)

    Vannette, Rachel L; Mohamed, Abbas; Johnson, Brian R

    2015-11-09

    Pollinators, including honey bees, routinely encounter potentially harmful microorganisms and phytochemicals during foraging. However, the mechanisms by which honey bees manage these potential threats are poorly understood. In this study, we examine the expression of antimicrobial, immune and detoxification genes in Apis mellifera and compare between forager and nurse bees using tissue-specific RNA-seq and qPCR. Our analysis revealed extensive tissue-specific expression of antimicrobial, immune signaling, and detoxification genes. Variation in gene expression between worker stages was pronounced in the mandibular and hypopharyngeal gland (HPG), where foragers were enriched in transcripts that encode antimicrobial peptides (AMPs) and immune response. Additionally, forager HPGs and mandibular glands were enriched in transcripts encoding detoxification enzymes, including some associated with xenobiotic metabolism. Using qPCR on an independent dataset, we verified differential expression of three AMP and three P450 genes between foragers and nurses. High expression of AMP genes in nectar-processing tissues suggests that these peptides may contribute to antimicrobial properties of honey or to honey bee defense against environmentally-acquired microorganisms. Together, these results suggest that worker role and tissue-specific expression of AMPs, and immune and detoxification enzymes may contribute to defense against microorganisms and xenobiotic compounds acquired while foraging.

  1. Dendrimer-Stabilized Gold Nanostars as a Multifunctional Theranostic Nanoplatform for CT Imaging, Photothermal Therapy, and Gene Silencing of Tumors.

    Science.gov (United States)

    Wei, Ping; Chen, Jingwen; Hu, Yong; Li, Xin; Wang, Han; Shen, Mingwu; Shi, Xiangyang

    2016-12-01

    Development of versatile nanomaterials combining diagnostic and therapeutic functionalities within one single nanoplatform is extremely important for tumor theranostics. In this work, the authors report the synthesis of a gold nanostar (Au NS)-based theranostic platform stabilized with cyclic arginine-glycine-aspartic (Arg-Gly-Asp, RGD) peptide-modified amine-terminated generation 3 poly(amidoamine) dendrimers. The formed RGD-modified dendrimer-stabilized Au NSs (RGD-Au DSNSs) are used as a gene delivery vector to complex small interfering RNA (siRNA) for computed tomography (CT) imaging, thermal imaging, photothermal therapy (PTT), and gene therapy of tumors. The results show that the RGD-Au DSNSs are able to compact vascular endothelial growth factor siRNA and specifically deliver siRNA to cancer cells overexpressing α v β 3 integrin. Under near-infrared laser irradiation, the viability of cancer cells is only 20.2% after incubation with the RGD-Au DSNS/siRNA polyplexes, which is much lower than that of cells after single PTT or gene therapy treatment. Furthermore, in vivo results show that the RGD-Au DSNS/siRNA polyplexes enable tumor CT imaging, thermal imaging, PTT, and gene therapy after intratumoral injection. These results indicate that the developed multifunctional nanoconstruct is a promising platform for tumor imaging and combinational PTT and gene therapy. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Gene-silencing effects of anti-survivin siRNA delivered by RGDV-functionalized nanodiamond carrier in the breast carcinoma cell line MCF-7.

    Science.gov (United States)

    Bi, Yanzhao; Zhang, Yifan; Cui, Chunying; Ren, Lulu; Jiang, Xueyun

    Nanodiamond (ND) is a renowned material in nonviral small interfering RNA (siRNA) carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH 2 ) 2 NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR) assay, enzyme-linked immunosorbent assay (ELISA), flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V-fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA nanoparticle with 60-110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH 2 ) 2 NH-VDGR was suggested to be used in siRNA delivery system and in cancer treatments.

  3. Gene-silencing effects of anti-survivin siRNA delivered by RGDV-functionalized nanodiamond carrier in the breast carcinoma cell line MCF-7

    Directory of Open Access Journals (Sweden)

    Bi YZ

    2016-11-01

    Full Text Available Yanzhao Bi, Yifan Zhang, Chunying Cui, Lulu Ren, Xueyun Jiang School of Chemical Biology and Pharmaceutical Sciences, Capital Medical University, Beijing, People’s Republic of China Abstract: Nanodiamond (ND is a renowned material in nonviral small interfering RNA (siRNA carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH22NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR assay, enzyme-linked immunosorbent assay (ELISA, flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH22NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V–fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH22NH-VDGR/survivin-siRNA nanoparticle with 60–110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH22NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH22NH-VDGR was suggested

  4. Cloning, characterization and effect of TmPGRP-LE gene silencing on survival of Tenebrio molitor against Listeria monocytogenes infection.

    Science.gov (United States)

    Tindwa, Hamisi; Patnaik, Bharat Bhusan; Kim, Dong Hyun; Mun, Seulgi; Jo, Yong Hun; Lee, Bok Luel; Lee, Yong Seok; Kim, Nam Jung; Han, Yeon Soo

    2013-11-14

    Peptidoglycan recognition proteins (PGRPs) are a family of innate immune molecules that recognize bacterial peptidoglycan. PGRP-LE, a member of the PGRP family, selectively binds to diaminopimelic acid (DAP)-type peptidoglycan to activate both the immune deficiency (Imd) and proPhenoloxidase (proPO) pathways in insects. A PGRP-LE-dependent induction of autophagy to control Listeria monocytogenes has also been reported. We identified and partially characterized a novel PGRP-LE homologue, from Tenebrio molitor and analyzed its functional role in the survival of the insect against infection by a DAP-type PGN containing intracellular pathogen, L. monocytogenes. The cDNA is comprised of an open reading frame (ORF) of 990 bp and encodes a polypeptide of 329 residues. TmPGRP-LE contains one PGRP domain, but lacks critical residues for amidase activity. Quantitative RT-PCR analysis showed a broad constitutive expression of the transcript at various stages of development spanning from larva to adult. RNAi mediated knockdown of the transcripts, followed by a challenge with L. monocytogenes, showed a significant reduction in survival rate of the larvae, suggesting a putative role of TmPGRP-LE in sensing and control of L. monocytogenes infection in T. molitor. These results implicate PGRP-LE as a defense protein necessary for survival of T. molitor against infection by L. monocytogenes.

  5. Cloning, Characterization and Effect of TmPGRP-LE Gene Silencing on Survival of Tenebrio Molitor against Listeria monocytogenes Infection

    Directory of Open Access Journals (Sweden)

    Yeon Soo Han

    2013-11-01

    Full Text Available Peptidoglycan recognition proteins (PGRPs are a family of innate immune molecules that recognize bacterial peptidoglycan. PGRP-LE, a member of the PGRP family, selectively binds to diaminopimelic acid (DAP-type peptidoglycan to activate both the immune deficiency (Imd and proPhenoloxidase (proPO pathways in insects. A PGRP-LE-dependent induction of autophagy to control Listeria monocytogenes has also been reported. We identified and partially characterized a novel PGRP-LE homologue, from Tenebrio molitor and analyzed its functional role in the survival of the insect against infection by a DAP-type PGN containing intracellular pathogen, L. monocytogenes. The cDNA is comprised of an open reading frame (ORF of 990 bp and encodes a polypeptide of 329 residues. TmPGRP-LE contains one PGRP domain, but lacks critical residues for amidase activity. Quantitative RT-PCR analysis showed a broad constitutive expression of the transcript at various stages of development spanning from larva to adult. RNAi mediated knockdown of the transcripts, followed by a challenge with L. monocytogenes, showed a significant reduction in survival rate of the larvae, suggesting a putative role of TmPGRP-LE in sensing and control of L. monocytogenes infection in T. molitor. These results implicate PGRP-LE as a defense protein necessary for survival of T. molitor against infection by L. monocytogenes.

  6. Candidate gene approach for parasite resistance in sheep--variation in immune pathway genes and association with fecal egg count.

    Directory of Open Access Journals (Sweden)

    Kathiravan Periasamy

    Full Text Available Sheep chromosome 3 (Oar3 has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05 in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have

  7. The Entomopathogenic Fungi Isaria fumosorosea Plays a Vital Role in Suppressing the Immune System of Plutella xylostella: RNA-Seq and DGE Analysis of Immunity-Related Genes.

    Science.gov (United States)

    Xu, Jin; Xu, Xiaoxia; Shakeel, Muhammad; Li, Shuzhong; Wang, Shuang; Zhou, Xianqiang; Yu, Jialin; Xu, Xiaojing; Yu, Xiaoqiang; Jin, Fengliang

    2017-01-01

    Most, if not all, entomopathogenic fungi have been used as alternative control agents to decrease the insect resistance and harmful effects of the insecticides on the environment. Among them, Isaria fumosorosea has also shown great potential to control different insect pests. In the present study, we explored the immune response of P. xylostella to the infection of I. fumosorosea at different time points by using RNA-Sequencing and differential gene expression technology at the genomic level. To gain insight into the host-pathogen interaction at the genomic level, five libraries of P. xylostella larvae at 12, 18, 24, and 36 h post-infection and a control were constructed. In total, 161 immunity-related genes were identified and grouped into four categories; immune recognition families, toll and Imd pathway, melanization, and antimicrobial peptides (AMPs). The results of differentially expressed immunity-related genes depicted that 15, 13, 53, and 14 up-regulated and 38, 51, 56, and 49 were down-regulated in P. xylostella at 12, 18, 24, and 36 h post-treatment, respectively. RNA-Seq results of immunity-related genes revealed that the expression of AMPs was reduced after treatment with I. fumosorosea . To validate RNA-Seq results by RT-qPCR, 22 immunity-related genes were randomly selected. In conclusion, our results demonstrate that I. fumosorosea has the potential to suppress the immune response of P. xylostella and can become a potential biopesticide for controlling P. xylostella .

