WorldWideScience

Sample records for immune function compared

  1. Incubation period and immune function: A comparative field study among coexisting birds

    Science.gov (United States)

    Palacios, M.G.; Martin, T.E.

    2006-01-01

    Developmental periods are integral components of life history strategies that can have important fitness consequences and vary enormously among organisms. However, the selection pressures and mechanisms causing variation in length of developmental periods are poorly understood. Particularly puzzling are prolonged developmental periods, because their selective advantage is unclear. Here we tested the hypotheses that immune function is stronger in species that are attacked at a higher rate by parasites and that prolonged embryonic development allows the development of this stronger immune system. Through a comparative field study among 12 coexisting passerine bird species, we show that species with higher blood parasite prevalence mounted stronger cellular immune responses than species with lower prevalence. These results provide support for the hypothesis that species facing greater selection pressure from parasites invest more in immune function. However, species with longer incubation periods mounted weaker cellular immune responses than species with shorter periods. Therefore, cellular immune responses do not support the hypothesis that longer development time enhances immunocompentence. Future studies should assess other components of the immune system and test alternative causes of variation in incubation periods among bird species. ?? Springer-Verlag 2005.

  2. Immune function in arctic mammals

    DEFF Research Database (Denmark)

    Desforges, Jean-Pierre; Jasperse, Lindsay; Jensen, Trine Hammer

    2018-01-01

    Natural killer (NK) cells are a vital part of the rapid and non-specific immune defense against invading pathogens and tumor cells. This study evaluated NK cell-like activity by flow cytometry for the first time in three ecologically and culturally important Arctic mammal species: polar bear (Ursus...... the effector:target cell ratio increased. Comparing NK activity between fresh and cryopreserved mouse lymphocytes revealed little to no difference in function, highlighting the applicability of cryopreserving cells in field studies. The evaluation of this important innate immune function in Arctic mammals can...... contribute to future population health assessments, especially as pollution-induced suppression of immune function may increase infectious disease susceptibility....

  3. Early enteral immune nutrition support after radical operation for gastric cancer on promoting the recovery of gastrointestinal function and immune function

    Directory of Open Access Journals (Sweden)

    Zhi-Gang Li

    2016-05-01

    Full Text Available Objective: To analyze the effect of early enteral immune nutrition support after radical operation for gastric cancer on the recovery of gastrointestinal function and immune function. Methods: A total of 106 cases of patients received radical operation for gastric cancer in our hospital were selected as research subjects, and according to different ways of postoperative nutrition intervention, all patients were divided into observation group (n=50 and control group (n=56. Control group received conventional enteral nutrition intervention, observation group received postoperative early enteral immune nutrition support, and then differences in postoperative intestinal mucosa barrier function, gastrointestinal hormone levels, immune function levels and nutrition-related indicator values were compared between two groups. Results: After observation group received enteral immune nutrition intervention, serum DAO, PS and D-lactate levels as well as urine L/M ratio were lower than those of control group; serum GAS, CCK, MTL and SP values of observation group after intervention were higher than those of control group, and GLU, VIP, GIP and SS values were lower than those of control group; CD4, IgG, NK cell, C3, C4, CH50 and S-IgA levels of observation group after intervention were higher than those of control group; serum ALB, PRE, TRF and RBP levels of observation group after intervention were higher than those of control group. Conclusion: Early enteral immune nutrition support after radical operation for gastric cancer is conducive to the recovery of gastrointestinal function and the promotion of immune state, eventually promotes patients’ postoperative overall recovery and has active clinical significance.

  4. Molecular and Functional Neuroscience in Immunity.

    Science.gov (United States)

    Pavlov, Valentin A; Chavan, Sangeeta S; Tracey, Kevin J

    2018-04-26

    The nervous system regulates immunity and inflammation. The molecular detection of pathogen fragments, cytokines, and other immune molecules by sensory neurons generates immunoregulatory responses through efferent autonomic neuron signaling. The functional organization of this neural control is based on principles of reflex regulation. Reflexes involving the vagus nerve and other nerves have been therapeutically explored in models of inflammatory and autoimmune conditions, and recently in clinical settings. The brain integrates neuro-immune communication, and brain function is altered in diseases characterized by peripheral immune dysregulation and inflammation. Here we review the anatomical and molecular basis of the neural interface with immunity, focusing on peripheral neural control of immune functions and the role of the brain in the model of the immunological homunculus. Clinical advances stemming from this knowledge within the framework of bioelectronic medicine are also briefly outlined.

  5. Modulation of Immune Functions by Foods

    Directory of Open Access Journals (Sweden)

    Shuichi Kaminogawa

    2004-01-01

    Full Text Available Evidence is rapidly accumulating as to the beneficial effects of foods. However, it is not always clear whether the information is based on data evaluated impartially in a scientific fashion. Human research into whether foods modulate immune functions in either intervention studies or randomized controlled trials can be classified into three categories according to the physical state of subjects enrolled for investigation: (i studies examining the effect of foods in healthy individuals; (ii studies analyzing the effect of foods on patients with hypersensitivity; and (iii studies checking the effect of foods on immunocompromized subjects, including patients who had undergone surgical resection of cancer and newborns. The systematization of reported studies has made it reasonable to conclude that foods are able to modulate immune functions manifesting as either innate immunity (phagocytic activity, NK cell activity or acquired immunity (T cell response, antibody production. Moreover, improvement of immune functions by foods can normalize the physical state of allergic patients or cancer patients, and may reduce the risk of diseases in healthy individuals. Therefore, it is valuable to assess the immune-modulating abilities of foods by measuring at least one parameter of either innate or acquired immunity.

  6. Monounsaturated fats and immune function

    Directory of Open Access Journals (Sweden)

    P. Yaqoob

    1998-04-01

    Full Text Available Animal studies suggest that olive oil is capable of modulating functions of cells of the immune system in a manner similar to, albeit weaker than, fish oils. There is some evidence that the effects of olive oil on immune function in animal studies are due to oleic acid rather than to trace elements or antioxidants. Importantly, several studies have demonstrated effects of oleic acid-containing diets on in vivo immune responses. In contrast, consumption of a monounsaturated fatty acid (MUFA-rich diet by humans does not appear to bring about a general suppression of immune cell functions. The effects of this diet in humans are limited to decreasing aspects of adhesion of peripheral blood mononuclear cells, although there are trends towards decreases in natural killer cell activity and proliferation. The lack of a clear effect of MUFA in humans may be attributable to the higher level of monounsaturated fat used in the animal studies, although it is ultimately of importance to examine the effects of intakes which are in no way extreme. The effects of MUFA on adhesion molecules are potentially important, since these molecules appear to have a role in the pathology of a number of diseases involving the immune system. This area clearly deserves further exploration

  7. Season of birth shapes neonatal immune function

    DEFF Research Database (Denmark)

    Thysen, Anna Hammerich; Rasmussen, Morten Arendt; Kreiner-Møller, Eskil

    2016-01-01

    Birth season has been reported to be a risk factor for several immune-mediated diseases. We hypothesized that this association is mediated by differential changes in neonatal immune phenotype and function with birth season. We sought to investigate the influence of season of birth on cord blood...... immune cell subsets and inflammatory mediators in neonatal airways. Cord blood was phenotyped for 26 different immune cell subsets, and at 1 month of age, 20 cytokines and chemokines were quantified in airway mucosal lining fluid. Multivariate partial least squares discriminant analyses were applied...... to determine whether certain immune profiles dominate by birth season, and correlations between individual cord blood immune cells and early airway immune mediators were defined. We found a birth season-related fluctuation in neonatal immune cell subsets and in early-life airway mucosal immune function...

  8. Advantages of laparoscopic compared to conventional surgery are not related to an innate immune response of peritoneal immune activation: an animal study in rats.

    Science.gov (United States)

    Lingohr, Philipp; Dohmen, Jonas; Matthaei, Hanno; Schwandt, Timo; Stein, Kathy; Hong, Gun-Soo; Steitz, Julia; Longerich, Thomas; Bölke, Edwin; Wehner, Sven; Kalff, Jörg C

    2017-06-01

    Laparoscopic surgery (LS) has proved superior compared to conventional surgery (CS) regarding morbidity, length of hospital stay, rate of wound infection and time until recovery. An improved preservation of the postoperative immune function is assumed to contribute to these benefits though the role of the local peritoneal immune response is still poorly understood. Our study investigates the peritoneal immune response subsequent to abdominal surgery and compares it between laparoscopic and conventional surgery to find an immunological explanation for the clinically proven benefits of LS. Wistar rats (N = 140) underwent laparoscopic cecum resection (LCR; N = 28), conventional cecum resection (CCR; N = 28), laparoscopic sham operation (LSO; N = 28), conventional sham operation (CSO; N = 28), or no surgical treatment (CTRL; N = 28). Postoperatively, peritoneal lavages were performed, leukocytes isolated and analyzed regarding immune function and phagocytosis activity. Immune function was inhibited postoperatively in animals undergoing LCR or CCR compared to CTRL reflected by a lower TNF-α (CTRL 3956.65 pg/ml, LCR 2018.48 pg/ml (p = 0.023), CCR 2793.78 pg/ml (n.s.)) and IL-6 secretion (CTRL 625.84 pg/ml, LCR 142.84 pg/ml (p = 0.009), CCR 169.53 pg/ml (p = 0.01)). Phagocytosis was not affected in rats undergoing any kind of surgery compared to CTRL. Neither cytokine secretion nor phagocytosis activity differed significantly between laparoscopic and conventional surgery. According to our findings the benefits associated with LS compared to CS cannot be explained by differences in the postoperative peritoneal innate immune response. Further studies are needed to elucidate the causes for a more favorable postoperative outcome in patients after LS compared to CS.

  9. Innate immune functions of microglia isolated from human glioma patients

    Directory of Open Access Journals (Sweden)

    Grimm Elizabeth

    2006-03-01

    Full Text Available Abstract Background Innate immunity is considered the first line of host defense and microglia presumably play a critical role in mediating potent innate immune responses to traumatic and infectious challenges in the human brain. Fundamental impairments of the adaptive immune system in glioma patients have been investigated; however, it is unknown whether microglia are capable of innate immunity and subsequent adaptive anti-tumor immune responses within the immunosuppressive tumor micro-environment of human glioma patients. We therefore undertook a novel characterization of the innate immune phenotype and function of freshly isolated human glioma-infiltrating microglia (GIM. Methods GIM were isolated by sequential Percoll purification from patient tumors immediately after surgical resection. Flow cytometry, phagocytosis and tumor cytotoxicity assays were used to analyze the phenotype and function of these cells. Results GIM expressed significant levels of Toll-like receptors (TLRs, however they do not secrete any of the cytokines (IL-1β, IL-6, TNF-α critical in developing effective innate immune responses. Similar to innate macrophage functions, GIM can mediate phagocytosis and non-MHC restricted cytotoxicity. However, they were statistically less able to mediate tumor cytotoxicity compared to microglia isolated from normal brain. In addition, the expression of Fas ligand (FasL was low to absent, indicating that apoptosis of the incoming lymphocyte population may not be a predominant mode of immunosuppression by microglia. Conclusion We show for the first time that despite the immunosuppressive environment of human gliomas, GIM are capable of innate immune responses such as phagocytosis, cytotoxicity and TLR expression but yet are not competent in secreting key cytokines. Further understanding of these innate immune functions could play a critical role in understanding and developing effective immunotherapies to malignant human gliomas.

  10. Nutrition, immune function and health of dairy cattle

    DEFF Research Database (Denmark)

    Ingvartsen, Klaus Lønne; Moyes, Kasey

    2013-01-01

    not seem to be improved. Earlier reviews have covered critical periods such as the transition period in the cow and its influence on health and immune function, the interplay between the endocrine system and the immune system and nutrition and immune function. Knowledge on these topics is crucial for our......) on immune function, and to give perspectives for prevention of diseases in the dairy cow through nutrition. To a large extent, the health problems during the periparturient period relate to cows having difficulty in adapting to the nutrient needs for lactation. This may result in PI, a situation where...... the regulatory mechanisms are insufficient for the animals to function optimally leading to a high risk of a complex of digestive, metabolic and infectious problems. The risk of infectious diseases will be increased if the immune competence is reduced. Nutrition plays a pivotal role in the immune response...

  11. Comparative genomic analysis of buffalo (Bubalus bubalis NOD1 and NOD2 receptors and their functional role in in-vitro cellular immune response.

    Directory of Open Access Journals (Sweden)

    Biswajit Brahma

    Full Text Available Nucleotide binding and oligomerization domain (NOD-like receptors (NLRs are innate immune receptors that recognize bacterial cell wall components and initiate host immune response. Structure and function of NLRs have been well studied in human and mice, but little information exists on genetic composition and role of these receptors in innate immune system of water buffalo--a species known for its exceptional disease resistance. Here, a comparative study on the functional domains of NOD1 and NOD2 was performed across different species. The NOD mediated in-vitro cellular responses were studied in buffalo peripheral blood mononuclear cells, resident macrophages, mammary epithelial, and fibroblast cells. Buffalo NOD1 (buNOD1 and buNOD2 showed conserved domain architectures as found in other mammals. The domains of buNOD1 and buNOD2 showed analogy in secondary and tertiary conformations. Constitutive expressions of NODs were ubiquitous in different tissues. Following treatment with NOD agonists, peripheral lymphocytes showed an IFN-γ response along-with production of pro-inflammatory cytokines. Alveolar macrophages and mammary epithelial cells showed NOD mediated in-vitro immune response through NF-κB dependent pathway. Fibroblasts showed pro-inflammatory cytokine response following agonist treatment. Our study demonstrates that both immune and non-immune cells could generate NOD-mediated responses to pathogens though the type and magnitude of response depend on the cell types. The structural basis of ligand recognition by buffalo NODs and knowledge of immune response by different cell types could be useful for development of non-infective innate immune modulators and next generation anti-inflammatory compounds.

  12. Impaired immune function in children and adults with Fanconi anemia.

    Science.gov (United States)

    Myers, Kasiani C; Sauter, Sharon; Zhang, Xue; Bleesing, Jacob J; Davies, Stella M; Wells, Susanne I; Mehta, Parinda A; Kumar, Ashish; Marmer, Daniel; Marsh, Rebecca; Brown, Darron; Butsch Kovacic, Melinda

    2017-11-01

    Fanconi anemia (FA) is a rare genetic disorder characterized by genome instability, bone marrow failure, and cancer predisposition. Previously, small studies have reported heterogeneous immune dysfunction in FA. We performed a detailed immunologic assessment in a large FA cohort who have not undergone bone marrow transplantation or developed malignancies. Comprehensive quantitative and functional immunologic assessment of 29 FA individuals was compared to healthy age-matched controls. Compared to non-FA persons of similar ages, FA individuals showed lower absolute total B cells (P candida (P = 0.019), were diminished in FA. Phytohemagglutinin responses and plasma cytokines were normal. Within FA subjects, adults and older children (≥10 years) exhibited higher CD8 + T cells than younger children (P = 0.004). Documented atypical infections were infrequent, although oral human papilloma virus (HPV) prevalence was higher (31% positive) in FA. Overall, these results demonstrate a high rate of significant humoral and cellular immune dysfunction. Continued longitudinal study of immune function is critical to understand evolution with age, bone marrow failure, and cancer development. © 2017 Wiley Periodicals, Inc.

  13. Problematic Internet Usage and Immune Function.

    Science.gov (United States)

    Reed, Phil; Vile, Rebecca; Osborne, Lisa A; Romano, Michela; Truzoli, Roberto

    2015-01-01

    Problematic internet use has been associated with a variety of psychological comorbidities, but it relationship with physical illness has not received the same degree of investigation. The current study surveyed 505 participants online, and asked about their levels of problematic internet usage (Internet Addiction Test), depression and anxiety (Hospital Anxiety and Depression Scales), social isolation (UCLA Loneliness Questionnaire), sleep problems (Pittsburgh Sleep Quality Index), and their current health - General Health Questionnaire (GHQ-28), and the Immune Function Questionnaire. The results demonstrated that around 30% of the sample displayed mild or worse levels of internet addiction, as measured by the IAT. Although there were differences in the purposes for which males and females used the internet, there were no differences in terms of levels of problematic usage between genders. The internet problems were strongly related to all of the other psychological variables such as depression, anxiety, social-isolation, and sleep problems. Internet addiction was also associated with reduced self-reported immune function, but not with the measure of general health (GHQ-28). This relationship between problematic internet use and reduced immune function was found to be independent of the impact of the co-morbidities. It is suggested that the negative relationship between level of problematic internet use and immune function may be mediated by levels of stress produced by such internet use, and subsequent sympathetic nervous activity, which related to immune-supressants, such as cortisol.

  14. Problematic Internet Usage and Immune Function.

    Directory of Open Access Journals (Sweden)

    Phil Reed

    Full Text Available Problematic internet use has been associated with a variety of psychological comorbidities, but it relationship with physical illness has not received the same degree of investigation. The current study surveyed 505 participants online, and asked about their levels of problematic internet usage (Internet Addiction Test, depression and anxiety (Hospital Anxiety and Depression Scales, social isolation (UCLA Loneliness Questionnaire, sleep problems (Pittsburgh Sleep Quality Index, and their current health - General Health Questionnaire (GHQ-28, and the Immune Function Questionnaire. The results demonstrated that around 30% of the sample displayed mild or worse levels of internet addiction, as measured by the IAT. Although there were differences in the purposes for which males and females used the internet, there were no differences in terms of levels of problematic usage between genders. The internet problems were strongly related to all of the other psychological variables such as depression, anxiety, social-isolation, and sleep problems. Internet addiction was also associated with reduced self-reported immune function, but not with the measure of general health (GHQ-28. This relationship between problematic internet use and reduced immune function was found to be independent of the impact of the co-morbidities. It is suggested that the negative relationship between level of problematic internet use and immune function may be mediated by levels of stress produced by such internet use, and subsequent sympathetic nervous activity, which related to immune-supressants, such as cortisol.

  15. Problematic Internet Usage and Immune Function

    Science.gov (United States)

    Reed, Phil; Vile, Rebecca; Osborne, Lisa A.; Romano, Michela; Truzoli, Roberto

    2015-01-01

    Problematic internet use has been associated with a variety of psychological comorbidities, but it relationship with physical illness has not received the same degree of investigation. The current study surveyed 505 participants online, and asked about their levels of problematic internet usage (Internet Addiction Test), depression and anxiety (Hospital Anxiety and Depression Scales), social isolation (UCLA Loneliness Questionnaire), sleep problems (Pittsburgh Sleep Quality Index), and their current health – General Health Questionnaire (GHQ-28), and the Immune Function Questionnaire. The results demonstrated that around 30% of the sample displayed mild or worse levels of internet addiction, as measured by the IAT. Although there were differences in the purposes for which males and females used the internet, there were no differences in terms of levels of problematic usage between genders. The internet problems were strongly related to all of the other psychological variables such as depression, anxiety, social-isolation, and sleep problems. Internet addiction was also associated with reduced self-reported immune function, but not with the measure of general health (GHQ-28). This relationship between problematic internet use and reduced immune function was found to be independent of the impact of the co-morbidities. It is suggested that the negative relationship between level of problematic internet use and immune function may be mediated by levels of stress produced by such internet use, and subsequent sympathetic nervous activity, which related to immune-supressants, such as cortisol. PMID:26244339

  16. Functional comparison of innate immune signaling pathways in primates.

    Directory of Open Access Journals (Sweden)

    Luis B Barreiro

    2010-12-01

    Full Text Available Humans respond differently than other primates to a large number of infections. Differences in susceptibility to infectious agents between humans and other primates are probably due to inter-species differences in immune response to infection. Consistent with that notion, genes involved in immunity-related processes are strongly enriched among recent targets of positive selection in primates, suggesting that immune responses evolve rapidly, yet providing only indirect evidence for possible inter-species functional differences. To directly compare immune responses among primates, we stimulated primary monocytes from humans, chimpanzees, and rhesus macaques with lipopolysaccharide (LPS and studied the ensuing time-course regulatory responses. We find that, while the universal Toll-like receptor response is mostly conserved across primates, the regulatory response associated with viral infections is often lineage-specific, probably reflecting rapid host-virus mutual adaptation cycles. Additionally, human-specific immune responses are enriched for genes involved in apoptosis, as well as for genes associated with cancer and with susceptibility to infectious diseases or immune-related disorders. Finally, we find that chimpanzee-specific immune signaling pathways are enriched for HIV-interacting genes. Put together, our observations lend strong support to the notion that lineage-specific immune responses may help explain known inter-species differences in susceptibility to infectious diseases.

  17. Mental resilience, perceived immune functioning, and health

    Directory of Open Access Journals (Sweden)

    Van Schrojenstein Lantman M

    2017-03-01

    Full Text Available Marith Van Schrojenstein Lantman,1 Marlou Mackus,1 Leila S Otten,1 Deborah de Kruijff,1 Aurora JAE van de Loo,1,2 Aletta D Kraneveld,1,2 Johan Garssen,1,3 Joris C Verster1,2,4 1Division of Pharmacology, Utrecht University, Utrecht, the Netherlands; 2Institute for Risk Assessment Sciences, Utrecht University, Utrecht, the Netherlands; 3Nutricia Research, Utrecht, the Netherlands; 4Centre for Human Psychopharmacology, Swinburne University, Melbourne, Australia Background: Mental resilience can be seen as a trait that enables an individual to recover from stress and to face the next stressor with optimism. People with resilient traits are considered to have a better mental and physical health. However, there are limited data available assessing the relationship between resilient individuals and their perspective of their health and immune status. Therefore, this study was conducted to examine the relationship between mental resilience, perceived health, and perceived immune status. Methods: A total of 779 participants recruited at Utrecht University completed a questionnaire consisting of demographic characteristics, the brief resilience scale for the assessment of mental resilience, the immune function questionnaire (IFQ, and questions regarding their perceived health and immune status. Results: When correcting for gender, age, height, weight, smoker status, amount of cigarettes smoked per week, alcohol consumption status, amount of drinks consumed per week, drug use, and frequency of past year drug use, mental resilience was significantly correlated with perceived health (r=0.233, p=0.0001, perceived immune functioning (r=0.124, p=0.002, and IFQ score (r=−0.185, p=0.0001. Conclusion: A significant, albeit modest, relationship was found between mental resilience and perceived immune functioning and health. Keywords: mental resilience, immune functioning, health, vitality, quality of life

  18. Measuring the immune system: a comprehensive approach for the analysis of immune functions in humans.

    Science.gov (United States)

    Claus, Maren; Dychus, Nicole; Ebel, Melanie; Damaschke, Jürgen; Maydych, Viktoriya; Wolf, Oliver T; Kleinsorge, Thomas; Watzl, Carsten

    2016-10-01

    The immune system is essential to provide protection from infections and cancer. Disturbances in immune function can therefore directly affect the health of the affected individual. Many extrinsic and intrinsic factors such as exposure to chemicals, stress, nutrition and age have been reported to influence the immune system. These influences can affect various components of the immune system, and we are just beginning to understand the causalities of these changes. To investigate such disturbances, it is therefore essential to analyze the different components of the immune system in a comprehensive fashion. Here, we demonstrate such an approach which provides information about total number of leukocytes, detailed quantitative and qualitative changes in the composition of lymphocyte subsets, cytokine levels in serum and functional properties of T cells, NK cells and monocytes. Using samples from a cohort of 24 healthy volunteers, we demonstrate the feasibility of our approach to detect changes in immune functions.

  19. Comparative Genomics Reveals the Origins and Diversity of Arthropod Immune Systems.

    Science.gov (United States)

    Palmer, William J; Jiggins, Francis M

    2015-08-01

    Insects are an important model for the study of innate immune systems, but remarkably little is known about the immune system of other arthropod groups despite their importance as disease vectors, pests, and components of biological diversity. Using comparative genomics, we have characterized the immune system of all the major groups of arthropods beyond insects for the first time--studying five chelicerates, a myriapod, and a crustacean. We found clear traces of an ancient origin of innate immunity, with some arthropods having Toll-like receptors and C3-complement factors that are more closely related in sequence or structure to vertebrates than other arthropods. Across the arthropods some components of the immune system, such as the Toll signaling pathway, are highly conserved. However, there is also remarkable diversity. The chelicerates apparently lack the Imd signaling pathway and beta-1,3 glucan binding proteins--a key class of pathogen recognition receptors. Many genes have large copy number variation across species, and this may sometimes be accompanied by changes in function. For example, we find that peptidoglycan recognition proteins have frequently lost their catalytic activity and switch between secreted and intracellular forms. We also find that there has been widespread and extensive duplication of the cellular immune receptor Dscam (Down syndrome cell adhesion molecule), which may be an alternative way to generate the high diversity produced by alternative splicing in insects. In the antiviral short interfering RNAi pathway Argonaute 2 evolves rapidly and is frequently duplicated, with a highly variable copy number. Our results provide a detailed analysis of the immune systems of several important groups of animals for the first time and lay the foundations for functional work on these groups. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Role of Polyamines in Immune Cell Functions

    Directory of Open Access Journals (Sweden)

    Rebecca S. Hesterberg

    2018-03-01

    Full Text Available The immune system is remarkably responsive to a myriad of invading microorganisms and provides continuous surveillance against tissue damage and developing tumor cells. To achieve these diverse functions, multiple soluble and cellular components must react in an orchestrated cascade of events to control the specificity, magnitude and persistence of the immune response. Numerous catabolic and anabolic processes are involved in this process, and prominent roles for l-arginine and l-glutamine catabolism have been described, as these amino acids serve as precursors of nitric oxide, creatine, agmatine, tricarboxylic acid cycle intermediates, nucleotides and other amino acids, as well as for ornithine, which is used to synthesize putrescine and the polyamines spermidine and spermine. Polyamines have several purported roles and high levels of polyamines are manifest in tumor cells as well in autoreactive B- and T-cells in autoimmune diseases. In the tumor microenvironment, l-arginine catabolism by both tumor cells and suppressive myeloid cells is known to dampen cytotoxic T-cell functions suggesting there might be links between polyamines and T-cell suppression. Here, we review studies suggesting roles of polyamines in normal immune cell function and highlight their connections to autoimmunity and anti-tumor immune cell function.

  1. Plasma polychlorinated biphenyl concentrations and immune function in postmenopausal women

    Energy Technology Data Exchange (ETDEWEB)

    Spector, June T., E-mail: spectj@uw.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way NE, Seattle, WA 98105 (United States); Department of Medicine, School of Medicine, University of Washington, Seattle, WA (United States); De Roos, Anneclaire J., E-mail: ajd335@drexel.edu [Epidemiology Program, Public Health Sciences Division, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue N, P.O. Box 19024, Seattle, WA 98109 (United States); Department of Epidemiology, School of Public Health, University of Washington, Seattle, WA (United States); Ulrich, Cornelia M., E-mail: neli.ulrich@nct-heidelberg.de [Department of Epidemiology, School of Public Health, University of Washington, Seattle, WA (United States); Cancer Prevention Program, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue N, P.O. Box 19024, Seattle, WA 98109 (United States); National Center for Tumor Diseases and German Cancer Research Center, Heidelberg (Germany); Sheppard, Lianne, E-mail: sheppard@uw.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way NE, Seattle, WA 98105 (United States); Department of Biostatistics, School of Public Health, University of Washington, Seattle, WA (United States); Sjoedin, Andreas, E-mail: asjodin@cdc.gov [National Center for Environmental Health, CDC, 4770 Buford Highway NE, Atlanta, GA 30341 (United States); Wener, Mark H., E-mail: wener@u.washington.edu [Department of Medicine, School of Medicine, University of Washington, Seattle, WA (United States); Wood, Brent, E-mail: woodbl@u.washington.edu [Department of Medicine, School of Medicine, University of Washington, Seattle, WA (United States); and others

    2014-05-01

    Background: Polychlorinated biphenyl (PCB) exposure has been associated with non-Hodgkin lymphoma in several studies, and the immune system is a potential mediator. Objectives: We analyzed associations of plasma PCBs with immune function measures. We hypothesized that higher plasma PCB concentrations are associated with lower immune function cross-sectionally, and that increases in PCB concentrations over a one year period are associated with decreases in immune function. Methods: Plasma PCB concentrations and immune function [natural killer (NK) cell cytotoxicity and PHA-induced T-lymphocyte proliferation (PHA-TLP)] were measured at baseline and one year in 109 postmenopausal overweight women participating in an exercise intervention study in the Seattle, Washington (USA) area. Mixed models, with adjustment for body mass index and other potential confounders, were used to estimate associations of PCBs with immune function cross-sectionally and longitudinally. Results: Associations of PCBs with immune function measures differed across groups of PCBs (e.g., medium- and high-chlorinated and dioxin-like [mono-ortho-substituted]) and by the time frame for the comparison (cross-sectional vs. longitudinal). Higher concentrations of medium- and high-chlorinated PCBs were associated with higher PHA-TLP cross-sectionally but not longitudinally. The mean decrease in 0.5 µg/mL PHA-TLP/50.0 pmol/g-lipid increase in dioxin-like PCBs over one year was 51.6 (95% confidence interval 2.7, 100.5; P=0.039). There was no association between plasma PCBs and NK cytotoxicity. Conclusions: These results do not provide strong evidence of impaired cellular immunity from PCB exposure. Larger longitudinal studies with greater variability in PCB exposures are needed to further examine temporal associations of PCBs with immune function. - Highlights: • Plasma PCBs and immune function were measured in 109 women at baseline and one year. • Immune measures included T lymphocyte proliferation

  2. Plasma polychlorinated biphenyl concentrations and immune function in postmenopausal women

    International Nuclear Information System (INIS)

    Spector, June T.; De Roos, Anneclaire J.; Ulrich, Cornelia M.; Sheppard, Lianne; Sjoedin, Andreas; Wener, Mark H.; Wood, Brent

    2014-01-01

    Background: Polychlorinated biphenyl (PCB) exposure has been associated with non-Hodgkin lymphoma in several studies, and the immune system is a potential mediator. Objectives: We analyzed associations of plasma PCBs with immune function measures. We hypothesized that higher plasma PCB concentrations are associated with lower immune function cross-sectionally, and that increases in PCB concentrations over a one year period are associated with decreases in immune function. Methods: Plasma PCB concentrations and immune function [natural killer (NK) cell cytotoxicity and PHA-induced T-lymphocyte proliferation (PHA-TLP)] were measured at baseline and one year in 109 postmenopausal overweight women participating in an exercise intervention study in the Seattle, Washington (USA) area. Mixed models, with adjustment for body mass index and other potential confounders, were used to estimate associations of PCBs with immune function cross-sectionally and longitudinally. Results: Associations of PCBs with immune function measures differed across groups of PCBs (e.g., medium- and high-chlorinated and dioxin-like [mono-ortho-substituted]) and by the time frame for the comparison (cross-sectional vs. longitudinal). Higher concentrations of medium- and high-chlorinated PCBs were associated with higher PHA-TLP cross-sectionally but not longitudinally. The mean decrease in 0.5 µg/mL PHA-TLP/50.0 pmol/g-lipid increase in dioxin-like PCBs over one year was 51.6 (95% confidence interval 2.7, 100.5; P=0.039). There was no association between plasma PCBs and NK cytotoxicity. Conclusions: These results do not provide strong evidence of impaired cellular immunity from PCB exposure. Larger longitudinal studies with greater variability in PCB exposures are needed to further examine temporal associations of PCBs with immune function. - Highlights: • Plasma PCBs and immune function were measured in 109 women at baseline and one year. • Immune measures included T lymphocyte proliferation

  3. Obligate brood parasites show more functionally effective innate immune responses: an eco-immunological hypothesis

    Science.gov (United States)

    Hahn, D. Caldwell; Summers, Scott G.; Genovese, Kenneth J.; He, Haiqi; Kogut, Michael H.

    2013-01-01

    Immune adaptations of obligate brood parasites attracted interest when three New World cowbird species (Passeriformes, Icteridae, genus Molothrus) proved unusually resistant to West Nile virus. We have used cowbirds as models to investigate the eco-immunological hypothesis that species in parasite-rich environments characteristically have enhanced immunity as a life history adaptation. As part of an ongoing program to understand the cowbird immune system, in this study we measured degranulation and oxidative burst, two fundamental responses of the innate immune system. Innate immunity provides non-specific, fast-acting defenses against a variety of invading pathogens, and we hypothesized that innate immunity experiences particularly strong selection in cowbirds, because their life history strategy exposes them to diverse novel and unpredictable parasites. We compared the relative effectiveness of degranulation and oxidative burst responses in two cowbird species and one related, non-parasitic species. Both innate immune defenses were significantly more functionally efficient in the two parasitic cowbird species than in the non-parasitic red-winged blackbird (Icteridae, Agelaius phoeniceus). Additionally, both immune defenses were more functionally efficient in the brown-headed cowbird (M. ater), an extreme host-generalist brood parasite, than in the bronzed cowbird (M. aeneus), a moderate host-specialist with lower exposure to other species and their parasites. Thus the relative effectiveness of these two innate immune responses corresponds to the diversity of parasites in the niche of each species and to their relative resistance to WNV. This study is the first use of these two specialized assays in a comparative immunology study of wild avian species.

  4. Immune functions of the garment workers.

    Science.gov (United States)

    Sultana, R; Ferdous, K J; Hossain, M; Zahid, M S H; Islam, L N

    2012-10-01

    Occupational exposure to cotton dust, fibers, metal fumes and different chemicals used in the aparrel manufacturing industries cause a wide range of physical and psychological health problems in the garment workers that may also affect their immune function. To assess the immune system function in garment workers. A total of 45 workers of a garment factory, and 41 control subjects, not exposed to the garment working environment were enrolled in this study. In the study subjects, the complement system function was assessed as bactericidal activity on Escherichia coli DH5α cells using the standard plate count method. Serum complement components C3 and C4 were measured by immunoprecipitation, and IgG was measured by immunonephelometry. The bactericidal activity of serum complement in the garment workers (range: 93.5%-99.9%) was significantly (pgarment workers, the mean levels of complement C3, and C4 were 1.75 and 0.26 g/L, respectively that were close to those of the controls. The mean IgG level in the garment workers was 13.5 g/L that was significantly (pgarment factory may affect the immune system.

  5. Streptavidin-functionalized capillary immune microreactor for highly efficient chemiluminescent immunoassay

    Energy Technology Data Exchange (ETDEWEB)

    Yang Zhanjun [State Key Laboratory of Analytical Chemistry for Life Science, Department of Chemistry, Nanjing University, Nanjing 210093 (China); College of Chemistry and Engineering, Yangzhou University, 88 South University Avenue, Yangzhou 225002 (China); Zong Chen [State Key Laboratory of Analytical Chemistry for Life Science, Department of Chemistry, Nanjing University, Nanjing 210093 (China); Ju Huangxian, E-mail: hxju@nju.edu.cn [State Key Laboratory of Analytical Chemistry for Life Science, Department of Chemistry, Nanjing University, Nanjing 210093 (China); Yan Feng, E-mail: yanfeng2007@sohu.com [Jiangsu Institute of Cancer Prevention and Cure, Nanjing 210009 (China)

    2011-11-07

    Highlights: {yields} A novel capillary immune microreactor was proposed for highly efficient flow-through chemiluminescent immunoassay. {yields} The microreactor was prepared by functionalizing capillary inner wall with streptavidin for capture of biotinylated antibody. {yields} The proposed immunoassay method showed wide dynamic range, good reproducibility, stability and practicality. {yields} The microreactor was low-cost and disposable, and possessed several advantages over the conventional immunoreactors. - Abstract: A streptavidin functionalized capillary immune microreactor was designed for highly efficient flow-through chemiluminescent (CL) immunoassay. The functionalized capillary could be used as both a support for highly efficient immobilization of antibody and a flow cell for flow-through immunoassay. The functionalized inner wall and the capture process were characterized using scanning electron microscopy. Compared to conventional packed tube or thin-layer cell immunoreactor, the proposed microreactor showed remarkable properties such as lower cost, simpler fabrication, better practicality and wider dynamic range for fast CL immunoassay with good reproducibility and stability. Using {alpha}-fetoprotein as model analyte, the highly efficient CL flow-through immunoassay system showed a linear range of 3 orders of magnitude from 0.5 to 200 ng mL{sup -1} and a low detection limit of 0.1 ng mL{sup -1}. The capillary immune microreactor could make up the shortcoming of conventional CL immunoreactors and provided a promising alternative for highly efficient flow-injection immunoassay.

  6. Differential Gender Effects in the Relationship between Perceived Immune Functioning and Autistic Traits.

    Science.gov (United States)

    Mackus, Marlou; Kruijff, Deborah de; Otten, Leila S; Kraneveld, Aletta D; Garssen, Johan; Verster, Joris C

    2017-04-12

    Altered immune functioning has been demonstrated in individuals with autism spectrum disorder (ASD). The current study explores the relationship between perceived immune functioning and experiencing ASD traits in healthy young adults. N = 410 students from Utrecht University completed a survey on immune functioning and autistic traits. In addition to a 1-item perceived immune functioning rating, the Immune Function Questionnaire (IFQ) was completed to assess perceived immune functioning. The Dutch translation of the Autism-Spectrum Quotient (AQ) was completed to examine variation in autistic traits, including the domains "social insights and behavior", "difficulties with change", "communication", "phantasy and imagination", and "detail orientation". The 1-item perceived immune functioning score did not significantly correlate with the total AQ score. However, a significant negative correlation was found between perceived immune functioning and the AQ subscale "difficulties with change" (r = -0.119, p = 0.019). In women, 1-item perceived immune functioning correlated significantly with the AQ subscales "difficulties with change" (r = -0.149, p = 0.029) and "communication" (r = -0.145, p = 0.032). In men, none of the AQ subscales significantly correlated with 1-item perceived immune functioning. In conclusion, a modest relationship between perceived immune functioning and several autistic traits was found.

  7. Nutrition, immune function and health of dairy cattle.

    Science.gov (United States)

    Ingvartsen, K L; Moyes, K

    2013-03-01

    The large increase in milk yield and the structural changes in the dairy industry have caused major changes in the housing, feeding and management of the dairy cow. However, while large improvements have occurred in production and efficiency, the disease incidence, based on veterinary records, does not seem to be improved. Earlier reviews have covered critical periods such as the transition period in the cow and its influence on health and immune function, the interplay between the endocrine system and the immune system and nutrition and immune function. Knowledge on these topics is crucial for our understanding of disease risk and our effort to develop health and welfare improving strategies, including proactive management for preventing diseases and reducing the severity of diseases. To build onto this the main purpose of this review will therefore be on the effect of physiological imbalance (PI) on immune function, and to give perspectives for prevention of diseases in the dairy cow through nutrition. To a large extent, the health problems during the periparturient period relate to cows having difficulty in adapting to the nutrient needs for lactation. This may result in PI, a situation where the regulatory mechanisms are insufficient for the animals to function optimally leading to a high risk of a complex of digestive, metabolic and infectious problems. The risk of infectious diseases will be increased if the immune competence is reduced. Nutrition plays a pivotal role in the immune response and the effect of nutrition may be directly through nutrients or indirectly by metabolites, for example, in situations with PI. This review discusses the complex relationships between metabolic status and immune function and how these complex interactions increase the risk of disease during early lactation. A special focus will be placed on the major energetic fuels currently known to be used by immune cells (i.e. glucose, non-esterified fatty acids, beta

  8. A novel algorithm of artificial immune system for high-dimensional function numerical optimization

    Institute of Scientific and Technical Information of China (English)

    DU Haifeng; GONG Maoguo; JIAO Licheng; LIU Ruochen

    2005-01-01

    Based on the clonal selection theory and immune memory theory, a novel artificial immune system algorithm, immune memory clonal programming algorithm (IMCPA), is put forward. Using the theorem of Markov chain, it is proved that IMCPA is convergent. Compared with some other evolutionary programming algorithms (like Breeder genetic algorithm), IMCPA is shown to be an evolutionary strategy capable of solving complex machine learning tasks, like high-dimensional function optimization, which maintains the diversity of the population and avoids prematurity to some extent, and has a higher convergence speed.

  9. [Impact of thymic function in age-related immune deterioration].

    Science.gov (United States)

    Ferrando-Martínez, Sara; de la Fuente, Mónica; Guerrero, Juan Miguel; Leal, Manuel; Muñoz-Fernández, M Ángeles

    2013-01-01

    Age-related biological deterioration also includes immune system deterioration and, in consequence, a rise in the incidence and prevalence of infections and cancers, as well as low responses to vaccination strategies. Out of all immune cell subsets, T-lymphocytes seem to be involved in most of the age-related defects. Since T-lymphocytes mature during their passage through the thymus, and the thymus shows an age-related process of atrophy, thymic regression has been proposed as the triggering event of this immune deterioration in elderly people. Historically, it has been accepted that the young thymus sets the T-lymphocyte repertoire during the childhood, whereupon atrophy begins until the elderly thymus is a non-functional evolutionary trace. However, a rising body of knowledge points toward the thymus functioning during adulthood. In the elderly, higher thymic function is associated with a younger immune system, while thymic function failure is associated with all-cause mortality. Therefore, any new strategy focused on the improvement of the elderly quality of life, especially those trying to influence the immune system, should take into account, together with peripheral homeostasis, thymus function as a key element in slowing down age-related decline. Copyright © 2012 SEGG. Published by Elsevier Espana. All rights reserved.

  10. Staphylococcal Immune Evasion Proteins: Structure, Function, and Host Adaptation.

    Science.gov (United States)

    Koymans, Kirsten J; Vrieling, Manouk; Gorham, Ronald D; van Strijp, Jos A G

    2017-01-01

    Staphylococcus aureus is a successful human and animal pathogen. Its pathogenicity is linked to its ability to secrete a large amount of virulence factors. These secreted proteins interfere with many critical components of the immune system, both innate and adaptive, and hamper proper immune functioning. In recent years, numerous studies have been conducted in order to understand the molecular mechanism underlying the interaction of evasion molecules with the host immune system. Structural studies have fundamentally contributed to our understanding of the mechanisms of action of the individual factors. Furthermore, such studies revealed one of the most striking characteristics of the secreted immune evasion molecules: their conserved structure. Despite high-sequence variability, most immune evasion molecules belong to a small number of structural categories. Another remarkable characteristic is that S. aureus carries most of these virulence factors on mobile genetic elements (MGE) or ex-MGE in its accessory genome. Coevolution of pathogen and host has resulted in immune evasion molecules with a highly host-specific function and prevalence. In this review, we explore how these shared structures and genomic locations relate to function and host specificity. This is discussed in the context of therapeutic options for these immune evasion molecules in infectious as well as in inflammatory diseases.

  11. Effect of immune nutritional support on immune function and inflammatory factor in postoperative patients with gastric cancer

    Directory of Open Access Journals (Sweden)

    Hua-Jia Dai

    2016-05-01

    Full Text Available Objective: To investigate the effect of immune nutritional support on immune function and inflammatory factor in postoperative patients with gastric cancer. Methods: A total of 100 patients with gastric cancer were selected and randomly divided into the observation group and the control group with 50 cases in each group. The control group received routine perioperative enteral and parenteral nutrition, on the basis of conventional nutritional support, and the observation group was given enteral nutrition emulsion immune support. Then, the immune function and the inflammatory factor of postoperative day 1 and day 7 were compared between the two groups. Results: (1 With the preoperative data as the basis, the levels of serum IgG, IgA, C3 and C4 decreased at the postoperative day 1 and then increased at the postoperative day 7, while the level of IgM showed an increasing trend and then a decreasing trend in the two groups, and the corresponding figures for the postoperative day 1 and day 7 were statistically different between the two groups. In the observation group, the levels of IgG, IgA, C3 and C4 were higher, while the level of IgM was lower at the postoperative day 1 and day 7 than that in the control group, and the differences were statistically significant; (2 With the preoperative data as the basis, the levels of serum TNF-α, IL-6 and CRP significantly increased at the postoperative day 1 and then decreased at the postoperative day 7 in the two groups, and the corresponding figures for the postoperative day 1 and day 7 in the observation group were lower than those in the control group, and the differences were statistically significant. Conclusion: Immune nutritional support can help to reduce the damage of immune function and the inflammatory response induced by surgery in patients with gastric cancer, which is worthy of clinical application.

  12. Effect of radiotherapy on immunity function of cancer patients receiving radiotherapy

    International Nuclear Information System (INIS)

    Li Xinli; Zhu Shentao; Xu Jiuhong

    2003-01-01

    Objective: In order to observe the effect of radiotherapy on immunity function of cancer patients receiving radiotherapy. Methods: Cellular immunity is determined by APAAP; Humoral immunity is determined by transmission method. Results: The items of cellular immunity is lower than the control after radiotherapy. These items decrease continually. The difference between before and after radiotherapy has statistic significance. Of all Humoral immunity items, IgA, IgM decreased after radiotherapy and the difference has statistic significance. Conclusions: Radiotherapy can damage patients' immunity function

  13. Exercise and the Regulation of Immune Functions.

    Science.gov (United States)

    Simpson, Richard J; Kunz, Hawley; Agha, Nadia; Graff, Rachel

    2015-01-01

    Exercise has a profound effect on the normal functioning of the immune system. It is generally accepted that prolonged periods of intensive exercise training can depress immunity, while regular moderate intensity exercise is beneficial. Single bouts of exercise evoke a striking leukocytosis and a redistribution of effector cells between the blood compartment and the lymphoid and peripheral tissues, a response that is mediated by increased hemodynamics and the release of catecholamines and glucocorticoids following the activation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis. Single bouts of prolonged exercise may impair T-cell, NK-cell, and neutrophil function, alter the Type I and Type II cytokine balance, and blunt immune responses to primary and recall antigens in vivo. Elite athletes frequently report symptoms associated with upper respiratory tract infections (URTI) during periods of heavy training and competition that may be due to alterations in mucosal immunity, particularly reductions in secretory immunoglobulin A. In contrast, single bouts of moderate intensity exercise are "immuno-enhancing" and have been used to effectively increase vaccine responses in "at-risk" patients. Improvements in immunity due to regular exercise of moderate intensity may be due to reductions in inflammation, maintenance of thymic mass, alterations in the composition of "older" and "younger" immune cells, enhanced immunosurveillance, and/or the amelioration of psychological stress. Indeed, exercise is a powerful behavioral intervention that has the potential to improve immune and health outcomes in the elderly, the obese, and patients living with cancer and chronic viral infections such as HIV. © 2015 Elsevier Inc. All rights reserved.

  14. [Effects of electromagnetic radiation on health and immune function of operators].

    Science.gov (United States)

    Li, Yan-zhong; Chen, Shao-hua; Zhao, Ke-fu; Gui, Yun; Fang, Si-xin; Xu, Ying; Ma, Zi-jian

    2013-08-01

    To investigate the effects of electromagnetic radiation on the physiological indices and immune function of operators. The general conditions and electromagnetic radiation awareness rate of 205 operators under electromagnetic radiation were evaluated using a self-designed questionnaire. Physical examination, electrocardiography, and routine urine test were performed in these operators. Peripheral blood was collected from the operators under electromagnetic radiation for blood cell counting and biochemical testing, and their peripheral blood lymphocytes were cultured for determination of chromosomal aberrant frequency and micronucleus frequency. The data from these operators (exposure group) were compared with those of 95 ordinary individuals (control group). The chief complaint of giddiness, tiredness, dizziness, and amnesia showed significant differences between the exposure group and control group (P electromagnetic radiation damage was significantly higher in the exposure group than in the control group. The difference in bradycardia was significant between the two groups (P Electromagnetic radiation may lead to the changes in physiological indices, genetic effects, and immune function and affect the health and immune function in operators. The adverse effects are increased as the working years increase. So it is important to strengthen occupational protection of operators under electromagnetic radiation.

  15. Vitamin D and neonatal immune function.

    LENUS (Irish Health Repository)

    Clancy, N

    2013-05-01

    Vitamin D deficiency is widespread in the neonatal and paediatric population of northern latitudes, particularly in children of African, Middle Eastern and Asian ethnicity. This is associated with diminished immune function and increases the risk of Th1 autoimmune diseases like type 1 diabetes. Epidermiological studies have also shown a link between vitamin D deficiency in children and a more severe course of illness with lower respiratory tract infection or Respiratory Syncitial Virus (RSV) bronchiolitis. The mechanism by which vitamin D enhances immunity is complex. It acts through the innate immune system by inducing antimicrobial peptides in epithelial cells, neutrophils and macrophages. The role of Vitamin D in neonatal and paediatric immunomodulation requires further study.

  16. Jungle Honey Enhances Immune Function and Antitumor Activity

    Directory of Open Access Journals (Sweden)

    Miki Fukuda

    2011-01-01

    Full Text Available Jungle honey (JH is collected from timber and blossom by wild honey bees that live in the tropical forest of Nigeria. JH is used as a traditional medicine for colds, skin inflammation and burn wounds as well as general health care. However, the effects of JH on immune functions are not clearly known. Therefore, we investigated the effects of JH on immune functions and antitumor activity in mice. Female C57BL/6 mice were injected with JH (1 mg/mouse/day, seven times intra-peritoneal. After seven injections, peritoneal cells (PC were obtained. Antitumor activity was assessed by growth of Lewis Lung Carcinoma/2 (LL/2 cells. PC numbers were increased in JH-injected mice compared to control mice. In Dot Plot analysis by FACS, a new cell population appeared in JH-injected mice. The percent of Gr-1 surface antigen and the intensity of Gr-1 antigen expression of PC were increased in JH-injected mice. The new cell population was neutrophils. JH possessed chemotactic activity for neutrophils. Tumor incidence and weight were decreased in JH-injected mice. The ratio of reactive oxygen species (ROS producing cells was increased in JH-injected mice. The effective component in JH was fractionized by gel filtration using HPLC and had an approximate molecular weight (MW of 261. These results suggest that neutrophils induced by JH possess potent antitumor activity mediated by ROS and the effective immune component of JH is substrate of MW 261.

  17. MenTORing Immunity: mTOR Signaling in the Development and Function of Tissue-Resident Immune Cells.

    Science.gov (United States)

    Jones, Russell G; Pearce, Edward J

    2017-05-16

    Tissue-resident immune cells must balance survival in peripheral tissues with the capacity to respond rapidly upon infection or tissue damage, and in turn couple these responses with intrinsic metabolic control and conditions in the tissue microenvironment. The serine/threonine kinase mammalian/mechanistic target of rapamycin (mTOR) is a central integrator of extracellular and intracellular growth signals and cellular metabolism and plays important roles in both innate and adaptive immune responses. This review discusses the function of mTOR signaling in the differentiation and function of tissue-resident immune cells, with focus on the role of mTOR as a metabolic sensor and its impact on metabolic regulation in innate and adaptive immune cells. We also discuss the impact of metabolic constraints in tissues on immune homeostasis and disease, and how manipulating mTOR activity with drugs such as rapamycin can modulate immunity in these contexts. Copyright © 2017. Published by Elsevier Inc.

  18. Maternal immunization increases nestling energy expenditure, immune function, and fledging success in a passerine bird

    Directory of Open Access Journals (Sweden)

    Gary Burness

    2018-04-01

    Full Text Available Female birds transfer maternally derived antibodies (matAb to their nestlings, via the egg yolk. These antibodies are thought to provide passive protection, and allow nestlings to avoid the costs associated with mounting an innate immune response. To test whether there is an energetic benefit to nestlings from receiving matAb, we challenged adult female tree swallows (Tachycineta bicolor prior to clutch initiation with either lipopolysaccharide (LPS or saline (Control. Following hatching, one half of each female's nestlings were immunized on day 8 post-hatch with LPS or saline, and the 4-h post-immunization nestling metabolic rate (MR was measured. There was no difference in either LPS-reactive antibodies or total Ig levels between offspring of immunized and non-immunized mothers on day 6 or 14 post-hatch, possibly reflecting a relatively short half-life of matAbs in altricial birds. Additionally, we found no evidence that nestlings from LPS-immunized mothers could avoid the growth suppression that may result from activation of an inflammatory response. Unexpectedly, we found that control nestlings from LPS mothers had higher resting MR than control nestlings of control mothers. We attribute the increased MR to the costs associated with a general non-specific enhancement of immune function in nestlings from LPS-immunized mothers. Consistent with enhanced immune function, nestlings of immunized mothers had a more robust inflammatory response to phytohaemagglutinin and higher fledging success. Our results suggest that maternal antigen exposure pre-laying can result in increased fitness for both mothers and offspring, depending on food availability.

