The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.

Science.gov (United States)

Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C

2013-12-23

Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure

Genes misregulated in C. elegans deficient in Dicer, RDE-4, or RDE-1 are enriched for innate immunity genes.

Science.gov (United States)

Welker, Noah C; Habig, Jeffrey W; Bass, Brenda L

2007-07-01

We describe the first microarray analysis of a whole animal containing a mutation in the Dicer gene. We used adult Caenorhabditis elegans and, to distinguish among different roles of Dicer, we also performed microarray analyses of animals with mutations in rde-4 and rde-1, which are involved in silencing by siRNA, but not miRNA. Surprisingly, we find that the X chromosome is greatly enriched for genes regulated by Dicer. Comparison of all three microarray data sets indicates the majority of Dicer-regulated genes are not dependent on RDE-4 or RDE-1, including the X-linked genes. However, all three data sets are enriched in genes important for innate immunity and, specifically, show increased expression of innate immunity genes.

Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.

Science.gov (United States)

Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J

2016-01-01

Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Thermodynamic control of small RNA-mediated gene silencing

Directory of Open Access Journals (Sweden)

Kumiko eUi-Tei

2012-06-01

Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.

Development of Agrobacterium-mediated virus-induced gene silencing and performance evaluation of four marker genes in Gossypium barbadense.

Directory of Open Access Journals (Sweden)

Jinhuan Pang

Full Text Available Gossypiumbarbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species. These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G. barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G. barbadense. In this study, we had successfully introduced a virus-induced gene silencing (VIGS system into three cultivars of G. barbadense by inserting marker genes into the tobacco rattle virus (TRV vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G. barbadense. The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G. barbadense, and help to contribute desirable traits for breeding of G. barbadense and G. hirsutum.

Strategies for Improving siRNA-Induced Gene Silencing Efficiency.

Science.gov (United States)

Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad

2017-12-01

Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.

Reduced rates of gene loss, gene silencing, and gene mutation in Dnmt1-deficient embryonic stem cells

NARCIS (Netherlands)

Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.

2001-01-01

Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by

Innate immune genes including a mucin-like gene, mul-1, induced by ionizing radiation in Caenorhabditis elegans.

Science.gov (United States)

Kimura, Takafumi; Takanami, Takako; Sakashita, Tetsuya; Wada, Seiichi; Kobayashi, Yasuhiko; Higashitani, Atsushi

2012-10-01

The effect of radiation on the intestine has been studied for more than one hundred years. It remains unclear, however, whether this organ uses specific defensive mechanisms against ionizing radiation. The infection with Pseudomonas aeruginosa (PA14) in Caenorhabditis elegans induces up-regulation of innate immune response genes. Here, we found that exposure to ionizing radiation also induces certain innate immune response genes such as F49F1.6 (termed mul-1), clec-4, clec-67, lys-1 and lys-2 in the intestine. Moreover, pre-treatment with ionizing radiation before seeding on PA14 lawn plate significantly increased survival rate in the nematode. We also studied transcription pathway of the mul-1 in response to ionizing radiation. Induction of mul-1 gene was highly dependent on the ELT-2 transcription factor and p38 MAPK. Moreover, the insulin/IGF-1 signal pathway works to enhance induction of this gene. The mul-1 gene showed a different induction pattern from the DNA damage response gene, ced-13, which implies that the expression of this gene might be triggered as an indirect effect of radiation. Silencing of the mul-1 gene led to growth retardation after treatment with ionizing radiation. We describe the cross-tolerance between the response to radiation exposure and the innate immune system.

The development and application of a multiple gene co-silencing system using endogenous URA3 as a reporter gene in Ganoderma lucidum.

Directory of Open Access Journals (Sweden)

Dashuai Mu

Full Text Available Ganoderma lucidum is one of the most important medicinal mushrooms; however, molecular genetics research on this species has been limited due to a lack of reliable reverse genetic tools. In this study, the endogenous orotidine 5'-monophosphate decarboxylase gene (URA3 was cloned as a silencing reporter, and four gene-silencing methods using hairpin, sense, antisense, and dual promoter constructs, were introduced into G. lucidum through a simple electroporation procedure. A comparison and evaluation of silencing efficiency demonstrated that all of the four methods differentially suppressed the expression of URA3. Our data unequivocally indicate that the dual promoter silencing vector yields the highest rate of URA3 silencing compared with other vectors (up to 81.9%. To highlight the advantages of the dual promoter system, we constructed a co-silencing system based on the dual promoter method and succeeded in co-silencing URA3 and laccase in G. lucidum. The reduction of the mRNA levels of the two genes were correlated. Thus, the screening efficiency for RNAi knockdown of multiple genes may be improved by the co-silencing of an endogenous reporter gene. The molecular tools developed in this study should facilitate the isolation of genes and the characterization of the functions of multiple genes in this pharmaceutically important species, and these tools should be highly useful for the study of other basidiomycetes.

Simultaneous gene silencing of Bcl-2, XIAP and Survivin re-sensitizes pancreatic cancer cells towards apoptosis

International Nuclear Information System (INIS)

Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian

2010-01-01

Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells

Transgene-induced gene silencing is not affected by a change in ploidy level.

Directory of Open Access Journals (Sweden)

Daniela Pignatta

Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.

Phenotyping of VIGS-mediated gene silencing in rice using a vector derived from a DNA virus.

Science.gov (United States)

Kant, Ravi; Dasgupta, Indranil

2017-07-01

Target genes in rice can be optimally silenced if inserted in antisense or hairpin orientation in the RTBV-derived VIGS vector and plants grown at 28 °C and 80% humidity after inoculation. Virus induced gene silencing (VIGS) is a method used to transiently silence genes in dicot as well as monocot plants. For the important monocot species rice, the Rice tungro bacilliform virus (RTBV)-derived VIGS system (RTBV-VIGS), which uses agroinoculation to initiate silencing, has not been standardized for optimal use. Here, using RTBV-VIGS, three sets of conditions were tested to achieve optimal silencing of the rice marker gene phytoene desaturase (pds). The effect of orientation of the insert in the RTBV-VIGS plasmid (sense, antisense and hairpin) on the silencing of the target gene was then evaluated using rice magnesium chelatase subunit H (chlH). Finally, the rice Xa21 gene, conferring resistance against bacterial leaf blight disease (BLB) was silenced using RTBV-VIGS system. In each case, real-time PCR-based assessment indicated approximately 40-80% fall in the accumulation levels of the transcripts of pds, chlH and Xa21. In the case of pds, the appearance of white streaks in the emerging leaves, and for chlH, chlorophyll levels and F v /F m ratio were assessed as phenotypes for silencing. For Xa21, the resistance levels to BLB were assessed by measuring the lesion length and the percent diseased areas of leaves, following challenge inoculation with Xanthomonas oryzae. In each case, the RTBV-MVIGS system gave rise to a discernible phenotype indicating the silencing of the respective target gene using condition III (temperature 28 °C, humidity 80% and 1 mM MES and 20 µM acetosyringone in secondary agrobacterium culture), which revealed the robustness of this gene silencing system for rice.

Development of a gene silencing DNA vector derived from a broad host range geminivirus

Directory of Open Access Journals (Sweden)

Hancock Leandria C

2009-07-01

Full Text Available Abstract Background Gene silencing is proving to be a powerful tool for genetic, developmental, and physiological analyses. The use of viral induced gene silencing (VIGS offers advantages to transgenic approaches as it can be potentially applied to non-model systems for which transgenic techniques are not readily available. However, many VIGS vectors are derived from Gemini viruses that have limited host ranges. We present a new, unipartite vector that is derived from a curtovirus that has a broad host range and will be amenable to use in many non-model systems. Results The construction of a gene silencing vector derived from the geminivirus Beet curly top virus (BCTV, named pWSRi, is reported. Two versions of the vector have been developed to allow application by biolistic techniques or by agro-infiltration. We demonstrate its ability to silence nuclear genes including ribulose bisphosphate carboxylase small subunit (rbcS, transketolase, the sulfur allele of magnesium chelatase (ChlI, and two homeotic transcription factors in spinach or tomato by generating gene-specific knock-down phenotypes. Onset of phenotypes occurred 3 to 12 weeks post-inoculation, depending on the target gene, in organs that developed after the application. The vector lacks movement genes and we found no evidence for significant spread from the site of inoculation. However, viral amplification in inoculated tissue was detected and is necessary for systemic silencing, suggesting that signals generated from active viral replicons are efficiently transported within the plant. Conclusion The unique properties of the pWSRi vector, the ability to silence genes in meristem tissue, the separation of virus and silencing phenotypes, and the broad natural host range of BCTV, suggest that it will have wide utility.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms

Directory of Open Access Journals (Sweden)

Mueller Nancy

2005-10-01

Full Text Available Abstract Background Human T-cell leukemia virus type I (HTLV-I causes adult T-cell leukemia (ATL after a long latent period. Among accessory genes encoded by HTLV-I, the tax gene is thought to play a central role in oncogenesis. However, Tax expression is disrupted by several mechanims including genetic changes of the tax gene, deletion/hypermethylation of 5'-LTR. To clarify the role of epigenetic changes, we analyzed DNA methylation and histone modification in the whole HTLV-I provirus genome. Results The gag, pol and env genes of HTLV-I provirus were more methylated than pX region, whereas methylation of 5'-LTR was variable and 3'-LTR was not methylated at all. In ATL cell lines, complete DNA methylation of 5'-LTR was associated with transcriptional silencing of viral genes. HTLV-I provirus was more methylated in primary ATL cells than in carrier state, indicating the association with disease progression. In seroconvertors, DNA methylation was already observed in internal sequences of provirus just after seroconversion. Taken together, it is speculated that DNA methylation first occurs in the gag, pol and env regions and then extends in the 5' and 3' directions in vivo, and when 5'-LTR becomes methylated, viral transcription is silenced. Analysis of histone modification in the HTLV-I provirus showed that the methylated provirus was associated with hypoacetylation. However, the tax gene transcript could not be detected in fresh ATL cells regardless of hyperacetylated histone H3 in 5'-LTR. The transcription rapidly recovered after in vitro culture in such ATL cells. Conclusion These results showed that epigenetic changes of provirus facilitated ATL cells to evade host immune system by suppressing viral gene transcription. In addition, this study shows the presence of another reversible mechanism that suppresses the tax gene transcription without DNA methylation and hypoacetylated histone.

A systemic gene silencing method suitable for high throughput, reverse genetic analyses of gene function in fern gametophytes

Directory of Open Access Journals (Sweden)

Tanurdzic Milos

2004-04-01

Full Text Available Abstract Background Ceratopteris richardii is a useful experimental system for studying gametophyte development and sexual reproduction in plants. However, few tools for cloning mutant genes or disrupting gene function exist for this species. The feasibility of systemic gene silencing as a reverse genetics tool was examined in this study. Results Several DNA constructs targeting a Ceratopteris protoporphyrin IX magnesium chelatase (CrChlI gene that is required for chlorophyll biosynthesis were each introduced into young gametophytes by biolistic delivery. Their transient expression in individual cells resulted in a colorless cell phenotype that affected most cells of the mature gametophyte, including the meristem and gametangia. The colorless phenotype was associated with a 7-fold decrease in the abundance of the endogenous transcript. While a construct designed to promote the transient expression of a CrChlI double stranded, potentially hairpin-forming RNA was found to be the most efficient in systemically silencing the endogenous gene, a plasmid containing the CrChlI cDNA insert alone was sufficient to induce silencing. Bombarded, colorless hermaphroditic gametophytes produced colorless embryos following self-fertilization, demonstrating that the silencing signal could be transmitted through gametogenesis and fertilization. Bombardment of young gametophytes with constructs targeting the Ceratopteris filamentous temperature sensitive (CrFtsZ and uroporphyrin dehydrogenase (CrUrod genes also produced the expected mutant phenotypes. Conclusion A method that induces the systemic silencing of target genes in the Ceratopteris gametophyte is described. It provides a simple, inexpensive and rapid means to test the functions of genes involved in gametophyte development, especially those involved in cellular processes common to all plants.

Host-Induced Gene Silencing of Rice Blast Fungus Magnaporthe oryzae Pathogenicity Genes Mediated by the Brome Mosaic Virus.

Science.gov (United States)

Zhu, Lin; Zhu, Jian; Liu, Zhixue; Wang, Zhengyi; Zhou, Cheng; Wang, Hong

2017-09-26

Magnaporthe oryzae is a devastating plant pathogen, which has a detrimental impact on rice production worldwide. Despite its agronomical importance, some newly-emerging pathotypes often overcome race-specific disease resistance rapidly. It is thus desirable to develop a novel strategy for the long-lasting resistance of rice plants to ever-changing fungal pathogens. Brome mosaic virus (BMV)-induced RNA interference (RNAi) has emerged as a useful tool to study host-resistance genes for rice blast protection. Planta-generated silencing of targeted genes inside biotrophic pathogens can be achieved by expression of M. oryzae -derived gene fragments in the BMV-mediated gene silencing system, a technique termed host-induced gene silencing (HIGS). In this study, the effectiveness of BMV-mediated HIGS in M. oryzae was examined by targeting three predicted pathogenicity genes, MoABC1, MoMAC1 and MoPMK1 . Systemic generation of fungal gene-specific small interfering RNA (siRNA) molecules induced by inoculation of BMV viral vectors inhibited disease development and reduced the transcription of targeted fungal genes after subsequent M. oryzae inoculation. Combined introduction of fungal gene sequences in sense and antisense orientation mediated by the BMV silencing vectors significantly enhanced the efficiency of this host-generated trans-specific RNAi, implying that these fungal genes played crucial roles in pathogenicity. Collectively, our results indicated that BMV-HIGS system was a great strategy for protecting host plants against the invasion of pathogenic fungi.

Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

Science.gov (United States)

Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

2016-10-13

PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.

Science.gov (United States)

Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

2017-01-01

RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.

Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.

Science.gov (United States)

Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad

2009-01-01

RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.

Development of a virus-induced gene silencing (VIGS) system for Spinacia oleracea L

DEFF Research Database (Denmark)

Lee, Jungmin; Cao, Dang Viet; Kim, Jiwon

2017-01-01

Virus-induced gene silencing (VIGS) is known as a rapid and efficient system for studying functions of interesting genes in plants. Tobacco rattle virus (TRV) is widely applied for the gene silencing of many plants. Although spinach is a TRV-susceptible plant, a TRV-based VIGS system has not yet ...

Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato

Science.gov (United States)

Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo

2016-12-01

Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato.

Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.

Science.gov (United States)

Panwar, Vinay; Bakkeren, Guus

2017-01-01

Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.

Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

Science.gov (United States)

Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

2015-01-01

In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

Solanum venturii, a suitable model system for virus-induced gene silencing studies in potato reveals StMKK6 as an important player in plant immunity

NARCIS (Netherlands)

Dobnik, David; Lazar, Ana; Stare, Tjaša; Gruden, Kristina; Vleeshouwers, Vivianne G.A.A.; Žel, Jana

2016-01-01

Background: Virus-induced gene silencing (VIGS) is an optimal tool for functional analysis of genes in plants, as the viral vector spreads throughout the plant and causes reduced expression of selected gene over the whole plant. Potato (Solanum tuberosum) is one of the most important food crops,

Down-regulation of osmotin (PR5) gene by virus-induced gene silencing (VIGS) leads to susceptibility of resistant Piper colubrinum Link. to the oomycete pathogen Phytophthora capsici Leonian.

Science.gov (United States)

Anu, K; Jessymol, K K; Chidambareswaren, M; Gayathri, G S; Manjula, S

2015-06-01

Piper colubrinum Link., a distant relative of Piper nigrum L., is immune to the oomycete pathogen Phytophthora capsici Leonian that causes 'quick wilt' in cultivated black pepper (P. nigrum). The osmotin, PR5 gene homologue, earlier identified from P. colubrinum, showed significant overexpression in response to pathogen and defense signalling molecules. The present study focuses on the functional validation of P. colubrinum osmotin (PcOSM) by virus induced gene silencing (VIGS) using Tobacco Rattle Virus (TRV)-based vector. P. colubrinum plants maintained under controlled growth conditions in a growth chamber were infiltrated with Agrobacterium carrying TRV empty vector (control) and TRV vector carrying PcOSM. Three weeks post infiltration, viral movement was confirmed in newly emerged leaves of infiltrated plants by RT-PCR using TRV RNA1 and TRV RNA2 primers. Semi-quantitative RT-PCR confirmed significant down-regulation of PcOSM gene in TRV-PcOSM infiltrated plant compared with the control plants. The control and silenced plants were challenged with Phytophthora capsici which demonstrated that knock-down of PcOSM in P. colubrinum leads to increased fungal mycelial growth in silenced plants compared to control plants, which was accompanied by decreased accumulation of H2O2 as indicated by 3,3'-diaminobenzidine (DAB) staining. Thus, in this study, we demonstrated that Piper colubrinum osmotin gene is required for resisting P. capsici infection and has possible role in hypersensitive cell death response and oxidative burst signaling during infection.

LNA-antisense rivals siRNA for gene silencing

DEFF Research Database (Denmark)

Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

2004-01-01

Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...

A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.

Science.gov (United States)

Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A

2016-06-01

Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.

Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

Directory of Open Access Journals (Sweden)

Sha Lu

Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

Klotho gene silencing promotes pathology in the mdx mouse model of Duchenne muscular dystrophy

Science.gov (United States)

Wehling-Henricks, Michelle; Li, Zhenzhi; Lindsey, Catherine; Wang, Ying; Welc, Steven S.; Ramos, Julian N.; Khanlou, Négar; Kuro-o, Makoto; Tidball, James G.

2016-01-01

Duchenne muscular dystrophy (DMD) is a lethal muscle disease involving progressive loss of muscle regenerative capacity and increased fibrosis. We tested whether epigenetic silencing of the klotho gene occurs in the mdx mouse model of DMD and whether klotho silencing is an important feature of the disease. Our findings show that klotho undergoes muscle-specific silencing at the acute onset of mdx pathology. Klotho experiences increased methylation of CpG sites in its promoter region, which is associated with gene silencing, and increases in a repressive histone mark, H3K9me2. Expression of a klotho transgene in mdx mice restored their longevity, reduced muscle wasting, improved function and greatly increased the pool of muscle-resident stem cells required for regeneration. Reductions of fibrosis in late, progressive stages of the mdx pathology achieved by transgene expression were paralleled by reduced expression of Wnt target genes (axin-2), transforming growth factor-beta (TGF-β1) and collagens types 1 and 3, indicating that Klotho inhibition of the profibrotic Wnt/TGFβ axis underlies its anti-fibrotic effect in aging, dystrophic muscle. Thus, epigenetic silencing of klotho during muscular dystrophy contributes substantially to lost regenerative capacity and increased fibrosis of dystrophic muscle during late progressive stages of the disease. PMID:27154199

Tospovirus : induction and suppression of RNA silencing

NARCIS (Netherlands)

Hedil, Marcio

2016-01-01

While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,

Smuggling gold nanoparticles across cell types - A new role for exosomes in gene silencing.

Science.gov (United States)

Roma-Rodrigues, Catarina; Pereira, Francisca; Alves de Matos, António P; Fernandes, Marta; Baptista, Pedro V; Fernandes, Alexandra R

2017-05-01

Once released to the extracellular space, exosomes enable the transfer of proteins, lipids and RNA between different cells, being able to modulate the recipient cells' phenotypes. Members of the Rab small GTP-binding protein family, such as RAB27A, are responsible for the coordination of several steps in vesicle trafficking, including budding, mobility, docking and fusion. The use of gold nanoparticles (AuNPs) for gene silencing is considered a cutting-edge technology. Here, AuNPs were functionalized with thiolated oligonucleotides anti-RAB27A (AuNP@PEG@anti-RAB27A) for selective silencing of the gene with a consequent decrease of exosomes´ release by MCF-7 and MDA-MB-453 cells. Furthermore, communication between tumor and normal cells was observed both in terms of alterations in c-Myc gene expression and transportation of the AuNPs, mediating gene silencing in secondary cells. Copyright © 2017 Elsevier Inc. All rights reserved.

Immune genes undergo more adaptive evolution than non-immune system genes in Daphnia pulex

Directory of Open Access Journals (Sweden)

McTaggart Seanna J

2012-05-01

Full Text Available Abstract Background Understanding which parts of the genome have been most influenced by adaptive evolution remains an unsolved puzzle. Some evidence suggests that selection has the greatest impact on regions of the genome that interact with other evolving genomes, including loci that are involved in host-parasite co-evolutionary processes. In this study, we used a population genetic approach to test this hypothesis by comparing DNA sequences of 30 putative immune system genes in the crustacean Daphnia pulex with 24 non-immune system genes. Results In support of the hypothesis, results from a multilocus extension of the McDonald-Kreitman (MK test indicate that immune system genes as a class have experienced more adaptive evolution than non-immune system genes. However, not all immune system genes show evidence of adaptive evolution. Additionally, we apply single locus MK tests and calculate population genetic parameters at all loci in order to characterize the mode of selection (directional versus balancing in the genes that show the greatest deviation from neutral evolution. Conclusions Our data are consistent with the hypothesis that immune system genes undergo more adaptive evolution than non-immune system genes, possibly as a result of host-parasite arms races. The results of these analyses highlight several candidate loci undergoing adaptive evolution that could be targeted in future studies.

High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.

Science.gov (United States)

Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert

2018-01-01

Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.

Science.gov (United States)

Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E

2010-12-15

N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.

Simultaneous silencing of multiple genes in the apple scab fungus, Venturia inaequalis, by expression of RNA with chimeric inverted repeats

NARCIS (Netherlands)

Fitzgerald, A.; Kan, van J.A.L.; Plummer, K.M.

2004-01-01

RNA-mediated gene silencing has been demonstrated in plants, animals, and more recently in filamentous fungi. Here, we report high frequency, RNA-mediated gene silencing in the apple scab fungus, Venturia inaequalis. The green fluorescent protein (GFP) transgene was silenced in a GFP-expressing

Bone marrow mesenchymal stem cells with Nogo-66 receptor gene silencing for repair of spinal cord injury

Science.gov (United States)

Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong

2014-01-01

We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group. PMID:25206893

Endogenous small RNAs and antibacterial immunity in plants.

Science.gov (United States)

Jin, Hailing

2008-08-06

Small RNAs are non-coding regulatory RNA molecules that control gene expression by mediating mRNA degradation, translational inhibition, or chromatin modification. Virus-derived small RNAs induce silencing of viral RNAs and are essential for antiviral defense in both animal and plant systems. The role of host endogenous small RNAs on antibacterial immunity has only recently been recognized. Host disease resistance and defense responses are achieved by activation and repression of a large array of genes. Certain endogenous small RNAs in plants, including microRNAs (miRNAs) and small interfering RNAs (siRNAs), are induced or repressed in response to pathogen attack and subsequently regulate the expression of genes involved in disease resistance and defense responses by mediating transcriptional or post-transcriptional gene silencing. Thus, these small RNAs play an important role in gene expression reprogramming in plant disease resistance and defense responses. This review focuses on the recent findings of plant endogenous small RNAs in antibacterial immunity.

RNA-mediated gene silencing signals are not graft transmissible from the rootstock to the scion in greenhouse-grown apple plants Malus sp.

Science.gov (United States)

Flachowsky, Henryk; Tränkner, Conny; Szankowski, Iris; Waidmann, Sascha; Hanke, Magda-Viola; Treutter, Dieter; Fischer, Thilo C

2012-01-01

RNA silencing describes the sequence specific degradation of RNA targets. Silencing is a non-cell autonomous event that is graft transmissible in different plant species. The present study is the first report on systemic acquired dsRNA-mediated gene silencing of transgenic and endogenous gene sequences in a woody plant like apple. Transgenic apple plants overexpressing a hairpin gene construct of the gusA reporter gene were produced. These plants were used as rootstocks and grafted with scions of the gusA overexpressing transgenic apple clone T355. After grafting, we observed a reduction of the gusA gene expression in T355 scions in vitro, but not in T355 scions grown in the greenhouse. Similar results were obtained after silencing of the endogenous Mdans gene in apple that is responsible for anthocyanin biosynthesis. Subsequently, we performed grafting experiments with Mdans silenced rootstocks and red leaf scions of TNR31-35 in order to evaluate graft transmitted silencing of the endogenous Mdans. The results obtained suggested a graft transmission of silencing signals in in vitro shoots. In contrast, no graft transmission of dsRNA-mediated gene silencing signals was detectable in greenhouse-grown plants and in plants grown in an insect protection tent.

Host-Induced Silencing of Pathogenicity Genes Enhances Resistance to Fusarium oxysporum Wilt in Tomato.

Science.gov (United States)

Bharti, Poonam; Jyoti, Poonam; Kapoor, Priya; Sharma, Vandana; Shanmugam, V; Yadav, Sudesh Kumar

2017-08-01

This study presents a novel approach of controlling vascular wilt in tomato by RNAi expression directed to pathogenicity genes of Fusarium oxysporum f. sp. lycopersici. Vascular wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici leads to qualitative and quantitative loss of the crop. Limitation in the existing control measures necessitates the development of alternative strategies to increase resistance in the plants against pathogens. Recent findings paved way to RNAi, as a promising method for silencing of pathogenicity genes in fungus and provided effective resistance against fungal pathogens. Here, two important pathogenicity genes FOW2, a Zn(II)2Cys6 family putative transcription regulator, and chsV, a putative myosin motor and a chitin synthase domain, were used for host-induced gene silencing through hairpinRNA cassettes of these genes against Fusarium oxysporum f. sp. lycopersici. HairpinRNAs were assembled in appropriate binary vectors and transformed into tomato plant targeting FOW2 and chsV genes, for two highly pathogenic strains of Fusarium oxysporum viz. TOFOL-IHBT and TOFOL-IVRI. Transgenic tomatoes were analyzed for possible attainment of resistance in transgenic lines against fungal infection. Eight transgenic lines expressing hairpinRNA cassettes showed trivial disease symptoms after 6-8 weeks of infection. Hence, the host-induced posttranscriptional gene silencing of pathogenicity genes in transgenic tomato plants has enhanced their resistance to vascular wilt disease caused by Fusarium oxysporum.

Plasmodium falciparum var Gene Silencing Is Determined by cis DNA Elements That Form Stable and Heritable Interactions ▿

Science.gov (United States)

Swamy, Lakshmi; Amulic, Borko; Deitsch, Kirk W.

2011-01-01

Antigenic variation in the human malaria parasite Plasmodium falciparum depends on the transcriptional regulation of the var gene family. In each individual parasite, mRNA is expressed exclusively from 1 var gene out of ∼60, while the rest of the genes are transcriptionally silenced. Both modifications to chromatin structure and DNA regulatory elements associated with each var gene have been implicated in the organization and maintenance of the silent state. Whether silencing is established at the level of entire chromosomal regions via heterochromatin spreading or at the level of individual var promoters through the action of a silencing element within each var intron has been debated. Here, we consider both possibilities, using clonal parasite lines carrying chromosomally integrated transgenes. We confirm a previous finding that the loss of an adjacent var intron results in var promoter activation and further show that transcriptional activation of a var promoter within a cluster does not affect the transcriptional activity of neighboring var promoters. Our results provide more evidence for the hypothesis that var genes are primarily silenced at the level of an individual gene, rather than by heterochromatin spreading. We also tested the intrinsic directionality of an intron's silencing effect on upstream or downstream var promoters. We found that an intron is capable of silencing in either direction and that, once established, a var promoter-intron pair is stably maintained through many generations, suggesting a possible role in epigenetic memory. This study provides insights into the regulation of endogenous var gene clusters. PMID:21317310

A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize1[OPEN

Science.gov (United States)

Mei, Yu; Kernodle, Bliss M.; Hill, John H.

2016-01-01

Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. PMID:27208311

Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

Directory of Open Access Journals (Sweden)

Dacheng Liang

2014-12-01

Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

Validation of RNAi Silencing Efficiency Using Gene Array Data shows 18.5% Failure Rate across 429 Independent Experiments

Directory of Open Access Journals (Sweden)

Gyöngyi Munkácsy

2016-01-01

Full Text Available No independent cross-validation of success rate for studies utilizing small interfering RNA (siRNA for gene silencing has been completed before. To assess the influence of experimental parameters like cell line, transfection technique, validation method, and type of control, we have to validate these in a large set of studies. We utilized gene chip data published for siRNA experiments to assess success rate and to compare methods used in these experiments. We searched NCBI GEO for samples with whole transcriptome analysis before and after gene silencing and evaluated the efficiency for the target and off-target genes using the array-based expression data. Wilcoxon signed-rank test was used to assess silencing efficacy and Kruskal–Wallis tests and Spearman rank correlation were used to evaluate study parameters. All together 1,643 samples representing 429 experiments published in 207 studies were evaluated. The fold change (FC of down-regulation of the target gene was above 0.7 in 18.5% and was above 0.5 in 38.7% of experiments. Silencing efficiency was lowest in MCF7 and highest in SW480 cells (FC = 0.59 and FC = 0.30, respectively, P = 9.3E−06. Studies utilizing Western blot for validation performed better than those with quantitative polymerase chain reaction (qPCR or microarray (FC = 0.43, FC = 0.47, and FC = 0.55, respectively, P = 2.8E−04. There was no correlation between type of control, transfection method, publication year, and silencing efficiency. Although gene silencing is a robust feature successfully cross-validated in the majority of experiments, efficiency remained insufficient in a significant proportion of studies. Selection of cell line model and validation method had the highest influence on silencing proficiency.

An Algorithm for Generating Small RNAs Capable of Epigenetically Modulating Transcriptional Gene Silencing and Activation in Human Cells

Directory of Open Access Journals (Sweden)

Amanda Ackley

2013-01-01

Full Text Available Small noncoding antisense RNAs (sasRNAs guide epigenetic silencing complexes to target loci in human cells and modulate gene transcription. When these targeted loci are situated within a promoter, long-term, stable epigenetic silencing of transcription can occur. Recent studies suggest that there exists an endogenous form of such epigenetic regulation in human cells involving long noncoding RNAs. In this article, we present and validate an algorithm for the generation of highly effective sasRNAs that can mimic the endogenous noncoding RNAs involved in the epigenetic regulation of gene expression. We validate this algorithm by targeting several oncogenes including AKT-1, c-MYC, K-RAS, and H-RAS. We also target a long antisense RNA that mediates the epigenetic repression of the tumor suppressor gene DUSP6, silenced in pancreatic cancer. An algorithm that can efficiently design small noncoding RNAs for the epigenetic transcriptional silencing or activation of specific genes has potential therapeutic and experimental applications.

MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense

Directory of Open Access Journals (Sweden)

Sheng-Rui Liu

2017-09-01

Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.

Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

Science.gov (United States)

Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

2015-12-01

Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.

Science.gov (United States)

Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert

2017-11-30

Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

The potential of virus-induced gene silencing for speeding up functional characterization of plant genes

NARCIS (Netherlands)

Benedito, V.A.; Visser, P.B.; Angenent, G.C.; Krens, F.A.

2004-01-01

Virus-induced gene silencing (VIGS) has been shown to be of great potential in plant reverse genetics. Advantages of VIGS over other approaches, such as T-DNA or transposon tagging, include the circumvention of plant transformation, methodological simplicity and robustness, and speedy results. These

An RNA-seq transcriptome analysis of histone modifiers and RNA silencing genes in soybean during floral initiation process.

Directory of Open Access Journals (Sweden)

Lim Chee Liew

Full Text Available Epigenetics has been recognised to play vital roles in many plant developmental processes, including floral initiation through the epigenetic regulation of gene expression. The histone modifying proteins that mediate these modifications involve the SET domain-containing histone methyltransferases, JmjC domain-containing demethylase, acetylases and deacetylases. In addition, RNA interference (RNAi-associated genes are also involved in epigenetic regulation via RNA-directed DNA methylation and post-transcriptional gene silencing. Soybean, a major crop legume, requires a short day to induce flowering. How histone modifications regulate the plant response to external cues that initiate flowering is still largely unknown. Here, we used RNA-seq to address the dynamics of transcripts that are potentially involved in the epigenetic programming and RNAi mediated gene silencing during the floral initiation of soybean. Soybean is a paleopolyploid that has been subjected to at least two rounds of whole genome duplication events. We report that the expanded genomic repertoire of histone modifiers and RNA silencing genes in soybean includes 14 histone acetyltransferases, 24 histone deacetylases, 47 histone methyltransferases, 15 protein arginine methyltransferases, 24 JmjC domain-containing demethylases and 47 RNAi-associated genes. To investigate the role of these histone modifiers and RNA silencing genes during floral initiation, we compared the transcriptional dynamics of the leaf and shoot apical meristem at different time points after a short-day treatment. Our data reveal that the extensive activation of genes that are usually involved in the epigenetic programming and RNAi gene silencing in the soybean shoot apical meristem are reprogrammed for floral development following an exposure to inductive conditions.

DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

KAUST Repository

Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong

2010-01-01

Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

KAUST Repository

Liu, Qian

2010-07-01

Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

Epigenetic silencing of host cell defense genes enhances intracellular survival of the rickettsial pathogen Anaplasma phagocytophilum.

Directory of Open Access Journals (Sweden)

Jose C Garcia-Garcia

2009-06-01

Full Text Available Intracellular bacteria have evolved mechanisms that promote survival within hostile host environments, often resulting in functional dysregulation and disease. Using the Anaplasma phagocytophilum-infected granulocyte model, we establish a link between host chromatin modifications, defense gene transcription and intracellular bacterial infection. Infection of THP-1 cells with A. phagocytophilum led to silencing of host defense gene expression. Histone deacetylase 1 (HDAC1 expression, activity and binding to the defense gene promoters significantly increased during infection, which resulted in decreased histone H3 acetylation in infected cells. HDAC1 overexpression enhanced infection, whereas pharmacologic and siRNA HDAC1 inhibition significantly decreased bacterial load. HDAC2 does not seem to be involved, since HDAC2 silencing by siRNA had no effect on A. phagocytophilum intracellular propagation. These data indicate that HDAC up-regulation and epigenetic silencing of host cell defense genes is required for A. phagocytophilum infection. Bacterial epigenetic regulation of host cell gene transcription could be a general mechanism that enhances intracellular pathogen survival while altering cell function and promoting disease.

Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

Science.gov (United States)

Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

2015-12-01

Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

Science.gov (United States)

Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

2007-09-01

The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

Expression of cancer stem markers could be influenced by silencing of p16 gene in HeLa cervical carcinoma cells.

Science.gov (United States)

Wu, H; Zhang, J; Shi, H

2016-01-01

Effect of the tumor suppression gene p16 on the biological characteristics of HeLa cervical carcinoma cells was explored. The expression of p16 protein was increased in HeLa tumor sphere cells, and no significant difference in tumor spheres from the first to the fourth passages. Compared with those of parental HeLa cells, the proportion of CD44+/CD24- and ABCG2+ cells increased significantly in tumor spheres. However after the cells were silenced by the p16-sh289 vector, expression of P16 protein and the cell number of CD44+/CD24- and ABCG2+ decreased. Moreover, HeLa cells with p16 gene silencing showed decreased abilities of sphere formation and matrigel invasion. More HeLa cells with p16 gene silence were needed for tumor formation in nude mice. Tumor size and weight in mouse model established with p16 gene silenced HeLa cells were less than those with HeLa parental cell model. The present results indicate that silencing of the p16 gene inhibits expression of cancer stem cell markers and tumorigenic ability of HeLa cells.

Varroa destructor induces changes in the expression of immunity-related genes during the development of Apis mellifera worker and drone broods.

Science.gov (United States)

Zaobidna, Ewa A; Żółtowska, Krystyna; Łopieńska-Biernat, Elżbieta

2017-12-20

The ectoparasitic mite Varroa destructor has emerged as the major pest of honeybees. Despite extensive research efforts, the pathogenesis of varroosis has not been fully explained. Earlier studies suggested that V. destructor infestation leads to the suppression of the host's immune system. The aim of this study was to analyze the immune responses of 14 genes in the Toll signal transduction pathways, including effector genes of antimicrobial peptides (AMPs), in developing Apis mellifera workers and drones infested with V. destructor. Four developmental stages (L5 larvae, prepupae, and 2 pupal stages) and newly emerged imagines were analyzed. In workers, the most significant changes were observed in L5 larvae in the initial stages of infestation. A significant increase in the relative expression of 10 of the 14 analyzed genes, including defensin-1 and defensin-2, was observed in infested bees relative to non-infested individuals. The immune response in drones developed at a slower rate. The expression of genes regulating cytoplasmic signal transduction increased in prepupae, whereas the expression of defensin-1 and defensin-2 effector genes increased in P3 pupae with red eyes. The expression of many immunity-related genes was silenced in successive life stages and in imagines, and it was more profound in workers than in drones. The results indicate that V. destructor significantly influences immune responses regulated by the Toll signal transduction pathway in bees. In infested bees, the observed changes in Toll pathway genes varied between life stages and the sexes.

An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing.

Science.gov (United States)

Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A

2016-06-28

Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.

Gene silencing of indoleamine 2,3-dioxygenase 2 in melanoma cells induces apoptosis through the suppression of NAD+ and inhibits in vivo tumor growth.

Science.gov (United States)

Liu, Yanling; Zhang, Yujuan; Zheng, Xiufen; Zhang, Xusheng; Wang, Hongmei; Li, Qin; Yuan, Keng; Zhou, Nanjing; Yu, Yanrong; Song, Na; Fu, Jiamin; Min, Weiping

2016-05-31

Indoleamine 2,3-dioxygenase 2 (IDO2) is a newly discovered enzyme that catalyzes the initial and rate-limiting step in the degradation of tryptophan. As a homologous protein of IDO1, IDO2 plays an inhibitory role in T cell proliferation, and it is essential for regulatory T cell (Treg) generation in healthy conditions. Little is known about the immune-independent functions of IDO2 relevant to its specific contributions to physiology and pathophysiology in cancer cells. The purpose of this study was to assess the impact of IDO2 gene silencing as a way to inhibit B16-BL6 cancer cells in a murine model. Here, for the first time, we show that knockdown of IDO2 using small interfering RNA (siRNA) inhibits cancer cell proliferation, arrests cell cycle in G1, induces greater cell apoptosis, and reduces cell migration in vitro. Knockdown of IDO2 decreased the generation of nicotinamide adenine dinucleotide (NAD+) while increasing the generation of reactive oxygen species (ROS). We further demonstrate that cell apoptosis, induced by IDO2 downregulation, can be weakened by addition of exogenous NAD+, suggesting a novel mechanism by which IDO2 promotes tumor growth through its metabolite product NAD+. In addition to in vitro findings, we also demonstrate that IDO2 silencing in tumor cells using short hairpin RNA (shRNA) delayed tumor formation and arrested tumor growth in vivo. In conclusion, this study demonstrates a new non-immune-associated mechanism of IDO2 in vitro and IDO2 expression in B16-BL6 cells contributes to cancer development and progression. Our research provides evidence of a novel target for gene silencing that has the potential to enhance cancer therapy.

Agrobacterium mediated transient gene silencing (AMTS in Stevia rebaudiana: insights into steviol glycoside biosynthesis pathway.

Directory of Open Access Journals (Sweden)

Praveen Guleria

Full Text Available Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins.RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes.SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.

Flexible tools for gene expression and silencing in tomato.

Science.gov (United States)

Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre

2009-12-01

As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.

Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

Directory of Open Access Journals (Sweden)

Jiangyu Wu

2013-01-01

Full Text Available RNA interference (RNAi was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc. of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system.

Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

Science.gov (United States)

Huang, Weizhe; He, Ziying

2013-01-01

RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

SGS3 Cooperates with RDR6 in Triggering Geminivirus-Induced Gene Silencing and in Suppressing Geminivirus Infection in Nicotiana Benthamiana

Directory of Open Access Journals (Sweden)

Fangfang Li

2017-09-01

Full Text Available RNA silencing has an important role in defending against virus infection in plants. Plants with the deficiency of RNA silencing components often show enhanced susceptibility to viral infections. RNA-dependent RNA polymerase (RDRs mediated-antiviral defense has a pivotal role in resistance to many plant viruses. In RDR6-mediated defense against viral infection, a plant-specific RNA binding protein, Suppressor of Gene Silencing 3 (SGS3, was also found to fight against some viruses in Arabidopsis. In this study, we showed that SGS3 from Nicotiana benthamiana (NbSGS3 is required for sense-RNA induced post-transcriptional gene silencing (S-PTGS and initiating sense-RNA-triggered systemic silencing. Further, the deficiency of NbSGS3 inhibited geminivirus-induced endogenous gene silencing (GIEGS and promoted geminivirus infection. During TRV-mediated NbSGS3 or N. benthamiana RDR6 (NbRDR6 silencing process, we found that their expression can be effectively fine-tuned. Plants with the knock-down of both NbSGS3 and NbRDR6 almost totally blocked GIEGS, and were more susceptible to geminivirus infection. These data suggest that NbSGS3 cooperates with NbRDR6 against GIEGS and geminivirus infection in N. benthamiana, which provides valuable information for breeding geminivirus-resistant plants.

Normalization of Overexpressed α-Synuclein Causing Parkinson's Disease By a Moderate Gene Silencing With RNA Interference

Directory of Open Access Journals (Sweden)

Masaki Takahashi

2015-01-01

Full Text Available The α-synuclein (SNCA gene is a responsible gene for Parkinson's disease (PD; and not only nucleotide variations but also overexpression of SNCA appears to be involved in the pathogenesis of PD. A specific inhibition against mutant SNCA genes carrying nucleotide variations may be feasible by a specific silencing such as an allele-specific RNA interference (RNAi; however, there is no method for restoring the SNCA overexpression to a normal level. Here, we show that an atypical RNAi using small interfering RNAs (siRNAs that confer a moderate level of gene silencing is capable of controlling overexpressed SNCA genes to return to a normal level; named “expression-control RNAi” (ExCont-RNAi. ExCont-RNAi exhibited little or no significant off-target effects in its treated PD patient's fibroblasts that carry SNCA triplication. To further assess the therapeutic effect of ExCont-RNAi, PD-model flies that carried the human SNCA gene underwent an ExCont-RNAi treatment. The treated PD-flies demonstrated a significant improvement in their motor function. Our current findings suggested that ExCont-RNAi might be capable of becoming a novel therapeutic procedure for PD with the SNCA overexpression, and that siRNAs conferring a moderate level of gene silencing to target genes, which have been abandoned as useless siRNAs so far, might be available for controlling abnormally expressed disease-causing genes without producing adverse effects.

Phosphorus starvation induces post-transcriptional CHS gene silencing in Petunia corolla.

Science.gov (United States)

Hosokawa, Munetaka; Yamauchi, Takayoshi; Takahama, Masayoshi; Goto, Mariko; Mikano, Sachiko; Yamaguchi, Yuki; Tanaka, Yoshiyuki; Ohno, Sho; Koeda, Sota; Doi, Motoaki; Yazawa, Susumu

2013-05-01

The corolla of Petunia 'Magic Samba' exhibits unstable anthocyanin expression depending on its phosphorus content. Phosphorus deficiency enhanced post-transcriptional gene silencing of chalcone synthase - A in the corolla. Petunia (Petunia hybrida) 'Magic Samba' has unstable red-white bicolored corollas that respond to nutrient deficiency. We grew this cultivar hydroponically using solutions that lacked one or several nutrients to identify the specific nutrient related to anthocyanin expression in corolla. The white area of the corolla widened under phosphorus (P)-deficient conditions. When the P content of the corolla grown under P-deficient conditions dropped to 40 corollas until the plants died. Other elemental deficiencies had no clear effects on anthocyanin suppression in the corolla. After phosphate was resupplied to the P-deficient plants, anthocyanin was restored in the corollas. The expression of chalcone synthase-A (CHS-A) was suppressed in the white area that widened under P-suppressed conditions, whereas the expression of several other genes related to anthocyanin biosynthesis was enhanced more in the white area than in the red area. Reddish leaves and sepals developed under the P-deficient condition, which is a typical P-deficiency symptom. Two genes related to anthocyanin biosynthesis were enhanced in the reddish organs. Small interfering RNA analysis of CHS-A showed that the suppression resulted from post-transcriptional gene silencing (PTGS). Thus, it was hypothesized that the enhancement of anthocyanin biosynthetic gene expression due to P-deficiency triggered PTGS of CHS-A, which resulted in white corolla development.

Agrobacterium Mediated Transient Gene Silencing (AMTS) in Stevia rebaudiana: Insights into Steviol Glycoside Biosynthesis Pathway

Science.gov (United States)

Guleria, Praveen; Yadav, Sudesh Kumar

2013-01-01

Background Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi) based Agrobacterium mediated transient gene silencing (AMTS) approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. Methodology/Principal Findings RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3) content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. Conclusions SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route. PMID:24023961

Dimerization site 2 of the bacterial DNA-binding protein H-NS is required for gene silencing and stiffened nucleoprotein filament formation.