  8. The Entomopathogenic Fungi Isaria fumosorosea Plays a Vital Role in Suppressing the Immune System of Plutella xylostella: RNA-Seq and DGE Analysis of Immunity-Related Genes

    Directory of Open Access Journals (Sweden)

    Jin Xu

    2017-07-01

    Full Text Available Most, if not all, entomopathogenic fungi have been used as alternative control agents to decrease the insect resistance and harmful effects of the insecticides on the environment. Among them, Isaria fumosorosea has also shown great potential to control different insect pests. In the present study, we explored the immune response of P. xylostella to the infection of I. fumosorosea at different time points by using RNA-Sequencing and differential gene expression technology at the genomic level. To gain insight into the host-pathogen interaction at the genomic level, five libraries of P. xylostella larvae at 12, 18, 24, and 36 h post-infection and a control were constructed. In total, 161 immunity-related genes were identified and grouped into four categories; immune recognition families, toll and Imd pathway, melanization, and antimicrobial peptides (AMPs. The results of differentially expressed immunity-related genes depicted that 15, 13, 53, and 14 up-regulated and 38, 51, 56, and 49 were down-regulated in P. xylostella at 12, 18, 24, and 36 h post-treatment, respectively. RNA-Seq results of immunity-related genes revealed that the expression of AMPs was reduced after treatment with I. fumosorosea. To validate RNA-Seq results by RT-qPCR, 22 immunity-related genes were randomly selected. In conclusion, our results demonstrate that I. fumosorosea has the potential to suppress the immune response of P. xylostella and can become a potential biopesticide for controlling P. xylostella.

  9. Construction of an integrated gene regulatory network link to stress-related immune system in cattle.

    Science.gov (United States)

    Behdani, Elham; Bakhtiarizadeh, Mohammad Reza

    2017-10-01

    The immune system is an important biological system that is negatively impacted by stress. This study constructed an integrated regulatory network to enhance our understanding of the regulatory gene network used in the stress-related immune system. Module inference was used to construct modules of co-expressed genes with bovine leukocyte RNA-Seq data. Transcription factors (TFs) were then assigned to these modules using Lemon-Tree algorithms. In addition, the TFs assigned to each module were confirmed using the promoter analysis and protein-protein interactions data. Therefore, our integrated method identified three TFs which include one TF that is previously known to be involved in immune response (MYBL2) and two TFs (E2F8 and FOXS1) that had not been recognized previously and were identified for the first time in this study as novel regulatory candidates in immune response. This study provides valuable insights on the regulatory programs of genes involved in the stress-related immune system.

  10. Virus-induced gene silencing of WRKY53 and an inducible phenylalanine ammonia-lyase in wheat reduces aphid resistance

    Science.gov (United States)

    Although several wheat genes differentially expressed during the Russian wheat aphid resistance response have recently been identified, their requirement for and specific role in resistance remain unclear. Progress in wheat-aphid interaction research is hampered by inadequate collections of mutant g...

  11. Gene silencing in Tribolium castaneum as a tool for the targeted identification of candidate RNAi targets in crop pests.

    Science.gov (United States)

    Knorr, Eileen; Fishilevich, Elane; Tenbusch, Linda; Frey, Meghan L F; Rangasamy, Murugesan; Billion, Andre; Worden, Sarah E; Gandra, Premchand; Arora, Kanika; Lo, Wendy; Schulenberg, Greg; Valverde-Garcia, Pablo; Vilcinskas, Andreas; Narva, Kenneth E

    2018-02-01

    RNAi shows potential as an agricultural technology for insect control, yet, a relatively low number of robust lethal RNAi targets have been demonstrated to control insects of agricultural interest. In the current study, a selection of lethal RNAi target genes from the iBeetle (Tribolium castaneum) screen were used to demonstrate efficacy of orthologous targets in the economically important coleopteran pests Diabrotica virgifera virgifera and Meligethes aeneus. Transcript orthologs of 50 selected genes were analyzed in D. v. virgifera diet-based RNAi bioassays; 21 of these RNAi targets showed mortality and 36 showed growth inhibition. Low dose injection- and diet-based dsRNA assays in T. castaneum and D. v. virgifera, respectively, enabled the identification of the four highly potent RNAi target genes: Rop, dre4, ncm, and RpII140. Maize was genetically engineered to express dsRNA directed against these prioritized candidate target genes. T 0 plants expressing Rop, dre4, or RpII140 RNA hairpins showed protection from D. v. virgifera larval feeding damage. dsRNA targeting Rop, dre4, ncm, and RpII140 in M. aeneus also caused high levels of mortality both by injection and feeding. In summary, high throughput systems for model organisms can be successfully used to identify potent RNA targets for difficult-to-work with agricultural insect pests.

  12. When silence is noise: infantile-onset Barth syndrome caused by a synonymous substitution affecting TAZ gene transcription

    NARCIS (Netherlands)

    Ferri, L.; Dionisi-Vici, C.; Taurisano, R.; Vaz, F. M.; Guerrini, R.; Morrone, A.

    2016-01-01

    Barth syndrome (BTHS) is an X-linked inborn error of metabolism which affects males. The main manifestations are cardiomyopathy, myopathy, hypotonia, growth delay, intermittent neutropenia and 3-methylglutaconic aciduria. Diagnosis is confirmed by mutational analysis of the TAZ gene and biochemical

  13. Introduction of optical reporter gene into cancer and immune cells using lentiviral vector

    International Nuclear Information System (INIS)

    Min, Jung Joon; Le, Uyenchi N.; Moon, Sung Min; Heo, Young Jun; Song, Ho Chun; Bom, Hee Seung; Kim, Yeon Soo

    2004-01-01

    For some applications such as gene therapy or reporter gene imaging, a gene has to be introduced into the organism of interest. Adenoviral vectors are capable of transducing both replicating and non-dividing cells. The adenoviral vectors do not integrate their DNA into host DNA, but do lead to an immune response. Lentiviruses belong to the retrovirus family and are capable of infecting both dividing and non-dividing cells. The human immunodeficiency virus (HIV) is an example of a lentavirus. A disabled HIV virus has been developed and could be used for in vivo gene delivery. A portion of the viral genome which encodes for accessory proteins canbe deleted without affecting production of the vector and efficiency of infection. Lentiviral delivery into various rodent tissues shows sustained expression of the transgene of up to six months. Furthermore, there seems to be little or no immune response with these vectors. These lentiviral vectors hold significant promise for in vivo gene delivery. We constructed lentiviral vector encoding firefly luciferase (Fluc) and eGFP. Fluc-eGFP fusion gene was inserted into multiple cloning sites of pLentiM1.3 vector. Reporter gene (Fluc-eGFP) was designed to be driven by murine CMV promoter with enhanced efficacy of transgene expression as compared to human CMV promoter. We transfected pLenti1.3-Fluc into human cervix cancer cell line (HeLa) and murine T lymphocytes. We also constructed adenovirus encoding Fluc and transfected to HeLa and T cells. This LentiM1.3-Fluc was transfected into HeLa cells and murine T lymphocytes in vitro, showing consistent expression of eGFP under the fluorescence microscopy from the 2nd day of transfection. Firefly luciferase reporter gene was not expressed in immune cells when it is mediated by adenovirus. Lentivirus was validated as a useful vector for both immune and cancer cells

  14. A comparison of CRISPR/Cas9 and siRNA-mediated ALDH2 gene silencing in human cell lines.

    Science.gov (United States)

    Wang, Fei; Guo, Tao; Jiang, Hongmei; Li, Ruobi; Wang, Ting; Zeng, Ni; Dong, Guanghui; Zeng, Xiaowen; Li, Daochuan; Xiao, Yongmei; Hu, Qiansheng; Chen, Wen; Xing, Xiumei; Wang, Qing

    2018-06-01

    Gene knockdown and knockout using RNAi and CRISPR/Cas9 allow for efficient evaluation of gene function, but it is unclear how the choice of technology can influence the results. To compare the phenotypes obtained using siRNA and CRISPR/Cas9 technologies, aldehyde dehydrogenase 2 (ALDH2) was selected as an example. In this study, we constructed one HepG2 cell line with a homozygous mutation in the fifth exon of ALDH2 (ALDH2-KO1 cell) using the eukaryotic CRISPR/Cas9 expression system followed by the limited dilution method and one HepG2 cell line with different mutations in the ALDH2 gene (ALDH2-KO2 cell) using the lentivirus CRISPR/Cas9 system. Additionally, one ALDH2-knockdown (KD) HepG2 cell line was created using siRNA. The reproducibility of these methods was further verified in the HEK293FT cell line. We found that the mRNA expression level of ALDH2 was significantly decreased and the protein expression level of ALDH2 was completely abolished in the ALDH2-KO cell lines, but not in ALDH2-KD cells. Furthermore, the functional activity of ALDH2 was also markedly disrupted in the two ALDH2-KO cell lines compared with ALDH2-KD and wild-type cells. The lack of ALDH2 expression mediated by CRIPSR/Cas9 resulted in a more dramatic increase in the cellular susceptibility to chemical-induced reactive oxygen species generation, cytotoxicity, apoptosis, and inflammation, especially at low concentrations compared with ALDH2-KD and WT cells. Therefore, we consider the gene knockout cell line created by CRISPR/Cas9 to be a more useful tool for identifying the function of a gene.

  15. Repurposed transcriptomic data facilitate discovery of innate immunity toll-like receptor (TLR) Genes across Lophotrochozoa.

    Science.gov (United States)

    Halanych, Kenneth M; Kocot, Kevin M

    2014-10-01

    The growing volume of genomic data from across life represents opportunities for deriving valuable biological information from data that were initially collected for another purpose. Here, we use transcriptomes collected for phylogenomic studies to search for toll-like receptor (TLR) genes in poorly sampled lophotrochozoan clades (Annelida, Mollusca, Brachiopoda, Phoronida, and Entoprocta) and one ecdysozoan clade (Priapulida). TLR genes are involved in innate immunity across animals by recognizing potential microbial infection. They have an extracellular leucine-rich repeat (LRR) domain connected to a transmembrane domain and an intracellular toll/interleukin-1 receptor (TIR) domain. Consequently, these genes are important in initiating a signaling pathway to trigger defense. We found at least one TLR ortholog in all but two taxa examined, suggesting that a broad array of lophotrochozoans may have innate immune systems similar to those observed in vertebrates and arthropods. Comparison to the SMART database confirmed the presence of both the LRR and the TIR protein motifs characteristic of TLR genes. Because we looked at only one transcriptome per species, discovery of TLR genes was limited for most taxa. However, several TRL-like genes that vary in the number and placement of LRR domains were found in phoronids. Additionally, several contigs contained LRR domains but lacked TIR domains, suggesting they were not TLRs. Many of these LRR-containing contigs had other domains (e.g., immunoglobin) and are likely involved in innate immunity. © 2014 Marine Biological Laboratory.