  19. Vitamin C and Immune Function

    Directory of Open Access Journals (Sweden)

    Anitra C. Carr

    2017-11-01

    Full Text Available Vitamin C is an essential micronutrient for humans, with pleiotropic functions related to its ability to donate electrons. It is a potent antioxidant and a cofactor for a family of biosynthetic and gene regulatory enzymes. Vitamin C contributes to immune defense by supporting various cellular functions of both the innate and adaptive immune system. Vitamin C supports epithelial barrier function against pathogens and promotes the oxidant scavenging activity of the skin, thereby potentially protecting against environmental oxidative stress. Vitamin C accumulates in phagocytic cells, such as neutrophils, and can enhance chemotaxis, phagocytosis, generation of reactive oxygen species, and ultimately microbial killing. It is also needed for apoptosis and clearance of the spent neutrophils from sites of infection by macrophages, thereby decreasing necrosis/NETosis and potential tissue damage. The role of vitamin C in lymphocytes is less clear, but it has been shown to enhance differentiation and proliferation of B- and T-cells, likely due to its gene regulating effects. Vitamin C deficiency results in impaired immunity and higher susceptibility to infections. In turn, infections significantly impact on vitamin C levels due to enhanced inflammation and metabolic requirements. Furthermore, supplementation with vitamin C appears to be able to both prevent and treat respiratory and systemic infections. Prophylactic prevention of infection requires dietary vitamin C intakes that provide at least adequate, if not saturating plasma levels (i.e., 100–200 mg/day, which optimize cell and tissue levels. In contrast, treatment of established infections requires significantly higher (gram doses of the vitamin to compensate for the increased inflammatory response and metabolic demand.

  20. The effects of stress hormones on immune function may be vital for the adaptive reconfiguration of the immune system during fight-or-flight behavior.

    Science.gov (United States)

    Adamo, Shelley A

    2014-09-01

    Intense, short-term stress (i.e., robust activation of the fight-or-flight response) typically produces a transient decline in resistance to disease in animals across phyla. Chemical mediators of the stress response (e.g., stress hormones) help induce this decline, suggesting that this transient immunosuppression is an evolved response. However, determining the function of stress hormones on immune function is difficult because of their complexity. Nevertheless, evidence suggests that stress hormones help maintain maximal resistance to disease during the physiological changes needed to optimize the body for intense physical activity. Work on insects demonstrates that stress hormones both shunt resources away from the immune system during fight-or-flight responses as well as reconfigure the immune system. Reconfiguring the immune system minimizes the impact of the loss of these resources and reduces the increased costs of some immune functions due to the physiological changes demanded by the fight-or-flight response. For example, during the stress response of the cricket Gryllus texensis, some molecular resources are shunted away from the immune system and toward lipid transport, resulting in a reduction in resistance to disease. However, insects' immune cells (hemocytes) have receptors for octopamine (the insect stress neurohormone). Octopamine increases many hemocyte functions, such as phagocytosis, and these changes would tend to mitigate the decline in immunity due to the loss of molecular resources. Moreover, because the stress response generates oxidative stress, some immune responses are probably more costly when activated during a stress response (e.g., those that produce reactive molecules). Some of these immune responses are depressed during stress in crickets, while others, whose costs are probably not increased during a stress response, are enhanced. Some effects of stress hormones on immune systems may be better understood as examples of reconfiguration

  1. Does Exercise Alter Immune Function and Respiratory Infections?

    Science.gov (United States)

    Nieman, David C.

    2001-01-01

    This paper examines whether physical activity influences immune function as a consequence risk of infection from the common cold and other upper respiratory tract infections (URTI) and whether the immune system responds differently to moderate versus intense physical exertion. Research indicates that people who participate in regular moderate…

  2. Tumor-altered dendritic cell function: implications for anti-tumor immunity

    Directory of Open Access Journals (Sweden)

    Kristian Michael Hargadon

    2013-07-01

    Full Text Available Dendritic cells are key regulators of both innate and adaptive immunity, and the array of immunoregulatory functions exhibited by these cells is dictated by their differentiation, maturation, and activation status. Although a major role for these cells in the induction of immunity to pathogens has long been appreciated, data accumulated over the last several years has demonstrated that DC are also critical regulators of anti-tumor immune responses. However, despite the potential for stimulation of robust anti-tumor immunity by DC, tumor-altered DC function has been observed in many cancer patients and tumor-bearing animals and is often associated with tumor immune escape. Such dysfunction has significant implications for both the induction of natural anti-tumor immune responses as well as the efficacy of immunotherapeutic strategies that target endogenous DC in situ or that employ exogenous DC as part of anti-cancer immunization maneuvers. In this review, the major types of tumor-altered DC function will be described, with emphasis on recent insights into the mechanistic bases for the inhibition of DC differentiation from hematopoietic precursors, the altered programming of DC precursors to differentiate into myeloid-derived suppressor cells or tumor-associated macrophages, the suppression of DC maturation and activation, and the induction of immunoregulatory DC by tumors, tumor-derived factors, and tumor-associated cells within the milieu of the tumor microenvironment. The impact of these tumor-altered cells on the quality of the overall anti-tumor immune response will also be discussed. Finally, this review will also highlight questions concerning tumor-altered DC function that remain unanswered, and it will address factors that have limited advances in the study of this phenomenon in order to focus future research efforts in the field on identifying strategies for interfering with tumor-associated DC dysfunction and improving DC-mediated anti

  3. Zinc as a Gatekeeper of Immune Function

    Directory of Open Access Journals (Sweden)

    Inga Wessels

    2017-11-01

    Full Text Available After the discovery of zinc deficiency in the 1960s, it soon became clear that zinc is essential for the function of the immune system. Zinc ions are involved in regulating intracellular signaling pathways in innate and adaptive immune cells. Zinc homeostasis is largely controlled via the expression and action of zinc “importers” (ZIP 1–14, zinc “exporters” (ZnT 1–10, and zinc-binding proteins. Anti-inflammatory and anti-oxidant properties of zinc have long been documented, however, underlying mechanisms are still not entirely clear. Here, we report molecular mechanisms underlying the development of a pro-inflammatory phenotype during zinc deficiency. Furthermore, we describe links between altered zinc homeostasis and disease development. Consequently, the benefits of zinc supplementation for a malfunctioning immune system become clear. This article will focus on underlying mechanisms responsible for the regulation of cellular signaling by alterations in zinc homeostasis. Effects of fast zinc flux, intermediate “zinc waves”, and late homeostatic zinc signals will be discriminated. Description of zinc homeostasis-related effects on the activation of key signaling molecules, as well as on epigenetic modifications, are included to emphasize the role of zinc as a gatekeeper of immune function.

  4. Constant illumination reduces circulating melatonin and impairs immune function in the cricket Teleogryllus commodus

    Directory of Open Access Journals (Sweden)

    Joanna Durrant

    2015-07-01

    Full Text Available Exposure to constant light has a range of negative effects on behaviour and physiology, including reduced immune function in both vertebrates and invertebrates. It is proposed that the associated suppression of melatonin (a ubiquitous hormone and powerful antioxidant in response to the presence of light at night could be an underlying mechanistic link driving the changes to immune function. Here, we investigated the relationship between constant illumination, melatonin and immune function, using a model invertebrate species, the Australian black field cricket, Teleogryllus commodus. Crickets were reared under either a 12 h light: 12 h dark regimen or a constant 24 h light regimen. Circulating melatonin concentration and immune function (haemocyte concentration, lytic activity and phenoloxidase (PO activity were assessed in individual adult crickets through the analysis of haemolymph. Constant illumination reduced melatonin and had a negative impact on haemocyte concentrations and lytic activity, but its effect on PO activity was less apparent. Our data provide the first evidence, to our knowledge, of a link between exposure to constant illumination and variation in haemocyte concentration in an invertebrate model, while also highlighting the potential complexity of the immune response following exposure to constant illumination. This study provides insight into the possible negative effect of artificial night-time lighting on the physiology of invertebrates, but whether lower and potentially more ecologically relevant levels of light at night produce comparable results, as has been reported in several vertebrate taxa, remains to be tested.

  5. Tradeoffs between immune function and childhood growth among Amazonian forager-horticulturalists.

    Science.gov (United States)

    Urlacher, Samuel S; Ellison, Peter T; Sugiyama, Lawrence S; Pontzer, Herman; Eick, Geeta; Liebert, Melissa A; Cepon-Robins, Tara J; Gildner, Theresa E; Snodgrass, J Josh

    2018-04-24

    Immune function is an energetically costly physiological activity that potentially diverts calories away from less immediately essential life tasks. Among developing organisms, the allocation of energy toward immune function may lead to tradeoffs with physical growth, particularly in high-pathogen, low-resource environments. The present study tests this hypothesis across diverse timeframes, branches of immunity, and conditions of energy availability among humans. Using a prospective mixed-longitudinal design, we collected anthropometric and blood immune biomarker data from 261 Amazonian forager-horticulturalist Shuar children (age 4-11 y old). This strategy provided baseline measures of participant stature, s.c. body fat, and humoral and cell-mediated immune activity as well as subsample longitudinal measures of linear growth (1 wk, 3 mo, 20 mo) and acute inflammation. Multilevel analyses demonstrate consistent negative effects of immune function on growth, with children experiencing up to 49% growth reduction during periods of mildly elevated immune activity. The direct energetic nature of these relationships is indicated by ( i ) the manifestation of biomarker-specific negative immune effects only when examining growth over timeframes capturing active competition for energetic resources, ( ii ) the exaggerated impact of particularly costly inflammation on growth, and ( iii ) the ability of children with greater levels of body fat (i.e., energy reserves) to completely avoid the growth-inhibiting effects of acute inflammation. These findings provide evidence for immunologically and temporally diverse body fat-dependent tradeoffs between immune function and growth during childhood. We discuss the implications of this work for understanding human developmental energetics and the biological mechanisms regulating variation in human ontogeny, life history, and health.

  6. Position statement. Part one: Immune function and exercise

    DEFF Research Database (Denmark)

    Walsh, Neil P; Gleeson, Michael; Shephard, Roy J

    2011-01-01

    responses and falls in stimulated B cell Ig synthesis. The cause of this apparent depression in acquired immunity appears to be related to elevated circulating stress hormones, and alterations in the pro/anti-inflammatory cytokine balance in response to exercise. The clinical significance of these changes...... and immediately after exercise, proportional to exercise intensity and duration, with numbers of cells (T cells and to a lesser extent B cells) falling below pre-exercise levels during the early stages of recovery, before returning to resting values normally within 24 h. Mobilization of T and B cell subsets...... risk of URTI during heavy training. An important question for exercise immunologists remains: how does one measure immune function in a meaningful way? One approach to assessing immune function that extends beyond blood or salivary measures involves challenging study participants with antigenic stimuli...

  7. Control of Immune Cell Homeostasis and Function by lncRNAs.

    Science.gov (United States)

    Mowel, Walter K; Kotzin, Jonathan J; McCright, Sam J; Neal, Vanessa D; Henao-Mejia, Jorge

    2018-01-01

    The immune system is composed of diverse cell types that coordinate responses to infection and maintain tissue homeostasis. In each of these cells, extracellular cues determine highly specific epigenetic landscapes and transcriptional profiles to promote immunity while maintaining homeostasis. New evidence indicates that long non-coding RNAs (lncRNAs) play crucial roles in epigenetic and transcriptional regulation in mammals. Thus, lncRNAs have emerged as key regulatory molecules of immune cell gene expression programs in response to microbial and tissue-derived cues. We review here how lncRNAs control the function and homeostasis of cell populations during immune responses, emphasizing the diverse molecular mechanisms by which lncRNAs tune highly contextualized transcriptional programs. In addition, we discuss the new challenges faced in interrogating lncRNA mechanisms and function in the immune system. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Nanoparticle-based B-cell targeting vaccines: Tailoring of humoral immune responses by functionalization with different TLR-ligands.

    Science.gov (United States)

    Zilker, Claudia; Kozlova, Diana; Sokolova, Viktoriya; Yan, Huimin; Epple, Matthias; Überla, Klaus; Temchura, Vladimir

    2017-01-01

    Induction of an appropriate type of humoral immune response during vaccination is essential for protection against viral and bacterial infections. We recently observed that biodegradable calcium phosphate (CaP) nanoparticles coated with proteins efficiently targeted and activated naïve antigen-specific B-cells in vitro. We now compared different administration routes for CaP-nanoparticles and demonstrated that intramuscular immunization with such CaP-nanoparticles induced stronger immune responses than immunization with monovalent antigen. Additional functionalization of the CaP-nanoparticles with TRL-ligands allowed modulating the IgG subtype response and the level of mucosal IgA antibodies. CpG-containing CaP-nanoparticles were as immunogenic as a virus-like particle vaccine. Functionalization of CaP-nanoparticles with T-helper cell epitopes or CpG also allowed overcoming lack of T-cell help. Thus, our results indicate that CaP-nanoparticle-based B-cell targeting vaccines functionalized with TLR-ligands can serve as a versatile platform for efficient induction and modulation of humoral immune responses in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Interaction Between 2 Nutraceutical Treatments and Host Immune Status in the Pediatric Critical Illness Stress-Induced Immune Suppression Comparative Effectiveness Trial.

    Science.gov (United States)

    Carcillo, Joseph A; Dean, J Michael; Holubkov, Richard; Berger, John; Meert, Kathleen L; Anand, Kanwaljeet J S; Zimmerman, Jerry J; Newth, Christopher J L; Harrison, Rick; Burr, Jeri; Willson, Douglas F; Nicholson, Carol; Bell, Michael J; Berg, Robert A; Shanley, Thomas P; Heidemann, Sabrina M; Dalton, Heidi; Jenkins, Tammara L; Doctor, Allan; Webster, Angie; Tamburro, Robert F

    2017-11-01

    The pediatric Critical Illness Stress-induced Immune Suppression (CRISIS) trial compared the effectiveness of 2 nutraceutical supplementation strategies and found no difference in the development of nosocomial infection and sepsis in the overall population. We performed an exploratory post hoc analysis of interaction between nutraceutical treatments and host immune status related to the development of nosocomial infection/sepsis. Children from the CRISIS trial were analyzed according to 3 admission immune status categories marked by decreasing immune competence: immune competent without lymphopenia, immune competent with lymphopenia, and previously immunocompromised. The comparative effectiveness of the 2 treatments was analyzed for interaction with immune status category. There were 134 immune-competent children without lymphopenia, 79 previously immune-competent children with lymphopenia, and 27 immunocompromised children who received 1 of the 2 treatments. A significant interaction was found between treatment arms and immune status on the time to development of nosocomial infection and sepsis ( P patient characteristic.

  10. The multitasking organ: recent insights into skin immune function.

    Science.gov (United States)

    Di Meglio, Paola; Perera, Gayathri K; Nestle, Frank O

    2011-12-23

    The skin provides the first line defense of the human body against injury and infection. By integrating recent findings in cutaneous immunology with fundamental concepts of skin biology, we portray the skin as a multitasking organ ensuring body homeostasis. Crosstalk between the skin and its microbial environment is also highlighted as influencing the response to injury, infection, and autoimmunity. The importance of the skin immune network is emphasized by the identification of several skin-resident cell subsets, each with its unique functions. Lessons learned from targeted therapy in inflammatory skin conditions, such as psoriasis, provide further insights into skin immune function. Finally, we look at the skin as an interacting network of immune signaling pathways exemplified by the development of a disease interactome for psoriasis. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Strategies to enhance immune function for marathon runners : what can be done?

    DEFF Research Database (Denmark)

    Åkerström, Thorbjörn; Pedersen, Bente K

    2007-01-01

    immune cells. During this period of immune suppression, by some referred to as an 'open window' in immune function, it has been hypothesised that viruses and bacteria might gain a foothold, which would increase the risk of infections. In light of this, nutritional interventions that can enhance immune...

  12. Comparison of the Functional microRNA Expression in Immune Cell Subsets of Neonates and Adults

    Science.gov (United States)

    Yu, Hong-Ren; Hsu, Te-Yao; Huang, Hsin-Chun; Kuo, Ho-Chang; Li, Sung-Chou; Yang, Kuender D.; Hsieh, Kai-Sheng

    2016-01-01

    Diversity of biological molecules in newborn and adult immune cells contributes to differences in cell function and atopic properties. Micro RNAs (miRNAs) are reported to involve in the regulation of immune system. Therefore, determining the miRNA expression profile of leukocyte subpopulations is important for understanding immune system regulation. In order to explore the unique miRNA profiling that contribute to altered immune in neonates, we comprehensively analyzed the functional miRNA signatures of eight leukocyte subsets (polymorphonuclear cells, monocytes, CD4+ T cells, CD8+ T cells, natural killer cells, B cells, plasmacytoid dendritic cells, and myeloid dendritic cells) from both neonatal and adult umbilical cord and peripheral blood samples, respectively. We observed distinct miRNA profiles between adult and neonatal blood leukocyte subsets, including unique miRNA signatures for each cell lineage. Leukocyte miRNA signatures were altered after stimulation. Adult peripheral leukocytes had higher let-7b-5p expression levels compared to neonatal cord leukocytes across multiple subsets, irrespective of stimulation. Transfecting neonatal monocytes with a let-7b-5p mimic resulted in a reduction of LPS-induced interleukin (IL)-6 and TNF-α production, while transfection of a let-7b-5p inhibitor into adult monocytes enhanced IL-6 and TNF-α production. With this functional approach, we provide intact differential miRNA expression profiling of specific immune cell subsets between neonates and adults. These studies serve as a basis to further understand the altered immune response observed in neonates and advance the development of therapeutic strategies. PMID:28066425

  13. Comparison of the functional microRNA expression in immune cell subsets of neonates and adults

    Directory of Open Access Journals (Sweden)

    Hong-Ren Yu

    2016-12-01

    Full Text Available Diversity of biological molecules in newborn and adult immune cells contributes to differences in cell function and atopic properties. Micro RNAs (miRNAs are reported involve in the regulation of immune system. Therefore, determining the miRNA expression profile of leukocyte sub-populations is important for understanding immune system regulation. In order to explore the unique microRNA profiling that contribute to altered immune in neonates, we comprehensively analyzed the functional miRNA signatures of eight leukocyte subsets (polymorphonuclear cells, monocytes, CD4+ T cells, CD8+ T cells, natural killer cells, B cells, plasmacytoid dendritic cells (pDCs, and myeloid dendritic cells (mDCs from both neonatal and adult umbilical cord and peripheral blood samples, respectively. We observed distinct miRNA profiles between adult and neonatal blood leukocyte subsets, including unique miRNA signatures for each cell lineage. Leukocyte miRNA signatures were altered after stimulation. Adult peripheral leukocytes had higher let-7b-5p expression levels compared to neonatal cord leukocytes across multiple subsets, irrespective of stimulation. Transfecting neonatal monocytes with a let-7b-5p mimic resulted in a reduction of LPS-induced IL-6 and TNF-alpha production, while transfection of a let-7b-5p inhibitor into adult monocytes enhanced IL-6 and TNF-alpha production. With this functional approach, we provide intact differential microRNA expression profiling of specific immune cell subsets between neonates and adults. These studies serve as a basis to further understand the altered immune response observed in neonates and advance the development of therapeutic strategies.

  14. Changes of some immune functions in combined radiation-burn injury in rats

    International Nuclear Information System (INIS)

    Yan Yongtang; Ran Xinze; Wei Shuqing

    1991-01-01

    The characteristics of some immune functions in radiation injury (6 Gy), burn injury (15%, III deg) and combined radiation-burn injury (CRBI) were studied in rats. The results showed that the functions of splenocytes and thymocytes in radiation injury group (RIG) were depressed more markedly 24-72 h after injury. The degree of thymocyte depression in burn injury group (BIG) was significantly lower than that in RIG and recovered more easily. The characteristics of the CRBI effects were as follows: (1) The combined depression effect on thymocytes in CRBI as compared with that in RIG was deeper and the recovery was slower. (2) The depression course of splenocytes was similar to that in RIG, but the depression degree in the early stage was significantly more heavy than that in RIG. (3) In the later stage of CRBI the level of recovery of T H cells was significantly lower than that in RIG. (4) Eschar-excision plus skin grafting at 24 h after combined injury was helpful for the recovery of thymocyte and splenocytes function. The results showed that the depression and recovery of immune functions in combined injury were closely related to the wound of burn

  15. Trade-off between growth and immune function : a meta-analysis of selection experiments

    NARCIS (Netherlands)

    van der Most, Peter; de Jong, Berber; Parmentier, Henk K.; Verhulst, Simon

    P>1. Evidence suggests that developing and maintaining an effective immune system may be costly and that an organism has to make a trade-off between immune function and other fitness-enhancing traits. To test for a trade-off between growth and immune function we carried out a meta-analysis of data

  16. Effect of liniment levamisole on cellular immune functions of patients with chronic hepatitis B.

    Science.gov (United States)

    Wang, Ke-Xia; Zhang, Li-Hua; Peng, Jiang-Long; Liang, Yong; Wang, Xue-Feng; Zhi, Hui; Wang, Xiang-Xia; Geng, Huan-Xiong

    2005-12-07

    To explore the effects of liniment levamisole on cellular immune functions of patients with chronic hepatitis B. The levels of T lymphocyte subsets and mIL-2R in peripheral blood mononuclear cells (PBMCs) were measured by biotin-streptavidin (BSA) technique in patients with chronic hepatitis B before and after the treatment with liniment levamisole. After one course of treatment with liniment levamisole, the levels of CD3(+), CD4(+), and the ratio of CD4(+)/CD8(+) increased as compared to those before the treatment but the level of CD8(+) decreased. The total expression level of mIL-2R in PBMCs increased before and after the treatment with liniment levamisole. Liniment levamisole may reinforce cellular immune functions of patients with chronic hepatitis B.

  17. Loss of renal function causes premature aging of the immune system.

    Science.gov (United States)

    Betjes, Michiel G H; Meijers, Ruud W J; Litjens, Nicolle H R

    2013-01-01

    Uremia-associated immune deficiency is a well-known complication of loss of renal function and contributes significantly to the overall mortality and morbidity of patients with end-stage renal disease. Chronic inflammation and increased oxidative stress are underlying the uremia-associated immune deficiency. In this review, the differential impact of uremia on the cellular immune system is summarized. Virtually all immune cells studied show a combination of an activated status and loss of function. However, uremia preferentially decreases the number and function of lymphoid cells while myeloid cells show normal and/or elevated cell numbers with increased production of inflammatory cytokines and reactive oxygen species. These particular changes are compatible with immunological aging, which is characterized by loss of thymic function, attrition of telomeres and an expanded memory T cell population. Similar to aging in healthy individuals, the proinflammatory and potential cardiotoxic subsets of CD28(null) T cells and CD16(+) monocytes are increased. Epigenetically changed hematopoietic stem cells may be involved in immunological aging as specific DNA regions become hypermethylated. Proinflammatory T cells and monocytes persist after kidney transplantation, which constitutes a persistent cardiovascular risk factor. Possible therapeutic options to reverse or halt uremia-associated immunological aging are discussed. Premature aging of the immune system is a dominant feature in patients with end-stage renal failure, which corresponds to immunological aging in elderly healthy individuals, which is characterized by preferential loss of cells belonging to the lymphoid cell lineage, inflammation and expansion of proinflammatory immune cells. © 2013 S. Karger AG, Basel.

  18. Development of immune organs and functioning in humans and test animals: Implications for immune intervention studies.

    Science.gov (United States)

    Kuper, C Frieke; van Bilsen, Jolanda; Cnossen, Hilde; Houben, Geert; Garthoff, Jossie; Wolterbeek, Andre

    2016-09-01

    A healthy immune status is mostly determined during early life stages and many immune-related diseases may find their origin in utero and the first years of life. Therefore, immune health optimization may be most effective during early life. This review is an inventory of immune organ maturation events in relation to developmental timeframes in minipig, rat, mouse and human. It is concluded that time windows of immune organ development in rodents can be translated to human, but minipig reflects the human timeframes better; however the lack of prenatal maternal-fetal immune interaction in minipig may cause less responsiveness to prenatal intervention. It is too early to conclude which immune parameters are most appropriate, because there are not enough comparative immune parameters. Filling these gaps will increase the predictability of results observed in experimental animals, and guide future intervention studies by assessing relevant parameters in the right corresponding developmental time frames. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Sleep and immune function: glial contributions and consequences of aging.

    Science.gov (United States)

    Ingiosi, Ashley M; Opp, Mark R; Krueger, James M

    2013-10-01

    The reciprocal interactions between sleep and immune function are well-studied. Insufficient sleep induces innate immune responses as evidenced by increased expression of pro-inflammatory mediators in the brain and periphery. Conversely, immune challenges upregulate immunomodulator expression, which alters central nervous system-mediated processes and behaviors, including sleep. Recent studies indicate that glial cells, namely microglia and astrocytes, are active contributors to sleep and immune system interactions. Evidence suggests glial regulation of these interactions is mediated, in part, by adenosine and adenosine 5'-triphosphate actions at purinergic type 1 and type 2 receptors. Furthermore, microglia and astrocytes may modulate declines in sleep-wake behavior and immunity observed in aging. Copyright © 2013. Published by Elsevier Ltd.

  20. Specific versus non-specific immune responses in an invertebrate species evidenced by a comparative de novo sequencing study.

    Directory of Open Access Journals (Sweden)

    Emeline Deleury

    Full Text Available Our present understanding of the functioning and evolutionary history of invertebrate innate immunity derives mostly from studies on a few model species belonging to ecdysozoa. In particular, the characterization of signaling pathways dedicated to specific responses towards fungi and Gram-positive or Gram-negative bacteria in Drosophila melanogaster challenged our original view of a non-specific immunity in invertebrates. However, much remains to be elucidated from lophotrochozoan species. To investigate the global specificity of the immune response in the fresh-water snail Biomphalaria glabrata, we used massive Illumina sequencing of 5'-end cDNAs to compare expression profiles after challenge by Gram-positive or Gram-negative bacteria or after a yeast challenge. 5'-end cDNA sequencing of the libraries yielded over 12 millions high quality reads. To link these short reads to expressed genes, we prepared a reference transcriptomic database through automatic assembly and annotation of the 758,510 redundant sequences (ESTs, mRNAs of B. glabrata available in public databases. Computational analysis of Illumina reads followed by multivariate analyses allowed identification of 1685 candidate transcripts differentially expressed after an immune challenge, with a two fold ratio between transcripts showing a challenge-specific expression versus a lower or non-specific differential expression. Differential expression has been validated using quantitative PCR for a subset of randomly selected candidates. Predicted functions of annotated candidates (approx. 700 unisequences belonged to a large extend to similar functional categories or protein types. This work significantly expands upon previous gene discovery and expression studies on B. glabrata and suggests that responses to various pathogens may involve similar immune processes or signaling pathways but different genes belonging to multigenic families. These results raise the question of the importance

  1. In-Situ Monitoring of Immune Function, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — Monitoring the health and wellness of mission pilots is a critically important function. Space flight has an adverse effect on the human immune response. During...

  2. Ex vivo cytosolic delivery of functional macromolecules to immune cells.

    Directory of Open Access Journals (Sweden)

    Armon Sharei

    Full Text Available Intracellular delivery of biomolecules, such as proteins and siRNAs, into primary immune cells, especially resting lymphocytes, is a challenge. Here we describe the design and testing of microfluidic intracellular delivery systems that cause temporary membrane disruption by rapid mechanical deformation of human and mouse immune cells. Dextran, antibody and siRNA delivery performance is measured in multiple immune cell types and the approach's potential to engineer cell function is demonstrated in HIV infection studies.

  3. Comparative Proteomics Identifies Host Immune System Proteins Affected by Infection with Mycobacterium bovis.

    Directory of Open Access Journals (Sweden)

    Vladimir López

    2016-03-01

    Full Text Available Mycobacteria of the Mycobacterium tuberculosis complex (MTBC greatly impact human and animal health worldwide. The mycobacterial life cycle is complex, and the mechanisms resulting in pathogen infection and survival in host cells are not fully understood. Eurasian wild boar (Sus scrofa are natural reservoir hosts for MTBC and a model for mycobacterial infection and tuberculosis (TB. In the wild boar TB model, mycobacterial infection affects the expression of innate and adaptive immune response genes in mandibular lymph nodes and oropharyngeal tonsils, and biomarkers have been proposed as correlates with resistance to natural infection. However, the mechanisms used by mycobacteria to manipulate host immune response are not fully characterized. Our hypothesis is that the immune system proteins under-represented in infected animals, when compared to uninfected controls, are used by mycobacteria to guarantee pathogen infection and transmission. To address this hypothesis, a comparative proteomics approach was used to compare host response between uninfected (TB- and M. bovis-infected young (TB+ and adult animals with different infection status [TB lesions localized in the head (TB+ or affecting multiple organs (TB++]. The results identified host immune system proteins that play an important role in host response to mycobacteria. Calcium binding protein A9, Heme peroxidase, Lactotransferrin, Cathelicidin and Peptidoglycan-recognition protein were under-represented in TB+ animals when compared to uninfected TB- controls, but protein levels were higher as infection progressed in TB++ animals when compared to TB- and/or TB+ adult wild boar. MHCI was the only protein over-represented in TB+ adult wild boar when compared to uninfected TB- controls. The results reported here suggest that M. bovis manipulates host immune response by reducing the production of immune system proteins. However, as infection progresses, wild boar immune response recovers to

  4. Comparative Proteomics Identifies Host Immune System Proteins Affected by Infection with Mycobacterium bovis.

    Science.gov (United States)

    López, Vladimir; Villar, Margarita; Queirós, João; Vicente, Joaquín; Mateos-Hernández, Lourdes; Díez-Delgado, Iratxe; Contreras, Marinela; Alves, Paulo C; Alberdi, Pilar; Gortázar, Christian; de la Fuente, José

    2016-03-01

    Mycobacteria of the Mycobacterium tuberculosis complex (MTBC) greatly impact human and animal health worldwide. The mycobacterial life cycle is complex, and the mechanisms resulting in pathogen infection and survival in host cells are not fully understood. Eurasian wild boar (Sus scrofa) are natural reservoir hosts for MTBC and a model for mycobacterial infection and tuberculosis (TB). In the wild boar TB model, mycobacterial infection affects the expression of innate and adaptive immune response genes in mandibular lymph nodes and oropharyngeal tonsils, and biomarkers have been proposed as correlates with resistance to natural infection. However, the mechanisms used by mycobacteria to manipulate host immune response are not fully characterized. Our hypothesis is that the immune system proteins under-represented in infected animals, when compared to uninfected controls, are used by mycobacteria to guarantee pathogen infection and transmission. To address this hypothesis, a comparative proteomics approach was used to compare host response between uninfected (TB-) and M. bovis-infected young (TB+) and adult animals with different infection status [TB lesions localized in the head (TB+) or affecting multiple organs (TB++)]. The results identified host immune system proteins that play an important role in host response to mycobacteria. Calcium binding protein A9, Heme peroxidase, Lactotransferrin, Cathelicidin and Peptidoglycan-recognition protein were under-represented in TB+ animals when compared to uninfected TB- controls, but protein levels were higher as infection progressed in TB++ animals when compared to TB- and/or TB+ adult wild boar. MHCI was the only protein over-represented in TB+ adult wild boar when compared to uninfected TB- controls. The results reported here suggest that M. bovis manipulates host immune response by reducing the production of immune system proteins. However, as infection progresses, wild boar immune response recovers to limit pathogen

  5. Immune activation is associated with decreased thymic function in ...

    African Journals Online (AJOL)

    Background: Reduced thymic function causes poor immunological reconstitution in human immunodeficiency virus (HIV)-positive patients on combined antiretroviral therapy (cART). The association between immune activation and thymic function in asymptomatic HIVpositive treatment-naive individuals has thus far not been ...

  6. Diverse novel functions of neutrophils in immunity, inflammation, and beyond.

    Science.gov (United States)

    Mócsai, Attila

    2013-07-01

    Neutrophils have long been considered simple suicide killers at the bottom of the hierarchy of the immune response. That view began to change 10-20 yr ago, when the sophisticated mechanisms behind how neutrophils locate and eliminate pathogens and regulate immunity and inflammation were discovered. The last few years witnessed a new wave of discoveries about additional novel and unexpected functions of these cells. Neutrophils have been proposed to participate in protection against intracellular pathogens such as viruses and mycobacteria. They have been shown to intimately shape the adaptive immune response at various levels, including marginal zone B cells, plasmacytoid dendritic cells and T cell populations, and even to control NK cell homeostasis. Neutrophils have been shown to mediate an alternative pathway of systemic anaphylaxis and to participate in allergic skin reactions. Finally, neutrophils were found to be involved in physiological and pathological processes beyond the immune system, such as diabetes, atherosclerosis, and thrombus formation. Many of those functions appear to be related to their unique ability to release neutrophil extracellular traps even in the absence of pathogens. This review summarizes those novel findings on versatile functions of neutrophils and how they change our view of neutrophil biology in health and disease.

  7. COMPARATIVE STUDY OF TUMORIGENESIS AND TUMOR IMMUNITY IN INVERTEBRATES AND NONMAMMALIAN VERTEBRATES

    Science.gov (United States)

    Robert, Jacques

    2010-01-01

    Despite intense study in mammals, the different roles played by the immune system in detecting (immunosurveillance), controlling and remodeling (immunoediting) neoplasia, and perhaps in metastasis are not fully understood. In this review, I will present evidence of neoplasia and invasive malignancy, as well as tumor immunity in invertebrates and nonmammalian vertebrates. I will also present a comparative and evolutionary view of the complex interactions between neoplasia and the host immune system. Overall, I wish to go beyond the too simplistic dichotomy between invertebrates with innate immunity that are only affected with benign neoplasia and vertebrates with adaptive immunity that are affected by metastatic malignancies or cancer. PMID:20553753

  8. Low Dose Ionizing Radiation Modulates Immune Function

    International Nuclear Information System (INIS)

    Nelson, Gregory A.

    2016-01-01

    In order to examine the effects of low dose ionizing radiation on the immune system we chose to examine an amplified adaptive cellular immunity response. This response is Type IV delayed-type hypersensitivity also called contact hypersensitivity. The agent fluorescein isothiocyanate (FITC) is a low molecular weight, lipophilic, reactive, fluorescent molecule that can be applied to the skin where it (hapten) reacts with proteins (carriers) to become a complete antigen. Exposure to FITC leads to sensitization which is easily measured as a hypersensitivity inflammatory reaction following a subsequent exposure to the ear. Ear swelling, eosinophil infiltration, immunoglobulin E production and cytokine secretion patterns characteristic of a 'Th2 polarized' immune response are the components of the reaction. The reaction requires successful implementation of antigen processing and presentation by antigen presenting Langerhans cells, communication with naïve T lymphocytes in draining lymph nodes, expansion of activated T cell clones, migration of activated T cells to the circulation, and recruitment of memory T cells, macrophages and eosinophils to the site of the secondary challenge. Using this model our approach was to quantify system function rather than relying only on indirect biomarkers of cell. We measured the FITC-induced hypersensitivity reaction over a range of doses from 2 cGy to 2 Gy. Irradiations were performed during key events or prior to key events to deplete critical cell populations. In addition to quantifying the final inflammatory response, we assessed cell populations in peripheral blood and spleen, cytokine signatures, IgE levels and expression of genes associated with key processes in sensitization and elicitation/recall. We hypothesized that ionizing radiation would produce a biphasic effect on immune system function resulting in an enhancement at low doses and a depression at higher doses and suggested that this transition would occur in

  9. Low Dose Ionizing Radiation Modulates Immune Function

    Energy Technology Data Exchange (ETDEWEB)

    Nelson, Gregory A. [Loma Linda Univ., CA (United States)

    2016-01-12

    In order to examine the effects of low dose ionizing radiation on the immune system we chose to examine an amplified adaptive cellular immunity response. This response is Type IV delayed-type hypersensitivity also called contact hypersensitivity. The agent fluorescein isothiocyanate (FITC) is a low molecular weight, lipophilic, reactive, fluorescent molecule that can be applied to the skin where it (hapten) reacts with proteins (carriers) to become a complete antigen. Exposure to FITC leads to sensitization which is easily measured as a hypersensitivity inflammatory reaction following a subsequent exposure to the ear. Ear swelling, eosinophil infiltration, immunoglobulin E production and cytokine secretion patterns characteristic of a “Th2 polarized” immune response are the components of the reaction. The reaction requires successful implementation of antigen processing and presentation by antigen presenting Langerhans cells, communication with naïve T lymphocytes in draining lymph nodes, expansion of activated T cell clones, migration of activated T cells to the circulation, and recruitment of memory T cells, macrophages and eosinophils to the site of the secondary challenge. Using this model our approach was to quantify system function rather than relying only on indirect biomarkers of cell. We measured the FITC-induced hypersensitivity reaction over a range of doses from 2 cGy to 2 Gy. Irradiations were performed during key events or prior to key events to deplete critical cell populations. In addition to quantifying the final inflammatory response, we assessed cell populations in peripheral blood and spleen, cytokine signatures, IgE levels and expression of genes associated with key processes in sensitization and elicitation/recall. We hypothesized that ionizing radiation would produce a biphasic effect on immune system function resulting in an enhancement at low doses and a depression at higher doses and suggested that this transition would occur in the

  10. The Value of a Comparative Approach to Understand the Complex Interplay between Microbiota and Host Immunity

    Directory of Open Access Journals (Sweden)

    Norma M. Morella

    2017-09-01

    Full Text Available The eukaryote immune system evolved and continues to evolve within a microbial world, and as such is critically shaped by—and in some cases even reliant upon—the presence of host-associated microbial species. There are clear examples of adaptations that allow the host to simultaneously tolerate and/or promote growth of symbiotic microbiota while protecting itself against pathogens, but the relationship between immunity and the microbiome reaches far beyond simple recognition and includes complex cross talk between host and microbe as well as direct microbiome-mediated protection against pathogens. Here, we present a broad but brief overview of how the microbiome is controlled by and interacts with diverse immune systems, with the goal of identifying questions that can be better addressed by taking a comparative approach across plants and animals and different types of immunity. As two key examples of such an approach, we focus on data examining the importance of early exposure on microbiome tolerance and immune system development and function, and the importance of transmission among hosts in shaping the potential coevolution between, and long-term stability of, host–microbiome associations. Then, by comparing existing evidence across short-lived plants, mouse model systems and humans, and insects, we highlight areas of microbiome research that are strong in some systems and absent in others with the hope of guiding future research that will allow for broad-scale comparisons moving forward. We argue that such an approach will not only help with identification of generalities in host–microbiome–immune interactions but also improve our understanding of the role of the microbiome in host health.

  11. Influence of Physical Activity and Nutrition on Obesity-Related Immune Function

    Directory of Open Access Journals (Sweden)

    Chun-Jung Huang

    2013-01-01

    Full Text Available Research examining immune function during obesity suggests that excessive adiposity is linked to impaired immune responses leading to pathology. The deleterious effects of obesity on immunity have been associated with the systemic proinflammatory profile generated by the secretory molecules derived from adipose cells. These include inflammatory peptides, such as TNF-α, CRP, and IL-6. Consequently, obesity is now characterized as a state of chronic low-grade systemic inflammation, a condition considerably linked to the development of comorbidity. Given the critical role of adipose tissue in the inflammatory process, especially in obese individuals, it becomes an important clinical objective to identify lifestyle factors that may affect the obesity-immune system relationship. For instance, stress, physical activity, and nutrition have each shown to be a significant lifestyle factor influencing the inflammatory profile associated with the state of obesity. Therefore, the purpose of this review is to comprehensively evaluate the impact of lifestyle factors, in particular psychological stress, physical activity, and nutrition, on obesity-related immune function with specific focus on inflammation.

  12. Effects of rearing temperature on immune functions in sockeye salmon (Oncorhynchus nerka)

    Science.gov (United States)

    Alcorn, S.W.; Murray, A.L.; Pascho, R.J.

    2002-01-01

    To determine if the defences of sockeye salmon (Oncorhynchus nerka) raised in captivity are affected by the rearing temperature or their life-cycle stage, various indices of the humoral and cellular immune functions were measured in fish reared at either 8 or 12??C for their entire life-cycle. Measures of humoral immunity included the commonly used haematological parameters, as well as measurements of complement, and lysozyme activity. Cellular assays quantified the ability of macrophages from the anterior kidney to phagocytise Staphylococcus aureus cells, or the activities of certain bactericidal systems of those cells. The T-dependent antibody response to a recombinant 57 kDa protein of Renibacterium salmoninarum was used to quantify the specific immune response. Fish were sampled during the spring and fall of their second, third and fourth years, corresponding to a period that began just before smolting and ended at sexual maturation. Fish reared at 8??C tended to have a greater percentage of phagocytic kidney macrophages during the first 2 years of sampling than the fish reared at 12??C. During the last half of the study the complement activity of the fish reared at 8??C was greater than that of the 12??C fish. Conversely, a greater proportion of the blood leucocytes were lymphocytes in fish reared at 12??C compared to the fish reared at 8??C. Fish reared at 12??C also produced a greater antibody response than those reared at 8??C. Results suggested that the immune apparatus of sockeye salmon reared at 8??C relied more heavily on the non-specific immune response, while the specific immune response was used to a greater extent when the fish were reared at 12??C. Although a seasonal effect was not detected in any of the indices measured, varying effects were observed in some measurements during sexual maturation of fish in both temperature groups. At that time there were dramatic decreases in complement activity and lymphocyte numbers. This study was unique in

  13. Behavioural conditioning of immune functions: how the central nervous system controls peripheral immune responses by evoking associative learning processes.

    Science.gov (United States)

    Riether, Carsten; Doenlen, Raphaël; Pacheco-López, Gustavo; Niemi, Maj-Britt; Engler, Andrea; Engler, Harald; Schedlowski, Manfred

    2008-01-01

    During the last 30 years of psychoneuroimmunology research the intense bi-directional communication between the central nervous system (CNS) and the immune system has been demonstrated in studies on the interaction between the nervous-endocrine-immune systems. One of the most intriguing examples of such interaction is the capability of the CNS to associate an immune status with specific environmental stimuli. In this review, we systematically summarize experimental evidence demonstrating the behavioural conditioning of peripheral immune functions. In particular, we focus on the mechanisms underlying the behavioural conditioning process and provide a theoretical framework that indicates the potential feasibility of behaviourally conditioned immune changes in clinical situations.

  14. Effect of Kanglaite combined with chemotherapy on myelosuppression, immune function and tumor markers levels in patients with breast cancer

    Directory of Open Access Journals (Sweden)

    Qi Pan

    2017-09-01

    Full Text Available Objective: To investigate the effect of Kanglaite combined with chemotherapy on myelosuppression, immune function and tumor markers levels in patients with breast cancer. Methods: A total of 90 breast cancer patients in our hospital were randomly divided into control group (45 cases and observation group (45 cases. The two groups received CAF chemotherapy, and the observation group was additionally given Kanglaite injection (200 mL/d for 2 weeks continuously. Both groups had chemotherapy for 6 courses. The effect on myelosuppression, immune function and tumor markers levels was detected and compared before and after treatment in two groups. Results: After treatment, myelosuppression was found in both groups, and the levels of leukocyte, hemoglobin and platelet decreased significantly compared with before treatment (P0.05, and the levels of immune function indexes (CD3+, CD4+, CD4+/ CD8+ of the observation group were significantly higher than those in the control group (P<0.05) . After treatment, the levels of two tumor markers (CEA, CA15-3 decreased significantly than before treatment in both groups (P<0.05, and the decrease amplitude in the observation group was higher than that in the control group (P<0.05. Conclusions: Kanglaite combined with chemotherapy has evident therapeutic effect on breast cancer. It can alleviate the myelosuppression caused by chemotherapy, improve immune function, and reduce the concentration of tumor markers in patients with breast cancer.

  15. Comprehensive proteome analysis of lysosomes reveals the diverse function of macrophages in immune responses.

    Science.gov (United States)

    Gao, Yanpan; Chen, Yanyu; Zhan, Shaohua; Zhang, Wenhao; Xiong, Feng; Ge, Wei

    2017-01-31

    Phagocytosis and autophagy in macrophages have been shown to be essential to both innate and adaptive immunity. Lysosomes are the main catabolic subcellular organelles responsible for degradation and recycling of both extracellular and intracellular material, which are the final steps in phagocytosis and autophagy. However, the molecular mechanisms underlying lysosomal functions after infection remain obscure. In this study, we conducted a quantitative proteomics analysis of the changes in constitution and glycosylation of proteins in lysosomes derived from murine RAW 264.7 macrophage cells treated with different types of pathogens comprising examples of bacteria (Listeria monocytogenes, L. m), DNA viruses (herpes simplex virus type-1, HSV-1) and RNA viruses (vesicular stomatitis virus, VSV). In total, 3,704 lysosome-related proteins and 300 potential glycosylation sites on 193 proteins were identified. Comparative analysis showed that the aforementioned pathogens induced distinct alterations in the proteome of the lysosome, which is closely associated with the immune functions of macrophages, such as toll-like receptor activation, inflammation and antigen-presentation. The most significant changes in proteins and fluctuations in glycosylation were also determined. Furthermore, Western blot analysis showed that the changes in expression of these proteins were undetectable at the whole cell level. Thus, our study provides unique insights into the function of lysosomes in macrophage activation and immune responses.

  16. Comparative assessment of immunization coverage of migrant children between national immunization program vaccines and non-national immunization program vaccines in East China.

    Science.gov (United States)

    Hu, Yu; Luo, Shuying; Tang, Xuewen; Lou, Linqiao; Chen, Yaping; Guo, Jing

    2015-01-01

    This study aimed to describe the disparities in immunization coverage between National Immunization Program (NIP) vaccines and non-NIP vaccines in Yiwu and to identify potential determinants. A face-to-face interview-based questionnaire survey among 423 migrant children born from 1 June 2010 to 31 May 2013 was conducted. Immunization coverage was estimated according to the vaccines scheduled at different age, the birth cohorts, and socio- demographic characteristics. Single-level logistic regression analysis was applied to identify the determinants of coverage of non-NIP vaccines. We found that NIP vaccines recorded higher immunization coverage compared with non-NIP vaccines (87.9100%- vs 0%-74.8%). Among the non-NIP vaccines, varicella vaccine (VarV) recorded the highest coverage of 85.4%, which was introduced in 1998; while 7-valent pneumococcal conjugate vaccine(PCV7) recorded the lowest coverage of 0% for primary series, which was introduced recently. Lower coverage rate of non-NIP vaccines was significantly associated with more siblings in household, shorter duration of living in the surveyed areas, lower family income, mother with a job, mother with poor awareness of vaccination, and mother with lower education level. We found the immunization coverage rate of non-NIP vaccines was significant lower than that of NIP vaccines. Expansion of NIP to include non-NIP vaccines can provide better protection against the vaccine preventable diseases through increased immunization coverage.

  17. [Effect of Supportan on nutritional status and immune function of late-staged gastric cancer patients undergoing chemotherapy].

    Science.gov (United States)

    Zhong, Hai-jun; Ying, Jie-er; Ma, Sheng-lin

    2006-09-01

    To evaluate the effect of Supportan, an enteral nutrition (EN) specific for tumor patients, on the nutritional status and immune function of late-staged gastric cancer patients undergoing chemotherapy. Sixty-six late-staged gastric cancer patients undergoing chemotherapy were randomly divided into EN group (n=33) and control group (n=33). During chemotherapy, the patients in EN group received Supportan and the patients in the control group received basic diet. On the 14th day before chemotherapy and after chemotherapy, nutritional status and cell immune indicators were evaluated. As for nutrition indicators, there were no significant differences in EN group before and after chemotherapy (P > 0.05). Total protein, hemoglobin, prealbumin and transferrin significantly decreased after chemotherapy compared with those before chemotherapy in the control group (Pnutrition in EN group were superior to that in the control group, however, the differences were not statistically significant. The incidences of nausea, vomiting and marrow inhibition in Supportan group was lower compared with those in the control group, but with no significant difference. Supportan can prevent malnutrition of the late-staged gastric cancer patients undergoing chemotherapy, and improve immune function and alleviate adverse effects of chemotherapy.

  18. Evidence of functional cell-mediated immune responses to nontypeable Haemophilus influenzae in otitis-prone children

    Science.gov (United States)

    Seppanen, Elke; Tan, Dino; Corscadden, Karli J.; Currie, Andrew J.; Richmond, Peter C.; Thornton, Ruth B.

    2018-01-01

    Otitis media (OM) remains a common paediatric disease, despite advances in vaccinology. Susceptibility to recurrent acute OM (rAOM) has been postulated to involve defective cell-mediated immune responses to common otopathogenic bacteria. We compared the composition of peripheral blood mononuclear cells (PBMC) from 20 children with a history of rAOM (otitis-prone) and 20 healthy non-otitis-prone controls, and assessed innate and cell-mediated immune responses to the major otopathogen nontypeable Haemophilus influenzae (NTHi). NTHi was a potent stimulator of inflammatory cytokine secretion from PBMC within 4 hours, with no difference in cytokine levels produced between PBMC from cases or controls. In the absence of antigen stimulation, otitis-prone children had more circulating Natural Killer (NK) cells (potitis-prone and non-otitis-prone children (potitis-prone children are functional and respond to NTHi. CD8+ T cells and NK cells from both cases and controls produced IFNγ in response to polyclonal stimulus (Staphylococcal enterotoxin B; SEB), with more IFNγ+ CD8+ T cells present in cases than controls (pOtitis-prone children had more circulating IFNγ-producing NK cells (potitis-prone children mounted innate and T cell-mediated responses to NTHi challenge that were comparable to healthy children. These data provide evidence that otitis-prone children do not have impaired functional cell mediated immunity. PMID:29621281

  19. Effect of long-term fluticasone treatment on immune function in horses with heaves.

    Science.gov (United States)

    Dauvillier, J; Felippe, M J B; Lunn, D P; Lavoie-Lamoureux, A; Leclère, M; Beauchamp, G; Lavoie, J-P

    2011-01-01

    Corticosteroids currently are the most effective pharmacological treatment available to control heaves in horses. Systemically administered corticosteroids have been shown to alter immune response in horses, humans, and other species. Aerosolized administration theoretically minimizes systemic adverse effects, but the effect of inhaled corticosteroids on immune function has not been evaluated in horses. To evaluate the effects of prolonged administration of inhaled fluticasone on the immune system of heaves-affected horses. Heaves-affected horses were treated with inhaled fluticasone (n = 5) for 11 months or received environmental modifications only (n = 5). Prospective analysis. Clinical parameters and CBC, lymphocyte subpopulations and function, and circulating neutrophil gene expression were sequentially measured. Primary and anamnestic immune responses also were evaluated by measuring antigen-specific antibodies in response to vaccination with bovine viral antigen and tetanus toxoid, respectively. No clinical adverse effects were observed and no differences in immune function were detected between treated and untreated horses. The treatment of heaves-affected horses with inhaled fluticasone at therapeutic dosages for 11 months has no significant detectable effect on innate and adaptive (both humoral and cell-mediated) immune parameters studied. These results suggest that prolonged administration of fluticasone would not compromise the systemic immune response to pathogens nor vaccination in adult horses. Copyright © 2011 by the American College of Veterinary Internal Medicine.

  20. Olive oil and immune system functions: potential involvement in immunonutrition

    Directory of Open Access Journals (Sweden)

    Álvarez de Cienfuegos, Gerardo

    2004-03-01

    Full Text Available Olive oil plays a crucial role as a main component of the Mediterranean diet, which has shown important benefits for the human health. According to the current knowledge, the administration of diets containing olive oil exerts some beneficial effects on the immune system functions due likely to the action of oleic acid rather than other substances contained in this fat. In the last few years, epidemiological, clinical and experimental studies have evidenced the potential of certain dietary lipids (containing polyunsaturated or monounsaturated fatty acids as modulators of immune system functions due to their ability to suppress several functions of immune system in both humans and animals. As a result, these fats have been applied in the reduction of symptoms from diseases characterized by an overactivation of the immune system (autoimmune diseases or in the reduction of cancer risk. Here, we review several relevant experimental and clinical data associated with the beneficial effects of olive oil upon the health, the mechanisms of action and the immune function susceptible of being be altered by the administration of dietary lipids and particularly of olive oil. In addition, we will also discuss the detrimental effects on the immune system functions caused by the administration of certain dietary lipids attributed mainly to a reduction of host natural resistance against infectious microorganisms as well as the involvement of olive oil diets in the regulation of immune resistance.El aceite de oliva tiene un papel crucial como componente de la dieta Mediterránea, con importantes beneficios sobre la salud humana. Dietas conteniendo aceite de oliva actúan de manera favorable en las funciones del sistema inmune por la acción sobretodo del ácido oleico. Los estudios epidemiológicos, clínicos y experimentales publicados en los últimos años demuestran que ciertos lípidos de la dieta [ácidos grasos monoinsaturados (MUFA y poliinsaturados (PUFA

  1. Age-dependent changes in innate immune phenotype and function in rhesus macaques (Macaca mulatta

    Directory of Open Access Journals (Sweden)

    Mark Asquith

    2012-06-01

    Full Text Available Aged individuals are more susceptible to infections due to a general decline in immune function broadly referred to as immune senescence. While age-related changes in the adaptive immune system are well documented, aging of the innate immune system remains less well understood, particularly in nonhuman primates. A more robust understanding of age-related changes in innate immune function would provide mechanistic insight into the increased susceptibility of the elderly to infection. Rhesus macaques have proved a critical translational model for aging research, and present a unique opportunity to dissect age-dependent modulation of the innate immune system. We examined age-related changes in: (i innate immune cell frequencies; (ii expression of pattern recognition receptors (PRRs and innate signaling molecules; (iii cytokine responses of monocytes and dendritic cells (DC following stimulation with PRR agonists; and (iv plasma cytokine levels in this model. We found marked changes in both the phenotype and function of innate immune cells. This included an age-associated increased frequency of myeloid DC (mDC. Moreover, we found toll-like receptor (TLR agonists lipopolysaccharide (TLR4, fibroblast stimulating ligand-1 (TLR2/6, and ODN2006 (TLR7/9 induced reduced cytokine responses in aged mDC. Interestingly, with the exception of the monocyte-derived TNFα response to LPS, which increased with age, TNFα, IL-6, and IFNα responses declined with age. We also found that TLR4, TLR5, and innate negative regulator, sterile alpha and TIR motif containing protein (SARM, were all expressed at lower levels in young animals. By contrast, absent in melanoma 2 and retinoic acid-inducible gene I expression was lowest in aged animals. Together, these observations indicate that several parameters of innate immunity are significantly modulated by age and contribute to differential immune function in aged macaques.