Science.gov (United States)

Yamanaka, Yuki; Winardhi, Ricksen S; Yamauchi, Erika; Nishiyama, So-Ichiro; Sowa, Yoshiyuki; Yan, Jie; Kawagishi, Ikuro; Ishihama, Akira; Yamamoto, Kaneyoshi

2018-06-15

The bacterial nucleoid-associated protein H-NS is a DNA-binding protein, playing a major role in gene regulation. To regulate transcription, H-NS silences genes, including horizontally acquired foreign genes. Escherichia coli H-NS is 137 residues long and consists of two discrete and independent structural domains: an N-terminal oligomerization domain and a C-terminal DNA-binding domain, joined by a flexible linker. The N-terminal oligomerization domain is composed of two dimerization sites, dimerization sites 1 and 2, which are both required for H-NS oligomerization, but the exact role of dimerization site 2 in gene silencing is unclear. To this end, we constructed a whole set of single amino acid substitution variants spanning residues 2 to 137. Using a well-characterized H-NS target, the slp promoter of the glutamic acid-dependent acid resistance (GAD) cluster promoters, we screened for any variants defective in gene silencing. Focusing on the function of dimerization site 2, we analyzed four variants, I70C/I70A and L75C/L75A, which all could actively bind DNA but are defective in gene silencing. Atomic force microscopy analysis of DNA-H-NS complexes revealed that all of these four variants formed condensed complexes on DNA, whereas WT H-NS formed rigid and extended nucleoprotein filaments, a conformation required for gene silencing. Single-molecule stretching experiments confirmed that the four variants had lost the ability to form stiffened filaments. We conclude that dimerization site 2 of H-NS plays a key role in the formation of rigid H-NS nucleoprotein filament structures required for gene silencing. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma

Science.gov (United States)

Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.

2012-01-01

Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009

Addiction, adolescence, and innate immune gene induction

Directory of Open Access Journals (Sweden)

Fulton T Crews

2011-04-01

Full Text Available Repeated drug use/abuse amplifies psychopathology, progressively reducing frontal lobe behavioral control and cognitive flexibility while simultaneously increasing limbic temporal lobe negative emotionality. The period of adolescence is a neurodevelopmental stage characterized by poor behavioral control as well as strong limbic reward and thrill seeking. Repeated drug abuse and/or stress during this stage increase the risk of addiction and elevate activator innate immune signaling in the brain. Nuclear factor-kappa-light-chain-enhancer of activated B cells (NF-κB is a key glial transcription factor that regulates proinflammatory chemokines, cytokines, oxidases, proteases, and other innate immune genes. Induction of innate brain immune gene expression (e.g., NF-κB facilitates negative affect, depression-like behaviors, and inhibits hippocampal neurogenesis. In addition, innate immune gene induction alters cortical neurotransmission consistent with loss of behavioral control. Studies with anti-oxidant, anti-inflammatory, and anti-depressant drugs as well as opiate antagonists link persistent innate immune gene expression to key behavioral components of addiction, e.g. negative affect-anxiety and loss of frontal cortical behavioral control. This review suggests that persistent and progressive changes in innate immune gene expression contribute to the development of addiction. Innate immune genes may represent a novel new target for addiction therapy.

Protocol: using virus-induced gene silencing to study the arbuscular mycorrhizal symbiosis in Pisum sativum

DEFF Research Database (Denmark)

Grønlund, Mette; Olsen, Anne; Johansen, Elisabeth

2010-01-01

, the available PEBV-VIGS protocols are inadequate for studying genes involved in the symbiosis with arbuscular mycorrhizal fungi (AMF). Here we describe a PEBV-VIGS protocol suitable for reverse genetics studies in pea of genes involved in the symbiosis with AMF and show its effectiveness in silencing genes...... involved in the early and late stages of AMF symbiosis....

Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.

Directory of Open Access Journals (Sweden)

Maciej Pietrzak

Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.

In planta assays involving epigenetically silenced genes reveal inhibition of cytosine methylation by genistein

Directory of Open Access Journals (Sweden)

Arase Sachiko

2012-03-01

Full Text Available Abstract Background Cytosine methylation is involved in epigenetic control of gene expression in a wide range of organisms. An increasing number of examples indicate that changing the frequency of cytosine methylation in the genome is a feasible tool to engineer novel traits in plants. Although demethylating effects of compounds have been analyzed in human cultured cells in terms of suppressing cancer, their effect in plant cells has not been analyzed extensively. Here, we developed in planta assay systems to detect inhibition of cytosine methylation using plants that contain a transgene transcriptionally silenced by an epigenetic mechanism. Results Seeds of two transgenic plants were used: a petunia line that has been identified as a revertant of the co-suppression of the chalcone synthase-A (CHS-A gene and contains CHS-A transgenes whose transcription is repressed; Nicotiana benthamiana plants that contain the green fluorescent protein (GFP reporter gene whose transcription is repressed through virus-induced transcriptional gene silencing. Seeds of these plants were sown on a medium that contained a demethylating agent, either 5-azacytidine or trichostatin A, and the restoration of the transcriptionally active state of the transgene was detected in seedlings. Using these systems, we found that genistein, a major isoflavonoid compound, inhibits cytosine methylation, thus restoring transgene transcription. Genistein also restored the transcription of an epigenetically silenced endogenous gene in Arabidopsis plants. Conclusions Our assay systems allowed us to assess the inhibition of cytosine methylation, in particular of maintenance of methylation, by compounds in plant cells. These results suggest a novel role of flavonoids in plant cells and that genistein is useful for modifying the epigenetic state of plant genomes.

The silencing effect of miR-30a on ITGA4 gene expression in vitro: an approach for gene therapy.

Science.gov (United States)

Darzi, Leila; Boshtam, Maryam; Shariati, Laleh; Kouhpayeh, Shirin; Gheibi, Azam; Mirian, Mina; Rahimmanesh, Ilnaz; Khanahmad, Hossein; Tabatabaiefar, Mohammad Amin

2017-12-01

Integrins are adhesion molecules which play crucial roles in cell-cell and cell-extracellular matrix interactions. Very late antigen-4 or α4β1 and lymphocyte Peyer's patch adhesion molecule-1 or α4β7, are key factors in the invasion of tumor cells and metastasis. Based on the previous reports, integrin α4 ( ITGA4 ) is overexpressed in some immune disorders and cancers. Thus, inhibition of ITGA4 could be a therapeutic strategy. In the present study, miR-30a was selected in order to suppress ITGA4 expression. The ITGA4 3' UTR was amplified, cloned in the Z2827-M67-( ITGA4 ) plasmid and named as Z2827-M67/3'UTR. HeLa cells were divided into five groups; (1) untreated without any transfection, (2) mock with Z2827-M67/3'UTR transfection and X-tremeGENE reagent, (3) negative control with Z2827-M67/3'UTR transfection alone, (4) test with miR-30a mimic and Z2827-M67/3'UTR transfection and (5) scramble with miR-30a scramble and Z2827-M67/3'UTR transfection. The MTT assay was performed to evaluate cell survival and cytotoxicity in each group. Real-time RT-PCR was applied for the ITGA4 expression analysis. The findings of this study showed that miR-30a downregulated ITGA4 expression and had no effect on the cell survival. Due to the silencing effect of miR-30a on the ITGA4 gene expression, this agent could be considered as a potential tool for cancer and immune disorders therapy.

Gene dosage induction of silencing directed against an Arabidopsis Myb transgene in tobacco

Science.gov (United States)

An unexpected reduction in petal pigmentation on petunia plants genetically engineered for enhanced flower color was one of the first experimental demonstrations of the natural process of RNA-associated gene silencing. The obvious visual nature of such alterations to pigment patterns of transgenic ...

Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

Directory of Open Access Journals (Sweden)

Tatsuya eKon

2014-11-01

Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

RNA-mediated gene silencing in Candida albicans: inhibition of hyphae formation by use of RNAi technology.

Science.gov (United States)

Moazeni, Maryam; Khoramizadeh, Mohammad Reza; Kordbacheh, Parivash; Sepehrizadeh, Zargham; Zeraati, Hojat; Noorbakhsh, Fatemeh; Teimoori-Toolabi, Ladan; Rezaie, Sassan

2012-09-01

The introduction of RNA silencing machinery in fungi has led to the promising application of RNAi methodology to knock down essential vital factor or virulence factor genes in the microorganisms. Efg1p is required for development of a true hyphal growth form which is known to be essential for interactions with human host cells and for the yeast's pathogenesis. In this paper, we describe the development of a system for presenting and studying the RNAi function on the EFG1 gene in C. albicans. The 19-nucleotide siRNA was designed on the basis of the cDNA sequence of the EFG1 gene in C. albicans and transfection was performed by use of a modified-PEG/LiAc method. To investigate EFG1 gene silencing in siRNA-treated cells, the yeasts were grown in human serum; to induce germ tubes a solid medium was used with the serum. Quantitative changes in expression of the EFG1 gene were analyzed by measuring the cognate EFG1 mRNA level by use of a quantitative real-time RT-PCR assay. Compared with the positive control, true hyphae formation was significantly reduced by siRNA at concentrations of 1 μM, 500 nM, and 100 nM (P < 0.05). In addition, siRNA at a concentration of 1 μM was revealed to inhibit expression of the EFG1 gene effectively (P < 0.05). On the basis of the potential of post-transcriptional gene silencing to control the expression of specific genes, these techniques may be regarded as promising means of drug discovery, with applications in biomedicine and functional genomics analysis.

Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

Directory of Open Access Journals (Sweden)

Yao Han

Full Text Available MIGS (miRNA-induced gene silencing is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs. MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase and PDS (phytoene desaturase gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant

Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

Science.gov (United States)

Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong

2015-01-01

MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.

Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine.

Science.gov (United States)

Tang, Wei; Newton, Ronald J; Weidner, Douglas A

2007-01-01

An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.

HvCKX2 gene silencing by biolistic or Agrobacterium-mediated transformation in barley leads to different phenotypes.

Science.gov (United States)

Zalewski, Wojciech; Orczyk, Wacław; Gasparis, Sebastian; Nadolska-Orczyk, Anna

2012-11-07

CKX genes encode cytokinin dehydrogenase enzymes (CKX), which metabolize cytokinins in plants and influence developmental processes. The genes are expressed in different tissues and organs during development; however, their exact role in barley is poorly understood. It has already been proven that RNA interference (RNAi)-based silencing of HvCKX1 decreased the CKX level, especially in those organs which showed the highest expression, i.e. developing kernels and roots, leading to higher plant productivity and higher mass of the roots [1]. The same type of RNAi construct was applied to silence HvCKX2 and analyze the function of the gene. Two cultivars of barley were transformed with the same silencing and selection cassettes by two different methods: biolistic and via Agrobacterium. The mean Agrobacterium-mediated transformation efficiency of Golden Promise was 3.47% (±2.82). The transcript level of HvCKX2 in segregating progeny of T(1) lines was decreased to 34%. The reduction of the transcript in Agrobacterium-derived plants resulted in decreased CKX activity in the developing and developed leaves as well as in 7 DAP (days after pollination) spikes. The final phenotypic effect was increased productivity of T(0) plants and T(1) lines. Higher productivity was the result of the higher number of seeds and higher grain yield. It was also correlated with the higher 1000 grain weight, increased (by 7.5%) height of the plants and higher (from 0.5 to 2) numbers of spikes. The transformation efficiency of Golden Promise after biolistic transformation was more than twice as low compared to Agrobacterium. The transcript level in segregating progeny of T(1) lines was decreased to 24%. Otherwise, the enzyme activity found in the leaves of the lines after biolistic transformation, especially in cv. Golden Promise, was very high, exceeding the relative level of the control lines. These unbalanced ratios of the transcript level and the activity of the CKX enzyme negatively

Virus-induced gene silencing (VIGS) as a reverse genetic tool to study development of symbiotic root nodules

DEFF Research Database (Denmark)

Kjær, Gabriela Didina Constantin; Grønlund, Mette; Stougaard, Jens

2008-01-01

Virus-induced gene silencing (VIGS) can provide a shortcut to plants with altered expression of specific genes. Here, we report that VIGS of the Nodule inception gene (Nin) can alter the nodulation phenotype and Nin gene expression in Pisum sativum. PsNin was chosen as target because of the disti...

Increasing the amylose content of durum wheat through silencing of the SBEIIa genes

Directory of Open Access Journals (Sweden)

Masci Stefania

2010-07-01

Full Text Available Abstract Background High amylose starch has attracted particular interest because of its correlation with the amount of Resistant Starch (RS in food. RS plays a role similar to fibre with beneficial effects for human health, providing protection from several diseases such as colon cancer, diabetes, obesity, osteoporosis and cardiovascular diseases. Amylose content can be modified by a targeted manipulation of the starch biosynthetic pathway. In particular, the inactivation of the enzymes involved in amylopectin synthesis can lead to the increase of amylose content. In this work, genes encoding starch branching enzymes of class II (SBEIIa were silenced using the RNA interference (RNAi technique in two cultivars of durum wheat, using two different methods of transformation (biolistic and Agrobacterium. Expression of RNAi transcripts was targeted to the seed endosperm using a tissue-specific promoter. Results Amylose content was markedly increased in the durum wheat transgenic lines exhibiting SBEIIa gene silencing. Moreover the starch granules in these lines were deformed, possessing an irregular and deflated shape and being smaller than those present in the untransformed controls. Two novel granule bound proteins, identified by SDS-PAGE in SBEIIa RNAi lines, were investigated by mass spectrometry and shown to have strong homologies to the waxy proteins. RVA analysis showed new pasting properties associated with high amylose lines in comparison with untransformed controls. Finally, pleiotropic effects on other starch genes were found by semi-quantitative and Real-Time reverse transcription-polymerase chain reaction (RT-PCR. Conclusion We have found that the silencing of SBEIIa genes in durum wheat causes obvious alterations in granule morphology and starch composition, leading to high amylose wheat. Results obtained with two different methods of transformation and in two durum wheat cultivars were comparable.

Suppressors of RNA silencing encoded by tomato leaf curl ...

Indian Academy of Sciences (India)

2013-01-06

Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

KAUST Repository

Zheng, Zhimin

2010-01-06

RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

Differential Cotton leaf crumple virus-VIGS-mediated gene silencing and viral genome localization in different Gossypium hirsutum genetic backgrounds

KAUST Repository

Idris, Ali

2010-12-01

A Cotton leaf crumple virus (CLCrV)-based gene silencing vector containing a fragment of the Gossypium hirsutum Magnesium chelatase subunit I was used to establish endogenous gene silencing in cotton of varied genetic backgrounds. Biolistic inoculation resulted in systemic and persistent photo-bleaching of the leaves and bolls of the seven cultivars tested, however, the intensity of silencing was variable. CLCrV-VIGS-mediated expression of green fluorescent protein was used to monitor the in planta distribution of the vector, indicating successful phloem invasion in all cultivars tested. Acala SJ-1, one of the cotton cultivars, was identified as a particularly optimal candidate for CLCrV-VIGS-based cotton reverse-genetics. © 2010 Elsevier Ltd.

RNAi-mediated Gene Silencing of Mutant Myotilin Improves Myopathy in LGMD1A Mice

Directory of Open Access Journals (Sweden)

Jian Liu

2014-01-01

Full Text Available Recent progress suggests gene therapy may one day be an option for treating some forms of limb girdle muscular dystrophy (LGMD. Nevertheless, approaches targeting LGMD have so far focused on gene replacement strategies for recessive forms of the disease. In contrast, no attempts have been made to develop molecular therapies for any of the eight dominantly inherited forms of LGMD. Importantly, the emergence of RNA interference (RNAi therapeutics in the last decade provided new tools to combat dominantly inherited LGMDs with molecular therapy. In this study, we describe the first RNAi-based, preclinical gene therapy approach for silencing a gene associated with dominant LGMD. To do this, we developed adeno-associated viral vectors (AAV6 carrying designed therapeutic microRNAs targeting mutant myotilin (MYOT, which is the underlying cause of LGMD type 1A (LGMD1A. Our best MYOT-targeted microRNA vector (called miMYOT significantly reduced mutant myotilin mRNA and soluble protein expression in muscles of LGMD1A mice (the TgT57I model both 3 and 9 months after delivery, demonstrating short- and long-term silencing effects. This MYOT gene silencing subsequently decreased deposition of MYOT-seeded intramuscular protein aggregates, which is the hallmark feature of LGMD1A. Histological improvements were accompanied by significant functional correction, as miMYOT-treated animals showed increased muscle weight and improved specific force in the gastrocnemius, which is one of the most severely affected muscles in TgT57I mice and patients with dominant myotilin mutations. These promising results in a preclinical model of LGMD1A support the further development of RNAi-based molecular therapy as a prospective treatment for LGMD1A. Furthermore, this study sets a foundation that may be refined and adapted to treat other dominant LGMD and related disorders.

Effects of gene silencing of CypB on gastric cancer cells.

Science.gov (United States)

Guo, Feng; Zhang, Ying; Zhao, Chun-Na; Li, Lin; Guo, Yan-Jun

2015-04-01

To determine the effect of gene silencing of cyclophilin B (CypB) on growth and proliferation of gastric cancer cells. CypB siRNA lentivirus (LV-CypB-si) and control lentivirus (LV-si-con) were produced. CypB expression in gastric cancer cell lines was detected by Western blot. BGC823 and SGC7901 cells were chosen to be infected with LV-si-con and LV-CypB-si, and stable transfectants were isolated. The cell groups transfected with LV-CypB-siRNA, LV-siRNA-con and transfected no carrier were served as the experimental group, the implicit control group and the blank control group respectively. MTT and colony formation assays were used to examine the effect of CypB on the cell growth and proliferation in vitro. Cell cycle was analyzed with flow cytometry. The expression of VEGFR of BGC823-si and SGC7901-si was detected by Western blot. Gene silencing of CypB can inhibit gastric cancer cell growth, proliferation, cell cycle progress and tumorigenesis. CypB expression level was obviously higher in SGC7901 and BGC823 than MKN28 and GES. These two cell lines were infected with LV-si-con and LV-CypB-si respectively. MTT and cloney formation assays showed a significantly decreased rate of cell proliferation from the forth day or the fifth day in cells transfected with LV-CypB-si (PCypB resulted in slightly decreased percentage of S phase and increased percentage of G1 (PCypB could promote the G1-S transition of gastric cancer cell. In addition, the expression of VEGF of BGC823 and SGC7901 transfected with CypB siRNA was reduced in comparison with the implicit control group and the blank control group. Gene silencing of CypB decreases gastric cancer cells proliferation and in vivo tumorigenesis. These findings indiccate CypB could be a potential biomarker and therapeutic target for gastric cancer. Copyright © 2015 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.

H3K9me-independent gene silencing in fission yeast heterochromatin by Clr5 and histone deacetylases

DEFF Research Database (Denmark)

Hansen, Klavs R; Hazan, Idit; Shanker, Sreenath

2011-01-01

organisms such as fission yeast. In spite of numerous studies, the relative contributions of the various heterochromatic histone marks to the properties of heterochromatin remain largely undefined. Here, we report that silencing of the fission yeast mating-type cassettes, which are located in a well......, our results point to histone deacetylases as prominent repressors of gene expression in fission yeast heterochromatin. These deacetylases can act in concert with, or independently of, the widely studied H3K9me mark to influence gene silencing at heterochromatic loci....

CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs

DEFF Research Database (Denmark)

Mandegar, Mohammad A.; Huebsch, Nathaniel; Frolov, Ekaterina B.

2016-01-01

repression system is tunable and has the potential to silence single alleles. Compared with CRISPR nuclease (CRISPRn), CRISPRi gene repression is more efficient and homogenous across cell populations. The CRISPRi system in iPSCs provides a powerful platform to perform genome-scale screens in a wide range...

Involvement of Multiple Gene-Silencing Pathways in a Paramutation-like Phenomenon in Arabidopsis

Directory of Open Access Journals (Sweden)

Zhimin Zheng

2015-05-01

Full Text Available Paramutation is an epigenetic phenomenon that has been observed in a number of multicellular organisms. The epigenetically silenced state of paramutated alleles is not only meiotically stable but also “infectious” to active homologous alleles. The molecular mechanism of paramutation remains unclear, but components involved in RNA-directed DNA methylation (RdDM are required. Here, we report a multi-copy pRD29A-LUC transgene in Arabidopsis thaliana that behaves like a paramutation locus. The silent state of LUC is induced by mutations in the DNA glycosylase gene ROS1. The silent alleles of LUC are not only meiotically stable but also able to transform active LUC alleles into silent ones, in the absence of ros1 mutations. Maintaining silencing at the LUC gene requires action of multiple pathways besides RdDM. Our study identified specific factors that are involved in the paramutation-like phenomenon and established a model system for the study of paramutation in Arabidopsis.

Silencing of a putative immunophilin gene in the cattle tick Rhipicephalus (Boophilus microplus increases the infection rate of Babesia bovis in larval progeny

Directory of Open Access Journals (Sweden)

Knowles Donald P

2009-11-01

Full Text Available Abstract Background The cattle tick Rhipicephalus (Boophilus microplus is involved in the transmission of the protozoan Babesia bovis, the etiological agent of bovine babesiosis. Interactions between ticks and protozoa are poorly understood and the investigation of tick genes that affect tick fitness and protozoan infection can set the stage for dissecting the molecular interactions between the two species. Results In this study, RNA interference was used to silence R. microplus genes that had been previously shown to be up-regulated in response to B. bovis infection. The silencing of a putative immunophilin gene (Imnp in female ticks fed on a calf acutely infected with B. bovis decreased the hatching rate and survival of larval progeny. Interestingly, Imnp was up-regulated significantly in ovaries of R. microplus in response to B. bovis infection and its silencing in female ticks significantly increased the infection rate of the protozoan in larval progeny. The results also showed that the silencing of a putative Kunitz-type serine protease inhibitor (Spi gene and a putative lipocalin (Lpc gene decreased the fitness of R. microplus females, but had no significant effect on the infection rate of B. bovis in larval progeny. Conclusion The silencing of the Imnp, Spi or Lpc genes decreased the fitness of R. microplus females fed on a calf during acute B. bovis infection. The Imnp gene data suggest that this putative immunophilin gene is involved in the defense system of R. microplus against B. bovis and may play a role in controlling the protozoan infection in tick ovaries and larval progeny.

Utilizing virus-induced gene silencing for the functional characterization of maize genes during infection with the fungal pathogen Ustilago maydis.

Science.gov (United States)

van der Linde, Karina; Doehlemann, Gunther

2013-01-01

While in dicotyledonous plants virus-induced gene silencing (VIGS) is well established to study plant-pathogen interaction, in monocots only few examples of efficient VIGS have been reported so far. One of the available systems is based on the brome mosaic virus (BMV) which allows gene silencing in different cereals including barley (Hordeum vulgare), wheat (Triticum aestivum), and maize (Zea mays).Infection of maize plants by the corn smut fungus Ustilago maydis leads to the formation of large tumors on stem, leaves, and inflorescences. During this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed comprehensive and stage-specific changes in host gene expression during disease progression.To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a VIGS system based on the Brome mosaic virus (BMV) to maize at conditions that allow successful U. maydis infection of BMV pre-infected maize plants. This setup enables quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (q(RT)-PCR)-based readout.

Silencing the SpMPK1, SpMPK2, and SpMPK3 Genes in Tomato Reduces Abscisic Acid—Mediated Drought Tolerance

Directory of Open Access Journals (Sweden)

Yan Liang

2013-11-01

Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.

Identification of an attenuated barley stripe mosaic virus for the virus-induced gene silencing of pathogenesis-related wheat genes

OpenAIRE

Buhrow, Leann M.; Clark, Shawn M.; Loewen, Michele C.

2016-01-01

Background Virus-induced gene silencing (VIGS) has become an emerging technology for the rapid, efficient functional genomic screening of monocot and dicot species. The barley stripe mosaic virus (BSMV) has been described as an effective VIGS vehicle for the evaluation of genes involved in wheat and barley phytopathogenesis; however, these studies have been obscured by BSMV-induced phenotypes and defense responses. The utility of BSMV VIGS may be improved using a BSMV genetic background which...

Paramutation of tobacco transgenes by small RNA-mediated transcriptional gene silencing

Czech Academy of Sciences Publication Activity Database

Crhák Khaitová, Lucie; Fojtová, M.; Křížová, Kateřina; Lunerová Bedřichová, Jana; Fulneček, Jaroslav; Depicker, A.; Kovařík, Aleš

2011-01-01

Roč. 6, č. 5 (2011), s. 650-660 ISSN 1559-2294 R&D Projects: GA ČR(CZ) GD204/09/H002; GA MŠk(CZ) LC06004 Grant - others:GA ČR(CZ) GPP501/11/P667 Program:GP Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : transcriptional gene silencing * transgene epialleles * DNA methylation Subject RIV: BO - Biophysics Impact factor: 4.318, year: 2011

The RNA silencing enzyme RNA polymerase v is required for plant immunity.

Directory of Open Access Journals (Sweden)

Ana López

2011-12-01

Full Text Available RNA-directed DNA methylation (RdDM is an epigenetic control mechanism driven by small interfering RNAs (siRNAs that influence gene function. In plants, little is known of the involvement of the RdDM pathway in regulating traits related to immune responses. In a genetic screen designed to reveal factors regulating immunity in Arabidopsis thaliana, we identified NRPD2 as the OVEREXPRESSOR OF CATIONIC PEROXIDASE 1 (OCP1. NRPD2 encodes the second largest subunit of the plant-specific RNA Polymerases IV and V (Pol IV and Pol V, which are crucial for the RdDM pathway. The ocp1 and nrpd2 mutants showed increases in disease susceptibility when confronted with the necrotrophic fungal pathogens Botrytis cinerea and Plectosphaerella cucumerina. Studies were extended to other mutants affected in different steps of the RdDM pathway, such as nrpd1, nrpe1, ago4, drd1, rdr2, and drm1drm2 mutants. Our results indicate that all the mutants studied, with the exception of nrpd1, phenocopy the nrpd2 mutants; and they suggest that, while Pol V complex is required for plant immunity, Pol IV appears dispensable. Moreover, Pol V defective mutants, but not Pol IV mutants, show enhanced disease resistance towards the bacterial pathogen Pseudomonas syringae DC3000. Interestingly, salicylic acid (SA-mediated defenses effective against PsDC3000 are enhanced in Pol V defective mutants, whereas jasmonic acid (JA-mediated defenses that protect against fungi are reduced. Chromatin immunoprecipitation analysis revealed that, through differential histone modifications, SA-related defense genes are poised for enhanced activation in Pol V defective mutants and provide clues for understanding the regulation of gene priming during defense. Our results highlight the importance of epigenetic control as an additional layer of complexity in the regulation of plant immunity and point towards multiple components of the RdDM pathway being involved in plant immunity based on genetic evidence

The RNA silencing enzyme RNA polymerase v is required for plant immunity.

Science.gov (United States)

López, Ana; Ramírez, Vicente; García-Andrade, Javier; Flors, Victor; Vera, Pablo

2011-12-01

RNA-directed DNA methylation (RdDM) is an epigenetic control mechanism driven by small interfering RNAs (siRNAs) that influence gene function. In plants, little is known of the involvement of the RdDM pathway in regulating traits related to immune responses. In a genetic screen designed to reveal factors regulating immunity in Arabidopsis thaliana, we identified NRPD2 as the OVEREXPRESSOR OF CATIONIC PEROXIDASE 1 (OCP1). NRPD2 encodes the second largest subunit of the plant-specific RNA Polymerases IV and V (Pol IV and Pol V), which are crucial for the RdDM pathway. The ocp1 and nrpd2 mutants showed increases in disease susceptibility when confronted with the necrotrophic fungal pathogens Botrytis cinerea and Plectosphaerella cucumerina. Studies were extended to other mutants affected in different steps of the RdDM pathway, such as nrpd1, nrpe1, ago4, drd1, rdr2, and drm1drm2 mutants. Our results indicate that all the mutants studied, with the exception of nrpd1, phenocopy the nrpd2 mutants; and they suggest that, while Pol V complex is required for plant immunity, Pol IV appears dispensable. Moreover, Pol V defective mutants, but not Pol IV mutants, show enhanced disease resistance towards the bacterial pathogen Pseudomonas syringae DC3000. Interestingly, salicylic acid (SA)-mediated defenses effective against PsDC3000 are enhanced in Pol V defective mutants, whereas jasmonic acid (JA)-mediated defenses that protect against fungi are reduced. Chromatin immunoprecipitation analysis revealed that, through differential histone modifications, SA-related defense genes are poised for enhanced activation in Pol V defective mutants and provide clues for understanding the regulation of gene priming during defense. Our results highlight the importance of epigenetic control as an additional layer of complexity in the regulation of plant immunity and point towards multiple components of the RdDM pathway being involved in plant immunity based on genetic evidence, but whether

Virus-induced gene silencing in Medicago truncatula and Lathyrus odorata

DEFF Research Database (Denmark)

Grønlund, Mette; Kjær, Gabriela Didina Constantin; Piednoir, Elodie

2008-01-01

Virus-induced gene silencing (VIGS) has become an important reverse genetics tool for functional genomics. VIGS vectors based on Pea early browning virus (PEBV, genus Tobravirus) and Bean pod mottle virus (genus Comovirus) are available for the legume species Pisum sativum and Glycine max, respec...

Manipulation of Cell Physiology Enables Gene Silencing in Well-differentiated Airway Epithelia

Directory of Open Access Journals (Sweden)

Sateesh Krishnamurthy

2012-01-01

Full Text Available The application of RNA interference-based gene silencing to the airway surface epithelium holds great promise to manipulate host and pathogen gene expression for therapeutic purposes. However, well-differentiated airway epithelia display significant barriers to double-stranded small-interfering RNA (siRNA delivery despite testing varied classes of nonviral reagents. In well-differentiated primary pig airway epithelia (PAE or human airway epithelia (HAE grown at the air–liquid interface (ALI, the delivery of a Dicer-substrate small-interfering RNA (DsiRNA duplex against hypoxanthine–guanine phosphoribosyltransferase (HPRT with several nonviral reagents showed minimal uptake and no knockdown of the target. In contrast, poorly differentiated cells (2–5-day post-seeding exhibited significant oligonucleotide internalization and target knockdown. This finding suggested that during differentiation, the barrier properties of the epithelium are modified to an extent that impedes oligonucleotide uptake. We used two methods to overcome this inefficiency. First, we tested the impact of epidermal growth factor (EGF, a known enhancer of macropinocytosis. Treatment of the cells with EGF improved oligonucleotide uptake resulting in significant but modest levels of target knockdown. Secondly, we used the connectivity map (Cmap database to correlate gene expression changes during small molecule treatments on various cells types with genes that change upon mucociliary differentiation. Several different drug classes were identified from this correlative assessment. Well-differentiated epithelia treated with DsiRNAs and LY294002, a PI3K inhibitor, significantly improved gene silencing and concomitantly reduced target protein levels. These novel findings reveal that well-differentiated airway epithelia, normally resistant to siRNA delivery, can be pretreated with small molecules to improve uptake of synthetic oligonucleotide and RNA interference (RNAi responses.

RNAi dynamics in Juvenile Fasciola spp. Liver flukes reveals the persistence of gene silencing in vitro.

Directory of Open Access Journals (Sweden)

Paul McVeigh

2014-09-01

Full Text Available Fasciola spp. liver fluke cause pernicious disease in humans and animals. Whilst current control is unsustainable due to anthelmintic resistance, gene silencing (RNA interference, RNAi has the potential to contribute to functional validation of new therapeutic targets. The susceptibility of juvenile Fasciola hepatica to double stranded (dsRNA-induced RNAi has been reported. To exploit this we probe RNAi dynamics, penetrance and persistence with the aim of building a robust platform for reverse genetics in liver fluke. We describe development of standardised RNAi protocols for a commercially-available liver fluke strain (the US Pacific North West Wild Strain, validated via robust transcriptional silencing of seven virulence genes, with in-depth experimental optimisation of three: cathepsin L (FheCatL and B (FheCatB cysteine proteases, and a σ-class glutathione transferase (FheσGST.Robust transcriptional silencing of targets in both F. hepatica and Fasciola gigantica juveniles is achievable following exposure to long (200-320 nt dsRNAs or 27 nt short interfering (siRNAs. Although juveniles are highly RNAi-susceptible, they display slower transcript and protein knockdown dynamics than those reported previously. Knockdown was detectable following as little as 4h exposure to trigger (target-dependent and in all cases silencing persisted for ≥25 days following long dsRNA exposure. Combinatorial silencing of three targets by mixing multiple long dsRNAs was similarly efficient. Despite profound transcriptional suppression, we found a significant time-lag before the occurrence of protein suppression; FheσGST and FheCatL protein suppression were only detectable after 9 and 21 days, respectively.In spite of marked variation in knockdown dynamics, we find that a transient exposure to long dsRNA or siRNA triggers robust RNAi penetrance and persistence in liver fluke NEJs supporting the development of multiple-throughput phenotypic screens for control

Deep sequencing uncovers commonality in small RNA profiles between transgene-induced and naturally occurring RNA silencing of chalcone synthase-A gene in petunia.

Science.gov (United States)

Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira

2013-01-30

Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the

Dimethylated H3K27 Is a Repressive Epigenetic Histone Mark in the Protist Entamoeba histolytica and Is Significantly Enriched in Genes Silenced via the RNAi Pathway*

Science.gov (United States)

Foda, Bardees M.; Singh, Upinder

2015-01-01

RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5′-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. PMID:26149683

Dimethylated H3K27 Is a Repressive Epigenetic Histone Mark in the Protist Entamoeba histolytica and Is Significantly Enriched in Genes Silenced via the RNAi Pathway.

Science.gov (United States)

Foda, Bardees M; Singh, Upinder

2015-08-21

RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5'-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

[Small interfering RNA-mediated COX-2 gene silencing enhances chemosensitivity of KB/VCR cells by suppressing MDR-1 gene expression and P-glycoprotein activity].

Science.gov (United States)

Mo, Xianchao; Li, Weizhong

2014-05-01

To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.

Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

Science.gov (United States)

Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

2011-12-01

Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

Characterization of a Brome mosaic virus strain and its use as a vector for gene silencing in monocotyledonous hosts.

Science.gov (United States)

Ding, Xin Shun; Schneider, William L; Chaluvadi, Srinivasa Rao; Mian, M A Rouf; Nelson, Richard S

2006-11-01

Virus-induced gene silencing (VIGS) is used to analyze gene function in dicotyledonous plants but less so in monocotyledonous plants (particularly rice and corn), partially due to the limited number of virus expression vectors available. Here, we report the cloning and modification for VIGS of a virus from Festuca arundinacea Schreb. (tall fescue) that caused systemic mosaic symptoms on barley, rice, and a specific cultivar of maize (Va35) under greenhouse conditions. Through sequencing, the virus was determined to be a strain of Brome mosaic virus (BMV). The virus was named F-BMV (F for Festuca), and genetic determinants that controlled the systemic infection of rice were mapped to RNAs 1 and 2 of the tripartite genome. cDNA from RNA 3 of the Russian strain of BMV (R-BMV) was modified to accept inserts from foreign genes. Coinoculation of RNAs 1 and 2 from F-BMV and RNA 3 from R-BMV expressing a portion of a plant gene to leaves of barley, rice, and maize plants resulted in visual silencing-like phenotypes. The visual phenotypes were correlated with decreased target host transcript levels in the corresponding leaves. The VIGS visual phenotype varied from maintained during silencing of actin 1 transcript expression to transient with incomplete penetration through affected tissue during silencing of phytoene desaturase expression. F-BMV RNA 3 was modified to allow greater accumulation of virus while minimizing virus pathogenicity. The modified vector C-BMV(A/G) (C for chimeric) was shown to be useful for VIGS. These BMV vectors will be useful for analysis of gene function in rice and maize for which no VIGS system is reported.

RNAi-based therapeutic nanostrategy: IL-8 gene silencing in pancreatic cancer cells using gold nanorods delivery vehicles

International Nuclear Information System (INIS)

Panwar, Nishtha; Yang, Chengbin; Yin, Feng; Chuan, Tjin Swee; Yong, Ken-Tye; Yoon, Ho Sup

2015-01-01

RNA interference (RNAi)-based gene silencing possesses great ability for therapeutic intervention in pancreatic cancer. Among various oncogene mutations, Interleukin-8 (IL-8) gene mutations are found to be overexpressed in many pancreatic cell lines. In this work, we demonstrate IL-8 gene silencing by employing an RNAi-based gene therapy approach and this is achieved by using gold nanorods (AuNRs) for efficient delivery of IL-8 small interfering RNA (siRNA) to the pancreatic cell lines of MiaPaCa-2 and Panc-1. Upon comparing to Panc-1 cells, we found that the dominant expression of the IL-8 gene in MiaPaCa-2 cells resulted in an aggressive behavior towards the processes of cell invasion and metastasis. We have hence investigated the suitability of using AuNRs as novel non-viral nanocarriers for the efficient uptake and delivery of IL-8 siRNA in realizing gene knockdown of both MiaPaCa-2 and Panc-1 cells. Flow cytometry and fluorescence imaging techniques have been applied to confirm transfection and release of IL-8 siRNA. The ratio of AuNRs and siRNA has been optimized and transfection efficiencies as high as 88.40 ± 2.14% have been achieved. Upon successful delivery of IL-8 siRNA into cancer cells, the effects of IL-8 gene knockdown are quantified in terms of gene expression, cell invasion, cell migration and cell apoptosis assays. Statistical comparative studies for both MiaPaCa-2 and Panc-1 cells are presented in this work. IL-8 gene silencing has been demonstrated with knockdown efficiencies of 81.02 ± 10.14% and 75.73 ± 6.41% in MiaPaCa-2 and Panc-1 cells, respectively. Our results are then compared with a commercial transfection reagent, Oligofectamine, serving as positive control. The gene knockdown results illustrate the potential role of AuNRs as non-viral gene delivery vehicles for RNAi-based targeted cancer therapy applications. (paper)

GW182-Free microRNA Silencing Complex Controls Post-transcriptional Gene Expression during Caenorhabditis elegans Embryogenesis.

Directory of Open Access Journals (Sweden)

Guillaume Jannot

2016-12-01

Full Text Available MicroRNAs and Argonaute form the microRNA induced silencing complex or miRISC that recruits GW182, causing mRNA degradation and/or translational repression. Despite the clear conservation and molecular significance, it is unknown if miRISC-GW182 interaction is essential for gene silencing during animal development. Using Caenorhabditis elegans to explore this question, we examined the relationship and effect on gene silencing between the GW182 orthologs, AIN-1 and AIN-2, and the microRNA-specific Argonaute, ALG-1. Homology modeling based on human Argonaute structures indicated that ALG-1 possesses conserved Tryptophan-binding Pockets required for GW182 binding. We show in vitro and in vivo that their mutations severely altered the association with AIN-1 and AIN-2. ALG-1 tryptophan-binding pockets mutant animals retained microRNA-binding and processing ability, but were deficient in reporter silencing activity. Interestingly, the ALG-1 tryptophan-binding pockets mutant phenocopied the loss of alg-1 in worms during larval stages, yet was sufficient to rescue embryonic lethality, indicating the dispensability of AINs association with the miRISC at this developmental stage. The dispensability of AINs in miRNA regulation is further demonstrated by the capacity of ALG-1 tryptophan-binding pockets mutant to regulate a target of the embryonic mir-35 microRNA family. Thus, our results demonstrate that the microRNA pathway can act independently of GW182 proteins during C. elegans embryogenesis.

Establishment of an efficient virus-induced gene silencing (VIGS) assay in Arabidopsis by Agrobacterium-mediated rubbing infection.

Science.gov (United States)

Manhães, Ana Marcia E de A; de Oliveira, Marcos V V; Shan, Libo

2015-01-01

Several VIGS protocols have been established for high-throughput functional genomic screens as it bypasses the time-consuming and laborious process of generation of transgenic plants. The silencing efficiency in this approach is largely hindered by a technically demanding step in which the first pair of newly emerged true leaves at the 2-week-old stage are infiltrated with a needleless syringe. To further optimize VIGS efficiency and achieve rapid inoculation for a large-scale functional genomic study, here we describe a protocol of an efficient VIGS assay in Arabidopsis using Agrobacterium-mediated rubbing infection. The Agrobacterium inoculation is performed by simply rubbing the leaves with Filter Agent Celite(®) 545. The highly efficient and uniform silencing effect was indicated by the development of a visibly albino phenotype due to silencing of the Cloroplastos alterados 1 (CLA1) gene in the newly emerged leaves. In addition, the albino phenotype could be observed in stems and flowers, indicating its potential application for gene functional studies in the late vegetative development and flowering stages.

AGO6 functions in RNA-mediated transcriptional gene silencing in shoot and root meristems in Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Changho Eun

Full Text Available RNA-directed DNA methylation (RdDM is a small interfering RNA (siRNA-mediated epigenetic modification that contributes to transposon silencing in plants. RdDM requires a complex transcriptional machinery that includes specialized RNA polymerases, named Pol IV and Pol V, as well as chromatin remodelling proteins, transcription factors, RNA binding proteins, and other plant-specific proteins whose functions are not yet clarified. In Arabidopsis thaliana, DICER-LIKE3 and members of the ARGONAUTE4 group of ARGONAUTE (AGO proteins are involved, respectively, in generating and using 24-nt siRNAs that trigger methylation and transcriptional gene silencing of homologous promoter sequences. AGO4 is the main AGO protein implicated in the RdDM pathway. Here we report the identification of the related AGO6 in a forward genetic screen for mutants defective in RdDM and transcriptional gene silencing in shoot and root apical meristems in Arabidopsis thaliana. The identification of AGO6, and not AGO4, in our screen is consistent with the primary expression of AGO6 in shoot and root growing points.

An Optimized Protocol to Increase Virus-Induced Gene Silencing Efficiency and Minimize Viral Symptoms in Petunia

OpenAIRE

Broderick, Shaun R.; Jones, Michelle L.

2013-01-01

Virus-induced gene silencing (VIGS) is used to down-regulate endogenous plant genes. VIGS efficiency depends on viral proliferation and systemic movement throughout the plant. Although tobacco rattle virus (TRV)-based VIGS has been successfully used in petunia (Petunia × hybrida), the protocol has not been thoroughly optimized for efficient and uniform gene down-regulation in this species. Therefore, we evaluated six parameters that improved VIGS in petunia. Inoculation of mechanically wounde...

Stability of RNA silencing-based traits after virus infection

DEFF Research Database (Denmark)

Jørgensen, Bodil; Albrechtsen, Merete

2007-01-01

with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

Virus-Induced Silencing of Key Genes Leads to Differential Impact on Withanolide Biosynthesis in the Medicinal Plant, Withania somnifera.

Science.gov (United States)

Agarwal, Aditya Vikram; Singh, Deeksha; Dhar, Yogeshwar Vikram; Michael, Rahul; Gupta, Parul; Chandra, Deepak; Trivedi, Prabodh Kumar

2018-02-01

Withanolides are a collection of naturally occurring, pharmacologically active, secondary metabolites synthesized in the medicinally important plant, Withania somnifera. These bioactive molecules are C28-steroidal lactone triterpenoids and their synthesis is proposed to take place via the mevalonate (MVA) and 2-C-methyl-d-erythritol-4-phosphate (MEP) pathways through the sterol pathway using 24-methylene cholesterol as substrate flux. Although the phytochemical profiles as well as pharmaceutical activities of Withania extracts have been well studied, limited genomic information and difficult genetic transformation have been a major bottleneck towards understanding the participation of specific genes in withanolide biosynthesis. In this study, we used the Tobacco rattle virus (TRV)-mediated virus-induced gene silencing (VIGS) approach to study the participation of key genes from MVA, MEP and triterpenoid biosynthesis for their involvement in withanolide biosynthesis. TRV-infected W. somnifera plants displayed unique phenotypic characteristics and differential accumulation of total Chl as well as carotenoid content for each silenced gene suggesting a reduction in overall isoprenoid synthesis. Comprehensive expression analysis of putative genes of withanolide biosynthesis revealed transcriptional modulations conferring the presence of complex regulatory mechanisms leading to withanolide biosynthesis. In addition, silencing of genes exhibited modulated total and specific withanolide accumulation at different levels as compared with control plants. Comparative analysis also suggests a major role for the MVA pathway as compared with the MEP pathway in providing substrate flux for withanolide biosynthesis. These results demonstrate that transcriptional regulation of selected Withania genes of the triterpenoid biosynthetic pathway critically affects withanolide biosynthesis, providing new horizons to explore this process further, in planta.