  16. Innate immune activity conditions the effect of regulatory variants upon monocyte gene expression.

    Science.gov (United States)

    Fairfax, Benjamin P; Humburg, Peter; Makino, Seiko; Naranbhai, Vivek; Wong, Daniel; Lau, Evelyn; Jostins, Luke; Plant, Katharine; Andrews, Robert; McGee, Chris; Knight, Julian C

    2014-03-07

    To systematically investigate the impact of immune stimulation upon regulatory variant activity, we exposed primary monocytes from 432 healthy Europeans to interferon-γ (IFN-γ) or differing durations of lipopolysaccharide and mapped expression quantitative trait loci (eQTLs). More than half of cis-eQTLs identified, involving hundreds of genes and associated pathways, are detected specifically in stimulated monocytes. Induced innate immune activity reveals multiple master regulatory trans-eQTLs including the major histocompatibility complex (MHC), coding variants altering enzyme and receptor function, an IFN-β cytokine network showing temporal specificity, and an interferon regulatory factor 2 (IRF2) transcription factor-modulated network. Induced eQTL are significantly enriched for genome-wide association study loci, identifying context-specific associations to putative causal genes including CARD9, ATM, and IRF8. Thus, applying pathophysiologically relevant immune stimuli assists resolution of functional genetic variants.

  17. Identification of immune response-related genes in the Chinese oak silkworm, Antheraea pernyi by suppression subtractive hybridization.

    Science.gov (United States)

    Liu, Qiu-Ning; Zhu, Bao-Jian; Wang, Lei; Wei, Guo-Qing; Dai, Li-Shang; Lin, Kun-Zhang; Sun, Yu; Qiu, Jian-Feng; Fu, Wei-Wei; Liu, Chao-Liang

    2013-11-01

    Insects possess an innate immune system that responds to invading microorganisms. In this study, a subtractive cDNA library was constructed to screen for immune response-related genes in the fat bodies of Antheraea pernyi (Lepidoptera: Saturniidae) pupa challenged with Escherichia coli. Four hundred putative EST clones were identified by suppression subtractive hybridization (SSH), including 50 immune response-related genes, three cytoskeleton genes, eight cell cycle and apoptosis genes, five respiration and energy metabolism genes, five transport genes, 40 metabolism genes, ten stress response genes, four transcription and translation regulation genes and 77 unknown genes. To verify the reliability of the SSH data, the transcription of a set of randomly selected immune response-related genes were confirmed by semi-quantitative reverse transcription-PCR (RT-PCR) and real-time quantitative reverse transcription-PCR (qRT-PCR). These identified immune response-related genes provide insight into understanding the innate immunity in A. pernyi. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Suv4-20h histone methyltransferases promote neuroectodermal differentiation by silencing the pluripotency-associated Oct-25 gene.

    Directory of Open Access Journals (Sweden)

    Dario Nicetto

    Full Text Available Post-translational modifications (PTMs of histones exert fundamental roles in regulating gene expression. During development, groups of PTMs are constrained by unknown mechanisms into combinatorial patterns, which facilitate transitions from uncommitted embryonic cells into differentiated somatic cell lineages. Repressive histone modifications such as H3K9me3 or H3K27me3 have been investigated in detail, but the role of H4K20me3 in development is currently unknown. Here we show that Xenopus laevis Suv4-20h1 and h2 histone methyltransferases (HMTases are essential for induction and differentiation of the neuroectoderm. Morpholino-mediated knockdown of the two HMTases leads to a selective and specific downregulation of genes controlling neural induction, thereby effectively blocking differentiation of the neuroectoderm. Global transcriptome analysis supports the notion that these effects arise from the transcriptional deregulation of specific genes rather than widespread, pleiotropic effects. Interestingly, morphant embryos fail to repress the Oct4-related Xenopus gene Oct-25. We validate Oct-25 as a direct target of xSu4-20h enzyme mediated gene repression, showing by chromatin immunoprecipitaton that it is decorated with the H4K20me3 mark downstream of the promoter in normal, but not in double-morphant, embryos. Since knockdown of Oct-25 protein significantly rescues the neural differentiation defect in xSuv4-20h double-morphant embryos, we conclude that the epistatic relationship between Suv4-20h enzymes and Oct-25 controls the transit from pluripotent to differentiation-competent neural cells. Consistent with these results in Xenopus, murine Suv4-20h1/h2 double-knockout embryonic stem (DKO ES cells exhibit increased Oct4 protein levels before and during EB formation, and reveal a compromised and biased capacity for in vitro differentiation, when compared to normal ES cells. Together, these results suggest a regulatory mechanism, conserved

  19. An Organismal Model for Gene Regulatory Networks in the Gut-Associated Immune Response

    Directory of Open Access Journals (Sweden)

    Katherine M. Buckley

    2017-10-01

    Full Text Available The gut epithelium is an ancient site of complex communication between the animal immune system and the microbial world. While elements of self-non-self receptors and effector mechanisms differ greatly among animal phyla, some aspects of recognition, regulation, and response are broadly conserved. A gene regulatory network (GRN approach provides a means to investigate the nature of this conservation and divergence even as more peripheral functional details remain incompletely understood. The sea urchin embryo is an unparalleled experimental model for detangling the GRNs that govern embryonic development. By applying this theoretical framework to the free swimming, feeding larval stage of the purple sea urchin, it is possible to delineate the conserved regulatory circuitry that regulates the gut-associated immune response. This model provides a morphologically simple system in which to efficiently unravel regulatory connections that are phylogenetically relevant to immunity in vertebrates. Here, we review the organism-wide cellular and transcriptional immune response of the sea urchin larva. A large set of transcription factors and signal systems, including epithelial expression of interleukin 17 (IL17, are important mediators in the activation of the early gut-associated response. Many of these have homologs that are active in vertebrate immunity, while others are ancient in animals but absent in vertebrates or specific to echinoderms. This larval model provides a means to experimentally characterize immune function encoded in the sea urchin genome and the regulatory interconnections that control immune response and resolution across the tissues of the organism.

  20. Effect of water pollution on expression of immune response genes of ...

    African Journals Online (AJOL)

    This research was aimed to study quality of water in Lake Qarun and effects of pollution on expression of immune genes in Egyptian sole (Solea aegyptiaca) fish. The study was carried out from August 2006 to the end of April 2007. The water samples were collected from different locations of Lake Qarun at Al-Oberge within ...

  1. Molecular cloning, functional expression, and gene silencing of two Drosophila receptors for the Drosophila neuropeptide pyrokinin-2

    DEFF Research Database (Denmark)

    Rosenkilde, Carina; Cazzamali, Giuseppe; Williamson, Michael

    2003-01-01

    The database of the Drosophila Genome Project contains the sequences of two genes, CG8784 and CG8795, predicted to code for two structurally related G protein-coupled receptors. We have cloned these genes and expressed their coding parts in Chinese hamster ovary cells. We found that both receptors...... can be activated by low concentrations of the Drosophila neuropeptide pyrokinin-2 (CG8784, EC(50) for pyrokinin-2, 1x10(-9)M; CG8795, EC(50) for pyrokinin-2, 5 x 10(-10)M). The precise role of Drosophila pyrokinin-2 (SVPFKPRLamide) in Drosophila is unknown, but in other insects, pyrokinins have...... embryos and first instar larvae. In addition to the two Drosophila receptors, we also identified two probable pyrokinin receptors in the genomic database from the malaria mosquito Anopheles gambiae. The two Drosophila pyrokinin receptors are, to our knowledge, the first invertebrate pyrokinin receptors...

  2. High amino acid diversity and positive selection at a putative coral immunity gene (tachylectin-2

    Directory of Open Access Journals (Sweden)

    Hellberg Michael E

    2010-05-01

    Full Text Available Abstract Background Genes involved in immune functions, including pathogen recognition and the activation of innate defense pathways, are among the most genetically variable known, and the proteins that they encode are often characterized by high rates of amino acid substitutions, a hallmark of positive selection. The high levels of variation characteristic of immunity genes make them useful tools for conservation genetics. To date, highly variable immunity genes have yet to be found in corals, keystone organisms of the world's most diverse marine ecosystem, the coral reef. Here, we examine variation in and selection on a putative innate immunity gene from Oculina, a coral genus previously used as a model for studies of coral disease and bleaching. Results In a survey of 244 Oculina alleles, we find high nonsynonymous variation and a signature of positive selection, consistent with a putative role in immunity. Using computational protein structure prediction, we generate a structural model of the Oculina protein that closely matches the known structure of tachylectin-2 from the Japanese horseshoe crab (Tachypleus tridentatus, a protein with demonstrated function in microbial recognition and agglutination. We also demonstrate that at least three other genera of anthozoan cnidarians (Acropora, Montastrea and Nematostella possess proteins structurally similar to tachylectin-2. Conclusions Taken together, the evidence of high amino acid diversity, positive selection and structural correspondence to the horseshoe crab tachylectin-2 suggests that this protein is 1 part of Oculina's innate immunity repertoire, and 2 evolving adaptively, possibly under selective pressure from coral-associated microorganisms. Tachylectin-2 may serve as a candidate locus to screen coral populations for their capacity to respond adaptively to future environmental change.