  2. Studying the Impact of Spaceflight Environment on Immune Functions Using New Molecular Diagnostics System

    Science.gov (United States)

    Cohen, Luchino

    Immune functions are altered during space flights. Latent virus reactivation, reduction in the number of immune cells, decreased cell activation and increased sensitivity of astronauts to infections following their return on Earth demonstrate that the immune system is less efficient during space flight. The causes of this immune deficiency are not fully understood and this dysfunction during long-term missions could result in the appearance of opportunistic infections or a decrease in the immuno-surveillance mechanisms that eradicate cancer cells. Therefore, the immune functions of astronauts will have to be monitored continuously during long-term missions in space, using miniature and semi-automated diagnostic systems. The objectives of this project are to study the causes of space-related immunodeficiency, to develop countermeasures to maintain an optimal immune function and to improve our capacity to detect infectious diseases during space missions through the monitoring of astronauts' immune system. In order to achieve these objectives, an Immune Function Diagnostic System (IFDS) will be designed to perform a set of immunological assays on board spacecrafts or on planet-bound bases. Through flow cytometric assays and molecular biology analyses, this diagnostic system could improve medical surveillance of astronauts and could be used to test countermeasures aimed at preventing immune deficiency during space missions. The capacity of the instrument to assess cellular fluorescence and to quantify the presence of soluble molecules in biological samples would support advanced molecular studies in space life sciences. Finally, such diagnostic system could also be used on Earth in remote areas or in mobile hospitals following natural disasters to fight against infectious diseases and other pathologies.

  3. Trade-offs between sexual advertisement and immune function in the pied flycatcher (Ficedula hypoleuca).

    OpenAIRE

    Kilpimaa, Janne; Alatalo, Rauno V.; Siitari, Heli

    2004-01-01

    Good genes models of sexual selection assume that sexual advertisement is costly and thus the level of advertisement honestly reveals heritable viability. Recently it has been suggested that an important cost of sexual advertisement might be impairment of the functioning of the immune system. In this field experiment we investigated the possible trade-offs between immune function and sexual advertisement by manipulating both mating effort and activity of immune defence in male pied flycatcher...

  4. Comparative assessment of immunization coverage of migrant children between national immunization program vaccines and non-national immunization program vaccines in East China

    Science.gov (United States)

    Hu, Yu; Luo, Shuying; Tang, Xuewen; Lou, Linqiao; Chen, Yaping; Guo, Jing

    2015-01-01

    This study aimed to describe the disparities in immunization coverage between National Immunization Program (NIP) vaccines and non-NIP vaccines in Yiwu and to identify potential determinants. A face-to-face interview-based questionnaire survey among 423 migrant children born from 1 June 2010 to 31 May 2013 was conducted. Immunization coverage was estimated according to the vaccines scheduled at different age, the birth cohorts, and socio- demographic characteristics. Single-level logistic regression analysis was applied to identify the determinants of coverage of non-NIP vaccines. We found that NIP vaccines recorded higher immunization coverage compared with non-NIP vaccines (87.9100%– vs 0%-74.8%). Among the non-NIP vaccines, varicella vaccine (VarV) recorded the highest coverage of 85.4%, which was introduced in 1998; while 7-valent pneumococcal conjugate vaccine(PCV7) recorded the lowest coverage of 0% for primary series, which was introduced recently. Lower coverage rate of non-NIP vaccines was significantly associated with more siblings in household, shorter duration of living in the surveyed areas, lower family income, mother with a job, mother with poor awareness of vaccination, and mother with lower education level. We found the immunization coverage rate of non-NIP vaccines was significant lower than that of NIP vaccines. Expansion of NIP to include non-NIP vaccines can provide better protection against the vaccine preventable diseases through increased immunization coverage. PMID:25760670

  5. Shingles Immunity and Health Functioning in the Elderly: Tai Chi Chih as a Behavioral Treatment

    Directory of Open Access Journals (Sweden)

    Michael Irwin

    2004-01-01

    Full Text Available Both the incidence and severity of herpes zoster (HZ or shingles increase markedly with increasing age in association with a decline in varicella zoster virus (VZV-specific immunity. Considerable evidence shows that behavioral stressors, prevalent in older adults, correlate with impairments of cellular immunity. Moreover, the presence of depressive symptoms in older adults is associated with declines in VZV-responder cell frequency (VZV-RCF, an immunological marker of shingles risk. In this review, we discuss recent findings that administration of a relaxation response-based intervention, tai chi chih (TCC, results in improvements in health functioning and immunity to VZV in older adults as compared with a control group. TCC is a slow moving meditation consisting of 20 separate standardized movements which can be readily used in elderly and medically compromised individuals. TCC offers standardized training and practice schedules, lending an important advantage over prior relaxation response-based therapies. Focus on older adults at increased risk for HZ and assay of VZV-specific immunity have implications for understanding the impact of behavioral factors and a behavioral intervention on a clinically relevant end-point and on the response of the immune system to infectious pathogens.

  6. Validation of Procedures for Monitoring Crewmember Immune Function

    Science.gov (United States)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarence

    2009-01-01

    There is ample evidence to suggest that space flight leads to immune system dysregulation, however the nature of the phenomenon as it equilibrates over longer flights has not been determined. This dysregulation may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk (if any) for exploration-class space flight is unknown, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. The objective of this Supplemental Medical Objective (SMO) is to determine the status of the immune system, physiological stress and latent viral reactivation (a clinical outcome that can be measured) during both short and long-duration spaceflight. In addition, this study will develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. Pre-mission, in-flight and post-flight blood and saliva samples will be obtained from participating crewmembers. Assays included peripheral immunophenotype, T cell function, cytokine profiles (RNA, intracellular, secreted), viral-specific immunity, latent viral reactivation (EBV, CMV, VZV), and stress hormone measurements. This study is currently ongoing. To date, 10 short duration and 5 long-duration crewmembers have completed the study. Technically, the study is progressing well. In-flight blood samples are being collected, and returned for analysis, including functional assays that require live cells. For all in-flight samples to date, sample viability has been acceptable. Preliminary data (n = 4/7; long/short duration, respectively) indicate that distribution of most peripheral leukocyte subsets is largely unaltered during flight. Exceptions include elevated T cells, reduced B/NK cells, increased memory T cells and increased central memory CD8+ T cells. General T cell function, early blastogenesis response to mitogenic stimulation, is markedly

  7. Diverse novel functions of neutrophils in immunity, inflammation, and beyond

    OpenAIRE

    Mocsai, A.

    2013-01-01

    Neutrophils have long been considered simple suicide killers at the bottom of the hierarchy of the immune response. That view began to change 10–20 yr ago, when the sophisticated mechanisms behind how neutrophils locate and eliminate pathogens and regulate immunity and inflammation were discovered. The last few years witnessed a new wave of discoveries about additional novel and unexpected functions of these cells. Neutrophils have been proposed to participate in protection against intracellu...

  8. Effects of intensified training and taper on immune function

    Directory of Open Access Journals (Sweden)

    Elena Papacosta

    2013-03-01

    Full Text Available Although resting immune function is not very different in athletes compared with non-athletes periods of intensified training (overreaching in already well trained athletes can result in a depression of immunity in the resting state. Illness-prone athletes appear to have an altered cytokine response to antigen stimulation and exercise. Having low levels of salivary IgA secretion also makes athletes more susceptible to upper respiratory tract infections. Overtraining is associated with recurrent infections and immunodepression is common, but immune functions do not seem to be reliable markers of impending overtraining. There are several possible causes of the diminution of immune function associated with periods of heavy training. One mechanism may simply be the cumulative effects of repeated bouts of intense exercise (with or without tissue damage with the consequent elevation of stress hormones, particularly glucocorticoids such as cortisol, causing temporary inhibition of TH-1 cytokines with a relative dampening of the cell-mediated response. When exercise is repeated frequently there may not be sufficient time for the immune system to recover fully. Tapering has been described as a gradual reduction in the training load which allows the recovery of physiological capacities that were impaired by previous intensive training and permits further training-induced adaptations to occur accompanied by competition performance enhancements. The majority of the studies that have examined the recovery of immunoendocrine responses during 1-3 week tapers in trained athletes have mainly reported enhanced performance, often accompanied by increased anabolic activity, reduced physiological stress and restoration of mucosal immunity and immune function.Quando se compara a função imune, em repouso, de atletas e não atletas, não se verificam grandes diferenças. Porém, períodos de treinamento intensificado ("overreaching" em atletas bem treinados podem

  9. Neurotrophin Receptor p75NTR Regulates Immune Function of Plasmacytoid Dendritic Cells.

    Science.gov (United States)

    Bandoła, Joanna; Richter, Cornelia; Ryser, Martin; Jamal, Arshad; Ashton, Michelle P; von Bonin, Malte; Kuhn, Matthias; Dorschner, Benjamin; Alexopoulou, Dimitra; Navratiel, Katrin; Roeder, Ingo; Dahl, Andreas; Hedrich, Christian M; Bonifacio, Ezio; Brenner, Sebastian; Thieme, Sebastian

    2017-01-01

    Plasmacytoid dendritic cells (pDCs) regulate innate and adaptive immunity. Neurotrophins and their receptors control the function of neuronal tissue. In addition, they have been demonstrated to be part of the immune response but little is known about the effector immune cells involved. We report, for the first time, the expression and immune-regulatory function of the low affinity neurotrophin receptor p75 neurotrophin receptor (p75NTR) by the antigen-presenting pDCs, mediated by toll-like receptor (TLR) 9 activation and differential phosphorylation of interferon regulatory factor 3 and 7. The modulation of p75NTR on pDCs significantly influences disease progression of asthma in an ovalbumin-induced mouse model mediated by the TLR9 signaling pathway. p75NTR activation of pDCs from patients with asthma increased allergen-specific T cell proliferation and cytokine secretion in nerve growth factor concentration-dependent manner. Further, p75NTR activation of pDCs delayed the onset of autoimmune diabetes in RIP-CD80GP mice and aggravated graft-versus-host disease in a xenotransplantation model. Thus, p75NTR signaling on pDCs constitutes a new and critical mechanism connecting neurotrophin signaling and immune response regulation with great therapeutic potential for a variety of immune disorders.

  10. Neurotrophin Receptor p75NTR Regulates Immune Function of Plasmacytoid Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Joanna Bandoła

    2017-08-01

    Full Text Available Plasmacytoid dendritic cells (pDCs regulate innate and adaptive immunity. Neurotrophins and their receptors control the function of neuronal tissue. In addition, they have been demonstrated to be part of the immune response but little is known about the effector immune cells involved. We report, for the first time, the expression and immune-regulatory function of the low affinity neurotrophin receptor p75 neurotrophin receptor (p75NTR by the antigen-presenting pDCs, mediated by toll-like receptor (TLR 9 activation and differential phosphorylation of interferon regulatory factor 3 and 7. The modulation of p75NTR on pDCs significantly influences disease progression of asthma in an ovalbumin-induced mouse model mediated by the TLR9 signaling pathway. p75NTR activation of pDCs from patients with asthma increased allergen-specific T cell proliferation and cytokine secretion in nerve growth factor concentration-dependent manner. Further, p75NTR activation of pDCs delayed the onset of autoimmune diabetes in RIP-CD80GP mice and aggravated graft-versus-host disease in a xenotransplantation model. Thus, p75NTR signaling on pDCs constitutes a new and critical mechanism connecting neurotrophin signaling and immune response regulation with great therapeutic potential for a variety of immune disorders.

  11. The function of the Mediator complex in plant immunity.

    Science.gov (United States)

    An, Chuanfu; Mou, Zhonglin

    2013-03-01

    Upon pathogen infection, plants undergo dramatic transcriptome reprogramming to shift from normal growth and development to immune response. During this rapid process, the multiprotein Mediator complex has been recognized as an important player to fine-tune gene-specific and pathway-specific transcriptional reprogramming by acting as an adaptor/coregulator between sequence-specific transcription factor and RNA polymerase II (RNAPII). Here, we review current understanding of the role of five functionally characterized Mediator subunits (MED8, MED15, MED16, MED21 and MED25) in plant immunity. All these Mediator subunits positively regulate resistance against leaf-infecting biotrophic bacteria or necrotrophic fungi. While MED21 appears to regulate defense against fungal pathogens via relaying signals from upstream regulators and chromatin modification to RNAPII, the other four Mediator subunits locate at different positions of the defense network to convey phytohormone signal(s). Fully understanding the role of Mediator in plant immunity needs to characterize more Mediator subunits in both Arabidopsis and other plant species. Identification of interacting proteins of Mediator subunits will further help to reveal their specific regulatory mechanisms in plant immunity.

  12. Studies on the control mechanism and the degenerative immune function of dendritic cells using radiation

    International Nuclear Information System (INIS)

    Yee, Sung Tae; Kim, Jong Jin; Choi, Ji Na; Park, Jung Eun; Jeong, Young Ran

    2010-05-01

    Dendritic cells are actively used as cellular adjuvant in cancer immunotherapy. However, although DC immunotherapies primarily target the elderly population, little is known about the effect of aging on DC functions. Here, we compared the T-cell stimulation, cytokine production, and costimulatory molecule expression of spleen or bone marrow-derived CD11c + DCs of C57BL/6 mice. In the first year, we compared various function of dendritic cells isolated from young and gamma-irradiated 57BL/6 mice(5 weeks after γ-radiation) for the development of aging models using radiation. In the second year, we also compared the function of spleen- and bone marrow-derived dendritic cells of young(2-3 months) and old(23-24 months) 57BL/6 mice. And we studied the differences of spleen- and bone marrow-derived dendritic cells of young and gamma-irradiated 57BL/6 mice(2, 4, 6 months after γ-radiation) for the development of aging models in third year. And we obtained various differences between spleen- and bone marrow-derived dendritic cells of normal and old(23-24 months) or γ-irradiated 57BL/6 mice. It is possible to use our results as age-associated model for modulation of the declined immunity and hematopoiesis for treatment of cancer, adult diseases and stress in aging. Such studies on the mechanism of aging model would further lead to new avenues for the development of functional foods which effect such as pathogenesis, inflammatory and autoimmune disorders. It will contributed to activation of related industry conforming quality and diversity of radiation industry. The techniques developed in our research may provide novel therapeutic modalities for age-associated immune dysfunctions

  13. Function of endoplasmic reticulum calcium ATPase in innate immunity-mediated programmed cell death

    Science.gov (United States)

    Zhu, Xiaohong; Caplan, Jeffrey; Mamillapalli, Padmavathi; Czymmek, Kirk; Dinesh-Kumar, Savithramma P

    2010-01-01

    Programmed cell death (PCD) initiated at the pathogen-infected sites during the plant innate immune response is thought to prevent the development of disease. Here, we describe the identification and characterization of an ER-localized type IIB Ca2+-ATPase (NbCA1) that function as a regulator of PCD. Silencing of NbCA1 accelerates viral immune receptor N- and fungal-immune receptor Cf9-mediated PCD, as well as non-host pathogen Pseudomonas syringae pv. tomato DC3000 and the general elicitor cryptogein-induced cell death. The accelerated PCD rescues loss-of-resistance phenotype of Rar1, HSP90-silenced plants, but not SGT1-silenced plants. Using a genetically encoded calcium sensor, we show that downregulation of NbCA1 results in the modulation of intracellular calcium signalling in response to cryptogein elicitor. We further show that NbCAM1 and NbrbohB function as downstream calcium decoders in N-immune receptor-mediated PCD. Our results indicate that ER-Ca2+-ATPase is a component of the calcium efflux pathway that controls PCD during an innate immune response. PMID:20075858

  14. Chromatin versus pathogens: the function of epigenetics in plant immunity

    Science.gov (United States)

    Ding, Bo; Wang, Guo-Liang

    2015-01-01

    To defend against pathogens, plants have developed a sophisticated innate immunity that includes effector recognition, signal transduction, and rapid defense responses. Recent evidence has demonstrated that plants utilize the epigenetic control of gene expression to fine-tune their defense when challenged by pathogens. In this review, we highlight the current understanding of the molecular mechanisms of histone modifications (i.e., methylation, acetylation, and ubiquitination) and chromatin remodeling that contribute to plant immunity against pathogens. Functions of key histone-modifying and chromatin remodeling enzymes are discussed. PMID:26388882

  15. Maintenance of systemic immune functions prevents accelerated presbycusis.

    Science.gov (United States)

    Iwai, Hiroshi; Baba, Susumu; Omae, Mariko; Lee, Shinryu; Yamashita, Toshio; Ikehara, Susumu

    2008-05-07

    There is no effective therapy for progressive hearing loss such as presbycusis, the causes of which remain poorly understood because of the difficulty of separating genetic and environmental contributions. In the present study, we show that the age-related dysfunctions of the systemic immune system in an animal model of accelerated presbycusis (SAMP1, senescence-accelerated mouse P1) can be corrected by allogeneic bone marrow transplantation (BMT). We also demonstrate that this presbycusis can be prevented; BMT protects the recipients from age-related hearing impairment and the degeneration of spiral ganglion cells (SGCs) as well as the dysfunctions of T lymphocytes, which have a close relation to immune senescence. No donor cells are infiltrated to the spiral ganglia, confirming that this experimental system using BMT is connected to the systemic immune system and does not contribute to transdifferentiation or fusion by donor hematopoietic stem cells (HSCs), or to the direct maintenance of ganglion cells by locally infiltrated donor immunocompetent cells. Therefore, another procedure which attempts to prevent the age-related dysfunctions of the recipient immune system is the inoculation of syngeneic splenocytes from young donors. These mice show no development of hearing loss, compared with the recipient mice with inoculation of saline or splenocytes from old donors. Our studies on the relationship between age-related systemic immune dysfunctions and neurodegeneration mechanisms open up new avenues of treatment for presbycusis, for which there is no effective therapy.

  16. Associations between immune function and air pollution among postmenopausal women living in the Puget Sound airshed

    Science.gov (United States)

    Williams, Lori A.

    Air pollution is associated with adverse health outcomes, and changes in the immune system may be intermediate steps between exposure and a clinically relevant adverse health outcome. We analyzed the associations between three different types of measures of air pollution exposure and five biomarkers of immune function among 115 overweight and obese postmenopausal women whose immunity was assessed as part of a year-long moderate exercise intervention trial. For air pollution metrics, we assessed: (1) residential proximity to major roads (freeways, major arterials and truck routes), (2) fine particulate matter(PM2.5) at the nearest monitor to the residence averaged over three time windows (3-days, 30-days and 60-days), and (3) nitrogen dioxide (NO2) modeled based on land use characteristics. Our immune biomarkers included three measures of inflammation---C-reactive protein, serum amyloid A and interleukin-6---and two measures of cellular immunity---natural killer cell cytotoxicity and T lymphocyte proliferation. We hypothesized that living near a major road, increased exposure to PM2.5 and increased exposure to NO2 would each be independently associated with increased inflammation and decreased immune function. We observed a 21% lower average natural killer cell cytotoxicity among women living within 150 meters of a major arterial road compared to other women. For PM2.5 , we observed changes in 3 of 4 indicators of lymphocyte proliferation stimulated by anti-CD3---an antibody to the T cell receptor associated with increases in 3-day averaged PM2.5. For 30-day averaged PM 2.5 and 60-day averaged PM2.5 we did not observe any statistically significant associations. We observed an increase in lymphocyte proliferation index stimulated by the plant protein phytohemagglutinin (PHA) at 1 of 2 PHA concentrations in association with modeled NO2. For the three inflammatory markers, we observed no notable associations with any of our measures of air pollution. If confirmed, our

  17. Quality and Timing of Stressors Differentially Impact on Brain Plasticity and Neuroendocrine-Immune Function in Mice

    Directory of Open Access Journals (Sweden)

    Sara Capoccia

    2013-01-01

    Full Text Available A growing body of evidence suggests that psychological stress is a major risk factor for psychiatric disorders. The basic mechanisms are still under investigation but involve changes in neuroendocrine-immune interactions, ultimately affecting brain plasticity. In this study we characterized central and peripheral effects of different stressors, applied for different time lengths, in adult male C57BL/6J mice. We compared the effects of repeated (7 versus 21 days restraint stress (RS and chronic disruption of social hierarchy (SS on neuroendocrine (corticosterone and immune function (cytokines and splenic apoptosis and on a marker of brain plasticity (brain-derived neurotrophic factor, BDNF . Neuroendocrine activation did not differ between SS and control subjects; by contrast, the RS group showed a strong neuroendocrine response characterized by a specific time-dependent profile. Immune function and hippocampal BDNF levels were inversely related to hypothalamic-pituitary-adrenal axis activation. These data show a fine modulation of the crosstalk between central and peripheral pathways of adaptation and plasticity and suggest that the length of stress exposure is crucial to determine its final outcome on health or disease.

  18. Stimulatory effect of low dose radiation on the immune function in tumor-bearing mice

    International Nuclear Information System (INIS)

    Zhang Ying; Li Xiujuan; Li Xiuyi; Liu Shuzheng

    1999-01-01

    Objective: The author aims at investigating the effect of whole body irradiation (WBI) with low dose radiation on immune function in tumor-bearing mice. Methods: C57BL/6J mine implanted with Lewis lung carcinoma cells in the right thighs were used as an experimental animal model. WBI with 75 mGy X-rays was given at the 10 th day after implantation and immunological parameters were detected 18 hours after irradiation. The immunological parameters included the spontaneous incorporation of 3 H-TdR into thymocytes, the number of splenocytes, the reaction of splenocytes to ConA and LPS, the splenic production of IL-2, the cytotoxic activities of natural killer (NK) and lymphokine activated killer cells (LAK) as well as specific cytotoxic T lymphocytes (CTL). Results: The immunological parameters of irradiated tumor-bearing mice were significantly increased compared with those of sham-irradiated tumor-bearing mice (P<0.05∼0.01). Conclusion: Low dose radiation could significantly increase the immune function of tumor-bearing mice, and this stimulatory effect may be of some potential significance in tumor therapy

  19. In vitro immune functions in thiamine-replete and -depleted lake trout (Salvelinus namaycush)

    Science.gov (United States)

    Ottinger, Christopher A.; Honeyfield, Dale C.; Densmore, Christine L.; Iwanowicz, Luke R.

    2014-01-01

    In this study we examined the impacts of in vivo thiamine deficiency on lake trout leukocyte function measured in vitro. When compared outside the context of individual-specific thiamine concentrations no significant differences were observed in leukocyte bactericidal activity or in concanavalin A (Con A), and phytohemagglutinin-P (PHA-P) stimulated leukocyte proliferation. Placing immune functions into context with the ratio of in vivo liver thiamine monophosphate (TMP – biologically inactive form) to thiamine pyrophosphate (TPP – biologically active form) proved to be the best indicator of thiamine depletion impacts as determined using regression modeling. These observed relationships indicated differential effects on the immune measures with bactericidal activity exhibiting an inverse relationship with TMP to TPP ratios, Con A stimulated mitogenesis exhibiting a positive relationship with TMP to TPP ratios and PHA-P stimulated mitogenesis exhibiting no significant relationships. In addition, these relationships showed considerable complexity which included the consistent observation of a thiamine-replete subgroup with characteristics similar to those seen in the leukocytes from thiamine-depleted fish. When considered together, our observations indicate that lake trout leukocytes experience cell-type specific impacts as well as an altered physiologic environment when confronted with a thiamine-limited state.

  20. Exploiting immune cell metabolic machinery for functional HIV cure and the prevention of inflammaging

    OpenAIRE

    Palmer, Clovis S.; Palchaudhuri, Riya; Albargy, Hassan; Abdel-Mohsen, Mohamed; Crowe, Suzanne M.

    2018-01-01

    An emerging paradigm in immunology suggests that metabolic reprogramming and immune cell activation and functions are intricately linked. Viral infections, such as HIV infection, as well as cancer force immune cells to undergo major metabolic challenges. Cells must divert energy resources in order to mount an effective immune response. However, the fact that immune cells adopt specific metabolic programs to provide host defense against intracellular pathogens and how this metabolic shift impa...

  1. Population-based versus practice-based recall for childhood immunizations: a randomized controlled comparative effectiveness trial.

    Science.gov (United States)

    Kempe, Allison; Saville, Alison; Dickinson, L Miriam; Eisert, Sheri; Reynolds, Joni; Herrero, Diana; Beaty, Brenda; Albright, Karen; Dibert, Eva; Koehler, Vicky; Lockhart, Steven; Calonge, Ned

    2013-06-01

    We compared the effectiveness and cost-effectiveness of population-based recall (Pop-recall) versus practice-based recall (PCP-recall) at increasing immunizations among preschool children. This cluster-randomized trial involved children aged 19 to 35 months needing immunizations in 8 rural and 6 urban Colorado counties. In Pop-recall counties, recall was conducted centrally using the Colorado Immunization Information System (CIIS). In PCP-recall counties, practices were invited to attend webinar training using CIIS and offered financial support for mailings. The percentage of up-to-date (UTD) and vaccine documentation were compared 6 months after recall. A mixed-effects model assessed the association between intervention and whether a child became UTD. Ten of 195 practices (5%) implemented recall in PCP-recall counties. Among children needing immunizations, 18.7% became UTD in Pop-recall versus 12.8% in PCP-recall counties (P immunization rates in preschool children.

  2. A non-canonical function of Ezh2 preserves immune homeostasis.

    Science.gov (United States)

    Vasanthakumar, Ajithkumar; Xu, Dakang; Lun, Aaron Tl; Kueh, Andrew J; van Gisbergen, Klaas Pjm; Iannarella, Nadia; Li, Xiaofang; Yu, Liang; Wang, Die; Williams, Bryan Rg; Lee, Stanley Cw; Majewski, Ian J; Godfrey, Dale I; Smyth, Gordon K; Alexander, Warren S; Herold, Marco J; Kallies, Axel; Nutt, Stephen L; Allan, Rhys S

    2017-04-01

    Enhancer of zeste 2 (Ezh2) mainly methylates lysine 27 of histone-H3 (H3K27me3) as part of the polycomb repressive complex 2 (PRC2) together with Suz12 and Eed. However, Ezh2 can also modify non-histone substrates, although it is unclear whether this mechanism has a role during development. Here, we present evidence for a chromatin-independent role of Ezh2 during T-cell development and immune homeostasis. T-cell-specific depletion of Ezh2 induces a pronounced expansion of natural killer T (NKT) cells, although Ezh2-deficient T cells maintain normal levels of H3K27me3. In contrast, removal of Suz12 or Eed destabilizes canonical PRC2 function and ablates NKT cell development completely. We further show that Ezh2 directly methylates the NKT cell lineage defining transcription factor PLZF, leading to its ubiquitination and subsequent degradation. Sustained PLZF expression in Ezh2-deficient mice is associated with the expansion of a subset of NKT cells that cause immune perturbation. Taken together, we have identified a chromatin-independent function of Ezh2 that impacts on the development of the immune system. © 2017 The Authors.

  3. Exercise Improves Immune Function, Antidepressive Response, and Sleep Quality in Patients with Chronic Primary Insomnia

    OpenAIRE

    Passos, Giselle Soares; Poyares, Dalva; Santana, Marcos Gonçalves; Teixeira, Alexandre Abílio de Souza; Lira, Fábio Santos; Youngstedt, Shawn D.; dos Santos, Ronaldo Vagner Thomatieli; Tufik, Sergio; de Mello, Marco Túlio

    2014-01-01

    The aim of this study was to evaluate the effects of moderate aerobic exercise training on sleep, depression, cortisol, and markers of immune function in patients with chronic primary insomnia. Twenty-one sedentary participants (16 women aged 44.7 +/- 9 years) with chronic primary insomnia completed a 4-month intervention of moderate aerobic exercise. Compared with baseline, polysomnographic data showed improvements following exercise training. Also observed were reductions in depression symp...

  4. Skin Immunization Obviates Alcohol-Related Immune Dysfunction

    Directory of Open Access Journals (Sweden)

    Rhonda M. Brand

    2015-11-01

    Full Text Available Alcoholics suffer from immune dysfunction that can impede vaccine efficacy. If ethanol (EtOH-induced immune impairment is in part a result of direct exposure of immune cells to EtOH, then reduced levels of exposure could result in less immune dysfunction. As alcohol ingestion results in lower alcohol levels in skin than blood, we hypothesized that the skin immune network may be relatively preserved, enabling skin-targeted immunizations to obviate the immune inhibitory effects of alcohol consumption on conventional vaccines. We employed the two most common chronic EtOH mouse feeding models, the liver-damaging Lieber-DeCarli (LD and liver-sparing Meadows-Cook (MC diets, to examine the roles of EtOH and/or EtOH-induced liver dysfunction on alcohol related immunosuppression. Pair-fed mice were immunized against the model antigen ovalbumin (OVA by DNA immunization or against flu by administering the protein-based influenza vaccine either systemically (IV, IM, directly to liver (hydrodynamic, or cutaneously (biolistic, ID. We measured resulting tissue EtOH levels, liver stress, regulatory T cell (Treg, and myeloid-derived suppressor cell (MDSC populations. We compared immune responsiveness by measuring delayed-type hypersensitivity (DTH, antigen-specific cytotoxic T lymphocyte (CTL, and antibody induction as a function of delivery route and feeding model. We found that, as expected, and independent of the feeding model, EtOH ingestion inhibits DTH, CTL lysis, and antigen-specific total IgG induced by traditional systemic vaccines. On the other hand, skin-targeted vaccines were equally immunogenic in alcohol-exposed and non-exposed subjects, suggesting that cutaneous immunization may result in more efficacious vaccination in alcohol-ingesting subjects.

  5. Food supplementation and testosterone interact to influence reproductive behavior and immune function in Sceloporus graciosus.

    Science.gov (United States)

    Ruiz, Mayté; French, Susannah S; Demas, Gregory E; Martins, Emília P

    2010-02-01

    The energetic resources in an organism's environment are essential for executing a wide range of life-history functions, including immunity and reproduction. Most energetic budgets, however, are limited, which can lead to trade-offs among competing functions. Increasing reproductive effort tends to decrease immunity in many cases, and increasing total energy via supplemental feedings can eliminate this effect. Testosterone (T), an important regulator of reproduction, and food availability are thus both potential factors regulating life-history processes, yet they are often tested in isolation of each other. In this study, we considered the effect of both food availability and elevated T on immune function and reproductive behavior in sagebrush lizards, Sceloporus graciosus, to assess how T and energy availability affect these trade-offs. We experimentally manipulated diet (via supplemental feedings) and T (via dermal patches) in males from a natural population. We determined innate immune response by calculating the bacterial killing capability of collected plasma exposed to Escherichia coli ex vivo. We measured reproductive behavior by counting the number of courtship displays produced in a 20-min sampling period. We observed an interactive effect of food availability and T-patch on immune function, with food supplementation increasing immunity in T-patch lizards. Additionally, T increased courtship displays in control food lizards. Lizards with supplemental food had higher circulating T than controls. Collectively, this study shows that the energetic state of the animal plays a critical role in modulating the interactions among T, behavior and immunity in sagebrush lizards and likely other species. Copyright 2009 Elsevier Inc. All rights reserved.

  6. [Changes and the impact on immune function of opioid-dependent subjects by Jitai tabelets during the withdrawal stage].

    Science.gov (United States)

    Li, X X; Fan, H Y; Sun, L; Liang, J C; Deng, Y P

    2017-04-10

    Objective: To detect the changes in the immune function of opioid-dependent subjects during the withdrawal stage through the administration of Jitai tablet. Methods: Subjects were treated as Jitai tablet alone, Jitai tablet plus buprenorphine and placebo, in a randomized,double-blind, placebo-controlled trial. Before and after the 14(th) day of withdrawal, levels of immunoglobulin (IgM, IgA, IgG), T cell subsets (CD(3)(+), CD(4)(+), CD(8)(+), CD(4)(+)/CD(8)(+)) and cytokines (IL-2, IFN-γ, IL-4, IFN-γ/IL-4) were detected. Results: Compared with healthy people, immunity function before withdrawal among the opioid abusers showed higher levels of IgM, IL-2, IFN-γ, IL-4 and lower level of CD(3)(+)T, as (1.67±0.87) g/L, (14.44±13.50) % , (20.23±15.10) % , (1.97±1.59) % , (47.01±13.62) % , respectively, with difference statistically significant ( P 0.05). At the 14(th) day of withdrawal in placebo group, levels of IL-4 returned to normal while IFN-γ/IL-4 ratio increased by 3.43 times ( P 0.05). Compared with placebo group, fluctuation of IgG and IgM decreased in Jitai group during withdrawal period, together with a normal level of IgM at the 14(th) day. Level of IL-4 abnormally rose up by 0.54 times in Jitai tablet plus buprenorphine group, while IFN-γ/IL-4 ratio been switched back at the 14(th) day of withdrawal. Other immune indicators were not affected by medical interventions. Conclusion: We noticed that certain impairment of the immune function might be restored by Jitai tablet during the withdrawal period.

  7. Development and function of human innate immune cells in a humanized mouse model.

    Science.gov (United States)

    Rongvaux, Anthony; Willinger, Tim; Martinek, Jan; Strowig, Till; Gearty, Sofia V; Teichmann, Lino L; Saito, Yasuyuki; Marches, Florentina; Halene, Stephanie; Palucka, A Karolina; Manz, Markus G; Flavell, Richard A

    2014-04-01

    Mice repopulated with human hematopoietic cells are a powerful tool for the study of human hematopoiesis and immune function in vivo. However, existing humanized mouse models cannot support development of human innate immune cells, including myeloid cells and natural killer (NK) cells. Here we describe two mouse strains called MITRG and MISTRG, in which human versions of four genes encoding cytokines important for innate immune cell development are knocked into their respective mouse loci. The human cytokines support the development and function of monocytes, macrophages and NK cells derived from human fetal liver or adult CD34(+) progenitor cells injected into the mice. Human macrophages infiltrated a human tumor xenograft in MITRG and MISTRG mice in a manner resembling that observed in tumors obtained from human patients. This humanized mouse model may be used to model the human immune system in scenarios of health and pathology, and may enable evaluation of therapeutic candidates in an in vivo setting relevant to human physiology.

  8. Impact of perioperative blood transfusion on immune function and prognosis in colorectal cancer patients.

    Science.gov (United States)

    Qiu, Li; Wang, Dao-Rong; Zhang, Xiang-Yun; Gao, Shan; Li, Xiao-Xia; Sun, Gong-Ping; Lu, Xiao-Bo

    2016-04-01

    To investigate the impacts of perioperative blood transfusion on the immune function and prognosis in colorectal cancer (CC) patients. A retrospective analysis was conducted in 1404 CC patients, including 1223 sporadic colorectal cancer (SCC) patients and 181 hereditary colorectal cancer (HCC) patients. Among them, 701 SCC and 102 HCC patients received perioperative blood transfusion. The amount of T lymphocyte subsets and natural killer (NK) cells was measured. All patients received a 10-year follow-up and relapse, metastasis and curative conditions were recorded. In SCC group, mortality, local recurrence and distant metastasis rate of transfused patients were significantly higher than non-transfused patients (all P transfused patients than non-transfused patients (P = 0.002). SCC patients transfused with ≥3 U of blood had significantly higher mortality than patients transfused with blood transfusion in SCC and HCC patients (all P blood transfusion (P blood transfusion had markedly lower 10-year survival rates as compared with those who did not receive (both P transfused with ≥3 U of blood had remarkably lower survival rates compared with SCC patients transfused with blood transfusion could impact immune function, increased postoperative mortality, local recurrence rate and distant metastasis rate in CC patients; and survival rate of CC patients is negatively related to blood transfusion volume. Copyright © 2016. Published by Elsevier Ltd.

  9. Immune Monitoring in Cancer Vaccine Clinical Trials: Critical Issues of Functional Flow Cytometry-Based Assays

    Directory of Open Access Journals (Sweden)

    Iole Macchia

    2013-01-01

    Full Text Available The development of immune monitoring assays is essential to determine the immune responses against tumor-specific antigens (TSAs and tumor-associated antigens (TAAs and their possible correlation with clinical outcome in cancer patients receiving immunotherapies. Despite the wide range of techniques used, to date these assays have not shown consistent results among clinical trials and failed to define surrogate markers of clinical efficacy to antitumor vaccines. Multiparameter flow cytometry- (FCM- based assays combining different phenotypic and functional markers have been developed in the past decade for informative and longitudinal analysis of polyfunctional T-cells. These technologies were designed to address the complexity and functional heterogeneity of cancer biology and cellular immunity and to define biomarkers predicting clinical response to anticancer treatment. So far, there is still a lack of standardization of some of these immunological tests. The aim of this review is to overview the latest technologies for immune monitoring and to highlight critical steps involved in some of the FCM-based cellular immune assays. In particular, our laboratory is focused on melanoma vaccine research and thus our main goal was the validation of a functional multiparameter test (FMT combining different functional and lineage markers to be applied in clinical trials involving patients with melanoma.

  10. Studies on the control mechanism and the degenerative immune function of dendritic cells using radiation

    Energy Technology Data Exchange (ETDEWEB)

    Yee, Sung Tae; Kim, Jong Jin; Choi, Ji Na; Park, Jung Eun; Jeong, Young Ran [Sunchon National University, Sunchon (Korea, Republic of)

    2010-05-15

    Dendritic cells are actively used as cellular adjuvant in cancer immunotherapy. However, although DC immunotherapies primarily target the elderly population, little is known about the effect of aging on DC functions. Here, we compared the T-cell stimulation, cytokine production, and costimulatory molecule expression of spleen or bone marrow-derived CD11c{sup +} DCs of C57BL/6 mice. In the first year, we compared various function of dendritic cells isolated from young and gamma-irradiated 57BL/6 mice(5 weeks after {gamma}-radiation) for the development of aging models using radiation. In the second year, we also compared the function of spleen- and bone marrow-derived dendritic cells of young(2-3 months) and old(23-24 months) 57BL/6 mice. And we studied the differences of spleen- and bone marrow-derived dendritic cells of young and gamma-irradiated 57BL/6 mice(2, 4, 6 months after {gamma}-radiation) for the development of aging models in third year. And we obtained various differences between spleen- and bone marrow-derived dendritic cells of normal and old(23-24 months) or {gamma}-irradiated 57BL/6 mice. It is possible to use our results as age-associated model for modulation of the declined immunity and hematopoiesis for treatment of cancer, adult diseases and stress in aging. Such studies on the mechanism of aging model would further lead to new avenues for the development of functional foods which effect such as pathogenesis, inflammatory and autoimmune disorders. It will contributed to activation of related industry conforming quality and diversity of radiation industry. The techniques developed in our research may provide novel therapeutic modalities for age-associated immune dysfunctions

  11. [Effects of Early Enteral Immunonutrition on Postoperative Immune Function and Rehabilitation of Patients with Gastric Cancer and Nutritional Risk].

    Science.gov (United States)

    Peng, Chang-Bing; Li, Wen-Zhong; Xu, Rui; Zhuang, Wen

    2017-05-01

    To investigate the effects of early enteral immunonutrition on postoperative immune function and rehabilitation of gastric cancer patients with nutritional risk. New hospitalized patients with gastric cancer were evaluated the nutrient status based on NRS 2002. The patients who scored between 3 to 5 points were randomized into two groups(30 cases for each group), and those in experimental group were given 7-d early postoperative enteral immune nutrition, those in control group were given normal nutrition. The immune indexes (CD3 + , CD4 + , CD8 + and CD4 + /CD8 + ) and nutritional indexes(transferrin, pre-albumin, albumin) were measured before operation and at the 3 rd and 7 th day postoperatively. In addition, the first flatus time, gastrointestinal adverse reactions and complications, length of hospital stays were compared between the two groups. The level of CD4 + /CD8 + and transferrin, pre-albumin, albumin in experimental group were significantly higher than those in control group at the third and seventh day postoperatively ( P 0.05). Early enteral immunonutrition can effectively promote the recovery of nutritional status and immune function in gastric cancer patients with nutrition risk.

  12. Clinical evaluation of immune-promoting functions of the developed product (HemoHIM)

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kyoung Soo; Lee, Ill Kyoo; Kwon, Soon Gil [The Catholic University of Korea, Seoul (Korea, Republic of)

    2007-07-15

    We performed a clinical study to evaluate the immune promotion and antioxidant effects of the developed product (HemoHIM) in healthy or subhealthy people. Volunteers with white blood cell numbers between 5000 and 10000/ul were recruited and the subjects were selected by appropriate inclusion and exclusion rules. The subjects were randomly assigned to 3 groups (HemoHIM 6g/day, HemoHIM 12g/day, Placebo). HemoHIM or placebo were adminstered for 2 months and the blood were collected and analyzed at 1 month and 2 month after the intake. The collected blood was analyzed for blood cell number, serum biochemical values (liver and kidney function), immunological activity of blood cells, antioxidant activity of blood plasma, and stress hormone level in the saliva. Finally the data of 88 subjects were analyzed for the immune promoting and antioxidant effects of HemoHIM. In results, no significant changes in blood cell numbers (white blood cell, lymphocyte, red blood cell) were observed in HemoHIM intake groups. However, NK cell activity were increased in HemoHIM intake groups and also IFN-gamma and IL-12, the biomarkers of immune cell functions, were increased in proportion to the dose and intake periode of HemoHIM. The antioxidant biomarker (TAS) was not significantly changed by HemoHIM intake. Besides, the serum biochemical analysis for liver and kidney functions, and the general medical examination showed the HemoHIM showed no side-effects, thus reconfirming its safety in humans. In conclusion, this study showed HemoHIM has a significant effects on the promotion of immune functions, while it has neither side-effects nor toxicity in humans. The results of this study may be utilized for the scientific data to acquire the Health Functional Food Certification of HemoHIM from Korea FDA

  13. Functions of innate and acquired immune system are reduced in domestic pigeons (Columba livia domestica) given a low protein diet

    Science.gov (United States)

    Mabuchi, Yuko; Frankel, Theresa L.

    2016-01-01

    Racing pigeons are exposed to and act as carriers of diseases. Dietary protein requirement for their maintenance has not been determined experimentally despite their being domesticated for over 7000 years. A maintenance nitrogen (protein) requirement (MNR) for pigeons was determined in a balance study using diets containing 6, 10 and 14% crude protein (CP). Then, the effects of feeding the diets were investigated to determine whether they were adequate to sustain innate and acquired immune functions. Nitrogen intake from the 6% CP diet was sufficient to maintain nitrogen balance and body weight in pigeons. However, the immune functions of phagocytosis, oxidative burst and lymphocyte proliferation in pigeons fed this diet were reduced compared with those fed 10 and 14% CP diets. Pigeons given the 6 and 10% CP diets had lower antibody titres following inoculation against Newcastle disease (ND) than those on the 14% CP diet. A confounding factor found on autopsy was the presence of intestinal parasites in some of the pigeons given the 6 and 10% CP diets; however, none of the pigeons used to measure MNR or acquired immunity to ND were infested with parasites. In conclusion, neither the 6 nor 10% CP diets adequately sustained acquired immune function of pigeons. PMID:27069640

  14. Comparative Analysis of Immune Checkpoint Molecules and Their Potential Role in the Transmissible Tasmanian Devil Facial Tumor Disease

    Directory of Open Access Journals (Sweden)

    Andrew S. Flies

    2017-05-01

    Full Text Available Immune checkpoint molecules function as a system of checks and balances that enhance or inhibit immune responses to infectious agents, foreign tissues, and cancerous cells. Immunotherapies that target immune checkpoint molecules, particularly the inhibitory molecules programmed cell death 1 and cytotoxic T-lymphocyte-associated protein 4 (CTLA-4, have revolutionized human oncology in recent years, yet little is known about these key immune signaling molecules in species other than primates and rodents. The Tasmanian devil facial tumor disease is caused by transmissible cancers that have resulted in a massive decline in the wild Tasmanian devil population. We have recently demonstrated that the inhibitory checkpoint molecule PD-L1 is upregulated on Tasmanian devil (Sarcophilus harrisii facial tumor cells in response to the interferon-gamma cytokine. As this could play a role in immune evasion by tumor cells, we performed a thorough comparative analysis of checkpoint molecule protein sequences among Tasmanian devils and eight other species. We report that many of the key signaling motifs and ligand-binding sites in the checkpoint molecules are highly conserved across the estimated 162 million years of evolution since the last common ancestor of placental and non-placental mammals. Specifically, we discovered that the CTLA-4 (MYPPPY ligand-binding motif and the CTLA-4 (GVYVKM inhibitory domain are completely conserved across all nine species used in our comparative analysis, suggesting that the function of CTLA-4 is likely conserved in these species. We also found that cysteine residues for intra- and intermolecular disulfide bonds were also highly conserved. For instance, all 20 cysteine residues involved in disulfide bonds in the human 4-1BB molecule were also present in devil 4-1BB. Although many key sequences were conserved, we have also identified immunoreceptor tyrosine-based inhibitory motifs (ITIMs and immunoreceptor tyrosine-based switch

  15. Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity

    Directory of Open Access Journals (Sweden)

    Harmit S. Ranhotra

    2016-07-01

    Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.

  16. The role of dehydroepiandrosterone on functional innate immune responses to acute stress.

    Science.gov (United States)

    Prall, Sean P; Larson, Emilee E; Muehlenbein, Michael P

    2017-12-01

    The androgen dehydroepiandrosterone (DHEA) responds to stress activation, exhibits anti-glucocorticoid properties, and modulates immunity in diverse ways, yet little is known of its role in acute stress responses. In this study, the effects of DHEA and its sulfate ester DHEA-S on human male immune function during exposure to an acute stressor is explored. Variation in DHEA, DHEA-S, testosterone, and cortisol, along with bacterial killing assays, was measured in response to a modified Trier Social Stress test in 27 young adult males. Cortisol was positively related to salivary innate immunity but only for participants who also exhibited high DHEA responses. Additionally, DHEA positively and DHEA-S negatively predicted salivary immunity, but the opposite was observed for serum-based innate immunity. The DHEA response to acute stress appears to be an important factor in stress-mediated immunological responses, with differential effects on immunity dependent upon the presence of other hormones, primarily cortisol and DHEA-S. These results suggest that DHEA plays an important role, alongside other hormones, in modulating immunological shifts during acute stress. Copyright © 2017 John Wiley & Sons, Ltd.

  17. Exploiting immune cell metabolic machinery for functional HIV cure and the prevention of inflammaging.

    Science.gov (United States)

    Palmer, Clovis S; Palchaudhuri, Riya; Albargy, Hassan; Abdel-Mohsen, Mohamed; Crowe, Suzanne M

    2018-01-01

    An emerging paradigm in immunology suggests that metabolic reprogramming and immune cell activation and functions are intricately linked. Viral infections, such as HIV infection, as well as cancer force immune cells to undergo major metabolic challenges. Cells must divert energy resources in order to mount an effective immune response. However, the fact that immune cells adopt specific metabolic programs to provide host defense against intracellular pathogens and how this metabolic shift impacts immune cell functions and the natural course of diseases have only recently been appreciated. A clearer insight into how these processes are inter-related will affect our understanding of several fundamental aspects of HIV persistence. Even in patients with long-term use of anti-retroviral therapies, HIV infection persists and continues to cause chronic immune activation and inflammation, ongoing and cumulative damage to multiple organs systems, and a reduction in life expectancy. HIV-associated fundamental changes to the metabolic machinery of the immune system can promote a state of "inflammaging", a chronic, low-grade inflammation with specific immune changes that characterize aging, and can also contribute to the persistence of HIV in its reservoirs. In this commentary, we will bring into focus evolving concepts on how HIV modulates the metabolic machinery of immune cells in order to persist in reservoirs and how metabolic reprogramming facilitates a chronic state of inflammation that underlies the development of age-related comorbidities. We will discuss how immunometabolism is facilitating the changing paradigms in HIV cure research and outline the novel therapeutic opportunities for preventing inflammaging and premature development of age-related conditions in HIV + individuals.

  18. Effects of psycho-behavioral interventions on immune functioning in cancer patients: a systematic review.

    Science.gov (United States)

    Tong, Guixian; Geng, Qingqing; Cheng, Jing; Chai, Jing; Xia, Yi; Feng, Rui; Zhang, Lu; Wang, Debin

    2014-01-01

    This study aimed at summarizing evidence about effects of psycho-behavioral interventions (PBIs) on immune responses among cancer patients and analyzing quality of published studies so as to inform future researches. Literature retrieval utilized both highly inclusive algorithms searching randomized controlled studies published in English and Chinese and manual searching of eligible studies from references of relevant review papers. Two researchers examined the articles selected separately and extracted the information using a pre-designed form for soliciting data about the trials (e.g., sample size, disease status, intervention, immune responses) and quality ratings of the studies. Both narrative descriptions and meta-analysis (via Review manager 5) were used synthesizing the effects of PBIs on immune responses among cancer patients and state of art of the researches in this area. Seventy-six RCTs met inclusion criteria. PBIs implemented were divided into three major categories including psychological state adjustment, physical activity and dietary modification. Immune indicators measured included CD4+ cells, CD8+ cells, CD4/CDC8+ ratio, CD3+ cells, NK cell activity, etc. Effects of PBIs on immune responses documented in individual papers were mixed and pooled analysis of CD4+ cells, CD4+/CD8+ ratio, CD3+ cells, NKCA, IgG, IgM and IL-2 showed modest effects. However, there were huge discrepancies in intervention effects between studies published in English and Chinese and the results should be interpreted with caution. Besides, most studies suffer from some quality flaws concerning blinding, randomization procedures, compliance, attrition and intention-to-treat analyses, etc. Although there are considerable evidences of PBI effects on some immune indicators, the effect sizes are modest and it is still premature to conclude whether PBIs have effects on immune functions among cancer patients. There is a clear need for much more rigorous efforts in this area

  19. Depression of leukocyte protein synthesis, immune function and growth performance induced by high environmental temperature in broiler chickens

    Science.gov (United States)

    Kamel, Nancy N.; Ahmed, Ayman M. H.; Mehaisen, Gamal M. K.; Mashaly, Magdi M.; Abass, Ahmed O.