Silencing of vacuolar invertase and asparagine synthetase genes and its impact on acrylamide formation of fried potato products.

Science.gov (United States)

Zhu, Xiaobiao; Gong, Huiling; He, Qunyan; Zeng, Zixian; Busse, James S; Jin, Weiwei; Bethke, Paul C; Jiang, Jiming

2016-02-01

Acrylamide is produced in a wide variety of carbohydrate-rich foods during high-temperature cooking. Dietary acrylamide is a suspected human carcinogen, and health concerns related to dietary acrylamide have been raised worldwide. French fries and potato chips contribute a significant proportion to the average daily intake of acrylamide, especially in developed countries. One way to mitigate health concerns related to acrylamide is to develop potato cultivars that have reduced contents of the acrylamide precursors asparagine, glucose and fructose in tubers. We generated a large number of silencing lines of potato cultivar Russet Burbank by targeting the vacuolar invertase gene VInv and the asparagine synthetase genes StAS1 and StAS2 with a single RNA interference construct. The transcription levels of these three genes were correlated with reducing sugar (glucose and fructose) and asparagine content in tubers. Fried potato products from the best VInv/StAS1/StAS2-triple silencing lines contained only one-fifteenth of the acrylamide content of the controls. Interestingly, the extent of acrylamide reduction of the best triple silencing lines was similar to that of the best VInv-single silencing lines developed previously from the same potato cultivar Russet Burbank. These results show that an acrylamide mitigation strategy focused on developing potato cultivars with low reducing sugars is likely to be an effective and sufficient approach for minimizing the acrylamide-forming potential of French fry processing potatoes. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

TGIF1 Gene Silencing in Tendon-Derived Stem Cells Improves the Tendon-to-Bone Insertion Site Regeneration

Directory of Open Access Journals (Sweden)

Liyang Chen

2015-11-01

Full Text Available Background/Aims: The slow healing process of tendon-to-bone junctions can be accelerated via implanted tendon-derived stem cells (TDSCs with silenced transforming growth interacting factor 1 (TGIF1 gene. Tendon-to-bone insertion site is the special form of connective tissues derivatives of common connective progenitors, where TGF-β plays bidirectional effects (chondrogenic or fibrogenic through different signaling pathways at different stages. A recent study revealed that TGF-β directly induces the chondrogenic gene Sox9. However, TGIF1 represses the expression of the cartilage master Sox9 gene and changes its expression rate against the fibrogenesis gene Scleraxis (Scx. Methods: TGIF1 siRNA was transduced or TGIF1 was over-expressed in tendon-derived stem cells. Following suprapinatus tendon repair, rats were either treated with transduced TDSCs or nontransduced TDSCs. Histologic examination and Western blot were performed in both groups. Results: In this study, the silencing of TGIF1 significantly upregulated the chondrogenic genes and markers. Similarly, TGIF1 inhibited TDSC differentiation into cartilage via interactions with TGF-β-activated Smad2 and suppressed the phosphorylation of Smad2. The area of fibrocartilage at the tendon-bone interface was significantly increased in the TGIF1 (- group compared with the control and TGIF1-overexpressing groups in the early stages of the animal model. The interface between the tendon and bone showed a increase of new bone and fibrocartilage in the TGIF1 (- group at 4 weeks. Fibrovascular scar tissue was observed in the TGIF1-overexpressing group and the fibrin glue only group. Low levels of fibrocartilage and fibrovascular scar tissue were found in the TDSCs group. Conclusion: Collectively, this study shows that the tendon-derived stem cell modified with TGIF1 gene silencing has promising effects on tendon-to-bone healing which can be further explored as a therapeutic tool in regenerative medicine.

Methylation and silencing of the retinoic acid receptor-β2 gene in cervical cancer

International Nuclear Information System (INIS)

Ivanova, Tatyana; Petrenko, Anatolii; Gritsko, Tatyana; Vinokourova, Svetlana; Eshilev, Ernest; Kobzeva, Vera; Kisseljov, Fjodor; Kisseljova, Natalia

2002-01-01

Expression of the retinoic acid receptor β2 (RAR-β2), a putative tumor suppressor gene, is reduced in various human cancers, including squamous cell carcinomas (SCC) of the uterine cervix. The mechanism of the inhibition of RAR-β2 expression remains obscure. We examined whether methylation of RAR-β2 gene could be responsible for this silencing in cervical SCC. Expression of RAR-β2 mRNA and methylation status of the 5' region of RAR-β2 gene were examined in 20 matched specimens from patients with cervical SCC and in three cervical cancer cell lines by Northern blot analysis and methylation-specific PCR (MSP) assay or Southern blot analysis respectively. In 8 out 20 cervical SCC (40%) the levels of RAR-β2 mRNA were decreased or undetectable in comparison with non-neoplastic cervix tissues. All 8 tumors with reduced levels of RAR-β2 mRNA expression showed methylation of the promoter and the first exon expressed in the RAR-β2 transcript. The RAR-β2 gene from non-neoplastic cervical tissues was mostly unmethylated and expressed, but methylated alleles of the gene were found in three samples of the morphologically normal tissues adjacent to the tumors. Three cervical cancer cell lines with extremely low level of RAR-β2 mRNA expression, SiHA, HeLA and CaSki, also showed methylation of this region of the RAR-β2 gene. These findings suggest that methylation of the 5' region of RAR-β2 gene may contribute to gene silencing and that methylation of this region may be an important and early event in cervical carcinogenesis. These findings may be useful to make retinoids more effective as preventive and therapeutic agents in combination with inhibitors of DNA methylation

Genome-wide analysis of immune system genes by EST profiling

Science.gov (United States)

Giallourakis, Cosmas; Benita, Yair; Molinie, Benoit; Cao, Zhifang; Despo, Orion; Pratt, Henry E.; Zukerberg, Lawrence R.; Daly, Mark J.; Rioux, John D.; Xavier, Ramnik J.

2013-01-01

Profiling studies of mRNA and miRNA, particularly microarray-based studies, have been extensively used to create compendia of genes that are preferentially expressed in the immune system. In some instances, functional studies have been subsequently pursued. Recent efforts such as ENCODE have demonstrated the benefit of coupling RNA-Seq analysis with information from expressed sequence tags (ESTs) for transcriptomic analysis. However, the full characterization and identification of transcripts that function as modulators of human immune responses remains incomplete. In this study, we demonstrate that an integrated analysis of human ESTs provides a robust platform to identify the immune transcriptome. Beyond recovering a reference set of immune-enriched genes and providing large-scale cross-validation of previous microarray studies, we discovered hundreds of novel genes preferentially expressed in the immune system, including non-coding RNAs. As a result, we have established the Immunogene database, representing an integrated EST “road map” of gene expression in human immune cells, which can be used to further investigate the function of coding and non-coding genes in the immune system. Using this approach, we have uncovered a unique metabolic gene signature of human macrophages and identified PRDM15 as a novel overexpressed gene in human lymphomas. Thus we demonstrate the utility of EST profiling as a basis for further deconstruction of physiologic and pathologic immune processes. PMID:23616578

A Plant Phytosulfokine Peptide Initiates Auxin-Dependent Immunity through Cytosolic Ca2+ Signaling in Tomato.

Science.gov (United States)

Zhang, Huan; Hu, Zhangjian; Lei, Cui; Zheng, Chenfei; Wang, Jiao; Shao, Shujun; Li, Xin; Xia, Xiaojian; Cai, Xinzhong; Zhou, Jie; Zhou, Yanhong; Yu, Jingquan; Foyer, Christine H; Shi, Kai

2018-03-01

Phytosulfokine (PSK) is a disulfated pentapeptide that is an important signaling molecule. Although it has recently been implicated in plant defenses to pathogen infection, the mechanisms involved remain poorly understood. Using surface plasmon resonance and gene silencing approaches, we showed that the tomato ( Solanum lycopersicum ) PSK receptor PSKR1, rather than PSKR2, functioned as the major PSK receptor in immune responses. Silencing of PSK signaling genes rendered tomato more susceptible to infection by the economically important necrotrophic pathogen Botrytis cinerea Analysis of tomato mutants defective in either defense hormone biosynthesis or signaling demonstrated that PSK-induced immunity required auxin biosynthesis and associated defense pathways. Here, using aequorin-expressing tomato plants, we provide evidence that PSK perception by tomato PSKR1 elevated cytosolic [Ca 2+ ], leading to auxin-dependent immune responses via enhanced binding activity between calmodulins and the auxin biosynthetic YUCs. Thus, our data demonstrate that PSK acts as a damage-associated molecular pattern and is perceived mainly by PSKR1, which increases cytosolic [Ca 2+ ] and activates auxin-mediated pathways that enhance immunity of tomato plants to B. cinerea . © 2018 American Society of Plant Biologists. All rights reserved.

Efficient transformation and artificial miRNA gene silencing in Lemna minor.

Science.gov (United States)

Cantó-Pastor, A; Mollá-Morales, A; Ernst, E; Dahl, W; Zhai, J; Yan, Y; Meyers, B C; Shanklin, J; Martienssen, R

2015-01-01

Despite rapid doubling time, simple architecture and ease of metabolic labelling, a lack of genetic tools in the Lemnaceae (duckweed) has impeded the full implementation of this organism as a model for biological research. Here, we present technologies to facilitate high-throughput genetic studies in duckweed. We developed a fast and efficient method for producing Lemna minor stable transgenic fronds via Agrobacterium-mediated transformation and regeneration from tissue culture. Additionally, we engineered an artificial microRNA (amiRNA) gene silencing system. We identified a Lemna gibba endogenous miR166 precursor and used it as a backbone to produce amiRNAs. As a proof of concept we induced the silencing of CH42, a magnesium chelatase subunit, using our amiRNA platform. Expression of CH42 in transgenic L. minor fronds was significantly reduced, which resulted in reduction of chlorophyll pigmentation. The techniques presented here will enable tackling future challenges in the biology and biotechnology of Lemnaceae. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

Hydrogel-Assisted Antisense LNA Gapmer Delivery for In Situ Gene Silencing in Spinal Cord Injury

DEFF Research Database (Denmark)

Moreno, Pedro M.D.; Ferreira, Ana R.; Salvador, Daniela

2018-01-01

)-modified AON gapmers in combination with a fibrin hydrogel bridging material to induce gene silencing in situ at a SCI lesion site. LNA gapmers were effectively developed against two promising gene targets aiming at enhancing axonal regeneration—RhoA and GSK3β. The fibrin-matrix-assisted AON delivery system......After spinal cord injury (SCI), nerve regeneration is severely hampered due to the establishment of a highly inhibitory microenvironment at the injury site, through the contribution of multiple factors. The potential of antisense oligonucleotides (AONs) to modify gene expression at different levels...

Silencing of a Germin-Like Gene in Nicotiana attenuata Improves Performance of Native Herbivores1[W

Science.gov (United States)

Lou, Yonggen; Baldwin, Ian T.

2006-01-01

Germins and germin-like proteins (GLPs) are known to function in pathogen resistance, but their involvement in defense against insect herbivores is poorly understood. In the native tobacco Nicotiana attenuata, attack from the specialist herbivore Manduca sexta or elicitation by adding larval oral secretions (OS) to wounds up-regulates transcripts of a GLP. To understand the function of this gene, which occurs as a single copy, we cloned the full-length NaGLP and silenced its expression in N. attenuata by expressing a 250-bp fragment in an antisense orientation with an Agrobacterium-based transformation system and by virus-induced gene silencing (VIGS). Homozygous lines harboring a single insert and VIGS plants had significantly reduced constitutive (measured in roots) and elicited NaGLP transcript levels (in leaves). Silencing NaGLP improved M. sexta larval performance and Tupiocoris notatus preference, two native herbivores of N. attenuata. Silencing NaGLP also attenuated the OS-induced hydrogen peroxide (H2O2), diterpene glycosides, and trypsin proteinase inhibitor responses, which may explain the observed susceptibility of antisense or VIGS plants to herbivore attack and increased nicotine contents, but did not influence the OS-elicited jasmonate and salicylate bursts, or the release of the volatile organic compounds (limonene, cis-α-bergamotene, and germacrene-A) that function as an indirect defense. This suggests that NaGLP is involved in H2O2 production and might also be related to ethylene production and/or perception, which in turn influences the defense responses of N. attenuata via H2O2 and ethylene-signaling pathways. PMID:16461381

A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3' untranslated region and intronic cis-elements.

Science.gov (United States)

Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A

2009-11-01

Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var

The known two types of transglutaminases regulate immune and stress responses in white shrimp, Litopenaeus vannamei.

Science.gov (United States)

Chang, Chin-Chyuan; Chang, Hao-Che; Liu, Kuan-Fu; Cheng, Winton

2016-06-01

Transglutaminases (TGs) play critical roles in blood coagulation, immune responses, and other biochemical functions, which undergo post-translational remodeling such as acetylation, phosphorylation and fatty acylation. Two types of TG have been identified in white shrimp, Litopenaeus vannamei, and further investigation on their potential function was conducted by gene silencing in the present study. Total haemocyte count (THC), differential haemocyte count (DHC), phenoloxidase activity, respiratory bursts (release of superoxide anion), superoxide dismutase activity, transglutaminase (TG) activity, haemolymph clotting time, and phagocytic activity and clearance efficiency to the pathogen Vibrio alginolyticus were measured when shrimps were individually injected with diethyl pyrocarbonate-water (DEPC-H2O) or TG dsRNAs. In addition, haemolymph glucose and lactate, and haemocytes crustin, lysozyme, crustacean hyperglycemic hormone (CHH), transglutaminaseI (TGI), transglutaminaseII (TGII) and clotting protein (CP) mRNA expression were determined in the dsRNA injected shrimp under hypothermal stress. Results showed that TG activity, phagocytic activity and clearance efficiency were significantly decreased, but THC, hyaline cells (HCs) and haemolymph clotting time were significantly increased in the shrimp which received LvTGI dsRNA and LvTGI + LvTGII dsRNA after 3 days. However, respiratory burst per haemocyte was significantly decreased in only LvTGI + LvTGII silenced shrimp. In hypothermal stress studies, elevation of haemolymph glucose and lactate was observed in all treated groups, and were advanced in LvTGI and LvTGI + LvTGII silenced shrimp following exposure to 22 °C. LvCHH mRNA expression was significantly up-regulated, but crustin and lysozyme mRNA expressions were significantly down-regulated in LvTGI and LvTGI + LvTGII silenced shrimp; moreover, LvTGII was significantly increased, but LvTGI was significantly decreased in LvTGI silenced shrimp

siRNA-mediated Erc gene silencing suppresses tumor growth in Tsc2 mutant renal carcinoma model.

Science.gov (United States)

Imamura, Osamu; Okada, Hiroaki; Takashima, Yuuki; Zhang, Danqing; Kobayashi, Toshiyuki; Hino, Okio

2008-09-18

Silencing of gene expression by small interfering RNAs (siRNAs) is rapidly becoming a powerful tool for genetic analysis and represents a potential strategy for therapeutic product development. However, there are no reports of systemic delivery of siRNAs for stable treatment except short hairpin RNAs (shRNAs). On the other hand, there are many reports of systemic delivery of siRNAs for transient treatment using liposome carriers and others. With regard to shRNAs, a report showed fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Therefore, we decided to use original siRNA microspheres instead of shRNA for stable treatment of disease. In this study, we designed rat-specific siRNA sequences for Erc/mesothelin, which is a tumor-specific gene expressed in the Eker (Tsc2 mutant) rat model of hereditary renal cancer and confirmed the efficacy of gene silencing in vitro. Then, by using siRNA microspheres, we found that the suppression of Erc/mesothelin caused growth inhibition of Tsc2 mutant renal carcinoma cells in tumor implantation experiments in mice.

Dissecting epigenetic silencing complexity in the mouse lung cancer suppressor gene Cadm1.

Directory of Open Access Journals (Sweden)

Stella Marie Reamon-Buettner

Full Text Available Disease-oriented functional analysis of epigenetic factors and their regulatory mechanisms in aberrant silencing is a prerequisite for better diagnostics and therapy. Yet, the precise mechanisms are still unclear and complex, involving the interplay of several effectors including nucleosome positioning, DNA methylation, histone variants and histone modifications. We investigated the epigenetic silencing complexity in the tumor suppressor gene Cadm1 in mouse lung cancer progenitor cell lines, exhibiting promoter hypermethylation associated with transcriptional repression, but mostly unresponsive to demethylating drug treatments. After predicting nucleosome positions and transcription factor binding sites along the Cadm1 promoter, we carried out single-molecule mapping with DNA methyltransferase M.SssI, which revealed in silent promoters high nucleosome occupancy and occlusion of transcription factor binding sites. Furthermore, M.SssI maps of promoters varied within and among the different lung cancer cell lines. Chromatin analysis with micrococcal nuclease also indicated variations in nucleosome positioning to have implications in the binding of transcription factors near nucleosome borders. Chromatin immunoprecipitation showed that histone variants (H2A.Z and H3.3, and opposing histone modification marks (H3K4me3 and H3K27me3 all colocalized in the same nucleosome positions that is reminiscent of epigenetic plasticity in embryonic stem cells. Altogether, epigenetic silencing complexity in the promoter region of Cadm1 is not only defined by DNA hypermethylation, but high nucleosome occupancy, altered nucleosome positioning, and 'bivalent' histone modifications, also likely contributed in the transcriptional repression of this gene in the lung cancer cells. Our results will help define therapeutic intervention strategies using epigenetic drugs in lung cancer.

Proteinase 3 on apoptotic cells disrupts immune silencing in autoimmune vasculitis

Science.gov (United States)

Millet, Arnaud; Martin, Katherine R.; Bonnefoy, Francis; Saas, Philippe; Mocek, Julie; Alkan, Manal; Terrier, Benjamin; Kerstein, Anja; Tamassia, Nicola; Satyanarayanan, Senthil Kumaran; Ariel, Amiram; Ribeil, Jean-Antoine; Guillevin, Loïc; Cassatella, Marco A.; Mueller, Antje; Thieblemont, Nathalie; Lamprecht, Peter; Mouthon, Luc; Perruche, Sylvain; Witko-Sarsat, Véronique

2015-01-01

Granulomatosis with polyangiitis (GPA) is a systemic necrotizing vasculitis that is associated with granulomatous inflammation and the presence of anti-neutrophil cytoplasmic antibodies (ANCAs) directed against proteinase 3 (PR3). We previously determined that PR3 on the surface of apoptotic neutrophils interferes with induction of antiinflammatory mechanisms following phagocytosis of these cells by macrophages. Here, we demonstrate that enzymatically active membrane-associated PR3 on apoptotic cells triggered secretion of inflammatory cytokines, including granulocyte CSF (G-CSF) and chemokines. This response required the IL-1R1/MyD88 signaling pathway and was dependent on the synthesis of NO, as macrophages from animals lacking these pathways did not exhibit a PR3-associated proinflammatory response. The PR3-induced microenvironment facilitated recruitment of inflammatory cells, such as macrophages, plasmacytoid DCs (pDCs), and neutrophils, which were observed in close proximity within granulomatous lesions in the lungs of GPA patients. In different murine models of apoptotic cell injection, the PR3-induced microenvironment instructed pDC-driven Th9/Th2 cell generation. Concomitant injection of anti-PR3 ANCAs with PR3-expressing apoptotic cells induced a Th17 response, revealing a GPA-specific mechanism of immune polarization. Accordingly, circulating CD4+ T cells from GPA patients had a skewed distribution of Th9/Th2/Th17. These results reveal that PR3 disrupts immune silencing associated with clearance of apoptotic neutrophils and provide insight into how PR3 and PR3-targeting ANCAs promote GPA pathophysiology. PMID:26436651

Inhibition of human esophageal squamous cell carcinomas by targeted silencing of tumor enhancer genes: an overview

International Nuclear Information System (INIS)

Islamian, Jalil Pirayesh; Mohammadi, Mohsen; Baradaran, Behzad

2014-01-01

Esophageal cancer has been reported as the ninth most common malignancy and ranks as the sixth most frequent cause of death worldwide. Esophageal cancer treatment involves surgery, chemotherapy, radiation therapy, or combination therapy. Novel strategies are needed to boost the oncologic outcome. Recent advances in the molecular biology of esophageal cancer have documented the role of genetic alterations in tumorigenesis. Oncogenes serve a pivotal function in tumorigenesis. Targeted therapies are directed at the unique molecular signature of cancer cells for enhanced efficacy with low toxicity. RNA interference (RNAi) technology is a powerful tool for silencing endogenous or exogenous genes in mammalian cells. Related results have shown that targeting oncogenes with siRNAs, specifically the mRNA, effectively reduces tumor cell proliferation and induces apoptotic cell death. This article will briefly review studies on silencing tumor enhancer genes related to the induction of esophageal cancer

Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

International Nuclear Information System (INIS)

Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

2012-01-01

Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

The molecular basis for stability of heterochromatin-mediated silencing in mammals.

Science.gov (United States)

Hiragami-Hamada, Kyoko; Xie, Sheila Q; Saveliev, Alexander; Uribe-Lewis, Santiago; Pombo, Ana; Festenstein, Richard

2009-11-04

The archetypal epigenetic phenomenon of position effect variegation (PEV) in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3), DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac) and lysine 4 di or tri methylation (H3K4me2/3) are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

The molecular basis for stability of heterochromatin-mediated silencing in mammals

Directory of Open Access Journals (Sweden)

Hiragami-Hamada Kyoko

2009-11-01

Full Text Available Abstract The archetypal epigenetic phenomenon of position effect variegation (PEV in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3, DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac and lysine 4 di or tri methylation (H3K4me2/3 are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

Silencing SlMED18, tomato Mediator subunit 18 gene, restricts internode elongation and leaf expansion.

Science.gov (United States)

Wang, Yunshu; Hu, Zongli; Zhang, Jianling; Yu, XiaoHui; Guo, Jun-E; Liang, Honglian; Liao, Changguang; Chen, Guoping

2018-02-19

Mediator complex, a conserved multi-protein, is necessary for controlling RNA polymerase II (Pol II) transcription in eukaryotes. Given little is known about them in tomato, a tomato Mediator subunit 18 gene was isolated and named SlMED18. To further explore the function of SlMED18, the transgenic tomato plants targeting SlMED18 by RNAi-mediated gene silencing were generated. The SlMED18-RNAi lines exhibited multiple developmental defects, including smaller size and slower growth rate of plant and significantly smaller compound leaves. The contents of endogenous bioactive GA 3 in SlMED18 silenced lines were slightly less than that in wild type. Furthermore, qRT-PCR analysis indicated that expression of gibberellins biosynthesis genes such as SlGACPS and SlGA20x2, auxin transport genes (PIN1, PIN4, LAX1 and LAX2) and several key regulators, KNOX1, KNOX2, PHAN and LANCEOLATE(LA), which involved in the leaf morphogenesis were significantly down-regulated in SlMED18-RNAi lines. These results illustrated that SlMED18 plays an essential role in regulating plant internode elongation and leaf expansion in tomato plants and it acts as a key positive regulator of gibberellins biosynthesis and signal transduction as well as auxin proper transport signalling. These findings are the basis for understanding the function of the individual Mediator subunits in tomato.

Apple latent spherical virus vectors for reliable and effective virus-induced gene silencing among a broad range of plants including tobacco, tomato, Arabidopsis thaliana, cucurbits, and legumes

International Nuclear Information System (INIS)

Igarashi, Aki; Yamagata, Kousuke; Sugai, Tomokazu; Takahashi, Yukari; Sugawara, Emiko; Tamura, Akihiro; Yaegashi, Hajime; Yamagishi, Noriko; Takahashi, Tsubasa; Isogai, Masamichi; Takahashi, Hideki; Yoshikawa, Nobuyuki

2009-01-01

Apple latent spherical virus (ALSV) vectors were evaluated for virus-induced gene silencing (VIGS) of endogenous genes among a broad range of plant species. ALSV vectors carrying partial sequences of a subunit of magnesium chelatase (SU) and phytoene desaturase (PDS) genes induced highly uniform knockout phenotypes typical of SU and PDS inhibition on model plants such as tobacco and Arabidopsis thaliana, and economically important crops such as tomato, legume, and cucurbit species. The silencing phenotypes persisted throughout plant growth in these plants. In addition, ALSV vectors could be successfully used to silence a meristem gene, proliferating cell nuclear antigen and disease resistant N gene in tobacco and RCY1 gene in A. thaliana. As ALSV infects most host plants symptomlessly and effectively induces stable VIGS for long periods, the ALSV vector is a valuable tool to determine the functions of interested genes among a broad range of plant species.

Concurrent epigenetic silencing of wnt/β-catenin pathway inhibitor genes in B cell chronic lymphocytic leukaemia

International Nuclear Information System (INIS)

Moskalev, Evgeny A; Pötz, Oliver; Joos, Thomas O; Hoheisel, Jörg D; Luckert, Katrin; Vorobjev, Ivan A; Mastitsky, Sergey E; Gladkikh, Aleena A; Stephan, Achim; Schrenk, Marita; Kaplanov, Kamil D; Kalashnikova, Olga B

2012-01-01

The Wnt/β-catenin signalling is aberrantly activated in primary B cell chronic lymphocytic leukaemia (CLL). Epigenetic silencing of pathway inhibitor genes may be a mechanism for its activation. In this study, we investigated systematically and quantitatively the methylation status of 12 Wnt/β-catenin pathway inhibitor genes – CDH1, DACT1, DKK1, DKK2, DKK3, DKK4, SFRP1, SFRP2, SFRP3, SFRP4, SFRP5 and WIF1 – in the cell lines EHEB and MEC-1 as well as patient samples. Quantification of DNA methylation was performed by means of bisulphite pyrosequencing and confirmed by bisulphite Sanger sequencing. Gene expression was analysed by qPCR using GAPDH as internal control. E-cadherin and β-catenin protein quantification was carried out by microsphere-based immunoassays. Methylation differences observed between the patient and control groups were tested using generalised least squares models. For 10 genes, a higher methylation level was observed in tumour material. Only DKK4 exhibited similarly high methylation levels in both tumour and normal specimens, while DACT1 was always essentially unmethylated. However, also for these inhibitors, treatment of cells with the demethylating agent 5-aza-2´-deoxycytidine resulted in an induction of their expression, as shown by quantitative PCR, suggesting an indirect epigenetic control of activity. While the degree of demethylation and its transcriptional consequences differed between the genes, there was an overall high correlation of demethylation and increased activity. Protein expression studies revealed that no constitutive Wnt/β-catenin signalling occurred in the cell lines, which is in discrepancy with results from primary CLL. However, treatment with 5-aza-2´-deoxycytidine caused accumulation of β-catenin. Simultaneously, E-cadherin expression was strongly induced, leading to the formation of a complex with β-catenin and thus demonstrating its epigenetically regulated inhibition effect. The results suggest an

Chromatin status of apoptosis genes correlates with sensitivity to chemo-, immune- and radiation therapy in colorectal cancer cell lines.

Science.gov (United States)

Benard, Anne; Janssen, Connie M; van den Elsen, Peter J; van Eggermond, Marja C J A; Hoon, Dave S B; van de Velde, Cornelis J H; Kuppen, Peter J K

2014-12-01

The apoptosis pathway of programmed cell death is frequently deregulated in cancer. An intact apoptosis pathway is required for proper response to anti-cancer treatment. We investigated the chromatin status of key apoptosis genes in the apoptosis pathway in colorectal cancer cell lines in relation to apoptosis induced by chemo-, immune- or radiation therapy. Using chromatin immunoprecipitation (ChIP), we measured the presence of transcription-activating histone modifications H3Ac and H3K4me3 and silencing modifications H3K9me3 and H3K27me3 at the gene promoter regions of key apoptosis genes Bax, Bcl2, Caspase-9, Fas (CD95) and p53. Cell lines DLD1, SW620, Colo320, Caco2, Lovo and HT29 were treated with cisplatin, anti-Fas or radiation. The apoptotic response was measured by flow cytometry using propidium iodide and annexin V-FITC. The chromatin status of the apoptosis genes reflected the activation status of the intrinsic (Bax, Bcl2, Caspase-9 and p53) and extrinsic (Fas) pathways. An active intrinsic apoptotic pathway corresponded to sensitivity to cisplatin and radiation treatment of cell lines DLD1, SW620 and Colo320. An active Fas promoter corresponded to an active extrinsic apoptotic pathway in cell line DLD1. mRNA expression data correlated with the chromatin status of the apoptosis genes as measured by ChIP. In conclusion, the results presented in this study indicate that the balance between activating and silencing histone modifications, reflecting the chromatin status of apoptosis genes, can be used to predict the response of tumor cells to different anti-cancer therapies and could provide a novel target to sensitize tumors to obtain adequate treatment responses.

Systematic Evaluation of Promising Clinical Trials-Gene Silencing for the Treatment of Glioblastoma.

Science.gov (United States)

Karaarslan, Numan; Yilmaz, Ibrahim; Ozbek, Hanefi; Caliskan, Tezcan; Topuk, Savas; Sirin, Duygu Yasar; Ates, Ozkan

2018-04-06

The aim of this study was to systematically investigate the role of artificial small interfering RNA (siRNA) molecules in glioblastoma treatment and to give a detailed overview of the literature concerning studies performed in this field worldwide in the last 31 years. Articles about clinical trials conducted between December 1, 1949 and November 8, 2017, were identified from the Cochrane Collaboration, the Cochrane Library, Ovid MEDLINE, ProQuest, the National Library of Medicine, and PubMed electronic databases, using the terms "post transcriptional gene silencing," "small interfering RNA," "siRNA," and "glioblastoma," either individually or combined (\\"OR\\" and \\"AND"), without language and country restrictions. Articles that met the examination criteria were included in the study. After descriptive statistical evaluation, the results were reported in frequency (%). After scanning 2.752 articles, five articles were found that met the research criteria. Examination of full texts of the five identified articles provided no sufficient evidence for research conducted with regard to the use of gene silencing via siRNAs in glioblastoma treatment. To be able to evaluate the clinical use of siRNAs, there is an urgent need for in-vivo studies and for trials with randomized, controlled, and clinical designs that provide long-term functional outcomes.

A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements

Science.gov (United States)

Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.

2009-01-01

Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of

Titration and hysteresis in epigenetic chromatin silencing

International Nuclear Information System (INIS)

Dayarian, Adel; Sengupta, Anirvan M

2013-01-01

Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)

Histone Methylation and Epigenetic Silencing in Breast Cancer

National Research Council Canada - National Science Library

Simon, Jeffrey A; Lange, Carol A

2008-01-01

.... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...

Charged residues in the H-NS linker drive DNA binding and gene silencing in single cells.

Science.gov (United States)

Gao, Yunfeng; Foo, Yong Hwee; Winardhi, Ricksen S; Tang, Qingnan; Yan, Jie; Kenney, Linda J

2017-11-21

Nucleoid-associated proteins (NAPs) facilitate chromosome organization in bacteria, but the precise mechanism remains elusive. H-NS is a NAP that also plays a major role in silencing pathogen genes. We used genetics, single-particle tracking in live cells, superresolution microscopy, atomic force microscopy, and molecular dynamics simulations to examine H-NS/DNA interactions in single cells. We discovered a role for the unstructured linker region connecting the N-terminal oligomerization and C-terminal DNA binding domains. In the present work we demonstrate that linker amino acids promote engagement with DNA. In the absence of linker contacts, H-NS binding is significantly reduced, although no change in chromosome compaction is observed. H-NS is not localized to two distinct foci; rather, it is scattered all around the nucleoid. The linker makes DNA contacts that are required for gene silencing, while chromosome compaction does not appear to be an important H-NS function.

Reactivation of CDX2 in Gastric Cancer as Mark for Gene Silencing Memory

International Nuclear Information System (INIS)

Kameoka, Yuri; Kitazawa, Riko; Ariasu, Kanazu; Tachibana, Ryosuke; Mizuno, Yosuke; Haraguchi, Ryuma; Kitazawa, Sohei

2015-01-01

To explore the epigenetic mechanism that reactivates CDX2 (a homeobox transcription factor that serves as a tumor-suppressor gene) in intestinal-type gastric cancer during cancer progression, we examined the methylation status of the CDX2 gene promoter and the expression pattern of methyl-CpG binding protein-2 (MeCP2). From archives of the pathology records of surgically excised advanced stomach cancer cases in the Department of Molecular Pathology, Ehime University in a past decate (n=265), 10 cases of intestinal-type tubular adenocarcinoma, well-differentiated type (wel) with minor poorly-differentiated adenocarcinoma (por) components were selected. The expression pattern of CDX2, MUC2 and MeCP2 in these 10 cases was analyzed by immunohistochemistry. The cancerous and non-cancerous areas were selectively obtained by microdissection, and the methylation status of the CDX2 promoter of each area was assessed by methylation-specific polymerase chain reaction (MSP). In all 10 cases, CDX2 expression was clearly observed in the nucleus of the non-cancerous background of the intestinal metaplasic area, where the unmethylation pattern of the CDX2 gene promoter prevailed with reduced MeCP2 expression. In this metaplastic area, CDX2 expression was co-localized with its target gene, MUC2. CDX2 expression then disappeared from the deep invasive wel area. Reflecting the reduced CDX2 expression, microdissected samples from all the wel areas showed hypermethylation of the CDX2 gene promoter by MSP, with prominent MeCP2 expression. Interestingly, while hypermethylation of the CDX2 gene promoter was maintained in the por area in 8 of the 10 cases, CDX2 expression was restored in por areas where MeCP2 expression was markedly and selectively reduced. The other two cases, however, showed a constant MeCP2 expression level comparable to the surrounding deep invasive wel area with negative CDX2 expression. Therefore, gene silencing by hypermethylation may be overcome by the reduction of

Identification of an attenuated barley stripe mosaic virus for the virus-induced gene silencing of pathogenesis-related wheat genes.

Science.gov (United States)

Buhrow, Leann M; Clark, Shawn M; Loewen, Michele C

2016-01-01

Virus-induced gene silencing (VIGS) has become an emerging technology for the rapid, efficient functional genomic screening of monocot and dicot species. The barley stripe mosaic virus (BSMV) has been described as an effective VIGS vehicle for the evaluation of genes involved in wheat and barley phytopathogenesis; however, these studies have been obscured by BSMV-induced phenotypes and defense responses. The utility of BSMV VIGS may be improved using a BSMV genetic background which is more tolerable to the host plant especially upon secondary infection of highly aggressive, necrotrophic pathogens such as Fusarium graminearum. BSMV-induced VIGS in Triticum aestivum (bread wheat) cv. 'Fielder' was assessed for the study of wheat genes putatively related to Fusarium Head Blight (FHB), the necrotrophism of wheat and other cereals by F. graminearum. Due to the lack of 'Fielder' spike viability and increased accumulation of Fusarium-derived deoxynivalenol contamination upon co-infection of BSMV and FHB, an attenuated BSMV construct was generated by the addition of a glycine-rich, C-terminal peptide to the BSMV γ b protein. This attenuated BSMV effectively silenced target wheat genes while limiting disease severity, deoxynivalenol contamination, and yield loss upon Fusarium co-infection compared to the original BSMV construct. The attenuated BSMV-infected tissue exhibited reduced abscisic, jasmonic, and salicylic acid defense phytohormone accumulation upon secondary Fusarium infection. Finally, the attenuated BSMV was used to investigate the role of the salicylic acid-responsive pathogenesis-related 1 in response to FHB. The use of an attenuated BSMV may be advantageous in characterizing wheat genes involved in phytopathogenesis, including Fusarium necrotrophism, where minimal viral background effects on defense are required. Additionally, the attenuated BSMV elicits reduced defense hormone accumulation, suggesting that this genotype may have applications for the

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.

Science.gov (United States)

Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

NARCIS (Netherlands)

Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.

Optimisation of tomato Micro-tom regeneration and selection on glufosinate/Basta and dependency of gene silencing on transgene copy number.

Science.gov (United States)

Khuong, Thi Thu Huong; Crété, Patrice; Robaglia, Christophe; Caffarri, Stefano

2013-09-01

An efficient protocol of transformation and selection of transgenic lines of Micro-tom, a widespread model cultivar for tomato, is reported. RNA interference silencing efficiency and stability have been investigated and correlated with the number of insertions. Given its small size and ease of cultivation, the tomato (Solanum lycopersicon) cultivar Micro-tom is of widespread use as a model tomato plant. To create and screen transgenic plants, different selectable markers are commonly used. The bar marker carrying the resistance to the herbicide glufosinate/Basta, has many advantages, but it has been little utilised and with low efficiency for identification of tomato transgenic plants. Here we describe a procedure for accurate selection of transgenic Micro-tom both in vitro and in soil. Immunoblot, Southern blot and phenotypic analyses showed that 100 % of herbicide-resistant plants were transgenic. In addition, regeneration improvement has been obtained by using 2 mg/l Gibberellic acid in the shoot elongation medium; rooting optimisation on medium containing 1 mg/l IAA allowed up to 97 % of shoots developing strong and very healthy roots after only 10 days. Stable transformation frequency by infection of leaf explants with Agrobacterium reached 12 %. Shoots have been induced by combination of 1 mg/l zeatin-trans and 0.1 mg/l IAA. Somatic embryogenesis of cotyledon on medium containing 1 mg/l zeatin + 2 mg/l IAA is described in Micro-tom. The photosynthetic psbS gene has been used as reporter gene for RNA silencing studies. The efficiency of gene silencing has been found equivalent using three different target gene fragments of 519, 398 and 328 bp. Interestingly, silencing efficiency decreased from T0 to the T3 generation in plants containing multiple copies of the inserted T-DNA, while it was stable in plants containing a single insertion.

Gene silencing of beta-catenin in melanoma cells retards their growth but promotes the formation of pulmonary metastasis in mice.

Science.gov (United States)

Takahashi, Yuki; Nishikawa, Makiya; Suehara, Tetsuya; Takiguchi, Naomi; Takakura, Yoshinobu

2008-11-15

Altered expression of beta-catenin, a key component of the Wnt signaling pathway, is involved in a variety of cancers because increased levels of beta-catenin protein are frequently associated with enhanced cellular proliferation. Although our previous study demonstrated that gene silencing of beta-catenin in melanoma B16-BL6 cells by plasmid DNA (pDNA) expressing short-hairpin RNA targeting the gene (pshbeta-catenin) markedly suppressed their growth in vivo, gene silencing of beta-catenin could promote tumor metastasis by the rearranging cell adhesion complex. In this study, we investigated how silencing of beta-catenin affects metastatic aspects of melanoma cells. Transfection of B16-BL6 cells with pshbeta-catenin significantly reduced the amount of cadherin protein, a cell adhesion molecule binding to beta-catenin, with little change in its mRNA level. Cadherin-derived fragments were detected in culture media of B16-BL6 cells transfected with pshbeta-catenin, suggesting that cadherin is shed from the cell surface when the expression of beta-catenin is reduced. The mobility of B16-BL6 cells transfected with pshbeta-catenin was greater than that of cells transfected with any of the control pDNAs. B16-BL6 cells stably transfected with pshbeta-catenin (B16/pshbeta-catenin) formed less or an equal number of tumor nodules in the lung than cells stably transfected with other plasmids when injected into mice via the tail vein. However, when subcutaneously inoculated, B16/pshbeta-catenin cells formed more nodules in the lung than the other stably transfected cells. These results raise concerns about the gene silencing of beta-catenin for inhibiting tumor growth, because it promotes tumor metastasis by reducing the amount of cadherin in tumor cells. (c) 2008 Wiley-Liss, Inc.

Investigations of barley stripe mosaic virus as a gene silencing vector in barley roots and in Brachypodium distachyon and oat

DEFF Research Database (Denmark)

Pacak, Andrzej; Geisler, Katrin; Jørgensen, Bodil

2010-01-01

-expressed genes we wanted to explore the potential of BSMV for silencing genes in root tissues. Furthermore, the newly completed genome sequence of the emerging cereal model species Brachypodium distachyon as well as the increasing amount of EST sequence information available for oat (Avena species) have created...

RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

KAUST Repository

Cernilogar, Filippo M.

2013-06-13

Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

Silence in the Communication or Communicating through Silence: Silence in Psychoanalysis

Directory of Open Access Journals (Sweden)

Rita Marta

2014-10-01

Full Text Available This paper is a reflection upon the meaning and importance of silence in the psychoanalytical relationship. Beginning with the silence in the “normal” relationship between people, we show how silence can be experienced as confortable or unconfortable, and how it can be used to achieve a bigger proximity or distance in the relationship with others. We show these same aspects in the psychoanalytical relationship, and the evolution of the regard towards silence along the development of psychoanalysis. We end, presenting the Nacht’s thinking about silence, who emphasizes its integrative and fundamental role in the psychoanalytical relationship. Thus, only through silence certain affects can be born, and silence allows the patient to internalize the analyst.

Inter-genomic DNA Exchanges and Homeologous Gene Silencing Shaped the Nascent Allopolyploid Coffee Genome (Coffea arabica L.

Directory of Open Access Journals (Sweden)

Philippe Lashermes

2016-09-01

Full Text Available Allopolyploidization is a biological process that has played a major role in plant speciation and evolution. Genomic changes are common consequences of polyploidization, but their dynamics over time are still poorly understood. Coffea arabica, a recently formed allotetraploid, was chosen to study genetic changes that accompany allopolyploid formation. Both RNA-seq and DNA-seq data were generated from two genetically distant C. arabica accessions. Genomic structural variation was investigated using C. canephora, one of its diploid progenitors, as reference genome. The fate of 9047 duplicate homeologous genes was inferred and compared between the accessions. The pattern of SNP density along the reference genome was consistent with the allopolyploid structure. Large genomic duplications or deletions were not detected. Two homeologous copies were retained and expressed in 96% of the genes analyzed. Nevertheless, duplicated genes were found to be affected by various genomic changes leading to homeolog loss or silencing. Genetic and epigenetic changes were evidenced that could have played a major role in the stabilization of the unique ancestral allotetraploid and its subsequent diversification. While the early evolution of C. arabica mainly involved homeologous crossover exchanges, the later stage appears to have relied on more gradual evolution involving gene conversion and homeolog silencing.

The rde-1 gene, RNA interference, and transposon silencing in C. elegans.

Science.gov (United States)

Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C

1999-10-15

Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.

Transient GFP expression in Nicotiana plumbaginifolia suspension cells: the role of gene silencing, cell death and T-DNA loss.

Science.gov (United States)

Weld, R; Heinemann, J; Eady, C

2001-03-01

The transient nature of T-DNA expression was studied with a gfp reporter gene transferred to Nicotiana plumbaginifolia suspension cells from Agrobacterium tumefaciens. Individual GFP-expressing protoplasts were isolated after 4 days' co-cultivation. The protoplasts were cultured without selection and 4 weeks later the surviving proto-calluses were again screened for GFP expression. Of the proto-calluses initially expressing GFP, 50% had lost detectable GFP activity during the first 4 weeks of culture. Multiple T-DNA copies of the gfp gene were detected in 10 of 17 proto-calluses lacking visible GFP activity. The remaining 7 cell lines contained no gfp sequences. Our results confirm that transiently expressed T-DNAs can be lost during growth of somatic cells and demonstrate that transiently expressing cells frequently integrate multiple T-DNAs that become silenced. In cells competent for DNA uptake, cell death and gene silencing were more important barriers to the recovery of stably expressing transformants than lack of T-DNA integration.

Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.

Science.gov (United States)

Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C

2017-09-11

To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.

Double silencing of relevant genes suggests the existence of the direct link between DNA replication/repair and central carbon metabolism in human fibroblasts.

Science.gov (United States)

Wieczorek, Aneta; Fornalewicz, Karolina; Mocarski, Łukasz; Łyżeń, Robert; Węgrzyn, Grzegorz

2018-04-15

Genetic evidence for a link between DNA replication and glycolysis has been demonstrated a decade ago in Bacillus subtilis, where temperature-sensitive mutations in genes coding for replication proteins could be suppressed by mutations in genes of glycolytic enzymes. Then, a strong influence of dysfunctions of particular enzymes from the central carbon metabolism (CCM) on DNA replication and repair in Escherichia coli was reported. Therefore, we asked if such a link occurs only in bacteria or it is a more general phenomenon. Here, we demonstrate that effects of silencing (provoked by siRNA) of expression of genes coding for proteins involved in DNA replication and repair (primase, DNA polymerase ι, ligase IV, and topoisomerase IIIβ) on these processes (less efficient entry into the S phase of the cell cycle and decreased level of DNA synthesis) could be suppressed by silencing of specific genes of enzymes from CMM. Silencing of other pairs of replication/repair and CMM genes resulted in enhancement of the negative effects of lower expression levels of replication/repair genes. We suggest that these results may be proposed as a genetic evidence for the link between DNA replication/repair and CMM in human cells, indicating that it is a common biological phenomenon, occurring from bacteria to humans. Copyright © 2018 Elsevier B.V. All rights reserved.