  3. Flowering Without Vernalization in Winter Canola (Brassica napus: use of Virus-Induced Gene Silencing (VIGS to accelerate genetic gain

    Directory of Open Access Journals (Sweden)

    Raúl Álvarez-Venegas

    2010-01-01

    Full Text Available Ciclos de reproducción cortos y la oportunidad de incrementar la ganancia genética, junto con el estudio de las bases moleculares de la vernalización, son áreas esenciales de investigación dentro de la biología de plantas. Varios métodos se han empleado para lograr el silenciamiento génico en plantas, pero ninguno reportado a la fecha para canola (Brassica napus, y en particular para inducir la floración sin vernalización en líneas de invierno a través del uso de secuencias sentido de DNA en vectores diseñados para el silenciamiento génico inducido por virus (VIGS. La presente investigación provee los métodos para transitoriamente regular a la baja, por medio de VIGS, genes de la vernalización en plantas anuales de invierno, específicamente la familia de genes de Flowering Locus C (FLC en canola de invierno (BnFLC1 a BnFLC5. La regulación a la baja de estos genes permite a las plantas anuales de invierno florecer sin vernalización y, consecuentemente, provee los medios para acelerar la ganancia genética. El sistema de silenciamiento propuesto puede ser utilizado para regular a la baja familias de genes, para determinar la función génica, y para inducir la floración sin la vernalización en líneas de invierno tanto del género Brassica como de muchos cultivos importantes de invierno.

  4. When silence is noise: infantile-onset Barth syndrome caused by a synonymous substitution affecting TAZ gene transcription.

    Science.gov (United States)

    Ferri, L; Dionisi-Vici, C; Taurisano, R; Vaz, F M; Guerrini, R; Morrone, A

    2016-11-01

    Barth syndrome (BTHS) is an X-linked inborn error of metabolism which affects males. The main manifestations are cardiomyopathy, myopathy, hypotonia, growth delay, intermittent neutropenia and 3-methylglutaconic aciduria. Diagnosis is confirmed by mutational analysis of the TAZ gene and biochemical dosage of the monolysocardiolipin/tetralinoleoyl cardiolipin (MLCL:L4-CL) ratio. We report a 6-year-old boy who presented with severe hypoglycemia, lactic acidosis and severe dilated cardiomyopathy soon after birth. The MLCL:L4-CL ratio confirmed BTHS (3.90 on patient's fibroblast, normal: 0-0.3). Subsequent sequencing of the TAZ gene revealed only the new synonymous variant NM_000116.3 (TAZ):c.348C>T p.(Gly116Gly), which did not appear to affect the protein sequence. In silico prediction analysis suggested the new c.348C>T nucleotide change could alter the TAZ mRNA splicing processing. We analyzed TAZ mRNAs in the patient's fibroblasts and found an abnormal skipping of 24 bases (NM_000116.3:c.346_371), with the consequent ablation of 8 amino acid residues in the tafazzin protein (NP_000107.1:p.Lys117_Gly124del). Molecular analysis of at risk female family members identified the patient's sister and mother as heterozygous carriers. Apparently harmless synonymous variants in the TAZ gene can damage gene expression. Such findings widen our knowledge of molecular heterogeneity in BTHS. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. 4'- C -Methoxy-2-deoxy-2'-fluoro Modified Ribonucleotides Improve Metabolic Stability and Elicit Efficient RNAi-Mediated Gene Silencing

    Energy Technology Data Exchange (ETDEWEB)

    Malek-Adamian, Elise; Guenther, Dale C.; Matsuda, Shigeo; Martínez-Montero, Saúl; Zlatev, Ivan; Harp, Joel; Patrascu, Mihai Burai; Foster, Donald J.; Fakhoury, Johans; Perkins, Lydia; Moitessier, Nicolas; Manoharan, Rajar M.; Taneja, Nate; Bisbe, Anna; Charisse, Klaus; Maier, Martin; Rajeev, Kallanthottathil G.; Egli, Martin; Manoharan, Muthiah; Damha, Masad J. (McGill); (Alnylam Pharm.); (Vanderbilt)

    2017-10-06

    We designed novel 4'-modified 2'-deoxy-2'-fluorouridine (2'-F U) analogues with the aim to improve nuclease resistance and potency of therapeutic siRNAs by introducing 4'-C-methoxy (4'-OMe) as the alpha (C4'α) or beta (C4'β) epimers. The C4'α epimer was synthesized by a stereoselective route in six steps; however, both α and β epimers could be obtained by a nonstereoselective approach starting from 2'-F U. 1H NMR analysis and computational investigation of the α-epimer revealed that the 4'-OMe imparts a conformational bias toward the North-East sugar pucker, due to intramolecular hydrogen bonding and hyperconjugation effects. The α-epimer generally conceded similar thermal stability as unmodified nucleotides, whereas the β-epimer led to significant destabilization. Both 4'-OMe epimers conferred increased nuclease resistance, which can be explained by the close proximity between 4'-OMe substituent and the vicinal 5'- and 3'-phosphate group, as seen in the X-ray crystal structure of modified RNA. siRNAs containing several C4'α-epimer monomers in the sense or antisense strands triggered RNAi-mediated gene silencing with efficiencies comparable to that of 2'-F U.

  6. Silencing of the HER2/neu Gene by siRNA Inhibits Proliferation and Induces Apoptosis in HER2/neu-Overexpressing Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Timo Faltus

    2004-11-01

    Full Text Available In eukaryotes, double-stranded (ds RNA induces sequence-specific inhibition of gene expression referred to as RNA interference (RNAi. We exploited RNAi to define the role of HER2/neu in the neoplastic proliferation of human breast cancer cells. We transfected SK-BR-3, BT-474, MCF-7, and MDA-MB-468 breast cancer cells with short interfering RNA (siRNA targeted against human HER2/neu and analyzed the specific inhibition of HER2/neu expression by Northern and Western blots. Transfection with HER2/neu-specific siRNA resulted in a sequence-specific decrease in HER2/neu mRNA and protein levels. Moreover, transfection with HER2/neu siRNA caused cell cycle arrest at G0/G1 in the breast cancer cell lines SKBR-3 and BT-474, consistent with a powerful RNA silencing effect. siRNA treatment resulted in an antiproliferative and apoptotic response in cells overexpressing HER2/neu, but had no influence in cells with almost no expression of HER2/neu proteins like MDA-MB-468 cells. These data indicate that HER2/neu function is essential for the proliferation of HER2/neuoverexpressing breast cancer cells. Our observations suggest that siRNA targeted against human HER2/neu may be valuable tools as anti proliferative agents that display activity against neoplastic cells at very low doses.

  7. Phylogenetic Studies of the Three RNA Silencing Suppressor Genes of South American CTV Isolates Reveal the Circulation of a Novel Genetic Lineage

    Directory of Open Access Journals (Sweden)

    María José Benítez-Galeano

    2015-07-01

    Full Text Available Citrus Tristeza Virus (CTV is the most economically important virus of citrus worldwide. Genetic diversity and population structure of CTV isolates from all citrus growing areas from Uruguay were analyzed by RT-PCR and cloning of the three RNA silencing suppressor genes (p25, p20 and p23. Bayesian phylogenetic analysis revealed the circulation of three known genotypes (VT, T3, T36 in the country, and the presence of a new genetic lineage composed by isolates from around the world, mainly from South America. Nucleotide and amino acid identity values for this new genetic lineage were both higher than 97% for the three analyzed regions. Due to incongruent phylogenetic relationships, recombination analysis was performed using Genetic Algorithms for Recombination Detection (GARD and SimPlot software. Recombination events between previously described CTV isolates were detected. High intra-sample variation was found, confirming the co-existence of different genotypes into the same plant. This is the first report describing: (1 the genetic diversity of Uruguayan CTV isolates circulating in the country and (2 the circulation of a novel CTV genetic lineage, highly present in the South American region. This information may provide assistance to develop an effective cross-protection program.

  8. Vacuolar invertase gene silencing in potato (Solanum tuberosum L. improves processing quality by decreasing the frequency of sugar-end defects.

    Directory of Open Access Journals (Sweden)

    Xiaobiao Zhu

    Full Text Available Sugar-end defect is a tuber quality disorder and persistent problem for the French fry processing industry that causes unacceptable darkening of one end of French fries. This defect appears when environmental stress during tuber growth increases post-harvest vacuolar acid invertase activity at one end of the tuber. Reducing sugars produced by invertase form dark-colored Maillard reaction products during frying. Acrylamide is another Maillard reaction product formed from reducing sugars and acrylamide consumption has raised health concerns worldwide. Vacuolar invertase gene (VInv expression was suppressed in cultivars Russet Burbank and Ranger Russet using RNA interference to determine if this approach could control sugar-end defect formation. Acid invertase activity and reducing sugar content decreased at both ends of tubers. Sugar-end defects and acrylamide in fried potato strips were strongly reduced in multiple transgenic potato lines. Thus vacuolar invertase silencing can minimize a long-standing French fry quality problem while providing consumers with attractive products that reduce health concerns related to dietary acrylamide.

  9. Polycomb complexes and silencing mechanisms

    DEFF Research Database (Denmark)

    Lund, Anders H; van Lohuizen, Maarten

    2004-01-01

    Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....

  10. Construction and comparison of gene co-expression networks shows complex plant immune responses

    Directory of Open Access Journals (Sweden)

    Luis Guillermo Leal

    2014-10-01

    Full Text Available Gene co-expression networks (GCNs are graphic representations that depict the coordinated transcription of genes in response to certain stimuli. GCNs provide functional annotations of genes whose function is unknown and are further used in studies of translational functional genomics among species. In this work, a methodology for the reconstruction and comparison of GCNs is presented. This approach was applied using gene expression data that were obtained from immunity experiments in Arabidopsis thaliana, rice, soybean, tomato and cassava. After the evaluation of diverse similarity metrics for the GCN reconstruction, we recommended the mutual information coefficient measurement and a clustering coefficient-based method for similarity threshold selection. To compare GCNs, we proposed a multivariate approach based on the Principal Component Analysis (PCA. Branches of plant immunity that were exemplified by each experiment were analyzed in conjunction with the PCA results, suggesting both the robustness and the dynamic nature of the cellular responses. The dynamic of molecular plant responses produced networks with different characteristics that are differentiable using our methodology. The comparison of GCNs from plant pathosystems, showed that in response to similar pathogens plants could activate conserved signaling pathways. The results confirmed that the closeness of GCNs projected on the principal component space is an indicative of similarity among GCNs. This also can be used to understand global patterns of events triggered during plant immune responses.