    2017-09-01

    In tropical and semitropical regions, raising broiler chickens out of their thermal comfort zone can cause an added economic loss in the poultry industry. The cause for the deleterious effects on immunity and growth performance of broilers under high environmental temperatures is still poorly understood. Therefore, the aim of the current investigation was to evaluate the effect of heat stress on leukocytes protein synthesis and immune function as a possible direct cause of low performance in broiler chickens under such condition. In this study, 300 one-day-old male broiler chicks (Cobb500™) were randomly assigned into 2 groups with 5 replicates of 30 chicks each. From 21 to 42 days of age, one group was exposed to non-stressed condition at 24 °C and 50% relative humidity (control group), while the other group was exposed to heat stress at 35 °C and 50% relative humidity (HS group). At 42 days of age, blood samples were collected from each group to evaluate stress indicators, immune function, and leukocytes protein synthesis. Production performance was also recorded. Noteworthy, protein synthesis in leukocytes was significantly ( P < 0.05) inhibited in HS group by 38% compared to control group. In contrast, the phosphorylation level on threonine 56 site (Thr56) of eukaryotic elongation factor (eEF2), which indicates the suppression of protein translation process through altering the protein elongation phase, was significantly threefold higher in HS group than in control ( P < 0.05). In addition, an increase in stress indicators was markedly ( P < 0.05) presented in the HS birds by twofold increase in heterophil/lymphocyte (H/L) ratio and threefold increase in plasma corticosterone level compared to control. Furthermore, the immune function was significantly ( P < 0.05) suppressed in HS birds than control (0.99 vs. 1.88 mg/mL plasma IgG, 89.2 vs. 148.0 μg/mL plasma IgM, 4.80 vs. 7.20 antibody titer against SRBC, and 1.38 vs. 3.39 stimulation index of lymphocyte

  20. Relationship between ways of nutritional support and immune function in patients with malignant obstructive jaundice after PTCD

    Directory of Open Access Journals (Sweden)

    YANG Shenghua

    2014-11-01

    Full Text Available ObjectiveTo investigate the clinical effect of different nutritional therapies on the immune function of patients with malignant obstructive jaundice after percutaneous transhepatic cholangiodrainage (PTCD. MethodsA total of 50 patients with malignant obstructive jaundice who were admitted to our hospital from January 2009 to March 2013 were randomly divided into two groups according to the admission order. The patients in group A (n=25 received enteral nutritional support after PTCD, and those in group B (n=25 received total parenteral nutritional support after PTCD. Intra-group and inter-group comparisons were made in terms of jaundice clearance, nutritional indices, and body’s immune function on preoperative day 1 and postoperative day 7; comparison between the two groups was made by t test. ResultsAmong the 50 patients who underwent PTCD, 39 (78% had good drainage, while 11 (22% did not reach the expectation, of which, 5 (10% were in group A and 6 (12% in group B. In both groups, the nutritional indices on postoperative day 7 were significantly higher than those on preoperative day 1(P<0.05, but no significant difference in these indices was observed between group A and group B on postoperative day 7 (P>0.05. The immune function of patients in both groups was significantly improved following PTCD and nutritional support (P<0.05, but there was no significant difference between the two groups (P>0.05. Although the same scheme of nutritional support was used, there were 11 patients who did not achieve the expected jaundice clearance after PTCD and had limited improvement in immune function compared with those who had complete jaundice clearance (all P<0.05. ConclusionJaundice clearance is closely related to PTCD in patients with malignant obstructive jaundice, but not markedly associated with the ways of nutritional support.

  1. T cell immunity

    OpenAIRE

    Emel Bülbül Başkan

    2013-01-01

    Since birth, our immune system is constantly bombarded with self-antigens and foreign pathogens. To stay healthy, complex immune strategies have evolved in our immune system to maintain self-tolerance and to defend against foreign pathogens. Effector T cells are the key players in steering the immune responses to execute immune functions. While effector T cells were initially identified to be immune promoting, recent studies unraveled negative regulatory functions of effector T cells...

  2. In vitro immune functions in thiamine-replete and -depleted lake trout (Salvelinus namaycush).

    Science.gov (United States)

    Ottinger, Christopher A; Honeyfield, Dale C; Densmore, Christine L; Iwanowicz, Luke R

    2014-05-01

    In this study we examined the impacts of in vivo thiamine deficiency on lake trout leukocyte function measured in vitro. When compared outside the context of individual-specific thiamine concentrations no significant differences were observed in leukocyte bactericidal activity or in concanavalin A (Con A), and phytohemagglutinin-P (PHA-P) stimulated leukocyte proliferation. Placing immune functions into context with the ratio of in vivo liver thiamine monophosphate (TMP--biologically inactive form) to thiamine pyrophosphate (TPP--biologically active form) proved to be the best indicator of thiamine depletion impacts as determined using regression modeling. These observed relationships indicated differential effects on the immune measures with bactericidal activity exhibiting an inverse relationship with TMP to TPP ratios, Con A stimulated mitogenesis exhibiting a positive relationship with TMP to TPP ratios and PHA-P stimulated mitogenesis exhibiting no significant relationships. In addition, these relationships showed considerable complexity which included the consistent observation of a thiamine-replete subgroup with characteristics similar to those seen in the leukocytes from thiamine-depleted fish. When considered together, our observations indicate that lake trout leukocytes experience cell-type specific impacts as well as an altered physiologic environment when confronted with a thiamine-limited state. Published by Elsevier Ltd.

  3. Effects of stress on immune function: the good, the bad, and the beautiful.

    Science.gov (United States)

    Dhabhar, Firdaus S

    2014-05-01

    Although the concept of stress has earned a bad reputation, it is important to recognize that the adaptive purpose of a physiological stress response is to promote survival during fight or flight. While long-term stress is generally harmful, short-term stress can be protective as it prepares the organism to deal with challenges. This review discusses the immune effects of biological stress responses that can be induced by psychological, physiological, or physical (including exercise) stressors. We have proposed that short-term stress is one of the nature's fundamental but under-appreciated survival mechanisms that could be clinically harnessed to enhance immunoprotection. Short-term (i.e., lasting for minutes to hours) stress experienced during immune activation enhances innate/primary and adaptive/secondary immune responses. Mechanisms of immuno-enhancement include changes in dendritic cell, neutrophil, macrophage, and lymphocyte trafficking, maturation, and function as well as local and systemic production of cytokines. In contrast, long-term stress suppresses or dysregulates innate and adaptive immune responses by altering the Type 1-Type 2 cytokine balance, inducing low-grade chronic inflammation, and suppressing numbers, trafficking, and function of immunoprotective cells. Chronic stress may also increase susceptibility to some types of cancer by suppressing Type 1 cytokines and protective T cells and increasing regulatory/suppressor T cell function. Here, we classify immune responses as being protective, pathological, or regulatory, and discuss "good" versus "bad" effects of stress on health. Thus, short-term stress can enhance the acquisition and/or expression of immunoprotective (wound healing, vaccination, anti-infectious agent, anti-tumor) or immuno-pathological (pro-inflammatory, autoimmune) responses. In contrast, chronic stress can suppress protective immune responses and/or exacerbate pathological immune responses. Studies such as the ones discussed

  4. Effects of water extract of Curcuma longa (L.) roots on immunity and telomerase function.

    Science.gov (United States)

    Pan, Min-Hsiung; Wu, Jia-Ching; Ho, Chi-Tang; Badmaev, Vladimir

    2017-05-12

    Background Immunity and Longevity Methods A water extract of Curcuma longa (L.) [vern. Turmeric] roots (TurmericImmune™) standardized for a minimum 20 % of turmeric polysaccharides ukonan A, B, C and D was evaluated for its biological properties in in vitro tissue culture studies. Results The water extract of turmeric (TurP) exhibited induced-nitric oxide (NO) production in RAW264.7 macrophages. These results suggested the immunomodulatory effects of TurP. In addition, the polysaccharides up-regulated function of telomerase reverse transcriptase (TERT) equally to the phenolic compound from turmeric, curcumin. Conclusions The ukonan family of polysaccharides may assist in promoting cellular immune responses, tissue repair and lifespan by enhancing immune response and telomere function.

  5. The effect of elevated reproductive effort onhumoral immune function in collared flycatcher females

    Science.gov (United States)

    Cichoń, Mariusz; Dubiec, Anna; Chadzińska, Magdalena

    2001-02-01

    In order to test whether high reproductive investments impair immune function in naturally breeding collared flycatchers, we performed a brood manipulation experiment and simultaneously induced an immune response by challenging birds with a non-pathogenic antigen - sheep red blood cells (SRBC). Females rearing experimentally enlarged number of nestlings showed significantly lower level of specific anti-SRBC antibodies than control females attending unaltered broods, but only in one of the two study years. The haemoconcentration of leukocytes did not differ between the two groups in both study years. The significant difference in immunological responsiveness between control and enlarged group coincided with differences in survival probability to the next breeding season: females attending enlarged broods showed lower probability of survival than control females, but there was no relationship between the level of immune response and survival probability. Our results indicate that reproduction may indeed trade for resources with immune functions at least in terms of specific antibody production. However, as in the other studies on reproductive costs, these costs seem not always to be pronounced.

  6. Clinical dosing regimen of selinexor maintains normal immune homeostasis and T cell effector function in mice: implications for combination with immunotherapy

    Science.gov (United States)

    Tyler, Paul M.; Servos, Mariah M.; de Vries, Romy C.; Klebanov, Boris; Kashyap, Trinayan; Sacham, Sharon; Landesman, Yosef; Dougan, Michael; Dougan, Stephanie K.

    2017-01-01

    Selinexor (KPT-330) is a first in class nuclear transport inhibitor currently in clinical trials as an anti-cancer agent. To determine how selinexor might impact anti-tumor immunity, we analyzed immune homeostasis in mice treated with selinexor and found disruptions in T cell development, a progressive loss of CD8 T cells and increases in inflammatory monocytes. Antibody production in response to immunization was mostly normal. Precursor populations in bone marrow and thymus were unaffected by selinexor, suggesting that normal immune homeostasis could recover. We found that a high dose of selinexor given once per week preserved nearly normal immune functioning, whereas a lower dose given 3 times per week did not restore immune homeostasis. Both naïve and effector CD8 T cells cultured in vitro showed impaired activation in the presence of selinexor. These experiments suggest that nuclear exportins are required for T cell development and function. We determined the minimum concentration of selinexor required to block T cell activation, and showed that T cell inhibitory effects of selinexor occur at levels above 100nM, corresponding to the first 24 hours post-oral dosing. In a model of implantable melanoma, selinexor treatment at 10 mg/kg with a 5 day drug holiday led to intratumoral IFNγ+, granzyme B+ cytotoxic CD8 T cells that were comparable to vehicle treated mice. Overall, selinexor treatment leads to transient inhibition of T cell activation but clinically relevant once and twice weekly dosing schedules that incorporate sufficient drug holidays allow for normal CD8 T cell functioning and development of anti-tumor immunity. PMID:28148714

  7. Microneedle-mediated immunization of an adenovirus-based malaria vaccine enhances antigen-specific antibody immunity and reduces anti-vector responses compared to the intradermal route.

    Science.gov (United States)

    Carey, John B; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V S; Draper, Simon J; Moore, Anne C

    2014-08-21

    Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP1₄₂, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delivery. Microneedle-mediated vaccine priming and resultant induction of low anti-vector antibody titres permitted repeated use of the same adenovirus vaccine vector. This resulted in significantly increased antigen-specific antibody responses in these mice compared to ID-treated mice. Boosting with a heterologous vaccine; MVA-PyMSP1₄₂ also resulted in significantly greater antibody responses in mice primed with HAdV5-PyMSP1₄₂ using MN compared to the ID route. The highest protection against blood-stage malaria challenge was observed when a heterologous route of immunization (MN/ID) was used. Therefore, microneedle-mediated immunization has potential to both overcome some of the logistic obstacles surrounding needle-and-syringe-based immunization as well as to facilitate the repeated use of the same adenovirus vaccine thereby potentially reducing manufacturing costs of multiple vaccines. This could have important benefits in the clinical ease of use of adenovirus-based immunization strategies.

  8. Microneedle-mediated immunization of an adenovirus-based malaria vaccine enhances antigen-specific antibody immunity and reduces anti-vector responses compared to the intradermal route

    Science.gov (United States)

    Carey, John B.; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V. S.; Draper, Simon J.; Moore, Anne C.

    2014-01-01

    Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP142, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delivery. Microneedle-mediated vaccine priming and resultant induction of low anti-vector antibody titres permitted repeated use of the same adenovirus vaccine vector. This resulted in significantly increased antigen-specific antibody responses in these mice compared to ID-treated mice. Boosting with a heterologous vaccine; MVA-PyMSP142 also resulted in significantly greater antibody responses in mice primed with HAdV5-PyMSP142 using MN compared to the ID route. The highest protection against blood-stage malaria challenge was observed when a heterologous route of immunization (MN/ID) was used. Therefore, microneedle-mediated immunization has potential to both overcome some of the logistic obstacles surrounding needle-and-syringe-based immunization as well as to facilitate the repeated use of the same adenovirus vaccine thereby potentially reducing manufacturing costs of multiple vaccines. This could have important benefits in the clinical ease of use of adenovirus-based immunization strategies. PMID:25142082

  9. The Notch Signaling Pathway Is Balancing Type 1 Innate Lymphoid Cell Immune Functions

    Directory of Open Access Journals (Sweden)

    Thibaut Perchet

    2018-06-01

    Full Text Available The Notch pathway is one of the canonical signaling pathways implicated in the development of various solid tumors. During carcinogenesis, the Notch pathway dysregulation induces tumor expression of Notch receptor ligands participating to escape the immune surveillance. The Notch pathway conditions both the development and the functional regulation of lymphoid subsets. Its importance on T cell subset polarization has been documented contrary to its action on innate lymphoid cells (ILC. We aim to analyze the effect of the Notch pathway on type 1 ILC polarization and functions after disruption of the RBPJk-dependent Notch signaling cascade. Indeed, type 1 ILC comprises conventional NK (cNK cells and type 1 helper innate lymphoid cells (ILC1 that share Notch-related functional characteristics such as the IFNg secretion downstream of T-bet expression. cNK cells have strong antitumor properties. However, data are controversial concerning ILC1 functions during carcinogenesis with models showing antitumoral capacities and others reporting ILC1 inability to control tumor growth. Using various mouse models of Notch signaling pathway depletion, we analyze the effects of its absence on type 1 ILC differentiation and cytotoxic functions. We also provide clues into its role in the maintenance of immune homeostasis in tissues. We show that modulating the Notch pathway is not only acting on tumor-specific T cell activity but also on ILC immune subset functions. Hence, our study uncovers the intrinsic Notch signaling pathway in ILC1/cNK populations and their response in case of abnormal Notch ligand expression. This study help evaluating the possible side effects mediated by immune cells different from T cells, in case of multivalent forms of the Notch receptor ligand delta 1 treatments. In definitive, it should help determining the best novel combination of therapeutic strategies in case of solid tumors.

  10. The Phagocytic Function of Macrophage-Enforcing Innate Immunity and Tissue Homeostasis

    Directory of Open Access Journals (Sweden)

    Daisuke Hirayama

    2017-12-01

    Full Text Available Macrophages are effector cells of the innate immune system that phagocytose bacteria and secrete both pro-inflammatory and antimicrobial mediators. In addition, macrophages play an important role in eliminating diseased and damaged cells through their programmed cell death. Generally, macrophages ingest and degrade dead cells, debris, tumor cells, and foreign materials. They promote homeostasis by responding to internal and external changes within the body, not only as phagocytes, but also through trophic, regulatory, and repair functions. Recent studies demonstrated that macrophages differentiate from hematopoietic stem cell-derived monocytes and embryonic yolk sac macrophages. The latter mainly give rise to tissue macrophages. Macrophages exist in all vertebrate tissues and have dual functions in host protection and tissue injury, which are maintained at a fine balance. Tissue macrophages have heterogeneous phenotypes in different tissue environments. In this review, we focused on the phagocytic function of macrophage-enforcing innate immunity and tissue homeostasis for a better understanding of the role of tissue macrophages in several pathological conditions.

  11. Modulation of immune cell functions by the E3 ligase CBL-b

    Directory of Open Access Journals (Sweden)

    Christina eLutz-Nicoladoni

    2015-03-01

    Full Text Available Maintenance of immunological tolerance is a critical hallmark of the immune system. Several signaling checkpoints necessary to balance activating and inhibitory input to immune cells have been described so far, among which the E3 ligase Cbl-b appears to be a central player. Cbl-b is expressed in all leukocyte subsets and regulates several signaling pathways in T cells, NK cells, B cells and different types of myeloid cells. In most cases Cbl-b negatively regulates activation signals through antigen or pattern recognition receptors and co-stimulatory molecules. In line with this function, cblb-deficient immune cells display lower activation thresholds and cblb knockout mice spontaneously develop autoimmunity and are highly susceptible to experimental autoimmunity. Interestingly, genetic association studies link cblb-polymorphisms with autoimmunity also in humans. Vice versa, the increased activation potential of cblb-deficient cells renders them more potent to fight against malignancies or infections. Accordingly, several reports have shown that cblb knockout mice reject tumors, which mainly depends on cytotoxic T and NK cells. Thus targeting Cbl-b may be an interesting strategy to enhance anti-cancer immunity. In this review we summarize the findings on the molecular function of Cbl-b in different cell types and illustrate the potential of Cbl-b as target for immunomodulatory therapies.

  12. Functional demonstration of adaptive immunity in zebrafish using DNA vaccination

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja

    Due to the well characterized genome, overall highly synteny with the human genome and its suitability for functional genomics studies, the zebrafish is considered to be an ideal animal model for basic studies of mechanisms of diseases and immunity in vertebrates including humans. While several s...

  13. Acute brief heat stress in late gestation alters neonatal calf innate immune functions.

    Science.gov (United States)

    Strong, R A; Silva, E B; Cheng, H W; Eicher, S D

    2015-11-01

    Heat stress, as one of the environmental stressors affecting the dairy industry, compromises the cow milk production, immune function, and reproductive system. However, few studies have looked at how prenatal heat stress (HS) affects the offspring. The objective of this study was to evaluate the effect of HS during late gestation on calf immunity. Calves were born to cows exposed to evaporative cooling (CT) or HS (cyclic 23-35°C) for 1 wk at 3 wk before calving. Both bull and heifer calves (CT, n=10; HS, n=10) were housed in similar environmental temperatures after birth. Both CT and HS calves received 3.78 L of pooled colostrum within 12 h after birth and were fed the same diet throughout the study. In addition to tumor necrosis factor α, IL-1β, IL-1 receptor antagonist (IL-1RA), and toll-like receptor (TLR)2, and TLR4 mRNA expression, the expression of CD14(+) and CD18(+) cells, and DEC205(+) dendritic cells were determined in whole blood samples at d 0, 3, 7, 14, 21, and 28. The neutrophil to lymphocyte ratio, differential cell counts, and the hematocrit were also determined. During late gestation, the HS cows had greater respiration rates, rectal temperatures, and tended to spend more time standing compared with the CT cows. The HS calves had less expression of tumor necrosis factor-α and TLR2 and greater levels of IL-1β, IL-1RA, and TLR4 compared with CT calves. The HS calves also had a greater percentage of CD18(+) cells compared with the CT calves. Additionally, a greater percentage of neutrophils and lesser percentage of lymphocytes were in the HS calves compared with the CT calves. The results indicate that biomarkers of calves' immunity are affected in the first several weeks after birth by HS in the dam during late gestation. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  14. Effects of Light Intensity on Growth, Anti-Stress Ability and Immune Function in Yellow Feathered Broilers

    Directory of Open Access Journals (Sweden)

    YL Guo

    Full Text Available ABSTRACT An experiment was conducted to investigate the effects of light intensity on growth, anti-stress ability, and immune function of yellow feathered broilers. A total of 480 one-day-old male Lingnan yellow feathered broilers were randomly allocated to 4 treatments based on light intensity (1, 5, 20 and 80 lx with 8 replicates of 15 chicks each. The experiment lasted for 63 days. Compared with those under high light intensity, broilers exposed to low light intensity had higher (p<0.05 total antioxidant capacity (T-AOC, glutathione peroxidase (GSH-Px, a-Naphthylacetate esterase (ANAE+, antibody titer, but lower (p<0.05 malonaldehyde (MDA levels and heterophil/lymphocyte ratio (H/L. There was a linear effect for T-AOC(p=0.002, GSH-Px(p≤0.047, MDA (p=0.003, H/L(p≤0.014, ANAE+ (p≤0.044, and antibody titer (p≤0.021 with T-AOC, GSH-Px, ANAE+, and antibody titer increased significantly as light intensity decreased, whereas MDA and H/L were decreased with the decrease in light intensity. These results suggested that broilers under low light intensity could have similar performance, better anti-stress ability, stronger immune function, and more efficient in energy usage as compared with those exposed to high light intensity environment.

  15. The Influence of histamine H1-receptor on liver functions in immunized rabbits.

    Science.gov (United States)

    Tripathi, Trivendra; Shahid, Mohammad; Khan, Haris M; Khan, Rahat Ali; Siddiqui, Mashiatullah; Mahdi, Abbas Ali

    2011-10-01

    This study was designed to investigate the functional roles of histamine and histamine H1-receptor agonist and antagonist in the development of liver function impairment in immunized rabbits. The study comprised of six groups containing 18 rabbits each. Group III-VI received histamine (100 μg/kg, s.c.), H1R-agonist (HTMT, 10 μg/kg, s.c.), H1R-antagonist (pheniramine, 10 mg/kg, i.m.), and H1R-antagonist (pheniramine, 10 mg/kg, i.m.) plus histamine (100 μg/kg, s.c.), respectively, b.i.d. for 10 days. Group I (negative control) and group II (positive control) received sterile distilled water intramuscularly b.i.d. for 10 days. Groups II-VI were immunized on day 3 with intravenous injection of SRBC (1 × 10(9) cells/ml). Blood samples were collected on pre-immunization day 0, as well as on days 7-, 14-, 21-, 28-, and 58-post-immunization. Biochemical parameters AST, ALT, alkaline phosphatase and bilirubin [total bilirubin (TB), direct bilirubin (DB), and indirect bilirubin (IB)] were determined. On each experimental day, the mean values of serum enzymes and bilirubin in group I and group II showed no significant changes while in group III, IV, V, and VI, these enzymes and bilirubin levels showed significant changes (p pheniramine, and combination of histamine + pheniramine cause hepatic function impairment in terms of altered serum enzymes and bilirubin levels. The present findings suggest that HTMT causes moderate liver function impairment while others show mild impairment.

  16. Phenotypic and functional plasticity of cells of innate immunity: macrophages, mast cells and neutrophils

    DEFF Research Database (Denmark)

    Galli, Stephen J; Borregaard, Niels; Wynn, Thomas A

    2011-01-01

    Hematopoietic cells, including lymphoid and myeloid cells, can develop into phenotypically distinct 'subpopulations' with different functions. However, evidence indicates that some of these subpopulations can manifest substantial plasticity (that is, undergo changes in their phenotype and function......). Here we focus on the occurrence of phenotypically distinct subpopulations in three lineages of myeloid cells with important roles in innate and acquired immunity: macrophages, mast cells and neutrophils. Cytokine signals, epigenetic modifications and other microenvironmental factors can substantially...... and, in some cases, rapidly and reversibly alter the phenotype of these cells and influence their function. This suggests that regulation of the phenotype and function of differentiated hematopoietic cells by microenvironmental factors, including those generated during immune responses, represents...

  17. Phenotypic and functional plasticity of cells of innate immunity: macrophages, mast cells and neutrophils

    DEFF Research Database (Denmark)

    Galli, Stephen J; Borregaard, Niels; Wynn, Thomas A

    2011-01-01

    ). Here we focus on the occurrence of phenotypically distinct subpopulations in three lineages of myeloid cells with important roles in innate and acquired immunity: macrophages, mast cells and neutrophils. Cytokine signals, epigenetic modifications and other microenvironmental factors can substantially......Hematopoietic cells, including lymphoid and myeloid cells, can develop into phenotypically distinct 'subpopulations' with different functions. However, evidence indicates that some of these subpopulations can manifest substantial plasticity (that is, undergo changes in their phenotype and function...... and, in some cases, rapidly and reversibly alter the phenotype of these cells and influence their function. This suggests that regulation of the phenotype and function of differentiated hematopoietic cells by microenvironmental factors, including those generated during immune responses, represents...

  18. The effects of low dose radiation (LDR) on mice of immune function

    International Nuclear Information System (INIS)

    Feng Li; Deng Daping

    2007-01-01

    Objective: To find out the Effects of Low Dose Radiation(LDR) on mice of immune function. Methods: Through flow cytometry to observe and analyse the effects of the leukomonocyte. Through immunohistochemistry to study IL-2, TNF-α. Results: At dose of 100mGy the stimulative effect on CD 4 + cells, CD 8 + cells and NK activity was higher than that at other doses. At dose of 500mGy leukomonocyte activity was lower. At dose of 100mGy, the colorations about IL-2, TNF-α deepen. Conclusion: LDR could stimulate immune function, especially at dose of 100mGy. while at dose of 500mGy, radiation could restrain the leukomonocyte activity. (authors)

  19. Hygiene and other early childhood influences on the subsequent function of the immune system.

    Science.gov (United States)

    Rook, Graham A W; Lowry, Christopher A; Raison, Charles L

    2015-08-18

    The immune system influences brain development and function. Hygiene and other early childhood influences impact the subsequent function of the immune system during adulthood, with consequences for vulnerability to neurodevelopmental and psychiatric disorders. Inflammatory events during pregnancy can act directly to cause developmental problems in the central nervous system (CNS) that have been implicated in schizophrenia and autism. The immune system also acts indirectly by "farming" the intestinal microbiota, which then influences brain development and function via the multiple pathways that constitute the gut-brain axis. The gut microbiota also regulates the immune system. Regulation of the immune system is crucial because inflammatory states in pregnancy need to be limited, and throughout life inflammation needs to be terminated completely when not required; for example, persistently raised levels of background inflammation during adulthood (in the presence or absence of a clinically apparent inflammatory stimulus) correlate with an increased risk of depression. A number of factors in the perinatal period, notably immigration from rural low-income to rich developed settings, caesarean delivery, breastfeeding and antibiotic abuse have profound effects on the microbiota and on immunoregulation during early life that persist into adulthood. Many aspects of the modern western environment deprive the infant of the immunoregulatory organisms with which humans co-evolved, while encouraging exposure to non-immunoregulatory organisms, associated with more recently evolved "crowd" infections. Finally, there are complex interactions between perinatal psychosocial stressors, the microbiota, and the immune system that have significant additional effects on both physical and psychiatric wellbeing in subsequent adulthood. This article is part of a Special Issue entitled Neuroimmunology in Health And Disease. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights

  20. Incomplete immune recovery in HIV infection

    DEFF Research Database (Denmark)

    Gaardbo, Julie C; Hartling, Hans J; Gerstoft, Jan

    2012-01-01

    -infected patients do not achieve optimal immune reconstitution despite suppression of viral replication. These patients are referred to as immunological nonresponders (INRs). INRs present with severely altered immunological functions, including malfunction and diminished production of cells within lymphopoetic...... tissue, perturbed frequencies of immune regulators such as regulatory T cells and Th17 cells, and increased immune activation, immunosenescence, and apoptosis. Importantly, INRs have an increased risk of morbidity and mortality compared to HIV-infected patients with an optimal immune reconstitution....... Additional treatment to HAART that may improve immune reconstitution has been investigated, but results thus far have proved disappointing. The reason for immunological nonresponse is incompletely understood. This paper summarizes the known and unknown factors regarding the incomplete immune reconstitution...

  1. Seasonal Redistribution of Immune Function in a Migrant Shorebird : Annual-Cycle Effects Override Adjustments to Thermal Regime

    NARCIS (Netherlands)

    Buehler, Deborah M.; Piersma, Theunis; Matson, Kevin D.; Tieleman, B. Irene; Demas, Greg (associate); Geber, Monica A.

    2008-01-01

    Throughout the annual cycle, demands on competing physiological systems change, and animals must allocate resources to maximize fitness. Immune function is one such system and is important for survival. Yet detailed empirical data tracking immune function over the entire annual cycle are lacking for

  2. Effects of microbial aerosol in poultry house on meat ducks’ immune function

    Directory of Open Access Journals (Sweden)

    Guanliu YU

    2016-08-01

    Full Text Available The aim of this study was to evaluate effects of microbial aerosols on immune function of ducks and shed light on the establishment of microbial aerosol concentration standards for poultry. A total of 1800 1-d-old Cherry Valley ducks were randomly divided into 5 groups (A, B, C, D and E with 360 ducks in each. To obtain objective data, each group had three replications. Concentrations of airborne bacteria, fungi, endotoxin in different groups were created by controlling ventilation and bedding cleaning frequency. Group A was the control group and hygienic conditions deteriorated progressively from group B to E. A 6-stage Andersen impactor was used to detect the aerosol concentration of aerobes, gram-negative bacteria, fungi and AGI-30 microbial air sampler detect the endotoxin, and Composite Gas Detector detect the noxious gas. In order to assess the immune function of meat ducks, immune indicators including H5 AIV antibody titer, IgG, IL-2, T-lymphocyte transformation rate, lysozyme and immune organ indexes were evaluated. Correlation coefficients were also calculated to evaluate the relationships among airborne bacteria, fungi, endotoxin and immune indicators. The results showed that the concentration of airborne aerobe, gram-negative bacteria, fungi, endotoxin have a strong correlation to H5 AIV antibody titer, IgG, IL-2, T-lymphocyte transformation rate, lysozyme and immune organ indexes, respectively. In addition, when the concentration of microbial aerosol reach the level of group D, serum IgG (6 - 8 weeks, lysozyme (4 week were significantly higher than in group A (P < 0.05; serum IL-2 (7 and 8 weeks , T-lymphocyte transformation rate, lysozyme (7 and 8 weeks, spleen index (6 and 8 weeks and bursa index (8 week were significantly lower than in group A(P < 0.05 or P < 0.01. The results indicated that a high level of microbial aerosol adversely affected the immune level of meat ducks. The microbial aerosol values in group D provide a basis

  3. Clinical Dosing Regimen of Selinexor Maintains Normal Immune Homeostasis and T-cell Effector Function in Mice: Implications for Combination with Immunotherapy.

    Science.gov (United States)

    Tyler, Paul M; Servos, Mariah M; de Vries, Romy C; Klebanov, Boris; Kashyap, Trinayan; Sacham, Sharon; Landesman, Yosef; Dougan, Michael; Dougan, Stephanie K

    2017-03-01

    Selinexor (KPT-330) is a first-in-class nuclear transport inhibitor currently in clinical trials as an anticancer agent. To determine how selinexor might affect antitumor immunity, we analyzed immune homeostasis in mice treated with selinexor and found disruptions in T-cell development, a progressive loss of CD8 T cells, and increases in inflammatory monocytes. Antibody production in response to immunization was mostly normal. Precursor populations in bone marrow and thymus were unaffected by selinexor, suggesting that normal immune homeostasis could recover. We found that a high dose of selinexor given once per week preserved nearly normal immune functioning, whereas a lower dose given 3 times per week did not restore immune homeostasis. Both naïve and effector CD8 T cells cultured in vitro showed impaired activation in the presence of selinexor. These experiments suggest that nuclear exportins are required for T-cell development and function. We determined the minimum concentration of selinexor required to block T-cell activation and showed that T-cell-inhibitory effects of selinexor occur at levels above 100 nmol/L, corresponding to the first 24 hours post-oral dosing. In a model of implantable melanoma, selinexor treatment at 10 mg/kg with a 4-day drug holiday led to intratumoral IFNγ + , granzyme B + cytotoxic CD8 T cells that were comparable with vehicle-treated mice. Overall, selinexor treatment leads to transient inhibition of T-cell activation, but clinically relevant once and twice weekly dosing schedules that incorporate sufficient drug holidays allow for normal CD8 T-cell functioning and development of antitumor immunity. Mol Cancer Ther; 16(3); 428-39. ©2017 AACR See related article by Farren et al., p. 417 . ©2017 American Association for Cancer Research.

  4. Maternal stress, nutrition and physical activity: Impact on immune function, CNS development and psychopathology.

    Science.gov (United States)

    Marques, Andrea Horvath; Bjørke-Monsen, Anne-Lise; Teixeira, Antônio L; Silverman, Marni N

    2015-08-18

    Evidence suggests that maternal and fetal immune dysfunction may impact fetal brain development and could play a role in neurodevelopmental disorders, although the definitive pathophysiological mechanisms are still not completely understood. Stress, malnutrition and physical inactivity are three maternal behavioral lifestyle factors that can influence immune and central nervous system (CNS) functions in both the mother and fetus, and may therefore, increase risk for neurodevelopmental/psychiatric disorders. First, we will briefly review some aspects of maternal-fetal immune system interactions and development of immune tolerance. Second, we will discuss the bidirectional communication between the immune system and CNS and the pathways by which immune dysfunction could contribute to neurodevelopmental disorders. Third, we will discuss the effects of prenatal stress and malnutrition (over and undernutrition) on perinatal programming of the CNS and immune system, and how this might influence neurodevelopment. Finally, we will discuss the beneficial impact of physical fitness during pregnancy on the maternal-fetal unit and infant and how regular physical activity and exercise can be an effective buffer against stress- and inflammatory-related disorders. Although regular physical activity has been shown to promote neuroplasticity and an anti-inflammatory state in the adult, there is a paucity of studies evaluating its impact on CNS and immune function during pregnancy. Implementing stress reduction, proper nutrition and ample physical activity during pregnancy and the childbearing period may be an efficient strategy to counteract the impact of maternal stress and malnutrition/obesity on the developing fetus. Such behavioral interventions could have an impact on early development of the CNS and immune system and contribute to the prevention of neurodevelopmental and psychiatric disorders. Further research is needed to elucidate this relationship and the underlying

  5. Frank A. Beach award: programming of neuroendocrine function by early-life experience: a critical role for the immune system.

    Science.gov (United States)

    Bilbo, Staci D

    2013-05-01

    Many neuropsychiatric disorders are associated with a strong dysregulation of the immune system, and several have a striking etiology in development as well. Our recent evidence using a rodent model of neonatal Escherichia coli infection has revealed novel insight into the mechanisms underlying cognitive deficits in adulthood, and suggests that the early-life immune history of an individual may be critical to understanding the relative risk of developing later-life mental health disorders in humans. A single neonatal infection programs the function of immune cells within the brain, called microglia, for the life of the rodent such that an adult immune challenge results in exaggerated cytokine production within the brain and associated cognitive deficits. I describe the important role of the immune system, notably microglia, during brain development, and discuss some of the many ways in which immune activation during early brain development can affect the later-life outcomes of neural function, immune function, and cognition. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Photoperiod history differentially impacts reproduction and immune function in adult Siberian hamsters.

    Science.gov (United States)

    Prendergast, Brian J; Pyter, Leah M

    2009-12-01

    Seasonal changes in numerous aspects of mammalian immune function arise as a result of the annual variation in environmental day length (photoperiod), but it is not known if absolute photoperiod or relative change in photoperiod drives these changes. This experiment tested the hypothesis that an individual's history of exposure to day length determines immune responses to ambiguous, intermediate-duration day lengths. Immunological (blood leukocytes, delayed-type hypersensitivity reactions [DTH]), reproductive, and adrenocortical responses were assessed in adult Siberian hamsters (Phodopus sungorus) that had been raised initially in categorically long (15-h light/day; 15L) or short (9L) photoperiods and were subsequently transferred to 1 of 7 cardinal experimental photoperiods between 9L and 15L, inclusive. Initial photoperiod history interacted with contemporary experimental photoperiods to determine reproductive responses: 11L, 12L, and 13L caused gonadal regression in hamsters previously exposed to 15L, but elicited growth in hamsters previously in 9L. In hamsters with a 15L photoperiod history, photoperiods history, DTH responses were largely unaffected by increases in day length. Enhancement and suppression of blood leukocyte concentrations occurred at 13L in hamsters with photoperiod histories of 15L and 9L, respectively; however, prior exposure to 9L imparted marked hysteresis effects, which suppressed baseline leukocyte concentrations. Cortisol concentrations were only enhanced in 15L hamsters transferred to 9L and, in common with DTH, were unaffected by photoperiod treatments in hamsters with a 9L photoperiod history. Photoperiod history acquired in adulthood impacts immune responses to photoperiod, but manifests in a markedly dissimilar fashion as compared to the reproductive system. Prior photoperiod exposure has an enduring impact on the ability of the immune system to respond to subsequent changes in day length.

  7. Effects of γ-rays on Th1 and Th2 immune function of mice

    International Nuclear Information System (INIS)

    Jin Wei; Cui Yufang; An Xiaoxia; Xu Han; Dong Bo; Liu Xiaolan; Luo Qingliang

    2007-01-01

    Objective: To observe the effects of 6 Gy whole body γ-irradiation on immune function of Th1 and Th2 in mouse, and to investigate the cellular and molecular mechanism of immune system injury induced by irradiation. Methods: Surface marker and intracellular cytokines of lymphocytes were stained with fluorescence-labeled monoclonal antibodies, then the changes of lymphocyte subpopulations, especially the Th1 and Th2 in mouse peripheral blood and spleen were analyzed by flow cytometry. Results: (1) 1 d after 6 Gy y- irradiation, lymphocytic subsets of CD 19 + and CD 8 + in spleen decreased apparently and the percentages of them were only 30% and 41% of control groups respectively (P 19 + and 14 d for CD 8 + respectively, however, up to 21 d post-irradiation they still did not return to control level. (2) Th1 subpopulations in mouse peripheral blood and spleen were significantly reduced at 1 d after irradiation and were only 2.6% and 7.6% of control groups (P 4 + / CD 8 + were significantly increased at 1 d post-irradiation in mouse spleen because of swift reduction of CD 8 + cells. Interestingly, either in peripheral blood or in spleen in irradiated mice, the ratio of Th1/Th2 were evidently raised because of the decrement of Th1 cells, exhibited obviously a phenomenon of predominant immune response of Th2 cells. Conclusions: It is suggested that the depression of mouse immune function induced by 6 Gy γ-irradiation might be caused by changes of CD 4 + /CD 8 + ratio, especially the imbalance of Th1/Th2 function subpopulations. It is shown that the imbalance of Th1/Th2 function subpopulations plays an important role in radiation-induced immune injury, thus providing a better insight into the molecular mechanism and new strategies for prevent and treatment measures of immune injury by irradiation. (authors)

  8. [Therapeutic effect of double fill nine tastes soup in treating recurrent respiratory infection (RRI) and change of immune function in children].

    Science.gov (United States)

    Wang, Youcheng; Zhang, Lijuan; Hu, Guohua; Wang, Menghe; Tang, Xiaoyuan; Guo, Hui; Shi, Yimei; Chen, Shufang; Shi, Changchun

    2012-04-01

    To investigate the therapeutic effect of double fill nine tastes soup in treating children recurrent respiratory infection (RRTI) and the change of immune function. 77 RRTI patients were randomly selected into observation and control groups. The observation group was treated with Chinese medicine- double fill nine tastes soup,water frying points 2 times oral. The control was treated with transfer factor oral liquid,every 10 mL,2 times daily oral. Treatment periods were both two months. IgA, IgG, IgM and IL-12, TNF-alpha, INF-gamma were detected before and after treatment to assess the clinical effects and the changes of immune factors, meanwhile, a health group was established. Before treatment, compared with the health group, the serum IgA, IgG, IgM, IgE, IL-12, TNF-alpha, IFN-gamma in both groups were significantly different (P soup has significant effects in treating recurrent respiratory infection (RRI) and enhance the immune function in children.

  9. Bacillus Coagulans Enhance the Immune Function of the Intestinal Mucosa of Yellow Broilers

    Directory of Open Access Journals (Sweden)

    L Xu

    Full Text Available ABSTRACT This experiment was conducted to investigate the effects of Bacillus coagulans on the growth performance and immune functions of the intestinal mucosa of yellow broilers. Three hundred and sixty one-day-old yellow chicks were randomly allocated to four treatments groups with six replicates of 15 chicks each. The broilers were randomly subjected to one of the following treatments for 28 days: control group (group1, fed a basal diet and three treatments (group 2, 3, 4 fed the basal diet supplemented with 100, 200, or 300 mg/kg Bacillus coagulans , respectively. The results showed that for 28 days, compared with the control diet, the dietary addition of 200 mg/kg Bacillus coagulans significantly decreased the feed/gain ratio (F/G (p<0.05, improved the thymus index, spleen index and bursa index (p<0.05, increased the villus height to crypt depth ratio (V/C in the duodenum (p<0.05, increased the number of secretory immunoglobulin (sIgA positive cells ( p<0.05. The dietary addition of 200 mg/kg Bacillus coagulans promoted a significant increase in Lactobacillus spp. populations and suppressed Escherichia coli replication in cecum, compared with the control (p<0.05. Moreover, the dietary addition of 200 mg/kg Bacillus coagulans also significantly enhanced the levels of interferon alpha (IFNα, toll-like receptor (TLR3, and melanoma differentiation-associated protein 5(MDA5 in the duodenum (p<0.05. In conclusion, the dietary addition of Bacillus coagulans significantly improved broiler performance, and enhanced the intestinal mucosal barrier and immune function. The optimal dosage of Bacillus coagulans for yellow broilers was determined as 2×108 cfu/kg.

  10. Child Immunization Status among a Sample of Adolescent Mothers: Comparing the Validity of Measurement Strategies

    Science.gov (United States)

    Phillips, Clarissa; Cota-Robles, Sonia; Knight, Margaret; Francis, Judith; Phillips, Elizabeth; Mazerbo, Laurie

    2011-01-01

    This study of adolescent mothers sought to identify whether a single general question asked by phone or a detailed, vaccine-specific question asked in a self-report questionnaire best captured infant immunization status at 6 months postpartum, by comparing them with immunization record books. Responses to a global question about whether infants…

  11. Effect of gavage of rhubarb preparation on immune function in patients with sepsis

    Directory of Open Access Journals (Sweden)

    Chao YIN

    2016-01-01

    Full Text Available Objectives  To study the effect of nasointestinal infusion of rhubarb preparation on general inflammatory reaction and immune function in sepsis patients. Methods  The patients with sepsis admitted to our hospital from August 2012 to November 2014 was randomized to placebo group (n=36 and treatment group (n=32. The placebo group was treated conventionally, while the treatment group received the rhubarb preparation through nasal tube. The differences in the clinical symptoms, inflammatory cytokines, immunological indexes were compared between two groups. Results  There was no significant difference in clinical indexes between two groups before the treatment (P>0.05. The time of gastric retention, first defecation, bowel sounds recovery, abdominal pain, and abdominal distension relief were shortened (P<0.05. The contents of TNF-α, IL-1β, and IL-6 were reduced significantly on day 8 and 28 after therapy (P<0.01 in the treatment group, but the level of IL-10 was elevated obviously on days 3 and 8 after therapy (P<0.01. Significant improvements in CD3+, CD4+, CD4+/CD8+ and HLA-DR/ CD14+ were observed at days 3, 8 and 28 after therapy (P<0.05, though the improvement of HLA-DR/CD14+ was seen only on day 8 after therapy (P<0.05. Conclusion  Rhubarb can improve the gastrointestinal function and immune function, and reduce release of inflammatory cytokines in sepsis patients, thus producing the positive role in the treatment of sepsis. DOI: 10.11855/j.issn.0577-7402.2015.12.15

  12. Single-walled carbon nanotubes disturbed the immune and metabolic regulation function 13-weeks after a single intratracheal instillation

    Energy Technology Data Exchange (ETDEWEB)

    Park, Eun-Jung, E-mail: pejtoxic@hanmail.net [Myunggok Eye Research Institute, Konyang University, Daejeon 302-718 (Korea, Republic of); Hong, Young-Shick [Division of Food and Nutrition, Chonnam National University, Yongbong-Ro, Buk-Gu, Gwangju 500-757 (Korea, Republic of); Lee, Byoung-Seok [Toxicologic Pathology Center, Korea Institute of Toxicology, Daejeon (Korea, Republic of); Yoon, Cheolho [Seoul Center, Korea Basic Science Institute, Seoul 126-16 (Korea, Republic of); Jeong, Uiseok; Kim, Younghun [Department of Chemical Engineering, Kwangwoon University, Seoul 139-701 (Korea, Republic of)

    2016-07-15

    Due to their unique physicochemical properties, the potential health effects of single-walled carbon nanotubes (SWCNTs) have attracted continuous attention together with their extensive application. In this study, we aimed to identify local and systemic health effects following pulmonary persistence of SWCNTs. As expected, SWCNTs remained in the lung for 13 weeks after a single intratracheal instillation (50, 100, and 200 μg/kg). In the lung, the total number of cells and the percentages of lymphocytes and neutrophils significantly increased at 200 μg/kg compared to the control, and the Th1-polarized immune response was induced accompanying enhanced expression of tissue damage-related genes and increased release of chemokines. Additionally, SWCNTs enhanced the expression of antigen presentation-related proteins on the surface of antigen-presenting cells, however, maturation of dendritic cells was inhibited by their persistence. As compared to the control, a significant increase in the percentage of neutrophils and a remarkable decrease of BUN and potassium level were observed in the blood of mice treated with the highest dose. This was accompanied by the down-regulation of the expression of antigen presentation-related proteins on splenocytes. Moreover, protein and glucose metabolism were disturbed with an up-regulation of fatty acid β-oxidation. Taken together, we conclude that SWCNTs may induce adverse health effects by disturbing immune and metabolic regulation functions in the body. Therefore, careful application of SWCNTs is necessary for the enforcement of safety in nano-industries. - Highlights: • We evaluated local and systemic health effects following persistence of SWCNTs. • SWCNTs remained in the lung for 13 weeks after a single intratracheal instillation. • Th1-polarized immune response was induced in the lung. • The expression of antigen presentation-related proteins was altered. • Immune and metabolic regulation function were disturbed.

  13. Advances in the quantification of mitochondrial function in primary human immune cells through extracellular flux analysis.

    Directory of Open Access Journals (Sweden)

    Dequina Nicholas

    Full Text Available Numerous studies show that mitochondrial energy generation determines the effectiveness of immune responses. Furthermore, changes in mitochondrial function may regulate lymphocyte function in inflammatory diseases like type 2 diabetes. Analysis of lymphocyte mitochondrial function has been facilitated by introduction of 96-well format extracellular flux (XF96 analyzers, but the technology remains imperfect for analysis of human lymphocytes. Limitations in XF technology include the lack of practical protocols for analysis of archived human cells, and inadequate data analysis tools that require manual quality checks. Current analysis tools for XF outcomes are also unable to automatically assess data quality and delete untenable data from the relatively high number of biological replicates needed to power complex human cell studies. The objectives of work presented herein are to test the impact of common cellular manipulations on XF outcomes, and to develop and validate a new automated tool that objectively analyzes a virtually unlimited number of samples to quantitate mitochondrial function in immune cells. We present significant improvements on previous XF analyses of primary human cells that will be absolutely essential to test the prediction that changes in immune cell mitochondrial function and fuel sources support immune dysfunction in chronic inflammatory diseases like type 2 diabetes.

  14. Cow's Milk and Immune Function in the Respiratory Tract: Potential Mechanisms.

    Science.gov (United States)

    Perdijk, Olaf; van Splunter, Marloes; Savelkoul, Huub F J; Brugman, Sylvia; van Neerven, R J Joost

    2018-01-01

    During the last decades, the world has witnessed a dramatic increase in allergy prevalence. Epidemiological evidence shows that growing up on a farm is a protective factor, which is partly explained by the consumption of raw cow's milk. Indeed, recent studies show inverse associations between raw cow's milk consumption in early life and asthma, hay fever, and rhinitis. A similar association of raw cow's milk consumption with respiratory tract infections is recently found. In line with these findings, controlled studies in infants with milk components such as lactoferrin, milk fat globule membrane, and colostrum IgG have shown to reduce respiratory infections. However, for ethical reasons, it is not possible to conduct controlled studies with raw cow's milk in infants, so formal proof is lacking to date. Because viral respiratory tract infections and aeroallergen exposure in children may be causally linked to the development of asthma, it is of interest to investigate whether cow's milk components can modulate human immune function in the respiratory tract and via which mechanisms. Inhaled allergens and viruses trigger local immune responses in the upper airways in both nasal and oral lymphoid tissue. The components present in raw cow's milk are able to promote a local microenvironment in which mucosal immune responses are modified and the epithelial barrier is enforced. In addition, such responses may also be triggered in the gut after exposure to allergens and viruses in the nasal cavity that become available in the GI tract after swallowing. However, these immune cells that come into contact with cow's milk components in the gut must recirculate into the blood and home to the (upper and lower) respiratory tract to regulate immune responses locally. Expression of the tissue homing-associated markers α4β7 and CCR9 or CCR10 on lymphocytes can be influenced by vitamin A and vitamin D3, respectively. Since both vitamins are present in milk, we speculate that raw

  15. Functional analysis of PGRP-LA in Drosophila immunity.

    Directory of Open Access Journals (Sweden)

    Mathilde Gendrin

    Full Text Available PeptidoGlycan Recognition Proteins (PGRPs are key regulators of the insect innate antibacterial response. Even if they have been intensively studied, some of them have yet unknown functions. Here, we present a functional analysis of PGRP-LA, an as yet uncharacterized Drosophila PGRP. The PGRP-LA gene is located in cluster with PGRP-LC and PGRP-LF, which encode a receptor and a negative regulator of the Imd pathway, respectively. Structure predictions indicate that PGRP-LA would not bind to peptidoglycan, pointing to a regulatory role of this PGRP. PGRP-LA expression was enriched in barrier epithelia, but low in the fat body. Use of a newly generated PGRP-LA deficient mutant indicates that PGRP-LA is not required for the production of antimicrobial peptides by the fat body in response to a systemic infection. Focusing on the respiratory tract, where PGRP-LA is strongly expressed, we conducted a genome-wide microarray analysis of the tracheal immune response of wild-type, Relish, and PGRP-LA mutant larvae. Comparing our data to previous microarray studies, we report that a majority of genes regulated in the trachea upon infection differ from those induced in the gut or the fat body. Importantly, antimicrobial peptide gene expression was reduced in the tracheae of larvae and in the adult gut of PGRP-LA-deficient Drosophila upon oral bacterial infection. Together, our results suggest that PGRP-LA positively regulates the Imd pathway in barrier epithelia.

  16. Effects of blood transportation on human peripheral mononuclear cell yield, phenotype and function: implications for immune cell biobanking.

    Directory of Open Access Journals (Sweden)

    Anita Posevitz-Fejfár

    Full Text Available Human biospecimen collection, processing and preservation are rapidly emerging subjects providing essential support to clinical as well as basic researchers. Unlike collection of other biospecimens (e.g. DNA and serum, biobanking of viable immune cells, such as peripheral blood mononuclear cells (PBMC and/or isolated immune cell subsets is still in its infancy. While certain aspects of processing and freezing conditions have been studied in the past years, little is known about the effect of blood transportation on immune cell survival, phenotype and specific functions. However, especially for multicentric and cooperative projects it is vital to precisely know those effects. In this study we investigated the effect of blood shipping and pre-processing delay on immune cell phenotype and function both on cellular and subcellular levels. Peripheral blood was collected from healthy volunteers (n = 9: at a distal location (shipped overnight and in the central laboratory (processed immediately. PBMC were processed in the central laboratory and analyzed post-cryopreservation. We analyzed yield, major immune subset distribution, proliferative capacity of T cells, cytokine pattern and T-cell receptor signal transduction. Results show that overnight transportation of blood samples does not globally compromise T- cell subsets as they largely retain their phenotype and proliferative capacity. However, NK and B cell frequencies, the production of certain PBMC-derived cytokines and IL-6 mediated cytokine signaling pathway are altered due to transportation. Various control experiments have been carried out to compare issues related to shipping versus pre-processing delay on site. Our results suggest the implementation of appropriate controls when using multicenter logistics for blood transportation aiming at subsequent isolation of viable immune cells, e.g. in multicenter clinical trials or studies analyzing immune cells/subsets. One important conclusion might

  17. Ageing and the humoral immune response in mice

    International Nuclear Information System (INIS)

    Blankwater, M.J.

    1978-01-01

    The study presented in this thesis is concerned with changes in the humoral immune system as a function of age in different inbred mouse strains. Their capacity to develop humoral immune responses to experimentally given thymus-dependent and thymus-independent antigens under various conditions is compared. Furthermore, experiments employing thymus transplantation and thymic humoral factors which are directed at the restoration of the diminished T cell functions in old age are reported. (Auth.)

  18. Microbial-immune cross-talk and regulation of the immune system.

    Science.gov (United States)

    Cahenzli, Julia; Balmer, Maria L; McCoy, Kathy D

    2013-01-01

    We are all born germ-free. Following birth we enter into a lifelong relationship with microbes residing on our body's surfaces. The lower intestine is home to the highest microbial density in our body, which is also the highest microbial density known on Earth (up to 10(12) /g of luminal contents). With our indigenous microbial cells outnumbering our human cells by an order of magnitude our body is more microbial than human. Numerous immune adaptations confine these microbes within the mucosa, enabling most of us to live in peaceful homeostasis with our intestinal symbionts. Intestinal epithelial cells not only form a physical barrier between the bacteria-laden lumen and the rest of the body but also function as multi-tasking immune cells that sense the prevailing microbial (apical) and immune (basolateral) milieus, instruct the underlying immune cells, and adapt functionally. In the constant effort to ensure intestinal homeostasis, the immune system becomes educated to respond appropriately and in turn immune status can shape the microbial consortia. Here we review how the dynamic immune-microbial dialogue underlies maturation and regulation of the immune system and discuss recent findings on the impact of diet on both microbial ecology and immune function. © 2012 The Authors. Immunology © 2012 Blackwell Publishing Ltd.

  19. Interactions between Temperament, Stress, and Immune Function in Cattle

    Directory of Open Access Journals (Sweden)

    N. C. Burdick

    2011-01-01

    Full Text Available The detrimental effects caused by stressors encountered by animals during routine handling can pose economic problems for the livestock industry due to increased costs ultimately borne by the producer and the consumer. Stress adversely affects key physiological processes of the reproductive and immune systems. In recent years stress responsiveness has been associated with cattle behavior, specifically temperament. Cattle with more excitable temperaments, as measured by chute score, pen score, and exit velocity (flight speed, exhibit greater basal concentrations of glucocorticoids and catecholamines. Similar to stressed cattle, more temperamental cattle (i.e., cattle exhibiting greater exit velocity or pen and chute scores have poorer growth performance, carcass characteristics, and immune responses. Thus, understanding the interrelationship of stress and temperament can help in the development of selection and management practices that reduce the negative influence of temperament on growth and productivity of cattle. This paper discusses the relationship between stress and temperament and the developing evidence of an effect of temperament on immune function of cattle that have been handled or restrained. Specifically, the paper discusses different methodologies used to measure temperament, including chute score, pen score, and exit velocity, and discusses the reaction of cattle to different stressors including handling and restraint.