Assessment of RNAi-induced silencing in banana (Musa spp.).

Science.gov (United States)

Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

2014-09-18

In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

RNA interference silences Microplitis demolitor bracovirus genes and implicates glc1.8 in disruption of adhesion in infected host cells

International Nuclear Information System (INIS)

Beck, Markus; Strand, Michael R.

2003-01-01

The family Polydnaviridae consists of ds-DNA viruses that are symbiotically associated with certain parasitoid wasps. PDVs are transmitted vertically but also are injected by wasps into hosts where they cause several physiological alterations including immunosuppression. The PDV genes responsible for mediating immunosuppression and other host alterations remain poorly characterized in large measure because viral mutants cannot be produced to study gene function. Here we report the use of RNA interference (RNAi) to specifically silence the glc1.8 and egf1.0 genes from Microplitis demolitor bracovirus (MdBV) in High Five cells derived from the lepidopteran Trichoplusia ni. Dose-response studies indicated that MdBV infects High Five cells and blocks the ability of these cells to adhere to culture plates. This response was very similar to what occurs in two classes of hemocytes, granular cells, and plasmatocytes, after infection by MdBV. Screening of monoclonal antibody (mAb) markers that distinguish different classes of lepidopteran hemocytes indicated that High Five cells cross-react with three mAbs that recognize granular cells from T. ni. Double-stranded RNA (dsRNA) complementary to glc1.8 specifically silenced glc1.8 expression and rescued the adhesive phenotype of High Five cells. Reciprocally, dsRNA complementary to egf1.0 silenced egf1.0 expression but had no effect on adhesion. The simplicity and potency of RNAi could be extremely useful for analysis of other PDV genes

An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene.

Science.gov (United States)

Cui, Hongguang; Wang, Aiming

2017-03-01

RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Development of marker-free transgenic Jatropha curcas producing curcin-deficient seeds through endosperm-specific RNAi-mediated gene silencing.

Science.gov (United States)

Gu, Keyu; Tian, Dongsheng; Mao, Huizhu; Wu, Lifang; Yin, Zhongchao

2015-10-08

Jatropha curcas L. is a potential biofuel plant and its seed oil is suitable for biodiesel production. Despite this promising application, jatropha seeds contain two major toxic components, namely phorbol esters and curcins. These compounds would reduce commercial value of seed cake and raise safety and environment concerns on jatropha plantation and processing. Curcins are Type I ribosome inactivating proteins. Several curcin genes have been identified in the jatropha genome. Among which, the Curcin 1 (C1) gene is identified to be specifically expressed in endosperm, whereas the Curcin 2A (C2A) is mainly expressed in young leaves. A marker-free RNAi construct carrying a β-estradiol-regulated Cre/loxP system and a C1 promoter-driven RNAi cassette for C1 gene was made and used to generate marker-free transgenic RNAi plants to specifically silence the C1 gene in the endosperm of J. curcas. Plants of transgenic line L1, derived from T0-1, carry two copies of marker-free RNAi cassette, whereas plants of L35, derived from T0-35, harbored one copy of marker-free RNAi cassette and three copies of closely linked and yet truncated Hpt genes. The C1 protein content in endosperm of L1 and L35 seeds was greatly reduced or undetectable, while the C2A proteins in young leaves of T0-1 and T0-35 plants were unaffected. In addition, the C1 mRNA transcripts were undetectable in the endosperm of T3 seeds of L1 and L35. The results demonstrated that the expression of the C1 gene was specifically down-regulated or silenced by the double-stranded RNA-mediated RNA interference generated from the RNAi cassette. The C1 promoter-driven RNAi cassette for the C1 gene in transgenic plants was functional and heritable. Both C1 transcripts and C1 proteins were greatly down-regulated or silenced in the endosperm of transgenic J. curcas. The marker-free transgenic plants and curcin-deficient seeds developed in this study provided a solution for the toxicity of curcins in jatropha seeds and

HC-Pro silencing suppressor significantly alters the gene expression profile in tobacco leaves and flowers

Directory of Open Access Journals (Sweden)

Lehto Kirsi

2011-04-01

Full Text Available Abstract Background RNA silencing is used in plants as a major defence mechanism against invasive nucleic acids, such as viruses. Accordingly, plant viruses have evolved to produce counter defensive RNA-silencing suppressors (RSSs. These factors interfere in various ways with the RNA silencing machinery in cells, and thereby disturb the microRNA (miRNA mediated endogene regulation and induce developmental and morphological changes in plants. In this study we have explored these effects using previously characterized transgenic tobacco plants which constitutively express (under CaMV 35S promoter the helper component-proteinase (HC-Pro derived from a potyviral genome. The transcript levels of leaves and flowers of these plants were analysed using microarray techniques (Tobacco 4 × 44 k, Agilent. Results Over expression of HC-Pro RSS induced clear phenotypic changes both in growth rate and in leaf and flower morphology of the tobacco plants. The expression of 748 and 332 genes was significantly changed in the leaves and flowers, respectively, in the HC-Pro expressing transgenic plants. Interestingly, these transcriptome alterations in the HC-Pro expressing tobacco plants were similar as those previously detected in plants infected with ssRNA-viruses. Particularly, many defense-related and hormone-responsive genes (e.g. ethylene responsive transcription factor 1, ERF1 were differentially regulated in these plants. Also the expression of several stress-related genes, and genes related to cell wall modifications, protein processing, transcriptional regulation and photosynthesis were strongly altered. Moreover, genes regulating circadian cycle and flowering time were significantly altered, which may have induced a late flowering phenotype in HC-Pro expressing plants. The results also suggest that photosynthetic oxygen evolution, sugar metabolism and energy levels were significantly changed in these transgenic plants. Transcript levels of S

Disruption of plant carotenoid biosynthesis through virus-induced gene silencing affects oviposition behaviour of the butterfly Pieris rapae

NARCIS (Netherlands)

Zheng, S.J.; Snoeren, T.A.L.; Hogewoning, S.W.; Loon, van J.J.A.; Dicke, M.

2010-01-01

Optical plant characteristics are important cues to plant-feeding insects. In this article, we demonstrate for the first time that silencing the phytoene desaturase (PDS) gene, encoding a key enzyme in plant carotenoid biosynthesis, affects insect oviposition site selection behaviour. Virus-induced

MiR-17-92 cluster and immunity.

Science.gov (United States)

Kuo, George; Wu, Chao-Yi; Yang, Huang-Yu

2018-05-29

MicroRNAs (MiR, MiRNA) are small single-stranded non-coding RNAs that play an important role in the regulation of gene expression. MircoRNAs exert their effect by binding to complementary nucleotide sequences of the targeted messenger RNA, thus forming an RNA-induced silencing complex. The mircoRNA-17-92 cluster encoded by the miR-17-92 host gene is first found in malignant B-cell lymphoma. Recent research identifies the miR-17-92 cluster as a crucial player in the development of the immune system, the heart, the lung, and oncogenic events. In light of the miR-17-92 cluster's increasing role in regulating the immune system, our review will discuss the latest knowledge regarding its involvement in cells of both innate and adaptive immunity, including B cells, subsets of T cells such as Th1, Th2, T follicular helper cells, regulatory T cells, monocytes/macrophages, NK cells, and dendritic cells, and the possible targets that are regulated by its members. Copyright © 2018. Published by Elsevier B.V.

Silencing of SARS-CoV spike gene by small interfering RNA in HEK 293T cells

International Nuclear Information System (INIS)

Qin Zhaoling; Zhao Ping; Zhang Xiaolian; Yu Jianguo; Cao Mingmei; Zhao Lanjuan; Luan Jie; Qi Zhongtian

2004-01-01

Two candidate small interfering RNAs (siRNAs) corresponding to severe acute respiratory syndrome-associated coronavirus (SARS-CoV) spike gene were designed and in vitro transcribed to explore the possibility of silencing SARS-CoV S gene. The plasmid pEGFP-optS, which contains the codon-optimized SARS-CoV S gene and expresses spike-EGFP fusion protein (S-EGFP) as silencing target and expressing reporter, was transfected with siRNAs into HEK 293T cells. At various time points of posttransfection, the levels of S-EGFP expression and amounts of spike mRNA transcript were detected by fluorescence microscopy, flow cytometry, Western blot, and real-time quantitative PCR, respectively. The results showed that the cells transfected with pEGFP-optS expressed S-EGFP fusion protein at a higher level compared with those transfected with pEGFP-S, which contains wildtype SARS-CoV spike gene sequence. The green fluorescence, mean fluorescence intensity, and SARS-CoV S RNA transcripts were found significantly reduced, and the expression of SARS-CoV S glycoprotein was strongly inhibited in those cells co-transfected with either EGFP- or S-specific siRNAs. Our findings demonstrated that the S-specific siRNAs used in this study were able to specifically and effectively inhibit SARS-CoV S glycoprotein expression in cultured cells through blocking the accumulation of S mRNA, which may provide an approach for studies on the functions of SARS-CoV S gene and development of novel prophylactic or therapeutic agents for SARS-CoV

RNAi Mediated curcin precursor gene silencing in Jatropha (Jatropha curcas L.).

Science.gov (United States)

Patade, Vikas Yadav; Khatri, Deepti; Kumar, Kamal; Grover, Atul; Kumari, Maya; Gupta, Sanjay Mohan; Kumar, Devender; Nasim, Mohammed

2014-07-01

Curcin, a type I ribosomal inhibiting protein-RIP, encoded by curcin precursor gene, is a phytotoxin present in Jatropha (Jatropha curcas L.). Here, we report designing of RNAi construct for the curcin precursor gene and further its genetic transformation of Jatropha to reduce its transcript expression. Curcin precursor gene was first cloned from Jatropha strain DARL-2 and part of the gene sequence was cloned in sense and antisense orientation separated by an intron sequence in plant expression binary vector pRI101 AN. The construction of the RNAi vector was confirmed by double digestion and nucleotide sequencing. The vector was then mobilized into Agrobacterium tumefaciens strain GV 3101 and used for tissue culture independent in planta transformation protocol optimized for Jatropha. Germinating seeds were injured with a needle before infection with Agrobacterium and then transferred to sterilized sand medium. The seedlings were grown for 90 days and genomic DNA was isolated from leaves for transgenic confirmation based on real time PCR with NPT II specific dual labeled probe. Result of the transgenic confirmation analysis revealed presence of the gene silencing construct in ten out of 30 tested seedlings. Further, quantitative transcript expression analysis of the curcin precursor gene revealed reduction in the transcript abundance by more than 98% to undetectable level. The transgenic plants are being grown in containment for further studies on reduction in curcin protein content in Jatropha seeds.

MLH1-Silenced and Non-Silenced Subgroups of Hypermutated Colorectal Carcinomas Have Distinct Mutational Landscapes

Science.gov (United States)

Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David

2014-01-01

Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370

Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects

International Nuclear Information System (INIS)

Huang, Shang-Lang; Chao, Chuck C.-K.

2015-01-01

A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug

Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects

Energy Technology Data Exchange (ETDEWEB)

Huang, Shang-Lang [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Chao, Chuck C.-K., E-mail: cckchao@mail.cgu.edu.tw [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Graduate Institute of Biomedical Sciences, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Department of Medical Research and Development, Chang Gung Memorial Hospital, Taoyuan 333, Taiwan (China)

2015-06-16

A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug.

Conifers have a unique small RNA silencing signature

OpenAIRE

Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.

2008-01-01

Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...

Targeted transfection increases siRNA uptake and gene silencing of primary endothelial cells in vitro--a quantitative study.

Science.gov (United States)

Asgeirsdóttir, Sigridur A; Talman, Eduard G; de Graaf, Inge A; Kamps, Jan A A M; Satchell, Simon C; Mathieson, Peter W; Ruiters, Marcel H J; Molema, Grietje

2010-01-25

Applications of small-interfering RNA (siRNA) call for specific and efficient delivery of siRNA into particular cell types. We developed a novel, non-viral targeting system to deliver siRNA specifically into inflammation-activated endothelial cells. This was achieved by conjugating the cationic amphiphilic lipid SAINT to antibodies recognizing the inflammatory cell adhesion molecule E-selectin. These anti-E-selectin-SAINT lipoplexes (SAINTarg) maintained antigen recognition capacity of the parental antibody in vitro, and ex vivo in human kidney tissue slices subjected to inflammatory conditions. Regular SAINT mediated transfection resulted in efficient gene silencing in human microvascular endothelial cells (HMEC-1) and conditionally immortalized glomerular endothelial cells (ciGEnC). However, primary human umbilical vein endothelial cells (HUVEC) transfected poorly, a phenomenon that we could quantitatively correlate with a cell-type specific capacity to facilitate siRNA uptake. Importantly, SAINTarg increased siRNA uptake and transfection specificity for activated endothelial cells. Transfection with SAINTarg delivered significantly more siRNA into activated HUVEC, compared to transfection with non-targeted SAINT. The enhanced uptake of siRNA was corroborated by improved silencing of both gene- and protein expression of VE-cadherin in activated HUVEC, indicating that SAINTarg delivered functionally active siRNA into endothelial cells. The obtained results demonstrate a successful design of a small nucleotide carrier system with improved and specific siRNA delivery into otherwise difficult-to-transfect primary endothelial cells, which in addition reduced considerably the amount of siRNA needed for gene silencing. Copyright 2009 Elsevier B.V. All rights reserved.

Silencing of Soybean Raffinose Synthase Gene Reduced Raffinose Family Oligosaccharides and Increased True Metabolizable Energy of Poultry Feed

Directory of Open Access Journals (Sweden)

Michelle F. Valentine

2017-05-01

Full Text Available Soybean [Glycine max (L. Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2, to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets.

Silencing of Soybean Raffinose Synthase Gene Reduced Raffinose Family Oligosaccharides and Increased True Metabolizable Energy of Poultry Feed

Science.gov (United States)

Valentine, Michelle F.; De Tar, Joann R.; Mookkan, Muruganantham; Firman, Jeffre D.; Zhang, Zhanyuan J.

2017-01-01

Soybean [Glycine max (L.) Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2), to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME) in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets. PMID:28559898

Stunned Silence: Gene Expression Programs in Human Cells Infected with Monkeypox or Vaccinia Virus

Science.gov (United States)

Rubins, Kathleen H.; Hensley, Lisa E.; Relman, David A.; Brown, Patrick O.

2011-01-01

Poxviruses use an arsenal of molecular weapons to evade detection and disarm host immune responses. We used DNA microarrays to investigate the gene expression responses to infection by monkeypox virus (MPV), an emerging human pathogen, and Vaccinia virus (VAC), a widely used model and vaccine organism, in primary human macrophages, primary human fibroblasts and HeLa cells. Even as the overwhelmingly infected cells approached their demise, with extensive cytopathic changes, their gene expression programs appeared almost oblivious to poxvirus infection. Although killed (gamma-irradiated) MPV potently induced a transcriptional program characteristic of the interferon response, no such response was observed during infection with either live MPV or VAC. Moreover, while the gene expression response of infected cells to stimulation with ionomycin plus phorbol 12-myristate 13-acetate (PMA), or poly (I-C) was largely unimpaired by infection with MPV, a cluster of pro-inflammatory genes were a notable exception. Poly(I-C) induction of genes involved in alerting the innate immune system to the infectious threat, including TNF-alpha, IL-1 alpha and beta, CCL5 and IL-6, were suppressed by infection with live MPV. Thus, MPV selectively inhibits expression of genes with critical roles in cell-signaling pathways that activate innate immune responses, as part of its strategy for stealthy infection. PMID:21267444

Deletion of an X-inactivation boundary disrupts adjacent gene silencing.

Directory of Open Access Journals (Sweden)

Lindsay M Horvath

2013-11-01

Full Text Available In mammalian females, genes on one X are largely silenced by X-chromosome inactivation (XCI, although some "escape" XCI and are expressed from both Xs. Escapees can closely juxtapose X-inactivated genes and provide a tractable model for assessing boundary function at epigenetically regulated loci. To delimit sequences at an XCI boundary, we examined female mouse embryonic stem cells carrying X-linked BAC transgenes derived from an endogenous escape locus. Previously we determined that large BACs carrying escapee Kdm5c and flanking X-inactivated transcripts are properly regulated. Here we identify two lines with truncated BACs that partially and completely delete the distal Kdm5c XCI boundary. This boundary is not required for escape, since despite integrating into regions that are normally X inactivated, transgenic Kdm5c escapes XCI, as determined by RNA FISH and by structurally adopting an active conformation that facilitates long-range preferential association with other escapees. Yet, XCI regulation is disrupted in the transgene fully lacking the distal boundary; integration site genes up to 350 kb downstream of the transgene now inappropriately escape XCI. Altogether, these results reveal two genetically separable XCI regulatory activities at Kdm5c. XCI escape is driven by a dominant element(s retained in the shortest transgene that therefore lies within or upstream of the Kdm5c locus. Additionally, the distal XCI boundary normally plays an essential role in preventing nearby genes from escaping XCI.

High-Throughput Screening Using iPSC-Derived Neuronal Progenitors to Identify Compounds Counteracting Epigenetic Gene Silencing in Fragile X Syndrome.

Science.gov (United States)

Kaufmann, Markus; Schuffenhauer, Ansgar; Fruh, Isabelle; Klein, Jessica; Thiemeyer, Anke; Rigo, Pierre; Gomez-Mancilla, Baltazar; Heidinger-Millot, Valerie; Bouwmeester, Tewis; Schopfer, Ulrich; Mueller, Matthias; Fodor, Barna D; Cobos-Correa, Amanda

2015-10-01

Fragile X syndrome (FXS) is the most common form of inherited mental retardation, and it is caused in most of cases by epigenetic silencing of the Fmr1 gene. Today, no specific therapy exists for FXS, and current treatments are only directed to improve behavioral symptoms. Neuronal progenitors derived from FXS patient induced pluripotent stem cells (iPSCs) represent a unique model to study the disease and develop assays for large-scale drug discovery screens since they conserve the Fmr1 gene silenced within the disease context. We have established a high-content imaging assay to run a large-scale phenotypic screen aimed to identify compounds that reactivate the silenced Fmr1 gene. A set of 50,000 compounds was tested, including modulators of several epigenetic targets. We describe an integrated drug discovery model comprising iPSC generation, culture scale-up, and quality control and screening with a very sensitive high-content imaging assay assisted by single-cell image analysis and multiparametric data analysis based on machine learning algorithms. The screening identified several compounds that induced a weak expression of fragile X mental retardation protein (FMRP) and thus sets the basis for further large-scale screens to find candidate drugs or targets tackling the underlying mechanism of FXS with potential for therapeutic intervention. © 2015 Society for Laboratory Automation and Screening.

Small RNA-Mediated Epigenetic Myostatin Silencing

Directory of Open Access Journals (Sweden)

Thomas C Roberts

2012-01-01

Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

Epigenetic silencing of the DNA mismatch repair gene, MLH1, induced by hypoxic stress in a pathway dependent on the histone demethylase, LSD1

Science.gov (United States)

Lu, Yuhong; Wajapeyee, Narendra; Turker, Mitchell S.; Glazer, Peter M.

2014-01-01

SUMMARY Silencing of the MLH1 gene is frequently seen in sporadic cancers. We report that hypoxia causes decreased H3K4 methylation at the MLH1 promoter via the H3K4 demethylases, LSD1 and PLU-1, and promotes long-term silencing of the promoter in a pathway that requires LSD1. Knockdown of LSD1 or its co-repressor, CoREST, also prevents the re-silencing (and cytosine DNA methylation) of the endogenous MLH1 promoter in RKO colon cancer cells following transient reactivation by the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (5-aza-dC). The results demonstrate that hypoxia is a critical driving force for silencing of MLH1 through chromatin modification and indicate that the LSD1/CoREST complex is essential for MLH1 silencing. PMID:25043185

Stunned silence: gene expression programs in human cells infected with monkeypox or vaccinia virus.

Directory of Open Access Journals (Sweden)

Kathleen H Rubins

2011-01-01

Full Text Available Poxviruses use an arsenal of molecular weapons to evade detection and disarm host immune responses. We used DNA microarrays to investigate the gene expression responses to infection by monkeypox virus (MPV, an emerging human pathogen, and Vaccinia virus (VAC, a widely used model and vaccine organism, in primary human macrophages, primary human fibroblasts and HeLa cells. Even as the overwhelmingly infected cells approached their demise, with extensive cytopathic changes, their gene expression programs appeared almost oblivious to poxvirus infection. Although killed (gamma-irradiated MPV potently induced a transcriptional program characteristic of the interferon response, no such response was observed during infection with either live MPV or VAC. Moreover, while the gene expression response of infected cells to stimulation with ionomycin plus phorbol 12-myristate 13-acetate (PMA, or poly (I-C was largely unimpaired by infection with MPV, a cluster of pro-inflammatory genes were a notable exception. Poly(I-C induction of genes involved in alerting the innate immune system to the infectious threat, including TNF-alpha, IL-1 alpha and beta, CCL5 and IL-6, were suppressed by infection with live MPV. Thus, MPV selectively inhibits expression of genes with critical roles in cell-signaling pathways that activate innate immune responses, as part of its strategy for stealthy infection.

Update on gene therapy of inherited immune deficiencies.

Science.gov (United States)

Engel, Barbara C; Kohn, Donald B; Podsakoff, Greg M

2003-10-01

Gene therapy has been under development as a way to correct inborn errors for many years. Recently, patients with two forms of inherited severe combined immunodeficiency (SCID), adenosine deaminase and X-linked, treated by three different clinical investigative teams, have shown significant immune reconstitution leading to protective immunity. These advances irrefutably prove the concept that hematopoietic progenitor cell gene therapy can ameliorate these diseases. However, due to proviral insertional oncogenesis, two individuals in one of the X-SCID studies developed T-cell leukemia more than two years after the gene transfer. Depending upon the results of long-term follow-up, the successes together with the side effects highlight the relative merits of this therapeutic approach.

Inhibition of Androgen-Independent Growth of Prostate Cancer by siRNA- Mediated Androgen Receptor Gene Silencing

Science.gov (United States)

2008-02-01

and then photographed using a digital camera . AAV production and infection. To silence AR gene expression, a hairpin- structured expression vector...Sandusky GE, Vessella RL, Neubauer BL. Increased AKT activity contributes to prostate cancer progression by dramatically accelerating prostate tumor...HeNe laser. The spectrograph has an f/2.0 Czerny–Turner imaging spec- trometer plus a thermo-electrically cooled Kodak 0401 CCD camera . The fiberoptic

Synthesis and Gene Silencing Properties of siRNAs Containing Terminal Amide Linkages

Directory of Open Access Journals (Sweden)

Maria Gaglione

2014-01-01

Full Text Available The active components of the RNAi are 21 nucleotides long dsRNAs containing a 2 nucleotide overhang at the 3′ end, carrying 5′-phosphate and 3′-hydroxyl groups (siRNAs. Structural analysis revealed that the siRNA is functionally bound at both ends to RISC. Terminal modifications are considered with interest as the introduction of chemical moieties interferes with the 3′ overhang recognition by the PAZ domain and the 5′-phosphate recognition by the MID and PIWI domains of RISC. Herein, we report the synthesis of modified siRNAs containing terminal amide linkages by introducing hydroxyethylglycine PNA (hegPNA moieties at 5′, and at 3′ positions and on both terminals. Results of gene silencing studies highlight that some of these modifications are compatible with the RNAi machinery and markedly increase the resistance to serum-derived nucleases even after 24 h of incubation. Molecular docking simulations were attained to give at atomistic level a clearer picture of the effect of the most performing modifications on the interactions with the human Argonaute 2 PAZ, MID, and PIWI domains. This study adds another piece to the puzzle of the heterogeneous chemical modifications that can be attained to enhance the silencing efficiency of siRNAs.

RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

KAUST Repository

Cernilogar, Filippo M.; Burroughs, A. Maxwell; Lanzuolo, Chiara; Breiling, Achim; Imhof, Axel; Orlando, Valerio

2013-01-01

.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

Why are parasite contingency genes often associated with telomeres?

Science.gov (United States)

Barry, J D; Ginger, M L; Burton, P; McCulloch, R

2003-01-01

Contingency genes are common in pathogenic microbes and enable, through pre-emptive mutational events, rapid, clonal switches in phenotype that are conducive to survival and proliferation in hosts. Antigenic variation, which is a highly successful survival strategy employed by eubacterial and eukaryotic pathogens, involves large repertoires of distinct contingency genes that are expressed differentially, enabling evasion of host acquired immunity. Most, but not all, antigenic variation systems make extensive use of subtelomeres. Study of model systems has shown that subtelomeres have unusual properties, including reversible silencing of genes mediated by proteins binding to the telomere, and engagement in ectopic recombination with other subtelomeres. There is a general theory that subtelomeric location confers a capacity for gene diversification through such recombination, although experimental evidence is that there is no increased mitotic recombination at such loci and that sequence homogenisation occurs. Possible benefits of subtelomeric location for pathogen contingency systems are reversible gene silencing, which could contribute to systems for gene switching and mutually exclusive expression, and ectopic recombination, leading to gene family diversification. We examine, in several antigenic variation systems, what possible benefits apply.

Gene Expression by PBMC in Primary Sclerosing Cholangitis: Evidence for Dysregulation of Immune Mediated Genes

Directory of Open Access Journals (Sweden)

Christopher A. Aoki

2006-01-01

Full Text Available Primary sclerosing cholangitis (PSC is a chronic disease of the bile ducts characterized by an inflammatory infiltrate and obliterative fibrosis. The precise role of the immune system in the pathogenesis of PSC remains unknown. We used RNA microarray analysis to identify immune-related genes and pathways that are differentially expressed in PSC. Messenger RNA (mRNA from peripheral blood mononuclear cells (PBMC was isolated from both patients with PSC and age and sex matched healthy controls. Samples from 5 PSC patients and 5 controls were analyzed by microarray and based upon rigorous statistical analysis of the data, relevant genes were chosen for confirmation by RT-PCR in 10 PSC patients and 10 controls. Using unsupervised hierarchical clustering, gene expression in PSC was statistically different from our control population. Interestingly, genes within the IL-2 receptor beta, IL-6 and MAP Kinase pathways were found to be differently expressed in patients with PSC compared to controls. Further, individual genes, TNF-α induced protein 6 (TNFaip6 and membrane-spanning 4-domains, subfamily A (ms4a were found to be upregulated in PSC while similar to Mothers against decapentaplegic homolog 5 (SMAD 5 was downregulated. In conclusion, several immune-related pathways and genes were differentially expressed in PSC compared to control patients, giving further evidence that this disease is systemic and immune-mediated.

SAD-3, a Putative Helicase Required for Meiotic Silencing by Unpaired DNA, Interacts with Other Components of the Silencing Machinery

Science.gov (United States)

Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.

2011-01-01

In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347

Silencing of the violaxanthin de-epoxidase gene in the diatom Phaeodactylum tricornutum reduces diatoxanthin synthesis and non-photochemical quenching.

Directory of Open Access Journals (Sweden)

Johann Lavaud

Full Text Available Diatoms are a major group of primary producers ubiquitous in all aquatic ecosystems. To protect themselves from photooxidative damage in a fluctuating light climate potentially punctuated with regular excess light exposures, diatoms have developed several photoprotective mechanisms. The xanthophyll cycle (XC dependent non-photochemical chlorophyll fluorescence quenching (NPQ is one of the most important photoprotective processes that rapidly regulate photosynthesis in diatoms. NPQ depends on the conversion of diadinoxanthin (DD into diatoxanthin (DT by the violaxanthin de-epoxidase (VDE, also called DD de-epoxidase (DDE. To study the role of DDE in controlling NPQ, we generated transformants of P. tricornutum in which the gene (Vde/Dde encoding for DDE was silenced. RNA interference was induced by genetic transformation of the cells with plasmids containing either short (198 bp or long (523 bp antisense (AS fragments or, alternatively, with a plasmid mediating the expression of a self-complementary hairpin-like construct (inverted repeat, IR. The silencing approaches generated diatom transformants with a phenotype clearly distinguishable from wildtype (WT cells, i.e. a lower degree as well as slower kinetics of both DD de-epoxidation and NPQ induction. Real-time PCR based quantification of Dde transcripts revealed differences in transcript levels between AS transformants and WT cells but also between AS and IR transformants, suggesting the possible presence of two different gene silencing mediating mechanisms. This was confirmed by the differential effect of the light intensity on the respective silencing efficiency of both types of transformants. The characterization of the transformants strengthened some of the specific features of the XC and NPQ and confirmed the most recent mechanistic model of the DT/NPQ relationship in diatoms.

Silencing of the Violaxanthin De-Epoxidase Gene in the Diatom Phaeodactylum tricornutum Reduces Diatoxanthin Synthesis and Non-Photochemical Quenching

Science.gov (United States)

Vugrinec, Sascha; Kroth, Peter G.

2012-01-01

Diatoms are a major group of primary producers ubiquitous in all aquatic ecosystems. To protect themselves from photooxidative damage in a fluctuating light climate potentially punctuated with regular excess light exposures, diatoms have developed several photoprotective mechanisms. The xanthophyll cycle (XC) dependent non-photochemical chlorophyll fluorescence quenching (NPQ) is one of the most important photoprotective processes that rapidly regulate photosynthesis in diatoms. NPQ depends on the conversion of diadinoxanthin (DD) into diatoxanthin (DT) by the violaxanthin de-epoxidase (VDE), also called DD de-epoxidase (DDE). To study the role of DDE in controlling NPQ, we generated transformants of P. tricornutum in which the gene (Vde/Dde) encoding for DDE was silenced. RNA interference was induced by genetic transformation of the cells with plasmids containing either short (198 bp) or long (523 bp) antisense (AS) fragments or, alternatively, with a plasmid mediating the expression of a self-complementary hairpin-like construct (inverted repeat, IR). The silencing approaches generated diatom transformants with a phenotype clearly distinguishable from wildtype (WT) cells, i.e. a lower degree as well as slower kinetics of both DD de-epoxidation and NPQ induction. Real-time PCR based quantification of Dde transcripts revealed differences in transcript levels between AS transformants and WT cells but also between AS and IR transformants, suggesting the possible presence of two different gene silencing mediating mechanisms. This was confirmed by the differential effect of the light intensity on the respective silencing efficiency of both types of transformants. The characterization of the transformants strengthened some of the specific features of the XC and NPQ and confirmed the most recent mechanistic model of the DT/NPQ relationship in diatoms. PMID:22629333

Transcriptional Silencing of Retroviral Vectors

DEFF Research Database (Denmark)

Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

1996-01-01

. Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...

Systemic virus-induced gene silencing allows functional characterization of maize genes during biotrophic interaction with Ustilago maydis.

Science.gov (United States)

van der Linde, Karina; Kastner, Christine; Kumlehn, Jochen; Kahmann, Regine; Doehlemann, Gunther

2011-01-01

Infection of maize (Zea mays) plants with the corn smut fungus Ustilago maydis leads to the formation of large tumors on the stem, leaves and inflorescences. In this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed massive and stage-specific changes in host gene expression during disease progression. To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a virus-induced gene silencing (VIGS) system based on the brome mosaic virus (BMV) for maize. Conditions were established that allowed successful U. maydis infection of BMV-preinfected maize plants. This set-up enabled quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (qRT-PCR)-based readout. In proof-of-principle experiments, an U. maydis-induced terpene synthase was shown to negatively regulate disease development while a protein involved in cell death inhibition was required for full virulence of U. maydis. The results suggest that this system is a versatile tool for the rapid identification of maize genes that determine compatibility with U. maydis. © (2010) Max Planck Society. Journal compilation © New Phytologist Trust (2010).

Immuno-Oncology-The Translational Runway for Gene Therapy: Gene Therapeutics to Address Multiple Immune Targets.

Science.gov (United States)

Weß, Ludger; Schnieders, Frank

2017-12-01

Cancer therapy is once again experiencing a paradigm shift. This shift is based on extensive clinical experience demonstrating that cancer cannot be successfully fought by addressing only single targets or pathways. Even the combination of several neo-antigens in cancer vaccines is not sufficient for successful, lasting tumor eradication. The focus has therefore shifted to the immune system's role in cancer and the striking abilities of cancer cells to manipulate and/or deactivate the immune system. Researchers and pharma companies have started to target the processes and cells known to support immune surveillance and the elimination of tumor cells. Immune processes, however, require novel concepts beyond the traditional "single-target-single drug" paradigm and need parallel targeting of diverse cells and mechanisms. This review gives a perspective on the role of gene therapy technologies in the evolving immuno-oncology space and identifies gene therapy as a major driver in the development and regulation of effective cancer immunotherapy. Present challenges and breakthroughs ranging from chimeric antigen receptor T-cell therapy, gene-modified oncolytic viruses, combination cancer vaccines, to RNA therapeutics are spotlighted. Gene therapy is recognized as the most prominent technology enabling effective immuno-oncology strategies.

A chitinase from pacific white shrimp Litopenaeus vannamei involved in immune regulation.

Science.gov (United States)

Niu, Shengwen; Yang, Linwei; Zuo, Hongliang; Zheng, Jiefu; Weng, Shaoping; He, Jianguo; Xu, Xiaopeng

2018-08-01

Chitinases are a group of hydrolytic enzymes that hydrolyze chitin and widely exist in organisms. Studies in mammals have demonstrated that chitinases play important roles in regulation of humoral and cellular immune responses. In arthropods, although it is well known that chitinases are involved in growth, molting and development, the current knowledge on the role of chitinases in immunity, especially in immune regulation, remains largely unknown. In this study, a chitinase (LvChi5) from Litopenaeus vannamei was representatively selected for studying its immune function. The start codon of LvChi5 was corrected by 5'RACE analysis and its protein sequence was reanalyzed. LvChi5 contains a catalytic domain and a chitin binding domain and shows no inhibitory effect on growth of bacteria in vitro. However, in vivo experiments demonstrated that silencing of LvChi5 increased the mortality of shrimp infected with white spot syndrome virus (WSSV) and Vibro parahaemolyticus and significantly upregulated the load of pathogens in tissues. The expression of various immune related genes, including transcription factors, antimicrobial peptides and other functional proteins with antibacterial and antiviral activities, was widely changed in LvChi5 silencing shrimp. Moreover, the recombinant LvChi5 protein could enhance the phagocytic activity of hemocytes against bacteria. These suggested that shrimp chitinase could play a role in regulation of both humoral and cellular immune responses in shrimp. Copyright © 2018 Elsevier Ltd. All rights reserved.

Simultaneous silencing of two arginine decarboxylase genes alters development in Arabidopsis

Directory of Open Access Journals (Sweden)

Diana eSánchez-Rangel

2016-03-01

Full Text Available Polyamines (PAs are small aliphatic polycations that are found ubiquitously in all organisms. In plants, PAs are involved in diverse biological processes such as growth, development, and stress responses. In Arabidopsis thaliana, the arginine decarboxylase enzymes (ADC1 and 2 catalyze the first step of PA biosynthesis. For a better understanding of PA biological functions, mutants in PA biosynthesis have been generated; however, the double adc1/adc2 mutant is not viable in A. thaliana. In this study, we generated non-lethal A. thaliana lines through an artificial microRNA that simultaneously silenced the two ADC genes (amiR:ADC. The generated transgenic lines (amiR:ADC-L1 and -L2 showed reduced AtADC1 and AtADC2 transcript levels. For further analyses the amiR:ADC-L2 line was selected. We found that the amiR:ADC-L2 line showed a significant decrease of their PA levels. The co-silencing revealed a stunted growth in A. thaliana seedlings, plantlets and delay in its flowering rate; these phenotypes were reverted with PA treatment. In addition, amiR:ADC-L2 plants displayed two seed phenotypes, such as yellow and brownish seeds. The yellow mutant seeds were smaller than adc1, adc2 mutants and wild type seeds; however, the brownish were the smallest seeds with arrested embryos at the torpedo stage. These data reinforce the importance of PA homeostasis in the plant development processes.

Involvement of activation of PKR in HBx-siRNA-mediated innate immune effects on HBV inhibition.

Directory of Open Access Journals (Sweden)

Qiuju Han

Full Text Available RNA interference (RNAi of virus-specific genes offers the possibility of developing a new anti-hepatitis B virus (anti-HBV therapy. Recent studies have revealed that siRNAs can induce an innate immune response in vitro and in vivo. Here, HBVx (HBx mRNA expression and HBV replication were significantly inhibited, followed by the enhancement of expression of type I interferons (IFNs, IFN-stimulated genes (ISG15 and ISG56 and proinflammatory cytokines after HepG2.2.15 cells were transfected with chemically synthesized HBx-siRNAs. Transfection with HBx-siRNAs also significantly increased expression of dsRNA-dependent protein kinase R (PKR in HepG2.2.15 cells, followed by activation of downstream signaling events such as eukaryotic initiation factor 2α (eIF2-α. In PKR-over-expressing HepG2.2.15 cells, HBx-siRNAs exerted more potent inhibitory effects on HBV replication and greater production of type I IFNs. By contrast, the inhibitory effect of HBx-siRNAs on HBV replication was attenuated when PKR was inhibited or silenced, demonstrating that HBx-siRNAs greatly promoted PKR activation, leading to the higher production of type I IFN. Therefore, we concluded that PKR is involved in the innate immune effects mediated by HBx-siRNAs and further contributes to HBV inhibition. The bifunctional siRNAs with both gene silencing and innate immune activation properties may represent a new potential strategy for treatment of HBV.

Changing expression of vertebrate immunity genes in an anthropogenic environment: a controlled experiment.

Science.gov (United States)

Hablützel, Pascal I; Brown, Martha; Friberg, Ida M; Jackson, Joseph A

2016-09-01

The effect of anthropogenic environments on the function of the vertebrate immune system is a problem of general importance. For example, it relates to the increasing rates of immunologically-based disease in modern human populations and to the desirability of identifying optimal immune function in domesticated animals. Despite this importance, our present understanding is compromised by a deficit of experimental studies that make adequately matched comparisons between wild and captive vertebrates. We transferred post-larval fishes (three-spined sticklebacks), collected in the wild, to an anthropogenic (captive) environment. We then monitored, over 11 months, how the systemic expression of immunity genes changed in comparison to cohort-matched wild individuals in the originator population (total n = 299). We found that a range of innate (lyz, defbl2, il1r-like, tbk1) and adaptive (cd8a, igmh) immunity genes were up-regulated in captivity, accompanied by an increase in expression of the antioxidant enzyme, gpx4a. For some genes previously known to show seasonality in the wild, this appeared to be reduced in captive fishes. Captive fishes tended to express immunity genes, including igzh, foxp3b, lyz, defbl2, and il1r-like, more variably. Furthermore, although gene co-expression patterns (analyzed through gene-by-gene correlations and mutual information theory based networks) shared common structure in wild and captive fishes, there was also significant divergence. For one gene in particular, defbl2, high expression was associated with adverse health outcomes in captive fishes. Taken together, these results demonstrate widespread regulatory changes in the immune system in captive populations, and that the expression of immunity genes is more constrained in the wild. An increase in constitutive systemic immune activity, such as we observed here, may alter the risk of immunopathology and contribute to variance in health in vertebrate populations exposed to

Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing

Directory of Open Access Journals (Sweden)

Elisabeth H. Vollmann

2017-06-01

Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.

The identification of immune genes in the milk transcriptome of the Tasmanian devil (Sarcophilus harrisii

Directory of Open Access Journals (Sweden)

Rehana V. Hewavisenti

2016-01-01

Full Text Available Tasmanian devil (Sarcophilus harrisii pouch young, like other marsupials, are born underdeveloped and immunologically naïve, and are unable to mount an adaptive immune response. The mother’s milk provides nutrients for growth and development as well as providing passive immunity. To better understand immune response in this endangered species, we set out to characterise the genes involved in passive immunity by sequencing and annotating the transcriptome of a devil milk sample collected during mid-lactation. At mid-lactation we expect the young to have heightened immune responses, as they have emerged from the pouch, encountering new pathogens. A total of 233,660 transcripts were identified, including approximately 17,827 unique protein-coding genes and 846 immune genes. The most highly expressed transcripts were dominated by milk protein genes such as those encoding early lactation protein, late lactation proteins, α-lactalbumin, α-casein and β-casein. There were numerous highly expressed immune genes including lysozyme, whey acidic protein, ferritin and major histocompatibility complex I and II. Genes encoding immunoglobulins, antimicrobial peptides, chemokines and immune cell receptors were also identified. The array of immune genes identified in this study reflects the importance of the milk in providing immune protection to Tasmanian devil young and provides the first insight into Tasmanian devil milk.

Microarray expression analysis of genes involved in innate immune memory in peritoneal macrophages

Directory of Open Access Journals (Sweden)

Keisuke Yoshida

2016-03-01

Full Text Available Immunological memory has been believed to be a feature of the adaptive immune system for long period, but recent reports suggest that the innate immune system also exhibits memory-like reaction. Although evidence of innate immune memory is accumulating, no in vivo experimental data has clearly implicated a molecular mechanism, or even a cell-type, for this phenomenon. In this study of data deposited into Gene Expression Omnibus (GEO under GSE71111, we analyzed the expression profile of peritoneal macrophages isolated from mice pre-administrated with toll-like receptor (TLR ligands, mimicking pathogen infection. In these macrophages, increased expression of a group of innate immunity-related genes was sustained over a long period of time, and these genes overlapped with ATF7-regulated genes. We conclude that ATF7 plays an important role in innate immune memory in macrophages. Keywords: Macrophage, ATF7, Innate immune memory, Microarray

Induction of innate immune genes in brain create the neurobiology of addiction.

Science.gov (United States)

Crews, F T; Zou, Jian; Qin, Liya

2011-06-01

Addiction occurs through repeated abuse of drugs that progressively reduce behavioral control and cognitive flexibility while increasing limbic negative emotion. Recent discoveries indicate neuroimmune signaling underlies addiction and co-morbid depression. Low threshold microglia undergo progressive stages of innate immune activation involving astrocytes and neurons with repeated drug abuse, stress, and/or cell damage signals. Increased brain NF-κB transcription of proinflammatory chemokines, cytokines, oxidases, proteases, TLR and other genes create loops amplifying NF-κB transcription and innate immune target gene expression. Human post-mortem alcoholic brain has increased NF-κB and NF-κB target gene message, increased microglial markers and chemokine-MCP1. Polymorphisms of human NF-κB1 and other innate immune genes contribute to genetic risk for alcoholism. Animal transgenic and genetic studies link NF-κB innate immune gene expression to alcohol drinking. Human drug addicts show deficits in behavioral flexibility modeled pre-clinically using reversal learning. Binge alcohol, chronic cocaine, and lesions link addiction neurobiology to frontal cortex, neuroimmune signaling and loss of behavioral flexibility. Addiction also involves increasing limbic negative emotion and depression-like behavior that is reflected in hippocampal neurogenesis. Innate immune activation parallels loss of neurogenesis and increased depression-like behavior. Protection against loss of neurogenesis and negative affect by anti-oxidant, anti-inflammatory, anti-depressant, opiate antagonist and abstinence from ethanol dependence link limbic affect to changes in innate immune signaling. The hypothesis that innate immune gene induction underlies addiction and affective disorders creates new targets for therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

Phenotypic silencing of cytoplasmic genes using sequence-specific double-stranded short interfering RNA and its application in the reverse genetics of wild type negative-strand RNA viruses

Directory of Open Access Journals (Sweden)

Barik Sailen

2001-12-01

Full Text Available Abstract Background Post-transcriptional gene silencing (PTGS by short interfering RNA has opened up new directions in the phenotypic mutation of cellular genes. However, its efficacy on non-nuclear genes and its effect on the interferon pathway remain unexplored. Since directed mutation of RNA genomes is not possible through conventional mutagenesis, we have tested sequence-specific 21-nucleotide long double-stranded RNAs (dsRNAs for their ability to silence cytoplasmic RNA genomes. Results Short dsRNAs were generated against specific mRNAs of respiratory syncytial virus, a nonsegmented negative-stranded RNA virus with a cytoplasmic life cycle. At nanomolar concentrations, the dsRNAs specifically abrogated expression of the corresponding viral proteins, and produced the expected mutant phenotype ex vivo. The dsRNAs did not induce an interferon response, and did not inhibit cellular gene expression. The ablation of the viral proteins correlated with the loss of the specific mRNAs. In contrast, viral genomic and antigenomic RNA, which are encapsidated, were not directly affected. Conclusions Synthetic inhibitory dsRNAs are effective in specific silencing of RNA genomes that are exclusively cytoplasmic and transcribed by RNA-dependent RNA polymerases. RNA-directed RNA gene silencing does not require cloning, expression, and mutagenesis of viral cDNA, and thus, will allow the generation of phenotypic null mutants of specific RNA viral genes under normal infection conditions and at any point in the infection cycle. This will, for the first time, permit functional genomic studies, attenuated infections, reverse genetic analysis, and studies of host-virus signaling pathways using a wild type RNA virus, unencumbered by any superinfecting virus.