  11. Gene expression in peripheral immune cells following cardioembolic stroke is sexually dimorphic.

    Directory of Open Access Journals (Sweden)

    Boryana Stamova

    Full Text Available Epidemiological studies suggest that sex has a role in the pathogenesis of cardioembolic stroke. Since stroke is a vascular disease, identifying sexually dimorphic gene expression changes in blood leukocytes can inform on sex-specific risk factors, response and outcome biology. We aimed to examine the sexually dimorphic immune response following cardioembolic stroke by studying the differential gene expression in peripheral white blood cells.Blood samples from patients with cardioembolic stroke were obtained at ≤3 hours (prior to treatment, 5 hours and 24 hours (after treatment after stroke onset (n = 23; 69 samples and compared with vascular risk factor controls without symptomatic vascular diseases (n = 23, 23 samples (ANCOVA, false discovery rate p≤0.05, |fold change| ≥1.2. mRNA levels were measured on whole-genome Affymetrix microarrays. There were more up-regulated than down-regulated genes in both sexes, and females had more differentially expressed genes than males following cardioembolic stroke. Female gene expression was associated with cell death and survival, cell-cell signaling and inflammation. Male gene expression was associated with cellular assembly, organization and compromise. Immune response pathways were over represented at ≤3, 5 and 24 h after stroke in female subjects but only at 24 h in males. Neutrophil-specific genes were differentially expressed at 3, 5 and 24 h in females but only at 5 h and 24 h in males.There are sexually dimorphic immune cell expression profiles following cardioembolic stroke. Future studies are needed to confirm the findings using qRT-PCR in an independent cohort, to determine how they relate to risk and outcome, and to compare to other causes of ischemic stroke.

  12. Population genomics of the immune evasion (var genes of Plasmodium falciparum.

    Directory of Open Access Journals (Sweden)

    Alyssa E Barry

    2007-03-01

    Full Text Available Var genes encode the major surface antigen (PfEMP1 of the blood stages of the human malaria parasite Plasmodium falciparum. Differential expression of up to 60 diverse var genes in each parasite genome underlies immune evasion. We compared the diversity of the DBLalpha domain of var genes sampled from 30 parasite isolates from a malaria endemic area of Papua New Guinea (PNG and 59 from widespread geographic origins (global. Overall, we obtained over 8,000 quality-controlled DBLalpha sequences. Within our sampling frame, the global population had a total of 895 distinct DBLalpha "types" and negligible overlap among repertoires. This indicated that var gene diversity on a global scale is so immense that many genomes would need to be sequenced to capture its true extent. In contrast, we found a much lower diversity in PNG of 185 DBLalpha types, with an average of approximately 7% overlap among repertoires. While we identify marked geographic structuring, nearly 40% of types identified in PNG were also found in samples from different countries showing a cosmopolitan distribution for much of the diversity. We also present evidence to suggest that recombination plays a key role in maintaining the unprecedented levels of polymorphism found in these immune evasion genes. This population genomic framework provides a cost effective molecular epidemiological tool to rapidly explore the geographic diversity of var genes.

  13. Pretransplant Immune- and Apoptosis-Related Gene Expression Is Associated with Kidney Allograft Function

    Directory of Open Access Journals (Sweden)

    Dorota Kamińska

    2016-01-01

    Full Text Available Renal transplant candidates present immune dysregulation, caused by chronic uremia. The aim of the study was to investigate whether pretransplant peripheral blood gene expression of immune factors affects clinical outcome of renal allograft recipients. Methods. In a prospective study, we analyzed pretransplant peripheral blood gene expression in87 renal transplant candidates with real-time PCR on custom-designed low density arrays (TaqMan. Results. Immediate posttransplant graft function (14-day GFR was influenced negatively by TGFB1 (P=0.039 and positively by IL-2 gene expression (P=0.040. Pretransplant blood mRNA expression of apoptosis-related genes (CASP3, FAS, and IL-18 and Th1-derived cytokine gene IFNG correlated positively with short- (6-month GFR CASP3: P=0.027, FAS: P=0.021, and IFNG: P=0.029 and long-term graft function (24-month GFR CASP3: P=0.003, FAS: P=0.033, IL-18: P=0.044, and IFNG: P=0.04. Conclusion. Lowered pretransplant Th1-derived cytokine and apoptosis-related gene expressions were a hallmark of subsequent worse kidney function but not of acute rejection rate. The pretransplant IFNG and CASP3 and FAS and IL-18 genes’ expression in the recipients’ peripheral blood is the possible candidate for novel biomarker of short- and long-term allograft function.

  14. Caste-, sex-, and age-dependent expression of immune-related genes in a Japanese subterranean termite, Reticulitermes speratus.

    Directory of Open Access Journals (Sweden)

    Yuki Mitaka

    Full Text Available Insects protect themselves from microbial infections through innate immune responses, including pathogen recognition, phagocytosis, the activation of proteolytic cascades, and the synthesis of antimicrobial peptides. Termites, eusocial insects inhabiting microbe-rich wood, live in closely-related family groups that are susceptible to shared pathogen infections. To resist pathogenic infection, termite families have evolved diverse immune adaptations at both individual and societal levels, and a strategy of trade-offs between reproduction and immunity has been suggested. Although termite immune-inducible genes have been identified, few studies have investigated the differential expression of these genes between reproductive and neuter castes, and between sexes in each caste. In this study, we compared the expression levels of immune-related genes among castes, sexes, and ages in a Japanese subterranean termite, Reticulitermes speratus. Using RNA-seq, we found 197 immune-related genes, including 40 pattern recognition proteins, 97 signalling proteins, 60 effectors. Among these genes, 174 showed differential expression among castes. Comparing expression levels between males and females in each caste, we found sexually dimorphic expression of immune-related genes not only in reproductive castes, but also in neuter castes. Moreover, we identified age-related differential expression of 162 genes in male and/or female reproductives. In addition, although R. speratus is known to use the antibacterial peptide C-type lysozyme as an egg recognition pheromone, we determined that R. speratus has not only C-type, but also P-type and I-type lysozymes, as well as other termite species. Our transcriptomic analyses revealed immune response plasticity among all castes, and sex-biased expression of immune genes even in neuter castes, suggesting a sexual division of labor in the immune system of R. speratus. This study heightens the understanding of the evolution of

  15. Transient Co-Expression of Post-Transcriptional Gene Silencing Suppressors for Increased in Planta Expression of a Recombinant Anthrax Receptor Fusion Protein

    Directory of Open Access Journals (Sweden)

    Kittipong Rattanaporn

    2011-08-01

    Full Text Available Potential epidemics of infectious diseases and the constant threat of bioterrorism demand rapid, scalable, and cost-efficient manufacturing of therapeutic proteins. Molecular farming of tobacco plants provides an alternative for the recombinant production of therapeutics. We have developed a transient production platform that uses Agrobacterium infiltration of Nicotiana benthamiana plants to express a novel anthrax receptor decoy protein (immunoadhesin, CMG2-Fc. This chimeric fusion protein, designed to protect against the deadly anthrax toxins, is composed of the von Willebrand factor A (VWA domain of human capillary morphogenesis 2 (CMG2, an effective anthrax toxin receptor, and the Fc region of human immunoglobulin G (IgG. We evaluated, in N. benthamiana intact plants and detached leaves, the expression of CMG2-Fc under the control of the constitutive CaMV 35S promoter, and the co-expression of CMG2-Fc with nine different viral suppressors of post-transcriptional gene silencing (PTGS: p1, p10, p19, p21, p24, p25, p38, 2b, and HCPro. Overall, transient CMG2-Fc expression was higher on intact plants than detached leaves. Maximum expression was observed with p1 co-expression at 3.5 days post-infiltration (DPI, with a level of 0.56 g CMG2-Fc per kg of leaf fresh weight and 1.5% of the total soluble protein, a ten-fold increase in expression when compared to absence of suppression. Co-expression with the p25 PTGS suppressor also significantly increased the CMG2-Fc expression level after just 3.5 DPI.

  16. Transient co-expression of post-transcriptional gene silencing suppressors for increased in planta expression of a recombinant anthrax receptor fusion protein.

    Science.gov (United States)

    Arzola, Lucas; Chen, Junxing; Rattanaporn, Kittipong; Maclean, James M; McDonald, Karen A

    2011-01-01

    Potential epidemics of infectious diseases and the constant threat of bioterrorism demand rapid, scalable, and cost-efficient manufacturing of therapeutic proteins. Molecular farming of tobacco plants provides an alternative for the recombinant production of therapeutics. We have developed a transient production platform that uses Agrobacterium infiltration of Nicotiana benthamiana plants to express a novel anthrax receptor decoy protein (immunoadhesin), CMG2-Fc. This chimeric fusion protein, designed to protect against the deadly anthrax toxins, is composed of the von Willebrand factor A (VWA) domain of human capillary morphogenesis 2 (CMG2), an effective anthrax toxin receptor, and the Fc region of human immunoglobulin G (IgG). We evaluated, in N. benthamiana intact plants and detached leaves, the expression of CMG2-Fc under the control of the constitutive CaMV 35S promoter, and the co-expression of CMG2-Fc with nine different viral suppressors of post-transcriptional gene silencing (PTGS): p1, p10, p19, p21, p24, p25, p38, 2b, and HCPro. Overall, transient CMG2-Fc expression was higher on intact plants than detached leaves. Maximum expression was observed with p1 co-expression at 3.5 days post-infiltration (DPI), with a level of 0.56 g CMG2-Fc per kg of leaf fresh weight and 1.5% of the total soluble protein, a ten-fold increase in expression when compared to absence of suppression. Co-expression with the p25 PTGS suppressor also significantly increased the CMG2-Fc expression level after just 3.5 DPI.

  17. Origin of the polycomb repressive complex 2 and gene silencing by an E(z) homolog in the unicellular alga Chlamydomonas.