  20. Use of the local lymph node assay in assessment of immune function

    International Nuclear Information System (INIS)

    Berg, Femke A. van den; Baken, Kirsten A.; Vermeulen, Jolanda P.; Gremmer, Eric R.; Steeg, Harry van; Loveren, Henk van

    2005-01-01

    The murine local lymph node assay (LLNA) was originally developed as a predictive test method for the identification of chemicals with sensitizing potential. In this study we demonstrated that an adapted LLNA can also be used as an immune function assay by studying the effects of orally administered immunomodulating compounds on the T-cell-dependent immune response induced by the contact sensitizer 2,4-dinitrochlorobenzene (DNCB). C57Bl/6 mice were treated with the immunotoxic compounds cyclosporin A (CsA), bis(tri-n-butyltin)oxide (TBTO) or benzo[a]pyrene (B[a]P). Subsequently, cell proliferation and interferon-γ (IFN-γ) and interleukin (IL)-4 release were determined in the auricular lymph nodes (LNs) after DNCB application on both ears. Immunosuppression induced by CsA, TBTO and B[a]P was clearly detectable in this application of the LLNA. Cytokine release measurements proved valuable to confirm the results of the cell proliferation assay and to obtain an indication of the effect on Th1/Th2 balance. We believe to have demonstrated the applicability of an adapted LLNA as an immune function assay in the mouse

  1. Use of the local lymph node assay in assessment of immune function.

    Science.gov (United States)

    van den Berg, Femke A; Baken, Kirsten A; Vermeulen, Jolanda P; Gremmer, Eric R; van Steeg, Harry; van Loveren, Henk

    2005-07-01

    The murine local lymph node assay (LLNA) was originally developed as a predictive test method for the identification of chemicals with sensitizing potential. In this study we demonstrated that an adapted LLNA can also be used as an immune function assay by studying the effects of orally administered immunomodulating compounds on the T-cell-dependent immune response induced by the contact sensitizer 2,4-dinitrochlorobenzene (DNCB). C57Bl/6 mice were treated with the immunotoxic compounds cyclosporin A (CsA), bis(tri-n-butyltin)oxide (TBTO) or benzo[a]pyrene, (B[a]P). Subsequently, cell proliferation and interferon-gamma (IFN-gamma) and interleukin (IL)-4 release were determined in the auricular lymph nodes (LNs) after DNCB application on both ears. Immunosuppression induced by CsA, TBTO and B[a]P was clearly detectable in this application of the LLNA. Cytokine release measurements proved valuable to confirm the results of the cell proliferation assay and to obtain an indication of the effect on Th1/Th2 balance. We believe to have demonstrated the applicability of an adapted LLNA as an immune function assay in the mouse.

  2. Comparative analysis of the effectiveness of three immunization strategies in controlling disease outbreaks in realistic social networks.

    Directory of Open Access Journals (Sweden)

    Zhijing Xu

    Full Text Available The high incidence of emerging infectious diseases has highlighted the importance of effective immunization strategies, especially the stochastic algorithms based on local available network information. Present stochastic strategies are mainly evaluated based on classical network models, such as scale-free networks and small-world networks, and thus are insufficient. Three frequently referred stochastic immunization strategies-acquaintance immunization, community-bridge immunization, and ring vaccination-were analyzed in this work. The optimal immunization ratios for acquaintance immunization and community-bridge immunization strategies were investigated, and the effectiveness of these three strategies in controlling the spreading of epidemics were analyzed based on realistic social contact networks. The results show all the strategies have decreased the coverage of the epidemics compared to baseline scenario (no control measures. However the effectiveness of acquaintance immunization and community-bridge immunization are very limited, with acquaintance immunization slightly outperforming community-bridge immunization. Ring vaccination significantly outperforms acquaintance immunization and community-bridge immunization, and the sensitivity analysis shows it could be applied to controlling the epidemics with a wide infectivity spectrum. The effectiveness of several classical stochastic immunization strategies was evaluated based on realistic contact networks for the first time in this study. These results could have important significance for epidemic control research and practice.

  3. Comparative analysis of the effectiveness of three immunization strategies in controlling disease outbreaks in realistic social networks.

    Science.gov (United States)

    Xu, Zhijing; Zu, Zhenghu; Zheng, Tao; Zhang, Wendou; Xu, Qing; Liu, Jinjie

    2014-01-01

    The high incidence of emerging infectious diseases has highlighted the importance of effective immunization strategies, especially the stochastic algorithms based on local available network information. Present stochastic strategies are mainly evaluated based on classical network models, such as scale-free networks and small-world networks, and thus are insufficient. Three frequently referred stochastic immunization strategies-acquaintance immunization, community-bridge immunization, and ring vaccination-were analyzed in this work. The optimal immunization ratios for acquaintance immunization and community-bridge immunization strategies were investigated, and the effectiveness of these three strategies in controlling the spreading of epidemics were analyzed based on realistic social contact networks. The results show all the strategies have decreased the coverage of the epidemics compared to baseline scenario (no control measures). However the effectiveness of acquaintance immunization and community-bridge immunization are very limited, with acquaintance immunization slightly outperforming community-bridge immunization. Ring vaccination significantly outperforms acquaintance immunization and community-bridge immunization, and the sensitivity analysis shows it could be applied to controlling the epidemics with a wide infectivity spectrum. The effectiveness of several classical stochastic immunization strategies was evaluated based on realistic contact networks for the first time in this study. These results could have important significance for epidemic control research and practice.

  4. Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

    International Nuclear Information System (INIS)

    Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C.; Ballestas, Mary E.; Elmets, Craig A.; Robbins, David J.; Matalon, Sadis; Deshane, Jessy S.; Afaq, Farrukh; Bickers, David R.; Athar, Mohammad

    2013-01-01

    Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon, 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions

  5. Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C. [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Ballestas, Mary E. [Department of Pediatrics Infectious Disease, Children' s of Alabama, School of Medicine, University of Alabama at Birmingham, AL (United States); Elmets, Craig A. [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Robbins, David J. [Department of Surgery, Molecular Oncology Program, Miller School of Medicine, University of Miami, Miami (United States); Matalon, Sadis [Department of Anesthesiology, University of Alabama at Birmingham, Birmingham, AL (United States); Deshane, Jessy S. [Department of Medicine, Division of Pulmonary, Allergy and Critical Care Medicine, University of Alabama at Birmingham, Birmingham, AL (United States); Afaq, Farrukh [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Bickers, David R. [Department of Dermatology, Columbia University Medical Center, New York (United States); Athar, Mohammad, E-mail: mathar@uab.edu [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States)

    2013-11-01

    Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon, 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions.

  6. Effects of methotrexate combined with hydroxychloroquine sulfate and prednisone acetate on inflammatory response, immune function and liver and renal function in patients with systemic lupus erythematosus

    Directory of Open Access Journals (Sweden)

    Jiang-Li Xia

    2017-11-01

    Full Text Available Objective: To investigate the effects of methotrexate and hydroxychloroquine sulfate and prednisone on inflammatory response, immune function, liver and renal function in patients with systemic lupus erythematosus (SLE. Methods: A total of 80 cases of SLE patients according to the random data table were divided into the control group (n=40 and observation group (n=40, the control group were treated with hydroxychloroquine sulfate and prednisone treatment, on the basis of treatment of the control group, patients in the observation group in the control group were treated with methotrexate, the levels of inflammatory factors, immune function, liver and kidney function indexes in the two groups between the before treatment and after treatment were compared. Results: Comparison of the levels before treatment, the difference of the CRP, WBC, ESR, IgA, IgG, complement C3, complement C4, ALT, AST, SCr and BUN levels were not statistically significant. After treatment, the levels of CRP, ESR, IgA, IgG, ALT, AST, SCr and BUN in the observation group were significantly lower than those in the control group, and the difference was statistically significant. The levels of WBC and complement C4 in the observation group [(5.18±1.08伊10 9 /L, (0.22±0.05 g/L] were significantly higher than those in the control group [(4.51±0.52伊10 9 /L, (0.18±0.03 g/L], and there was no significant difference in the level of complement C3 between the two groups after treatment. Conclusion: Methotrexate combined with hydroxychloroquine sulfate and prednisone for the treatment of SLE can effectively reduce inflammation, improve immune function, has little effect on kidney function, high safety, which has an important clinical value.

  7. Effects of prenatal yoga on women's stress and immune function across pregnancy: A randomized controlled trial.

    Science.gov (United States)

    Chen, Pao-Ju; Yang, Luke; Chou, Cheng-Chen; Li, Chia-Chi; Chang, Yu-Cune; Liaw, Jen-Jiuan

    2017-04-01

    The effects of prenatal yoga on biological indicators have not been widely studied. Thus, we compared changes in stress and immunity salivary biomarkers from 16 to 36 weeks' gestation between women receiving prenatal yoga and those receiving routine prenatal care. For this longitudinal, prospective, randomized controlled trial, we recruited 94 healthy pregnant women at 16 weeks' gestation through convenience sampling from a prenatal clinic in Taipei. Participants were randomly assigned to intervention (n=48) or control (n=46) groups using Clinstat block randomization. The 20-week intervention comprised two weekly 70-min yoga sessions led by a midwife certified as a yoga instructor; the control group received only routine prenatal care. In both groups, participants' salivary cortisol and immunoglobulin A levels were collected before and after yoga every 4 weeks from 16 to 36 weeks' gestation. The intervention group had lower salivary cortisol (pcontrol group. Specifically, the intervention group had significantly higher long-term salivary immunoglobulin A levels than the control group (p=0.018), and infants born to women in the intervention group weighed more than those born to the control group (pPrenatal yoga significantly reduced pregnant women's stress and enhanced their immune function. Clinicians should learn the mechanisms of yoga and its effects on pregnant women. Our findings can guide clinicians to help pregnant women alleviate their stress and enhance their immune function. Copyright © 2017. Published by Elsevier Ltd.

  8. Combined acupuncture and general anesthesia on immune and cognitive function in elderly patients following subtotal gastrectomy for gastric cancer.

    Science.gov (United States)

    Wang, Ningke; Ou, Yangwen; Qing, Wenxiang

    2018-01-01

    This study investigated the effects of acupuncture combined with general anesthesia on postoperative immune and cognitive functions in elderly patients undergoing subtotal gastrectomy. We recruited 96 elderly patients who received anesthesia for subtotal gastrectomy and randomly divided them into control (n=48) and experimental (n=48) groups. The control group received general anesthesia and the experimental group received combined acupuncture and general anesthesia. We measured hemodynamic immediately before and after anesthesia induction, and immune observations before and after surgery. We found no significant differences in mean heart rate (HR), mean oxygen saturation (SpO2), and partial pressure of end-tidal carbon dioxide (PETCO2) in the perioperative period between the two groups. Mean arterial pressure (MAP) was lower in the experimental group than that in the control group (P0.05), but the incidence of delayed recovery and postoperative agitation were significantly lower in the experimental group compared with those in the control group (P<0.05). One day after surgery, the experimental group showed better protection of cognitive function than the control group (P<0.05). Overall, combined acupuncture and general anesthesia in elderly gastric cancer patients receiving subtotal gastrectomy showed more stable hemodynamics and fewer stress responses during surgery. Thus, combined acupuncture and general anesthesia can shorten the recovery time from anesthesia, have less negative effects on immune function and decrease the incidence of postoperative cognitive impairment.

  9. The kinase TBK1 functions in dendritic cells to regulate T cell homeostasis, autoimmunity, and antitumor immunity.

    Science.gov (United States)

    Xiao, Yichuan; Zou, Qiang; Xie, Xiaoping; Liu, Ting; Li, Haiyan S; Jie, Zuliang; Jin, Jin; Hu, Hongbo; Manyam, Ganiraju; Zhang, Li; Cheng, Xuhong; Wang, Hui; Marie, Isabelle; Levy, David E; Watowich, Stephanie S; Sun, Shao-Cong

    2017-05-01

    Dendritic cells (DCs) are crucial for mediating immune responses but, when deregulated, also contribute to immunological disorders, such as autoimmunity. The molecular mechanism underlying the function of DCs is incompletely understood. In this study, we have identified TANK-binding kinase 1 (TBK1), a master innate immune kinase, as an important regulator of DC function. DC-specific deletion of Tbk1 causes T cell activation and autoimmune symptoms and also enhances antitumor immunity in animal models of cancer immunotherapy. The TBK1-deficient DCs have up-regulated expression of co-stimulatory molecules and increased T cell-priming activity. We further demonstrate that TBK1 negatively regulates the induction of a subset of genes by type I interferon receptor (IFNAR). Deletion of IFNAR1 could largely prevent aberrant T cell activation and autoimmunity in DC-conditional Tbk1 knockout mice. These findings identify a DC-specific function of TBK1 in the maintenance of immune homeostasis and tolerance. © 2017 Xiao et al.

  10. Suppression of adaptive immunity to heterologous antigens during Plasmodium infection through hemozoin-induced failure of dendritic cell function

    Directory of Open Access Journals (Sweden)

    Phillips R

    2006-04-01

    Full Text Available Abstract Background Dendritic cells (DCs are central to the initiation and regulation of the adaptive immune response during infection. Modulation of DC function may therefore allow evasion of the immune system by pathogens. Significant depression of the host's systemic immune response to both concurrent infections and heterologous vaccines has been observed during malaria infection, but the mechanisms underlying this immune hyporesponsiveness are controversial. Results Here, we demonstrate that the blood stages of malaria infection induce a failure of DC function in vitro and in vivo, causing suboptimal activation of T cells involved in heterologous immune responses. This effect on T-cell activation can be transferred to uninfected recipients by DCs isolated from infected mice. Significantly, T cells activated by these DCs subsequently lack effector function, as demonstrated by a failure to migrate to lymphoid-organ follicles, resulting in an absence of B-cell responses to heterologous antigens. Fractionation studies show that hemozoin, rather than infected erythrocyte (red blood cell membranes, reproduces the effect of intact infected red blood cells on DCs. Furthermore, hemozoin-containing DCs could be identified in T-cell areas of the spleen in vivo. Conclusion Plasmodium infection inhibits the induction of adaptive immunity to heterologous antigens by modulating DC function, providing a potential explanation for epidemiological studies linking endemic malaria with secondary infections and reduced vaccine efficacy.

  11. The sweet side of a long pentraxin: how glycosylation affects PTX3 functions in innate immunity and inflammation

    Directory of Open Access Journals (Sweden)

    Antonio eInforzato

    2013-01-01

    Full Text Available Innate immunity represents the first line of defence against pathogens and plays key roles in activation and orientation of the adaptive immune response. The innate immune system comprises both a cellular and a humoral arm. Components of the humoral arm include soluble pattern recognition molecules (PRMs that recognise pathogen associated molecular patterns (PAMPs and initiate the immune response in coordination with the cellular arm, therefore acting as functional ancestors of antibodies. The long pentraxin PTX3 is a prototypic soluble PRM that is produced at sites of infection and inflammation by both somatic and immune cells. Gene targeting of this evolutionarily conserved protein has revealed a non-redundant role in resistance to selected pathogens. Moreover, PTX3 exerts important functions at the crossroad between innate immunity, inflammation and female fertility. The human PTX3 protein contains a single N-glycosylation site that is fully occupied by complex type oligosaccharides, mainly fucosylated and sialylated biantennary glycans. Glycosylation has been implicated in a number of PTX3 activities, including neutralization of influenza viruses, modulation of the complement system, and attenuation of leukocyte recruitment. Therefore, this post translational modification might act as a fine tuner of PTX3 functions in native immunity and inflammation.Here we review the studies on PTX3, with emphasis on the glycan-dependent mechanisms underlying pathogen recognition and crosstalk with other components of the innate immune system.

  12. Abnormal immune system development and function in schizophrenia helps reconcile diverse findings and suggests new treatment and prevention strategies.

    Science.gov (United States)

    Anders, Sherry; Kinney, Dennis K

    2015-08-18

    Extensive research implicates disturbed immune function and development in the etiology and pathology of schizophrenia. In addition to reviewing evidence for immunological factors in schizophrenia, this paper discusses how an emerging model of atypical immune function and development helps explain a wide variety of well-established - but puzzling - findings about schizophrenia. A number of theorists have presented hypotheses that early immune system programming, disrupted by pre- and perinatal adversity, often combines with abnormal brain development to produce schizophrenia. The present paper focuses on the hypothesis that disruption of early immune system development produces a latent immune vulnerability that manifests more fully after puberty, when changes in immune function and the thymus leave individuals more susceptible to infections and immune dysfunctions that contribute to schizophrenia. Complementing neurodevelopmental models, this hypothesis integrates findings on many contributing factors to schizophrenia, including prenatal adversity, genes, climate, migration, infections, and stress, among others. It helps explain, for example, why (a) schizophrenia onset is typically delayed until years after prenatal adversity, (b) individual risk factors alone often do not lead to schizophrenia, and (c) schizophrenia prevalence rates actually tend to be higher in economically advantaged countries. Here we discuss how the hypothesis explains 10 key findings, and suggests new, potentially highly cost-effective, strategies for treatment and prevention of schizophrenia. Moreover, while most human research linking immune factors to schizophrenia has been correlational, these strategies provide ethical ways to experimentally test in humans theories about immune function and schizophrenia. This article is part of a Special Issue entitled SI: Neuroimmunology in Health And Disease. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Heavy metal pollution disturbs immune response in wild ant populations

    International Nuclear Information System (INIS)

    Sorvari, Jouni; Rantala, Liisa M.; Rantala, Markus J.; Hakkarainen, Harri; Eeva, Tapio

    2007-01-01

    Concern about the effects of environmental contaminants on immune function in both humans and wildlife is growing and practically nothing is known about this impact on terrestrial invertebrates, even though they are known to easily accumulate pollutants. We studied the effect of industrial heavy metal contamination on immune defense of a free-living wood ant (Formica aquilonia). To find out whether ants show an adapted immune function in a polluted environment, we compared encapsulation responses between local and translocated colonies. Local colonies showed higher heavy metal levels than the translocated ones but the encapsulation response was similar between the two groups, indicating that the immune system of local ants has not adapted to high contamination level. The encapsulation response was elevated in moderate whereas suppressed in high heavy metal levels suggesting higher risk for infections in heavily polluted areas. - Heavy metal pollution affects immune function in ants

  14. Effects of methylmercury exposure on the immune function of juvenile common loons (Gavia immer)

    Science.gov (United States)

    Kenow, K.P.; Grasman, K.A.; Hines, R.K.; Meyer, M.W.; Gendron-Fitzpatrick, A.; Spalding, M.G.; Gray, B.R.

    2007-01-01

    We conducted a dose-response laboratory study to quantify the level of exposure to dietary Hg, delivered as methylmercury chloride (CH3HgCl), that is associated with suppressed immune function in captive-reared common loon (Gavia immer) chicks. We used the phytohemagglutinin (PHA) skin test to assess T-lymphocyte function and the sheep red blood cell (SRBC) hemagglutination test to measure antibody-mediated immunity. The PHA stimulation index among chicks receiving dietary Hg treatment did not differ significantly from those of chicks on the control diet (p = 0.15). Total antibody (immunoglobulin [Ig] M [primary antibody] + IgG [secondary response]) production to the SRBC antigen in chicks treated with dietary methylmercury (MeHg), however, was suppressed (p = 0.04) relative to chicks on control diets. Analysis indicated suppression of total Ig production (p = 0.025 with comparisonwise ?? level = 0.017) between control and 0.4 ??g Hg/g wet food intake treatment groups. Furthermore, the control group exhibited a higher degree of variability in antibody response compared to the Hg groups, suggesting that in addition to reducing the mean response, Hg treatment reduced the normal variation attributable to other biological factors. We observed bursal lymphoid depletion in chicks receiving the 1.2 ??g Hg/g treatment (p = 0.017) and a marginally significant effect (p = 0.025) in chicks receiving the 0.4 ??g Hg/g diet. These findings suggest that common loon chick immune systems may be compromised at an ecologically relevant dietary exposure concentration (0.4 ??g Hg/g wet wt food intake). We also found that chicks hatched from eggs collected from low-pH lakes exhibited higher levels of lymphoid depletion in bursa tissue relative to chicks hatched from eggs collected from neutral-pH lakes. ?? 2007 SETAC.

  15. A method for high purity intestinal epithelial cell culture from adult human and murine tissues for the investigation of innate immune function.

    Science.gov (United States)

    Graves, Christina L; Harden, Scott W; LaPato, Melissa; Nelson, Michael; Amador, Byron; Sorenson, Heather; Frazier, Charles J; Wallet, Shannon M

    2014-12-01

    Intestinal epithelial cells (IECs) serve as an important physiologic barrier between environmental antigens and the host intestinal immune system. Thus, IECs serve as a first line of defense and may act as sentinel cells during inflammatory insults. Despite recent renewed interest in IEC contributions to host immune function, the study of primary IEC has been hindered by lack of a robust culture technique, particularly for small intestinal and adult tissues. Here, a novel adaptation for culture of primary IEC is described for human duodenal organ donor tissue as well as duodenum and colon of adult mice. These epithelial cell cultures display characteristic phenotypes and are of high purity. In addition, the innate immune function of human primary IEC, specifically with regard to Toll-like receptor (TLR) expression and microbial ligand responsiveness, is contrasted with a commonly used intestinal epithelial cell line (HT-29). Specifically, TLR expression at the mRNA level and production of cytokine (IFNγ and TNFα) in response to TLR agonist stimulation is assessed. Differential expression of TLRs as well as innate immune responses to ligand stimulation is observed in human-derived cultures compared to that of HT-29. Thus, use of this adapted method to culture primary epithelial cells from adult human donors and from adult mice will allow for more appropriate studies of IECs as innate immune effectors. Published by Elsevier B.V.

  16. Microglia and Beyond: Innate Immune Cells As Regulators of Brain Development and Behavioral Function

    Directory of Open Access Journals (Sweden)

    Kathryn M. Lenz

    2018-04-01

    Full Text Available Innate immune cells play a well-documented role in the etiology and disease course of many brain-based conditions, including multiple sclerosis, Alzheimer’s disease, traumatic brain and spinal cord injury, and brain cancers. In contrast, it is only recently becoming clear that innate immune cells, primarily brain resident macrophages called microglia, are also key regulators of brain development. This review summarizes the current state of knowledge regarding microglia in brain development, with particular emphasis on how microglia during development are distinct from microglia later in life. We also summarize the effects of early life perturbations on microglia function in the developing brain, the role that biological sex plays in microglia function, and the potential role that microglia may play in developmental brain disorders. Finally, given how new the field of developmental neuroimmunology is, we highlight what has yet to be learned about how innate immune cells shape the development of brain and behavior.

  17. Microglia and Beyond: Innate Immune Cells As Regulators of Brain Development and Behavioral Function.

    Science.gov (United States)

    Lenz, Kathryn M; Nelson, Lars H

    2018-01-01

    Innate immune cells play a well-documented role in the etiology and disease course of many brain-based conditions, including multiple sclerosis, Alzheimer's disease, traumatic brain and spinal cord injury, and brain cancers. In contrast, it is only recently becoming clear that innate immune cells, primarily brain resident macrophages called microglia, are also key regulators of brain development. This review summarizes the current state of knowledge regarding microglia in brain development, with particular emphasis on how microglia during development are distinct from microglia later in life. We also summarize the effects of early life perturbations on microglia function in the developing brain, the role that biological sex plays in microglia function, and the potential role that microglia may play in developmental brain disorders. Finally, given how new the field of developmental neuroimmunology is, we highlight what has yet to be learned about how innate immune cells shape the development of brain and behavior.

  18. Immunization Information System and Informatics to Promote Immunizations: Perspective From Minnesota Immunization Information Connection.

    Science.gov (United States)

    Muscoplat, Miriam Halstead; Rajamani, Sripriya

    2017-01-01

    The vision for management of immunization information is availability of real-time consolidated data and services for all ages, to clinical, public health, and other stakeholders. This is being executed through Immunization Information Systems (IISs), which are population-based and confidential computerized systems present in most US states and territories. Immunization Information Systems offer many functionalities, such as immunization assessment reports, client follow-up, reminder/recall feature, vaccine management tools, state-supplied vaccine ordering, comprehensive immunization history, clinical decision support/vaccine forecasting and recommendations, data processing, and data exchange. This perspective article will present various informatics tools in an IIS, in the context of the Minnesota Immunization Information Connection.

  19. In immune defense: redefining the role of the immune system in chronic disease.

    Science.gov (United States)

    Rubinow, Katya B; Rubinow, David R

    2017-03-01

    The recognition of altered immune system function in many chronic disease states has proven to be a pivotal advance in biomedical research over the past decade. For many metabolic and mood disorders, this altered immune activity has been characterized as inflammation, with the attendant assumption that the immune response is aberrant. However, accumulating evidence challenges this assumption and suggests that the immune system may be mounting adaptive responses to chronic stressors. Further, the inordinate complexity of immune function renders a simplistic, binary model incapable of capturing critical mechanistic insights. In this perspective article, we propose alternative paradigms for understanding the role of the immune system in chronic disease. By invoking allostasis or systems biology rather than inflammation, we can ascribe greater functional significance to immune mediators, gain newfound appreciation of the adaptive facets of altered immune activity, and better avoid the potentially disastrous effects of translating erroneous assumptions into novel therapeutic strategies.

  20. MicroRNAs (MiRs) Precisely Regulate Immune System Development and Function in Immunosenescence Process.

    Science.gov (United States)

    Aalaei-Andabili, Seyed Hossein; Rezaei, Nima

    2016-01-01

    Human aging is a complex process with pivotal changes in gene expression of biological pathways. Immune system dysfunction has been recognized as one of the most important abnormalities induced by senescent names immunosenescence. Emerging evidences suggest miR role in immunosenescence. We aimed to systemically review all relevant reports to clearly state miR effects on immunosenescence process. Sensitive electronic searches carried out. Quality assessment has been performed. Since majority of the included studies were laboratory works, and therefore heterogen, we discussed miR effects on immunological aging process nonstatically. Forty-six articles were found in the initial search. After exclusion of 34 articles, 12 studies enrolled to the final stage. We found that miRs have crucial roles in exact function of immune system. MiRs are involved in the regulation of the aging process in the immune system components and target certain genes, promoting or inhibiting immune system reaction to invasion. Also, miRs control life span of the immune system members by regulation of the genes involved in the apoptosis. Interestingly, we found that immunosenescence is controllable by proper manipulation of the various miRs expression. DNA methylation and histone acetylation have been discovered as novel strategies, altering NF-κB binding ability to the miR promoter sites. Effect of miRs on impairment of immune system function due to the aging is emerging. Although it has been accepted that miRs have determinant roles in the regulation of the immunosenescence; however, most of the reports are concluded from animal/laboratory works, suggesting the necessity of more investigations in human.

  1. Dim light at night increases immune function in Nile grass rats, a diurnal rodent.

    Science.gov (United States)

    Fonken, Laura K; Haim, Achikam; Nelson, Randy J

    2012-02-01

    With the widespread adoption of electrical lighting during the 20th century, human and nonhuman animals became exposed to high levels of light at night for the first time in evolutionary history. This divergence from the natural environment may have significant implications for certain ecological niches because of the important influence light exerts on the circadian system. For example, circadian disruption and nighttime light exposure are linked to changes in immune function. The majority of studies investigating the effects of light exposure and circadian disruption on the immune system use nocturnal rodents. In diurnal species, many hormones and immune parameters vary with secretion patterns 180° out of phase to those of nocturnal rodents. Thus, the authors investigated the effects of nighttime light exposure on immunocompetence in diurnal Nile grass rats (Arvicanthis niloticus). Rats were housed in either standard 14-h light (L):10-h dark (D) cycles with L ∼150 lux and D 0 lux or dim light at night (dLAN) cycles of LD 14:10 with L ∼150 lux and D 5 lux for 3 wks, then tested for plasma bactericidal capacity, as well as humoral and cell-mediated immune responses. Rats exposed to dLAN showed increased delayed-type hypersensitivity pinna swelling, which is consistent with enhanced cell-mediated immune function. dLAN rats similarly showed increased antibody production following inoculation with keyhole lymphocyte hemocyanin (KLH) and increased bactericidal capacity. Daytime corticosterone concentrations were elevated in grass rats exposed to nighttime dim light, which may have influenced immunological measures. Overall, these results indicate nighttime light affects immune parameters in a diurnal rodent.

  2. Human papillomavirus immunization uptake among girls with a refugee background compared with Danish-born girls

    DEFF Research Database (Denmark)

    P. Møller, Sanne; Kristiansen, Maria; Norredam, Marie

    2018-01-01

    Refugee children and their families may experience impaired access to healthcare; therefore, we aimed to uncover human papillomavirus (HPV) immunization patterns among a large group of refugee girls compared with Danish-born girls. We also examined possible predictors of uptake among refugee girls....... We used aregister-based cohort design where refugee girls (n = 3264) who, between 1 January 1994 and 31 December 2010, obtained residency permits in Denmark, were included and matched on age and sex with Danish-born girls (n = 19 584). Personal identification numbers were cross-linked to the National...... Danish Health Service Register, identifying all contacts for HPV-immunization in both the ordinary HPV-immunization program and in a catch-up program. We applied logistic regression to estimate the odds ratios (OR) of uptake. We found that refugee girls had significantly lower HPV-immunization uptake...

  3. Shifts in Host Mucosal Innate Immune Function Are Associated with Ruminal Microbial Succession in Supplemental Feeding and Grazing Goats at Different Ages

    Directory of Open Access Journals (Sweden)

    Jinzhen Jiao

    2017-08-01

    Full Text Available Gastrointestinal microbiota may play an important role in regulating host mucosal innate immune function. This study was conducted to test the hypothesis that age (non-rumination, transition and rumination and feeding type [Supplemental feeding (S vs. Grazing (G] could alter ruminal microbial diversity and maturation of host mucosal innate immune system in goat kids. MiSeq sequencing was applied to investigate ruminal microbial composition and diversity, and RT-PCR was used to test expression of immune-related genes in ruminal mucosa. Results showed that higher (P < 0.05 relative abundances of Prevotella, Butyrivibrio, Pseudobutyrivibrio, Methanobrevibacter.gottschalkii, Neocallimastix, Anoplodinium–Diplodinium, and Polyplastron, and lower relative abundance of Methanosphaera (P = 0.042 were detected in the rumen of S kids when compared to those in G kids. The expression of genes encoding TLRs, IL1α, IL1β and TICAM2 was down-regulated (P < 0.01, while expression of genes encoding tight junction proteins was up-regulated (P < 0.05 in the ruminal mucosa of S kids when compared to that in G kids. Moreover, irrespective of feeding type, relative abundances of ruminal Prevotella, Fibrobacter, Ruminococcus, Butyrivibrio, Methanobrevibacter, Neocallimastix, and Entodinium increased with age. The expression of most genes encoding TLRs and cytokines increased (P < 0.05 from day 0 to 7, while expression of genes encoding tight junction proteins declined with age (P < 0.05. This study revealed that the composition of each microbial domain changed as animals grew, and these changes might be associated with variations in host mucosal innate immune function. Moreover, supplementing goat kids with concentrate could modulate ruminal microbial composition, enhance barrier function and decrease local inflammation. The findings provide useful information in interpreting microbiota and host interactions, and developing nutritional strategies to improve the

  4. Integrated Circuit Immunity

    Science.gov (United States)

    Sketoe, J. G.; Clark, Anthony

    2000-01-01

    This paper presents a DOD E3 program overview on integrated circuit immunity. The topics include: 1) EMI Immunity Testing; 2) Threshold Definition; 3) Bias Tee Function; 4) Bias Tee Calibration Set-Up; 5) EDM Test Figure; 6) EMI Immunity Levels; 7) NAND vs. and Gate Immunity; 8) TTL vs. LS Immunity Levels; 9) TP vs. OC Immunity Levels; 10) 7805 Volt Reg Immunity; and 11) Seventies Chip Set. This paper is presented in viewgraph form.

  5. Immune function genes CD99L2, JARID2 and TPO show association with autism spectrum disorder

    Directory of Open Access Journals (Sweden)

    Ramos Paula S

    2012-06-01

    Full Text Available Abstract Background A growing number of clinical and basic research studies have implicated immunological abnormalities as being associated with and potentially responsible for the cognitive and behavioral deficits seen in autism spectrum disorder (ASD children. Here we test the hypothesis that immune-related gene loci are associated with ASD. Findings We identified 2,012 genes of known immune-function via Ingenuity Pathway Analysis. Family-based tests of association were computed on the 22,904 single nucleotide polymorphisms (SNPs from the 2,012 immune-related genes on 1,510 trios available at the Autism Genetic Resource Exchange (AGRE repository. Several SNPs in immune-related genes remained statistically significantly associated with ASD after adjusting for multiple comparisons. Specifically, we observed significant associations in the CD99 molecule-like 2 region (CD99L2, rs11796490, P = 4.01 × 10-06, OR = 0.68 (0.58-0.80, in the jumonji AT rich interactive domain 2 (JARID2 gene (rs13193457, P = 2.71 × 10-06, OR = 0.61 (0.49-0.75, and in the thyroid peroxidase gene (TPO (rs1514687, P = 5.72 × 10-06, OR = 1.46 (1.24-1.72. Conclusions This study suggests that despite the lack of a general enrichment of SNPs in immune function genes in ASD children, several novel genes with known immune functions are associated with ASD.

  6. Reproduction Alters Hydration State but Does Not Impact the Positive Effects of Dehydration on Innate Immune Function in Children's Pythons (Antaresia childreni).

    Science.gov (United States)

    Brusch, George A; Billy, Gopal; Blattman, Joseph N; DeNardo, Dale F

    Resource availability can impact immune function, with the majority of studies of such influences focusing on the allocation of energy investment into immune versus other physiological functions. When energy is a limited resource, performance trade-offs can result, compromising immunity. Dehydration is also considered a physiological challenge resulting from the limitation of a vital resource, yet previous research has found a positive relationship between dehydration and innate immune performance. However, these studies did not examine the effects of dehydration on immunity when there was another concurrent, substantial physiological challenge. Thus, we examined the impact of reproduction and water deprivation, individually and in combination, on immune performance in Children's pythons (Antaresia childreni). We collected blood samples from free-ranging A. childreni to evaluate osmolality and innate immune function (lysis, agglutination, bacterial growth inhibition) during the austral dry season, when water availability is limited and this species is typically reproducing. To examine how reproduction and water imbalance, both separately and combined, impact immune function, we used a laboratory-based 2 × 2 experiment. Our results demonstrate that A. childreni experience significant dehydration during the dry season and that, overall, osmolality, regardless of the underlying cause (seasonal rainfall, water deprivation, or reproduction), is positively correlated with increased innate immune performance.

  7. Gap junctions in cells of the immune system: structure, regulation and possible functional roles

    Directory of Open Access Journals (Sweden)

    J.C. Sáez

    2000-04-01

    Full Text Available Gap junction channels are sites of cytoplasmic communication between contacting cells. In vertebrates, they consist of protein subunits denoted connexins (Cxs which are encoded by a gene family. According to their Cx composition, gap junction channels show different gating and permeability properties that define which ions and small molecules permeate them. Differences in Cx primary sequences suggest that channels composed of different Cxs are regulated differentially by intracellular pathways under specific physiological conditions. Functional roles of gap junction channels could be defined by the relative importance of permeant substances, resulting in coordination of electrical and/or metabolic cellular responses. Cells of the native and specific immune systems establish transient homo- and heterocellular contacts at various steps of the immune response. Morphological and functional studies reported during the last three decades have revealed that many intercellular contacts between cells in the immune response present gap junctions or "gap junction-like" structures. Partial characterization of the molecular composition of some of these plasma membrane structures and regulatory mechanisms that control them have been published recently. Studies designed to elucidate their physiological roles suggest that they might permit coordination of cellular events which favor the effective and timely response of the immune system.

  8. Power of tests for comparing trend curves with application to national immunization survey (NIS).

    Science.gov (United States)

    Zhao, Zhen

    2011-02-28

    To develop statistical tests for comparing trend curves of study outcomes between two socio-demographic strata across consecutive time points, and compare statistical power of the proposed tests under different trend curves data, three statistical tests were proposed. For large sample size with independent normal assumption among strata and across consecutive time points, the Z and Chi-square test statistics were developed, which are functions of outcome estimates and the standard errors at each of the study time points for the two strata. For small sample size with independent normal assumption, the F-test statistic was generated, which is a function of sample size of the two strata and estimated parameters across study period. If two trend curves are approximately parallel, the power of Z-test is consistently higher than that of both Chi-square and F-test. If two trend curves cross at low interaction, the power of Z-test is higher than or equal to the power of both Chi-square and F-test; however, at high interaction, the powers of Chi-square and F-test are higher than that of Z-test. The measurement of interaction of two trend curves was defined. These tests were applied to the comparison of trend curves of vaccination coverage estimates of standard vaccine series with National Immunization Survey (NIS) 2000-2007 data. Copyright © 2011 John Wiley & Sons, Ltd.

  9. Comparative biology of the pentraxin protein family: evolutionarily conserved component of innate immune system.

    Science.gov (United States)

    Armstrong, Peter B

    2015-01-01

    The immune system is based on the actions of the collection of specialized immune defense cells and their secreted proteins and peptides that defend the host against infection by parasites. Parasites are organisms that live part or all of their lives in close physical association with the host and extract nutrients from the host and, by releasing toxins and virulence factors, cause disease with the potential for injury and premature death of that host. Parasites of the metazoa can be viruses, eubacteria, fungi, protozoans, and other metazoans. The immune system operates to kill or eliminate parasites and eliminate or detoxify their toxins and virulence factors. Although some of the elements of immune systems are specific to a particular phylum of metazoans, others show extensive evolutionary conservation, being present in several or all major phyla of the metazoa. The pentraxins display this latter character in their roles in immune defense. Pentraxins have been documented in vertebrates, nonvertebrate chordates, arthropods, and mollusks and may be present in other taxa of metazoans. Presumably the pentraxins appeared early in the evolution of metazoa, prior to their evolutionary divergence in the Precambrian epoch into many phyla present today, and have been preserved for the 542 million years since that explosive evolutionary radiation. The fidelity with which these phyla have preserved the pentraxins suggests that the functions of these proteins are important for survival of the members of these diverse taxa of animals. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Immune functions in crustaceans: lessons from flies

    NARCIS (Netherlands)

    Stet, R.J.M.; Arts, J.A.J.

    2005-01-01

    In recent years insects, notably Drosophila, have emerged as a popular model for studying immune responses to bacterial and fungal pathogens. Due to the availability of the complete genome sequence, genome-wide scans of immune responses have been performed using microarray analyses. These analyses

  11. Inhibition of CXCL12 signaling attenuates the postischemic immune response and improves functional recovery after stroke

    DEFF Research Database (Denmark)

    Ruscher, Karsten; Kuric, Enida; Liu, Yawei

    2013-01-01

    cell-derived factor-1 (CXCL12). To mimic beneficial effects of EE, we studied the impact of inhibiting CXCL12 action on functional recovery after transient MCAO (tMCAO). Rats treated with the specific CXCL12 receptor antagonist 1-[4-(1,4,8,11-tetrazacyclotetradec-1-ylmethyl)phenyl]methyl]-1......After stroke, brain inflammation in the ischemic hemisphere hampers brain tissue reorganization and functional recovery. Housing rats in an enriched environment (EE) dramatically improves recovery of lost neurologic functions after experimental stroke. We show here that rats housed in EE after......,4,8,11-tetrazacyclo-tetradecan (AMD3100) showed improved recovery compared with saline-treated rats after tMCAO, without a concomitant reduction in infarct size. This was accompanied by a reduction of infiltrating immune cells in the ischemic hemisphere, particularly cluster of differentiation 3-positive (CD3...

  12. Biliary Innate Immunity: Function and Modulation

    Directory of Open Access Journals (Sweden)

    Kenichi Harada

    2010-01-01

    Full Text Available Biliary innate immunity is involved in the pathogenesis of cholangiopathies in patients with primary biliary cirrhosis (PBC and biliary atresia. Biliary epithelial cells possess an innate immune system consisting of the Toll-like receptor (TLR family and recognize pathogen-associated molecular patterns (PAMPs. Tolerance to bacterial PAMPs such as lipopolysaccharides is also important to maintain homeostasis in the biliary tree, but tolerance to double-stranded RNA (dsRNA is not found. In PBC, CD4-positive Th17 cells characterized by the secretion of IL-17 are implicated in the chronic inflammation of bile ducts and the presence of Th17 cells around bile ducts is causally associated with the biliary innate immune responses to PAMPs. Moreover, a negative regulator of intracellular TLR signaling, peroxisome proliferator-activated receptor-γ (PPARγ, is involved in the pathogenesis of cholangitis. Immunosuppression using PPARγ ligands may help to attenuate the bile duct damage in PBC patients. In biliary atresia characterized by a progressive, inflammatory, and sclerosing cholangiopathy, dsRNA viruses are speculated to be an etiological agent and to directly induce enhanced biliary apoptosis via the expression of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL. Moreover, the epithelial-mesenchymal transition (EMT of biliary epithelial cells is also evoked by the biliary innate immune response to dsRNA.

  13. Novel immune-modulator identified by a rapid, functional screen of the parapoxvirus ovis (Orf virus genome

    Directory of Open Access Journals (Sweden)

    McGuire Michael J

    2012-01-01

    Full Text Available Abstract Background The success of new sequencing technologies and informatic methods for identifying genes has made establishing gene product function a critical rate limiting step in progressing the molecular sciences. We present a method to functionally mine genomes for useful activities in vivo, using an unusual property of a member of the poxvirus family to demonstrate this screening approach. Results The genome of Parapoxvirus ovis (Orf virus was sequenced, annotated, and then used to PCR-amplify its open-reading-frames. Employing a cloning-independent protocol, a viral expression-library was rapidly built and arrayed into sub-library pools. These were directly delivered into mice as expressible cassettes and assayed for an immune-modulating activity associated with parapoxvirus infection. The product of the B2L gene, a homolog of vaccinia F13L, was identified as the factor eliciting immune cell accumulation at sites of skin inoculation. Administration of purified B2 protein also elicited immune cell accumulation activity, and additionally was found to serve as an adjuvant for antigen-specific responses. Co-delivery of the B2L gene with an influenza gene-vaccine significantly improved protection in mice. Furthermore, delivery of the B2L expression construct, without antigen, non-specifically reduced tumor growth in murine models of cancer. Conclusion A streamlined, functional approach to genome-wide screening of a biological activity in vivo is presented. Its application to screening in mice for an immune activity elicited by the pathogen genome of Parapoxvirus ovis yielded a novel immunomodulator. In this inverted discovery method, it was possible to identify the adjuvant responsible for a function of interest prior to a mechanistic study of the adjuvant. The non-specific immune activity of this modulator, B2, is similar to that associated with administration of inactivated particles to a host or to a live viral infection. Administration

  14. Comparative Assessment of Induced Immune Responses Following Intramuscular Immunization with Fusion and Cocktail of LeIF, LACK and TSA Genes Against Cutaneous Leishmaniasis in BALB/c Mice.

    Science.gov (United States)

    Maspi, Nahid; Ghaffarifar, Fatemeh; Sharifi, Zohreh; Dalimi, Abdolhossein; Dayer, Mohammad Saaid

    2018-02-01

    In the present study, we evaluated induced immune responses following DNA vaccine containing cocktail or fusion of LeIF, LACK and TSA genes or each gene alone. Mice were injected with 100 µg of each plasmid containing the gene of insert, plasmid DNA alone as the first control group or phosphate buffer saline as the second control group. Then, cellular and humoral responses, lesion size were measured for all groups. All vaccinated mice induced Th1 immune responses against Leishmania characterized by higher IFN-γ and IgG2a levels compared with control groups (p < 0.05). In addition, IFN-γ levels increased in groups immunized with fusion and cocktail vaccines in comparison with LACK (p < 0.001) and LeIF (p < 0.01) groups after challenge. In addition, fusion and cocktail groups produced higher IgG2a values than groups vaccinated with a gene alone (p < 0.05). Lesion progression delayed for all immunized groups compared with control groups from 5th week post-infection (p < 0.05). Mean lesion size decreased in immunized mice with fusion DNA than three groups vaccinated with one gene alone (p < 0.05). While, lesion size decreased significantly in cocktail recipient group than LeIF recipient group (p < 0.05). There was no difference in lesion size between fusion and cocktail groups. Overall, immunized mice with cocktail and fusion vaccines showed stronger Th1 response by production of higher IFN-γ and IgG2a and showed smaller mean lesion size. Therefore, use of multiple antigens can improve induced immune responses by DNA vaccination.

  15. A Functional Toll-Interacting Protein Variant Is Associated with Bacillus Calmette-Guérin-Specific Immune Responses and Tuberculosis.

    Science.gov (United States)

    Shah, Javeed A; Musvosvi, Munyaradzi; Shey, Muki; Horne, David J; Wells, Richard D; Peterson, Glenna J; Cox, Jeffery S; Daya, Michelle; Hoal, Eileen G; Lin, Lin; Gottardo, Raphael; Hanekom, Willem A; Scriba, Thomas J; Hatherill, Mark; Hawn, Thomas R

    2017-08-15

    The molecular mechanisms that regulate tuberculosis susceptibility and bacillus Calmette-Guérin (BCG)-induced immunity are mostly unknown. However, induction of the adaptive immune response is a critical step in host control of Mycobacterium tuberculosis. Toll-interacting protein (TOLLIP) is a ubiquitin-binding protein that regulates innate immune responses, including Toll-like receptor signaling, which initiate adaptive immunity. TOLLIP variation is associated with susceptibility to tuberculosis, but the mechanism by which it regulates tuberculosis immunity is poorly understood. To identify functional TOLLIP variants and evaluate the role of TOLLIP variation on innate and adaptive immune responses to mycobacteria and susceptibility to tuberculosis. We used human cellular immunology approaches to characterize the role of a functional TOLLIP variant on monocyte mRNA expression and M. tuberculosis-induced monocyte immune functions. We also examined the association of TOLLIP variation with BCG-induced T-cell responses and susceptibility to latent tuberculosis infection. We identified a functional TOLLIP promoter region single-nucleotide polymorphism, rs5743854, which was associated with decreased TOLLIP mRNA expression in infant monocytes. After M. tuberculosis infection, TOLLIP-deficient monocytes demonstrated increased IL-6, increased nitrite, and decreased bacterial replication. The TOLLIP-deficiency G/G genotype was associated with decreased BCG-specific IL-2 + CD4 + T-cell frequency and proliferation. This genotype was also associated with increased susceptibility to latent tuberculosis infection. TOLLIP deficiency is associated with decreased BCG-specific T-cell responses and increased susceptibility to tuberculosis. We hypothesize that the heightened antibacterial monocyte responses after vaccination of TOLLIP-deficient infants are responsible for decreased BCG-specific T-cell responses. Activating TOLLIP may provide a novel adjuvant strategy for BCG

  16. A biocultural perspective on fictive kinship in the Andes: social support and women's immune function in El Alto, Bolivia.

    Science.gov (United States)

    Hicks, Kathryn

    2014-09-01

    This article examines the influence of emotional and instrumental support on women's immune function, a biomarker of stress, in the city of El Alto, Bolivia. It tests the prediction that instrumental support is protective of immune function for women living in this marginal environment. Qualitative and quantitative ethnographic methods were employed to assess perceived emotional and instrumental support and common sources of support; multiple linear regression analysis was used to model the relationship between social support and antibodies to the Epstein-Barr virus. These analyses provided no evidence that instrumental social support is related to women's health, but there is some evidence that emotional support from compadres helps protect immune function. © 2014 by the American Anthropological Association.

  17. Immune System Dysfunction in the Elderly.

    Science.gov (United States)

    Fuentes, Eduardo; Fuentes, Manuel; Alarcón, Marcelo; Palomo, Iván

    2017-01-01

    Human aging is characterized by both physical and physiological frailty that profoundly affects the immune system. In this context aging is associated with declines in adaptive and innate immunity established as immunosenescence. Immunosenescence is a new concept that reflects the age-associated restructuring changes of innate and adaptive immune functions. Thus elderly individuals usually present chronic low-level inflammation, higher infection rates and chronic diseases. A study of alterations in the immune system during aging could provide a potentially useful biomarker for the evaluation of immune senescence treatment. The immune system is the result of the interplay between innate and adaptive immunity, yet the impact of aging on this function is unclear. In this article the function of the immune system during aging is explored.

  18. Effects of treated sewage effluent on immune function in rainbow trout (Oncorhynchus mykiss)

    Energy Technology Data Exchange (ETDEWEB)

    Hoeger, Birgit [Environmental Toxicology, University of Konstanz, P.O. Box X918, D-78457 Constance (Germany); Heuvel, Michael R. van den [Forest Research, Private Bag 3020, Sala St., Rotorua (New Zealand); Hitzfeld, Bettina C. [Swiss Agency for the Environment, Forests and Landscape (SAEFL), Substances, Soil, Biotechnology Division, Section Substances, 3003 Bern (Switzerland); Dietrich, Daniel R. [Environmental Toxicology, University of Konstanz, P.O. Box X918, D-78457 Constance (Germany)]. E-mail: daniel.dietrich@uni-konstanz.de

    2004-12-20

    In this study, the immune reactions of rainbow trout (Oncorhynchus mykiss) were examined, after exposure to 10, 30 and 70% of tertiary-treated municipal sewage effluent for 27 days. Exposures were conducted concurrently with and without an immune challenge using intraperitoneal injections of inactivated Aeromonas salmonicida salmonicida. Due to the time required to prepare and analyse samples, fish sampling was conducted over two consecutive days. There was no trout mortality for any of the experimental treatments. The exposure to effluent increased in vitro lymphocyte proliferation, decreased circulating lymphocytes and increased degrading erythrocytes in peripheral blood samples. Circulating lymphocytes were only decreased in the sham-injected, but not in the A. salmonicida-injected group. In addition to effluent effects, circulating lymphocytes and lymphocyte proliferation were decreased on day 2 of sampling as compared to day 1. Concentration-dependent degradation of erythrocytes was only observed on day 2 of sampling. Capture and removal of trout on day 1 of sampling presumably caused low-level stress that affected some results on day 2. Oxidative burst, phagocytosis, lysozyme, leucocyte populations other than lymphocytes and A. salmonicida-specific IgM production were not affected by exposure to effluent, and of these parameters, only oxidative burst and total leucocytes showed sampling day effects. From these results it can be observed, that with the exception of oxidative burst, those variables affected by effluent exposure were also significantly changed by the low-level sampling stress imposed by staggered sampling. Elevated liver mixed-function oxygenase activity as measured by 7-ethoxyresorufin-O-deethylase activity, and increased bile polycyclic aromatic hydrocarbon (PAH) metabolites were observed in response to sewage effluent exposure. As both PAHs and stress are known immune suppressors, it is difficult to conclude whether or not changes in immune

  19. Effects of treated sewage effluent on immune function in rainbow trout (Oncorhynchus mykiss)

    International Nuclear Information System (INIS)

    Hoeger, Birgit; Heuvel, Michael R. van den; Hitzfeld, Bettina C.; Dietrich, Daniel R.

    2004-01-01

    In this study, the immune reactions of rainbow trout (Oncorhynchus mykiss) were examined, after exposure to 10, 30 and 70% of tertiary-treated municipal sewage effluent for 27 days. Exposures were conducted concurrently with and without an immune challenge using intraperitoneal injections of inactivated Aeromonas salmonicida salmonicida. Due to the time required to prepare and analyse samples, fish sampling was conducted over two consecutive days. There was no trout mortality for any of the experimental treatments. The exposure to effluent increased in vitro lymphocyte proliferation, decreased circulating lymphocytes and increased degrading erythrocytes in peripheral blood samples. Circulating lymphocytes were only decreased in the sham-injected, but not in the A. salmonicida-injected group. In addition to effluent effects, circulating lymphocytes and lymphocyte proliferation were decreased on day 2 of sampling as compared to day 1. Concentration-dependent degradation of erythrocytes was only observed on day 2 of sampling. Capture and removal of trout on day 1 of sampling presumably caused low-level stress that affected some results on day 2. Oxidative burst, phagocytosis, lysozyme, leucocyte populations other than lymphocytes and A. salmonicida-specific IgM production were not affected by exposure to effluent, and of these parameters, only oxidative burst and total leucocytes showed sampling day effects. From these results it can be observed, that with the exception of oxidative burst, those variables affected by effluent exposure were also significantly changed by the low-level sampling stress imposed by staggered sampling. Elevated liver mixed-function oxygenase activity as measured by 7-ethoxyresorufin-O-deethylase activity, and increased bile polycyclic aromatic hydrocarbon (PAH) metabolites were observed in response to sewage effluent exposure. As both PAHs and stress are known immune suppressors, it is difficult to conclude whether or not changes in immune

  20. Identification of genetic loci in Lactobacillus plantarum that modulate the immune response of dendritic cells using comparative genome hybridization.