Growth inhibition of head and neck squamous cell carcinoma cells by sgRNA targeting the cyclin D1 mRNA based on TRUE gene silencing.

Directory of Open Access Journals (Sweden)

Satoshi Iizuka

Full Text Available Head and neck squamous cell carcinoma (HNSCC exhibits increased expression of cyclin D1 (CCND1. Previous studies have shown a correlation between poor prognosis of HNSCC and cyclin D1 overexpression. tRNase ZL-utilizing efficacious gene silencing (TRUE gene silencing is one of the RNA-mediated gene expression control technologies that have therapeutic potential. This technology is based on a unique enzymatic property of mammalian tRNase ZL, which is that it can cleave any target RNA at any desired site by recognizing a pre-tRNA-like complex formed between the target RNA and an artificial small guide RNA (sgRNA. In this study, we designed several sgRNAs targeting human cyclin D1 mRNA to examine growth inhibition of HNSCC cells. Transfection of certain sgRNAs decreased levels of cyclin D1 mRNA and protein in HSC-2 and HSC-3 cells, and also inhibited their proliferation. The combination of these sgRNAs and cisplatin showed more than additive inhibition of cancer cell growth. These findings demonstrate that TRUE gene silencing of cyclin D1 leads to inhibition of the growth of HNSCC cells and suggest that these sgRNAs alone or combined with cisplatin may be a useful new therapy for HNSCCs.

Disruption of prefoldin-2 protein synthesis in root-knot nematodes via host-mediated gene silencing efficiently reduces nematode numbers and thus protects plants.

Science.gov (United States)

Ajjappala, Hemavathi; Chung, Ha Young; Sim, Joon-Soo; Choi, Inchan; Hahn, Bum-Soo

2015-03-01

The aim of this study is to demonstrate the feasibility of down-regulating endogeneous prefoldin-2 root-knot nematode transcripts by expressing dsRNA with sequence identity to the nematode gene in tobacco roots under the influence of strong Arabidopsis ubiquitin (UBQ1) promoter. Root-knot nematodes (RKNs) are sedentary endoparasites infecting a wide range of plant species. They parasitise the root system, thereby disrupting water and nutrient uptake and causing major reductions in crop yields. The most reliable means of controlling RKNs is via the use of soil fumigants such as methyl bromide. With the emergence of RNA interference (RNAi) technology, which permits host-mediated nematode gene silencing, a new strategy to control plant pathogens has become available. In the present study, we investigated host-induced RNAi gene silencing of prefoldin-2 in transgenic Nicotiana benthamiana. Reductions in prefoldin-2 mRNA transcript levels were observed when nematodes were soaked in a dsRNA solution in vitro. Furthermore, nematode reproduction was suppressed in RNAi transgenic lines, as evident by reductions in the numbers of root knots (by 34-60 % in independent RNAi lines) and egg masses (by 33-58 %). Endogenous expression of prefoldin-2, analysed via real-time polymerase chain reaction and Western blotting, revealed that the gene was strongly expressed in the pre-parasitic J2 stage. Our observations demonstrate the relevance and potential importance of targeting the prefoldin gene during the nematode life cycle. The work also suggests that further improvements in silencing efficiency in economically important crops can be accomplished using RNAi directed against plant-parasitic nematodes.

MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts

Science.gov (United States)

Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng

2014-01-01

Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645

MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.

Directory of Open Access Journals (Sweden)

Bushuai Zhong

Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.

Discovering Host Genes Involved in the Infection by the Tomato Yellow Leaf Curl Virus Complex and in the Establishment of Resistance to the Virus Using Tobacco Rattle Virus-based Post Transcriptional Gene Silencing

Directory of Open Access Journals (Sweden)

Rosa Lozano-Durán

2013-03-01

Full Text Available The development of high-throughput technologies allows for evaluating gene expression at the whole-genome level. Together with proteomic and metabolomic studies, these analyses have resulted in the identification of plant genes whose function or expression is altered as a consequence of pathogen attacks. Members of the Tomato yellow leaf curl virus (TYLCV complex are among the most important pathogens impairing production of agricultural crops worldwide. To understand how these geminiviruses subjugate plant defenses, and to devise counter-measures, it is essential to identify the host genes affected by infection and to determine their role in susceptible and resistant plants. We have used a reverse genetics approach based on Tobacco rattle virus-induced gene silencing (TRV-VIGS to uncover genes involved in viral infection of susceptible plants, and to identify genes underlying virus resistance. To identify host genes with a role in geminivirus infection, we have engineered a Nicotiana benthamiana line, coined 2IRGFP, which over-expresses GFP upon virus infection. With this system, we have achieved an accurate description of the dynamics of virus replication in space and time. Upon silencing selected N. benthamiana genes previously shown to be related to host response to geminivirus infection, we have identified eighteen genes involved in a wide array of cellular processes. Plant genes involved in geminivirus resistance were studied by comparing two tomato lines: one resistant (R, the other susceptible (S to the virus. Sixty-nine genes preferentially expressed in R tomatoes were identified by screening cDNA libraries from infected and uninfected R and S genotypes. Out of the 25 genes studied so far, the silencing of five led to the total collapse of resistance, suggesting their involvement in the resistance gene network. This review of our results indicates that TRV-VIGS is an exquisite reverse genetics tool that may provide new insights into the

Identification of the TaBTF3 gene in wheat (Triticum aestivum L.) and the effect of its silencing on wheat chloroplast, mitochondria and mesophyll cell development.

Science.gov (United States)

Ma, Hong-Zhen; Liu, Guo-Qin; Li, Cheng-Wei; Kang, Guo-Zhang; Guo, Tian-Cai

2012-10-05

The full-length cDNA (882bp) and DNA (1742bp) sequences encoding a basic transcription factor 3, designated as TaBTF3, were first isolated from common wheat (Triticum aestivum L.). Subcellular localization studies revealed that the TaBTF3 protein was mainly located in the cytoplasm and nucleus. In TaBTF3-silenced transgenic wheat seedlings obtained using the Virus-induced gene silencing (VIGS) method, the chlorophyll pigment content was markedly reduced. However, the malonaldehyde (MDA) and H(2)O(2) contents were enhanced, and the structure of the wheat mesophyll cell was seriously damaged. Furthermore, transcripts of the chloroplast- and mitochondrial-encoded genes were significantly reduced in TaBTF3-silenced transgenic wheat plants. These results suggest that the TaBTF3 gene might function in the development of the wheat chloroplast, mitochondria and mesophyll cell. This paper is the first report to describe the involvement of TaBTF3 in maintaining the normal plant mesophyll cell structure. Copyright © 2012 Elsevier Inc. All rights reserved.

Effective gene silencing activity of prodrug-type 2'-O-methyldithiomethyl siRNA compared with non-prodrug-type 2'-O-methyl siRNA.

Science.gov (United States)

Hayashi, Junsuke; Nishigaki, Misa; Ochi, Yosuke; Wada, Shun-Ichi; Wada, Fumito; Nakagawa, Osamu; Obika, Satoshi; Harada-Shiba, Mariko; Urata, Hidehito

2018-07-01

Small interfering RNAs (siRNAs) are an active agent to induce gene silencing and they have been studied for becoming a biological and therapeutic tool. Various 2'-O-modified RNAs have been extensively studied to improve the nuclease resistance. However, the 2'-O-modified siRNA activities were often decreased by modification, since the bulky 2'-O-modifications inhibit to form a RNA-induced silencing complex (RISC). We developed novel prodrug-type 2'-O-methyldithiomethyl (MDTM) siRNA, which is converted into natural siRNA in an intracellular reducing environment. Prodrug-type 2'-O-MDTM siRNAs modified at the 5'-end side including 5'-end nucleotide and the seed region of the antisense strand exhibited much stronger gene silencing effect than non-prodrug-type 2'-O-methyl (2'-O-Me) siRNAs. Furthermore, the resistances for nuclease digestion of siRNAs were actually enhanced by 2'-O-MDTM modifications. Our results indicate that 2'-O-MDTM modifications improve the stability of siRNA in serum and they are able to be introduced at any positions of siRNA. Copyright © 2018 Elsevier Ltd. All rights reserved.

Analysis of immune-related genes during Nora virus infection of Drosophila melanogaster using next generation sequencing.

Science.gov (United States)

Lopez, Wilfredo; Page, Alexis M; Carlson, Darby J; Ericson, Brad L; Cserhati, Matyas F; Guda, Chittibabu; Carlson, Kimberly A

2018-01-01

Drosophila melanogaster depends upon the innate immune system to regulate and combat viral infection. This is a complex, yet widely conserved process that involves a number of immune pathways and gene interactions. In addition, expression of genes involved in immunity are differentially regulated as the organism ages. This is particularly true for viruses that demonstrate chronic infection, as is seen with Nora virus. Nora virus is a persistent non-pathogenic virus that replicates in a horizontal manner in D. melanogaster . The genes involved in the regulation of the immune response to Nora virus infection are largely unknown. In addition, the temporal response of immune response genes as a result of infection has not been examined. In this study, D. melanogaster either infected with Nora virus or left uninfected were aged for 2, 10, 20 and 30 days. The RNA from these samples was analyzed by next generation sequencing (NGS) and the resulting immune-related genes evaluated by utilizing both the PANTHER and DAVID databases, as well as comparison to lists of immune related genes and FlyBase. The data demonstrate that Nora virus infected D. melanogaster exhibit an increase in immune related gene expression over time. In addition, at day 30, the data demonstrate that a persistent immune response may occur leading to an upregulation of specific immune response genes. These results demonstrate the utility of NGS in determining the potential immune system genes involved in Nora virus replication, chronic infection and involvement of antiviral pathways.

Gene silencing of HPV16 E6/E7 induced by promoter-targeting siRNA in SiHa cells

OpenAIRE

Hong, D; Lu, W; Ye, F; Hu, Y; Xie, X

2009-01-01

Background: Recently, transcriptional gene silencing induced by small interfering RNA (siRNA) was found in mammalian and human cells. However, previous studies focused on endogenous genes. Methods: In this study, we designed siRNA targeting the promoter of human papillomavirus 16 E6/E7 and transfected it into the cervical cancer cell line, SiHa. E6 and E7 mRNA and protein expression were detected in cells treated by promoter-targeting siRNA. Futhermore, cellular growth, proliferation, apoptos...

ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

Directory of Open Access Journals (Sweden)

de Souza Emanuel M

2009-03-01

Full Text Available Abstract Background ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. Methods First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP. Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. Results The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM; tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC was 76.2% compared with 25.5% in invasive ductal carcinoma

ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

International Nuclear Information System (INIS)

Seniski, Gerusa G; Zanata, Silvio M; Costa, Fabrício F; Klassen, Giseli; Camargo, Anamaria A; Ierardi, Daniela F; Ramos, Edneia AS; Grochoski, Mariana; Ribeiro, Enilze SF; Cavalli, Iglenir J; Pedrosa, Fabio O; Souza, Emanuel M de

2009-01-01

ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR) treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP). Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR) demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM); tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC) was 76.2% compared with 25.5% in invasive ductal carcinoma (IDC), and this difference was

Surface functionalisation of PLGA nanoparticles for gene silencing

DEFF Research Database (Denmark)

Andersen, Morten Østergaard; Lichawska, Agata; Arpanaei, Ayyoob

2010-01-01

. In addition, particles containing cetylated-PEI achieved 64% silencing of TNFα in J774.1 cells. This rapid method for surface modification of PLGA nanoparticles promotes its application for alternative cetylated functional derivatives as a strategy to control specific biological properties of nanoparticles....

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

OpenAIRE

Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...

RNA silencing is required for Arabidopsis defence against Verticillium wilt disease

NARCIS (Netherlands)

Ellendorff, U.; Fradin, E.F.; Jonge, de R.; Thomma, B.P.H.J.

2009-01-01

RNA silencing is a conserved mechanism in eukaryotes that plays an important role in various biological processes including regulation of gene expression. RNA silencing also plays a role in genome stability and protects plants against invading nucleic acids such as transgenes and viruses. Recently,

Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots.

Science.gov (United States)

Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T

2014-12-01

Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.

Identification and gene-silencing of a putative odorant receptor transcription factor in Varroa destructor: possible role in olfaction.

Science.gov (United States)

Singh, N K; Eliash, N; Stein, I; Kamer, Y; Ilia, Z; Rafaeli, A; Soroker, V

2016-04-01

The ectoparasitic mite Varroa destructor is one of the major threats to apiculture. Using a behavioural choice bioassay, we determined that phoretic mites were more successful in reaching a bee than reproductive mites, suggesting an energy trade-off between reproduction and host selection. We used both chemo-ecological and molecular strategies to identify the regulation of the olfactory machinery of Varroa and its association with reproduction. We focused on transcription regulation. Using primers designed to the conserved DNA binding region of transcription factors, we identified a gene transcript in V. destructor homologous to the pheromone receptor transcription factor (PRTF) gene of Pediculus humanus corporis. Quantitative PCR (qPCR) revealed that this PRTF-like gene transcript is expressed in the forelegs at higher levels than in the body devoid of forelegs. Subsequent comparative qPCR analysis showed that transcript expression was significantly higher in the phoretic as compared to the reproductive stage. Electrophysiological and behavioural studies revealed a reduction in the sensitivity of PRTF RNA interference-silenced mites to bee headspace, consistent with a reduction in the mites' ability to reach a host. In addition, vitellogenin expression was stimulated in PRTF-silenced mites to similar levels as found in reproductive mites. These data shed light upon the regulatory mechanism of host chemosensing in V. destructor. © 2016 The Royal Entomological Society.

The immune gene repertoire of an important viral reservoir, the Australian black flying fox

Directory of Open Access Journals (Sweden)

Papenfuss Anthony T

2012-06-01

Full Text Available Abstract Background Bats are the natural reservoir host for a range of emerging and re-emerging viruses, including SARS-like coronaviruses, Ebola viruses, henipaviruses and Rabies viruses. However, the mechanisms responsible for the control of viral replication in bats are not understood and there is little information available on any aspect of antiviral immunity in bats. Massively parallel sequencing of the bat transcriptome provides the opportunity for rapid gene discovery. Although the genomes of one megabat and one microbat have now been sequenced to low coverage, no transcriptomic datasets have been reported from any bat species. In this study, we describe the immune transcriptome of the Australian flying fox, Pteropus alecto, providing an important resource for identification of genes involved in a range of activities including antiviral immunity. Results Towards understanding the adaptations that have allowed bats to coexist with viruses, we have de novo assembled transcriptome sequence from immune tissues and stimulated cells from P. alecto. We identified about 18,600 genes involved in a broad range of activities with the most highly expressed genes involved in cell growth and maintenance, enzyme activity, cellular components and metabolism and energy pathways. 3.5% of the bat transcribed genes corresponded to immune genes and a total of about 500 immune genes were identified, providing an overview of both innate and adaptive immunity. A small proportion of transcripts found no match with annotated sequences in any of the public databases and may represent bat-specific transcripts. Conclusions This study represents the first reported bat transcriptome dataset and provides a survey of expressed bat genes that complement existing bat genomic data. In addition, these data provide insight into genes relevant to the antiviral responses of bats, and form a basis for examining the roles of these molecules in immune response to viral infection.

Candidate innate immune system gene expression in the ecological model Daphnia.

Science.gov (United States)

Decaestecker, Ellen; Labbé, Pierrick; Ellegaard, Kirsten; Allen, Judith E; Little, Tom J

2011-10-01

The last ten years have witnessed increasing interest in host-pathogen interactions involving invertebrate hosts. The invertebrate innate immune system is now relatively well characterised, but in a limited range of genetic model organisms and under a limited number of conditions. Immune systems have been little studied under real-world scenarios of environmental variation and parasitism. Thus, we have investigated expression of candidate innate immune system genes in the water flea Daphnia, a model organism for ecological genetics, and whose capacity for clonal reproduction facilitates an exceptionally rigorous control of exposure dose or the study of responses at many time points. A unique characteristic of the particular Daphnia clones and pathogen strain combinations used presently is that they have been shown to be involved in specific host-pathogen coevolutionary interactions in the wild. We choose five genes, which are strong candidates to be involved in Daphnia-pathogen interactions, given that they have been shown to code for immune effectors in related organisms. Differential expression of these genes was quantified by qRT-PCR following exposure to the bacterial pathogen Pasteuria ramosa. Constitutive expression levels differed between host genotypes, and some genes appeared to show correlated expression. However, none of the genes appeared to show a major modification of expression level in response to Pasteuria exposure. By applying knowledge from related genetic model organisms (e.g. Drosophila) to models for the study of evolutionary ecology and coevolution (i.e. Daphnia), the candidate gene approach is temptingly efficient. However, our results show that detection of only weak patterns is likely if one chooses target genes for study based on previously identified genome sequences by comparison to homologues from other related organisms. Future work on the Daphnia-Pasteuria system will need to balance a candidate gene approach with more comprehensive

Altered immunity in crowded locust reduced fungal (Metarhizium anisopliae pathogenesis.

Directory of Open Access Journals (Sweden)

Yundan Wang

2013-01-01

Full Text Available The stress of living conditions, similar to infections, alters animal immunity. High population density is empirically considered to induce prophylactic immunity to reduce the infection risk, which was challenged by a model of low connectivity between infectious and susceptible individuals in crowded animals. The migratory locust, which exhibits polyphenism through gregarious and solitary phases in response to population density and displays different resistance to fungal biopesticide (Metarhizium anisopliae, was used to observe the prophylactic immunity of crowded animals. We applied an RNA-sequencing assay to investigate differential expression in fat body samples of gregarious and solitary locusts before and after infection. Solitary locusts devoted at least twice the number of genes for combating M. anisopliae infection than gregarious locusts. The transcription of immune molecules such as pattern recognition proteins, protease inhibitors, and anti-oxidation proteins, was increased in prophylactic immunity of gregarious locusts. The differentially expressed transcripts reducing gregarious locust susceptibility to M. anisopliae were confirmed at the transcriptional and translational level. Further investigation revealed that locust GNBP3 was susceptible to proteolysis while GNBP1, induced by M. anisopliae infection, resisted proteolysis. Silencing of gnbp3 by RNAi significantly shortened the life span of gregarious locusts but not solitary locusts. By contrast, gnbp1 silencing did not affect the life span of both gregarious and solitary locusts after M. anisopliae infection. Thus, the GNBP3-dependent immune responses were involved in the phenotypic resistance of gregarious locusts to fungal infection, but were redundant in solitary locusts. Our results indicated that gregarious locusts prophylactically activated upstream modulators of immune cascades rather than downstream effectors, preferring to quarantine rather than eliminate pathogens to

Identification of immune response-related genes in the Chinese oak silkworm, Antheraea pernyi by suppression subtractive hybridization.

Science.gov (United States)

Liu, Qiu-Ning; Zhu, Bao-Jian; Wang, Lei; Wei, Guo-Qing; Dai, Li-Shang; Lin, Kun-Zhang; Sun, Yu; Qiu, Jian-Feng; Fu, Wei-Wei; Liu, Chao-Liang

2013-11-01

Insects possess an innate immune system that responds to invading microorganisms. In this study, a subtractive cDNA library was constructed to screen for immune response-related genes in the fat bodies of Antheraea pernyi (Lepidoptera: Saturniidae) pupa challenged with Escherichia coli. Four hundred putative EST clones were identified by suppression subtractive hybridization (SSH), including 50 immune response-related genes, three cytoskeleton genes, eight cell cycle and apoptosis genes, five respiration and energy metabolism genes, five transport genes, 40 metabolism genes, ten stress response genes, four transcription and translation regulation genes and 77 unknown genes. To verify the reliability of the SSH data, the transcription of a set of randomly selected immune response-related genes were confirmed by semi-quantitative reverse transcription-PCR (RT-PCR) and real-time quantitative reverse transcription-PCR (qRT-PCR). These identified immune response-related genes provide insight into understanding the innate immunity in A. pernyi. Copyright © 2013 Elsevier Inc. All rights reserved.

Virus-induced Gene Silencing-based Functional Analyses Revealed the Involvement of Several Putative Trehalose-6-Phosphate Synthase/Phosphatase Genes in Disease Resistance against Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000 in Tomato

Directory of Open Access Journals (Sweden)

Huijuan Zhang

2016-08-01

Full Text Available Trehalose and its metabolism have been demonstrated to play important roles in control of plant growth, development and stress responses. However, direct genetic evidence supporting the functions of trehalose and its metabolism in defense response against pathogens is lacking. In the present study, genome-wide characterization of putative trehalose-related genes identified 11 SlTPSs for trehalose-6-phosphate synthase, 8 SlTPPs for trehalose-6-phosphate phosphatase and one SlTRE1 for trehalase in tomato genome. Nine SlTPSs, 4 SlTPPs and SlTRE1 were selected for functional analyses to explore their involvement in tomato disease resistance. Some selected SlTPSs, SlTPPs and SlTRE1 responded with distinct expression induction patterns to Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst DC3000 as well as to defense signaling hormones (e.g. salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-mediated silencing of SlTPS3, SlTPS4 or SlTPS7 led to deregulation of ROS accumulation and attenuated the expression of defense-related genes upon pathogen infection and thus deteriorated the resistance against B. cinerea or Pst DC3000. By contrast, silencing of SlTPS5 or SlTPP2 led to an increased expression of the defense-related genes upon pathogen infection and conferred an increased resistance against Pst DC3000. Silencing of SlTPS3, SlTPS4, SlTPS5, SlTPS7 or SlTPP2 affected trehalose level in tomato plants with or without infection of B. cinerea or Pst DC3000. These results demonstrate that SlTPS3, SlTPS4, SlTPS5, SlTPS7 and SlTPP2 play roles in resistance against B. cinerea and Pst DC3000, implying the importance of trehalose and tis metabolism in regulation of defense response against pathogens in tomato.

Silence multiple

DEFF Research Database (Denmark)

Søndergaard, Katia Dupret

The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...

Identifying genes that mediate anthracyline toxicity in immune cells

Directory of Open Access Journals (Sweden)

Amber eFrick

2015-04-01

Full Text Available The role of the immune system in response to chemotherapeutic agents remains elusive. The interpatient variability observed in immune and chemotherapeutic cytotoxic responses is likely, at least in part, due to complex genetic differences. Through the use of a panel of genetically diverse mouse inbred strains, we developed a drug screening platform aimed at identifying genes underlying these chemotherapeutic cytotoxic effects on immune cells. Using genome-wide association studies (GWAS, we identified four genome-wide significant quantitative trait loci (QTL that contributed to the sensitivity of doxorubicin and idarubicin in immune cells. Of particular interest, a locus on chromosome 16 was significantly associated with cell viability following idarubicin administration (p = 5.01x10-8. Within this QTL lies App, which encodes amyloid beta precursor protein. Comparison of dose-response curves verified that T-cells in App knockout mice were more sensitive to idarubicin than those of C57BL/6J control mice (p < 0.05.In conclusion, the cellular screening approach coupled with GWAS led to the identification and subsequent validation of a gene involved in T-cell viability after idarubicin treatment. Previous studies have suggested a role for App in in vitro and in vivo cytotoxicity to anticancer agents; the overexpression of App enhances resistance, while the knockdown of this gene is deleterious to cell viability. Thus, further investigations should include performing mechanistic studies, validating additional genes from the GWAS, including Ppfia1 and Ppfibp1, and ultimately translating the findings to in vivo and human studies.

PhOBF1, a petunia ocs element binding factor, plays an important role in antiviral RNA silencing.

Science.gov (United States)

Sun, Daoyang; Li, Shaohua; Niu, Lixin; Reid, Michael S; Zhang, Yanlong; Jiang, Cai-Zhong

2017-02-01

Virus-induced gene silencing (VIGS) is a common reverse genetics strategy for characterizing the function of genes in plants. The detailed mechanism governing RNA silencing efficiency triggered by viruses is largely unclear. Here, we reveal that a petunia (Petunia hybrida) ocs element binding factor, PhOBF1, one of the basic leucine zipper (bZIP) transcription factors, was up-regulated by Tobacco rattle virus (TRV) infection. Simultaneous silencing of PhOBF1 and a reporter gene, phytoene desaturase (PDS) or chalcone synthase (CHS), by TRV-based VIGS led to a failure of the development of leaf photobleaching or the white-corollas phenotype. PhOBF1 silencing caused down-regulation of RNA silencing-related genes, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonautes (AGOs). After inoculation with the TRV-PhPDS, PhOBF1-RNAi lines exhibited a substantially impaired PDS silencing efficiency, whereas overexpression of PhOBF1 resulted in a recovery of the silencing phenotype (photobleaching) in systemic leaves. A compromised resistance to TRV and Tobacco mosaic virus was found in PhOBF1-RNAi lines, while PhOBF1-overexpressing lines displayed an enhanced resistance to their infections. Compared with wild-type plants, PhOBF1-silenced plants accumulated lower levels of free salicylic acid (SA), salicylic acid glucoside, and phenylalanine, contrarily to higher levels of those in plants overexpressing PhOBF1. Furthermore, transcripts of a number of genes associated with the shikimate and phenylpropanoid pathways were decreased or increased in PhOBF1-RNAi or PhOBF1-overexpressing lines, respectively. Taken together, the data suggest that PhOBF1 regulates TRV-induced RNA silencing efficiency through modulation of RDRs, DCLs, and AGOs mediated by the SA biosynthesis pathway. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Decreasing erucic acid level by RNAi-mediated silencing of fatty ...

African Journals Online (AJOL)

To develop low level of erucic acid in rapeseeds by intron-spliced hairpin RNA, an inverted repeat unit of a partial BnFAE1.1 gene interrupted by a spliceable intron ... In conclusion, the expression of endogenous BnFAE1.1 was efficiently silenced by the designed RNAi silencer, causing a significant down-regulation in the ...

Identification of immunity related genes to study the Physalis peruviana--Fusarium oxysporum pathosystem.

Science.gov (United States)

Enciso-Rodríguez, Felix E; González, Carolina; Rodríguez, Edwin A; López, Camilo E; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

2013-01-01

The Cape gooseberry (Physalisperuviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P. peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC-NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance.

Identification of immunity related genes to study the Physalis peruviana--Fusarium oxysporum pathosystem.

Directory of Open Access Journals (Sweden)

Felix E Enciso-Rodríguez

Full Text Available The Cape gooseberry (Physalisperuviana L is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site, CC (Coiled-Coil, TIR (Toll/Interleukin-1 Receptor. We identified 74 immunity related gene candidates in P. peruviana which have the typical resistance gene (R-gene architecture, 17 Receptor like kinase (RLKs candidates related to PAMP-Triggered Immunity (PTI, eight (TIR-NBS-LRR, or TNL and nine (CC-NBS-LRR, or CNL candidates related to Effector-Triggered Immunity (ETI genes among others. These candidate genes were categorized by molecular function (98%, biological process (85% and cellular component (79% using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance.

CXCL12 gene silencing down-regulates metastatic potential via blockage of MAPK/PI3K/AP-1 signaling pathway in colon cancer.

Science.gov (United States)

Ma, J; Su, H; Yu, B; Guo, T; Gong, Z; Qi, J; Zhao, X; Du, J

2018-01-05

To investigate the effect of CXCL12 gene silencing on proliferation,invasion, angiogenesis and the relationship of MAPK/PI3K/AP-1 signaling pathway in colon cancer cells. RT-PCR and Western-blot were used to detect the expression of CXCL12 mRNA and protein in four colon cancer cell lines. Human colon cancer cells were transfected with CXCL12 siRNA carrying by Lipofectamine 2000. The expression of CXCL12 protein was confirmed by immunoblotting. WST-1, invasion and angiogenesis assay were used to examine the effect on proliferation, invasion and angiogenesis in colon cancer cells after CXCL12 siRNA silence, respectively. The phosphorylation of MAPK/PI3K/AP-1 protein levels was detected by Western blotting in CXCL12 siRNA suppression DLD-1 cell. CXCL12 mRNA and proteins were only expressed in DLD-1 colon cancer cell lines. CXCL12 siRNA were transfected into DLD-1 cells, the expression CXCL12 proteins was significantly inhibited (P colon cancer cell. The silencing CXCL12 gene significantly inhibits the proliferation, invasion and angiogenesis ability of some types colon carcinoma cells through down-regulation of MAPK/PI3K/AP-1 signaling pathway.

Antisense targeting of 3' end elements involved in DUX4 mRNA processing is an efficient therapeutic strategy for facioscapulohumeral dystrophy: a new gene-silencing approach.

Science.gov (United States)

Marsollier, Anne-Charlotte; Ciszewski, Lukasz; Mariot, Virginie; Popplewell, Linda; Voit, Thomas; Dickson, George; Dumonceaux, Julie

2016-04-15

Defects in mRNA 3'end formation have been described to alter transcription termination, transport of the mRNA from the nucleus to the cytoplasm, stability of the mRNA and translation efficiency. Therefore, inhibition of polyadenylation may lead to gene silencing. Here, we choose facioscapulohumeral dystrophy (FSHD) as a model to determine whether or not targeting key 3' end elements involved in mRNA processing using antisense oligonucleotide drugs can be used as a strategy for gene silencing within a potentially therapeutic context. FSHD is a gain-of-function disease characterized by the aberrant expression of the Double homeobox 4 (DUX4) transcription factor leading to altered pathogenic deregulation of multiple genes in muscles. Here, we demonstrate that targeting either the mRNA polyadenylation signal and/or cleavage site is an efficient strategy to down-regulate DUX4 expression and to decrease the abnormally high-pathological expression of genes downstream of DUX4. We conclude that targeting key functional 3' end elements involved in pre-mRNA to mRNA maturation with antisense drugs can lead to efficient gene silencing and is thus a potentially effective therapeutic strategy for at least FSHD. Moreover, polyadenylation is a crucial step in the maturation of almost all eukaryotic mRNAs, and thus all mRNAs are virtually eligible for this antisense-mediated knockdown strategy. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Global Screening of Antiviral Genes that Suppress Baculovirus Transgene Expression in Mammalian Cells.

Science.gov (United States)

Wang, Chia-Hung; Naik, Nenavath Gopal; Liao, Lin-Li; Wei, Sung-Chan; Chao, Yu-Chan

2017-09-15

Although baculovirus has been used as a safe and convenient gene delivery vector in mammalian cells, baculovirus-mediated transgene expression is less effective in various mammalian cell lines. Identification of the negative regulators in host cells is necessary to improve baculovirus-based expression systems. Here, we performed high-throughput shRNA library screening, targeting 176 antiviral innate immune genes, and identified 43 host restriction factor genes in a human A549 lung carcinoma cell line. Among them, suppression of receptor interaction protein kinase 1 (RIP1, also known as RIPK1) significantly increased baculoviral transgene expression without resulting in significant cell death. Silencing of RIP1 did not affect viral entry or cell viability, but it did inhibit nuclear translocation of the IRF3 and NF-κB transcription factors. Also, activation of downstream signaling mediators (such as TBK1 and IRF7) was affected, and subsequent interferon and cytokine gene expression levels were abolished. Further, Necrostatin-1 (Nec-1)-an inhibitor of RIP1 kinase activity-dramatically increased baculoviral transgene expression in RIP1-silenced cells. Using baculovirus as a model system, this study presents an initial investigation of large numbers of human cell antiviral innate immune response factors against a "nonadaptive virus." In addition, our study has made baculovirus a more efficient gene transfer vector for some of the most frequently used mammalian cell systems.

Specific gene expression responses to parasite genotypes reveal redundancy of innate immunity in vertebrates.

Directory of Open Access Journals (Sweden)

David Haase

Full Text Available Vertebrate innate immunity is the first line of defense against an invading pathogen and has long been assumed to be largely unspecific with respect to parasite/pathogen species. However, recent phenotypic evidence suggests that immunogenetic variation, i.e. allelic variability in genes associated with the immune system, results in host-parasite genotype-by-genotype interactions and thus specific innate immune responses. Immunogenetic variation is common in all vertebrate taxa and this reflects an effective immunological function in complex environments. However, the underlying variability in host gene expression patterns as response of innate immunity to within-species genetic diversity of macroparasites in vertebrates is unknown. We hypothesized that intra-specific variation among parasite genotypes must be reflected in host gene expression patterns. Here we used high-throughput RNA-sequencing to examine the effect of parasite genotypes on gene expression patterns of a vertebrate host, the three-spined stickleback (Gasterosteus aculeatus. By infecting naïve fish with distinct trematode genotypes of the species Diplostomum pseudospathaceum we show that gene activity of innate immunity in three-spined sticklebacks depended on the identity of an infecting macroparasite genotype. In addition to a suite of genes indicative for a general response against the trematode we also find parasite-strain specific gene expression, in particular in the complement system genes, despite similar infection rates of single clone treatments. The observed discrepancy between infection rates and gene expression indicates the presence of alternative pathways which execute similar functions. This suggests that the innate immune system can induce redundant responses specific to parasite genotypes.

Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins

Directory of Open Access Journals (Sweden)

Marcio Hedil

2016-07-01

Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.

Science.gov (United States)

Hedil, Marcio; Kormelink, Richard

2016-07-23

The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

Silencing of acidic pathogenesis-related PR-1 genes increases extracellular beta-(1 -> 3)-glucanase activity at the onset of tobacco defence reactions

DEFF Research Database (Denmark)

Riviere, M.P.; Marais, A.; Ponchet, M.

2008-01-01

silenced. Plants lacking extracellular PR-1s were more susceptible than wild-type plants to the oomycete Phytophthora parasitica but displayed unaffected systemic acquired resistance and developmental resistance to this pathogen. Treatment with salicylic acid up-regulates the PR-1g gene, encoding a basic...... protein of the PR-1 family, in PR-1-deficient tobacco, indicating that PR-1 expression may repress that of PR-1g. This shows that acidic PR-1s are dispensable for expression of salicylic acid-dependent acquired resistances against P. parasitica and may reveal a functional overlap in tobacco defence......The class 1 pathogenesis-related (PR) proteins are thought to be involved in plant defence responses, but their molecular functions are unknown. The function of PR-1 was investigated in tobacco by generating stable PR-1a-silenced lines in which other acidic PR-1 genes (PR-1b and PR-1c) were...

SiRNAs conjugated with aromatic compounds induce RISC-mediated antisense strand selection and strong gene-silencing activity

Energy Technology Data Exchange (ETDEWEB)

Kubo, Takanori, E-mail: kubo-t@yasuda-u.ac.jp [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan); Yanagihara, Kazuyoshi [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan); Division of Genetics, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Takei, Yoshifumi [Department of Biochemistry, Nagoya University Graduate School of Medicine, 65 Tsurumi-cho, Showa-ku, Nagoya 466-8550 (Japan); Mihara, Keichiro [Department of Hematology and Oncology, Research Institute for Radiation Biology and Medicine, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8553 (Japan); Sato, Yuichiro; Seyama, Toshio [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan)

2012-10-05

Highlights: Black-Right-Pointing-Pointer SiRNAs conjugated with aromatic compounds (Ar-siRNAs) at 5 Prime -sense strand were synthesized. Black-Right-Pointing-Pointer Ar-siRNAs increased resistance against nuclease degradation. Black-Right-Pointing-Pointer Ar-siRNAs were thermodynamically stable compared with the unmodified siRNA. Black-Right-Pointing-Pointer High levels of cellular uptake and cytoplasmic localization were found. Black-Right-Pointing-Pointer Strong gene-silencing efficacy was exhibited in the Ar-siRNAs. -- Abstract: Short interference RNA (siRNA) is a powerful tool for suppressing gene expression in mammalian cells. In this study, we focused on the development of siRNAs conjugated with aromatic compounds in order to improve the potency of RNAi and thus to overcome several problems with siRNAs, such as cellular delivery and nuclease stability. The siRNAs conjugated with phenyl, hydroxyphenyl, naphthyl, and pyrenyl derivatives showed strong resistance to nuclease degradation, and were thermodynamically stable compared with unmodified siRNA. A high level of membrane permeability in HeLa cells was also observed. Moreover, these siRNAs exhibited enhanced RNAi efficacy, which exceeded that of locked nucleic acid (LNA)-modified siRNAs, against exogenous Renilla luciferase in HeLa cells. In particular, abundant cytoplasmic localization and strong gene-silencing efficacy were found in the siRNAs conjugated with phenyl and hydroxyphenyl derivatives. The novel siRNAs conjugated with aromatic compounds are promising candidates for a new generation of modified siRNAs that can solve many of the problems associated with RNAi technology.

PfSETvs methylation of histone H3K36 represses virulence genes in Plasmodium falciparum

DEFF Research Database (Denmark)

Jiang, Lubin; Mu, Jianbing; Zhang, Qingfeng

2013-01-01

The variant antigen Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1), which is expressed on the surface of P. falciparum-infected red blood cells, is a critical virulence factor for malaria. Each parasite has 60 antigenically distinct var genes that each code for a different PfEMP1...... parasite nuclei and their expression as proteins on the surface of individual infected red blood cells. PfSETvs-dependent H3K36me3 is present along the entire gene body, including the transcription start site, to silence var genes. With low occupancy of PfSETvs at both the transcription start site of var...... protein. During infection the clonal parasite population expresses only one gene at a time before switching to the expression of a new variant antigen as an immune-evasion mechanism to avoid the host antibody response. The mechanism by which 59 of the 60 var genes are silenced remains largely unknown...

An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing

DEFF Research Database (Denmark)

Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria

2016-01-01

/2 12 min (naked) to t1/2 45 min (single cholesteryl) and t1/2 71 min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing......HSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies...

Genome-wide RNAi screen reveals a new role of a WNT/CTNNB1 signaling pathway as negative regulator of virus-induced innate immune responses.

Science.gov (United States)

Baril, Martin; Es-Saad, Salwa; Chatel-Chaix, Laurent; Fink, Karin; Pham, Tram; Raymond, Valérie-Ann; Audette, Karine; Guenier, Anne-Sophie; Duchaine, Jean; Servant, Marc; Bilodeau, Marc; Cohen, Eric; Grandvaux, Nathalie; Lamarre, Daniel

2013-01-01

To identify new regulators of antiviral innate immunity, we completed the first genome-wide gene silencing screen assessing the transcriptional response at the interferon-β (IFNB1) promoter following Sendai virus (SeV) infection. We now report a novel link between WNT signaling pathway and the modulation of retinoic acid-inducible gene I (RIG-I)-like receptor (RLR)-dependent innate immune responses. Here we show that secretion of WNT2B and WNT9B and stabilization of β-catenin (CTNNB1) upon virus infection negatively regulate expression of representative inducible genes IFNB1, IFIT1 and TNF in a CTNNB1-dependent effector mechanism. The antiviral response is drastically reduced by glycogen synthase kinase 3 (GSK3) inhibitors but restored in CTNNB1 knockdown cells. The findings confirm a novel regulation of antiviral innate immunity by a canonical-like WNT/CTNNB1 signaling pathway. The study identifies novel avenues for broad-spectrum antiviral targets and preventing immune-mediated diseases upon viral infection.

Genome-wide RNAi screen reveals a new role of a WNT/CTNNB1 signaling pathway as negative regulator of virus-induced innate immune responses.

Directory of Open Access Journals (Sweden)

Martin Baril

Full Text Available To identify new regulators of antiviral innate immunity, we completed the first genome-wide gene silencing screen assessing the transcriptional response at the interferon-β (IFNB1 promoter following Sendai virus (SeV infection. We now report a novel link between WNT signaling pathway and the modulation of retinoic acid-inducible gene I (RIG-I-like receptor (RLR-dependent innate immune responses. Here we show that secretion of WNT2B and WNT9B and stabilization of β-catenin (CTNNB1 upon virus infection negatively regulate expression of representative inducible genes IFNB1, IFIT1 and TNF in a CTNNB1-dependent effector mechanism. The antiviral response is drastically reduced by glycogen synthase kinase 3 (GSK3 inhibitors but restored in CTNNB1 knockdown cells. The findings confirm a novel regulation of antiviral innate immunity by a canonical-like WNT/CTNNB1 signaling pathway. The study identifies novel avenues for broad-spectrum antiviral targets and preventing immune-mediated diseases upon viral infection.

Silencing of BCR/ABL Chimeric Gene in Human Chronic Myelogenous Leukemia Cell Line K562 by siRNA-Nuclear Export Signal Peptide Conjugates.

Science.gov (United States)

Shinkai, Yasuhiro; Kashihara, Shinichi; Minematsu, Go; Fujii, Hirofumi; Naemura, Madoka; Kotake, Yojiro; Morita, Yasutaka; Ohnuki, Koichiro; Fokina, Alesya A; Stetsenko, Dmitry A; Filichev, Vyacheslav V; Fujii, Masayuki

2017-06-01

Herein we described the synthesis of siRNA-NES (nuclear export signal) peptide conjugates by solid phase fragment coupling and the application of them to silencing of bcr/abl chimeric gene in human chronic myelogenous leukemia cell line K562. Two types of siRNA-NES conjugates were prepared, and both sense strands at 5' ends were covalently linked to a NES peptide derived from TFIIIA and HIV-1 REV, respectively. Significant enhancement of silencing efficiency was observed for both of them. siRNA-TFIIIA NES conjugate suppressed the expression of BCR/ABL gene to 8.3% at 200 nM and 11.6% at 50 nM, and siRNA-HIV-1REV NES conjugate suppressed to 4.0% at 200 nM and 6.3% at 50 nM, whereas native siRNA suppressed to 36.3% at 200 nM and 30.2% at 50 nM. We could also show complex of siRNA-NES conjugate and designed amphiphilic peptide peptideβ7 could be taken up into cells with no cytotoxicity and showed excellent silencing efficiency. We believe that the complex siRNA-NES conjugate and peptideβ7 is a promising candidate for in vivo use and therapeutic applications.

Transcriptional changes in epigenetic modifiers associated with gene silencing in the intestine of the sea cucumber, Apostichopus japonicus (Selenka), during aestivation

Science.gov (United States)

Wang, Tianming; Yang, Hongsheng; Zhao, Huan; Chen, Muyan; Wang, Bing

2011-11-01

The sea cucumber, Apostichopus japonicus, undergoes aestivation to improve survival during periods of high-temperature. During aestivation, the metabolic rate is depressed to reduce the consumption of reserved energy. We evaluated the role of epigenetic modification on global gene silencing during metabolic rate depression in the sea cucumber. We compared the expression of epigenetic modifiers in active and aestivating sea cucumbers. The expression of three genes involved in DNA methylation and chromatin remodeling (DNA (cytosine-5)-methyltransferase 1, Methyl-CpG-binding domain protein 2), and Chromodomain-helicase-DNA-binding protein 5) was significantly higher during aestivation (Days 20 and 40). Similarly, we observed an increase in the expression of genes involved in histone acetylation (Histone deacetylase 3) and Histone-binding protein RBBP4) during the early (Days 5 and 10) and late phases (Days 20 and 40) of aestivation. There was no change in the expression of KAT2B, a histone acetyltransferase. However, the expression of histone methylation associated modifiers (Histone-arginine methyltransferase CARMER and Histone-lysine N-methyltransferase MLL5) was significantly higher after 5 d in the aestivating group. The results suggest that the expression of epigenetic modifiers involved in DNA methylation, chromatin remodeling, histone acetylation, and histone methylation is upregulated during aestivation. We hypothesize that these changes regulate global gene silencing during aestivation in A. japonicus.

Gene silencing in primary and metastatic tumors by small interfering RNA delivery in mice: quantitative analysis using melanoma cells expressing firefly and sea pansy luciferases.

Science.gov (United States)

Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu

2005-07-20

Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.

Inducible defenses stay up late: temporal patterns of immune gene expression in Tenebrio molitor.