    Science.gov (United States)

    Shaver, Scott; Casas-Mollano, J Armando; Cerny, Ronald L; Cerutti, Heriberto

    2010-05-16

    Polycomb group proteins play an essential role in the maintenance of cell identity and the regulation of development in both animals and plants. The Polycomb Repressive Complex 2 (PRC2) is involved in the establishment of transcriptionally silent chromatin states, in part through its ability to methylate lysine 27 of histone H3 by the Enhancer of zeste [E(z)] subunit. The absence of PRC2 in unicellular model fungi and its function in the repression of genes vital for the development of higher eukaryotes led to the proposal that this complex may have evolved together with the emergence of multicellularity. However, we report here on the widespread presence of PRC2 core subunits in unicellular eukaryotes from the Opisthokonta, Chromalveolata and Archaeplastida supergroups. To gain insight on the role of PRC2 in single celled organisms, we characterized an E(z) homolog, EZH, in the green alga Chlamydomonas reinhardtii. RNAi-mediated suppression of EZH led to defects in the silencing of transgenes and retrotransposons as well as to a global increase in histone post-translational modifications associated with transcriptional activity, such as trimethylation of histone H3 lysine 4 and acetylation of histone H4. On the basis of the parsimony principle, our findings suggest that PRC2 appeared early in eukaryotic evolution, even perhaps in the last unicellular common ancestor of eukaryotes. One of the ancestral roles of PCR2 may have been in defense responses against intragenomic parasites such as transposable elements, prior to being co-opted for lineage specific functions like developmental regulation in multicellular eukaryotes.

  18. AAV2-mediated in vivo immune gene therapy of solid tumours

    LENUS (Irish Health Repository)

    Collins, Sara A

    2010-12-20

    Abstract Background Many strategies have been adopted to unleash the potential of gene therapy for cancer, involving a wide range of therapeutic genes delivered by various methods. Immune therapy has become one of the major strategies adopted for cancer gene therapy and seeks to stimulate the immune system to target tumour antigens. In this study, the feasibility of AAV2 mediated immunotherapy of growing tumours was examined, in isolation and combined with anti-angiogenic therapy. Methods Immune-competent Balb\\/C or C57 mice bearing subcutaneous JBS fibrosarcoma or Lewis Lung Carcinoma (LLC) tumour xenografts respectively were treated by intra-tumoural administration of AAV2 vector encoding the immune up-regulating cytokine granulocyte macrophage-colony stimulating factor (GM-CSF) and the co-stimulatory molecule B7-1 to subcutaneous tumours, either alone or in combination with intra-muscular (IM) delivery of AAV2 vector encoding Nk4 14 days prior to tumour induction. Tumour growth and survival was monitored for all animals. Cured animals were re-challenged with tumourigenic doses of the original tumour type. In vivo cytotoxicity assays were used to investigate establishment of cell-mediated responses in treated animals. Results AAV2-mediated GM-CSF, B7-1 treatment resulted in a significant reduction in tumour growth and an increase in survival in both tumour models. Cured animals were resistant to re-challenge, and induction of T cell mediated anti-tumour responses were demonstrated. Adoptive transfer of splenocytes to naïve animals prevented tumour establishment. Systemic production of Nk4 induced by intra-muscular (IM) delivery of Nk4 significantly reduced subcutaneous tumour growth. However, combination of Nk4 treatment with GM-CSF, B7-1 therapy reduced the efficacy of the immune therapy. Conclusions Overall, this study demonstrates the potential for in vivo AAV2 mediated immune gene therapy, and provides data on the inter-relationship between tumour

  19. Cellular Immune Response Against Firefly Luciferase After Sleeping Beauty–Mediated Gene Transfer In Vivo

    Science.gov (United States)

    Podetz-Pedersen, Kelly M.; Vezys, Vaiva; Somia, Nikunj V.; Russell, Stephen J.

    2014-01-01

    Abstract The Sleeping Beauty (SB) transposon system has been shown to mediate new gene sequence integration resulting in long-term expression. Here the effectiveness of hyperactive SB100X transposase was tested, and we found that hydrodynamic co-delivery of a firefly luciferase transposon (pT2/CaL) along with SB100X transposase (pCMV-SB100X) resulted in remarkably sustained, high levels of luciferase expression. However, after 4 weeks there was a rapid, animal-by-animal loss of luciferase expression that was not observed in immunodeficient mice. We hypothesized that this sustained, high-level luciferase expression achieved using the SB100X transposase elicits an immune response in pT2/CaL co-administered mice, which was supported by the rapid loss of luciferase expression upon challenge of previously treated animals and in naive animals adoptively transferred with splenocytes from previously treated animals. Specificity of the immune response to luciferase was demonstrated by increased cytokine expression in splenocytes after exposure to luciferase peptide in parallel with MHC I–luciferase peptide tetramer binding. This anti-luciferase immune response observed following continuous, high-level luciferase expression in vivo clearly impacts its use as an in vivo reporter. As both an immunogen and an extremely sensitive reporter, luciferase is also a useful model system for the study of immune responses following in vivo gene transfer and expression. PMID:25093708

  20. Genome-wide characterization and expression profiling of immune genes in the diamondback moth, Plutella xylostella (L.).

    Science.gov (United States)

    Xia, Xiaofeng; Yu, Liying; Xue, Minqian; Yu, Xiaoqiang; Vasseur, Liette; Gurr, Geoff M; Baxter, Simon W; Lin, Hailan; Lin, Junhan; You, Minsheng

    2015-05-06

    The diamondback moth, Plutella xylostella (L.), is a destructive pest that attacks cruciferous crops worldwide. Immune responses are important for interactions between insects and pathogens and information on these underpins the development of strategies for biocontrol-based pest management. Little, however, is known about immune genes and their regulation patterns in P. xylostella. A total of 149 immune-related genes in 20 gene families were identified through comparison of P. xylostella genome with the genomes of other insects. Complete and conserved Toll, IMD and JAK-STAT signaling pathways were found in P. xylostella. Genes involved in pathogen recognition were expanded and more diversified than genes associated with intracellular signal transduction. Gene expression profiles showed that the IMD pathway may regulate expression of antimicrobial peptide (AMP) genes in the midgut, and be related to an observed down-regulation of AMPs in experimental lines of insecticide-resistant P. xylostella. A bacterial feeding study demonstrated that P. xylostella could activate different AMPs in response to bacterial infection. This study has established a framework of comprehensive expression profiles that highlight cues for immune regulation in a major pest. Our work provides a foundation for further studies on the functions of P. xylostella immune genes and mechanisms of innate immunity.

  1. Titration and hysteresis in epigenetic chromatin silencing

    International Nuclear Information System (INIS)

    Dayarian, Adel; Sengupta, Anirvan M

    2013-01-01

    Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)

  2. Antibody study in canine distemper virus nucleocapsid protein gene-immunized mice.

    Science.gov (United States)

    Yuan, B; Li, X Y; Zhu, T; Yuan, L; Hu, J P; Chen, J; Gao, W; Ren, W Z

    2015-04-10

    The gene for the nucleocapsid (N) protein of canine distemper virus was cloned into the pMD-18T vector, and positive recombinant plasmids were obtained by enzyme digestion and sequencing. After digestion by both EcoRI and KpnI, the plasmid was directionally cloned into the eukaryotic expression vector pcDNA; the positive clone pcDNA-N was screened by electrophoresis and then transfected into COS-7 cells. Immunofluorescence analysis results showed that the canine distemper virus N protein was expressed in the cytoplasm of transfected COS-7 cells. After emulsification in Freund's adjuvant, the recombinant plasmid pcDNA-N was injected into the abdominal cavity of 8-week-old BABL/c mice, with the pcDNA original vector used as a negative control. Mice were immunized 3 times every 2 weeks. The blood of immunized mice was drawn 2 weeks after completing the immunizations to measure titer levels. The antibody titer in the pcDNA-N test was 10(1.62 ± 0.164), while in the control group this value was 10(0.52 ± 0.56), indicating that specific humoral immunity was induced in canine distemper virus nucleocapsid protein-immunized mice.

  3. Small RNA-Mediated Epigenetic Myostatin Silencing

    Directory of Open Access Journals (Sweden)

    Thomas C Roberts

    2012-01-01

    Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

  4. Activation of innate immune genes in caprine blood leukocytes after systemic endotoxin challenge

    DEFF Research Database (Denmark)

    Salvesen, Øyvind; Reiten, Malin R; Heegaard, Peter M. H.

    2016-01-01

    observed peaking at 2 h, corroborating the increasing evidence that ISGs respond immediately to bacterial endotoxins. A slower response was manifested by four extrahepatic acute phase proteins (APP) (SAA3, HP, LF and LCN2) reaching maximum levels at 5 h. We report an immediate induction of ISGs...... insights into the dynamic regulation of innate immune genes, as well as raising new questions regarding the importance of ISGs and extrahepatic APPs in leukocytes after systemic endotoxin challenge....

  5. Induction of innate immune gene expression following methyl methanesulfonate-induced DNA damage in sea urchins

    OpenAIRE

    Reinardy, H. C.; Chapman, J.; Bodnar, A. G.

    2016-01-01

    Sea urchins are noted for the absence of neoplastic disease and represent a novel model to investigate cellular and systemic cancer protection mechanisms. Following intracoelomic injection of the DNA alkylating agent methyl methanesulfonate, DNA damage was detected in sea urchin cells and tissues (coelomocytes, muscle, oesophagus, ampullae and gonad) by the alkaline unwinding, fast micromethod. Gene expression analyses of the coelomocytes indicated upregulation of innate immune markers, inclu...