    Directory of Open Access Journals (Sweden)

    Marjolein Meijerink

    Full Text Available BACKGROUND: Probiotics can be used to stimulate or regulate epithelial and immune cells of the intestinal mucosa and generate beneficial mucosal immunomodulatory effects. Beneficial effects of specific strains of probiotics have been established in the treatment and prevention of various intestinal disorders, including allergic diseases and diarrhea. However, the precise molecular mechanisms and the strain-dependent factors involved are poorly understood. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we aimed to identify gene loci in the model probiotic organism Lactobacillus plantarum WCFS1 that modulate the immune response of host dendritic cells. The amounts of IL-10 and IL-12 secreted by dendritic cells (DCs after stimulation with 42 individual L. plantarum strains were measured and correlated with the strain-specific genomic composition using comparative genome hybridisation and the Random Forest algorithm. This in silico "gene-trait matching" approach led to the identification of eight candidate genes in the L. plantarum genome that might modulate the DC cytokine response to L. plantarum. Six of these genes were involved in bacteriocin production or secretion, one encoded a bile salt hydrolase and one encoded a transcription regulator of which the exact function is unknown. Subsequently, gene deletions mutants were constructed in L. plantarum WCFS1 and compared to the wild-type strain in DC stimulation assays. All three bacteriocin mutants as well as the transcription regulator (lp_2991 had the predicted effect on cytokine production confirming their immunomodulatory effect on the DC response to L. plantarum. Transcriptome analysis and qPCR data showed that transcript level of gtcA3, which is predicted to be involved in glycosylation of cell wall teichoic acids, was substantially increased in the lp_2991 deletion mutant (44 and 29 fold respectively. CONCLUSION: Comparative genome hybridization led to the identification of gene loci in L

  1. Impact of enteral nutrition on postoperative immune function and nutritional status.

    Science.gov (United States)

    Wang, F; Hou, M X; Wu, X L; Bao, L D; Dong, P D

    2015-06-10

    We studied the effects of enteral nutrition (EN) support initiated 1 week before surgery on postoperative nutritional status, immune function, and inflammatory response in gastric cancer patients. A total of 200 gastric cancer patients were randomly divided into two groups: EN starting 1 week before surgery (study group) and EN starting early after surgery (control group). The two groups received EN support, following different therapeutic schedules, until the 9th day after operation. In the patients, body weight, skinfold thickness, upper-arm circumference, white blood cell count, albumin, prealbumin, C-reactive protein, peripheral immunoglobulins (IgA, IgG, and IgM), T lymphocyte subsets, interleukin-6, and tumor necrosis factor-α were measured 10 days before and after surgery and on the first day after surgery. There was no statistically significant difference in the results of recovery time of passage of gas by anus, abdominal distension, stomachache, blood glucose, hepatic and renal functions, and electrolytes between the two groups of patients (P > 0. 05). Adverse reactions occurred to both groups at 1 and 2 days after operation. Such conditions was improved after the intravenous drip rate was adjusted. The albumin and prealbumin levels of the patients in both groups decreased at 1 day after operation (P gastric cancer patients can improve their postoperative nutritional status and immune function, can reduce inflammatory response, and is more conducive to the recovery of patients.

  2. Comprehensive Transcriptome Profiling and Functional Analysis of the Frog (Bombina maxima) Immune System

    Science.gov (United States)

    Zhao, Feng; Yan, Chao; Wang, Xuan; Yang, Yang; Wang, Guangyin; Lee, Wenhui; Xiang, Yang; Zhang, Yun

    2014-01-01

    Amphibians occupy a key phylogenetic position in vertebrates and evolution of the immune system. But, the resources of its transcriptome or genome are still little now. Bombina maxima possess strong ability to survival in very harsh environment with a more mature immune system. We obtained a comprehensive transcriptome by RNA-sequencing technology. 14.3% of transcripts were identified to be skin-specific genes, most of which were not isolated from skin secretion in previous works or novel non-coding RNAs. 27.9% of transcripts were mapped into 242 predicted KEGG pathways and 6.16% of transcripts related to human disease and cancer. Of 39 448 transcripts with the coding sequence, at least 1501 transcripts (570 genes) related to the immune system process. The molecules of immune signalling pathway were almost presented, several transcripts with high expression in skin and stomach. Experiments showed that lipopolysaccharide or bacteria challenge stimulated pro-inflammatory cytokine production and activation of pro-inflammatory caspase-1. These frog's data can remarkably expand the existing genome or transcriptome resources of amphibians, especially immunity data. The entity of the data provides a valuable platform for further investigation on more detailed immune response in B. maxima and a comparative study with other amphibians. PMID:23942912

  3. Cow’s Milk and Immune Function in the Respiratory Tract: Potential Mechanisms

    Directory of Open Access Journals (Sweden)

    Olaf Perdijk

    2018-02-01

    Full Text Available During the last decades, the world has witnessed a dramatic increase in allergy prevalence. Epidemiological evidence shows that growing up on a farm is a protective factor, which is partly explained by the consumption of raw cow’s milk. Indeed, recent studies show inverse associations between raw cow’s milk consumption in early life and asthma, hay fever, and rhinitis. A similar association of raw cow’s milk consumption with respiratory tract infections is recently found. In line with these findings, controlled studies in infants with milk components such as lactoferrin, milk fat globule membrane, and colostrum IgG have shown to reduce respiratory infections. However, for ethical reasons, it is not possible to conduct controlled studies with raw cow’s milk in infants, so formal proof is lacking to date. Because viral respiratory tract infections and aeroallergen exposure in children may be causally linked to the development of asthma, it is of interest to investigate whether cow’s milk components can modulate human immune function in the respiratory tract and via which mechanisms. Inhaled allergens and viruses trigger local immune responses in the upper airways in both nasal and oral lymphoid tissue. The components present in raw cow’s milk are able to promote a local microenvironment in which mucosal immune responses are modified and the epithelial barrier is enforced. In addition, such responses may also be triggered in the gut after exposure to allergens and viruses in the nasal cavity that become available in the GI tract after swallowing. However, these immune cells that come into contact with cow’s milk components in the gut must recirculate into the blood and home to the (upper and lower respiratory tract to regulate immune responses locally. Expression of the tissue homing-associated markers α4β7 and CCR9 or CCR10 on lymphocytes can be influenced by vitamin A and vitamin D3, respectively. Since both vitamins are present

  4. Heat and immunity: an experimental heat wave alters immune functions in three-spined sticklebacks (Gasterosteus aculeatus).

    Science.gov (United States)

    Dittmar, Janine; Janssen, Hannah; Kuske, Andra; Kurtz, Joachim; Scharsack, Jörn P

    2014-07-01

    Global climate change is predicted to lead to increased temperatures and more extreme climatic events. This may influence host-parasite interactions, immunity and therefore the impact of infectious diseases on ecosystems. However, little is known about the effects of rising temperatures on immune defence, in particular in ectothermic animals, where the immune system is directly exposed to external temperature change. Fish are ideal models for studying the effect of temperature on immunity, because they are poikilothermic, but possess a complete vertebrate immune system with both innate and adaptive immunity. We used three-spined sticklebacks ( Gasterosteus aculeatus) originating from a stream and a pond, whereby the latter supposedly were adapted to higher temperature variation. We studied the effect of increasing and decreasing temperatures and a simulated heat wave with subsequent recovery on body condition and immune parameters. We hypothesized that the immune system might be less active at low temperatures, but will be even more suppressed at temperatures towards the upper tolerable temperature range. Contrary to our expectation, we found innate and adaptive immune activity to be highest at a temperature as low as 13 °C. Exposure to a simulated heat wave induced long-lasting immune disorders, in particular in a stickleback population that might be less adapted to temperature variation in its natural environment. The results show that the activity of the immune system of an ectothermic animal species is temperature dependent and suggest that heat waves associated with global warming may immunocompromise host species, thereby potentially facilitating the spread of infectious diseases. © 2014 The Authors. Journal of Animal Ecology © 2014 British Ecological Society.

  5. Complex multicellular functions at a unicellular eukaryote level: Learning, memory, and immunity.

    Science.gov (United States)

    Csaba, György

    2017-06-01

    According to experimental data, eukaryote unicellulars are able to learn, have immunity and memory. Learning is carried out in a very primitive form, and the memory is not neural but an epigenetic one. However, this epigenetic memory, which is well justified by the presence and manifestation of hormonal imprinting, is strong and permanent in the life of cell and also in its progenies. This memory is epigenetically executed by the alteration and fixation of methylation pattern of genes without changes in base sequences. The immunity of unicellulars is based on self/non-self discrimination, which leads to the destruction of non-self invaders and utilization of them as nourishment (by phagocytosis). The tools of learning, memory, and immunity of unicellulars are uniformly found in plasma membrane receptors, which formed under the effect of dynamic receptor pattern generation, suggested by Koch et al., and this is the basis of hormonal imprinting, by which the encounter between a chemical substance and the cell is specifically memorized. The receptors and imprinting are also used in the later steps of evolution up to mammals (including man) in each mentioned functions. This means that learning, memory, and immunity can be deduced to a unicellular eukaryote level.

  6. 17D yellow fever vaccine elicits comparable long-term immune responses in healthy individuals and immune-compromised patients

    NARCIS (Netherlands)

    Wieten, R. W.; Goorhuis, A.; Jonker, E. F. F.; de Bree, G. J.; de Visser, A. W.; van Genderen, P. J. J.; Remmerswaal, E. B. M.; ten Berge, I. J. M.; Visser, L. G.; Grobusch, M. P.; van Leeuwen, E. M. M.

    2016-01-01

    The 17D live attenuated yellow fever (YF) vaccine is contra-indicated in immune-compromised individuals and may elicit a suboptimal immunologic response. The aim of this study is to assess whether long-term immune responses against the YF vaccine are impaired in immune-compromised patients. Fifteen

  7. Functional and Transcriptomic Characterization of Peritoneal Immune-Modulation by Addition of Alanyl-Glutamine to Dialysis Fluid.

    Science.gov (United States)

    Herzog, Rebecca; Kuster, Lilian; Becker, Julia; Gluexam, Tobias; Pils, Dietmar; Spittler, Andreas; Bhasin, Manoj K; Alper, Seth L; Vychytil, Andreas; Aufricht, Christoph; Kratochwill, Klaus

    2017-07-24

    Peritonitis remains a major cause of morbidity and mortality during chronic peritoneal dialysis (PD). Glucose-based PD fluids reduce immunological defenses in the peritoneal cavity. Low concentrations of peritoneal extracellular glutamine during PD may contribute to this immune deficit. For these reasons we have developed a clinical assay to measure the function of the immune-competent cells in PD effluent from PD patients. We then applied this assay to test the impact on peritoneal immune-competence of PD fluid supplementation with alanyl-glutamine (AlaGln) in 6 patients in an open-label, randomized, crossover pilot trial (EudraCT 2012-004004-36), and related the functional results to transcriptome changes in PD effluent cells. Ex-vivo stimulation of PD effluent peritoneal cells increased release of interleukin (IL) 6 and tumor necrosis factor (TNF) α. Both IL-6 and TNF-α were lower at 1 h than at 4 h of the peritoneal equilibration test but the reductions in cytokine release were attenuated in AlaGln-supplemented samples. AlaGln-supplemented samples exhibited priming of IL-6-related pathways and downregulation of TNF-α upstream elements. Results from measurement of cytokine release and transcriptome analysis in this pilot clinical study support the conclusion that suppression of PD effluent cell immune function in human subjects by standard PD fluid is attenuated by AlaGln supplementation.

  8. Comparative assessment of immunization procedures for development of anti proinsulin antisera for radioimmunoassay

    International Nuclear Information System (INIS)

    Nascimento, M. do; Borghi, V.C.; Bellini, M.H.; Mesquita, C.H.; Wajchenberg, B.L.

    1992-08-01

    Two schedules of immunization were employed for developing anti proinsulin antisera for radioimmunoassay. Biosynthetic human proinsulin-h P I (Elli Lilly. US), was injected subcutaneously in guinea pigs in multiple sites. In the first schedule were used 50 u g of h P I and the booster injections were administered 4 weeks after the primary immunization and then at 3-week intervals. In the second schedule was used 250 u g of h P I and boosters were done 7, 9 and 18 weeks later. As the antisera were not sufficiently specific for h P I they were purified and assessed for kinetic of precipitation and avidity. Both immunization schedules gave comparable responses. The antisera generated by the use of 50 u g of h P I presented higher cross-reactivity with insulin while the reactivity with c p eptide was of the same order in both antiserum groups. The avidity was very variable in the two groups and the three most sensitive antisera required 24 h at 4 o C for achieving maximum binding with the 125 I-h P I. However, only one antiserum (from the first group) was suitable for the radioimmunoassay. This study emphasizes the difficulties of making valid comparisons between different immunization procedures, especially in the cases when highest avidity is required. (author)

  9. Nutritional components regulate the gut immune system and its association with intestinal immune disease development.

    Science.gov (United States)

    Lamichhane, Aayam; Kiyono, Hiroshi; Kunisawa, Jun

    2013-12-01

    The gut is equipped with a unique immune system for maintaining immunological homeostasis, and its functional immune disruption can result in the development of immune diseases such as food allergy and intestinal inflammation. Accumulating evidence has demonstrated that nutritional components play an important role in the regulation of gut immune responses and also in the development of intestinal immune diseases. In this review, we focus on the immunological functions of lipids, vitamins, and nucleotides in the regulation of the intestinal immune system and as potential targets for the control of intestinal immune diseases. © 2013 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

  10. Clinical value of Pro-GRP and T lymphocyte subpopulation for the assessment of immune functions of lung cancer patients after DC-CIK biological therapy.

    Science.gov (United States)

    He, Lijie; Wang, Jing; Chang, Dandan; Lv, Dandan; Li, Haina; Zhang, Heping

    2018-02-01

    The present study investigated the aptness of assessing the levels of progastrin-releasing peptide (Pro-GRP) in addition to the T lymphocyte subpopulation in lung cancer patients prior to and after therapy for determining immune function. A total of 45 patients with lung cancer were recruited and stratified in to a non-small cell lung cancer (NSCLC) and an SCLC group. Prior to and after treatment by combined biological therapy comprising chemotherapy or chemoradiotherapy followed by three cycles of retransformation of autologous dendritic cells-cytokine-induced killer cells (DC-CIK), the peripheral blood was assessed for populations of CD3 + , CD4 + , CD8 + and regulatory T cells (Treg) by flow cytometry, and for the levels of pro-GRP, carcinoembryonic antigen, neuron-specific enolase and Cyfra 21-1. The results revealed that in NSCLC patients, CD8 + T lymphocytes and Treg populations were decreased, and that CD3 + and CD4 + T lymphocytes as well as the CD4 + /CD8 + ratio were increased after therapy; in SCLC patients, CD3 + , CD4 + and CD8 + T lymphocytes were increased, while Treg cells were decreased after treatment compared with those at baseline. In each group, Pro-GRP was decreased compared with that prior to treatment, and in the SCLC group only, an obvious negative correlation was identified between Pro-GRP and the T lymphocyte subpopulation. Furthermore, a significant correlation between Pro-GRP and Tregs was identified in each group. In conclusion, the present study revealed that the immune function of the patients was improved after biological therapy. The results suggested a significant correlation between Pro-GRP and the T lymphocyte subpopulation in SCLC patients. Detection of Pro-GRP may assist the early clinical diagnosis of SCLC and may also be used to assess the immune regulatory function of patients along with the T lymphocyte subpopulation. Biological therapy with retransformed autologous DC-CIK was indicated to enhance the specific elimination

  11. Leptin as immune mediator: Interaction between neuroendocrine and immune system.

    Science.gov (United States)

    Procaccini, Claudio; La Rocca, Claudia; Carbone, Fortunata; De Rosa, Veronica; Galgani, Mario; Matarese, Giuseppe

    2017-01-01

    Leptin is an adipocyte-derived hormone/cytokine that links nutritional status with neuroendocrine and immune functions. Initially described as an anti-obesity hormone, leptin has subsequently been shown to exert pleiotropic effects, being also able to influence haematopoiesis, thermogenesis, reproduction, angiogenesis, and more importantly immune homeostasis. As a cytokine, leptin can affect both innate and adaptive immunity, by inducing a pro-inflammatory response and thus playing a key role in the regulation of the pathogenesis of several autoimmune/inflammatory diseases. In this review, we discuss the most recent advances on the role of leptin as immune-modulator in mammals and we also provide an overview on its main functions in non-mammalian vertebrates. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Exploiting immune cell metabolic machinery for functional HIV cure and the prevention of inflammaging [version 1; referees: 4 approved

    OpenAIRE

    Clovis S. Palmer; Riya Palchaudhuri; Hassan Albargy; Mohamed Abdel-Mohsen; Suzanne M. Crowe

    2018-01-01

    An emerging paradigm in immunology suggests that metabolic reprogramming and immune cell activation and functions are intricately linked. Viral infections, such as HIV infection, as well as cancer force immune cells to undergo major metabolic challenges. Cells must divert energy resources in order to mount an effective immune response. However, the fact that immune cells adopt specific metabolic programs to provide host defense against intracellular pathogens and how this metabolic shift impa...

  13. Immune responses at brain barriers and implications for brain development and neurological function in later life

    Directory of Open Access Journals (Sweden)

    Helen B. Stolp

    2013-08-01

    Full Text Available For a long time the brain has been considered an immune-privileged site due to a muted inflammatory response and the presence of protective brain barriers. It is now recognised that neuroinflammation may play an important role in almost all neurological disorders and that the brain barriers may be contributing through either normal immune signalling, or disruption of their basic physiological mechanisms. The distinction between normal function and dysfunction at the barriers is difficult to dissect, partly due to a lack of understanding of normal barrier function and partly because of physiological changes that occur as part of normal development and ageing. Brain barriers consist of a number of interacting structural and physiological elements including tight junctions between adjacent barrier cells and an array of influx and efflux transporters. Despite these protective mechanisms, the capacity for immune-surveillance of the brain is maintained, and there is evidence of inflammatory signalling at the brain barriers that may be an important part of the body’s response to damage or infection. This signalling system appears to change both with normal ageing, and during disease. Changes may affect diapedesis of immune cells and active molecular transfer, or cause rearrangement of the tight junctions and an increase in passive permeability across barrier interfaces. Here we review the many elements that contribute to brain barrier functions and how they respond to inflammation, particularly during development and aging. The implications of inflammation–induced barrier dysfunction for brain development and subsequent neurological function are also discussed.

  14. Indices of immune function used by ecologists are mostly unaffected by repeated freeze-thaw cycles and methodological deviations

    NARCIS (Netherlands)

    Hegemann, Arne; Pardal, Sara; Matson, Kevin D.

    2017-01-01

    Background
    Over the past couple of decades, measuring immunological parameters has become widespread in studies of ecology and evolution. A combination of different immunological indices is useful for quantifying different parts of the immune system and comprehensively assessing immune function.

  15. Functional disorders of T-cell immunity at persons engaged in the Chernobyl emergency operations in a 10 years after the accident

    International Nuclear Information System (INIS)

    Potapnev, M.P.; Kuz'menok, O.I.; Potapova, S.M.; Smol'nikova, V.V.; Myslitskj, V.F.; Rzheutskij, V.A.; Vaslevskaya, T.A.; Vasyukhina, L.V.

    1998-01-01

    Functional disorders of T-cell immunity in persons engaged in Chernobyl emergency operations - 10 years after the accident. The results evaluating T-cell immunity of 148 liquidators of Chernobyl accident are presented. It was estimated that 10 years after the accident immuno phenotyping of peripheral blood lymphocytes did not reveal marked disturbance in lymphocyte subpopulation content in exposed group as compared with healthy control. Determination of cell proliferation in vitro indicated the decrease in DNA synthesis of T-lymphocytes stimulated with optimal and particularly suboptimal concentrations of polyclonal T-cell activators. Based on individual deviation of the results of T-lymphocyte proliferation the groups with high and low level of response were sorted out for future examination

  16. Impact of pharmacists providing immunizations on adolescent influenza immunization.

    Science.gov (United States)

    Robison, Steve G

    2016-01-01

    To determine if the Oregon law change in 2011 to allow pharmacists to immunize adolescents 11 to 17 years of age increased influenza immunizations or changed existing immunization venues. With the use of Oregon's ALERT Immunization Information System (IIS), 2 measures of impact were developed. First, the change in adolescent age 11-17 influenza immunizations before (2007-2010) and after (2011-2014) the pharmacy law change was evaluated against a reference cohort (aged 7-10) not affected by the law. Community pharmacies were also compared with other types of influenza immunization sites within one of the study influenza seasons (2013-2014). From 2007 to 2014, adolescent influenza immunizations at community pharmacies increased from 36 to 6372 per year. After the 2011 pharmacy law change, adolescents aged 11 to 17 were more likely to receive an influenza immunization compared with the reference population (odds ratio, 1.21; 95% CI, 1.19-1.22). Analysis of the 2013-2014 influenza season suggests that community pharmacies immunized a different population of adolescents than other providers. The 2011 change in Oregon law allowed pharmacists to increase the total of influenza immunizations given to adolescents. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  17. Immune function surveillance: association with rejection, infection and cardiac allograft vasculopathy.

    Science.gov (United States)

    Heikal, N M; Bader, F M; Martins, T B; Pavlov, I Y; Wilson, A R; Barakat, M; Stehlik, J; Kfoury, A G; Gilbert, E M; Delgado, J C; Hill, H R

    2013-01-01

    Rejection, cardiac allograft vasculopathy (CAV), and infection are significant causes of mortality in heart transplantation recipients. Assessing the immune status of a particular patient remains challenging. Although endomyocardial biopsy (EMB) and angiography are effective for the identification of rejection and CAV, respectively, these are expensive, invasive, and may have numerous complications. The aim of this study was to evaluate the immune function and assess its utility in predicting rejection, CAV, and infection in heart transplantation recipients. We prospectively obtained samples at the time of routine EMB and when clinically indicated for measurement of the ImmuKnow assay (IM), 12 cytokines and soluble CD30 (sCD30). EMB specimens were evaluated for acute cellular rejection, and antibody-mediated rejection (AMR). CAV was diagnosed by the development of angiographic coronary artery disease. Infectious episodes occurring during the next 30 days after testing were identified by the presence of positive bacterial or fungal cultures and/or viremia that prompted treatment with antimicrobials. We collected 162 samples from 56 cardiac transplant recipients. There were 31 infection episodes, 7 AMR, and 4 CAV cases. The average IM value was significantly lower during infection, (P = .04). Soluble CD30 concentrations showed significantly positive correlation with infection episodes, (P = .001). Significant positive correlation was observed between interleukin-5(IL-5) and AMR episodes (P = .008). Tumor necrosis factor-α and IL-8 showed significant positive correlation with CAV (P = .001). Immune function monitoring appears promising in predicting rejection, CAV, and infection in cardiac transplantation recipients. This approach may help in more individualized immunosuppression and it may also minimize unnecessary EMBs and cardiac angiographies. Published by Elsevier Inc.

  18. A cascade reaction network mimicking the basic functional steps of acquired immune response

    Science.gov (United States)

    Han, Da; Wu, Cuichen; You, Mingxu; Zhang, Tao; Wan, Shuo; Chen, Tao; Qiu, Liping; Zheng, Zheng; Liang, Hao; Tan, Weihong

    2015-01-01

    Biological systems use complex ‘information processing cores’ composed of molecular networks to coordinate their external environment and internal states. An example of this is the acquired, or adaptive, immune system (AIS), which is composed of both humoral and cell-mediated components. Here we report the step-by-step construction of a prototype mimic of the AIS which we call Adaptive Immune Response Simulator (AIRS). DNA and enzymes are used as simple artificial analogues of the components of the AIS to create a system which responds to specific molecular stimuli in vitro. We show that this network of reactions can function in a manner which is superficially similar to the most basic responses of the vertebrate acquired immune system, including reaction sequences that mimic both humoral and cellular responses. As such, AIRS provides guidelines for the design and engineering of artificial reaction networks and molecular devices. PMID:26391084

  19. The Mucosal Immune Function Is Not Compromised during a Period of High-Intensity Interval Training. Is It Time to Reconsider an Old Assumption?

    Science.gov (United States)

    Born, Dennis-Peter; Zinner, Christoph; Sperlich, Billy

    2017-01-01

    Purpose: The aim of the study was to evaluate the mucosal immune function and circadian variation of salivary cortisol, Immunoglobin-A (sIgA) secretion rate and mood during a period of high-intensity interval training (HIIT) compared to long-slow distance training (LSD). Methods: Recreational male runners (n = 28) completed nine sessions of either HIIT or LSD within 3 weeks. The HIIT involved 4 × 4 min of running at 90–95% of maximum heart rate interspersed with 3 min of active recovery while the LSD comprised of continuous running at 70–75% of maximum heart rate for 60–80 min. The psycho-immunological stress-response was investigated with a full daily profile of salivary cortisol and immunoglobin-A (sIgA) secretion rate along with the mood state on a baseline day, the first and last day of training and at follow-up 4 days after the last day of training. Before and after the training period, each athlete's running performance and peak oxygen uptake (V·O2peak) was determined with an incremental exercise test. Results: The HIIT resulted in a longer time-to-exhaustion (P = 0.02) and increased V·O2peak compared to LSD (P = 0.01). The circadian variation of sIgA secretion rate showed highest values in the morning immediately after waking up followed by a decrease throughout the day in both groups (P HIIT, the wake-up response of sIgA secretion rate was higher on the last day of training (P HIIT and LSD (P HIIT indicates no compromised mucosal immune function compared to LSD and shows the functional adaptation of the mucosal immune system in response to the increased stress and training load of nine sessions of HIIT. PMID:28744226

  20. Immune System

    Science.gov (United States)

    A properly functioning immune system is essential to good health. It defends the body against infectious agents and in some cases tumor cells. Individuals with immune deficiencies resulting from genetic defects, diseases (e.g., AIDS, leukemia), or drug therapies are more suscepti...

  1. Restoration of the immune functions in aged mice by supplementation with a new herbal composition, HemoHIM.

    Science.gov (United States)

    Park, Hae-Ran; Jo, Sung-Kee; Jung, Uhee; Yee, Sung-Tae

    2008-01-01

    The effect of a new herbal composition, HemoHIM, on immune functions was examined in aged mice, in which various immune responses had been impaired. The composition HemoHIM was prepared by adding the ethanol-insoluble fraction to the total water extract of a mixture of three edible herbs, Angelica Radix, Cnidium Rhizoma and Paeonia Radix. Supplementation to the aged mice with HemoHIM restored the proliferative response and cytokine production of splenocytes with a response to ConA. Also, HemoHIM recovered the NK cell activity which had been impaired in the aged mice. Meanwhile aging is known to reduce the Th1-like function, but not the Th2-like function, resulting in a Th1/Th2 imbalance. HemoHIM restored the Th1/Th2 balance in the aged mice through enhanced IFN-gamma and IgG2a production, and conversely a reduced IL-4 and IgG1 production. It was found that one factor for the Th1/Th2 imbalance in the aged mice was a lower production of IL-12p70. However, HemoHIM restored the IL-12p70 production in the aged mice. These results suggested that HemoHIM was effective for the restoration of impaired immune functions of the aged mice and therefore could be a good recommendation for immune restoration in elderly humans. Copyright (c) 2007 John Wiley & Sons, Ltd.

  2. Effects of zinc-methionine on growth performance, intestinal flora and immune function in pigeon squabs.

    Science.gov (United States)

    Wang, Y; Yi, L; Zhao, M L; Wu, J Q; Wang, M Y; Cheng, X C

    2014-01-01

    1. Different concentrations of zinc-methionine (Zn-Met) were given to pigeon squabs, and the resulting effects on growth, immune functions and intestinal microflora were investigated from hatching to 28 d of age. A total of 180 artificially hatched pigeon squabs were randomly allotted to each of three treatments with three replicates of 20 squabs. The three treatments given were either one ml (2 mg/ml) Zn-Met, one ml (10 mg/ml) Zn-Met or one ml 0.9% NaCl solution. 2. The results showed that Zn-Met improved the growth performance of squabs. The average daily and average weekly weight gain was significantly greater in squabs treated with Zn-Met than in the control group. 3. The group given 2 and 10 mg supplemental Zn-Met had heavier thymus, spleen and bursa of Fabricius than the control group at d 28. 4. Maternal antibody titres against Newcastle disease haemagglutination inhibition and alpha-naphthyl acetate esterase were significantly higher in squabs treated with supplemental 2 and 10 mg Zn-Met compared to the control group at d 14 and d 28. 5. Additionally, the squabs given supplemental 2 mg Zn-Met exhibited significantly higher Bacillaceae, Lactobacillus, Enterococcus and Bifidobacterium populations at d 14 and d 28, but lower Escherichia coli populations at d 28 compared to the control group. On the contrary, Lactobacillus, Enterococcus and Bifidobacterium populations were significantly decreased with 10 mg Zn-Met at d 28. 6. This study indicates that supplementation with Zn-Met has a positive effect on growth performance, immune function and regulation of intestinal flora in pigeons. An inclusion level of 2 mg seems to be better than 10 mg Zn-Met per day per bird.

  3. Toxicity of cadmium in Japanese quail: Evaluation of body weight, hepatic and renal function, and cellular immune response

    International Nuclear Information System (INIS)

    Sant'Ana, M.G.; Moraes, R.; Bernardi, M.M.

    2005-01-01

    Cadmium (Cd) is an environmental pollutant that is able to alter the immune function. Previous studies have shown that, in mammals, chronic exposure to Cd decreases the release of macrophagic cytokines such as IL1 and TNα and decreases phagocytosis activity. On the other hand contradictory results showed an increase in the humoral response. The cellular response could be decreased by exposure to Cd. These alterations were observed in mammals. The present study aimed to investigate some of the toxic effects of Cd exposure in birds. In particular, the main objective of this work was to elucidate the effects of exposure to this pollutant on the cellular immune function of the Japanese quail as a model for the study of toxicity in animals exposed in nature. The animals were exposed to the metal (100 ppm, per os) during development, i.e., from 1 to 28 days old. Body weight, biochemical parameters, and cellular immune response were measured during and at the end of treatment. The results showed that the exposure to Cd for 28 days significantly reduced the body weight and induced hepatic toxicity. The kidney function and cellular immune response were not affected by the Cd exposure

  4. Functional aspects of the adaptive immune system in arthritis

    NARCIS (Netherlands)

    Jansen, D.T.S.L.

    2017-01-01

    The adaptive immune system is the part of the immune system that is highly specific and generates memory resulting in a fast and specific immune response upon a second infection with the same pathogen. However, when this response is specific for a part of the body itself instead of a pathogen,

  5. Cytokine regulation of immune tolerance

    OpenAIRE

    Wu, Jie; Xie, Aini; Chen, Wenhao

    2014-01-01

    The immune system provides defenses against invading pathogens while maintaining immune tolerance to self-antigens. This immune homeostasis is harmonized by the direct interactions between immune cells and the cytokine environment in which immune cells develop and function. Herein, we discuss three non-redundant paradigms by which cytokines maintain or break immune tolerance. We firstly describe how anti-inflammatory cytokines exert direct inhibitory effects on immune cells to enforce immune ...

  6. Arabidopsis MKS1 is involved in basal immunity and requires an intact N-terminal domain for proper function

    DEFF Research Database (Denmark)

    Petersen, Klaus; Qiu, Jin-Long; Lütje, Juri

    2010-01-01

    Innate immune signaling pathways in animals and plants are regulated by mitogen-activated protein kinase (MAPK) cascades. MAP kinase 4 (MPK4) functions downstream of innate immune receptors via a nuclear substrate MKS1 to regulate the activity of the WRKY33 transcription factor, which in turn...

  7. A Strong Immune Response in Young Adult Honeybees Masks Their Increased Susceptibility to Infection Compared to Older Bees

    Science.gov (United States)

    Bull, James C.; Ryabov, Eugene V.; Prince, Gill; Mead, Andrew; Zhang, Cunjin; Baxter, Laura A.; Pell, Judith K.; Osborne, Juliet L.; Chandler, Dave

    2012-01-01

    Honeybees, Apis mellifera, show age-related division of labor in which young adults perform maintenance (“housekeeping”) tasks inside the colony before switching to outside foraging at approximately 23 days old. Disease resistance is an important feature of honeybee biology, but little is known about the interaction of pathogens and age-related division of labor. We tested a hypothesis that older forager bees and younger “house” bees differ in susceptibility to infection. We coupled an infection bioassay with a functional analysis of gene expression in individual bees using a whole genome microarray. Forager bees treated with the entomopathogenic fungus Metarhizium anisopliae s.l. survived for significantly longer than house bees. This was concomitant with substantial differences in gene expression including genes associated with immune function. In house bees, infection was associated with differential expression of 35 candidate immune genes contrasted with differential expression of only two candidate immune genes in forager bees. For control bees (i.e. not treated with M. anisopliae) the development from the house to the forager stage was associated with differential expression of 49 candidate immune genes, including up-regulation of the antimicrobial peptide gene abaecin, plus major components of the Toll pathway, serine proteases, and serpins. We infer that reduced pathogen susceptibility in forager bees was associated with age-related activation of specific immune system pathways. Our findings contrast with the view that the immunocompetence in social insects declines with the onset of foraging as a result of a trade-off in the allocation of resources for foraging. The up-regulation of immune-related genes in young adult bees in response to M. anisopliae infection was an indicator of disease susceptibility; this also challenges previous research in social insects, in which an elevated immune status has been used as a marker of increased disease

  8. High contaminant loads in Lake Apopka's riparian wetland disrupt gene networks involved in reproduction and immune function in largemouth bass.

    Science.gov (United States)

    Martyniuk, Christopher J; Doperalski, Nicholas J; Prucha, Melinda S; Zhang, Ji-Liang; Kroll, Kevin J; Conrow, Roxanne; Barber, David S; Denslow, Nancy D

    2016-09-01

    Lake Apopka (FL, USA) has elevated levels of some organochlorine pesticides in its sediments and a portion of its watershed has been designated a US Environmental Protection Agency Superfund site. This study assessed reproductive endpoints in Florida largemouth bass (LMB) (Micropterus salmoides floridanus) after placement into experimental ponds adjacent to Lake Apopka. LMB collected from a clean reference site (DeLeon Springs) were stocked at two periods of time into ponds constructed in former farm fields on the north shore of the lake. LMB were stocked during early and late oogenesis to determine if there were different effects of contamination on LMB that may be attributed to their reproductive stage. LMB inhabiting the ponds for ~4months had anywhere from 2 to 800 times higher contaminant load for a number of organochlorine pesticides (e.g. p, p'-DDE, methoxychlor) compared to control animals. Gonadosomatic index and plasma vitellogenin were not different between reproductively-stage matched LMB collected at reference sites compared to those inhabiting the ponds. However, plasma 17β-estradiol was lower in LMB inhabiting the Apopka ponds compared to ovary stage-matched LMB from the St. Johns River, a site used as a reference site. Sub-network enrichment analysis revealed that genes related to reproduction (granulosa function, oocyte development), endocrine function (steroid metabolism, hormone biosynthesis), and immune function (T cell suppression, leukocyte accumulation) were differentially expressed in the ovaries of LMB placed into the ponds. These data suggest that (1) LMB inhabiting the Apopka ponds showed disrupted reproduction and immune responses and that (2) gene expression profiles provided site-specific information by discriminating LMB from different macro-habitats. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Changes in proHB-EGF expression after functional activation of the immune system cells

    Directory of Open Access Journals (Sweden)

    T. O. Chudina

    2017-12-01

    Full Text Available The level of proHB-EGF expression on J774, Raji, KG-1 cells derived from different types of human and mouse immune system cells under the standard in vitro culture conditions and during functional activation of these cells was investigated. Changes in the proHB-EGF expression on the cell surface were found to depend on the density of cell population, the content of fetal bovine serum in the culture medium, the effect of mitogenic factors – bacterial lipopolysaccharide, an inactive full-size form of diphtheria toxin (CRM197 and recombinant soluble HB-EGF – rsHB-EGF. The results obtained are important for the understanding of the functional role of proHB-EGF receptor on the surface of macrophage-like cells and B lymphocytes and indicate the involvement of this receptor in immune response regulation in an organism.

  10. Early Enteral Combined with Parenteral Nutrition Treatment for Severe Traumatic Brain Injury: Effects on Immune Function, Nutritional Status and Outcomes.

    Science.gov (United States)

    Fan, Mingchao; Wang, Qiaoling; Fang, Wei; Jiang, Yunxia; Li, Liandi; Sun, Peng; Wang, Zhihong

    2016-11-20

    Objective To compare the conjoint effect of enteral nutrition (EN) and parenteral nutrition (PN) with single EN or PN on immune function, nutritional status, complications and clinical outcomes of patients with severe traumatic brain injury (STBI). Methods A prospective randomized control trial was carried out from January 2009 to May 2012 in Neurological Intensive Care Unit (NICU). Patients of STBI who met the enrolment criteria (Glasgow Coma Scale score 6~8; Nutritional Risk Screening ≥3) were randomly divided into 3 groups and were admi- nistrated EN, PN or EN+PN treatments respectively. The indexes of nutritional status, immune function, complications and clinical outcomes were examined and compared statistically. Results There were 120 patients enrolled in the study, with 40 pationts in each group. In EN+PN group, T lymthocyte subsets CD3+%, CD4+%, ratio of CD3+/CD25+, ratio of CD4+/CD8+, the plasma levels of IgA, IgM, and IgG at 20 days after nutritional treatment were significantly increased compared to the baseline(t=4.32-30.00, Pnutritional status, the serum total protein, albumin, prealbumin and hemoglobin were significantly higher in the EN (t=5.87-11.91; Pnutrition treatment. The serum prealbumin was higher in EN+PN group than that in EN group (t=2.08; Pnutritional status, decrease complications and improve the clinical outcomes in patients with severe traumatic brain injury.

  11. PCSK9 at the crossroad of cholesterol metabolism and immune function during infections.

    Science.gov (United States)

    Paciullo, Francesco; Fallarino, Francesca; Bianconi, Vanessa; Mannarino, Massimo R; Sahebkar, Amirhossein; Pirro, Matteo

    2017-09-01

    Sepsis, a complex and dynamic syndrome resulting from microbial invasion and immune system dysregulation, is associated with an increased mortality, reaching up to 35% worldwide. Cholesterol metabolism is often disturbed during sepsis, with low plasma cholesterol levels being associated with poor prognosis. Proprotein convertase subtilisin/kexin type 9 (PCSK9) promotes degradation of the low-density lipoprotein receptor (LDLR), thus regulating intracellular and plasma cholesterol levels. PCSK9 is often upregulated during sepsis and might have a detrimental effect on immune host response and survival. Accordingly, PCSK9 reduces lipopolysaccharide uptake and clearance by human hepatocytes. Moreover, PCSK9 upregulation exacerbates organ dysfunction and tissue inflammation during sepsis, whereas a protective effect of PCSK9 deficiency has been documented in septic patients. Although a possible detrimental impact of PCSK9 on survival has been described, some beneficial effects of PCSK9 on immune response may be hypothesized. First, PCSK9 is associated with increased plasma cholesterol levels, which might be protective during sepsis. Second, PCSK9, by stimulating LDLR degradation and inhibiting reverse cholesterol transport (RCT), might promote preferential cholesterol accumulation in macrophages and other immune cells; these events might improve lipid raft composition and augment toll-like receptor function thus supporting inflammatory response. Hence, a more clear definition of the role of PCSK9 in septic states might provide additional insight in the understanding of the sepsis-associated immune dysregulation and enhance therapeutic outcomes. © 2017 Wiley Periodicals, Inc.

  12. Hydrogen-rich Water Exerting a Protective Effect on Ovarian Reserve Function in a Mouse Model of Immune Premature Ovarian Failure Induced by Zona Pellucida 3

    Science.gov (United States)

    He, Xin; Wang, Shu-Yu; Yin, Cheng-Hong; Wang, Tong; Jia, Chan-Wei; Ma, Yan-Min

    2016-01-01

    Background: Premature ovarian failure (POF) is a disease that affects female fertility but has few effective treatments. Ovarian reserve function plays an important role in female fertility. Recent studies have reported that hydrogen can protect male fertility. Therefore, we explored the potential protective effect of hydrogen-rich water on ovarian reserve function through a mouse immune POF model. Methods: To set up immune POF model, fifty female BALB/c mice were randomly divided into four groups: Control (mice consumed normal water, n = 10), hydrogen (mice consumed hydrogen-rich water, n = 10), model (mice were immunized with zona pellucida glycoprotein 3 [ZP3] and consumed normal water, n = 15), and model-hydrogen (mice were immunized with ZP3 and consumed hydrogen-rich water, n = 15) groups. After 5 weeks, mice were sacrificed. Serum anti-Müllerian hormone (AMH) levels, granulosa cell (GC) apoptotic index (AI), B-cell leukemia/lymphoma 2 (Bcl-2), and BCL2-associated X protein (Bax) expression were examined. Analyses were performed using SPSS 17.0 (SPSS Inc., Chicago, IL, USA) software. Results: Immune POF model, model group exhibited markedly reduced serum AMH levels compared with those of the control group (5.41 ± 0.91 ng/ml vs. 16.23 ± 1.97 ng/ml, P = 0.033) and the hydrogen group (19.65 ± 7.82 ng/ml, P = 0.006). The model-hydrogen group displayed significantly higher AMH concentrations compared with that of the model group (15.03 ± 2.75 ng/ml vs. 5.41 ± 0.91 ng/ml, P = 0.021). The GC AI was significantly higher in the model group (21.30 ± 1.74%) than those in the control (7.06 ± 0.27%), hydrogen (5.17 ± 0.41%), and model-hydrogen groups (11.24 ± 0.58%) (all P hydrogen group compared with that of the hydrogen group (11.24 ± 0.58% vs. 5.17 ± 0.41%, P = 0.021). Compared with those of the model group, ovarian tissue Bcl-2 levels increased (2.18 ± 0.30 vs. 3.01 ± 0.33, P = 0.045) and the Bax/Bcl-2 ratio decreased in the model-hydrogen group

  13. Understanding how commensal obligate anaerobic bacteria regulate immune functions in the large intestine.

    Science.gov (United States)

    Maier, Eva; Anderson, Rachel C; Roy, Nicole C

    2014-12-24

    The human gastrointestinal tract is colonised by trillions of commensal bacteria, most of which are obligate anaerobes residing in the large intestine. Appropriate bacterial colonisation is generally known to be critical for human health. In particular, the development and function of the immune system depends on microbial colonisation, and a regulated cross-talk between commensal bacteria, intestinal epithelial cells and immune cells is required to maintain mucosal immune homeostasis. This homeostasis is disturbed in various inflammatory disorders, such as inflammatory bowel diseases. Several in vitro and in vivo studies indicate a role for Faecalibacterium prausnitzii, Bacteroides thetaiotaomicron, Bacteroides fragilis, Akkermansia muciniphila and segmented filamentous bacteria in maintaining intestinal immune homeostasis. These obligate anaerobes are abundant in the healthy intestine but reduced in several inflammatory diseases, suggesting an association with protective effects on human health. However, knowledge of the mechanisms underlying the effects of obligate anaerobic intestinal bacteria remains limited, in part due to the difficulty of co-culturing obligate anaerobes together with oxygen-requiring human epithelial cells. By using novel dual-environment co-culture models, it will be possible to investigate the effects of the unstudied majority of intestinal microorganisms on the human epithelia. This knowledge will provide opportunities for improving human health and reducing the risk of inflammatory diseases.

  14. Understanding How Commensal Obligate Anaerobic Bacteria Regulate Immune Functions in the Large Intestine

    Science.gov (United States)

    Maier, Eva; Anderson, Rachel C.; Roy, Nicole C.

    2014-01-01

    The human gastrointestinal tract is colonised by trillions of commensal bacteria, most of which are obligate anaerobes residing in the large intestine. Appropriate bacterial colonisation is generally known to be critical for human health. In particular, the development and function of the immune system depends on microbial colonisation, and a regulated cross-talk between commensal bacteria, intestinal epithelial cells and immune cells is required to maintain mucosal immune homeostasis. This homeostasis is disturbed in various inflammatory disorders, such as inflammatory bowel diseases. Several in vitro and in vivo studies indicate a role for Faecalibacterium prausnitzii, Bacteroides thetaiotaomicron, Bacteroides fragilis, Akkermansia muciniphila and segmented filamentous bacteria in maintaining intestinal immune homeostasis. These obligate anaerobes are abundant in the healthy intestine but reduced in several inflammatory diseases, suggesting an association with protective effects on human health. However, knowledge of the mechanisms underlying the effects of obligate anaerobic intestinal bacteria remains limited, in part due to the difficulty of co-culturing obligate anaerobes together with oxygen-requiring human epithelial cells. By using novel dual-environment co-culture models, it will be possible to investigate the effects of the unstudied majority of intestinal microorganisms on the human epithelia. This knowledge will provide opportunities for improving human health and reducing the risk of inflammatory diseases. PMID:25545102

  15. Antiviral immunity in fish – functional analysis using DNA vaccination as a tool

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja

    2013-01-01

    fingerlings. Vaccination of fish at an early stage appears advantageous, since larger fish require higher doses of vaccine to be protected. Even in fish with an average size of 0.5 g at the time of vaccination, good protection can be obtained. Interestingly, immunity is established already a few days after...... and cellular components both play a role in the long lasting protection. The similarity of the functional immune response profile to that induced by a natural virus infection is striking and is most likely one of the major reasons for the efficacy of the rhabdovirus DNA vaccines. Although other elements like...... protein gene suggest that the structural requirements for antigenicity are different from the requirements for immunogenicity....

  16. Neural circuitry and immunity

    Science.gov (United States)

    Pavlov, Valentin A.; Tracey, Kevin J.

    2015-01-01

    Research during the last decade has significantly advanced our understanding of the molecular mechanisms at the interface between the nervous system and the immune system. Insight into bidirectional neuroimmune communication has characterized the nervous system as an important partner of the immune system in the regulation of inflammation. Neuronal pathways, including the vagus nerve-based inflammatory reflex are physiological regulators of immune function and inflammation. In parallel, neuronal function is altered in conditions characterized by immune dysregulation and inflammation. Here, we review these regulatory mechanisms and describe the neural circuitry modulating immunity. Understanding these mechanisms reveals possibilities to use targeted neuromodulation as a therapeutic approach for inflammatory and autoimmune disorders. These findings and current clinical exploration of neuromodulation in the treatment of inflammatory diseases defines the emerging field of Bioelectronic Medicine. PMID:26512000

  17. Pretransplant Immune- and Apoptosis-Related Gene Expression Is Associated with Kidney Allograft Function

    Directory of Open Access Journals (Sweden)

    Dorota Kamińska

    2016-01-01

    Full Text Available Renal transplant candidates present immune dysregulation, caused by chronic uremia. The aim of the study was to investigate whether pretransplant peripheral blood gene expression of immune factors affects clinical outcome of renal allograft recipients. Methods. In a prospective study, we analyzed pretransplant peripheral blood gene expression in87 renal transplant candidates with real-time PCR on custom-designed low density arrays (TaqMan. Results. Immediate posttransplant graft function (14-day GFR was influenced negatively by TGFB1 (P=0.039 and positively by IL-2 gene expression (P=0.040. Pretransplant blood mRNA expression of apoptosis-related genes (CASP3, FAS, and IL-18 and Th1-derived cytokine gene IFNG correlated positively with short- (6-month GFR CASP3: P=0.027, FAS: P=0.021, and IFNG: P=0.029 and long-term graft function (24-month GFR CASP3: P=0.003, FAS: P=0.033, IL-18: P=0.044, and IFNG: P=0.04. Conclusion. Lowered pretransplant Th1-derived cytokine and apoptosis-related gene expressions were a hallmark of subsequent worse kidney function but not of acute rejection rate. The pretransplant IFNG and CASP3 and FAS and IL-18 genes’ expression in the recipients’ peripheral blood is the possible candidate for novel biomarker of short- and long-term allograft function.

  18. Natural material adsorbed onto a polymer to enhance immune function

    Directory of Open Access Journals (Sweden)

    Reinaque AP

    2012-08-01

    Full Text Available Ana Paula Barcelos Reinaque,1 Eduardo Luzía França,2 Edson Fredulin Scherer,3 Mayra Aparecida Côrtes,1 Francisco José Dutra Souto,4 Adenilda Cristina Honorio-França51Post Graduate Program in Material Science, 2Institute of Biological and Health Science, Federal University of Mato Grosso, Barra do Garças, 3Post Graduate Program in Material Science, Institute of Biological and Health Science, Federal University of Mato Grosso, Pontal do Araguaia, 4Faculty of Medical Sciences, Federal University of Mato Grosso, Cuiabá, 5Institute of Biological and Health Science, Federal University of Mato Grosso, Pontal do Araguaia, MT, BrazilBackground: In this study, we produced poly(ethylene glycol (PEG microspheres of different sizes and adsorbing a medicinal plant mixture, and verified their effect in vitro on the viability, superoxide production, and bactericidal activity of phagocytes in the blood.Methods: The medicinal plant mixture was adsorbed onto PEG microspheres and its effects were evaluated by flow cytometry and fluorescence microscopy.Results: Adsorption of the herbal mixture onto the PEG microspheres was achieved and the particles were internalized by phagocytes. PEG microspheres bearing the adsorbed herbal mixture stimulated superoxide release, and activated scavenging and microbicidal activity in phagocytes. No differences in functional activity were observed when the phagocytes were not incubated with PEG microspheres bearing the adsorbed herbal mixture.Conclusion: This system may be useful for the delivery of a variety of medicinal plants and can confer additional protection against infection. The data reported here suggest that a polymer adsorbed with a natural product is a treatment alternative for enhancing immune function.Keywords: natural product, polymer, adsorption, immune function, phagocytes

  19. Thermal sensitivity of immune function: evidence against a generalist-specialist trade-off among endothermic and ectothermic vertebrates

    Science.gov (United States)

    Butler, Michael W.; Stahlschmidt, Zachary R.; Ardia, Daniel R.; Davies, Scott; Davis, Jon; Guillette, Louis J.; Johnson, Nicholas; McCormick, Stephen D.; McGraw, Kevin J.; DeNardo, Dale F.

    2013-01-01

    Animal body temperature (Tbody) varies over daily and annual cycles, affecting multiple aspects of biological performance in both endothermic and ectothermic animals. Yet a comprehensive comparison of thermal performance among animals varying in Tbody (mean and variance) and heat production is lacking. Thus, we examined the thermal sensitivity of immune function (a crucial fitness determinant) in Vertebrata, a group encompassing species of varying thermal biology. Specifically, we investigated temperature-related variation in two innate immune performance metrics, hemagglutination and hemolysis, for 13 species across all seven major vertebrate clades. Agglutination and lysis were temperature dependent and were more strongly related to the thermal biology of species (e.g., mean Tbody) than to the phylogenetic relatedness of species, although these relationships were complex and frequently surprising (e.g., heterotherms did not exhibit broader thermal performance curves than homeotherms). Agglutination and lysis performance were positively correlated within species, except in taxa that produce squalamine, a steroidal antibiotic that does not lyse red blood cells. Interestingly, we found the antithesis of a generalist-specialist trade-off: species with broader temperature ranges of immune performance also had higher peak performance levels. In sum, we have uncovered thermal sensitivity of immune performance in both endotherms and ectotherms, highlighting the role that temperature and life history play in immune function across Vertebrata.

  20. The role of selenium in inflammation and immunity: from molecular mechanisms to therapeutic opportunities.

    Science.gov (United States)

    Huang, Zhi; Rose, Aaron H; Hoffmann, Peter R

    2012-04-01

    Dietary selenium (]Se), mainly through its incorporation into selenoproteins, plays an important role in inflammation and immunity. Adequate levels of Se are important for initiating immunity, but they are also involved in regulating excessive immune responses and chronic inflammation. Evidence has emerged regarding roles for individual selenoproteins in regulating inflammation and immunity, and this has provided important insight into mechanisms by which Se influences these processes. Se deficiency has long been recognized to negatively impact immune cells during activation, differentiation, and proliferation. This is related to increased oxidative stress, but additional functions such as protein folding and calcium flux may also be impaired in immune cells under Se deficient conditions. Supplementing diets with above-adequate levels of Se can also impinge on immune cell function, with some types of inflammation and immunity particularly affected and sexually dimorphic effects of Se levels in some cases. In this comprehensive article, the roles of Se and individual selenoproteins in regulating immune cell signaling and function are discussed. Particular emphasis is given to how Se and selenoproteins are linked to redox signaling, oxidative burst, calcium flux, and the subsequent effector functions of immune cells. Data obtained from cell culture and animal models are reviewed and compared with those involving human physiology and pathophysiology, including the effects of Se levels on inflammatory or immune-related diseases including anti-viral immunity, autoimmunity, sepsis, allergic asthma, and chronic inflammatory disorders. Finally, the benefits and potential adverse effects of intervention with Se supplementation for various inflammatory or immune disorders are discussed.