Science.gov (United States)

Johnston, Paul R; Makarova, Olga; Rolff, Jens

2013-12-06

The course of microbial infection in insects is shaped by a two-stage process of immune defense. Constitutive defenses, such as engulfment and melanization, act immediately and are followed by inducible defenses, archetypically the production of antimicrobial peptides, which eliminate or suppress the remaining microbes. By applying RNAseq across a 7-day time course, we sought to characterize the long-lasting immune response to bacterial challenge in the mealworm beetle Tenebrio molitor, a model for the biochemistry of insect immunity and persistent bacterial infection. By annotating a hybrid de novo assembly of RNAseq data, we were able to identify putative orthologs for the majority of components of the conserved insect immune system. Compared with Tribolium castaneum, the most closely related species with a reference genome sequence and a manually curated immune system annotation, the T. molitor immune gene count was lower, with lineage-specific expansions of genes encoding serine proteases and their countervailing inhibitors accounting for the majority of the deficit. Quantitative mapping of RNAseq reads to the reference assembly showed that expression of genes with predicted functions in cellular immunity, wound healing, melanization, and the production of reactive oxygen species was transiently induced immediately after immune challenge. In contrast, expression of genes encoding antimicrobial peptides or components of the Toll signaling pathway and iron sequestration response remained elevated for at least 7 days. Numerous genes involved in metabolism and nutrient storage were repressed, indicating a possible cost of immune induction. Strikingly, the expression of almost all antibacterial peptides followed the same pattern of long-lasting induction, regardless of their spectra of activity, signaling possible interactive roles in vivo. Copyright © 2014 Johnston et al.

Anopheles gambiae antiviral immune response to systemic O'nyong-nyong infection.

Directory of Open Access Journals (Sweden)

Joanna Waldock

Full Text Available Mosquito-borne viral diseases cause significant burden in much of the developing world. Although host-virus interactions have been studied extensively in the vertebrate host, little is known about mosquito responses to viral infection. In contrast to mosquitoes of the Aedes and Culex genera, Anopheles gambiae, the principal vector of human malaria, naturally transmits very few arboviruses, the most important of which is O'nyong-nyong virus (ONNV. Here we have investigated the A. gambiae immune response to systemic ONNV infection using forward and reverse genetic approaches.We have used DNA microarrays to profile the transcriptional response of A. gambiae inoculated with ONNV and investigate the antiviral function of candidate genes through RNAi gene silencing assays. Our results demonstrate that A. gambiae responses to systemic viral infection involve genes covering all aspects of innate immunity including pathogen recognition, modulation of immune signalling, complement-mediated lysis/opsonisation and other immune effector mechanisms. Patterns of transcriptional regulation and co-infections of A. gambiae with ONNV and the rodent malaria parasite Plasmodium berghei suggest that hemolymph immune responses to viral infection are diverted away from melanisation. We show that four viral responsive genes encoding two putative recognition receptors, a galectin and an MD2-like receptor, and two effector lysozymes, function in limiting viral load.This study is the first step in elucidating the antiviral mechanisms of A. gambiae mosquitoes, and has revealed interesting differences between A. gambiae and other invertebrates. Our data suggest that mechanisms employed by A. gambiae are distinct from described invertebrate antiviral immunity to date, and involve the complement-like branch of the humoral immune response, supressing the melanisation response that is prominent in anti-parasitic immunity. The antiviral immune response in A. gambiae is thus

Nicotiana plumbaginifolia plants silenced for the ATP-binding cassette transporter gene NpPDR1 show increased susceptibility to a group of fungal and oomycete pathogens.

Science.gov (United States)

Bultreys, Alain; Trombik, Tomasz; Drozak, Anna; Boutry, Marc

2009-09-01

SUMMARY The behaviour of Nicotiana plumbaginifolia plants silenced for the ATP-binding cassette transporter gene NpPDR1 was investigated in response to fungal and oomycete infections. The importance of NpPDR1 in plant defence was demonstrated for two organs in which NpPDR1 is constitutively expressed: the roots and the petal epidermis. The roots of the plantlets of two lines silenced for NpPDR1 expression were clearly more sensitive than those of controls to the fungal pathogens Botrytis cinerea, Fusarium oxysporum sp., F. oxysporum f. sp. nicotianae, F. oxysporum f. sp. melonis and Rhizoctonia solani, as well as to the oomycete pathogen Phytophthora nicotianae race 0. The Ph gene-linked resistance of N. plumbaginifolia to P. nicotianae race 0 was totally ineffective in NpPDR1-silenced lines. In addition, the petals of the NpPDR1-silenced lines were spotted 15%-20% more rapidly by B. cinerea than were the controls. The rapid induction (after 2-4 days) of NpPDR1 expression in N. plumbaginifolia and N. tabacum mature leaves in response to pathogen presence was demonstrated for the first time with fungi and one oomycete: R. solani, F. oxysporum and P. nicotianae. With B. cinerea, such rapid expression was not observed in healthy mature leaves. NpPDR1 expression was not observed during latent infections of B. cinerea in N. plumbaginifolia and N. tabacum, but was induced when conditions facilitated B. cinerea development in leaves, such as leaf ageing or an initial root infection. This work demonstrates the increased sensitivity of NpPDR1-silenced N. plumbaginifolia plants to all of the fungal and oomycete pathogens investigated.

AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.

Science.gov (United States)

Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik

2013-05-01

AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.

Identification of Immunity Related Genes to Study the Physalis peruviana – Fusarium oxysporum Pathosystem

Science.gov (United States)

Enciso-Rodríguez, Felix E.; González, Carolina; Rodríguez, Edwin A.; López, Camilo E.; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

2013-01-01

The Cape gooseberry ( Physalis peruviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P . peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC–NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance. PMID:23844210

Rescue of Metabolic Alterations in AR113Q Skeletal Muscle by Peripheral Androgen Receptor Gene Silencing

Directory of Open Access Journals (Sweden)

Elisa Giorgetti

2016-09-01

Full Text Available Spinal and bulbar muscular atrophy (SBMA, a progressive degenerative disorder, is caused by a CAG/glutamine expansion in the androgen receptor (polyQ AR. Recent studies demonstrate that skeletal muscle is an important site of toxicity that contributes to the SBMA phenotype. Here, we sought to identify critical pathways altered in muscle that underlie disease manifestations in AR113Q mice. This led to the unanticipated identification of gene expression changes affecting regulators of carbohydrate metabolism, similar to those triggered by denervation. AR113Q muscle exhibits diminished glycolysis, altered mitochondria, and an impaired response to exercise. Strikingly, the expression of genes regulating muscle energy metabolism is rescued following peripheral polyQ AR gene silencing by antisense oligonucleotides (ASO, a therapeutic strategy that alleviates disease. Our data establish the occurrence of a metabolic imbalance in SBMA muscle triggered by peripheral expression of the polyQ AR and indicate that alterations in energy utilization contribute to non-neuronal disease manifestations.

Genome-wide characterization and expression profiling of immune genes in the diamondback moth, Plutella xylostella (L.).

Science.gov (United States)

Xia, Xiaofeng; Yu, Liying; Xue, Minqian; Yu, Xiaoqiang; Vasseur, Liette; Gurr, Geoff M; Baxter, Simon W; Lin, Hailan; Lin, Junhan; You, Minsheng

2015-05-06

The diamondback moth, Plutella xylostella (L.), is a destructive pest that attacks cruciferous crops worldwide. Immune responses are important for interactions between insects and pathogens and information on these underpins the development of strategies for biocontrol-based pest management. Little, however, is known about immune genes and their regulation patterns in P. xylostella. A total of 149 immune-related genes in 20 gene families were identified through comparison of P. xylostella genome with the genomes of other insects. Complete and conserved Toll, IMD and JAK-STAT signaling pathways were found in P. xylostella. Genes involved in pathogen recognition were expanded and more diversified than genes associated with intracellular signal transduction. Gene expression profiles showed that the IMD pathway may regulate expression of antimicrobial peptide (AMP) genes in the midgut, and be related to an observed down-regulation of AMPs in experimental lines of insecticide-resistant P. xylostella. A bacterial feeding study demonstrated that P. xylostella could activate different AMPs in response to bacterial infection. This study has established a framework of comprehensive expression profiles that highlight cues for immune regulation in a major pest. Our work provides a foundation for further studies on the functions of P. xylostella immune genes and mechanisms of innate immunity.

Anti-viral RNA silencing: do we look like plants ?

Directory of Open Access Journals (Sweden)

Lecellier Charles-Henri

2006-01-01

Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

AAV2-mediated in vivo immune gene therapy of solid tumours

LENUS (Irish Health Repository)

Collins, Sara A

2010-12-20

Abstract Background Many strategies have been adopted to unleash the potential of gene therapy for cancer, involving a wide range of therapeutic genes delivered by various methods. Immune therapy has become one of the major strategies adopted for cancer gene therapy and seeks to stimulate the immune system to target tumour antigens. In this study, the feasibility of AAV2 mediated immunotherapy of growing tumours was examined, in isolation and combined with anti-angiogenic therapy. Methods Immune-competent Balb\\/C or C57 mice bearing subcutaneous JBS fibrosarcoma or Lewis Lung Carcinoma (LLC) tumour xenografts respectively were treated by intra-tumoural administration of AAV2 vector encoding the immune up-regulating cytokine granulocyte macrophage-colony stimulating factor (GM-CSF) and the co-stimulatory molecule B7-1 to subcutaneous tumours, either alone or in combination with intra-muscular (IM) delivery of AAV2 vector encoding Nk4 14 days prior to tumour induction. Tumour growth and survival was monitored for all animals. Cured animals were re-challenged with tumourigenic doses of the original tumour type. In vivo cytotoxicity assays were used to investigate establishment of cell-mediated responses in treated animals. Results AAV2-mediated GM-CSF, B7-1 treatment resulted in a significant reduction in tumour growth and an increase in survival in both tumour models. Cured animals were resistant to re-challenge, and induction of T cell mediated anti-tumour responses were demonstrated. Adoptive transfer of splenocytes to naïve animals prevented tumour establishment. Systemic production of Nk4 induced by intra-muscular (IM) delivery of Nk4 significantly reduced subcutaneous tumour growth. However, combination of Nk4 treatment with GM-CSF, B7-1 therapy reduced the efficacy of the immune therapy. Conclusions Overall, this study demonstrates the potential for in vivo AAV2 mediated immune gene therapy, and provides data on the inter-relationship between tumour

Illuminating the gateway of gene silencing: perspective of RNA interference technology in clinical therapeutics.

Science.gov (United States)

Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok

2012-07-01

A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.

High-level HIV-1 Nef transient expression in Nicotiana benthamiana using the P19 gene silencing suppressor protein of Artichoke Mottled Crinckle Virus

Directory of Open Access Journals (Sweden)

Bianco Linda

2009-11-01

Full Text Available Abstract Background In recent years, different HIV antigens have been successfully expressed in plants by either stable transformation or transient expression systems. Among HIV proteins, Nef is considered a promising target for the formulation of a multi-component vaccine due to its implication in the first steps of viral infection. Attempts to express Nef as a single protein product (not fused to a stabilizing protein in transgenic plants resulted in disappointingly low yields (about 0.5% of total soluble protein. In this work we describe a transient expression system based on co-agroinfiltration of plant virus gene silencing suppressor proteins in Nicotiana benthamiana, followed by a two-step affinity purification protocol of plant-derived Nef. Results The effect of three gene silencing viral suppressor proteins (P25 of Potato Virus X, P19 of either Artichoke Mottled Crinckle virus and Tomato Bushy Stunt virus on Nef transient expression yield was evaluated. The P19 protein of Artichoke Mottled Crinckle virus (AMCV-P19 gave the highest expression yield in vacuum co-agroinfiltration experiments reaching 1.3% of total soluble protein, a level almost three times higher than that previously reported in stable transgenic plants. The high yield observed in the co-agroinfiltrated plants was correlated to a remarkable decrease of Nef-specific small interfering RNAs (siRNAs indicating an effective modulation of RNA silencing mechanisms by AMCV-P19. Interestingly, we also showed that expression levels in top leaves of vacuum co-agroinfiltrated plants were noticeably reduced compared to bottom leaves. Moreover, purification of Nef from agroinfiltrated tissue was achieved by a two-step immobilized metal ion affinity chromatography protocol with yields of 250 ng/g of fresh tissue. Conclusion We demonstrated that expression level of HIV-1 Nef in plant can be improved using a transient expression system enhanced by the AMCV-P19 gene silencing suppressor

The sandfly Lutzomyia longipalpis LL5 embryonic cell line has active Toll and Imd pathways and shows immune responses to bacteria, yeast and Leishmania.

Science.gov (United States)

Tinoco-Nunes, Bruno; Telleria, Erich Loza; da Silva-Neves, Monique; Marques, Christiane; Azevedo-Brito, Daisy Aline; Pitaluga, André Nóbrega; Traub-Csekö, Yara Maria

2016-04-20

Lutzomyia longipalpis is the main vector of visceral leishmaniasis in Latin America. Sandfly immune responses are poorly understood. In previous work we showed that these vector insects respond to bacterial infections by modulating a defensin gene expression and activate the Imd pathway in response to Leishmania infection. Aspects of innate immune pathways in insects (including mosquito vectors of human diseases) have been revealed by studying insect cell lines, and we have previously demonstrated antiviral responses in the L. longipalpis embryonic cell line LL5. The expression patterns of antimicrobial peptides (AMPs) and transcription factors were evaluated after silencing the repressors of the Toll pathway (cactus) and Imd pathway (caspar). AMPs and transcription factor expression patterns were also evaluated after challenge with heat-killed bacteria, heat-killed yeast, or live Leishmania. These studies showed that LL5 cells have active Toll and Imd pathways, since they displayed an increased expression of AMP genes following silencing of the repressors cactus and caspar, respectively. These pathways were also activated by challenges with bacteria, yeast and Leishmania infantum chagasi. We demonstrated that L. longipalpis LL5 embryonic cells respond to immune stimuli and are therefore a good model to study the immunological pathways of this important vector of leishmaniasis.

Silencing of mitochondrial NADP+-dependent isocitrate dehydrogenase gene enhances glioma radiosensitivity

International Nuclear Information System (INIS)

Kim, Sung Youl; Yoo, Young Hyun; Park, Jeen-Woo

2013-01-01

Highlights: •Silencing of the IDPm gene enhances IR-induced autophagy in glioma cells. •Autophagy inhibition augmented apoptosis of irradiated glioma cells. •Results offer a redox-active therapeutic strategy for the treatment of cancer. -- Abstract: Reactive oxygen species (ROS) levels are elevated in organisms that have been exposed to ionizing radiation and are protagonists in the induction of cell death. Recently, we demonstrated that the control of mitochondrial redox balance and the cellular defense against oxidative damage are primary functions of mitochondrial NADP + -dependent isocitrate dehydrogenase (IDPm) via the supply of NADPH for antioxidant systems. In the present study, we report an autophagic response to ionizing radiation in A172 glioma cells transfected with small interfering RNA (siRNA) targeting the IDPm gene. Autophagy in A172 transfectant cells was associated with enhanced autophagolysosome formation and GFP–LC3 punctuation/aggregation. Furthermore, we found that the inhibition of autophagy by chloroquine augmented apoptotic cell death of irradiated A172 cells transfected with IDPm siRNA. Taken together, our data suggest that autophagy functions as a survival mechanism in A172 cells against ionizing radiation-induced apoptosis and the sensitizing effect of IDPm siRNA and autophagy inhibitor on the ionizing radiation-induced apoptotic cell death of glioma cells offers a novel redox-active therapeutic strategy for the treatment of cancer

A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

Science.gov (United States)

Pompey, Justine M; Foda, Bardees; Singh, Upinder

2015-01-01

Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

Directory of Open Access Journals (Sweden)

Justine M Pompey

Full Text Available Dicer enzymes process double-stranded RNA (dsRNA into small RNAs that target gene silencing through the RNA interference (RNAi pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

6-Thioguanine Reactivates Epigenetically Silenced Genes in Acute Lymphoblastic Leukemia Cells by Facilitating Proteasome-mediated Degradation of DNMT1

OpenAIRE

Yuan, Bifeng; Zhang, Jing; Wang, Hongxia; Xiong, Lei; Cai, Qian; Wang, Tina; Jacobsen, Steven; Pradhan, Sriharsa; Wang, Yinsheng

2011-01-01

Thiopurines including 6-thioguanine (SG), 6-mercaptopurine and azathioprine are effective anticancer agents with remarkable success in clinical practice, especially in effective treatment of acute lymphoblastic leukemia (ALL). SG is understood to act as a DNA hypomethylating agent in ALL cells, however, the underlying mechanism leading to global cytosine demethylation remains unclear. Here we report that SG treatment results in reactivation of epigenetically silenced genes in T leukemia cells...

Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.

Science.gov (United States)

Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H

2016-06-17

In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.

Mitochondrial damage and cholesterol storage in human hepatocellular carcinoma cells with silencing of UBIAD1 gene expression

Directory of Open Access Journals (Sweden)

Carlos R. Morales

2014-01-01

Full Text Available Heterozygous mutations in the UBIAD1 gene cause Schnyder corneal dystrophy characterized by abnormal cholesterol and phospholipid deposits in the cornea. Ubiad1 protein was recently identified as Golgi prenyltransferase responsible for biosynthesis of vitamin K2 and CoQ10, a key protein in the mitochondrial electron transport chain. Our study shows that silencing UBIAD1 in cultured human hepatocellular carcinoma cells causes dramatic morphological changes and cholesterol storage in the mitochondria, emphasizing an important role of UBIAD1 in mitochondrial function.

Function of endoplasmic reticulum calcium ATPase in innate immunity-mediated programmed cell death

Science.gov (United States)

Zhu, Xiaohong; Caplan, Jeffrey; Mamillapalli, Padmavathi; Czymmek, Kirk; Dinesh-Kumar, Savithramma P

2010-01-01

Programmed cell death (PCD) initiated at the pathogen-infected sites during the plant innate immune response is thought to prevent the development of disease. Here, we describe the identification and characterization of an ER-localized type IIB Ca2+-ATPase (NbCA1) that function as a regulator of PCD. Silencing of NbCA1 accelerates viral immune receptor N- and fungal-immune receptor Cf9-mediated PCD, as well as non-host pathogen Pseudomonas syringae pv. tomato DC3000 and the general elicitor cryptogein-induced cell death. The accelerated PCD rescues loss-of-resistance phenotype of Rar1, HSP90-silenced plants, but not SGT1-silenced plants. Using a genetically encoded calcium sensor, we show that downregulation of NbCA1 results in the modulation of intracellular calcium signalling in response to cryptogein elicitor. We further show that NbCAM1 and NbrbohB function as downstream calcium decoders in N-immune receptor-mediated PCD. Our results indicate that ER-Ca2+-ATPase is a component of the calcium efflux pathway that controls PCD during an innate immune response. PMID:20075858

Transcriptional profiling of immune-related genes in Pacific white shrimp (Litopenaeus vannamei) during ontogenesis.

Science.gov (United States)

Quispe, Ruth L; Justino, Emily B; Vieira, Felipe N; Jaramillo, Michael L; Rosa, Rafael D; Perazzolo, Luciane M

2016-11-01

We have performed here a gene expression analysis to determine the developmental stage at the main genes involved in crustacean immune response begin to be expressed and their changes in mRNA abundance during shrimp development. By using a quantitative PCR-based approach, we have measured the mRNA abundance of 24 immune-related genes from different functional categories in twelve developmental stages ranging from fertilized eggs to larval and postlarval stages and also in juveniles. We showed for the first time that the main genes from the RNAi-based post-transcriptional pathway involved in shrimp antiviral immunity are transcribed in all developmental stages, but exhibit a diverse pattern of gene expression during shrimp ontogenesis. On the other hand, hemocyte-expressed genes mainly involved in antimicrobial defenses appeared to be transcribed in larval stages, indicating that hematopoiesis initiates early in development. Moreover, transcript levels of some genes were early detected in fertilized eggs at 0-4 h post-spawning, suggesting a maternal contribution of immune-related transcripts to shrimp progeny. Altogether, our results provide important clues regarding the ontogenesis of hemocytes as well the establishment of antiviral and antimicrobial defenses in shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.

Silencing the epigenetic silencer KDM4A for TRAIL and DR5 simultaneous induction and antitumor therapy.

Science.gov (United States)

Wang, Junjian; Wang, Haibin; Wang, Ling-Yu; Cai, Demin; Duan, Zhijian; Zhang, Yanhong; Chen, Peng; Zou, June X; Xu, Jianzhen; Chen, Xinbin; Kung, Hsing-Jien; Chen, Hong-Wu

2016-11-01

Recombinant TRAIL and agonistic antibodies to death receptors (DRs) have been in clinical trial but displayed limited anti-cancer efficacy. Lack of functional DR expression in tumors is a major limiting factor. We report here that chromatin regulator KDM4A/JMJD2A, not KDM4B, has a pivotal role in silencing tumor cell expression of both TRAIL and its receptor DR5. In TRAIL-sensitive and -resistant cancer cells of lung, breast and prostate, KDM4A small-molecule inhibitor compound-4 (C-4) or gene silencing strongly induces TRAIL and DR5 expression, and causes TRAIL-dependent apoptotic cell death. KDM4A inhibition also strongly sensitizes cells to TRAIL. C-4 alone potently inhibits tumor growth with marked induction of TRAIL and DR5 expression in the treated tumors and effectively sensitizes them to the newly developed TRAIL-inducer ONC201. Mechanistically, C-4 does not appear to act through the Akt-ERK-FOXO3a pathway. Instead, it switches histone modifying enzyme complexes at promoters of TRAIL and DR5 transcriptional activator CHOP gene by dissociating KDM4A and nuclear receptor corepressor (NCoR)-HDAC complex and inducing the recruitment of histone acetylase CBP. Thus, our results reveal KDM4A as a key epigenetic silencer of TRAIL and DR5 in tumors and establish inhibitors of KDM4A as a novel strategy for effectively sensitizing tumors to TRAIL pathway-based therapeutics.

The dynamics and efficacy of antiviral RNA silencing: A model study

Directory of Open Access Journals (Sweden)

Hogeweg Paulien

2008-03-01

Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.

Caste-, sex-, and age-dependent expression of immune-related genes in a Japanese subterranean termite, Reticulitermes speratus.

Directory of Open Access Journals (Sweden)

Yuki Mitaka

Full Text Available Insects protect themselves from microbial infections through innate immune responses, including pathogen recognition, phagocytosis, the activation of proteolytic cascades, and the synthesis of antimicrobial peptides. Termites, eusocial insects inhabiting microbe-rich wood, live in closely-related family groups that are susceptible to shared pathogen infections. To resist pathogenic infection, termite families have evolved diverse immune adaptations at both individual and societal levels, and a strategy of trade-offs between reproduction and immunity has been suggested. Although termite immune-inducible genes have been identified, few studies have investigated the differential expression of these genes between reproductive and neuter castes, and between sexes in each caste. In this study, we compared the expression levels of immune-related genes among castes, sexes, and ages in a Japanese subterranean termite, Reticulitermes speratus. Using RNA-seq, we found 197 immune-related genes, including 40 pattern recognition proteins, 97 signalling proteins, 60 effectors. Among these genes, 174 showed differential expression among castes. Comparing expression levels between males and females in each caste, we found sexually dimorphic expression of immune-related genes not only in reproductive castes, but also in neuter castes. Moreover, we identified age-related differential expression of 162 genes in male and/or female reproductives. In addition, although R. speratus is known to use the antibacterial peptide C-type lysozyme as an egg recognition pheromone, we determined that R. speratus has not only C-type, but also P-type and I-type lysozymes, as well as other termite species. Our transcriptomic analyses revealed immune response plasticity among all castes, and sex-biased expression of immune genes even in neuter castes, suggesting a sexual division of labor in the immune system of R. speratus. This study heightens the understanding of the evolution of

A Genetic Screen Identifies a Requirement for Cysteine-Rich-Receptor-Like Kinases in Rice NH1 (OsNPR1-Mediated Immunity.

Directory of Open Access Journals (Sweden)

Mawsheng Chern

2016-05-01

Full Text Available Systemic acquired resistance, mediated by the Arabidopsis NPR1 gene and the rice NH1 gene, confers broad-spectrum immunity to diverse pathogens. NPR1 and NH1 interact with TGA transcription factors to activate downstream defense genes. Despite the importance of this defense response, the signaling components downstream of NPR1/NH1 and TGA proteins are poorly defined. Here we report the identification of a rice mutant, snim1, which suppresses NH1-mediated immunity and demonstrate that two genes encoding previously uncharacterized cysteine-rich-receptor-like kinases (CRK6 and CRK10, complement the snim1 mutant phenotype. Silencing of CRK6 and CRK10 genes individually in the parental genetic background recreates the snim1 phenotype. We identified a rice mutant in the Kitaake genetic background with a frameshift mutation in crk10; this mutant also displays a compromised immune response highlighting the important role of crk10. We also show that elevated levels of NH1 expression lead to enhanced CRK10 expression and that the rice TGA2.1 protein binds to the CRK10 promoter. These experiments demonstrate a requirement for CRKs in NH1-mediated immunity and establish a molecular link between NH1 and induction of CRK10 expression.

GENETIC SUSCEPTIBILITY TO RESPIRATORY SYNCYTIAL VIRUS BRONCHIOLITIS IN PRETERM CHILDREN IS ASSOCIATED WITH AIRWAY REMODELING GENES AND INNATE IMMUNE GENES

NARCIS (Netherlands)

Siezen, Christine L. E.; Bont, Louis; Hodemaekers, Hennie M.; Ermers, Marieke J.; Doornbos, Gerda; van't Slot, Ruben; Wijmenga, Ciska; van Hottwelingen, Hans C.; Kimpen, Jan L. L.; Kimman, Tjeerd G.; Hoebee, Barbara; Janssen, Riny

Prematurity is a risk factor for severe respiratory syncytial virus bronchiolitis. We show that genetic factors in innate immune genes (IFNA13, IFNAR2, STAT2. IL27, NFKBIA, C3, IL1RN, TLR5), in innate and adaptive immunity (IFNG), and in airway remodeling genes (ADAM33 and TGFBR1), affect disease

Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

Directory of Open Access Journals (Sweden)

Monika Mahajan

Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

H Ferritin Gene Silencing in a Human Metastatic Melanoma Cell Line: A Proteomic Analysis

DEFF Research Database (Denmark)

Di Sanzo, Maddalena; Gaspari, Marco; Misaggi, Roberta

2011-01-01

Ferritin, the major intracellular iron-storage protein, is made of 24 subunits of two types, H and L. Besides regulating intracellular iron homeostasis, it has been found that ferritin, in particular the H subunit (FHC), is involved in different biological events such as cell differentiation...... and pathologic states (i.e., neurodegeneration and cancer). This study is aimed at investigating the whole-cell proteome of FHC-expressing and sh-RNA-silenced human metastatic melanoma cells (MM07(m)) in the attempt to identify and classify the highest number of proteins directly or indirectly controlled...... of H ferritin signaling pathways and lend support to the hypothesis that specific targeting of this gene might be an attractive and potentially effective strategy for the management of metastatic melanoma....

Extensive shared polymorphism at non-MHC immune genes in recently diverged North American prairie grouse

Science.gov (United States)

Minias, Piotr; Bateson, Zachary W.; Whittingham, Linda A.; Johnson, Jeff A.; Oyler-McCance, Sara J.; Dunn, Peter O.

2018-01-01

Gene polymorphisms shared between recently diverged species are thought to be widespread and most commonly reflect introgression from hybridization or retention of ancestral polymorphism through incomplete lineage sorting. Shared genetic diversity resulting from incomplete lineage sorting is usually maintained for a relatively short period of time, but under strong balancing selection it may persist for millions of years beyond species divergence (balanced trans-species polymorphism), as in the case of the major histocompatibility complex (MHC) genes. However, balancing selection is much less likely to act on non-MHC immune genes. The aim of this study was to investigate the patterns of shared polymorphism and selection at non-MHC immune genes in five grouse species from Centrocercus and Tympanuchus genera. For this purpose, we genotyped five non-MHC immune genes that do not interact directly with pathogens, but are involved in signaling and regulate immune cell growth. In contrast to previous studies with MHC, we found no evidence for balancing selection or balanced trans-species polymorphism among the non-MHC immune genes. No haplotypes were shared between genera and in most cases more similar allelic variants sorted by genus. Between species within genera, however, we found extensive shared polymorphism, which was most likely attributable to introgression or incomplete lineage sorting following recent divergence and large ancestral effective population size (i.e., weak genetic drift). Our study suggests that North American prairie grouse may have attained relatively low degree of reciprocal monophyly at nuclear loci and reinforces the rarity of balancing selection in non-MHC immune genes.

Enhancement of allele discrimination by introduction of nucleotide mismatches into siRNA in allele-specific gene silencing by RNAi.

Directory of Open Access Journals (Sweden)

Yusuke Ohnishi

Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense

F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function

Science.gov (United States)

Pazhouhandeh, Maghsoud; Dieterle, Monika; Marrocco, Katia; Lechner, Esther; Berry, Bassam; Brault, Véronique; Hemmer, Odile; Kretsch, Thomas; Richards, Kenneth E.; Genschik, Pascal; Ziegler-Graff, Véronique

2006-01-01

Plants employ small RNA-mediated posttranscriptional gene silencing as a virus defense mechanism. In response, plant viruses encode proteins that can suppress RNA silencing, but the mode of action of most such proteins is poorly understood. Here, we show that the silencing suppressor protein P0 of two Arabidopsis-infecting poleroviruses interacts by means of a conserved minimal F-box motif with Arabidopsis thaliana orthologs of S-phase kinase-related protein 1 (SKP1), a component of the SCF family of ubiquitin E3 ligases. Point mutations in the F-box-like motif abolished the P0–SKP1 ortholog interaction, diminished virus pathogenicity, and inhibited the silencing suppressor activity of P0. Knockdown of expression of a SKP1 ortholog in Nicotiana benthamiana rendered the plants resistant to polerovirus infection. Together, the results support a model in which P0 acts as an F-box protein that targets an essential component of the host posttranscriptional gene silencing machinery. PMID:16446454

Insect parents improve the anti-parasitic and anti-bacterial defence of their offspring by priming the expression of immune-relevant genes.

Science.gov (United States)

Trauer-Kizilelma, Ute; Hilker, Monika

2015-09-01

Insect parents that experienced an immune challenge are known to prepare (prime) the immune activity of their offspring for improved defence. This phenomenon has intensively been studied by analysing especially immunity-related proteins. However, it is unknown how transgenerational immune priming affects transcript levels of immune-relevant genes of the offspring upon an actual threat. Here, we investigated how an immune challenge of Manduca sexta parents affects the expression of immune-related genes in their eggs that are attacked by parasitoids. Furthermore, we addressed the question whether the transgenerational immune priming of expression of genes in the eggs is still traceable in adult offspring. Our study revealed that a parental immune challenge did not affect the expression of immune-related genes in unparasitised eggs. However, immune-related genes in parasitised eggs of immune-challenged parents were upregulated to a higher level than those in parasitised eggs of unchallenged parents. Hence, this transgenerational immune priming of the eggs was detected only "on demand", i.e. upon parasitoid attack. The priming effects were also traceable in adult female progeny of immune-challenged parents which showed higher transcript levels of several immune-related genes in their ovaries than non-primed progeny. Some of the primed genes showed enhanced expression even when the progeny was left unchallenged, whereas other genes were upregulated to a greater extent in primed female progeny than non-primed ones only when the progeny itself was immune-challenged. Thus, the detection of transgenerational immune priming strongly depends on the analysed genes and the presence or absence of an actual threat for the offspring. We suggest that M. sexta eggs laid by immune-challenged parents "afford" to upregulate the transcription of immunity-related genes only upon attack, because they have the chance to be endowed by parentally directly transferred protective proteins

Gene Network Polymorphism Illuminates Loss and Retention of Novel RNAi Silencing Components in the Cryptococcus Pathogenic Species Complex.

Directory of Open Access Journals (Sweden)

Marianna Feretzaki

2016-03-01

Full Text Available RNAi is a ubiquitous pathway that serves central functions throughout eukaryotes, including maintenance of genome stability and repression of transposon expression and movement. However, a number of organisms have lost their RNAi pathways, including the model yeast Saccharomyces cerevisiae, the maize pathogen Ustilago maydis, the human pathogen Cryptococcus deuterogattii, and some human parasite pathogens, suggesting there may be adaptive benefits associated with both retention and loss of RNAi. By comparing the RNAi-deficient genome of the Pacific Northwest Outbreak C. deuterogattii strain R265 with the RNAi-proficient genomes of the Cryptococcus pathogenic species complex, we identified a set of conserved genes that were lost in R265 and all other C. deuterogattii isolates examined. Genetic and molecular analyses reveal several of these lost genes play roles in RNAi pathways. Four novel components were examined further. Znf3 (a zinc finger protein and Qip1 (a homolog of N. crassa Qip were found to be essential for RNAi, while Cpr2 (a constitutive pheromone receptor and Fzc28 (a transcription factor are involved in sex-induced but not mitosis-induced silencing. Our results demonstrate that the mitotic and sex-induced RNAi pathways rely on the same core components, but sex-induced silencing may be a more specific, highly induced variant that involves additional specialized or regulatory components. Our studies further illustrate how gene network polymorphisms involving known components of key cellular pathways can inform identification of novel elements and suggest that RNAi loss may have been a core event in the speciation of C. deuterogattii and possibly contributed to its pathogenic trajectory.

Modulation of histone methylation and MLH1 gene silencing by hexavalent chromium

International Nuclear Information System (INIS)

Sun Hong; Zhou Xue; Chen Haobin; Li Qin; Costa, Max

2009-01-01

Hexavalent chromium [Cr(VI)] is a mutagen and carcinogen, and occupational exposure can lead to lung cancers and other adverse health effects. Genetic changes resulting from DNA damage have been proposed as an important mechanism that mediates chromate's carcinogenicity. Here we show that chromate exposure of human lung A549 cells increased global levels of di- and tri-methylated histone H3 lysine 9 (H3K9) and lysine 4 (H3K4) but decreased the levels of tri-methylated histone H3 lysine 27 (H3K27) and di-methylated histone H3 arginine 2 (H3R2). Most interestingly, H3K9 dimethylation was enriched in the human MLH1 gene promoter following chromate exposure and this was correlated with decreased MLH1 mRNA expression. Chromate exposure increased the protein as well as mRNA levels of G9a a histone methyltransferase that specifically methylates H3K9. This Cr(VI)-induced increase in G9a may account for the global elevation of H3K9 dimethylation. Furthermore, supplementation with ascorbate, the primary reductant of Cr(VI) and also an essential cofactor for the histone demethylase activity, partially reversed the H3K9 dimethylation induced by chromate. Thus our studies suggest that Cr(VI) may target histone methyltransferases and demethylases, which in turn affect both global and gene promoter specific histone methylation, leading to the silencing of specific tumor suppressor genes such as MLH1.

Balancing selection on immunity genes: review of the current literature and new analysis in Drosophila melanogaster.

Science.gov (United States)

Croze, Myriam; Živković, Daniel; Stephan, Wolfgang; Hutter, Stephan

2016-08-01

Balancing selection has been widely assumed to be an important evolutionary force, yet even today little is known about its abundance and its impact on the patterns of genetic diversity. Several studies have shown examples of balancing selection in humans, plants or parasites, and many genes under balancing selection are involved in immunity. It has been proposed that host-parasite coevolution is one of the main forces driving immune genes to evolve under balancing selection. In this paper, we review the literature on balancing selection on immunity genes in several organisms, including Drosophila. Furthermore, we performed a genome scan for balancing selection in an African population of Drosophila melanogaster using coalescent simulations of a demographic model with and without selection. We find very few genes under balancing selection and only one novel candidate gene related to immunity. Finally, we discuss the possible causes of the low number of genes under balancing selection. Copyright © 2016 The Authors. Published by Elsevier GmbH.. All rights reserved.

Expression of putative immune response genes during early ontogeny in the coral Acropora millepora.

Directory of Open Access Journals (Sweden)

Eneour Puill-Stephan

Full Text Available Corals, like many other marine invertebrates, lack a mature allorecognition system in early life history stages. Indeed, in early ontogeny, when corals acquire and establish associations with various surface microbiota and dinoflagellate endosymbionts, they do not efficiently distinguish between closely and distantly related individuals from the same population. However, very little is known about the molecular components that underpin allorecognition and immunity responses or how they change through early ontogeny in corals.Patterns in the expression of four putative immune response genes (apextrin, complement C3, and two CELIII type lectin genes were examined in juvenile colonies of Acropora millepora throughout a six-month post-settlement period using quantitative real-time PCR (qPCR. Expression of a CELIII type lectin gene peaked in the fourth month for most of the coral juveniles sampled and was significantly higher at this time than at any other sampling time during the six months following settlement. The timing of this increase in expression levels of putative immune response genes may be linked to allorecognition maturation which occurs around this time in A. millepora. Alternatively, the increase may represent a response to immune challenges, such as would be involved in the recognition of symbionts (such as Symbiodinium spp. or bacteria during winnowing processes as symbioses are fine-tuned.Our data, although preliminary, are consistent with the hypothesis that lectins may play an important role in the maturation of allorecognition responses in corals. The co-expression of lectins with apextrin during development of coral juveniles also raises the possibility that these proteins, which are components of innate immunity in other invertebrates, may influence the innate immune systems of corals through a common pathway or system. However, further studies investigating the expression of these genes in alloimmune-challenged corals are

Expression of putative immune response genes during early ontogeny in the coral Acropora millepora.

Science.gov (United States)

Puill-Stephan, Eneour; Seneca, François O; Miller, David J; van Oppen, Madeleine J H; Willis, Bette L

2012-01-01

Corals, like many other marine invertebrates, lack a mature allorecognition system in early life history stages. Indeed, in early ontogeny, when corals acquire and establish associations with various surface microbiota and dinoflagellate endosymbionts, they do not efficiently distinguish between closely and distantly related individuals from the same population. However, very little is known about the molecular components that underpin allorecognition and immunity responses or how they change through early ontogeny in corals. Patterns in the expression of four putative immune response genes (apextrin, complement C3, and two CELIII type lectin genes) were examined in juvenile colonies of Acropora millepora throughout a six-month post-settlement period using quantitative real-time PCR (qPCR). Expression of a CELIII type lectin gene peaked in the fourth month for most of the coral juveniles sampled and was significantly higher at this time than at any other sampling time during the six months following settlement. The timing of this increase in expression levels of putative immune response genes may be linked to allorecognition maturation which occurs around this time in A. millepora. Alternatively, the increase may represent a response to immune challenges, such as would be involved in the recognition of symbionts (such as Symbiodinium spp. or bacteria) during winnowing processes as symbioses are fine-tuned. Our data, although preliminary, are consistent with the hypothesis that lectins may play an important role in the maturation of allorecognition responses in corals. The co-expression of lectins with apextrin during development of coral juveniles also raises the possibility that these proteins, which are components of innate immunity in other invertebrates, may influence the innate immune systems of corals through a common pathway or system. However, further studies investigating the expression of these genes in alloimmune-challenged corals are needed to further

RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

Science.gov (United States)

Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

2016-12-01

Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

Extensive innate immune gene activation accompanies brain aging, increasing vulnerability to cognitive decline and neurodegeneration: a microarray study

Science.gov (United States)

2012-01-01

Background This study undertakes a systematic and comprehensive analysis of brain gene expression profiles of immune/inflammation-related genes in aging and Alzheimer’s disease (AD). Methods In a well-powered microarray study of young (20 to 59 years), aged (60 to 99 years), and AD (74 to 95 years) cases, gene responses were assessed in the hippocampus, entorhinal cortex, superior frontal gyrus, and post-central gyrus. Results Several novel concepts emerge. First, immune/inflammation-related genes showed major changes in gene expression over the course of cognitively normal aging, with the extent of gene response far greater in aging than in AD. Of the 759 immune-related probesets interrogated on the microarray, approximately 40% were significantly altered in the SFG, PCG and HC with increasing age, with the majority upregulated (64 to 86%). In contrast, far fewer immune/inflammation genes were significantly changed in the transition to AD (approximately 6% of immune-related probesets), with gene responses primarily restricted to the SFG and HC. Second, relatively few significant changes in immune/inflammation genes were detected in the EC either in aging or AD, although many genes in the EC showed similar trends in responses as in the other brain regions. Third, immune/inflammation genes undergo gender-specific patterns of response in aging and AD, with the most pronounced differences emerging in aging. Finally, there was widespread upregulation of genes reflecting activation of microglia and perivascular macrophages in the aging brain, coupled with a downregulation of select factors (TOLLIP, fractalkine) that when present curtail microglial/macrophage activation. Notably, essentially all pathways of the innate immune system were upregulated in aging, including numerous complement components, genes involved in toll-like receptor signaling and inflammasome signaling, as well as genes coding for immunoglobulin (Fc) receptors and human leukocyte antigens I

Extensive innate immune gene activation accompanies brain aging, increasing vulnerability to cognitive decline and neurodegeneration: a microarray study

Directory of Open Access Journals (Sweden)

Cribbs David H

2012-07-01

Full Text Available Abstract Background This study undertakes a systematic and comprehensive analysis of brain gene expression profiles of immune/inflammation-related genes in aging and Alzheimer’s disease (AD. Methods In a well-powered microarray study of young (20 to 59 years, aged (60 to 99 years, and AD (74 to 95 years cases, gene responses were assessed in the hippocampus, entorhinal cortex, superior frontal gyrus, and post-central gyrus. Results Several novel concepts emerge. First, immune/inflammation-related genes showed major changes in gene expression over the course of cognitively normal aging, with the extent of gene response far greater in aging than in AD. Of the 759 immune-related probesets interrogated on the microarray, approximately 40% were significantly altered in the SFG, PCG and HC with increasing age, with the majority upregulated (64 to 86%. In contrast, far fewer immune/inflammation genes were significantly changed in the transition to AD (approximately 6% of immune-related probesets, with gene responses primarily restricted to the SFG and HC. Second, relatively few significant changes in immune/inflammation genes were detected in the EC either in aging or AD, although many genes in the EC showed similar trends in responses as in the other brain regions. Third, immune/inflammation genes undergo gender-specific patterns of response in aging and AD, with the most pronounced differences emerging in aging. Finally, there was widespread upregulation of genes reflecting activation of microglia and perivascular macrophages in the aging brain, coupled with a downregulation of select factors (TOLLIP, fractalkine that when present curtail microglial/macrophage activation. Notably, essentially all pathways of the innate immune system were upregulated in aging, including numerous complement components, genes involved in toll-like receptor signaling and inflammasome signaling, as well as genes coding for immunoglobulin (Fc receptors and human

ETS transcription factors control transcription of EZH2 and epigenetic silencing of the tumor suppressor gene Nkx3.1 in prostate cancer.

Directory of Open Access Journals (Sweden)

Paolo Kunderfranco

2010-05-01

Full Text Available ETS transcription factors regulate important signaling pathways involved in cell differentiation and development in many tissues and have emerged as important players in prostate cancer. However, the biological impact of ETS factors in prostate tumorigenesis is still debated.We performed an analysis of the ETS gene family using microarray data and real-time PCR in normal and tumor tissues along with functional studies in normal and cancer cell lines to understand the impact in prostate tumorigenesis and identify key targets of these transcription factors. We found frequent dysregulation of ETS genes with oncogenic (i.e., ERG and ESE1 and tumor suppressor (i.e., ESE3 properties in prostate tumors compared to normal prostate. Tumor subgroups (i.e., ERG(high, ESE1(high, ESE3(low and NoETS tumors were identified on the basis of their ETS expression status and showed distinct transcriptional and biological features. ERG(high and ESE3(low tumors had the most robust gene signatures with both distinct and overlapping features. Integrating genomic data with functional studies in multiple cell lines, we demonstrated that ERG and ESE3 controlled in opposite direction transcription of the Polycomb Group protein EZH2, a key gene in development, differentiation, stem cell biology and tumorigenesis. We further demonstrated that the prostate-specific tumor suppressor gene Nkx3.1 was controlled by ERG and ESE3 both directly and through induction of EZH2.These findings provide new insights into the role of the ETS transcriptional network in prostate tumorigenesis and uncover previously unrecognized links between aberrant expression of ETS factors, deregulation of epigenetic effectors and silencing of tumor suppressor genes. The link between aberrant ETS activity and epigenetic gene silencing may be relevant for the clinical management of prostate cancer and design of new therapeutic strategies.