  6. Extensive innate immune gene activation accompanies brain aging, increasing vulnerability to cognitive decline and neurodegeneration: a microarray study

    Science.gov (United States)

    2012-01-01

    Background This study undertakes a systematic and comprehensive analysis of brain gene expression profiles of immune/inflammation-related genes in aging and Alzheimer’s disease (AD). Methods In a well-powered microarray study of young (20 to 59 years), aged (60 to 99 years), and AD (74 to 95 years) cases, gene responses were assessed in the hippocampus, entorhinal cortex, superior frontal gyrus, and post-central gyrus. Results Several novel concepts emerge. First, immune/inflammation-related genes showed major changes in gene expression over the course of cognitively normal aging, with the extent of gene response far greater in aging than in AD. Of the 759 immune-related probesets interrogated on the microarray, approximately 40% were significantly altered in the SFG, PCG and HC with increasing age, with the majority upregulated (64 to 86%). In contrast, far fewer immune/inflammation genes were significantly changed in the transition to AD (approximately 6% of immune-related probesets), with gene responses primarily restricted to the SFG and HC. Second, relatively few significant changes in immune/inflammation genes were detected in the EC either in aging or AD, although many genes in the EC showed similar trends in responses as in the other brain regions. Third, immune/inflammation genes undergo gender-specific patterns of response in aging and AD, with the most pronounced differences emerging in aging. Finally, there was widespread upregulation of genes reflecting activation of microglia and perivascular macrophages in the aging brain, coupled with a downregulation of select factors (TOLLIP, fractalkine) that when present curtail microglial/macrophage activation. Notably, essentially all pathways of the innate immune system were upregulated in aging, including numerous complement components, genes involved in toll-like receptor signaling and inflammasome signaling, as well as genes coding for immunoglobulin (Fc) receptors and human leukocyte antigens I

  7. Extensive innate immune gene activation accompanies brain aging, increasing vulnerability to cognitive decline and neurodegeneration: a microarray study

    Directory of Open Access Journals (Sweden)

    Cribbs David H

    2012-07-01

    Full Text Available Abstract Background This study undertakes a systematic and comprehensive analysis of brain gene expression profiles of immune/inflammation-related genes in aging and Alzheimer’s disease (AD. Methods In a well-powered microarray study of young (20 to 59 years, aged (60 to 99 years, and AD (74 to 95 years cases, gene responses were assessed in the hippocampus, entorhinal cortex, superior frontal gyrus, and post-central gyrus. Results Several novel concepts emerge. First, immune/inflammation-related genes showed major changes in gene expression over the course of cognitively normal aging, with the extent of gene response far greater in aging than in AD. Of the 759 immune-related probesets interrogated on the microarray, approximately 40% were significantly altered in the SFG, PCG and HC with increasing age, with the majority upregulated (64 to 86%. In contrast, far fewer immune/inflammation genes were significantly changed in the transition to AD (approximately 6% of immune-related probesets, with gene responses primarily restricted to the SFG and HC. Second, relatively few significant changes in immune/inflammation genes were detected in the EC either in aging or AD, although many genes in the EC showed similar trends in responses as in the other brain regions. Third, immune/inflammation genes undergo gender-specific patterns of response in aging and AD, with the most pronounced differences emerging in aging. Finally, there was widespread upregulation of genes reflecting activation of microglia and perivascular macrophages in the aging brain, coupled with a downregulation of select factors (TOLLIP, fractalkine that when present curtail microglial/macrophage activation. Notably, essentially all pathways of the innate immune system were upregulated in aging, including numerous complement components, genes involved in toll-like receptor signaling and inflammasome signaling, as well as genes coding for immunoglobulin (Fc receptors and human

  8. Dynamic network reconstruction from gene expression data applied to immune response during bacterial infection.

    Science.gov (United States)

    Guthke, Reinhard; Möller, Ulrich; Hoffmann, Martin; Thies, Frank; Töpfer, Susanne

    2005-04-15

    The immune response to bacterial infection represents a complex network of dynamic gene and protein interactions. We present an optimized reverse engineering strategy aimed at a reconstruction of this kind of interaction networks. The proposed approach is based on both microarray data and available biological knowledge. The main kinetics of the immune response were identified by fuzzy clustering of gene expression profiles (time series). The number of clusters was optimized using various evaluation criteria. For each cluster a representative gene with a high fuzzy-membership was chosen in accordance with available physiological knowledge. Then hypothetical network structures were identified by seeking systems of ordinary differential equations, whose simulated kinetics could fit the gene expression profiles of the cluster-representative genes. For the construction of hypothetical network structures singular value decomposition (SVD) based methods and a newly introduced heuristic Network Generation Method here were compared. It turned out that the proposed novel method could find sparser networks and gave better fits to the experimental data. Reinhard.Guthke@hki-jena.de.

  9. Mechanisms of HO-1 mediated attenuation of renal immune injury: a gene profiling study.

    Science.gov (United States)

    Duann, Pu; Lianos, Elias A

    2011-10-01

    Using a mouse model of immune injury directed against the renal glomerular vasculature and resembling human forms of glomerulonephritis (GN), we assessed the effect of targeted expression of the cytoprotective enzyme heme oxygenase (HO)-1. A human (h) HO-1 complementary DNAN (cDNA) sequence was targeted to glomerular epithelial cells (GECs) using a GEC-specific murine nephrin promoter. Injury by administration of antibody against the glomerular basement membrane (anti-GBM) to transgenic (TG) mice with GEC-targeted hHO-1 was attenuated compared with wild-type (WT) controls. To explore changes in the expression of genes that could mediate this salutary effect, we performed gene expression profiling using a microarray analysis of RNA isolated from the renal cortex of WT or TG mice with or without anti-GBM antibody-induced injury. Significant increases in expression were detected in 9 major histocompatibility complex (MHC)-class II genes, 2 interferon-γ (IFN-γ)-inducible guanosine triphosphate (GTP)ases, and 3 genes of the ubiquitin-proteasome system. The increase in MHC-class II and proteasome gene expression in TG mice with injury was validated by real-time polymerase chain reaction (PCR) or Western blot analysis. The observations point to novel mechanisms underlying the cytoprotective effect of HO-1 in renal immune injury. Copyright © 2011. Published by Mosby, Inc.

  10. Insect parents improve the anti-parasitic and anti-bacterial defence of their offspring by priming the expression of immune-relevant genes.

    Science.gov (United States)

    Trauer-Kizilelma, Ute; Hilker, Monika

    2015-09-01

    Insect parents that experienced an immune challenge are known to prepare (prime) the immune activity of their offspring for improved defence. This phenomenon has intensively been studied by analysing especially immunity-related proteins. However, it is unknown how transgenerational immune priming affects transcript levels of immune-relevant genes of the offspring upon an actual threat. Here, we investigated how an immune challenge of Manduca sexta parents affects the expression of immune-related genes in their eggs that are attacked by parasitoids. Furthermore, we addressed the question whether the transgenerational immune priming of expression of genes in the eggs is still traceable in adult offspring. Our study revealed that a parental immune challenge did not affect the expression of immune-related genes in unparasitised eggs. However, immune-related genes in parasitised eggs of immune-challenged parents were upregulated to a higher level than those in parasitised eggs of unchallenged parents. Hence, this transgenerational immune priming of the eggs was detected only "on demand", i.e. upon parasitoid attack. The priming effects were also traceable in adult female progeny of immune-challenged parents which showed higher transcript levels of several immune-related genes in their ovaries than non-primed progeny. Some of the primed genes showed enhanced expression even when the progeny was left unchallenged, whereas other genes were upregulated to a greater extent in primed female progeny than non-primed ones only when the progeny itself was immune-challenged. Thus, the detection of transgenerational immune priming strongly depends on the analysed genes and the presence or absence of an actual threat for the offspring. We suggest that M. sexta eggs laid by immune-challenged parents "afford" to upregulate the transcription of immunity-related genes only upon attack, because they have the chance to be endowed by parentally directly transferred protective proteins

  11. Expression of plasmid-based shRNA against the E1 and nsP1 genes effectively silenced Chikungunya virus replication.

    Directory of Open Access Journals (Sweden)

    Shirley Lam

    Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these

  12. Gene networks specific for innate immunity define post-traumatic stress disorder.

    Science.gov (United States)

    Breen, M S; Maihofer, A X; Glatt, S J; Tylee, D S; Chandler, S D; Tsuang, M T; Risbrough, V B; Baker, D G; O'Connor, D T; Nievergelt, C M; Woelk, C H

    2015-12-01

    The molecular factors involved in the development of Post-Traumatic Stress Disorder (PTSD) remain poorly understood. Previous transcriptomic studies investigating the mechanisms of PTSD apply targeted approaches to identify individual genes under a cross-sectional framework lack a holistic view of the behaviours and properties of these genes at the system-level. Here we sought to apply an unsupervised gene-network based approach to a prospective experimental design using whole-transcriptome RNA-Seq gene expression from peripheral blood leukocytes of U.S. Marines (N=188), obtained both pre- and post-deployment to conflict zones. We identified discrete groups of co-regulated genes (i.e., co-expression modules) and tested them for association to PTSD. We identified one module at both pre- and post-deployment containing putative causal signatures for PTSD development displaying an over-expression of genes enriched for functions of innate-immune response and interferon signalling (Type-I and Type-II). Importantly, these results were replicated in a second non-overlapping independent dataset of U.S. Marines (N=96), further outlining the role of innate immune and interferon signalling genes within co-expression modules to explain at least part of the causal pathophysiology for PTSD development. A second module, consequential of trauma exposure, contained PTSD resiliency signatures and an over-expression of genes involved in hemostasis and wound responsiveness suggesting that chronic levels of stress impair proper wound healing during/after exposure to the battlefield while highlighting the role of the hemostatic system as a clinical indicator of chronic-based stress. These findings provide novel insights for early preventative measures and advanced PTSD detection, which may lead to interventions that delay or perhaps abrogate the development of PTSD.

  13. Effects of excretory/secretory products from Anisakis simplex (Nematoda) on immune gene expression in rainbow trout (Oncorhynchus mykiss)

    DEFF Research Database (Denmark)

    Bahlool, Qusay Zuhair Mohammad; Skovgaard, Alf; Kania, Per Walter

    2013-01-01

    Excretory/secretory (ES) products are molecules produced by parasitic nematodes, including larval Anisakis simplex, a parasite occurring in numerous marine fish hosts. The effects of these substances on host physiology have not been fully described. The present work elucidates the influence of ES...... substances on the fish immune system by measuring immune gene expression in spleen and liver of rainbow trout (Oncorhynchus mykiss) injected intraperitoneally with ES products isolated from A. simplex third stage larvae. The overall gene expression profile of exposed fish showed a generalized down....... This type of hydrolytic enzyme activity may play a role in nematode penetration of host tissue. In addition, based on the notion that A. simplex ES products may have an immune-depressive effect (by minimizing immune gene expression) it could also be suggested that worm enzymes directly target host immune...

  14. Conifers have a unique small RNA silencing signature

    OpenAIRE

    Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.

    2008-01-01

    Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...