  1. Regulatory immune cells and functions in autoimmunity and transplantation immunology.

    Science.gov (United States)

    Papp, Gabor; Boros, Peter; Nakken, Britt; Szodoray, Peter; Zeher, Margit

    2017-05-01

    In physiological circumstances, various tolerogenic mechanisms support the protection of self-structures during immune responses. However, quantitative and/or qualitative changes in regulatory immune cells and mediators can evoke auto-reactive immune responses, and upon susceptible genetic background, along with the presence of other concomitant etiological factors, autoimmune disease may develop. In transplant immunology, tolerogenic mechanisms are also critical, since the balance between of alloantigen-reactive effector cells and the regulatory immune cells will ultimately determine whether a graft is accepted or rejected. Better understanding of the immunological tolerance and the potential modulations of immune regulatory processes are crucial for developing effective therapies in autoimmune diseases as well as in organ transplantation. In this review, we focus on the novel insights regarding the impaired immune regulation and other relevant factors contributing to the development of auto-reactive and graft-reactive immune responses in autoimmune diseases and transplant rejection, respectively. We also address some promising approaches for modification of immune-regulatory processes and tolerogenic mechanisms in autoimmunity and solid organ transplantation, which may be beneficial in future therapeutic strategies. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Exercise protects from cancer through regulation of immune function and inflammation

    DEFF Research Database (Denmark)

    Hojman, Pernille

    2017-01-01

    Exercise training has been extensively studied in cancer settings as part of prevention or rehabilitation strategies, yet emerging evidence suggests that exercise training can also directly affect tumor-specific outcomes. The underlying mechanisms for this exercise-dependent cancer protection are...... regulation of immune and inflammatory functions, and exercise may be pursued as anticancer treatment through incorporation into standard oncological therapy to the benefit of the cancer patients.......Exercise training has been extensively studied in cancer settings as part of prevention or rehabilitation strategies, yet emerging evidence suggests that exercise training can also directly affect tumor-specific outcomes. The underlying mechanisms for this exercise-dependent cancer protection...... are just starting to be elucidated. To this end, evasion of immune surveillance and tumor-associated inflammation are established as hallmarks of cancer, and exercise may target cancer incidence and progression through regulation of these mechanisms. Here, I review the role of exercise in protection from...

  3. Poly-functional and long-lasting anticancer immune response elicited by a safe attenuated Pseudomonas aeruginosa vector for antigens delivery

    Directory of Open Access Journals (Sweden)

    Xavier Chauchet

    2016-01-01

    Full Text Available Live-attenuated bacterial vectors for antigens delivery have aroused growing interest in the field of cancer immunotherapy. Their potency to stimulate innate immunity and to promote intracellular antigen delivery into antigen-presenting cells could be exploited to elicit a strong and specific cellular immune response against tumor cells. We previously described genetically-modified and attenuated Pseudomonas aeruginosa vectors able to deliver in vivo protein antigens into antigen-presenting cells, through Type 3 secretion system of the bacteria. Using this approach, we managed to protect immunized mice against aggressive B16 melanoma development in both a prophylactic and therapeutic setting. In this study, we further investigated the antigen-specific CD8+ T cell response, in terms of phenotypic and functional aspects, obtained after immunizations with a killed but metabolically active P. aeruginosa attenuated vector. We demonstrated that P. aeruginosa vaccine induces a highly functional pool of antigen-specific CD8+ T cell able to infiltrate the tumor. Furthermore, multiple immunizations allowed the development of a long-lasting immune response, represented by a pool of predominantly effector memory cells which protected mice against late tumor challenge. Overall, killed but metabolically active P. aeruginosa vector is a safe and promising approach for active and specific antitumor immunotherapy.

  4. Exploiting immune cell metabolic machinery for functional HIV cure and the prevention of inflammaging [version 1; referees: 4 approved

    Directory of Open Access Journals (Sweden)

    Clovis S. Palmer

    2018-01-01

    Full Text Available An emerging paradigm in immunology suggests that metabolic reprogramming and immune cell activation and functions are intricately linked. Viral infections, such as HIV infection, as well as cancer force immune cells to undergo major metabolic challenges. Cells must divert energy resources in order to mount an effective immune response. However, the fact that immune cells adopt specific metabolic programs to provide host defense against intracellular pathogens and how this metabolic shift impacts immune cell functions and the natural course of diseases have only recently been appreciated. A clearer insight into how these processes are inter-related will affect our understanding of several fundamental aspects of HIV persistence. Even in patients with long-term use of anti-retroviral therapies, HIV infection persists and continues to cause chronic immune activation and inflammation, ongoing and cumulative damage to multiple organs systems, and a reduction in life expectancy. HIV-associated fundamental changes to the metabolic machinery of the immune system can promote a state of “inflammaging”, a chronic, low-grade inflammation with specific immune changes that characterize aging, and can also contribute to the persistence of HIV in its reservoirs. In this commentary, we will bring into focus evolving concepts on how HIV modulates the metabolic machinery of immune cells in order to persist in reservoirs and how metabolic reprogramming facilitates a chronic state of inflammation that underlies the development of age-related comorbidities. We will discuss how immunometabolism is facilitating the changing paradigms in HIV cure research and outline the novel therapeutic opportunities for preventing inflammaging and premature development of age-related conditions in HIV+ individuals.

  5. Structural and functional analyses of DNA-sensing and immune activation by human cGAS.

    Science.gov (United States)

    Kato, Kazuki; Ishii, Ryohei; Goto, Eiji; Ishitani, Ryuichiro; Tokunaga, Fuminori; Nureki, Osamu

    2013-01-01

    The detection of cytosolic DNA, derived from pathogens or host cells, by cytosolic receptors is essential for appropriate host immune responses. Cyclic GMP-AMP synthase (cGAS) is a newly identified cytosolic DNA receptor that produces cyclic GMP-AMP, which activates stimulator of interferon genes (STING), resulting in TBK1-IRF3 pathway activation followed by the production of type I interferons. Here we report the crystal structure of human cGAS. The structure revealed that a cluster of lysine and arginine residues forms the positively charged DNA binding surface of human cGAS, which is important for the STING-dependent immune activation. A structural comparison with other previously determined cGASs and our functional analyses suggested that a conserved zinc finger motif and a leucine residue on the DNA binding surface are crucial for the DNA-specific immune response of human cGAS, consistent with previous work. These structural features properly orient the DNA binding to cGAS, which is critical for DNA-induced cGAS activation and STING-dependent immune activation. Furthermore, we showed that the cGAS-induced activation of STING also involves the activation of the NF-κB and IRF3 pathways. Our results indicated that cGAS is a DNA sensor that efficiently activates the host immune system by inducing two distinct pathways.

  6. Structural and functional analyses of DNA-sensing and immune activation by human cGAS.

    Directory of Open Access Journals (Sweden)

    Kazuki Kato

    Full Text Available The detection of cytosolic DNA, derived from pathogens or host cells, by cytosolic receptors is essential for appropriate host immune responses. Cyclic GMP-AMP synthase (cGAS is a newly identified cytosolic DNA receptor that produces cyclic GMP-AMP, which activates stimulator of interferon genes (STING, resulting in TBK1-IRF3 pathway activation followed by the production of type I interferons. Here we report the crystal structure of human cGAS. The structure revealed that a cluster of lysine and arginine residues forms the positively charged DNA binding surface of human cGAS, which is important for the STING-dependent immune activation. A structural comparison with other previously determined cGASs and our functional analyses suggested that a conserved zinc finger motif and a leucine residue on the DNA binding surface are crucial for the DNA-specific immune response of human cGAS, consistent with previous work. These structural features properly orient the DNA binding to cGAS, which is critical for DNA-induced cGAS activation and STING-dependent immune activation. Furthermore, we showed that the cGAS-induced activation of STING also involves the activation of the NF-κB and IRF3 pathways. Our results indicated that cGAS is a DNA sensor that efficiently activates the host immune system by inducing two distinct pathways.

  7. The twilight of immunity: emerging concepts in aging of the immune system.

    Science.gov (United States)

    Nikolich-Žugich, Janko

    2018-01-01

    Immunosenescence is a series of age-related changes that affect the immune system and, with time, lead to increased vulnerability to infectious diseases. This Review addresses recent developments in the understanding of age-related changes that affect key components of immunity, including the effect of aging on cells of the (mostly adaptive) immune system, on soluble molecules that guide the maintenance and function of the immune system and on lymphoid organs that coordinate both the maintenance of lymphocytes and the initiation of immune responses. I further address the effect of the metagenome and exposome as key modifiers of immune-system aging and discuss a conceptual framework in which age-related changes in immunity might also affect the basic rules by which the immune system operates.

  8. The Role of TAM Family Receptors in Immune Cell Function: Implications for Cancer Therapy.

    Science.gov (United States)

    Paolino, Magdalena; Penninger, Josef M

    2016-10-21

    The TAM receptor protein tyrosine kinases-Tyro3, Axl, and Mer-are essential regulators of immune homeostasis. Guided by their cognate ligands Growth arrest-specific gene 6 (Gas6) and Protein S (Pros1), these receptors ensure the resolution of inflammation by dampening the activation of innate cells as well as by restoring tissue function through promotion of tissue repair and clearance of apoptotic cells. Their central role as negative immune regulators is highlighted by the fact that deregulation of TAM signaling has been linked to the pathogenesis of autoimmune, inflammatory, and infectious diseases. Importantly, TAM receptors have also been associated with cancer development and progression. In a cancer setting, TAM receptors have a dual regulatory role, controlling the initiation and progression of tumor development and, at the same time, the associated anti-tumor responses of diverse immune cells. Thus, modulation of TAM receptors has emerged as a potential novel strategy for cancer treatment. In this review, we discuss our current understanding of how TAM receptors control immunity, with a particular focus on the regulation of anti-tumor responses and its implications for cancer immunotherapy.

  9. Effects of Aromatherapy Massage on Pregnant Women's Stress and Immune Function: A Longitudinal, Prospective, Randomized Controlled Trial.

    Science.gov (United States)

    Chen, Pao-Ju; Chou, Cheng-Chen; Yang, Luke; Tsai, Yu-Lun; Chang, Yue-Cune; Liaw, Jen-Jiuan

    2017-10-01

    This study's aims are to examine the effects of aromatherapy massage on women's stress and immune function during pregnancy. This longitudinal, prospective, randomized controlled trial recruited 52 healthy pregnant women from a prenatal clinic in Taipei using convenience sampling. The participants were randomly assigned to the intervention (n = 24) or control (n = 28) group using Clinstat block randomization. The intervention group received 70 min of aromatherapy massage with 2% lavender essential oil every other week (10 times in total) for 20 weeks; the control group received only routine prenatal care. In both groups, participants' salivary cortisol and immunoglobulin A (IgA) levels were collected before and after the intervention group received aromatherapy massage (every month from 16 to 36 weeks gestation) and were analyzed using enzyme-linked immunosorbent assay. The pregnant women in the intervention group had lower salivary cortisol (p aromatherapy massage than those in the control group, which did not receive massage treatment. Comparing the long-term effects of aromatherapy massage on salivary IgA levels between groups at different times, the study found that the pretest salivary IgA levels at 32 (p = 0.002) and 36 (p aromatherapy massage could significantly decrease stress and enhance immune function in pregnant women. The findings can guide clinicians or midwives in providing aromatherapy massage to women throughout the pregnancy.

  10. Coelomocytes: Biology and Possible Immune Functions in Invertebrates with Special Remarks on Nematodes

    Directory of Open Access Journals (Sweden)

    Qudsia Tahseen

    2009-01-01

    Full Text Available All metazoans are exposed to a wide range of microbes and have evolved complex immune defenses used to repel infectious agents. Coelomocytes play a key role in the defense reactions of most invertebrates. They are involved in important immune functions, such as phagocytosis, encapsulation, graft rejection, and inflammation, as well as the synthesis and secretion of several humoral factors especially in annelids and echinoderms. Coelomocytes in nematodes are variable in shapes from round, ovoid, cuboidal, and spindle-shaped to stellate or branched cells that are found usually at fixed positions in the pseudocoelom. Their number usually varies from 2 to 6. The model nematode, C. elegans lacks an adaptive immune system and the coelomocytes are capable of endocytosis, but their involvement in phagocytosis of bacteria seems unlikely. The aim of this review is to evaluate current knowledge on coelomocytes of invertebrates with special reference to nematodes. The morphology and structure of these coelomocytes are discussed along with their origin. Their relative positions and diversity in different nematode groups have also been discussed and illustrated.

  11. Melatonin: Buffering the Immune System

    Directory of Open Access Journals (Sweden)

    Juan M. Guerrero

    2013-04-01

    Full Text Available Melatonin modulates a wide range of physiological functions with pleiotropic effects on the immune system. Despite the large number of reports implicating melatonin as an immunomodulatory compound, it still remains unclear how melatonin regulates immunity. While some authors argue that melatonin is an immunostimulant, many studies have also described anti-inflammatory properties. The data reviewed in this paper support the idea of melatonin as an immune buffer, acting as a stimulant under basal or immunosuppressive conditions or as an anti-inflammatory compound in the presence of exacerbated immune responses, such as acute inflammation. The clinical relevance of the multiple functions of melatonin under different immune conditions, such as infection, autoimmunity, vaccination and immunosenescence, is also reviewed.

  12. Melatonin: Buffering the Immune System

    Science.gov (United States)

    Carrillo-Vico, Antonio; Lardone, Patricia J.; Álvarez-Sánchez, Nuria; Rodríguez-Rodríguez, Ana; Guerrero, Juan M.

    2013-01-01

    Melatonin modulates a wide range of physiological functions with pleiotropic effects on the immune system. Despite the large number of reports implicating melatonin as an immunomodulatory compound, it still remains unclear how melatonin regulates immunity. While some authors argue that melatonin is an immunostimulant, many studies have also described anti-inflammatory properties. The data reviewed in this paper support the idea of melatonin as an immune buffer, acting as a stimulant under basal or immunosuppressive conditions or as an anti-inflammatory compound in the presence of exacerbated immune responses, such as acute inflammation. The clinical relevance of the multiple functions of melatonin under different immune conditions, such as infection, autoimmunity, vaccination and immunosenescence, is also reviewed. PMID:23609496

  13. Functions of innate immune cells and commensal bacteria in gut homeostasis.

    Science.gov (United States)

    Kayama, Hisako; Takeda, Kiyoshi

    2016-02-01

    The intestinal immune system remains unresponsive to beneficial microbes and dietary antigens while activating pro-inflammatory responses against pathogens for host defence. In intestinal mucosa, abnormal activation of innate immunity, which directs adaptive immune responses, causes the onset and/or progression of inflammatory bowel diseases. Thus, innate immunity is finely regulated in the gut. Multiple innate immune cell subsets have been identified in both murine and human intestinal lamina propria. Some innate immune cells play a key role in the maintenance of gut homeostasis by preventing inappropriate adaptive immune responses while others are associated with the pathogenesis of intestinal inflammation through development of Th1 and Th17 cells. In addition, intestinal microbiota and their metabolites contribute to the regulation of innate/adaptive immune responses. Accordingly, perturbation of microbiota composition can trigger intestinal inflammation by driving inappropriate immune responses. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  14. Economic evaluation of pediatric influenza immunization program compared with other pediatric immunization programs: A systematic review.

    Science.gov (United States)

    Gibson, Edward; Begum, Najida; Sigmundsson, Birgir; Sackeyfio, Alfred; Hackett, Judith; Rajaram, Sankarasubramanian

    2016-05-03

    This study compared the economic value of pediatric immunisation programmes for influenza to those for rotavirus (RV), meningococcal disease (MD), pneumococcal disease (PD), human papillomavirus (HPV), hepatitis B (Hep B), and varicella reported in recent (2000 onwards) cost-effectiveness (CE) studies identified in a systematic review of PubMed, health technology, and vaccination databases. The systematic review yielded 51 economic evaluation studies of pediatric immunisation - 10 (20%) for influenza and 41 (80%) for the other selected diseases. The quality of the eligible articles was assessed using Drummond's checklist. Although inherent challenges and limitations exist when comparing economic evaluations of immunisation programmes, an overall comparison of the included studies demonstrated cost-effectiveness/cost saving for influenza from a European-Union-Five (EU5) and United States (US) perspective; point estimates for cost/quality-adjusted life-years (QALY) from dominance (cost-saving with more effect) to ≤45,444 were reported. The economic value of influenza programmes was comparable to the other vaccines of interest, with cost/QALY in general considerably lower than RV, Hep B, MD and PD. Independent of the perspective and type of analysis, the economic impact of a pediatric influenza immunisation program was influenced by vaccine efficacy, immunisation coverage, costs, and most significantly by herd immunity. This review suggests that pediatric influenza immunisation may offer a cost effective strategy when compared with HPV and varicella and possibly more value compared with other childhood vaccines (RV, Hep B, MD and PD).

  15. Functionalized iron oxide nanoparticles for controlling the movement of immune cells

    Science.gov (United States)

    White, Ethan E.; Pai, Alex; Weng, Yiming; Suresh, Anil K.; van Haute, Desiree; Pailevanian, Torkom; Alizadeh, Darya; Hajimiri, Ali; Badie, Behnam; Berlin, Jacob M.

    2015-04-01

    Immunotherapy is currently being investigated for the treatment of many diseases, including cancer. The ability to control the location of immune cells during or following activation would represent a powerful new technique for this field. Targeted magnetic delivery is emerging as a technique for controlling cell movement and localization. Here we show that this technique can be extended to microglia, the primary phagocytic immune cells in the central nervous system. The magnetized microglia were generated by loading the cells with iron oxide nanoparticles functionalized with CpG oligonucleotides, serving as a proof of principle that nanoparticles can be used to both deliver an immunostimulatory cargo to cells and to control the movement of the cells. The nanoparticle-oligonucleotide conjugates are efficiently internalized, non-toxic, and immunostimulatory. We demonstrate that the in vitro migration of the adherent, loaded microglia can be controlled by an external magnetic field and that magnetically-induced migration is non-cytotoxic. In order to capture video of this magnetically-induced migration of loaded cells, a novel 3D-printed ``cell box'' was designed to facilitate our imaging application. Analysis of cell movement velocities clearly demonstrate increased cell velocities toward the magnet. These studies represent the initial step towards our final goal of using nanoparticles to both activate immune cells and to control their trafficking within the diseased brain.Immunotherapy is currently being investigated for the treatment of many diseases, including cancer. The ability to control the location of immune cells during or following activation would represent a powerful new technique for this field. Targeted magnetic delivery is emerging as a technique for controlling cell movement and localization. Here we show that this technique can be extended to microglia, the primary phagocytic immune cells in the central nervous system. The magnetized microglia were

  16. Functions of Calcium-Dependent Protein Kinases in Plant Innate Immunity

    Directory of Open Access Journals (Sweden)

    Xiquan Gao

    2014-03-01

    Full Text Available An increase of cytosolic Ca2+ is generated by diverse physiological stimuli and stresses, including pathogen attack. Plants have evolved two branches of the immune system to defend against pathogen infections. The primary innate immune response is triggered by the detection of evolutionarily conserved pathogen-associated molecular pattern (PAMP, which is called PAMP-triggered immunity (PTI. The second branch of plant innate immunity is triggered by the recognition of specific pathogen effector proteins and known as effector-triggered immunity (ETI. Calcium (Ca2+ signaling is essential in both plant PTI and ETI responses. Calcium-dependent protein kinases (CDPKs have emerged as important Ca2+ sensor proteins in transducing differential Ca2+ signatures, triggered by PAMPs or effectors and activating complex downstream responses. CDPKs directly transmit calcium signals by calcium binding to the elongation factor (EF-hand domain at the C-terminus and substrate phosphorylation by the catalytic kinase domain at the N-terminus. Emerging evidence suggests that specific and overlapping CDPKs phosphorylate distinct substrates in PTI and ETI to regulate diverse plant immune responses, including production of reactive oxygen species, transcriptional reprogramming of immune genes, and the hypersensitive response.

  17. Functions of Calcium-Dependent Protein Kinases in Plant Innate Immunity

    Science.gov (United States)

    Gao, Xiquan; Cox, Kevin L.; He, Ping

    2014-01-01

    An increase of cytosolic Ca2+ is generated by diverse physiological stimuli and stresses, including pathogen attack. Plants have evolved two branches of the immune system to defend against pathogen infections. The primary innate immune response is triggered by the detection of evolutionarily conserved pathogen-associated molecular pattern (PAMP), which is called PAMP-triggered immunity (PTI). The second branch of plant innate immunity is triggered by the recognition of specific pathogen effector proteins and known as effector-triggered immunity (ETI). Calcium (Ca2+) signaling is essential in both plant PTI and ETI responses. Calcium-dependent protein kinases (CDPKs) have emerged as important Ca2+ sensor proteins in transducing differential Ca2+ signatures, triggered by PAMPs or effectors and activating complex downstream responses. CDPKs directly transmit calcium signals by calcium binding to the elongation factor (EF)-hand domain at the C-terminus and substrate phosphorylation by the catalytic kinase domain at the N-terminus. Emerging evidence suggests that specific and overlapping CDPKs phosphorylate distinct substrates in PTI and ETI to regulate diverse plant immune responses, including production of reactive oxygen species, transcriptional reprogramming of immune genes, and the hypersensitive response. PMID:27135498

  18. Functional similarities between pigeon 'milk' and mammalian milk: induction of immune gene expression and modification of the microbiota.

    Directory of Open Access Journals (Sweden)

    Meagan J Gillespie

    Full Text Available Pigeon 'milk' and mammalian milk have functional similarities in terms of nutritional benefit and delivery of immunoglobulins to the young. Mammalian milk has been clearly shown to aid in the development of the immune system and microbiota of the young, but similar effects have not yet been attributed to pigeon 'milk'. Therefore, using a chicken model, we investigated the effect of pigeon 'milk' on immune gene expression in the Gut Associated Lymphoid Tissue (GALT and on the composition of the caecal microbiota. Chickens fed pigeon 'milk' had a faster rate of growth and a better feed conversion ratio than control chickens. There was significantly enhanced expression of immune-related gene pathways and interferon-stimulated genes in the GALT of pigeon 'milk'-fed chickens. These pathways include the innate immune response, regulation of cytokine production and regulation of B cell activation and proliferation. The caecal microbiota of pigeon 'milk'-fed chickens was significantly more diverse than control chickens, and appears to be affected by prebiotics in pigeon 'milk', as well as being directly seeded by bacteria present in pigeon 'milk'. Our results demonstrate that pigeon 'milk' has further modes of action which make it functionally similar to mammalian milk. We hypothesise that pigeon 'lactation' and mammalian lactation evolved independently but resulted in similarly functional products.

  19. Chicken IgY Fc linked to Bordetella avium ompA and Taishan Pinus massoniana pollen polysaccharide adjuvant enhances macrophage function and specific immune responses

    Directory of Open Access Journals (Sweden)

    Zhu Ruiliang

    2016-11-01

    Full Text Available Fc-fusion technologies, in which immunoglobulin Fc is genetically fused to an antigenic protein, have been developed to confer antibody-like properties to proteins and peptides. Mammalian IgG Fc fusion exhibits improved antigen-induced immune responses by providing aggregates with high avidity for the IgG Fc receptor and salvaging the antigenic portion from endosomal degradation. However, whether the linked chicken IgY Fc fragment shares similar characteristics to mammalian IgG Fc remains unclear. In this study, we linked the chicken IgY Fc gene to the outer membrane protein A (ompA of Borderella avium through overlapping PCR. The fusion gene was cloned into the pPIC9 plasmid to construct the recombinant Pichia pastoris transformant expressing the ompA–Fc fusion protein. The effects of the linked Fc on macrophage vitality, activity, efficiency of antigen processing, and immune responses induced by the fused ompA were investigated. Furthermore, the effect of Taishan Pinus massoniana pollen polysaccharide (TPPPS, an immunomodulator, on chicken macrophage activation was evaluated. TPPPS was also used as an adjuvant to investigate its immunomodulatory effect on immunoresponses induced by the fused ompA–Fc in chickens. The pinocytosis, phagocytosis, secretion of nitric oxide and TNF-α, and MHC-II molecular expression of the macrophages treated with the fused ompA–Fc were significantly higher than those of the macrophages treated with ompA alone. The addition of TPPPS to the fused ompA–Fc further enhanced macrophage functions. The fused ompA–Fc elicited higher antigen-specific immune responses and protective efficacy compared with ompA alone. Moreover, the fused ompA–Fc conferred higher serum antibody titers, serum IL-2 and IL-4 concentrations, CD4+ and CD8+ T-lymphocyte counts, lymphocyte transformation rate, and protection rate compared with ompA alone. Notably, the prepared TPPPS adjuvant ompA–Fc vaccines induced high immune

  20. Cesarean section and disease associated with immune function

    DEFF Research Database (Denmark)

    Kristensen, Kim; Henriksen, Lonny

    2016-01-01

    colitis and celiac disease, whereas children delivered by elective CS had an increased risk of lower respiratory tract infection and juvenile idiopathic arthritis. The effect of elective CS was higher than the effect of acute CS on the risk of asthma. CONCLUSION: Children delivered by CS are at increased......BACKGROUND: Earlier studies have shown that delivery by cesarean section (CS) is associated with an increased risk of disease associated with immune function in the offspring, but these studies have generally not discriminated between the effect of acute and elective CS. OBJECTIVE: We sought...... to further explore these associations using discrimination between the effects of acute versus elective CS. METHODS: We performed a population- and national register-based cohort study including all children born in Denmark from January 1997 through December 2012. Hazard ratios for diseases associated...

  1. The Immune System: Basis of so much Health and Disease: 3. Adaptive Immunity.

    Science.gov (United States)

    Scully, Crispian; Georgakopoulou, Eleni A; Hassona, Yazan

    2017-04-01

    The immune system is the body’s primary defence mechanism against infections, and disturbances in the system can cause disease if the system fails in defence functions (in immunocompromised people), or if the activity is detrimental to the host (as in auto-immune and auto-inflammatory states). A healthy immune system is also essential to normal health of dental and oral tissues. This series presents the basics for the understanding of the immune system; this article covers adaptive immunity. Clinical relevance: Dental clinicians need a basic understanding of the immune system as it underlies health and disease.

  2. Tumor necrosis factor (TNF) receptor shedding controls thresholds of innate immune activation that balance opposing TNF functions in infectious and inflammatory diseases

    DEFF Research Database (Denmark)

    Xanthoulea, Sofia; Pasparakis, Manolis; Kousteni, Stavroula

    2004-01-01

    Tumor necrosis factor (TNF) is a potent cytokine exerting critical functions in the activation and regulation of immune and inflammatory responses. Due to its pleiotropic activities, the amplitude and duration of TNF function must be tightly regulated. One of the mechanisms that may have evolved...... to modulate TNF function is the proteolytic cleavage of its cell surface receptors. In humans, mutations affecting shedding of the p55TNF receptor (R) have been linked with the development of the TNFR-associated periodic syndromes, disorders characterized by recurrent fever attacks and localized inflammation....... Here we show that knock-in mice expressing a mutated nonsheddable p55TNFR develop Toll-like receptor-dependent innate immune hyperreactivity, which renders their immune system more efficient at controlling intracellular bacterial infections. Notably, gain of function for antibacterial host defenses...

  3. Blood metal levels and metal-influenced immune functions of harbour seals in captivity

    International Nuclear Information System (INIS)

    Kakuschke, Antje; Valentine-Thon, Elizabeth; Griesel, Simone; Rosenberger, Tanja; Mundry, Roger; Siebert, Ursula; Prange, Andreas

    2008-01-01

    Immunological blood parameters and the effects of environmental pollutants on the immune system are important to assess the health status of seals. Animals living permanently in seal centres are useful for development and validation of diagnostic tools for free-ranging animals. In this study, parameters of cellular immunity as well as metal concentrations in blood and metal influence on cell proliferation of seven seals from a seal centre were investigated repeatedly using multi-element analysis and a lymphocyte proliferation assay. The metal concentrations, except for tin and chromium, were in general comparable to those of free-ranging animals of the North Sea. The unstimulated and mitogen-stimulated lymphocyte proliferation showed strong intra- and inter-individual variability, which reflected variability in activation of the immune status. Furthermore, both immunosuppressive and stimulative influences of metals on lymphocytes were found. Summarising, the methods used in this investigation provided useful information on these animals, and their application to free-ranging animals can be recommended

  4. Blood metal levels and metal-influenced immune functions of harbour seals in captivity

    Energy Technology Data Exchange (ETDEWEB)

    Kakuschke, Antje [GKSS Research Centre, Institute for Coastal Research, Max-Planck-Strasse 1, 21502 Geesthacht (Germany)], E-mail: antje.kakuschke@gkss.de; Valentine-Thon, Elizabeth [Department of Immunology, Laboratory Center Bremen, Friedrich-Karl-Strasse 22, 28205 Bremen (Germany); Griesel, Simone [GKSS Research Centre, Institute for Coastal Research, Max-Planck-Strasse 1, 21502 Geesthacht (Germany); Rosenberger, Tanja [Seal Centre Friedrichskoog e.V., 25718 Friedrichskoog (Germany); Mundry, Roger [Research and Technology Centre Westcoast (FTZ), University of Kiel, Hafentoern 1, 25761 Buesum (Germany); Max Planck Institute for Evolutionary Anthropology, Deutscher Platz 6, 04103 Leipzig (Germany); Siebert, Ursula [Research and Technology Centre Westcoast (FTZ), University of Kiel, Hafentoern 1, 25761 Buesum (Germany); Prange, Andreas [GKSS Research Centre, Institute for Coastal Research, Max-Planck-Strasse 1, 21502 Geesthacht (Germany)

    2008-04-15

    Immunological blood parameters and the effects of environmental pollutants on the immune system are important to assess the health status of seals. Animals living permanently in seal centres are useful for development and validation of diagnostic tools for free-ranging animals. In this study, parameters of cellular immunity as well as metal concentrations in blood and metal influence on cell proliferation of seven seals from a seal centre were investigated repeatedly using multi-element analysis and a lymphocyte proliferation assay. The metal concentrations, except for tin and chromium, were in general comparable to those of free-ranging animals of the North Sea. The unstimulated and mitogen-stimulated lymphocyte proliferation showed strong intra- and inter-individual variability, which reflected variability in activation of the immune status. Furthermore, both immunosuppressive and stimulative influences of metals on lymphocytes were found. Summarising, the methods used in this investigation provided useful information on these animals, and their application to free-ranging animals can be recommended.

  5. Cost of reproduction in a long-lived bird: incubation effort reduces immune function and future reproduction.

    Science.gov (United States)

    Hanssen, Sveinn Are; Hasselquist, Dennis; Folstad, Ivar; Erikstad, Kjell Einar

    2005-05-22

    Life-history theory predicts that increased current reproductive effort should lead to a fitness cost. This cost of reproduction may be observed as reduced survival or future reproduction, and may be caused by temporal suppression of immune function in stressed or hard-working individuals. In birds, consideration of the costs of incubating eggs has largely been neglected in favour of the costs of brood rearing. We manipulated incubation demand in two breeding seasons (2000 and 2001) in female common eiders (Somateria mollissima) by creating clutches of three and six eggs (natural range 3-6 eggs). The common eider is a long-lived sea-duck where females do not eat during the incubation period. Mass loss increased and immune function (lymphocyte levels and specific antibody response to the non-pathogenic antigens diphtheria and tetanus toxoid) was reduced in females incubating large clutches. The increased incubation effort among females assigned to large incubation demand did not lead to adverse effects on current reproduction or return rate in the next breeding season. However, large incubation demand resulted in long-term fitness costs through reduced fecundity the year after manipulation. Our data show that in eiders, a long-lived species, the cost of high incubation demand is paid in the currency of reduced future fecundity, possibly mediated by reduced immune function.

  6. Effects of ration level on immune functions in chinook salmon (Oncorhynchus tshawytscha)

    Science.gov (United States)

    Alcorn, S.W.; Pascho, R.J.; Murray, A.L.; Shearer, K.D.

    2003-01-01

    The relationship between nutritional status and disease resistance in cultured salmonids can be affected by dietary manipulations. Careful attention to feeding levels may be important to avoid imbalances in nutrient levels that could ultimately impair a fish's ability to resist infectious microorganisms. In the current study, fish in three feed-level groups were fed an experimental diet either to satiation, 64% of satiation or 40% of satiation. A fourth group of fish were fed a commercial diet at the 64% of satiation level and served as controls. To evaluate certain indices of disease resistance in the test and control fish, a panel of assays was employed to measure humoral and cellular immune functions 30, 39 and 54 weeks after starting the dietary treatments. The panel included measures of blood hematocrit and leucocrit levels, plasma protein concentration and serum lysozyme and complement activity. Cellular analyses included differential blood leucocyte counts, NBT reduction and phagocytosis by pronephros macrophages and myeloperoxidase activity of pronephros neutrophils. No differences were observed in those indices between fish tested from the control-diet group (commercial diet fed at the 64% rate) and fish tested from the 64% feed-level group, except that fish fed the commercial diet had a greater concentration of plasma protein. Leucocrit values and plasma protein concentrations tended to increase among the experimental feed groups as the ration increased from 40% to satiation. More importantly, phagocytic activity by anterior kidney leucocytes was found to be inversely proportional to the feed level. Whereas the results of this study provide evidence that the salmonid immune system may be fairly robust with regard to available metabolic energy, the significant changes observed in phagocytic cell activity suggest that some cellular immune functions may be affected by the feed level.

  7. Induction of antitumor immunity through xenoplacental immunization

    Directory of Open Access Journals (Sweden)

    Agadjanyan Michael G

    2006-05-01

    Full Text Available Abstract Historically cancer vaccines have yielded suboptimal clinical results. We have developed a novel strategy for eliciting antitumor immunity based upon homology between neoplastic tissue and the developing placenta. Placenta formation shares several key processes with neoplasia, namely: angiogenesis, activation of matrix metalloproteases, and active suppression of immune function. Immune responses against xenoantigens are well known to break self-tolerance. Utilizing xenogeneic placental protein extracts as a vaccine, we have successfully induced anti-tumor immunity against B16 melanoma in C57/BL6 mice, whereas control xenogeneic extracts and B16 tumor extracts where ineffective, or actually promoted tumor growth, respectively. Furthermore, dendritic cells were able to prime tumor immunity when pulsed with the placental xenoantigens. While vaccination-induced tumor regression was abolished in mice depleted of CD4 T cells, both CD4 and CD8 cells were needed to adoptively transfer immunity to naïve mice. Supporting the role of CD8 cells in controlling tumor growth are findings that only freshly isolated CD8 cells from immunized mice were capable of inducing tumor cell caspases-3 activation ex vivo. These data suggest feasibility of using xenogeneic placental preparations as a multivalent vaccine potently targeting not just tumor antigens, but processes that are essential for tumor maintenance of malignant potential.

  8. Immune system handling time may alter the outcome of competition between pathogens and the immune system.

    Science.gov (United States)

    Greenspoon, Philip B; Banton, Sydney; Mideo, Nicole

    2018-06-14

    Predators may be limited in their ability to kill prey (i.e., have type II or III functional responses), an insight that has had far-reaching consequences in the ecological literature. With few exceptions, however, this possibility has not been extended to the behaviour of immune cells, which kill pathogens much as predators kill their prey. Rather, models of the within-host environment have tended to tacitly assume that immune cells have an unlimited ability to target and kill pathogens (i.e., a type I functional response). Here we explore the effects of changing this assumption on infection outcomes (i.e., pathogen loads). We incorporate immune cell handling time into an ecological model of the within-host environment that considers both the predatory nature of the pathogen-immune cell interaction as well as competition between immune cells and pathogens for host resources. Unless pathogens can preempt immune cells for host resources, adding an immune cell handling time increases equilibrium pathogen load. We find that the shape of the relationship between energy intake and pathogen load can change: with a type I functional response, pathogen load is maximised at intermediate inputs, while for a type II or III functional response, pathogen load is solely increasing. With a type II functional response, pathogen load can fluctuate rather than settling to an equilibrium, a phenomenon unobserved with type I or III functional responses. Our work adds to a growing literature highlighting the role of resource availability in host-parasite interactions. Implications of our results for adaptive anorexia are discussed. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Immunizations and African Americans

    Science.gov (United States)

    ... Data > Minority Population Profiles > Black/African American > Immunizations Immunizations and African Americans African American adults are less ... 19 to 35 months had comparable rates of immunization. African American women are as likely to have ...

  10. Consumption of Dairy Yogurt Containing Lactobacillus paracasei ssp. paracasei, Bifidobacterium animalis ssp. lactis and Heat-Treated Lactobacillus plantarum Improves Immune Function Including Natural Killer Cell Activity

    Science.gov (United States)

    Lee, Ayoung; Lee, Young Ju; Yoo, Hye Jin; Kim, Minkyung; Chang, Yeeun; Lee, Dong Seog; Lee, Jong Ho

    2017-01-01

    The aim of this study was to investigate the impact of consuming dairy yogurt containing Lactobacillus paracasei ssp. paracasei (L. paracasei), Bifidobacterium animalis ssp. lactis (B. lactis) and heat-treated Lactobacillus plantarum (L. plantarum) on immune function. A randomized, open-label, placebo-controlled study was conducted on 200 nondiabetic subjects. Over a twelve-week period, the test group consumed dairy yogurt containing probiotics each day, whereas the placebo group consumed milk. Natural killer (NK) cell activity, interleukin (IL)-12 and immunoglobulin (Ig) G1 levels were significantly increased in the test group at twelve weeks compared to baseline. Additionally, the test group had significantly greater increases in serum NK cell activity and interferon (IFN)-γ and IgG1 than placebo group. Daily consumption of dairy yogurt containing L. paracasei, B. lactis and heat-treated L. plantarum could be an effective option to improve immune function by enhancing NK cell function and IFN-γ concentration (ClinicalTrials.gov: NCT03051425). PMID:28561762

  11. Consumption of Dairy Yogurt Containing Lactobacillus paracasei ssp. paracasei, Bifidobacterium animalis ssp. lactis and Heat-Treated Lactobacillus plantarum Improves Immune Function Including Natural Killer Cell Activity

    Directory of Open Access Journals (Sweden)

    Ayoung Lee

    2017-05-01

    Full Text Available The aim of this study was to investigate the impact of consuming dairy yogurt containing Lactobacillus paracasei ssp. paracasei (L. paracasei, Bifidobacterium animalis ssp. lactis (B. lactis and heat-treated Lactobacillus plantarum (L. plantarum on immune function. A randomized, open-label, placebo-controlled study was conducted on 200 nondiabetic subjects. Over a twelve-week period, the test group consumed dairy yogurt containing probiotics each day, whereas the placebo group consumed milk. Natural killer (NK cell activity, interleukin (IL-12 and immunoglobulin (Ig G1 levels were significantly increased in the test group at twelve weeks compared to baseline. Additionally, the test group had significantly greater increases in serum NK cell activity and interferon (IFN-γ and IgG1 than placebo group. Daily consumption of dairy yogurt containing L. paracasei, B. lactis and heat-treated L. plantarum could be an effective option to improve immune function by enhancing NK cell function and IFN-γ concentration (ClinicalTrials.gov: NCT03051425.

  12. Consumption of Dairy Yogurt Containing Lactobacillus paracasei ssp. paracasei, Bifidobacterium animalis ssp. lactis and Heat-Treated Lactobacillus plantarum Improves Immune Function Including Natural Killer Cell Activity.

    Science.gov (United States)

    Lee, Ayoung; Lee, Young Ju; Yoo, Hye Jin; Kim, Minkyung; Chang, Yeeun; Lee, Dong Seog; Lee, Jong Ho

    2017-05-31

    The aim of this study was to investigate the impact of consuming dairy yogurt containing Lactobacillus paracasei ssp. paracasei ( L. paracasei ), Bifidobacterium animalis ssp. lactis ( B. lactis ) and heat-treated Lactobacillus plantarum ( L. plantarum ) on immune function. A randomized, open-label, placebo-controlled study was conducted on 200 nondiabetic subjects. Over a twelve-week period, the test group consumed dairy yogurt containing probiotics each day, whereas the placebo group consumed milk. Natural killer (NK) cell activity, interleukin (IL)-12 and immunoglobulin (Ig) G1 levels were significantly increased in the test group at twelve weeks compared to baseline. Additionally, the test group had significantly greater increases in serum NK cell activity and interferon (IFN)-γ and IgG1 than placebo group. Daily consumption of dairy yogurt containing L. paracasei , B. lactis and heat-treated L. plantarum could be an effective option to improve immune function by enhancing NK cell function and IFN-γ concentration (ClinicalTrials.gov: NCT03051425).

  13. Zinc and immunity: An essential interrelation.

    Science.gov (United States)

    Maares, Maria; Haase, Hajo

    2016-12-01

    The significance of the essential trace element zinc for immune function has been known for several decades. Zinc deficiency affects immune cells, resulting in altered host defense, increased risk of inflammation, and even death. The micronutrient zinc is important for maintenance and development of immune cells of both the innate and adaptive immune system. A disrupted zinc homeostasis affects these cells, leading to impaired formation, activation, and maturation of lymphocytes, disturbed intercellular communication via cytokines, and weakened innate host defense via phagocytosis and oxidative burst. This review outlines the connection between zinc and immunity by giving a survey on the major roles of zinc in immune cell function, and their potential consequences in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Anti-Tribbles Pseudokinase 2 (TRIB2)-Immunization Modulates Hypocretin/Orexin Neuronal Functions.

    Science.gov (United States)

    Tanaka, Susumu; Honda, Yoshiko; Honda, Makoto; Yamada, Hisao; Honda, Kazuki; Kodama, Tohru

    2017-01-01

    Recent findings showed that 16%-26% of narcolepsy patients were positive for anti-tribbles pseudokinase 2 (TRIB2) antibody, and the intracerebroventricular administration of immunoglobulin-G purified from anti-TRIB2 positive narcolepsy patients caused hypocretin/orexin neuron loss. We investigated the pathophysiological role of TRIB2 antibody using TRIB2-immunized rats and hypocretin/ataxin-3 transgenic (ataxin-3) mice. Plasma, cerebrospinal fluid (CSF), and hypothalamic tissues from TRIB2-immunized rats were collected. Anti-TRIB2 titers, hypocretin contents, mRNA expressions, the cell count of hypocretin neurons, and immunoreactivity of anti-TRIB2 antibodies on hypocretin neurons were investigated. The plasma from ataxin-3 mice was also used to determine the anti-TRIB2 antibody titer changes following the loss of hypocretin neurons. TRIB2 antibody titers increased in the plasma and CSF of TRIB2-immunized rats. The hypothalamic tissue immunostained with the sera from TRIB2-immunized rats revealed positive signals in the cytoplasm of hypcretin neurons. While no changes were found regarding hypothalamic hypocretin contents or cell counts, but there were significant decreases of the hypocretin mRNA level and release into the CSF. The plasma from over 26-week-old ataxin-3 mice, at the advanced stage of hypocretin cell destruction, showed positive reactions against TRIB2 antigen, and positive plasma also reacted with murine hypothalamic hypocretin neurons. Our results suggest that the general activation of the immune system modulates the functions of hypocretin neurons. The absence of a change in hypocretin cell populations suggested that factors other than anti-TRIB2 antibody play a part in the loss of hypocretin neurons in narcolepsy. The increased anti-TRIB2 antibody after the destruction of hypocretin neurons suggest that anti-TRIB2 antibody in narcolepsy patients is the consequence rather than the inciting cause of hypocretin cell destruction. © Sleep Research

  15. Effects of 12-Week’s Tai Chi Chuan Practice on the Immune Function of Female College Students Who Lack Physical Exercise

    Directory of Open Access Journals (Sweden)

    M-Y. Wang

    2011-03-01

    Full Text Available Objective: The present study investigated the effects of 12 weeks’ tai chi chuan (TCC practice on the immune function of female college students. Method: 60 female college students (19.3 ± 1.8 years were recruited and were randomly assigned to either the TCC training (n=30 or the control group (n=30. In the TCC group, the exercise duration was 45 minutes per day and 5 days a week for 12 weeks. The TCC group performed TCC under the teaching of a TCC master. Immunoglobulin G (IgG, IgA, IgM, Cluster of differentiation 3 (CD3, CD4 , CD8 , interferon γ (IFN-γ, interleukin 4 (IL-4 and IL-12 were measured before and after 12 weeks of TCC practice. Results: The TCC group had significantly higher plasma levels of IgG (P=0.000, IgM (P=0.05 and CD4 (P=0.032 after practice compared with their respective pre-practice levels. There were no significant differences in IgA, CD3, IFN-γ, IL-4 or IL-12, but IgA and IFN-γ levels increased and IL-12 decreased within the normal range. Conclusion: The results suggest that regular long-term TCC practice might be a potential method to improve the cellular immune function (anti-virus and anti-infection of people who lack physical exercise. Further studies concerning other immune aspects are needed.

  16. Perturbation of cellular immune functions in cigarette smokers and protection by palm oil vitamin E supplementation

    Directory of Open Access Journals (Sweden)

    Jubri Zakiah

    2013-01-01

    Full Text Available Abstract Background Cigarette smoke contains free radicals and an have adverse effect to the immune system. Supplementation of palm oil vitamin E (palmvitee, is known has antioxidant properties is thought to be beneficial for system immune protection against free radicals activity. The objective of the study was to determine the effect of palmvitee supplementation on immune response in smokers. Methods This study involved a group of smokers and nonsmokers who received 200 mg/day palmvitee and placebo for the control group. Blood samples were taken at 0, 12 and 24 weeks of supplementation. Plasma tocopherol and tocotrienol were determined by HPLC, lymphocyte proliferation by lymphocyte transformation test (LTT and enumeration of lymphocytes T and B cells by flow cytometry. Statistical analysis was performed by Mann–Whitney U-test for non-parametric data distribution and correlation among the variables was examined by Spearman. Results Plasma tocopherol and tocotrienol were increased in vitamin E supplemented group as compared to placebo group. Urine cotinine levels and serum α1-antitrypsin were significantly higher in smokers compared to nonsmokers. Lymphocyte proliferation induced by PHA showed an increasing trend with palmvitee supplementation in both smokers and nonsmokers. Natural killer cells were decreased; CD4+ cells and B cells were increased in smokers compared to nonsmokers but were unaffected with vitamin E supplementation except in the percentage of B cells which were increased in nonsmokers supplemented palmvitee compared to placebo. CD4+/CD8+ ratio was increased in smokers compared to nonsmokers. The high TWBC count observed in smokers correlated with the increased CD4+ and B cells. Conclusions Smoking caused alterations in certain immune parameters and palmvitee supplementation tended to cause an increase in lymphocytes transformation test but had no effect on CD3+, CD4+, CD8+, NK cells and B cells except B cells percentage

  17. Studies on the protection effects of functional foods for skin immune system from radiation damage

    International Nuclear Information System (INIS)

    Yee, Sung Tae; Shin, Seong Hae; Kim, Do Sun; Heo, Ji Yun; Kang, Hye In

    2007-07-01

    We evaluated the protective effects of pilot products (HemoHIM and HemoTonic) on the UV-induced skin immune damages as the following. · Protective effects of HemoHIM and HemoTonic against UV using contact hypersensitivity model - Protection against depression of contact hypersensitivity by administration and skin application of HemoHIM and HemoTonic - Induction of dendritic cell differentiation and maturation by HemoHIM and HemoTonic treatment - Improvement of antigen-presenting activity of dedritic cells by HemoHIM and HemoTonic treatment · Protective effects of HemoHIM and HemoTonic on skin immune system against UV-irradiation - Protection of antigen-presenting activity of dendritic cells under UV-irradiation - In vivo protection of antigen-presenting activity of Langerhans cells in UV-irradiated mice · Protective effects of HemoHIM on UV-induced apoptosis of dendritic cells - Inhibition of cell membrane change, mitochondrial potential change, SubG1 cell population, nuclear condensation, and DNA fragmentation in UV-irradiated dendritic cells · Anti-allergic effects of HemoHIM and HemoTonic in human adipocyte HMC-1 cells - Inhibition of allergic histamine release from adipocytes - Inhibition of secretion of inflammatory cytokines (IL-6, IL-8, TNF-α, GM-CSF) - Inhibition of c-kit, tryptase, FcεRI mRNA expression From these results, the developed functional food products (HemoHIM, HemoTonic) showed the protection and recovery of the immune functions in the UV-irradiated skin. It is suggested that these products may be used as a new functional food or cosmetic material for the protection of skin damage and the promotion of recovery

  18. Early life innate immune signatures of persistent food allergy.

    Science.gov (United States)

    Neeland, Melanie R; Koplin, Jennifer J; Dang, Thanh D; Dharmage, Shyamali C; Tang, Mimi L; Prescott, Susan L; Saffery, Richard; Martino, David J; Allen, Katrina J

    2017-11-14

    Food allergy naturally resolves in a proportion of food-allergic children without intervention; however the underlying mechanisms governing the persistence or resolution of food allergy in childhood are not understood. This study aimed to define the innate immune profiles associated with egg allergy at age 1 year, determine the phenotypic changes that occur with the development of natural tolerance in childhood, and explore the relationship between early life innate immune function and serum vitamin D. This study used longitudinally collected PBMC samples from a population-based cohort of challenge-confirmed egg-allergic infants with either persistent or transient egg allergy outcomes in childhood to phenotype and quantify the functional innate immune response associated with clinical phenotypes of egg allergy. We show that infants with persistent egg allergy exhibit a unique innate immune signature, characterized by increased numbers of circulating monocytes and dendritic cells that produce more inflammatory cytokines both at baseline and following endotoxin exposure when compared with infants with transient egg allergy. Follow-up analysis revealed that this unique innate immune signature continues into childhood in those with persistent egg allergy and that increased serum vitamin D levels correlate with changes in innate immune profiles observed in children who developed natural tolerance to egg. Early life innate immune dysfunction may represent a key immunological driver and predictor of persistent food allergy in childhood. Serum vitamin D may play an immune-modulatory role in the development of natural tolerance. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  19. Zymosan-induced immune challenge modifies the stress response of hypoxic air-breathing fish (Anabas testudineus Bloch): Evidence for reversed patterns of cortisol and thyroid hormone interaction, differential ion transporter functions and non-specific immune response.

    Science.gov (United States)

    Simi, S; Peter, Valsa S; Peter, M C Subhash

    2017-09-15

    Fishes have evolved physiological mechanisms to exhibit stress response, where hormonal signals interact with an array of ion transporters and regulate homeostasis. As major ion transport regulators in fish, cortisol and thyroid hormones have been shown to interact and fine-tune the stress response. Likewise, in fishes many interactions have been identified between stress and immune components, but the physiological basis of such interaction has not yet delineated particularly in air-breathing fish. We, therefore, investigated the responses of thyroid hormones and cortisol, ion transporter functions and non-specific immune response of an obligate air-breathing fish Anabas testudineus Bloch to zymosan treatment or hypoxia stress or both, to understand how immune challenge modifies the pattern of stress response in this fish. Induction of experimental peritonitis in these fish by zymosan treatment (200ngg -1 ) for 24h produced rise in respiratory burst and lysozomal activities in head kidney phagocytes. In contrast, hypoxia stress for 30min in immune-challenged fish reversed these non-specific responses of head kidney phagocytes. The decline in plasma cortisol in zymosan-treated fish and its further suppression by hypoxia stress indicate that immune challenge suppresses the cortisol-driven stress response of this fish. Likewise, the decline in plasma T 3 and T 4 after zymosan-treatment and the rise in plasma T 4 after hypoxia stress in immune-challenged fish indicate a critical role for thyroid hormone in immune-stress response due to its differential sensitivity to both immune and stress challenges. Further, analysis of the activity pattern of ion-dependent ATPases viz. Na + /K + -ATPase, H + /K + -ATPase and Na + /NH 4 + -ATPase indicates a functional interaction of ion transport system with the immune response as evident in its differential and spatial modifications after hypoxia stress in immune-challenged fish. The immune-challenge that produced differential

  20. Neutrophil degranulation and immunosuppression in patients with GBM: restoration of cellular immune function by targeting arginase I.