Concerted down-regulation of immune-system related genes predicts metastasis in colorectal carcinoma

International Nuclear Information System (INIS)

Fehlker, Marion; Huska, Matthew R; Jöns, Thomas; Andrade-Navarro, Miguel A; Kemmner, Wolfgang

2014-01-01

This study aimed at the identification of prognostic gene expression markers in early primary colorectal carcinomas without metastasis at the time point of surgery by analyzing genome-wide gene expression profiles using oligonucleotide microarrays. Cryo-conserved tumor specimens from 45 patients with early colorectal cancers were examined, with the majority of them being UICC stage II or earlier and with a follow-up time of 41–115 months. Gene expression profiling was performed using Whole Human Genome 4x44K Oligonucleotide Microarrays. Validation of microarray data was performed on five of the genes in a smaller cohort. Using a novel algorithm based on the recursive application of support vector machines (SVMs), we selected a signature of 44 probes that discriminated between patients developing later metastasis and patients with a good prognosis. Interestingly, almost half of the genes was related to the patients’ immune response and showed reduced expression in the metastatic cases. Whereas up to now gene signatures containing genes with various biological functions have been described for prediction of metastasis in CRC, in this study metastasis could be well predicted by a set of gene expression markers consisting exclusively of genes related to the MHC class II complex involved in immune response. Thus, our data emphasize that the proper function of a comprehensive network of immune response genes is of vital importance for the survival of colorectal cancer patients

The silencing of cathepsin K used in gene therapy for periodontal disease reveals the role of cathepsin K in chronic infection and inflammation.

Science.gov (United States)

Chen, W; Gao, B; Hao, L; Zhu, G; Jules, J; MacDougall, M J; Wang, J; Han, X; Zhou, X; Li, Y-P

2016-10-01

Periodontitis is a severe chronic inflammatory disease and one of the most prevalent non-communicable chronic diseases that affects the majority of the world's adult population. While great efforts have been devoted toward understanding the pathogenesis of periodontitis, there remains a pressing need for developing potent therapeutic strategies for targeting this dreadful disease. In this study, we utilized adeno-associated virus (AAV) expressing cathepsin K (Ctsk) small hairpin (sh)RNA (AAV-sh-Ctsk) to silence Ctsk in vivo and subsequently evaluated its impact in periodontitis as a potential therapeutic strategy for this disease. We used a known mouse model of periodontitis, in which wild-type BALB/cJ mice were infected with Porphyromonas gingivalis W50 in the maxillary and mandibular periodontium to induce the disease. AAV-sh-Ctsk was then administrated locally into the periodontal tissues in vivo, followed by analyses to assess progression of the disease. AAV-mediated Ctsk silencing drastically protected mice (> 80%) from P. gingivalis-induced bone resorption by osteoclasts. In addition, AAV-sh-Ctsk administration drastically reduced inflammation by impacting the expression of many inflammatory cytokines as well as T-cell and dendritic cell numbers in periodontal lesions. AAV-mediated Ctsk silencing can simultaneously target both the inflammation and bone resorption associated with periodontitis through its inhibitory effect on immune cells and osteoclast function. Thereby, AAV-sh-Ctsk administration can efficiently protect against periodontal tissue damage and alveolar bone loss, establishing this AAV-mediated local silencing of Ctsk as an important therapeutic strategy for effectively treating periodontal disease. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

UV-C-Induced alleviation of transcriptional gene silencing through plant–plant communication: Key roles of jasmonic acid and salicylic acid pathways

Energy Technology Data Exchange (ETDEWEB)

Xu, Wei; Wang, Ting [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China); Xu, Shaoxin [School of physics and materials science, Anhui University, Hefei, Anhui, 230601 (China); Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China); Bian, Po, E-mail: bianpo@ipp.ac.cn [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China)

2016-08-15

Highlights: • Transcriptional gene silencing (TGS) in plants can be epigenetically alleviated by volatile signals from UV-C- irradiated neighboring plants. • Alleviation of TGS can be induced by UV-C irradiation through plant–plant–plant communication. • JA and SA signals take part in interplant communication for alleviation of TGS. - Abstract: Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant–plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant–plant and plant–plant–plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant–plant and plant–plant–plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant–plant–plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA.

UV-C-Induced alleviation of transcriptional gene silencing through plant–plant communication: Key roles of jasmonic acid and salicylic acid pathways

International Nuclear Information System (INIS)

Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po

2016-01-01

Highlights: • Transcriptional gene silencing (TGS) in plants can be epigenetically alleviated by volatile signals from UV-C- irradiated neighboring plants. • Alleviation of TGS can be induced by UV-C irradiation through plant–plant–plant communication. • JA and SA signals take part in interplant communication for alleviation of TGS. - Abstract: Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant–plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant–plant and plant–plant–plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant–plant and plant–plant–plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant–plant–plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA.

Recombinant immunotoxin for cancer treatment with low immunogenicity by identification and silencing of human T-cell epitopes

OpenAIRE

Mazor, Ronit; Eberle, Jaime A.; Hu, Xiaobo; Vassall, Aaron N.; Onda, Masanori; Beers, Richard; Lee, Elizabeth C.; Kreitman, Robert J.; Lee, Byungkook; Baker, David; King, Chris; Hassan, Raffit; Benhar, Itai; Pastan, Ira

2014-01-01

Recombinant immunotoxins have produced complete remissions in leukemia patients where many doses can be given but are less active in patients with solid tumors because their immune system makes antidrug antibodies, which inactivate the immunotoxin. To suppress the immune response, we have identified and largely silenced the T-cell epitopes responsible for the immune response. A redesigned immunotoxin with T-cell epitope mutations is highly cytotoxic to cell lines and to cells isolated from ca...

Feminizing Wolbachia: a transcriptomics approach with insights on the immune response genes in Armadillidium vulgare

Directory of Open Access Journals (Sweden)

Chevalier Frédéric

2012-01-01

Full Text Available Abstract Background Wolbachia are vertically transmitted bacteria known to be the most widespread endosymbiont in arthropods. They induce various alterations of the reproduction of their host, including feminization of genetic males in isopod crustaceans. In the pill bug Armadillidium vulgare, the presence of Wolbachia is also associated with detrimental effects on host fertility and lifespan. Deleterious effects have been demonstrated on hemocyte density, phenoloxidase activity, and natural hemolymph septicemia, suggesting that infected individuals could have defective immune capacities. Since nothing is known about the molecular mechanisms involved in Wolbachia-A. vulgare interactions and its secondary immunocompetence modulation, we developed a transcriptomics strategy and compared A. vulgare gene expression between Wolbachia-infected animals (i.e., “symbiotic” animals and uninfected ones (i.e., “asymbiotic” animals as well as between animals challenged or not challenged by a pathogenic bacteria. Results Since very little genetic data is available on A. vulgare, we produced several EST libraries and generated a total of 28 606 ESTs. Analyses of these ESTs revealed that immune processes were over-represented in most experimental conditions (responses to a symbiont and to a pathogen. Considering canonical crustacean immune pathways, these genes encode antimicrobial peptides or are involved in pathogen recognition, detoxification, and autophagy. By RT-qPCR, we demonstrated a general trend towards gene under-expression in symbiotic whole animals and ovaries whereas the same gene set tends to be over-expressed in symbiotic immune tissues. Conclusion This study allowed us to generate the first reference transcriptome ever obtained in the Isopoda group and to identify genes involved in the major known crustacean immune pathways encompassing cellular and humoral responses. Expression of immune-related genes revealed a modulation of host

Transplantation of Nogo-66 receptor gene-silenced cells in a poly(D,L-lactic-co-glycolic acid) scaffold for the treatment of spinal cord injury★

Science.gov (United States)

Wang, Dong; Fan, Yuhong; Zhang, Jianjun

2013-01-01

Inhibition of neurite growth, which is in large part mediated by the Nogo-66 receptor, affects neural regeneration following bone marrow mesenchymal stem cell transplantation. The tissue engineering scaffold poly(D,L-lactide-co-glycolic acid) has good histocompatibility and can promote the growth of regenerating nerve fibers. The present study used small interfering RNA to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells and Schwann cells, which were subsequently transplanted with poly(D,L-lactide-co-glycolic acid) into the spinal cord lesion regions in rats. Simultaneously, rats treated with scaffold only were taken as the control group. Hematoxylin-eosin staining and immunohistochemistry revealed that at 4 weeks after transplantation, rats had good motor function of the hind limb after treatment with Nogo-66 receptor gene-silenced cells plus the poly(D,L-lactide-co-glycolic acid) scaffold compared with rats treated with scaffold only, and the number of bone marrow mesenchymal stem cells and neuron-like cells was also increased. At 8 weeks after transplantation, horseradish peroxidase tracing and transmission electron microscopy showed a large number of unmyelinated and myelinated nerve fibers, as well as intact regenerating axonal myelin sheath following spinal cord hemisection injury. These experimental findings indicate that transplantation of Nogo-66 receptor gene-silenced bone marrow mesenchymal stem cells and Schwann cells plus a poly(D,L-lactide-co-glycolic acid) scaffold can significantly enhance axonal regeneration of spinal cord neurons and improve motor function of the extremities in rats following spinal cord injury. PMID:25206713

Association of a Network of Interferon-Stimulated Genes with a Locus Encoding a Negative Regulator of Non-conventional IKK Kinases and IFNB1

Directory of Open Access Journals (Sweden)

Saloua Jeidane

2016-10-01

Full Text Available Functional genomic analysis of gene expression in mice allowed us to identify a quantitative trait locus (QTL linked in trans to the expression of 190 gene transcripts and in cis to the expression of only two genes, one of which was Ypel5. Most of the trans-expression QTL genes were interferon-stimulated genes (ISGs, and their expression in mouse macrophage cell lines was stimulated in an IFNB1-dependent manner by Ypel5 silencing. In human HEK293T cells, YPEL5 silencing enhanced the induction of IFNB1 by pattern recognition receptors and phosphorylation of TBK1/IKBKE kinases, whereas co-immunoprecipitation experiments revealed that YPEL5 interacted physically with IKBKE. We thus found that the Ypel5 gene (contained in a locus linked to a network of ISGs in mice is a negative regulator of IFNB1 production and innate immune responses that interacts functionally and physically with TBK1/IKBKE kinases.

Dynamics of immune system gene expression upon bacterial challenge and wounding in a social insect (Bombus terrestris.

Directory of Open Access Journals (Sweden)

Silvio Erler

2011-03-01

Full Text Available The innate immune system which helps individuals to combat pathogens comprises a set of genes representing four immune system pathways (Toll, Imd, JNK and JAK/STAT. There is a lack of immune genes in social insects (e.g. honeybees when compared to Diptera. Potentially, this might be compensated by an advanced system of social immunity (synergistic action of several individuals. The bumble bee, Bombus terrestris, is a primitively eusocial species with an annual life cycle and colonies headed by a single queen. We used this key pollinator to study the temporal dynamics of immune system gene expression in response to wounding and bacterial challenge.Antimicrobial peptides (AMP (abaecin, defensin 1, hymenoptaecin were strongly up-regulated by wounding and bacterial challenge, the latter showing a higher impact on the gene expression level. Sterile wounding down-regulated TEP A, an effector gene of the JAK/STAT pathway, and bacterial infection influenced genes of the Imd (relish and JNK pathway (basket. Relish was up-regulated within the first hour after bacterial challenge, but decreased strongly afterwards. AMP expression following wounding and bacterial challenge correlates with the expression pattern of relish whereas correlated expression with dorsal was absent. Although expression of AMPs was high, continuous bacterial growth was observed throughout the experiment.Here we demonstrate for the first time the temporal dynamics of immune system gene expression in a social insect. Wounding and bacterial challenge affected the innate immune system significantly. Induction of AMP expression due to wounding might comprise a pre-adaptation to accompanying bacterial infections. Compared with solitary species this social insect exhibits reduced immune system efficiency, as bacterial growth could not be inhibited. A negative feedback loop regulating the Imd-pathway is suggested. AMPs, the end product of the Imd-pathway, inhibited the up-regulation of the

Differential expression of immune and stress genes in the skin of Atlantic cod (Gadus morhua)

NARCIS (Netherlands)

Caipang, C.M.A.; Lazado, C.C.; Brinchmann, M.; Rombout, J.H.W.M.; Kiron, V.

2011-01-01

The present study describes the transcriptional profiles of selected immune and stress genes with putative important roles in the cutaneous immune defense of Atlantic cod (Gadus morhua). In addition it shows differential expression of many genes at the dorsal and ventral sides of fish, in general

big bang gene modulates gut immune tolerance in Drosophila.

Science.gov (United States)

Bonnay, François; Cohen-Berros, Eva; Hoffmann, Martine; Kim, Sabrina Y; Boulianne, Gabrielle L; Hoffmann, Jules A; Matt, Nicolas; Reichhart, Jean-Marc

2013-02-19

Chronic inflammation of the intestine is detrimental to mammals. Similarly, constant activation of the immune response in the gut by the endogenous flora is suspected to be harmful to Drosophila. Therefore, the innate immune response in the gut of Drosophila melanogaster is tightly balanced to simultaneously prevent infections by pathogenic microorganisms and tolerate the endogenous flora. Here we describe the role of the big bang (bbg) gene, encoding multiple membrane-associated PDZ (PSD-95, Discs-large, ZO-1) domain-containing protein isoforms, in the modulation of the gut immune response. We show that in the adult Drosophila midgut, BBG is present at the level of the septate junctions, on the apical side of the enterocytes. In the absence of BBG, these junctions become loose, enabling the intestinal flora to trigger a constitutive activation of the anterior midgut immune response. This chronic epithelial inflammation leads to a reduced lifespan of bbg mutant flies. Clearing the commensal flora by antibiotics prevents the abnormal activation of the gut immune response and restores a normal lifespan. We now provide genetic evidence that Drosophila septate junctions are part of the gut immune barrier, a function that is evolutionarily conserved in mammals. Collectively, our data suggest that septate junctions are required to maintain the subtle balance between immune tolerance and immune response in the Drosophila gut, which represents a powerful model to study inflammatory bowel diseases.

Polycomb complexes and silencing mechanisms

DEFF Research Database (Denmark)

Lund, Anders H; van Lohuizen, Maarten

2004-01-01

Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....

Immune function genes CD99L2, JARID2 and TPO show association with autism spectrum disorder

Directory of Open Access Journals (Sweden)

Ramos Paula S

2012-06-01

Full Text Available Abstract Background A growing number of clinical and basic research studies have implicated immunological abnormalities as being associated with and potentially responsible for the cognitive and behavioral deficits seen in autism spectrum disorder (ASD children. Here we test the hypothesis that immune-related gene loci are associated with ASD. Findings We identified 2,012 genes of known immune-function via Ingenuity Pathway Analysis. Family-based tests of association were computed on the 22,904 single nucleotide polymorphisms (SNPs from the 2,012 immune-related genes on 1,510 trios available at the Autism Genetic Resource Exchange (AGRE repository. Several SNPs in immune-related genes remained statistically significantly associated with ASD after adjusting for multiple comparisons. Specifically, we observed significant associations in the CD99 molecule-like 2 region (CD99L2, rs11796490, P = 4.01 × 10-06, OR = 0.68 (0.58-0.80, in the jumonji AT rich interactive domain 2 (JARID2 gene (rs13193457, P = 2.71 × 10-06, OR = 0.61 (0.49-0.75, and in the thyroid peroxidase gene (TPO (rs1514687, P = 5.72 × 10-06, OR = 1.46 (1.24-1.72. Conclusions This study suggests that despite the lack of a general enrichment of SNPs in immune function genes in ASD children, several novel genes with known immune functions are associated with ASD.

Construction of an integrated gene regulatory network link to stress-related immune system in cattle.

Science.gov (United States)

Behdani, Elham; Bakhtiarizadeh, Mohammad Reza

2017-10-01

The immune system is an important biological system that is negatively impacted by stress. This study constructed an integrated regulatory network to enhance our understanding of the regulatory gene network used in the stress-related immune system. Module inference was used to construct modules of co-expressed genes with bovine leukocyte RNA-Seq data. Transcription factors (TFs) were then assigned to these modules using Lemon-Tree algorithms. In addition, the TFs assigned to each module were confirmed using the promoter analysis and protein-protein interactions data. Therefore, our integrated method identified three TFs which include one TF that is previously known to be involved in immune response (MYBL2) and two TFs (E2F8 and FOXS1) that had not been recognized previously and were identified for the first time in this study as novel regulatory candidates in immune response. This study provides valuable insights on the regulatory programs of genes involved in the stress-related immune system.

The Entomopathogenic Fungi Isaria fumosorosea Plays a Vital Role in Suppressing the Immune System of Plutella xylostella: RNA-Seq and DGE Analysis of Immunity-Related Genes.

Science.gov (United States)

Xu, Jin; Xu, Xiaoxia; Shakeel, Muhammad; Li, Shuzhong; Wang, Shuang; Zhou, Xianqiang; Yu, Jialin; Xu, Xiaojing; Yu, Xiaoqiang; Jin, Fengliang

2017-01-01

Most, if not all, entomopathogenic fungi have been used as alternative control agents to decrease the insect resistance and harmful effects of the insecticides on the environment. Among them, Isaria fumosorosea has also shown great potential to control different insect pests. In the present study, we explored the immune response of P. xylostella to the infection of I. fumosorosea at different time points by using RNA-Sequencing and differential gene expression technology at the genomic level. To gain insight into the host-pathogen interaction at the genomic level, five libraries of P. xylostella larvae at 12, 18, 24, and 36 h post-infection and a control were constructed. In total, 161 immunity-related genes were identified and grouped into four categories; immune recognition families, toll and Imd pathway, melanization, and antimicrobial peptides (AMPs). The results of differentially expressed immunity-related genes depicted that 15, 13, 53, and 14 up-regulated and 38, 51, 56, and 49 were down-regulated in P. xylostella at 12, 18, 24, and 36 h post-treatment, respectively. RNA-Seq results of immunity-related genes revealed that the expression of AMPs was reduced after treatment with I. fumosorosea . To validate RNA-Seq results by RT-qPCR, 22 immunity-related genes were randomly selected. In conclusion, our results demonstrate that I. fumosorosea has the potential to suppress the immune response of P. xylostella and can become a potential biopesticide for controlling P. xylostella .

The Entomopathogenic Fungi Isaria fumosorosea Plays a Vital Role in Suppressing the Immune System of Plutella xylostella: RNA-Seq and DGE Analysis of Immunity-Related Genes

Directory of Open Access Journals (Sweden)

Jin Xu

2017-07-01

Full Text Available Most, if not all, entomopathogenic fungi have been used as alternative control agents to decrease the insect resistance and harmful effects of the insecticides on the environment. Among them, Isaria fumosorosea has also shown great potential to control different insect pests. In the present study, we explored the immune response of P. xylostella to the infection of I. fumosorosea at different time points by using RNA-Sequencing and differential gene expression technology at the genomic level. To gain insight into the host-pathogen interaction at the genomic level, five libraries of P. xylostella larvae at 12, 18, 24, and 36 h post-infection and a control were constructed. In total, 161 immunity-related genes were identified and grouped into four categories; immune recognition families, toll and Imd pathway, melanization, and antimicrobial peptides (AMPs. The results of differentially expressed immunity-related genes depicted that 15, 13, 53, and 14 up-regulated and 38, 51, 56, and 49 were down-regulated in P. xylostella at 12, 18, 24, and 36 h post-treatment, respectively. RNA-Seq results of immunity-related genes revealed that the expression of AMPs was reduced after treatment with I. fumosorosea. To validate RNA-Seq results by RT-qPCR, 22 immunity-related genes were randomly selected. In conclusion, our results demonstrate that I. fumosorosea has the potential to suppress the immune response of P. xylostella and can become a potential biopesticide for controlling P. xylostella.

Tailoring the Immune Response via Customization of Pathogen Gene Expression.

Science.gov (United States)

Runco, Lisa M; Stauft, Charles B; Coleman, J Robert

2014-01-01

The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.

Sperm competition, immunity, selfish genes and cancer.

Science.gov (United States)

Lewis, Z; Price, T A R; Wedell, N

2008-10-01

Sperm competition is widespread and has played an important role in shaping male reproductive characters such as testis size and numbers of sperm produced, and this is reflected in the rapid evolution of many reproductive genes. Additionally, sperm competition has been implicated in the rapid evolution of seminal fluids. However, our understanding of the molecular basis of many traits thought to be important in sperm competition is rudimentary. Furthermore, links between sperm competition and a range of issues not directly related to reproduction are only just beginning to be explored. These include associations between sperm competition and selfish genes, immunity and diseases such as cancer.We briefly review these topics and suggest areas we consider worthy of additional research.

Expression profile of immune response genes in patients with Severe Acute Respiratory Syndrome

Directory of Open Access Journals (Sweden)

Tai Dessmon

2005-01-01

Full Text Available Abstract Background Severe acute respiratory syndrome (SARS emerged in later February 2003, as a new epidemic form of life-threatening infection caused by a novel coronavirus. However, the immune-pathogenesis of SARS is poorly understood. To understand the host response to this pathogen, we investigated the gene expression profiles of peripheral blood mononuclear cells (PBMCs derived from SARS patients, and compared with healthy controls. Results The number of differentially expressed genes was found to be 186 under stringent filtering criteria of microarray data analysis. Several genes were highly up-regulated in patients with SARS, such as, the genes coding for Lactoferrin, S100A9 and Lipocalin 2. The real-time PCR method verified the results of the gene array analysis and showed that those genes that were up-regulated as determined by microarray analysis were also found to be comparatively up-regulated by real-time PCR analysis. Conclusions This differential gene expression profiling of PBMCs from patients with SARS strongly suggests that the response of SARS affected patients seems to be mainly an innate inflammatory response, rather than a specific immune response against a viral infection, as we observed a complete lack of cytokine genes usually triggered during a viral infection. Our study shows for the first time how the immune system responds to the SARS infection, and opens new possibilities for designing new diagnostics and treatments for this new life-threatening disease.

Grape seed proanthocyanidins reactivate silenced tumor suppressor genes in human skin cancer cells by targeting epigenetic regulators

International Nuclear Information System (INIS)

Vaid, Mudit; Prasad, Ram; Singh, Tripti; Jones, Virginia; Katiyar, Santosh K.

2012-01-01

Grape seed proanthocyanidins (GSPs) have been shown to have anti-skin carcinogenic effects in in vitro and in vivo models. However, the precise epigenetic molecular mechanisms remain unexplored. This study was designed to investigate whether GSPs reactivate silenced tumor suppressor genes following epigenetic modifications in skin cancer cells. For this purpose, A431 and SCC13 human squamous cell carcinoma cell lines were used as in vitro models. The effects of GSPs on DNA methylation, histone modifications and tumor suppressor gene expressions were studied in these cell lines using enzyme activity assays, western blotting, dot-blot analysis and real-time polymerase chain reaction (RT-PCR). We found that treatment of A431 and SCC13 cells with GSPs decreased the levels of: (i) global DNA methylation, (ii) 5-methylcytosine, (iii) DNA methyltransferase (DNMT) activity and (iv) messenger RNA (mRNA) and protein levels of DNMT1, DNMT3a and DNMT3b in these cells. Similar effects were noted when these cancer cells were treated identically with 5-aza-2′-deoxycytidine, an inhibitor of DNA methylation. GSPs decreased histone deacetylase activity, increased levels of acetylated lysines 9 and 14 on histone H3 (H3-Lys 9 and 14) and acetylated lysines 5, 12 and 16 on histone H4, and reduced the levels of methylated H3-Lys 9. Further, GSP treatment resulted in re-expression of the mRNA and proteins of silenced tumor suppressor genes, RASSF1A, p16 INK4a and Cip1/p21. Together, this study provides a new insight into the epigenetic mechanisms of GSPs and may have significant implications for epigenetic therapy in the treatment/prevention of skin cancers in humans. -- Highlights: ►Epigenetic modulations have been shown to have a role in cancer risk. ►Proanthocyanidins decrease the levels of DNA methylation and histone deacetylation. ►Proanthocyanidins inhibit histone deacetylase activity in skin cancer cells. ►Proanthocyanidins reactivate tumor suppressor genes in skin

HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

International Nuclear Information System (INIS)

Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

2004-01-01

Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

The fission yeast ubiquitin-conjugating enzymes UbcP3, Ubc15, and Rhp6 affect transcriptional silencing of the mating-type region

DEFF Research Database (Denmark)

Nielsen, Inga Sig; Nielsen, Olaf; Murray, Johanne M

2002-01-01

Genes transcribed by RNA polymerase II are silenced when introduced near the mat2 or mat3 mating-type loci of the fission yeast Schizosaccharomyces pombe. Silencing is mediated by a number of gene products and cis-acting elements. We report here the finding of novel trans-acting factors identified...... was not suppressed by a mutation in the 26S proteasome, suggesting that loss of silencing is not due to an increased degradation of silencing factors but rather to the posttranslational modification of proteins by ubiquitination. We discuss the implications of these results for the possible modes of action of UbcP3...

The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA

Directory of Open Access Journals (Sweden)

Logan M. Decker

2017-04-01

Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.

Candidate gene approach for parasite resistance in sheep--variation in immune pathway genes and association with fecal egg count.

Directory of Open Access Journals (Sweden)

Kathiravan Periasamy

Full Text Available Sheep chromosome 3 (Oar3 has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05 in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have

Performative Silences

DEFF Research Database (Denmark)

Dupret, Katia

2018-01-01

static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...

Surface coating of siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers: enhanced gene silencing and reduced adverse effects in vitro

Science.gov (United States)

Zeng, Xianghui; de Groot, Anne Marit; Sijts, Alice J. A. M.; Broere, Femke; Oude Blenke, Erik; Colombo, Stefano; van Eden, Willem; Franzyk, Henrik; Nielsen, Hanne Mørck; Foged, Camilla

2015-11-01

Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine and homoarginine residues was shown to self-assemble with small interfering RNA (siRNA). The resulting well-defined nanocomplexes were coated with anionic lipids giving rise to net anionic liposomes. These complexes and the corresponding liposomes were optimized towards efficient gene silencing and low adverse effects. The optimal anionic liposomes mediated a high silencing effect, which was comparable to that of the control (cationic Lipofectamine 2000), and did not display any noticeable cytotoxicity and immunogenicity in vitro. In contrast, the corresponding nanocomplexes mediated a reduced silencing effect with a more narrow safety window. The surface coating with anionic lipid bilayers led to partial decomplexation of the siRNA-peptidomimetic nanocomplex core of the liposomes, which facilitated siRNA release. Additionally, the optimal anionic liposomes showed efficient intracellular uptake and endosomal escape. Therefore, these findings suggest that a more efficacious and safe formulation can be achieved by surface coating of the siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers.Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine

Phenotypic changes associated with RNA interference silencing of chalcone synthase in apple (Malus × domestica).

Science.gov (United States)

Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P

2013-05-01

We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.

Silencing of a Germin-Like Protein Gene (CchGLP in Geminivirus-Resistant Pepper (Capsicum chinense Jacq. BG-3821 Increases Susceptibility to Single and Mixed Infections by Geminiviruses PHYVV and PepGMV

Directory of Open Access Journals (Sweden)

Laura Mejía-Teniente

2015-11-01

Full Text Available Germin-like proteins (GLPs are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.

Silencing of a Germin-Like Protein Gene (CchGLP) in Geminivirus-Resistant Pepper (Capsicum chinense Jacq.) BG-3821 Increases Susceptibility to Single and Mixed Infections by Geminiviruses PHYVV and PepGMV.

Science.gov (United States)

Mejía-Teniente, Laura; Joaquin-Ramos, Ahuizolt de Jesús; Torres-Pacheco, Irineo; Rivera-Bustamante, Rafael F; Guevara-Olvera, Lorenzo; Rico-García, Enrique; Guevara-Gonzalez, Ramon G

2015-11-25

Germin-like proteins (GLPs) are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.

Baltic salmon activates immune relevant genes in fin tissue when responding to Gyrodactylus salaris infection

DEFF Research Database (Denmark)

Kania, Per Walther; Larsen, Thomas Bjerre; Ingerslev, Hans C.

2007-01-01

A series of immune relevant genes are expressed when the Baltic salmon responds on infections with the ectoparasite Gyrodactylus salaris which leads to a decrease of the parasite infection......A series of immune relevant genes are expressed when the Baltic salmon responds on infections with the ectoparasite Gyrodactylus salaris which leads to a decrease of the parasite infection...

Gene expression in peripheral immune cells following cardioembolic stroke is sexually dimorphic.

Directory of Open Access Journals (Sweden)

Boryana Stamova

Full Text Available Epidemiological studies suggest that sex has a role in the pathogenesis of cardioembolic stroke. Since stroke is a vascular disease, identifying sexually dimorphic gene expression changes in blood leukocytes can inform on sex-specific risk factors, response and outcome biology. We aimed to examine the sexually dimorphic immune response following cardioembolic stroke by studying the differential gene expression in peripheral white blood cells.Blood samples from patients with cardioembolic stroke were obtained at ≤3 hours (prior to treatment, 5 hours and 24 hours (after treatment after stroke onset (n = 23; 69 samples and compared with vascular risk factor controls without symptomatic vascular diseases (n = 23, 23 samples (ANCOVA, false discovery rate p≤0.05, |fold change| ≥1.2. mRNA levels were measured on whole-genome Affymetrix microarrays. There were more up-regulated than down-regulated genes in both sexes, and females had more differentially expressed genes than males following cardioembolic stroke. Female gene expression was associated with cell death and survival, cell-cell signaling and inflammation. Male gene expression was associated with cellular assembly, organization and compromise. Immune response pathways were over represented at ≤3, 5 and 24 h after stroke in female subjects but only at 24 h in males. Neutrophil-specific genes were differentially expressed at 3, 5 and 24 h in females but only at 5 h and 24 h in males.There are sexually dimorphic immune cell expression profiles following cardioembolic stroke. Future studies are needed to confirm the findings using qRT-PCR in an independent cohort, to determine how they relate to risk and outcome, and to compare to other causes of ischemic stroke.

Epstein-Barr Virus (EBV) Latent Protein EBNA3A Directly Targets and Silences the STK39 Gene in B Cells Infected by EBV.

Science.gov (United States)

Bazot, Quentin; Paschos, Kostas; Allday, Martin J

2018-04-01

Epstein-Barr virus (EBV) establishes latent infection in human B cells and is associated with a wide range of cancers. The EBV nuclear antigen 3 (EBNA3) family proteins are critical for B cell transformation and function as transcriptional regulators. It is well established that EBNA3A and EBNA3C cooperate in the regulation of cellular genes. Here, we demonstrate that the gene STK39 is repressed only by EBNA3A. This is the first example of a gene regulated only by EBNA3A in EBV-transformed lymphoblastoid cell lines (LCLs) without the help of EBNA3C. This was demonstrated using a variety of LCLs carrying either knockout, revertant, or conditional EBNA3 recombinants. Investigating the kinetics of EBNA3A-mediated changes in STK39 expression showed that STK39 becomes derepressed quickly after EBNA3A inactivation. This derepression is reversible as EBNA3A reactivation represses STK39 in the same cells expressing a conditional EBNA3A. STK39 is silenced shortly after primary B cell infection by EBV, and no STK39 -encoded protein (SPAK) is detected 3 weeks postinfection. Chromatin immunoprecipitation (ChIP) analysis indicates that EBNA3A directly binds to a regulatory region downstream of the STK39 transcription start site. For the first time, we demonstrated that the polycomb repressive complex 2 with the deposition of the repressive mark H3K27me3 is not only important for the maintenance of an EBNA3A target gene ( STK39 ) but is also essential for the initial establishment of its silencing. Finally, we showed that DNA methyltransferases are involved in the EBNA3A-mediated repression of STK39 IMPORTANCE EBV is well known for its ability to transform B lymphocytes to continuously proliferating lymphoblastoid cell lines. This is achieved in part by the reprogramming of cellular gene transcription by EBV transcription factors, including the EBNA3 proteins that play a crucial role in this process. In the present study, we found that EBNA3A epigenetically silences STK39 This

Introduction of optical reporter gene into cancer and immune cells using lentiviral vector

International Nuclear Information System (INIS)

Min, Jung Joon; Le, Uyenchi N.; Moon, Sung Min; Heo, Young Jun; Song, Ho Chun; Bom, Hee Seung; Kim, Yeon Soo

2004-01-01

For some applications such as gene therapy or reporter gene imaging, a gene has to be introduced into the organism of interest. Adenoviral vectors are capable of transducing both replicating and non-dividing cells. The adenoviral vectors do not integrate their DNA into host DNA, but do lead to an immune response. Lentiviruses belong to the retrovirus family and are capable of infecting both dividing and non-dividing cells. The human immunodeficiency virus (HIV) is an example of a lentavirus. A disabled HIV virus has been developed and could be used for in vivo gene delivery. A portion of the viral genome which encodes for accessory proteins canbe deleted without affecting production of the vector and efficiency of infection. Lentiviral delivery into various rodent tissues shows sustained expression of the transgene of up to six months. Furthermore, there seems to be little or no immune response with these vectors. These lentiviral vectors hold significant promise for in vivo gene delivery. We constructed lentiviral vector encoding firefly luciferase (Fluc) and eGFP. Fluc-eGFP fusion gene was inserted into multiple cloning sites of pLentiM1.3 vector. Reporter gene (Fluc-eGFP) was designed to be driven by murine CMV promoter with enhanced efficacy of transgene expression as compared to human CMV promoter. We transfected pLenti1.3-Fluc into human cervix cancer cell line (HeLa) and murine T lymphocytes. We also constructed adenovirus encoding Fluc and transfected to HeLa and T cells. This LentiM1.3-Fluc was transfected into HeLa cells and murine T lymphocytes in vitro, showing consistent expression of eGFP under the fluorescence microscopy from the 2nd day of transfection. Firefly luciferase reporter gene was not expressed in immune cells when it is mediated by adenovirus. Lentivirus was validated as a useful vector for both immune and cancer cells

Silencing the Girdin gene enhances radio-sensitivity of hepatocellular carcinoma via suppression of glycolytic metabolism.

Science.gov (United States)

Yu, Li; Sun, Yifan; Li, Jingjing; Wang, Yan; Zhu, Yuxing; Shi, Yong; Fan, Xiaojun; Zhou, Jianda; Bao, Ying; Xiao, Jie; Cao, Ke; Cao, Peiguo

2017-08-15

Radiotherapy has been used increasingly to treat primary hepatocellular carcinoma. Clinically, the main cause of radiotherapy failure is cellular radioresistance, conferred via glycolytic metabolism. Our previous study demonstrated that Girdin is upregulated in primary hepatocellular carcinoma and promotes the invasion and metastasis of tumor cells. However, whether Girdin underlies the radio-sensitivity of hepatocellular carcinoma remains unclear. A short hairpin RNA (shRNA) was used to silence CCDC88A (encoding Girdin), and real-time PCR was performed to determine CCDC88A mRNA expression. Then, cell proliferation, colony formation, flow cytometric, scratch, and transwell assays were to examine the influence of Girdin silencing on cellular radiosensitivity. Glycolysis assays were conducted to exam cell glycolysis process. Western blotting was performed to explore the signaling pathway downstream of Girdin. Finally, animal experiments were performed to demonstrate the effect of CCDC88A silencing on the radiosensitivity of hepatoma in vivo. shRNA-induced Girdin silencing suppressed glycolysis and enhanced the radio-sensitivity of hepatic cell lines, HepG2 and Huh-7. Furthermore, silencing of Girdin inhibited the PI3K/AKT/HIF-1α signaling pathway, which is a central regulator of glycolysis. Girdin can regulate glycolysis in hepatocellular carcinoma cells through the PI3K/AKT/HIF-1α signaling pathway, which decreases the sensitivity of tumor cells to radiotherapy.

Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

Directory of Open Access Journals (Sweden)

Zeenia Jagga

Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a

Effects of FVIII immunity on hepatocyte and hematopoietic stem cell–directed gene therapy of murine hemophilia A

Science.gov (United States)

Lytle, Allison M; Brown, Harrison C; Paik, Na Yoon; Knight, Kristopher A; Wright, J Fraser; Spencer, H Trent; Doering, Christopher B

2016-01-01

Immune responses to coagulation factors VIII (FVIII) and IX (FIX) represent primary obstacles to hemophilia treatment. Previously, we showed that hematopoietic stem cell (HSC) retroviral gene therapy induces immune nonresponsiveness to FVIII in both naive and preimmunized murine hemophilia A settings. Liver-directed adeno-associated viral (AAV)-FIX vector gene transfer achieved similar results in preclinical hemophilia B models. However, as clinical immune responses to FVIII and FIX differ, we investigated the ability of liver-directed AAV-FVIII gene therapy to affect FVIII immunity in hemophilia A mice. Both FVIII naive and preimmunized mice were administered recombinant AAV8 encoding a liver-directed bioengineered FVIII expression cassette. Naive animals receiving high or mid-doses subsequently achieved near normal FVIII activity levels. However, challenge with adjuvant-free recombinant FVIII induced loss of FVIII activity and anti-FVIII antibodies in mid-dose, but not high-dose AAV or HSC lentiviral (LV) vector gene therapy cohorts. Furthermore, unlike what was shown previously for FIX gene transfer, AAV-FVIII administration to hemophilia A inhibitor mice conferred no effect on anti-FVIII antibody or inhibitory titers. These data suggest that functional differences exist in the immune modulation achieved to FVIII or FIX in hemophilia mice by gene therapy approaches incorporating liver-directed AAV vectors or HSC-directed LV. PMID:26909355

Host-induced silencing of essential genes in Puccinia triticina through transgenic expression of RNAi sequences reduces severity of leaf rust infection in wheat.

Science.gov (United States)

Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus

2018-05-01

Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

An MHC class I immune evasion gene of Marek׳s disease virus.

Science.gov (United States)

Hearn, Cari; Preeyanon, Likit; Hunt, Henry D; York, Ian A

2015-01-15

Marek׳s disease virus (MDV) is a widespread α-herpesvirus of chickens that causes T cell tumors. Acute, but not latent, MDV infection has previously been shown to lead to downregulation of cell-surface MHC class I (Virology 282:198-205 (2001)), but the gene(s) involved have not been identified. Here we demonstrate that an MDV gene, MDV012, is capable of reducing surface expression of MHC class I on chicken cells. Co-expression of an MHC class I-binding peptide targeted to the endoplasmic reticulum (bypassing the requirement for the TAP peptide transporter) partially rescued MHC class I expression in the presence of MDV012, suggesting that MDV012 is a TAP-blocking MHC class I immune evasion protein. This is the first unique non-mammalian MHC class I immune evasion gene identified, and suggests that α-herpesviruses have conserved this function for at least 100 million years. Copyright © 2014 Elsevier Inc. All rights reserved.

5-Azacytidine mediated reactivation of silenced transgenes in potato (Solanum tuberosum) at the whole plant level.

Science.gov (United States)

Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš

2017-08-01

Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.

Silencing of DNase Colicin E8 Gene Expression by a Complex Nucleoprotein Assembly Ensures Timely Colicin Induction.

Directory of Open Access Journals (Sweden)

Simona Kamenšek

2015-06-01

Full Text Available Colicins are plasmid-encoded narrow spectrum antibiotics that are synthesized by strains of Escherichia coli and govern intraspecies competition. In a previous report, we demonstrated that the global transcriptional factor IscR, co dependently with the master regulator of the DNA damage response, LexA, delays induction of the pore forming colicin genes after SOS induction. Here we show that IscR is not involved in the regulation of nuclease colicins, but that the AsnC protein is. We report that AsnC, in concert with LexA, is the key controller of the temporal induction of the DNA degrading colicin E8 gene (cea8, after DNA damage. We demonstrate that a large AsnC nucleosome-like structure, in conjunction with two LexA molecules, prevent cea8 transcription initiation and that AsnC binding activity is directly modulated by L asparagine. We show that L-asparagine is an environmental factor that has a marked impact on cea8 promoter regulation. Our results show that AsnC also modulates the expression of several other DNase and RNase colicin genes but does not substantially affect pore-forming colicin K gene expression. We propose that selection pressure has "chosen" highly conserved regulators to control colicin expression in E. coli strains, enabling similar colicin gene silencing among bacteria upon exchange of colicinogenic plasmids.

Sumoylation of Sir2 differentially regulates transcriptional silencing in yeast.

Science.gov (United States)

Hannan, Abdul; Abraham, Neethu Maria; Goyal, Siddharth; Jamir, Imlitoshi; Priyakumar, U Deva; Mishra, Krishnaveni

2015-12-02

Silent information regulator 2 (Sir2), the founding member of the conserved sirtuin family of NAD(+)-dependent histone deacetylase, regulates several physiological processes including genome stability, gene silencing, metabolism and life span in yeast. Within the nucleus, Sir2 is associated with telomere clusters in the nuclear periphery and rDNA in the nucleolus and regulates gene silencing at these genomic sites. How distribution of Sir2 between telomere and rDNA is regulated is not known. Here we show that Sir2 is sumoylated and this modification modulates the intra-nuclear distribution of Sir2. We identify Siz2 as the key SUMO ligase and show that multiple lysines in Sir2 are subject to this sumoylation activity. Mutating K215 alone counteracts the inhibitory effect of Siz2 on telomeric silencing. SUMO modification of Sir2 impairs interaction with Sir4 but not Net1 and, furthermore, SUMO modified Sir2 shows predominant nucleolar localization. Our findings demonstrate that sumoylation of Sir2 modulates distribution between telomeres and rDNA and this is likely to have implications for Sir2 function in other loci as well. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

PCA3 Silencing Sensitizes Prostate Cancer Cells to Enzalutamide-mediated Androgen Receptor Blockade.

Science.gov (United States)

Özgür, Emre; Celik, Ayca Iribas; Darendeliler, Emin; Gezer, Ugur

2017-07-01

Prostate cancer (PCa) is an androgen-dependent disease. Novel anti-androgens (i.e. enzalutamide) have recently been developed for the treatment of patients with metastatic castration-resistant prostate cancer (CRPC). Evidence is accumulating that prostate cancer antigen 3 (PCA3) is involved in androgen receptor (AR) signaling. Here, in combination with enzalutamide-mediated AR blockade, we investigated the effect of PCA3 targeting on the viability of PCa cells. In hormone-sensitive LNCaP cells, AR-overexpressing LNCaP-AR + cells and VCaP cells (representing CRPC), PCA3 was silenced using siRNA oligonucleotides. Gene expression and cell viability was assessed in PCA3-silenced and/or AR-blocked cells. PCA3 targeting reduced the expression of AR-related genes (i.e. prostate-specific antigen (PSA) and prostate-specific transcript 1 (non-protein coding) (PCGEM1)) and potentiated the effect of enzalutamide. Proliferation of PCa cells was suppressed upon PCA3 silencing with a greater effect in LNCaP-AR + cells. Furthermore, PCA3 silencing sensitized PCa cells to enzalutamide-induced loss of cell growth. PCA3, as a therapeutic target in PCa, might be used to potentiate AR antagonists. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Population genomics of the immune evasion (var genes of Plasmodium falciparum.

Directory of Open Access Journals (Sweden)

Alyssa E Barry

2007-03-01

Full Text Available Var genes encode the major surface antigen (PfEMP1 of the blood stages of the human malaria parasite Plasmodium falciparum. Differential expression of up to 60 diverse var genes in each parasite genome underlies immune evasion. We compared the diversity of the DBLalpha domain of var genes sampled from 30 parasite isolates from a malaria endemic area of Papua New Guinea (PNG and 59 from widespread geographic origins (global. Overall, we obtained over 8,000 quality-controlled DBLalpha sequences. Within our sampling frame, the global population had a total of 895 distinct DBLalpha "types" and negligible overlap among repertoires. This indicated that var gene diversity on a global scale is so immense that many genomes would need to be sequenced to capture its true extent. In contrast, we found a much lower diversity in PNG of 185 DBLalpha types, with an average of approximately 7% overlap among repertoires. While we identify marked geographic structuring, nearly 40% of types identified in PNG were also found in samples from different countries showing a cosmopolitan distribution for much of the diversity. We also present evidence to suggest that recombination plays a key role in maintaining the unprecedented levels of polymorphism found in these immune evasion genes. This population genomic framework provides a cost effective molecular epidemiological tool to rapidly explore the geographic diversity of var genes.