  15. Early Involvement of Immune/Inflammatory Response Genes in Retinal Degeneration in DBA/2J Mice

    Directory of Open Access Journals (Sweden)

    W. Fan

    2010-01-01

    Full Text Available Purpose The DBA/2J (D2 mouse carries mutations in two of its genes, Tyrp1 and Gpnmb. These alterations result in the development of an immune response in the iris, leading to iris atrophy and pigment dispersion. The development of elevated intraocular pressure (IOP in this model of glaucoma is considered to be a significant factor leading to the death of retinal ganglion cells (RGCs. Changes in gene expression in the retina have already been correlated with the appearance of elevated IOP in the D2 mouse. The purpose of the present study was to determine if any changes in gene expression occur prior to the development of IOP. Methods The IOP was measured monthly using a rebound tonometer in D2 and age-matched C57/BL6 (B6 mice (normal controls. D2 animals with normal IOP at 2 and 4 M were used. In addition, mice at the age of 6–7 M were included to look for any trends in gene expression that might develop during the progression of the disease. Separate RNA samples were prepared from each of three individual retinas for each age, and gene expression profiles were determined with the aid of mouse oligonucleotide arrays (Agilent. A subset of genes was examined with the aid of real-time PCR. Immunocytochemistry was used to visualize changes in the retina for some of the gene-products. Results Four hundred and thirteen oligonucleotide probes were differentially expressed in the retinas of 4 M versus 2 M old D2 mice. The most significantly up-regulated genes (181 were associated with immune responses including interferon signaling, the complement system and the antigen presentation pathway, whereas the down-regulated genes (232 were linked to pathways related to cell death and known neurological diseases/disorders. These particular changes were not revealed in the age-matched B6 mice. By 6 M, when IOP started to increase in many of the D2 mice, more robust changes of these same genes were observed. Changes in the levels of selected genes

  16. Early Involvement of Immune/Inflammatory Response Genes in Retinal Degeneration in DBA/2J Mice

    Directory of Open Access Journals (Sweden)

    W. Fan

    2010-03-01

    Full Text Available Purpose: The DBA/2J (D2 mouse carries mutations in two of its genes, Tyrp1 and Gpnmb. These alterations result in the development of an immune response in the iris, leading to iris atrophy and pigment dispersion. The development of elevated intraocular pressure (IOP in this model of glaucoma is considered to be a significant factor leading to the death of retinal ganglion cells (RGCs. Changes in gene expression in the retina have already been correlated with the appearance of elevated IOP in the D2 mouse. The purpose of the present study was to determine if any changes in gene expression occur prior to the development of IOP. Methods: The IOP was measured monthly using a rebound tonometer in D2 and age-matched C57/BL6 (B6 mice (normal controls. D2 animals with normal IOP at 2 and 4 M were used. In addition, mice at the age of 6–7 M were included to look for any trends in gene expression that might develop during the progression of the disease. Separate RNA samples were prepared from each of three individual retinas for each age, and gene expression profiles were determined with the aid of mouse oligonucleotide arrays (Agilent. A subset of genes was examined with the aid of real-time PCR. Immunocytochemistry was used to visualize changes in the retina for some of the gene-products. Results: Four hundred and thirteen oligonucleotide probes were differentially expressed in the retinas of 4 M versus 2 M old D2 mice. The most significantly up-regulated genes (181 were associated with immune responses including interferon signaling, the complement system and the antigen presentation pathway, whereas the down-regulated genes (232 were linked to pathways related to cell death and known neurological diseases/disorders. These particular changes were not revealed in the age-matched B6 mice. By 6 M, when IOP started to increase in many of the D2 mice, more robust changes of these same genes were observed. Changes in the levels of selected genes

  17. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Science.gov (United States)

    Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

    2015-05-01

    Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  18. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Directory of Open Access Journals (Sweden)

    Alene Kast

    2015-05-01

    Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  19. Silencing of a Germin-Like Protein Gene (CchGLP in Geminivirus-Resistant Pepper (Capsicum chinense Jacq. BG-3821 Increases Susceptibility to Single and Mixed Infections by Geminiviruses PHYVV and PepGMV

    Directory of Open Access Journals (Sweden)

    Laura Mejía-Teniente

    2015-11-01

    Full Text Available Germin-like proteins (GLPs are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.

  20. Silencing of a Germin-Like Protein Gene (CchGLP) in Geminivirus-Resistant Pepper (Capsicum chinense Jacq.) BG-3821 Increases Susceptibility to Single and Mixed Infections by Geminiviruses PHYVV and PepGMV.

    Science.gov (United States)

    Mejía-Teniente, Laura; Joaquin-Ramos, Ahuizolt de Jesús; Torres-Pacheco, Irineo; Rivera-Bustamante, Rafael F; Guevara-Olvera, Lorenzo; Rico-García, Enrique; Guevara-Gonzalez, Ramon G

    2015-11-25

    Germin-like proteins (GLPs) are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.

  1. MGMT methylation analysis of glioblastoma on the Infinium methylation BeadChip identifies two distinct CpG regions associated with gene silencing and outcome, yielding a prediction model for comparisons across datasets, tumor grades, and CIMP-status.

    Science.gov (United States)

    Bady, Pierre; Sciuscio, Davide; Diserens, Annie-Claire; Bloch, Jocelyne; van den Bent, Martin J; Marosi, Christine; Dietrich, Pierre-Yves; Weller, Michael; Mariani, Luigi; Heppner, Frank L; Mcdonald, David R; Lacombe, Denis; Stupp, Roger; Delorenzi, Mauro; Hegi, Monika E

    2012-10-01

    The methylation status of the O(6)-methylguanine-DNA methyltransferase (MGMT) gene is an important predictive biomarker for benefit from alkylating agent therapy in glioblastoma. Recent studies in anaplastic glioma suggest a prognostic value for MGMT methylation. Investigation of pathogenetic and epigenetic features of this intriguingly distinct behavior requires accurate MGMT classification to assess high throughput molecular databases. Promoter methylation-mediated gene silencing is strongly dependent on the location of the methylated CpGs, complicating classification. Using the HumanMethylation450 (HM-450K) BeadChip interrogating 176 CpGs annotated for the MGMT gene, with 14 located in the promoter, two distinct regions in the CpG island of the promoter were identified with high importance for gene silencing and outcome prediction. A logistic regression model (MGMT-STP27) comprising probes cg12434587 [corrected] and cg12981137 provided good classification properties and prognostic value (kappa = 0.85; log-rank p CIMP) positive tumors was found in glioblastomas from The Cancer Genome Atlas than in low grade and anaplastic glioma cohorts, while in CIMP-negative gliomas MGMT was classified as methylated in approximately 50 % regardless of tumor grade. The proposed MGMT-STP27 prediction model allows mining of datasets derived on the HM-450K or HM-27K BeadChip to explore effects of distinct epigenetic context of MGMT methylation suspected to modulate treatment resistance in different tumor types.

  2. The effects of dietary Myrtle (Myrtus communis) on skin mucus immune parameters and mRNA levels of growth, antioxidant and immune related genes in zebrafish (Danio rerio).

    Science.gov (United States)

    Safari, Roghieh; Hoseinifar, Seyed Hossein; Van Doan, Hien; Dadar, Maryam

    2017-07-01

    Myrtle (Myrtus communis L., Myrtaceae) is a significant plant which naturally distributed around the globe. Although numerous studies have demonstrated the benefits of myrtle in different species, studies using the oral route are rare in the literature. In the present study, we evaluated the effect of myrtle intake on the antioxidant, immune, appetite and growth related genes as well as mucosal immune responses in zebrafish (Danio rerio) model. Zebrafish were fed control or myrtle (5, 10 and 20 g kg -1 myrtle) supplemented diets for sixty days. The results showed that, oral administration of Myrtle significantly improved mucosal immune responses (the activity of lysozyme, total Ig and protease). Furthermore, fish fed 20 g kg -1 showed remarkably higher antioxidant (sod and cat) enzymes gene expression compared other treatment. There were significant difference between myrtle fed fish and control group regarding tnf-alpha and lyz expression. Also, evaluation of growth (gh and igf1) related genes revealed remarkable upregulation in 20 g kg -1 myrtle treatment compared other myrtle treatments and control group. Similar results was observed regarding the mRNA levels of appetite related genes (ghrl) in zebrafish fed 20 g kg -1 myrtle. The present results indicated that dietary administration of myrtle improved mucosal immune parameters and altered mRNA levels of selected genes. These results on zebrafish model also highlights the potential use of Myrtle supplements as additive in human diets. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. An MHC class I immune evasion gene of Marek׳s disease virus.

    Science.gov (United States)

    Hearn, Cari; Preeyanon, Likit; Hunt, Henry D; York, Ian A

    2015-01-15

    Marek׳s disease virus (MDV) is a widespread α-herpesvirus of chickens that causes T cell tumors. Acute, but not latent, MDV infection has previously been shown to lead to downregulation of cell-surface MHC class I (Virology 282:198-205 (2001)), but the gene(s) involved have not been identified. Here we demonstrate that an MDV gene, MDV012, is capable of reducing surface expression of MHC class I on chicken cells. Co-expression of an MHC class I-binding peptide targeted to the endoplasmic reticulum (bypassing the requirement for the TAP peptide transporter) partially rescued MHC class I expression in the presence of MDV012, suggesting that MDV012 is a TAP-blocking MHC class I immune evasion protein. This is the first unique non-mammalian MHC class I immune evasion gene identified, and suggests that α-herpesviruses have conserved this function for at least 100 million years. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Life-threatening infectious diseases of childhood: single-gene inborn errors of immunity?

    Science.gov (United States)

    Alcaïs, Alexandre; Quintana-Murci, Lluis; Thaler, David S; Schurr, Erwin; Abel, Laurent; Casanova, Jean-Laurent

    2010-12-01

    The hypothesis that inborn errors of immunity underlie infectious diseases is gaining experimental support. However, the apparent modes of inheritance of predisposition or resistance differ considerably among diseases and among studies. A coherent genetic architecture of infectious diseases is lacking. We suggest here that life-threatening infectious diseases in childhood, occurring in the course of primary infection, result mostly from individually rare but collectively diverse single-gene variations of variable clinical penetrance,