Effects of FVIII immunity on hepatocyte and hematopoietic stem cell–directed gene therapy of murine hemophilia A

Directory of Open Access Journals (Sweden)

Allison M Lytle

2016-01-01

Full Text Available Immune responses to coagulation factors VIII (FVIII and IX (FIX represent primary obstacles to hemophilia treatment. Previously, we showed that hematopoietic stem cell (HSC retroviral gene therapy induces immune nonresponsiveness to FVIII in both naive and preimmunized murine hemophilia A settings. Liver-directed adeno-associated viral (AAV-FIX vector gene transfer achieved similar results in preclinical hemophilia B models. However, as clinical immune responses to FVIII and FIX differ, we investigated the ability of liver-directed AAV-FVIII gene therapy to affect FVIII immunity in hemophilia A mice. Both FVIII naive and preimmunized mice were administered recombinant AAV8 encoding a liver-directed bioengineered FVIII expression cassette. Naive animals receiving high or mid-doses subsequently achieved near normal FVIII activity levels. However, challenge with adjuvant-free recombinant FVIII induced loss of FVIII activity and anti-FVIII antibodies in mid-dose, but not high-dose AAV or HSC lentiviral (LV vector gene therapy cohorts. Furthermore, unlike what was shown previously for FIX gene transfer, AAV-FVIII administration to hemophilia A inhibitor mice conferred no effect on anti-FVIII antibody or inhibitory titers. These data suggest that functional differences exist in the immune modulation achieved to FVIII or FIX in hemophilia mice by gene therapy approaches incorporating liver-directed AAV vectors or HSC-directed LV.

Tobacco rattle virus (TRV) based silencing of cotton enoyl-CoA reductase (ECR) gene and the role of very long chain fatty acids in normal leaf development and resistance to wilt disease

Science.gov (United States)

A Tobacco rattle virus (TRV) based virus-induced gene silencing (VIGS) assay was employed as a reverse genetic approach to study gene function in cotton (Gossypium hirsutum). This approach was used to investigate the function of Enoyl-CoA reductase (GhECR) in pathogen defense. Amino acid sequence al...

Gene expression profiling provides insights into the immune mechanism of Plutella xylostella midgut to microbial infection.

Science.gov (United States)

Lin, Junhan; Xia, Xiaofeng; Yu, Xiao-Qiang; Shen, Jinhong; Li, Yong; Lin, Hailan; Tang, Shanshan; Vasseur, Liette; You, Minsheng

2018-03-20

Insect gut immunity plays a key role in defense against microorganism infection. The knowledge of insect gut immunity has been obtained mostly from Drosophila melanogaster. Little is known about gut immunity in the diamondback moth, Plutella xylostella (L.), a pest destroying cruciferous crops worldwide. In this study, expressions of the immune-related genes in the midgut of P. xylostella orally infected with Staphylococcus aureus, Escherichia coli and Pichia pastoris were profiled by RNA-seq and qRT-PCR approaches. The results revealed that the Toll, IMD, JNK and JAK-STAT pathways and possibly the prophenoloxidase activation system in P. xylostella could be activated by oral infections, and moricins, gloverins and lysozyme2 might act as important effectors against microorganisms. Subsequent knock-down of IMD showed that this gene was involved in regulating the expression of down-stream genes in the IMD pathway. Our work indicates that the Toll, IMD, JNK and JAK-STAT pathways may synergistically modulate immune responses in the P. xylostella midgut, implying a complex and diverse immune system in the midgut of insects. Copyright © 2018 Elsevier B.V. All rights reserved.

Indispensable Role of Proteases in Plant Innate Immunity.

Science.gov (United States)

Balakireva, Anastasia V; Zamyatnin, Andrey A

2018-02-23

Plant defense is achieved mainly through the induction of microbe-associated molecular patterns (MAMP)-triggered immunity (MTI), effector-triggered immunity (ETI), systemic acquired resistance (SAR), induced systemic resistance (ISR), and RNA silencing. Plant immunity is a highly complex phenomenon with its own unique features that have emerged as a result of the arms race between plants and pathogens. However, the regulation of these processes is the same for all living organisms, including plants, and is controlled by proteases. Different families of plant proteases are involved in every type of immunity: some of the proteases that are covered in this review participate in MTI, affecting stomatal closure and callose deposition. A large number of proteases act in the apoplast, contributing to ETI by managing extracellular defense. A vast majority of the endogenous proteases discussed in this review are associated with the programmed cell death (PCD) of the infected cells and exhibit caspase-like activities. The synthesis of signal molecules, such as salicylic acid, jasmonic acid, and ethylene, and their signaling pathways, are regulated by endogenous proteases that affect the induction of pathogenesis-related genes and SAR or ISR establishment. A number of proteases are associated with herbivore defense. In this review, we summarize the data concerning identified plant endogenous proteases, their effect on plant-pathogen interactions, their subcellular localization, and their functional properties, if available, and we attribute a role in the different types and stages of innate immunity for each of the proteases covered.

Senataxin plays an essential role with DNA damage response proteins in meiotic recombination and gene silencing.

Directory of Open Access Journals (Sweden)

Olivier J Becherel

2013-04-01

Full Text Available Senataxin, mutated in the human genetic disorder ataxia with oculomotor apraxia type 2 (AOA2, plays an important role in maintaining genome integrity by coordination of transcription, DNA replication, and the DNA damage response. We demonstrate that senataxin is essential for spermatogenesis and that it functions at two stages in meiosis during crossing-over in homologous recombination and in meiotic sex chromosome inactivation (MSCI. Disruption of the Setx gene caused persistence of DNA double-strand breaks, a defect in disassembly of Rad51 filaments, accumulation of DNA:RNA hybrids (R-loops, and ultimately a failure of crossing-over. Senataxin localised to the XY body in a Brca1-dependent manner, and in its absence there was incomplete localisation of DNA damage response proteins to the XY chromosomes and ATR was retained on the axial elements of these chromosomes, failing to diffuse out into chromatin. Furthermore persistence of RNA polymerase II activity, altered ubH2A distribution, and abnormal XY-linked gene expression in Setx⁻/⁻ revealed an essential role for senataxin in MSCI. These data support key roles for senataxin in coordinating meiotic crossing-over with transcription and in gene silencing to protect the integrity of the genome.

Comparative Assessment of Induced Immune Responses Following Intramuscular Immunization with Fusion and Cocktail of LeIF, LACK and TSA Genes Against Cutaneous Leishmaniasis in BALB/c Mice.

Science.gov (United States)

Maspi, Nahid; Ghaffarifar, Fatemeh; Sharifi, Zohreh; Dalimi, Abdolhossein; Dayer, Mohammad Saaid

2018-02-01

In the present study, we evaluated induced immune responses following DNA vaccine containing cocktail or fusion of LeIF, LACK and TSA genes or each gene alone. Mice were injected with 100 µg of each plasmid containing the gene of insert, plasmid DNA alone as the first control group or phosphate buffer saline as the second control group. Then, cellular and humoral responses, lesion size were measured for all groups. All vaccinated mice induced Th1 immune responses against Leishmania characterized by higher IFN-γ and IgG2a levels compared with control groups (p < 0.05). In addition, IFN-γ levels increased in groups immunized with fusion and cocktail vaccines in comparison with LACK (p < 0.001) and LeIF (p < 0.01) groups after challenge. In addition, fusion and cocktail groups produced higher IgG2a values than groups vaccinated with a gene alone (p < 0.05). Lesion progression delayed for all immunized groups compared with control groups from 5th week post-infection (p < 0.05). Mean lesion size decreased in immunized mice with fusion DNA than three groups vaccinated with one gene alone (p < 0.05). While, lesion size decreased significantly in cocktail recipient group than LeIF recipient group (p < 0.05). There was no difference in lesion size between fusion and cocktail groups. Overall, immunized mice with cocktail and fusion vaccines showed stronger Th1 response by production of higher IFN-γ and IgG2a and showed smaller mean lesion size. Therefore, use of multiple antigens can improve induced immune responses by DNA vaccination.

The chromatin accessibility signature of human immune aging stems from CD8+ T cells.

Science.gov (United States)

Ucar, Duygu; Márquez, Eladio J; Chung, Cheng-Han; Marches, Radu; Rossi, Robert J; Uyar, Asli; Wu, Te-Chia; George, Joshy; Stitzel, Michael L; Palucka, A Karolina; Kuchel, George A; Banchereau, Jacques

2017-10-02

Aging is linked to deficiencies in immune responses and increased systemic inflammation. To unravel the regulatory programs behind these changes, we applied systems immunology approaches and profiled chromatin accessibility and the transcriptome in PBMCs and purified monocytes, B cells, and T cells. Analysis of samples from 77 young and elderly donors revealed a novel and robust aging signature in PBMCs, with simultaneous systematic chromatin closing at promoters and enhancers associated with T cell signaling and a potentially stochastic chromatin opening mostly found at quiescent and repressed sites. Combined analyses of chromatin accessibility and the transcriptome uncovered immune molecules activated/inactivated with aging and identified the silencing of the IL7R gene and the IL-7 signaling pathway genes as potential biomarkers. This signature is borne by memory CD8 + T cells, which exhibited an aging-related loss in binding of NF-κB and STAT factors. Thus, our study provides a unique and comprehensive approach to identifying candidate biomarkers and provides mechanistic insights into aging-associated immunodeficiency. © 2017 Ucar et al.

Silencing of HaAce1 gene by host-delivered artificial microRNA disrupts growth and development of Helicoverpa armigera.

Science.gov (United States)

Saini, Ravi Prakash; Raman, Venkat; Dhandapani, Gurusamy; Malhotra, Era Vaidya; Sreevathsa, Rohini; Kumar, Polumetla Ananda; Sharma, Tilak R; Pattanayak, Debasis

2018-01-01

The polyphagous insect-pest, Helicoverpa armigera, is a serious threat to a number of economically important crops. Chemical application and/or cultivation of Bt transgenic crops are the two strategies available now for insect-pest management. However, environmental pollution and long-term sustainability are major concerns against these two options. RNAi is now considered as a promising technology to complement Bt to tackle insect-pests menace. In this study, we report host-delivered silencing of HaAce1 gene, encoding the predominant isoform of H. armigera acetylcholinesterase, by an artificial microRNA, HaAce1-amiR1. Arabidopsis pre-miRNA164b was modified by replacing miR164b/miR164b* sequences with HaAce1-amiR1/HaAce1-amiR1* sequences. The recombinant HaAce1-preamiRNA1 was put under the control of CaMV 35S promoter and NOS terminator of plant binary vector pBI121, and the resultant vector cassette was used for tobacco transformation. Two transgenic tobacco lines expressing HaAce1-amiR1 was used for detached leaf insect feeding bioassays. Larval mortality of 25% and adult deformity of 20% were observed in transgenic treated insect group over that control tobacco treated insect group. The reduction in the steady-state level of HaAce1 mRNA was 70-80% in the defective adults compared to control. Our results demonstrate promise for host-delivered amiRNA-mediated silencing of HaAce1 gene for H. armigera management.

Genome-wide analysis of histone H3 acetylation patterns in AML identifies PRDX2 as an epigenetically silenced tumor suppressor gene

DEFF Research Database (Denmark)

Agrawal-Singh, Shuchi; Isken, Fabienne; Agelopoulos, Konstantin

2012-01-01

to have lower H3Ac levels in AML compared with progenitor cells, which suggested that a large number of genes are epigenetically silenced in AML. Intriguingly, we identified peroxiredoxin 2 (PRDX2) as a novel potential tumor suppressor gene in AML. H3Ac was decreased at the PRDX2 gene promoter in AML......With the use of ChIP on microarray assays in primary leukemia samples, we report that acute myeloid leukemia (AML) blasts exhibit significant alterations in histone H3 acetylation (H3Ac) levels at > 1000 genomic loci compared with CD34+ progenitor cells. Importantly, core promoter regions tended......, which correlated with low mRNA and protein expression. We also observed DNA hypermethylation at the PRDX2 promoter in AML. Low protein expression of the antioxidant PRDX2 gene was clinically associated with poor prognosis in patients with AML. Functionally, PRDX2 acted as inhibitor of myeloid cell...

Effects of date palm fruit extracts on skin mucosal immunity, immune related genes expression and growth performance of common carp (Cyprinus carpio) fry.

Science.gov (United States)

Hoseinifar, Seyed Hossein; Khalili, Mohsen; Rufchaei, Rudabeh; Raeisi, Mojtaba; Attar, Marzieh; Cordero, Héctor; Esteban, M Ángeles

2015-12-01

The aim of this study was to investigate the effects of date palm fruit extracts (DPFE) on skin mucosal immunity, immune related genes expression and growth performance of fry common carp (Cyprinus carpio). One hundred and twenty specimens (4.06 ± 0.13 g) were supplied and allocated into six aquaria; specimens in three aquaria were fed non-supplemented diet (control) while the fish in the other 3 aquaria were fed with DPFE at 200 ml kg(-1). At the end of feeding trial (8 weeks) skin mucus immune parameters (total immunoglobulins, lysozyme, protease and alkaline phosphatase activity) and immune related gene expression (tumor necrosis factor α [tnfa], lysozyme [ly] and interleukin-1-beta, [il1b]) in the head-kidney were studied. The results revealed that feeding carp fry with 200 ml kg(-1) DPFE remarkably elevated the three skin mucus immune parameters tested (P 0.05) compared to control fish (fed control diet). Furthermore, growth performance parameters were significantly improved in fry fed DPFE (P < 0.05). More studies are needed to understand different aspects of DPFE administration in fry mucosal immunity. Copyright © 2015 Elsevier Ltd. All rights reserved.

Transcriptome analysis of Pacific white shrimp (Litopenaeus vannamei) challenged by Vibrio parahaemolyticus reveals unique immune-related genes.

Science.gov (United States)

Qin, Zhendong; Babu, V Sarath; Wan, Quanyuan; Zhou, Meng; Liang, Risheng; Muhammad, Asim; Zhao, Lijuan; Li, Jun; Lan, Jiangfeng; Lin, Li

2018-06-01

Pacific white shrimp (Litopenaeus vannamei) is an important cultural species worldwide. However, Vibrio spp. infections have caused a great economic loss in Pacific white shrimp culture industry. The immune responses of Pacific white shrimp to the Vibrio spp. is not fully characterized. In this study, the transcriptomic profiles of L. vannamei hemocytes were explored by injecting with or without Vibrio parahaemolyticus. Totally, 42,632 high-quality unigenes were obtained from RNAseq data. Comparative genome analysis showed 2258 differentially expressed genes (DEGs) following the Vibrio challenge, including 1017 up-regulated and 1241 down-regulated genes. Eight DEGs were randomly selected for further validation by quantitative real-time RT-PCR (qRT-PCR) and the results showed that are consistent with the RNA-seq data. Due to the lack of predictable adaptive immunity, shrimps rely on an innate immune system to defend themselves against invading microbes by recognizing and clearing them through humoral and cellular immune responses. Here we focused our studies on the humoral immunity, five genes (SR, MNK, CTL3, GILT, and ALFP) were selected from the transcriptomic data, which were significantly up-regulated by V. parahaemolyticus infection. These genes were widely expressed in six different tissues and were up-regulated by both Gram negative bacteria (V. parahaemolyticus) and Gram positive bacteria (Staphylococcus aureus). To further extend our studies, we knock-down those five genes by dsRNA in L. vannamei and analyzed the functions of specific genes against V. parahaemolyticus and S. aureus by bacterial clearance analysis. We found that the ability of L. vannamei was significantly reduced in bacterial clearance when treated with those specific dsRNA. These results indicate that those five genes play essential roles in antibacterial immunity and have its specific functions against different types of pathogens. The obtained data will shed a new light on the immunity

"Listening Silence" and Its Discursive Effects

Science.gov (United States)

Applebaum, Barbara

2016-01-01

While researchers have studied how white silence protects white innocence and white ignorance, in this essay Barbara Applebaum explores a form of white silence that she refers to as "listening silence" in which silence protects white innocence but does not necessarily promote resistance to learning. White listening silence can appear to…

Subtle variation within conserved effector operon gene products contributes to T6SS-mediated killing and immunity.

Science.gov (United States)

Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T

2017-11-01

Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.

Gene expression profiles of immune-regulatory genes in whole blood of cattle with a subclinical infection of Mycobacterium avium subsp. paratuberculosis.

Directory of Open Access Journals (Sweden)

Hyun-Eui Park

Full Text Available Johne's disease is a chronic wasting disease of ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP, resulting in inflammation of intestines and persistent diarrhea. The initial host response against MAP infections is mainly regulated by the Th1 response, which is characterized by the production of IFN-γ. With the progression of disease, MAP can survive in the host through the evasion of the host's immune response by manipulating the host immune response. However, the host response during subclinical phases has not been fully understood. Immune regulatory genes, including Th17-derived cytokines, interferon regulatory factors, and calcium signaling-associated genes, are hypothesized to play an important role during subclinical phases of Johne's disease. Therefore, the present study was conducted to analyze the expression profiles of immune regulatory genes during MAP infection in whole blood. Different expression patterns of genes were identified depending on the infection stages. Downregulation of IL-17A, IL-17F, IL-22, IL-26, HMGB1, and IRF4 and upregulation of PIP5K1C indicate suppression of the Th1 response due to MAP infection and loss of granuloma integrity. In addition, increased expression of IRF5 and IRF7 suggest activation of IFN-α/β signaling during subclinical stages, which induced indoleamine 2,3-dioxygenase mediated depletion of tryptophan metabolism. Increased expression of CORO1A indicate modulation of calcium signaling, which enhanced the survival of MAP. Taken together, distinct host gene expression induced by MAP infection indicates enhanced survival of MAP during subclinical stages.

Complement C3 gene: Expression characterization and innate immune response in razor clam Sinonovacula constricta.

Science.gov (United States)

Peng, Maoxiao; Niu, Donghong; Wang, Fei; Chen, Zhiyi; Li, Jiale

2016-08-01

Complement component 3 (C3) is central to the complement system, playing an important role in immune defense, immune regulation and immune pathology. Several C3 genes have been characterized in invertebrates but very few in shellfish. The C3 gene was identified from the razor clam Sinonovacula constricta, referred to here as Sc-C3. It was found to be highly homologous with the C3 gene of Ruditapes decussatus. All eight model motifs of the C3 gene were found to be included in the thiolester bond and the C345C region. Sc-C3 was widely expressed in all healthy tissues with expression being highest in hemolymph. A significant difference in expression was revealed at the umbo larvae development stage. The expression of Sc-C3 was highly regulated in the hemolymph and liver, with a distinct response pattern being noted after a challenge with Micrococcus lysodeikticus and Vibrio parahemolyticus. It is therefore suggested that a complicated and unique response pathway may be present in S. constricta. Further, serum of S. constricta containing Sc-C3 was extracted. This was activated by LPS or bacterium for verification for function. The more obvious immune function of Sc-C3 was described as an effective membrane rupture in hemocyte cells of rabbit, V. parahemolyticus and Vibrio anguillarum. Thus, Sc-C3 plays an essential role in the immune defense of S. constricta. Copyright © 2016 Elsevier Ltd. All rights reserved.

Pnc1p-mediated nicotinamide clearance modifies the epigenetic properties of rDNA silencing in Saccharomyces cerevisiae.

Science.gov (United States)

McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S

2008-10-01

The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.

Forager bees (Apis mellifera) highly express immune and detoxification genes in tissues associated with nectar processing.

Science.gov (United States)

Vannette, Rachel L; Mohamed, Abbas; Johnson, Brian R

2015-11-09

Pollinators, including honey bees, routinely encounter potentially harmful microorganisms and phytochemicals during foraging. However, the mechanisms by which honey bees manage these potential threats are poorly understood. In this study, we examine the expression of antimicrobial, immune and detoxification genes in Apis mellifera and compare between forager and nurse bees using tissue-specific RNA-seq and qPCR. Our analysis revealed extensive tissue-specific expression of antimicrobial, immune signaling, and detoxification genes. Variation in gene expression between worker stages was pronounced in the mandibular and hypopharyngeal gland (HPG), where foragers were enriched in transcripts that encode antimicrobial peptides (AMPs) and immune response. Additionally, forager HPGs and mandibular glands were enriched in transcripts encoding detoxification enzymes, including some associated with xenobiotic metabolism. Using qPCR on an independent dataset, we verified differential expression of three AMP and three P450 genes between foragers and nurses. High expression of AMP genes in nectar-processing tissues suggests that these peptides may contribute to antimicrobial properties of honey or to honey bee defense against environmentally-acquired microorganisms. Together, these results suggest that worker role and tissue-specific expression of AMPs, and immune and detoxification enzymes may contribute to defense against microorganisms and xenobiotic compounds acquired while foraging.

High amino acid diversity and positive selection at a putative coral immunity gene (tachylectin-2

Directory of Open Access Journals (Sweden)

Hellberg Michael E

2010-05-01

Full Text Available Abstract Background Genes involved in immune functions, including pathogen recognition and the activation of innate defense pathways, are among the most genetically variable known, and the proteins that they encode are often characterized by high rates of amino acid substitutions, a hallmark of positive selection. The high levels of variation characteristic of immunity genes make them useful tools for conservation genetics. To date, highly variable immunity genes have yet to be found in corals, keystone organisms of the world's most diverse marine ecosystem, the coral reef. Here, we examine variation in and selection on a putative innate immunity gene from Oculina, a coral genus previously used as a model for studies of coral disease and bleaching. Results In a survey of 244 Oculina alleles, we find high nonsynonymous variation and a signature of positive selection, consistent with a putative role in immunity. Using computational protein structure prediction, we generate a structural model of the Oculina protein that closely matches the known structure of tachylectin-2 from the Japanese horseshoe crab (Tachypleus tridentatus, a protein with demonstrated function in microbial recognition and agglutination. We also demonstrate that at least three other genera of anthozoan cnidarians (Acropora, Montastrea and Nematostella possess proteins structurally similar to tachylectin-2. Conclusions Taken together, the evidence of high amino acid diversity, positive selection and structural correspondence to the horseshoe crab tachylectin-2 suggests that this protein is 1 part of Oculina's innate immunity repertoire, and 2 evolving adaptively, possibly under selective pressure from coral-associated microorganisms. Tachylectin-2 may serve as a candidate locus to screen coral populations for their capacity to respond adaptively to future environmental change.

A Small RNA-Based Immune System Defends Germ Cells against Mobile Genetic Elements

Directory of Open Access Journals (Sweden)

Astrid D. Haase

2016-01-01

Full Text Available Transposons are mobile genetic elements that threaten the survival of species by destabilizing the germline genomes. Limiting the spread of these selfish elements is imperative. Germ cells employ specialized small regulatory RNA pathways to restrain transposon activity. PIWI proteins and Piwi-interacting RNAs (piRNAs silence transposons at the transcriptional and posttranscriptional level with loss-of-function mutant animals universally exhibiting sterility often associated with germ cell defects. This short review aims to illustrate basic strategies of piRNA-guided defense against transposons. Mechanisms of piRNA silencing are most readily studied in Drosophila melanogaster, which serves as a model to delineate molecular concepts and as a reference for mammalian piRNA systems. PiRNA pathways utilize two major strategies to handle the challenges of transposon control: (1 the hard-wired molecular memory of prior transpositions enables recognition of mobile genetic elements and discriminates transposons from host genes; (2 a feed-forward adaptation mechanism shapes piRNA populations to selectively combat the immediate threat of transposon transcripts. In flies, maternally contributed PIWI-piRNA complexes bolster both of these lines of defense and ensure transgenerational immunity. While recent studies have provided a conceptual framework of what could be viewed as an ancient immune system, we are just beginning to appreciate its many molecular innovations.

Innate immune activity conditions the effect of regulatory variants upon monocyte gene expression.

Science.gov (United States)

Fairfax, Benjamin P; Humburg, Peter; Makino, Seiko; Naranbhai, Vivek; Wong, Daniel; Lau, Evelyn; Jostins, Luke; Plant, Katharine; Andrews, Robert; McGee, Chris; Knight, Julian C

2014-03-07

To systematically investigate the impact of immune stimulation upon regulatory variant activity, we exposed primary monocytes from 432 healthy Europeans to interferon-γ (IFN-γ) or differing durations of lipopolysaccharide and mapped expression quantitative trait loci (eQTLs). More than half of cis-eQTLs identified, involving hundreds of genes and associated pathways, are detected specifically in stimulated monocytes. Induced innate immune activity reveals multiple master regulatory trans-eQTLs including the major histocompatibility complex (MHC), coding variants altering enzyme and receptor function, an IFN-β cytokine network showing temporal specificity, and an interferon regulatory factor 2 (IRF2) transcription factor-modulated network. Induced eQTL are significantly enriched for genome-wide association study loci, identifying context-specific associations to putative causal genes including CARD9, ATM, and IRF8. Thus, applying pathophysiologically relevant immune stimuli assists resolution of functional genetic variants.

Breaking an epigenetic chromatin switch: curious features of hysteresis in Saccharomyces cerevisiae telomeric silencing.

Directory of Open Access Journals (Sweden)

Vijayalakshmi H Nagaraj

Full Text Available In addition to gene network switches, local epigenetic modifications to DNA and histones play an important role in all-or-none cellular decision-making. Here, we study the dynamical design of a well-characterized epigenetic chromatin switch: the yeast SIR system, in order to understand the origin of the stability of epigenetic states. We study hysteresis in this system by perturbing it with a histone deacetylase inhibitor. We find that SIR silencing has many characteristics of a non-linear bistable system, as observed in conventional genetic switches, which are based on activities of a few promoters affecting each other through the abundance of their gene products. Quite remarkably, our experiments in yeast telomeric silencing show a very distinctive pattern when it comes to the transition from bistability to monostability. In particular, the loss of the stable silenced state, upon increasing the inhibitor concentration, does not seem to show the expected saddle node behavior, instead looking like a supercritical pitchfork bifurcation. In other words, the 'off' state merges with the 'on' state at a threshold concentration leading to a single state, as opposed to the two states remaining distinct up to the threshold and exhibiting a discontinuous jump from the 'off' to the 'on' state. We argue that this is an inevitable consequence of silenced and active regions coexisting with dynamic domain boundaries. The experimental observations in our study therefore have broad implications for the understanding of chromatin silencing in yeast and beyond.

Igf2/H19 Imprinting Control Region (ICR: An Insulator or a Position-Dependent Silencer?

Directory of Open Access Journals (Sweden)

Subhasis Banerjee

2001-01-01

Full Text Available The imprinting control region (ICR located far upstream of the H19 gene, in conjunction with enhancers, modulates the transcription of Igf2 and H19 genes in an allele-specific manner. On paternal inheritance, the methylated ICR silences the H19 gene and indirectly facilitates transcription from the distant Igf2 promoter, whereas on the maternal chromosome the unmethylated ICR, together with enhancers, activates transcription of the H19 gene and thereby contributes to the repression of Igf2. This repression of maternal Igf2 has recently been postulated to be due to a chromatin boundary or insulator function of the unmethylated ICR. Central to the insulator model is the site-specific binding of a ubiquitous nuclear factor CTCF which exhibits remarkable flexibility in functioning as transcriptional activator or silencer. We suggest that the ICR positioned close to the enhancers in an episomal context might function as a transcriptional silencer by virtue of interaction of CTCF with its modifiers such as SIN3A and histone deacetylases. Furthermore, a localised folded chromatin structure resulting from juxtaposition of two disparate regulatory sequences (enhancer ICR could be the mechanistic basis of ICR-mediated position-dependent (ICR-promoter transcriptional repression in transgenic Drosophila.

Computational analysis of siRNA recognition by the Ago2 PAZ domain and identification of the determinants of RNA-induced gene silencing.

Directory of Open Access Journals (Sweden)

Mahmoud Kandeel

Full Text Available RNA interference (RNAi is a highly specialized process of protein-siRNA interaction that results in the regulation of gene expression and cleavage of target mRNA. The PAZ domain of the Argonaute proteins binds to the 3' end of siRNA, and during RNAi the attaching end of the siRNA switches between binding and release from its binding pocket. This biphasic interaction of the 3' end of siRNA with the PAZ domain is essential for RNAi activity; however, it remains unclear whether stronger or weaker binding with PAZ domain will facilitate or hinder the overall RNAi process. Here we report the correlation between the binding of modified siRNA 3' overhang analogues and their in vivo RNAi efficacy. We found that higher RNAi efficacy was associated with the parameters of lower Ki value, lower total intermolecular energy, lower free energy, higher hydrogen bonding, smaller total surface of interaction and fewer van der Waals interactions. Electrostatic interaction was a minor contributor to compounds recognition, underscoring the presence of phosphate groups in the modified analogues. Thus, compounds with lower binding affinity are associated with better gene silencing. Lower binding strength along with the smaller interaction surface, higher hydrogen bonding and fewer van der Waals interactions were among the markers for favorable RNAi activity. Within the measured parameters, the interaction surface, van der Waals interactions and inhibition constant showed a statistically significant correlation with measured RNAi efficacy. The considerations provided in this report will be helpful in the design of new compounds with better gene silencing ability.

Gene therapy for ocular diseases.

Science.gov (United States)

Liu, Melissa M; Tuo, Jingsheng; Chan, Chi-Chao

2011-05-01

The eye is an easily accessible, highly compartmentalised and immune-privileged organ that offers unique advantages as a gene therapy target. Significant advancements have been made in understanding the genetic pathogenesis of ocular diseases, and gene replacement and gene silencing have been implicated as potentially efficacious therapies. Recent improvements have been made in the safety and specificity of vector-based ocular gene transfer methods. Proof-of-concept for vector-based gene therapies has also been established in several experimental models of human ocular diseases. After nearly two decades of ocular gene therapy research, preliminary successes are now being reported in phase 1 clinical trials for the treatment of Leber congenital amaurosis. This review describes current developments and future prospects for ocular gene therapy. Novel methods are being developed to enhance the performance and regulation of recombinant adeno-associated virus- and lentivirus-mediated ocular gene transfer. Gene therapy prospects have advanced for a variety of retinal disorders, including retinitis pigmentosa, retinoschisis, Stargardt disease and age-related macular degeneration. Advances have also been made using experimental models for non-retinal diseases, such as uveitis and glaucoma. These methodological advancements are critical for the implementation of additional gene-based therapies for human ocular diseases in the near future.

Effects of excretory/secretory products from Anisakis simplex (Nematoda) on immune gene expression in rainbow trout (Oncorhynchus mykiss)

DEFF Research Database (Denmark)

Bahlool, Qusay Zuhair Mohammad; Skovgaard, Alf; Kania, Per Walter

2013-01-01

Excretory/secretory (ES) products are molecules produced by parasitic nematodes, including larval Anisakis simplex, a parasite occurring in numerous marine fish hosts. The effects of these substances on host physiology have not been fully described. The present work elucidates the influence of ES...... substances on the fish immune system by measuring immune gene expression in spleen and liver of rainbow trout (Oncorhynchus mykiss) injected intraperitoneally with ES products isolated from A. simplex third stage larvae. The overall gene expression profile of exposed fish showed a generalized down....... This type of hydrolytic enzyme activity may play a role in nematode penetration of host tissue. In addition, based on the notion that A. simplex ES products may have an immune-depressive effect (by minimizing immune gene expression) it could also be suggested that worm enzymes directly target host immune...

Flg22-Triggered Immunity Negatively Regulates Key BR Biosynthetic Genes.

Science.gov (United States)

Jiménez-Góngora, Tamara; Kim, Seong-Ki; Lozano-Durán, Rosa; Zipfel, Cyril

2015-01-01

In plants, activation of growth and activation of immunity are opposing processes that define a trade-off. In the past few years, the growth-promoting hormones brassinosteroids (BR) have emerged as negative regulators of pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI), promoting growth at the expense of defense. The crosstalk between BR and PTI signaling was described as negative and unidirectional, since activation of PTI does not affect several analyzed steps in the BR signaling pathway. In this work, we describe that activation of PTI by the bacterial PAMP flg22 results in the reduced expression of BR biosynthetic genes. This effect does not require BR perception or signaling, and occurs within 15 min of flg22 treatment. Since the described PTI-induced repression of gene expression may result in a reduction in BR biosynthesis, the crosstalk between PTI and BR could actually be negative and bidirectional, a possibility that should be taken into account when considering the interaction between these two pathways.

Epigenetics: beyond genes

CSIR Research Space (South Africa)

Fossey, A

2009-06-01

Full Text Available in forestry breeding. Keywords Gene regulation; chromatin; histone code hyporthesis; RNA silencing; post transcriptional gene silencing; forestry. Introduction to epigenetic phenomena Most living organisms share a vast amount of genetic information... (Rapp and Wendel, 2005). Epigenetic phenomena pervade all aspects of cell proliferation and plant development and are often in conflict with Mendelian models of genetics (Grant-Downton and Dickinson, 2005). A key element in many epigenetic effects...

A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

KAUST Repository

Jin, Hailing; Zhu, Jian-Kang

2010-01-01

RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host's essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

E(y)2/Sus1 is required for blocking PRE silencing by the Wari insulator in Drosophila melanogaster.

Science.gov (United States)

Erokhin, Maksim; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

2010-06-01

Chromatin insulators affect interactions between promoters and enhancers/silencers and function as barriers to the spread of repressive chromatin. Recently, we have found an insulator, named Wari, located on the 3' side of the white gene. Here, we show that the previously identified 368-bp core of this insulator is sufficient for blocking Polycomb response element-mediated silencing. Although Wari does not contain binding sites for known insulator proteins, the E(y)2 and CP190 proteins bind to Wari as well as to the Su(Hw)-containing insulators in vivo. It may well be that these proteins are recruited to the insulator by as yet unidentified DNA-binding protein. Partial inactivation of E(y)2 in a weak e(y)2 ( u1 ) mutation impairs only the anti-silencing but not the enhancer-blocking activity of the Wari insulator. Thus, the E(y)2 protein in different Drosophila insulators serves to protect gene expression from silencing.

Metabolic engineering of potato tuber carotenoids through tuber-specific silencing of lycopene epsilon cyclase

Directory of Open Access Journals (Sweden)

Papacchioli Velia

2006-06-01

Full Text Available Abstract Background Potato is a major staple food, and modification of its provitamin content is a possible means for alleviating nutritional deficiencies. beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein, antheraxanthin, violaxanthin, and of xanthophyll esters. None of these carotenoids have provitamin A activity. Results We silenced the first dedicated step in the beta-epsilon- branch of carotenoid biosynthesis, lycopene epsilon cyclase (LCY-e, by introducing, via Agrobacterium-mediated transformation, an antisense fragment of this gene under the control of the patatin promoter. Real Time measurements confirmed the tuber-specific silencing of Lcy-e. Antisense tubers showed significant increases in beta-beta-carotenoid levels, with beta-carotene showing the maximum increase (up to 14-fold. Total carotenoids increased up to 2.5-fold. These changes were not accompanied by a decrease in lutein, suggesting that LCY-e is not rate-limiting for lutein accumulation. Tuber-specific changes in expression of several genes in the pathway were observed. Conclusion The data suggest that epsilon-cyclization of lycopene is a key regulatory step in potato tuber carotenogenesis. Upon tuber-specific silencing of the corresponding gene, beta-beta-carotenoid and total carotenoid levels are increased, and expression of several other genes in the pathway is modified.

Expression of immune-response genes in lepidopteran host is suppressed by venom from an endoparasitoid, Pteromalus puparum

Directory of Open Access Journals (Sweden)

Fang Qi

2010-09-01

Full Text Available Abstract Background The relationships between parasitoids and their insect hosts have attracted attention at two levels. First, the basic biology of host-parasitoid interactions is of fundamental interest. Second, parasitoids are widely used as biological control agents in sustainable agricultural programs. Females of the gregarious endoparasitoid Pteromalus puparum (Hymenoptera: Pteromalidae inject venom along with eggs into their hosts. P. puparum does not inject polydnaviruses during oviposition. For this reason, P. puparum and its pupal host, the small white butterfly Pieris rapae (Lepidoptera: Pieridae, comprise an excellent model system for studying the influence of an endoparasitoid venom on the biology of the pupal host. P. puparum venom suppresses the immunity of its host, although the suppressive mechanisms are not fully understood. In this study, we tested our hypothesis that P. puparum venom influences host gene expression in the two main immunity-conferring tissues, hemocytes and fat body. Results At 1 h post-venom injection, we recorded significant decreases in transcript levels of 217 EST clones (revealing 113 genes identified in silico, including 62 unknown contigs derived from forward subtractive libraries of host hemocytes and in transcript levels of 288 EST clones (221 genes identified in silico, including 123 unknown contigs from libraries of host fat body. These genes are related to insect immune response, cytoskeleton, cell cycle and apoptosis, metabolism, transport, stress response and transcriptional and translational regulation. We verified the reliability of the suppression subtractive hybridization (SSH data with semi-quantitative RT-PCR analysis of a set of randomly selected genes. This analysis showed that most of the selected genes were down-regulated after venom injection. Conclusions Our findings support our hypothesis that P. puparum venom influences gene expression in host hemocytes and fat body. Specifically

Polyethylenimine-based siRNA nanocomplexes reprogram tumor-associated dendritic cells via TLR5 to elicit therapeutic antitumor immunity.

Science.gov (United States)

Cubillos-Ruiz, Juan R; Engle, Xavier; Scarlett, Uciane K; Martinez, Diana; Barber, Amorette; Elgueta, Raul; Wang, Li; Nesbeth, Yolanda; Durant, Yvon; Gewirtz, Andrew T; Sentman, Charles L; Kedl, Ross; Conejo-Garcia, Jose R

2009-08-01

The success of clinically relevant immunotherapies requires reversing tumor-induced immunosuppression. Here we demonstrated that linear polyethylenimine-based (PEI-based) nanoparticles encapsulating siRNA were preferentially and avidly engulfed by regulatory DCs expressing CD11c and programmed cell death 1-ligand 1 (PD-L1) at ovarian cancer locations in mice. PEI-siRNA uptake transformed these DCs from immunosuppressive cells to efficient antigen-presenting cells that activated tumor-reactive lymphocytes and exerted direct tumoricidal activity, both in vivo and in situ. PEI triggered robust and selective TLR5 activation in vitro and elicited the production of hallmark TLR5-inducible cytokines in WT mice, but not in Tlr5-/- littermates. Thus, PEI is a TLR5 agonist that, to our knowledge, was not previously recognized. In addition, PEI-complexed nontargeting siRNA oligonucleotides stimulated TLR3 and TLR7. The nonspecific activation of multiple TLRs (specifically, TLR5 and TLR7) reversed the tolerogenic phenotype of human and mouse ovarian tumor-associated DCs. In ovarian carcinoma-bearing mice, this induced T cell-mediated tumor regression and prolonged survival in a manner dependent upon myeloid differentiation primary response gene 88 (MyD88; i.e., independent of TLR3). Furthermore, gene-specific siRNA-PEI nanocomplexes that silenced immunosuppressive molecules on mouse tumor-associated DCs elicited discernibly superior antitumor immunity and enhanced therapeutic effects compared with nontargeting siRNA-PEI nanocomplexes. Our results demonstrate that the intrinsic TLR5 and TLR7 stimulation of siRNA-PEI nanoparticles synergizes with the gene-specific silencing activity of siRNA to transform tumor-infiltrating regulatory DCs into DCs capable of promoting therapeutic antitumor immunity.

Silencing of the CaCP Gene Delays Salt- and Osmotic-Induced Leaf Senescence in Capsicum annuum L.

Directory of Open Access Journals (Sweden)

Huai-Juan Xiao

2014-05-01

Full Text Available Cysteine proteinases have been known to participate in developmental processes and in response to stress in plants. Our present research reported that a novel CP gene, CaCP, was involved in leaf senescence in pepper (Capsicum annuum L.. The full-length CaCP cDNA is comprised of 1316 bp, contains 1044 nucleotides in open reading frame (ORF, and encodes a 347 amino acid protein. The deduced protein belongs to the papain-like cysteine proteases (CPs superfamily, containing a highly conserved ERFNIN motif, a GCNGG motif and a conserved catalytic triad. This protein localized to the vacuole of plant cells. Real-time quantitative PCR analysis revealed that the expression level of CaCP gene was dramatically higher in leaves and flowers than that in roots, stems and fruits. Moreover, CaCP transcripts were induced upon during leaf senescence. CaCP expression was upregulated by plant hormones, especially salicylic acid. CaCP was also significantly induced by abiotic and biotic stress treatments, including high salinity, mannitol and Phytophthora capsici. Loss of function of CaCP using the virus-induced gene-silencing technique in pepper plants led to enhanced tolerance to salt- and osmotic-induced stress. Taken together, these results suggest that CaCP is a senescence-associated gene, which is involved in developmental senescence and regulates salt- and osmotic-induced leaf senescence in pepper.

Silencing of the CaCP Gene Delays Salt- and Osmotic-Induced Leaf Senescence in Capsicum annuum L.

Science.gov (United States)

Xiao, Huai-Juan; Yin, Yan-Xu; Chai, Wei-Guo; Gong, Zhen-Hui

2014-01-01

Cysteine proteinases have been known to participate in developmental processes and in response to stress in plants. Our present research reported that a novel CP gene, CaCP, was involved in leaf senescence in pepper (Capsicum annuum L.). The full-length CaCP cDNA is comprised of 1316 bp, contains 1044 nucleotides in open reading frame (ORF), and encodes a 347 amino acid protein. The deduced protein belongs to the papain-like cysteine proteases (CPs) superfamily, containing a highly conserved ERFNIN motif, a GCNGG motif and a conserved catalytic triad. This protein localized to the vacuole of plant cells. Real-time quantitative PCR analysis revealed that the expression level of CaCP gene was dramatically higher in leaves and flowers than that in roots, stems and fruits. Moreover, CaCP transcripts were induced upon during leaf senescence. CaCP expression was upregulated by plant hormones, especially salicylic acid. CaCP was also significantly induced by abiotic and biotic stress treatments, including high salinity, mannitol and Phytophthora capsici. Loss of function of CaCP using the virus-induced gene-silencing technique in pepper plants led to enhanced tolerance to salt- and osmotic-induced stress. Taken together, these results suggest that CaCP is a senescence-associated gene, which is involved in developmental senescence and regulates salt- and osmotic-induced leaf senescence in pepper. PMID:24823878

Small RNAs were involved in homozygous state-associated silencing of a marker gene (Neomycin phosphotransferase II: nptII) in transgenic tomato plants.

Science.gov (United States)

Deng, Lei; Pan, Yu; Chen, Xuqing; Chen, Guoping; Hu, Zongli

2013-07-01

Homozygous state-associated co-suppression is not a very common phenomenon. In our experiments, two transgenic plants 3A29 and 1195A were constructed by being transformed with the constructs pBIN-353A and pBIN119A containing nptII gene as a marker respectively. The homozygous progeny from these two independent transgenic lines 3A29 and 1195A, displayed kanamycin-sensitivity and produced a short main root without any lateral roots as untransformed control (wild-type) seedlings when germinated on kanamycin media. For the seedlings derived from putative hemizygous plants, the percentage of the seedlings showing normal growth on kanamycin media was about 50% and lower than the expected percentage (75%). Southern analysis of the genomic DNA confirmed that the homozygous and hemizygous plants derived from the same lines contained the same multiple nptII transgenes, which were located on the same site of chromosome. Northern analysis suggested that the marker nptII gene was expressed in the primary and the hemizygous transformants, but it was silenced in the homozygous transgenic plants. Further Northern analysis indicated that antisense and sense small nptII-derived RNAs were present in the transgenic plants and the blotting signal of nptII-derived small RNA was much higher in the homozygous transgenic plants than that of hemizygous transgenic plants. Additionally, read-through transcripts from the TRAMP gene to the nptII gene were detected. These results suggest that the read-through transcripts may be involved in homozygous state-associated silencing of the nptII transgene in transgenic tomato plants and a certain threshold level of the nptII-derived small RNAs is required for the homozygous state-associated co-suppression of the nptII transgene. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Methylation and Expression of Immune and Inflammatory Genes in the Offspring of Bariatric Bypass Surgery Patients

Directory of Open Access Journals (Sweden)

Frédéric Guénard

2013-01-01

Full Text Available Background. Maternal obesity, excess weight gain and overnutrition during pregnancy increase risks of obesity, type 2 diabetes mellitus, and cardiovascular disease in the offspring. Maternal biliopancreatic diversion is an effective treatment for severe obesity and is beneficial for offspring born after maternal surgery (AMS. These offspring exhibit lower severe obesity prevalence and improved cardiometabolic risk factors including inflammatory marker compared to siblings born before maternal surgery (BMS. Objective. To assess relationships between maternal bariatric surgery and the methylation/expression of genes involved in the immune and inflammatory pathways. Methods. A differential gene methylation analysis was conducted in a sibling cohort of 25 BMS and 25 AMS offspring from 20 mothers. Following differential gene expression analysis (23 BMS and 23 AMS, pathway analysis was conducted. Correlations between gene methylation/expression and circulating inflammatory markers were computed. Results. Five immune and inflammatory pathways with significant overrepresentation of both differential gene methylation and expression were identified. In the IL-8 pathway, gene methylation correlated with both gene expression and plasma C-reactive protein levels. Conclusion. These results suggest that improvements in cardiometabolic risk markers in AMS compared to BMS offspring may be mediated through differential methylation of genes involved in immune and inflammatory pathways.