    Science.gov (United States)

    Sippel, Trisha R; White, Jason; Nag, Kamalika; Tsvankin, Vadim; Klaassen, Marci; Kleinschmidt-DeMasters, B K; Waziri, Allen

    2011-11-15

    The source of glioblastoma (GBM)-associated immunosuppression remains multifactorial. We sought to clarify and therapeutically target myeloid cell-derived peripheral immunosuppression in patients with GBM. Direct ex vivo T-cell function, serum Arginase I (ArgI) levels, and circulating myeloid lineage populations were compared between patients with GBM and normal donors or patients with other intracranial tumors. Immunofunctional assays were conducted using bulk and sorted cell populations to explore the potential transfer of myeloid cell-mediated immunosuppression and to identify a potential mechanism for these effects. ArgI-mediated immunosuppression was therapeutically targeted in vitro through pharmacologic inhibition or arginine supplementation. We identified a significantly expanded population of circulating, degranulated neutrophils associated with elevated levels of serum ArgI and decreased T-cell CD3ζ expression within peripheral blood from patients with GBM. Sorted CD11b(+) cells from patients with GBM were found to markedly suppress normal donor T-cell function in coculture, and media harvested from mitogen-stimulated GBM peripheral blood mononuclear cell (PBMC) or GBM-associated mixed lymphoid reactions showed ArgI levels that were significantly higher than controls. Critically, T-cell suppression in both settings could be completely reversed through pharmacologic ArgI inhibition or with arginine supplementation. These data indicate that peripheral cellular immunosuppression in patients with GBM is associated with neutrophil degranulation and elevated levels of circulating ArgI, and that T-cell function can be restored in these individuals by targeting ArgI. These data identify a novel pathway of GBM-mediated suppression of cellular immunity and offer a potential therapeutic window for improving antitumor immunity in affected patients.

  1. Hepatitis B virus surface antigen impairs myeloid dendritic cell function: a possible immune escape mechanism of hepatitis B virus

    Science.gov (United States)

    Op den Brouw, Marjoleine L; Binda, Rekha S; van Roosmalen, Mark H; Protzer, Ulrike; Janssen, Harry L A; van der Molen, Renate G; Woltman, Andrea M

    2009-01-01

    Chronic hepatitis B virus (HBV) infection is the result of an inadequate immune response towards the virus. Myeloid dendritic cells (mDC) of patients with chronic HBV are impaired in their maturation and function, resulting in more tolerogenic rather than immunogenic responses, which may contribute to viral persistence. The mechanism responsible for altered mDC function remains unclear. The HBV-infected patients display large amounts of HBV particles and viral proteins in their circulation, especially the surface antigen HBsAg, which allows multiple interactions between the virus, its viral proteins and DC. To assess whether HBV directly influences mDC function, the effects of HBV and HBsAg on human mDC maturation and function were investigated in vitro. As already described for internalization of HBV by DC, the present study shows that peripheral blood-derived mDC of healthy controls also actively take up HBsAg in a time-dependent manner. Cytokine-induced maturation in the presence of HBV or HBsAg resulted in a significantly more tolerogenic mDC phenotype as demonstrated by a diminished up-regulation of costimulatory molecules and a decreased T-cell stimulatory capacity, as assessed by T-cell proliferation and interferon-γ production. In addition, the presence of HBV significantly reduced interleukin-12 production by mDC. These results show that both HBV particles and purified HBsAg have an immune modulatory capacity and may directly contribute to the dysfunction of mDC in patients with chronic HBV. The direct immune regulatory effect of HBV and circulating HBsAg particles on the function of DC can be considered as part of the mechanism by which HBV escapes immunity. PMID:18624732

  2. [Changes in serum YKL-40 level and humoral immune function and their significance in children with recurrent pneumonia].

    Science.gov (United States)

    Ma, Wei-Yin; Peng, Shao; Zhang, Ting

    2017-04-01

    To investigate the changes in serum YKL-40 level and humoral immune function and their significance in children with recurrent pneumonia. Blood samples were collected from 30 children with recurrent pneumonia (recurrent pneumonia group), 30 children with acute pneumonia (acute pneumonia group), and 30 healthy children (control group). Serum YKL-40 levels were measured by enzyme-linked immunosorbent assay. The correlation between serum YKL-40 level and laboratory indices related to humoral immune function was analyzed. The receiver operating characteristic (ROC) curve was used to analyze the diagnostic value of serum YKL-40 level for recurrent pneumonia. The recurrent pneumonia group had a significantly higher serum YKL-40 level than the acute pneumonia and control groups (Ppneumonia group had a significantly higher serum YKL-40 level than the control group (Ppneumonia group were significantly lower than in the acute pneumonia group (Ppneumonia was 0.958 (95%CI: 0.921-0.994). Humoral immune function is low in children with recurrent pneumonia. Serum YKL-40 may be involved in the occurrence of recurrent pneumonia and can be used as a reference index for diagnosing recurrent pneumonia.

  3. Vitamin E, immunity, and infection

    Science.gov (United States)

    A normally functioning immune system is critical for the body to fight and eliminate invading pathogens from the environment. On the other hand, the immune system also protects the body from internal risks such as neoplasia growing within and autoimmune responses that attack self. The immune system ...

  4. CMV immune evasion and manipulation of the immune system with aging.

    Science.gov (United States)

    Jackson, Sarah E; Redeker, Anke; Arens, Ramon; van Baarle, Debbie; van den Berg, Sara P H; Benedict, Chris A; Čičin-Šain, Luka; Hill, Ann B; Wills, Mark R

    2017-06-01

    Human cytomegalovirus (HCMV) encodes numerous proteins and microRNAs that function to evade the immune response and allow the virus to replicate and disseminate in the face of a competent innate and acquired immune system. The establishment of a latent infection by CMV, which if completely quiescent at the level of viral gene expression would represent an ultimate in immune evasion strategies, is not sufficient for lifelong persistence and dissemination of the virus. CMV needs to reactivate and replicate in a lytic cycle of infection in order to disseminate further, which occurs in the face of a fully primed secondary immune response. Without reactivation, latency itself would be redundant for the virus. It is also becoming clear that latency is not a totally quiescent state, but is characterized by limited viral gene expression. Therefore, the virus also needs immune evasion strategies during latency. An effective immune response to CMV is required or viral replication will cause morbidity and ultimately mortality in the host. There is clearly a complex balance between virus immune evasion and host immune recognition over a lifetime. This poses the important question of whether long-term evasion or manipulation of the immune response driven by CMV is detrimental to health. In this meeting report, three groups used the murine model of CMV (MCMV) to examine if the contribution of the virus to immune senescence is set by the (i) initial viral inoculum, (ii) inflation of T cell responses, (iii) or the balance between functionally distinct effector CD4+ T cells. The work of other groups studying the CMV response in humans is discussed. Their work asks whether the ability to make immune responses to new antigens is compromised by (i) age and HCMV carriage, (ii) long-term exposure to HCMV giving rise to an overall immunosuppressive environment and increased levels of latent virus, or (iii) adapted virus mutants (used as potential vaccines) that have the capacity to

  5. Insect immunity shows specificity in protection upon secondary pathogen exposure.

    Science.gov (United States)

    Sadd, Ben M; Schmid-Hempel, Paul

    2006-06-20

    Immunological memory in vertebrates, conferring lasting specific protection after an initial pathogen exposure, has implications for a broad spectrum of evolutionary, epidemiological, and medical phenomena . However, the existence of specificity in protection upon secondary pathogen exposure in invertebrates remains controversial . To separate this functional phenomenon from a particular mechanism, we refer to it as specific immune priming. We investigate the presence of specific immune priming in workers of the social insect Bombus terrestris. Using three bacterial pathogens, we test whether a prior homologous pathogen exposure gives a benefit in terms of long-term protection against a later challenge, over and above a heterologous combination. With a reciprocally designed initial and second-exposure protocol (i.e., all combinations of bacteria were tested), we demonstrate, even several weeks after the clearance of a first exposure, increased protection and narrow specificity upon secondary exposure. This demonstrates that the invertebrate immune system is functionally capable of unexpectedly specific and durable induced protection. Ultimately, despite general broad differences between vertebrates and invertebrates, the ability of both immune systems to show specificity in protection suggests that their immune defenses have found comparable solutions to similar selective pressures over evolutionary time.

  6. Prenatal cadmium exposure alters postnatal immune cell development and function

    Energy Technology Data Exchange (ETDEWEB)

    Hanson, Miranda L.; Holásková, Ida; Elliott, Meenal; Brundage, Kathleen M.; Schafer, Rosana; Barnett, John B., E-mail: jbarnett@hsc.wvu.edu

    2012-06-01

    Cadmium (Cd) is generally found in low concentrations in the environment due to its widespread and continual use, however, its concentration in some foods and cigarette smoke is high. Although evidence demonstrates that adult exposure to Cd causes changes in the immune system, there are limited reports of immunomodulatory effects of prenatal exposure to Cd. This study was designed to investigate the effects of prenatal exposure to Cd on the immune system of the offspring. Pregnant C57Bl/6 mice were exposed to an environmentally relevant dose of CdCl{sub 2} (10 ppm) and the effects on the immune system of the offspring were assessed at two time points following birth (2 and 7 weeks of age). Thymocyte and splenocyte phenotypes were analyzed by flow cytometry. Prenatal Cd exposure did not affect thymocyte populations at 2 and 7 weeks of age. In the spleen, the only significant effect on phenotype was a decrease in the number of macrophages in male offspring at both time points. Analysis of cytokine production by stimulated splenocytes demonstrated that prenatal Cd exposure decreased IL-2 and IL-4 production by cells from female offspring at 2 weeks of age. At 7 weeks of age, splenocyte IL-2 production was decreased in Cd-exposed males while IFN-γ production was decreased from both male and female Cd-exposed offspring. The ability of the Cd-exposed offspring to respond to immunization with a S. pneumoniae vaccine expressing T-dependent and T-independent streptococcal antigens showed marked increases in the levels of both T-dependent and T-independent serum antibody levels compared to control animals. CD4{sup +}FoxP3{sup +}CD25{sup +} (nTreg) cell percentages were increased in the spleen and thymus in all Cd-exposed offspring except in the female spleen where a decrease was seen. CD8{sup +}CD223{sup +} T cells were markedly decreased in the spleens in all offspring at 7 weeks of age. These findings suggest that even very low levels of Cd exposure during gestation can

  7. Reversibility of alcohol-induced immune depression

    DEFF Research Database (Denmark)

    Tønnesen, H; Kaiser, A H; Nielsen, B B

    1992-01-01

    Alcohol abusers have suppressed cellular immune function. The aim of the study was to investigate the time of sobriety required to normalize immune function. Delayed hypersensitivity was investigated during disulfiram controlled abstinence in ten heavy alcoholics and in seven moderate drinkers...... months of abstinence. The results suggest that while 2 weeks of abstinence from alcohol will improve the depressed cellular immunity, 2 months of sobriety is necessary to normalize it....

  8. Effect of S-1 combined with oxaliplatin on serum tumor markers, matrix metalloproteinase and immune function in elderly patients with gastric cancer

    Directory of Open Access Journals (Sweden)

    Yong-Feng Shan

    2017-10-01

    Full Text Available Objective: To investigate the effect of Compound Tegafur and Oteracil Potassium Sustained Capsules (S-1 combined with oxaliplatin chemotherapy on serum tumor marker matrix metalloproteinase and immune function in elderly patients with gastric cancer. Methods: According to the random data table, 80 cases of elderly patients with gastric cancer were divided into control group and observation group (n=40, patients in the control group were treated with oxaliplatin combined with Capecitabine Tablets, and the observation group patients were treated with S-1 combined with oxaliplatin, all treated for 6 cycles, before and after treatment, levels of serum tumor markers, matrix metalloproteinase and immune function were compared between the two groups. Results: Before treatment, there was no significant difference in the levels of CEA, CA125, CA19-9, MMP-2, MMP-9, CD3 + , CD4 + , CD8 + and CD4 + /CD8 + between the two groups; After treatment, the levels of CEA, CA125, CA19-9, MMP-2, MMP-9 and CD8 + in the two groups were significantly lower than those in the same group before treatment, and the levels of the observation group[(7.79±2.78 ng/ mL, (22.56±7.31 U/mL, (13.48±3.05 U/mL, (57.84±8.93 ng/mL, (199.14±67.39 ng/ mL and (26.21±4.18%] were significantly lower than those in the control group; Compared with the group before treatment, the levels of CD3 + , CD4 + and CD4 + /CD8 + in the two groups were significantly increased, and the observation group [(66.89±5.84%, (41.63±5.24% and (1.37±0.29] was significantly higher than the control group. Conclusion: S-1 combined with oxaliplatin chemotherapy can effectively reduce serum tumor markers and matrix metalloproteinase levels, improve immune function, has an important clinical value.

  9. Pregnancy immunology: decidual immune cells.

    Science.gov (United States)

    Sanguansermsri, Donruedee; Pongcharoen, Sutatip

    2008-01-01

    Human pregnancy is a complex process. Placental development depends on the function of secretory molecules produced by placental trophoblast cells as well as by maternal uterine immune cells within the decidua. These decidual immune cells are T cells, natural killer cells, macrophages and dendritic cells. The interactions between the trophoblast cells and the maternal immune cells have an impact on the outcome of the pregnancy. Knowledge about the phenotypes and functions of the maternal immune cells in normal and pathological pregnancies including recurrent spontaneous abortions, preeclampsia and hydatidiform moles may improve our understanding of the immunobiology of the normal pregnancy as a whole and may provide approaches for improving the treatment of pathological pregnancies.

  10. Stressor Controllability and Immune Function

    Science.gov (United States)

    1986-10-17

    susceptibility to infectious disease . In E. Kurstak, P. V. Morozov, & Z. P. Lipowski (Eds.), Viruses , immunity, and mental health. Plenum Press, in press. w...following inmunization . a. ELISA Procedure. We-Tsof a flat bottomed microtiter plate (NUNC, certified Immunopla.e I) were coated with KLH (0.2 mi/well, 0.5 mg...because the, rats were being infected with viruses and other agents tnat could alter proliferation. We thus began to purchase pathogen-free animals and

  11. Influence on the mouse immune system of chronic ingestion of 137Cs

    International Nuclear Information System (INIS)

    Bertho, Jean-Marc; Faure, Marie-Cecile; Louiba, Sonia; Tourlonias, Elie; Stefani, Johanna; Siffert, Baptiste; Paquet, Francois; Dublineau, Isabelle

    2011-01-01

    The aim of this work was to determine the possible occurrence of damage to the immune system during the course of chronic ingestion of 137 Cs. BALB/C mice were used, with 137 Cs intake via drinking water at a concentration of 20 kBq l -1 . Adults received 137 Cs before mating and offspring were sacrificed at various ages between birth and 20 weeks. Phenotypic analysis of circulating blood cells and thymocytes did not show any significant modification of immune cell populations in animals ingesting 137 Cs as compared with control animals, with the exception of a slight increase in Treg percentage at the age of 12 weeks. Functional tests, including proliferative response to mitogens such as phytohaemagglutinin, response to alloantigens in mixed lymphocyte reaction and immunoglobulin response to vaccine antigens such as tetanus toxin and keyhole limpet haemocyanin did not show any significant functional modification of the immune system in 137 Cs-ingesting animals as compared with control animals. Overall, our results suggest that chronic ingestion of a low concentration of 137 Cs in drinking water in the long term does not have any biologically relevant effect on the immune system.

  12. Immune-Modulating Perspectives for Low Frequency Electromagnetic Fields in Innate Immunity

    Directory of Open Access Journals (Sweden)

    Maria Manuela Rosado

    2018-03-01

    Full Text Available In recent years, the effects of electromagnetic fields (EMFs on the immune system have received a considerable interest, not only to investigate possible negative health impact but also to explore the possibility to favorably modulate immune responses. To generate beneficial responses, the immune system should eradicate pathogens while “respecting” the organism and tolerating irrelevant antigens. According to the current view, damage-associated molecules released by infected or injured cells, or secreted by innate immune cells generate danger signals activating an immune response. These signals are also relevant to the subsequent activation of homeostatic mechanisms that control the immune response in pro- or anti-inflammatory reactions, a feature that allows modulation by therapeutic treatments. In the present review, we describe and discuss the effects of extremely low frequency (ELF-EMF and pulsed EMF on cell signals and factors relevant to the activation of danger signals and innate immunity cells. By discussing the EMF modulating effects on cell functions, we envisage the use of EMF as a therapeutic agent to regulate immune responses associated with wound healing.

  13. Effect of glutamine-enriched nutritional support on intestinal mucosal barrier function, MMP-2, MMP-9 and immune function in patients with advanced gastric cancer during perioperative chemotherapy.

    Science.gov (United States)

    Wang, Juan; Li, Yanfen; Qi, Yuanling

    2017-09-01

    We studied the effects of glutamine-enriched nutritional support on intestinal mucosal barrier, matrix metalloproteinase (MMP)-2, MMP-9 and immune function during perioperative chemotherapy in patients with advanced gastric cancer. The study was conducted on 94 patients with advanced gastric cancer admitted from April 2015 to March 2016. They were randomly divided into observation and control groups, n=47. Control group was given basic nutritional support whereas glutamine-enriched nutritional support was given to patients in observation group. High-performance liquid chromatography was used to measure lactulose and mannitol ratio in urine (L/M) and ELISA was used to measure D-lactate levels before chemotherapy and in the 1st, 2nd and 3rd cycle of chemotherapy. Immunoglobulin level was detected by immune turbidimetry assay, T lymphocyte subsets were determined by flow cytometry after 3 cycles of chemotherapy, MMP-2 and MMP-9 of patients were compared between the two groups. The serious adverse reactions incidence (grade and IV) of patients were observed. To evaluate the life quality of patients, QLQ-C30 was used after 6 months. The levels of L/M and D-lactate in both groups after the first cycle of chemotherapy were significantly higher than that before chemotherapy; they began to decline after the second or third cycle, but were still significantly higher than the levels before chemotherapy (pgroups after 1st, 2nd, 3rd cycle after chemotherapy, L/M and D-lactate levels of patients in the observation group were significantly lower than in the control group (pgroup was significantly lower than control group (pgroup were significantly higher than control group (pnutritional support can effectively protect the intestinal mucosal barrier function in patients with advanced gastric cancer in their perioperative chemotherapy, improve the level of MMP-2 and MMP-9 in patients with advanced gastric cancer, enhance their immune function, reduce the incidence of adverse

  14. Role of the Ca2+-Calcineurin-Nuclear Factor of Activated T cell Pathway in Mitofusin-2-Mediated Immune Function of Jurkat Cells

    Directory of Open Access Journals (Sweden)

    Xiu-Ping Xu

    2018-01-01

    Conclusions: Our findings suggest that MFN2 may regulate T cell immune functions primarily through the Ca2+-calcineurin-NFAT pathway. MFN2 may represent a potential therapeutic target for T cell immune dysfunction-related diseases.

  15. The effect of perioperative analgesic drugs omnopon and dexketoprofen on the functional activity of immune cells in murine model of tumor surgery.

    Science.gov (United States)

    Sydor, R I; Khranovska, N M; Skachkova, O V; Skivka, L M

    2016-01-01

    We aimed to investigate the effect of perioperative analgesia with nonselective cyclooxygenase-2 inhibitor dexketoprofen and opioid drug omnopon on the functional activity of immune cells in tumor excision murine model. Lewis lung carcinoma cells were transplanted into hind paw of C57/black mice. On the 23th day tumor was removed. Analgesic drugs were injected 30 min before and once a day for 3 days after the surgery. Biological material was obtained a day before, 1 day and 3 days after the tumor removal. IFN-γ, IL-4, IL-10 and TGF-β mRNA levels in splenic cells were assessed by quantitative real-time RT-PCR. Cytotoxic activity of splenocytes was estimated by flow cytometry. We found that in splenocytes of mice received opioid analgesia IL-10 mRNA level was increased 2.3 times on day one after the surgery compared to preoperative level (P dexketoprofen group this parameter did not change. IFN-γ gene expression level on day 3 after tumor removal was 40% higher in splenocytes of dexketoprofen treated mice as compared with omnopon treated animals (P dexketoprofen against (50.2 ± 3.3)% in omnopon group. In conclusion, perioperative analgesia with cyclooxygenase inhibitor dexketoprofen in contrast to opioid analgesia with omnopon preserves higher functional activity of murine immune cells in the experimental model of tumor surgery.

  16. Cheetahs have a stronger constitutive innate immunity than leopards.

    Science.gov (United States)

    Heinrich, Sonja K; Hofer, Heribert; Courtiol, Alexandre; Melzheimer, Jörg; Dehnhard, Martin; Czirják, Gábor Á; Wachter, Bettina

    2017-03-23

    As a textbook case for the importance of genetics in conservation, absence of genetic variability at the major histocompatibility complex (MHC) is thought to endanger species viability, since it is considered crucial for pathogen resistance. An alternative view of the immune system inspired by life history theory posits that a strong response should evolve in other components of the immune system if there is little variation in the MHC. In contrast to the leopard (Panthera pardus), the cheetah (Acinonyx jubatus) has a relatively low genetic variability at the MHC, yet free-ranging cheetahs are healthy. By comparing the functional competence of the humoral immune system of both species in sympatric populations in Namibia, we demonstrate that cheetahs have a higher constitutive innate but lower induced innate and adaptive immunity than leopards. We conclude (1) immunocompetence of cheetahs is higher than previously thought; (2) studying both innate and adaptive components of immune systems will enrich conservation science.

  17. Transplantation of β-endorphin neurons into the hypothalamus promotes immune function and restricts the growth and metastasis of mammary carcinoma.

    Science.gov (United States)

    Sarkar, Dipak K; Zhang, Changqing; Murugan, Sengottuvelan; Dokur, Madhavi; Boyadjieva, Nadka I; Ortigüela, Maria; Reuhl, Kenneth R; Mojtehedzadeh, Sepide

    2011-10-01

    Neurobehavioral stress has been shown to promote tumor growth and progression and dampen the immune system. In this study, we investigated whether inhibiting stress hormone production could inhibit the development of mammary carcinoma and metastasis in a rat model of breast carcinogenesis. To enhance β-endorphin (BEP), the endogenous opioid polypeptide that boosts immune activity and decreases stress, we generated BEP neurons by in vitro differentiation from fetal neuronal stem cells and transplanted them into the hypothalami of rats subjected to breast carcinogenesis. BEP-transplanted rats displayed a reduction in mammary tumor incidence, growth, malignancy rate, and metastasis compared with cortical cells-transplanted rats. BEP neuron transplants also reduced inflammation and epithelial to mesenchymal transition in the tumor tissues. In addition, BEP neuron transplants increased peripheral natural killer (NK) cell and macrophage activities, elevated plasma levels of antiinflammatory cytokines, and reduced plasma levels of inflammatory cytokines. Antimetastatic effects along with stimulation of NK cells and macrophages could be reversed by treatment with the opiate antagonist naloxone, the β-receptor agonist metaproterenol, or the nicotine acetylcholine receptor antagonist methyllycaconitine. Together, our findings establish a protective role for BEP against the growth and metastasis of mammary tumor cells by altering autonomic nervous system activities that enhance innate immune function.

  18. Loss of function JAK1 mutations occur at high frequency in cancers with microsatellite instability and are suggestive of immune evasion.

    Science.gov (United States)

    Albacker, Lee A; Wu, Jeremy; Smith, Peter; Warmuth, Markus; Stephens, Philip J; Zhu, Ping; Yu, Lihua; Chmielecki, Juliann

    2017-01-01

    Immune evasion is a well-recognized hallmark of cancer and recent studies with immunotherapy agents have suggested that tumors with increased numbers of neoantigens elicit greater immune responses. We hypothesized that the immune system presents a common selective pressure on high mutation burden tumors and therefore immune evasion mutations would be enriched in high mutation burden tumors. The JAK family of kinases is required for the signaling of a host of immune modulators in tumor, stromal, and immune cells. Therefore, we analyzed alterations in this family for the hypothesized signature of an immune evasion mutation. Here, we searched a database of 61,704 unique solid tumors for alterations in the JAK family kinases (JAK1/2/3, TYK2). We used The Cancer Genome Atlas and Cancer Cell Line Encyclopedia data to confirm and extend our findings by analyzing gene expression patterns. Recurrent frameshift mutations in JAK1 were associated with high mutation burden and microsatellite instability. These mutations occurred in multiple tumor types including endometrial, colorectal, stomach, and prostate carcinomas. Analyzing gene expression signatures in endometrial and stomach adenocarcinomas revealed that tumors with a JAK1 frameshift exhibited reduced expression of interferon response signatures and multiple anti-tumor immune signatures. Importantly, endometrial cancer cell lines exhibited similar gene expression changes that were expected to be tumor cell intrinsic (e.g. interferon response) but not those expected to be tumor cell extrinsic (e.g. NK cells). From these data, we derive two primary conclusions: 1) JAK1 frameshifts are loss of function alterations that represent a potential pan-cancer adaptation to immune responses against tumors with microsatellite instability; 2) The mechanism by which JAK1 loss of function contributes to tumor immune evasion is likely associated with loss of the JAK1-mediated interferon response.

  19. Efficacy of screening immune system function in at-risk newborns

    OpenAIRE

    Pavlovski, Christopher J

    2014-01-01

    This paper explores the introduction of a screening test to highlight impaired immune system status for newborn infants and its efficacy as a preventative clinical measure. Moreover, it is suggested that screening of the infantile immune system has the potential to highlight susceptibility to a range of infant and childhood diseases, bestowing an opportunity to introduce early intervention to reduce the incidence of these diseases. Development of the neonatal immune system is an important hea...

  20. Functional Analysis of the Tomato Immune Receptor Ve1 through Domain Swaps with Its Non-Functional Homolog Ve2

    Science.gov (United States)

    Rovenich, Hanna; Song, Yin; Liebrand, Thomas W. H.; Masini, Laura; van den Berg, Grardy C. M.; Joosten, Matthieu H. A. J.; Thomma, Bart P. H. J.

    2014-01-01

    Resistance in tomato against race 1 strains of the fungal vascular wilt pathogens Verticillium dahliae and V. albo-atrum is mediated by the Ve locus. This locus comprises two closely linked inversely oriented genes, Ve1 and Ve2, which encode cell surface receptors of the extracellular leucine-rich repeat receptor-like protein (eLRR-RLP) type. While Ve1 mediates Verticillium resistance through monitoring the presence of the recently identified V. dahliae Ave1 effector, no functionality for Ve2 has been demonstrated in tomato. Ve1 and Ve2 contain 37 eLRRs and share 84% amino acid identity, facilitating investigation of Ve protein functionality through domain swapping. In this study it is shown that Ve chimeras in which the first thirty eLRRs of Ve1 were replaced by those of Ve2 remain able to induce HR and activate Verticillium resistance, and that deletion of these thirty eLRRs from Ve1 resulted in loss of functionality. Also the region between eLRR30 and eLRR35 is required for Ve1-mediated resistance, and cannot be replaced by the region between eLRR30 and eLRR35 of Ve2. We furthermore show that the cytoplasmic tail of Ve1 is required for functionality, as truncation of this tail results in loss of functionality. Moreover, the C-terminus of Ve2 fails to activate immune signaling as chimeras containing the C-terminus of Ve2 do not provide Verticillium resistance. Furthermore, Ve1 was found to interact through its C-terminus with the eLRR-containing receptor-like kinase (eLRR-RLK) interactor SOBIR1 that was recently identified as an interactor of eLRR-RLP (immune) receptors. Intriguingly, also Ve2 was found to interact with SOBIR1. PMID:24505431

  1. Corticosterone suppresses immune activity in territorial Galápagos marine iguanas during reproduction.

    Science.gov (United States)

    Berger, Silke; Martin, Lynn B; Wikelski, Martin; Romero, L Michael; Kalko, Elisabeth K V; Vitousek, Maren N; Rödl, Thomas

    2005-04-01

    Individuals that display elaborate sexually selected characters often show reduced immune function. According to the immunocompetence handicap hypothesis, testosterone (T) is responsible for this result as it drives the development and maintenance of sexual characters and causes immunosuppression. But glucocorticoids also have strong influences on immune function and may also be elevated in reproductively active males. Here, we compared immune activity using the phytohemagglutinin (PHA) skin test in three discrete groups of male marine iguanas (Amblyrhynchus cristatus): territorials, satellites, and bachelors. Males of these three reproductive phenotypes had indistinguishable T concentrations during the height of the breeding season, but their corticosterone (cort) concentrations, body condition and hematocrit were significantly different. Territorial males, the animals with the most elaborate sexual ornaments and behaviors, had lower immune responses and body condition but higher cort concentrations and hematocrit than satellites or bachelors. To test directly cort's immunosuppressive role, we elevated cort by either restraining animals or additionally injecting cort and compared their PHA swelling response with the response of free-roaming animals. Such experimental elevation of cort significantly decreased immune activity in both restrained and cort-injected animals. Our data show that cort can induce immunosuppression, but they do not support the immunocompetence handicap hypothesis in its narrow sense because T concentrations were not related to immunosuppression.

  2. TIPE2, a negative regulator of innate and adaptive immunity that maintains immune homeostasis.

    Science.gov (United States)

    Sun, Honghong; Gong, Shunyou; Carmody, Ruaidhri J; Hilliard, Anja; Li, Li; Sun, Jing; Kong, Li; Xu, Lingyun; Hilliard, Brendan; Hu, Shimin; Shen, Hao; Yang, Xiaolu; Chen, Youhai H

    2008-05-02

    Immune homeostasis is essential for the normal functioning of the immune system, and its breakdown leads to fatal inflammatory diseases. We report here the identification of a member of the tumor necrosis factor-alpha-induced protein-8 (TNFAIP8) family, designated TIPE2, that is required for maintaining immune homeostasis. TIPE2 is preferentially expressed in lymphoid tissues, and its deletion in mice leads to multiorgan inflammation, splenomegaly, and premature death. TIPE2-deficient animals are hypersensitive to septic shock, and TIPE2-deficient cells are hyper-responsive to Toll-like receptor (TLR) and T cell receptor (TCR) activation. Importantly, TIPE2 binds to caspase-8 and inhibits activating protein-1 and nuclear factor-kappaB activation while promoting Fas-induced apoptosis. Inhibiting caspase-8 significantly blocks the hyper-responsiveness of TIPE2-deficient cells. These results establish that TIPE2 is an essential negative regulator of TLR and TCR function, and its selective expression in the immune system prevents hyperresponsiveness and maintains immune homeostasis.

  3. A Simulated Heat Wave Has Diverse Effects on Immune Function and Oxidative Physiology in the Corn Snake (Pantherophis guttatus).

    Science.gov (United States)

    Stahlschmidt, Z R; French, S S; Ahn, A; Webb, A; Butler, M W

    Animals will continue to encounter increasingly warm environments, including more frequent and intense heat waves. Yet the physiological consequences of heat waves remain equivocal, potentially because of variation in adaptive plasticity (reversible acclimation) and/or aspects of experimental design. Thus, we measured a suite of physiological variables in the corn snake (Pantherophis guttatus) after exposure to field-parameterized, fluctuating temperature regimes (moderate temperature and heat wave treatments) to address two hypotheses: (1) a heat wave causes physiological stress, and (2) thermal performance of immune function exhibits adaptive plasticity in response to a heat wave. We found little support for our first hypothesis because a simulated heat wave had a negative effect on body mass, but it also reduced oxidative damage and did not affect peak performance of three immune metrics. Likewise, we found only partial support for our second hypothesis. After exposure to a simulated heat wave, P. guttatus exhibited greater performance breadth and reduced temperature specialization (the standardized difference between peak performance and performance breadth) for only one of three immune metrics and did so in a sex-dependent manner. Further, a simulated heat wave did not elicit greater performance of any immune metric at higher temperatures. Yet a heat wave likely reduced innate immune function in P. guttatus because each metric of innate immune performance in this species (as in most vertebrates) was lower at elevated temperatures. Together with previous research, our study indicates that a heat wave may have complex, modest, and even positive physiological effects in some taxa.

  4. Studies on the protection effects of functional foods for skin immune system from radiation damage

    Energy Technology Data Exchange (ETDEWEB)

    Yee, Sung Tae; Shin, Seong Hae; Kim, Do Sun; Heo, Ji Yun; Kang, Hye In [Sunchon National University, Sunchon (Korea, Republic of)

    2007-07-15

    We evaluated the protective effects of pilot products (HemoHIM and HemoTonic) on the UV-induced skin immune damages as the following. centre dot Protective effects of HemoHIM and HemoTonic against UV using contact hypersensitivity model - Protection against depression of contact hypersensitivity by administration and skin application of HemoHIM and HemoTonic - Induction of dendritic cell differentiation and maturation by HemoHIM and HemoTonic treatment - Improvement of antigen-presenting activity of dedritic cells by HemoHIM and HemoTonic treatment centre dot Protective effects of HemoHIM and HemoTonic on skin immune system against UV-irradiation - Protection of antigen-presenting activity of dendritic cells under UV-irradiation - In vivo protection of antigen-presenting activity of Langerhans cells in UV-irradiated mice centre dot Protective effects of HemoHIM on UV-induced apoptosis of dendritic cells - Inhibition of cell membrane change, mitochondrial potential change, SubG1 cell population, nuclear condensation, and DNA fragmentation in UV-irradiated dendritic cells centre dot Anti-allergic effects of HemoHIM and HemoTonic in human adipocyte HMC-1 cells - Inhibition of allergic histamine release from adipocytes - Inhibition of secretion of inflammatory cytokines (IL-6, IL-8, TNF-alpha, GM-CSF) - Inhibition of c-kit, tryptase, FcepsilonRI mRNA expression From these results, the developed functional food products (HemoHIM, HemoTonic) showed the protection and recovery of the immune functions in the UV-irradiated skin. It is suggested that these products may be used as a new functional food or cosmetic material for the protection of skin damage and the promotion of recovery

  5. Immune regulation by microbiome metabolites.

    Science.gov (United States)

    Kim, Chang H

    2018-03-22

    Commensal microbes and the host immune system have been co-evolved for mutual regulation. Microbes regulate the host immune system, in part, by producing metabolites. A mounting body of evidence indicates that diverse microbial metabolites profoundly regulate the immune system via host receptors and other target molecules. Immune cells express metabolite-specific receptors such as P2X 7 , GPR41, GPR43, GPR109A, aryl hydrocarbon receptor precursor (AhR), pregnane X receptor (PXR), farnesoid X receptor (FXR), TGR5 and other molecular targets. Microbial metabolites and their receptors form an extensive array of signals to respond to changes in nutrition, health and immunological status. As a consequence, microbial metabolite signals contribute to nutrient harvest from diet, and regulate host metabolism and the immune system. Importantly, microbial metabolites bidirectionally function to promote both tolerance and immunity to effectively fight infection without developing inflammatory diseases. In pathogenic conditions, adverse effects of microbial metabolites have been observed as well. Key immune-regulatory functions of the metabolites, generated from carbohydrates, proteins and bile acids, are reviewed in this article. © 2018 John Wiley & Sons Ltd.

  6. Therapeutic immunization with HIV-1 Tat reduces immune activation and loss of regulatory T-cells and improves immune function in subjects on HAART.

    Directory of Open Access Journals (Sweden)

    Barbara Ensoli

    2010-11-01

    Full Text Available Although HAART suppresses HIV replication, it is often unable to restore immune homeostasis. Consequently, non-AIDS-defining diseases are increasingly seen in treated individuals. This is attributed to persistent virus expression in reservoirs and to cell activation. Of note, in CD4(+ T cells and monocyte-macrophages of virologically-suppressed individuals, there is continued expression of multi-spliced transcripts encoding HIV regulatory proteins. Among them, Tat is essential for virus gene expression and replication, either in primary infection or for virus reactivation during HAART, when Tat is expressed, released extracellularly and exerts, on both the virus and the immune system, effects that contribute to disease maintenance. Here we report results of an ad hoc exploratory interim analysis (up to 48 weeks on 87 virologically-suppressed HAART-treated individuals enrolled in a phase II randomized open-label multicentric clinical trial of therapeutic immunization with Tat (ISS T-002. Eighty-eight virologically-suppressed HAART-treated individuals, enrolled in a parallel prospective observational study at the same sites (ISS OBS T-002, served for intergroup comparison. Immunization with Tat was safe, induced durable immune responses, and modified the pattern of CD4(+ and CD8(+ cellular activation (CD38 and HLA-DR together with reduction of biochemical activation markers and persistent increases of regulatory T cells. This was accompanied by a progressive increment of CD4(+ T cells and B cells with reduction of CD8(+ T cells and NK cells, which were independent from the type of antiretroviral regimen. Increase in central and effector memory and reduction in terminally-differentiated effector memory CD4(+ and CD8(+ T cells were accompanied by increases of CD4(+ and CD8(+ T cell responses against Env and recall antigens. Of note, more immune-compromised individuals experienced greater therapeutic effects. In contrast, these changes were opposite

  7. ImprimatinC1, a novel plant immune-priming compound, functions as a partial agonist of salicylic acid.

    Science.gov (United States)

    Noutoshi, Yoshiteru; Jikumaru, Yusuke; Kamiya, Yuji; Shirasu, Ken

    2012-01-01

    Plant activators are agrochemicals that protect crops from pathogens. They confer durable resistance to a broad range of diseases by activating intrinsic immune mechanisms in plants. To obtain leads regarding useful compounds, we have screened a chemical library using an established method that allows selective identification of immune-priming compounds. Here, we report the characterisation of one of the isolated chemicals, imprimatinC1, and its structural derivative imprimatinC2. ImprimatinC1 functions as a weak analogue of salicylic acid (SA) and activates the expression of defence-related genes. However, it lacks antagonistic activity toward jasmonic acid. Structure-activity relationship analysis suggests that imprimatinC1 and C2 can be metabolised to 4-chlorobenzoic acid and 3,4-chlorobenzoic acid, respectively, to function in Arabidopsis. We also found that imprimatinC1 and C2 and their potential functional metabolites acted as partial agonists of SA. Thus, imprimatinC compounds could be useful tools for dissecting SA-dependent signal transduction pathways.

  8. Immunizations challenge healthcare personnel and affects immunization rates.

    Science.gov (United States)

    Strohfus, Pamela K; Kim, Susan C; Palma, Sara; Duke, Russell A; Remington, Richard; Roberts, Caleb

    2017-02-01

    This study measured 1. medical office immunization rates and 2. health care personnel competency in managing vaccine practices before and after evidence-based immunization education was provided. This descriptive study compared 32 family medicine and pediatric offices and 178 medical assistants, licensed practical nurses, registered nurses, nurse practitioners, and physicians in knowledge-based testing pre-education, post-education, and 12-months post-education. Immunization rates were assessed before and 18-months post-education. Immunization rates increased 10.3% - 18months post-education; knowledge increased 7.8% - 12months post-education. Family medicine offices, licensed practical nurses, and medical assistants showed significant knowledge deficits before and 12-months post-education. All demographic groups scored less in storage/handling 12-months post-education. This study is one of the first studies to identify competency challenges in effective immunization delivery among medical assistants, licensed practical nurses, and family medicine offices. Formal and continuous education in immunization administration and storage/handling is recommended among these select groups. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Effect of psychological intervention in the form of relaxation and guided imagery on cellular immune function in normal healthy subjects. An overview

    DEFF Research Database (Denmark)

    Zachariae, R; Kristensen, J S; Hokland, P

    1991-01-01

    The present study measured the effects of relaxation and guided imagery on cellular immune function. During a period of 10 days 10 healthy subjects were given one 1-hour relaxation procedure and one combined relaxation and guided imagery procedure, instructing the subjects to imagine their immune...... on the immune defense and could form the basis of further studies on psychological intervention and immunological status. Udgivelsesdato: 1990-null...

  10. Gut immunity in Lepidopteran insects.

    Science.gov (United States)

    Wu, Kai; Yang, Bing; Huang, Wuren; Dobens, Leonard; Song, Hongsheng; Ling, Erjun

    2016-11-01

    Lepidopteran insects constitute one of the largest fractions of animals on earth, but are considered pests in their relationship with man. Key to the success of this order of insects is its ability to digest food and absorb nutrition, which takes place in the midgut. Because environmental microorganisms can easily enter Lepidopteran guts during feeding, the innate immune response guards against pathogenic bacteria, virus and microsporidia that can be devoured with food. Gut immune responses are complicated by both resident gut microbiota and the surrounding peritrophic membrane and are distinct from immune responses in the body cavity, which depend on the function of the fat body and hemocytes. Due to their relevance to agricultural production, studies of Lepidopteran insect midgut and immunity are receiving more attention, and here we summarize gut structures and functions, and discuss how these confer immunity against different microorganisms. It is expected that increased knowledge of Lepidopteran gut immunity may be utilized for pest biological control in the future. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. A cascade reaction network mimicking the basic functional steps of adaptive immune response.

    Science.gov (United States)

    Han, Da; Wu, Cuichen; You, Mingxu; Zhang, Tao; Wan, Shuo; Chen, Tao; Qiu, Liping; Zheng, Zheng; Liang, Hao; Tan, Weihong

    2015-10-01

    Biological systems use complex 'information-processing cores' composed of molecular networks to coordinate their external environment and internal states. An example of this is the acquired, or adaptive, immune system (AIS), which is composed of both humoral and cell-mediated components. Here we report the step-by-step construction of a prototype mimic of the AIS that we call an adaptive immune response simulator (AIRS). DNA and enzymes are used as simple artificial analogues of the components of the AIS to create a system that responds to specific molecular stimuli in vitro. We show that this network of reactions can function in a manner that is superficially similar to the most basic responses of the vertebrate AIS, including reaction sequences that mimic both humoral and cellular responses. As such, AIRS provides guidelines for the design and engineering of artificial reaction networks and molecular devices.

  12. Pressure Induced Changes in Adaptive Immune Function in Belugas (Delphinapterus leucas; implications for dive physiology and health

    Directory of Open Access Journals (Sweden)

    Laura A Thompson

    2016-09-01

    Full Text Available Increased pressure, associated with diving, can alter cell function through several mechanisms and has been shown to impact immune functions performed by peripheral blood mononuclear cells (PBMC in humans. While marine mammals possess specific adaptations which protect them from dive related injury, it is unknown how their immune system is adapted to the challenges associated with diving. The purpose of this study was to measure PBMC activation (IL2R expression and Concanavalin A induced lymphocyte proliferation (BrdU incorporation in belugas following in vitro pressure exposures during baseline, Out of Water Examination (OWE and capture/release conditions. Beluga blood samples (n=4 were obtained from animals at the Mystic Aquarium and from free ranging animals in Alaska (n=9. Human blood samples (n=4 (Biological Specialty Corporation were run for comparison. In vivo catecholamines and cortisol were measured in belugas to characterize the neuroendocrine response. Comparison of cellular responses between controls and pressure exposed cells, between conditions in belugas, between belugas and humans as well as between dive profiles, were run using mixed generalized linear models (α=0.05. Cortisol was significantly higher in wild belugas and OWE samples as compared with baseline for aquarium animals. Both IL2R expression and proliferation displayed significant pressure induced changes, and these responses varied between conditions in belugas. Both belugas and humans displayed increased IL2R expression, while lymphocyte proliferation decreased for aquarium animals and increased for humans and wild belugas. Results suggest beluga PBMC function is altered during diving and changes may represent dive adaptation as the response differs from humans, a non-dive adapted mammal. In addition, characteristics of a dive (i.e., duration, depth as well as neuroendocrine activity can alter the response of beluga cells, potentially impacting the ability of animals

  13. Francisella tularensis Catalase Restricts Immune Function by Impairing TRPM2 Channel Activity.

    Science.gov (United States)

    Shakerley, Nicole L; Chandrasekaran, Akshaya; Trebak, Mohamed; Miller, Barbara A; Melendez, J Andrés

    2016-02-19

    As an innate defense mechanism, macrophages produce reactive oxygen species that weaken pathogens and serve as secondary messengers involved in immune function. The Gram-negative bacterium Francisella tularensis utilizes its antioxidant armature to limit the host immune response, but the mechanism behind this suppression is not defined. Here we establish that F. tularensis limits Ca(2+) entry in macrophages, thereby limiting actin reorganization and IL-6 production in a redox-dependent fashion. Wild type (live vaccine strain) or catalase-deficient F. tularensis (ΔkatG) show distinct profiles in their H2O2 scavenging rates, 1 and 0.015 pm/s, respectively. Murine alveolar macrophages infected with ΔkatG display abnormally high basal intracellular Ca(2+) concentration that did not increase further in response to H2O2. Additionally, ΔkatG-infected macrophages displayed limited Ca(2+) influx in response to ionomycin, as a result of ionophore H2O2 sensitivity. Exogenously added H2O2 or H2O2 generated by ΔkatG likely oxidizes ionomycin and alters its ability to transport Ca(2+). Basal increases in cytosolic Ca(2+) and insensitivity to H2O2-mediated Ca(2+) entry in ΔkatG-infected cells are reversed by the Ca(2+) channel inhibitors 2-aminoethyl diphenylborinate and SKF-96365. 2-Aminoethyl diphenylborinate but not SKF-96365 abrogated ΔkatG-dependent increases in macrophage actin remodeling and IL-6 secretion, suggesting a role for H2O2-mediated Ca(2+) entry through the transient receptor potential melastatin 2 (TRPM2) channel in macrophages. Indeed, increases in basal Ca(2+), actin polymerization, and IL-6 production are reversed in TRPM2-null macrophages infected with ΔkatG. Together, our findings provide compelling evidence that F. tularensis catalase restricts reactive oxygen species to temper macrophage TRPM2-mediated Ca(2+) signaling and limit host immune function. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Various functions of PBMC from colon cancer patients are not decreased compared to healthy blood donors

    DEFF Research Database (Denmark)

    Afzelius, P; Nielsen, Hans Jørgen

    1997-01-01

    The immune surveillance hypothesis suggests impaired immune responses to participate in development of cancer. This may partly be due to increased amounts of PGE2 and histamine, which inhibit cellular immunity. These effects are mediated by cAMP, which is increased and thereby may down-regulate I...... no difference in levels of intracellular cAMP, IL-2 mRNA expression, IL-2R mRNA expression, or proliferative responses of PBMC from colon cancer patients compared to healthy blood donors. There was no effect of the immune modulating agents on PBMC from colon cancer patients....

  15. Ejaculate economics: testing the effects of male sexual history on the trade-off between sperm and immune function in Australian crickets.

    Directory of Open Access Journals (Sweden)

    Damian K Dowling

    Full Text Available Trade-offs between investment into male sexual traits and immune function provide the foundation for some of the most prominent models of sexual selection. Post-copulatory sexual selection on the male ejaculate is intense, and therefore trade-offs should occur between investment into the ejaculate and the immune system. Examples of such trade-offs exist, including that between sperm quality and immunity in the Australian cricket, Teleogryllus oceanicus. Here, we explore the dynamics of this trade-off, examining the effects that increased levels of sexual interaction have on the viability of a male's sperm across time, and the concomitant effects on immune function. Males were assigned to a treatment, whereby they cohabited with females that were sexually immature, sexually mature but incapable of copulation, or sexually mature and capable of copulation. Sperm viability of each male was then assessed at two time points: six and 13 days into the treatment, and immune function at day 13. Sperm viability decreased across the time points, but only for males exposed to treatment classes involving sexually mature females. This decrease was similar in magnitude across both sexually mature classes, indicating that costs to the expression of high sperm viability are incurred largely through levels of pre-copulatory investment. Males exposed to immature females produced sperm of low viability at both time points. Although we confirmed a weak negative association between sperm viability and lytic activity (a measure of immune response to bacterial infection at day 13, this relationship was not altered across the mating treatment. Our results highlight that sperm viability is a labile trait, costly to produce, and subject to strategic allocation in these crickets.

  16. The immune self: a selectionist theory of recognition, learning, and remembering within the immune system.

    Science.gov (United States)

    Kradin, R L

    1995-01-01

    In this paper, I have briefly explored metaphors shared by the immune and nervous systems and shown that this exercise can lead to the elucidation of common principles of organization, as well as to predictions concerning how the immune system functions. Metaphor itself undoubtedly reflects the way in which we categorize and retrieve information 44], so it is not surprising that the deep processes of language tend to sample information from related data categories. Although the nervous and immune systems are obviously not the same and metaphors are indeed just that, my primary goal has been to suggest that by virtue of their having evolved in parallel over millions of years, the nervous and immune systems currently use the same archetypal principles and strategies to address related challenges in information processing and retrieval. Ultimately, nature is conservative. One need only look at a tree, a river, the airways, or the vascular bed in order to see how a fractal pattern of repetitive dichotomous branching has been used by each, in order to optimize the transport of fluids over large distances [45]. While each system has had to adopt different materials in order to solve the problem, the shape of their solutions is remarkably alike. In the immune and nervous systems, the elements used to produce optimal functional responses are also quite different, but again the solutions have been achieved by comparable strategies. I am certain that these two great systems of information processing, each responding with vastly different kinetics, will prove to be far more integrally interdependent than has been previously recognized. For example, should a swift response by the immune system be required in an overwhelming invasion by microbial pathogens, the immune system may be able to cooperate with the rapidly reacting nervous system to rid the host of the invaders. In this regard, we have shown that the beta-adrenergic hormone epinephrine rapidly increases the traffic of

  17. Proximal Versus Distal Splenic Artery Embolisation for Blunt Splenic Trauma: What is the Impact on Splenic Immune Function?

    International Nuclear Information System (INIS)

    Foley, P. T.; Kavnoudias, H.; Cameron, P. U.; Czarnecki, C.; Paul, E.; Lyon, S. M.

    2015-01-01

    PurposeTo compare the impact of proximal or distal splenic artery embolisation versus that of splenectomy on splenic immune function as measured by IgM memory B cell levels.Materials and MethodsPatients with splenic trauma who were treated by splenic artery embolisation (SAE) were enrolled. After 6 months splenic volume was assessed by CT, and IgM memory B cells in peripheral blood were measured and compared to a local normal reference population and to a post-splenectomy population.ResultsOf the 71 patients who underwent embolisation, 38 underwent proximal embolisation, 11 underwent distal embolisation, 22 patients were excluded, 1 had both proximal and distal embolisation, 5 did not survive and 16 did not return for evaluation. There was a significant difference between splenectomy and proximal or distal embolisation and a trend towards greater preservation of IgM memory B cell number in those with distal embolisation—a difference that could not be attributed to differences in age, grade of injury or residual splenic volume.ConclusionIgM memory B cell levels are significantly higher in those treated with SAE compared to splenectomy. Our data provide evidence that splenic embolisation should reduce immunological complications of spleen trauma and suggest that distal embolisation may maintain better function

  18. Proximal Versus Distal Splenic Artery Embolisation for Blunt Splenic Trauma: What is the Impact on Splenic Immune Function?

    Energy Technology Data Exchange (ETDEWEB)

    Foley, P. T., E-mail: pfoley@doctors.org.uk [The Canberra Hospital, Department of Medical Imaging (Australia); Kavnoudias, H., E-mail: h.kavnoudias@alfred.org.au [The Alfred Hospital, Radiology Research Unit, Radiology Department (Australia); Cameron, P. U., E-mail: paul.cameron@unimelb.edu.au [The Alfred Hospital, Infectious Diseases Unit (Australia); Czarnecki, C., E-mail: caroline.czarnecki@gmail.com [Royal Melbourne Hospital, Radiology Department (Australia); Paul, E., E-mail: eldho.paul@monash.edu [Monash University, Department of Epidemiology & Preventive Medicine, School of Public Health and Preventive Medicine, Alfred Hospital (Australia); Lyon, S. M., E-mail: lyonsey@optusnet.com.au [Melbourne Endovascular (Australia)

    2015-10-15

    PurposeTo compare the impact of proximal or distal splenic artery embolisation versus that of splenectomy on splenic immune function as measured by IgM memory B cell levels.Materials and MethodsPatients with splenic trauma who were treated by splenic artery embolisation (SAE) were enrolled. After 6 months splenic volume was assessed by CT, and IgM memory B cells in peripheral blood were measured and compared to a local normal reference population and to a post-splenectomy population.ResultsOf the 71 patients who underwent embolisation, 38 underwent proximal embolisation, 11 underwent distal embolisation, 22 patients were excluded, 1 had both proximal and distal embolisation, 5 did not survive and 16 did not return for evaluation. There was a significant difference between splenectomy and proximal or distal embolisation and a trend towards greater preservation of IgM memory B cell number in those with distal embolisation—a difference that could not be attributed to differences in age, grade of injury or residual splenic volume.ConclusionIgM memory B cell levels are significantly higher in those treated with SAE compared to splenectomy. Our data provide evidence that splenic embolisation should reduce immunological complications of spleen trauma and suggest that distal embolisation may maintain better function.

  19. Proximal Versus Distal Splenic Artery Embolisation for Blunt Splenic Trauma: What is the Impact on Splenic Immune Function?

    Science.gov (United States)

    Foley, P T; Kavnoudias, H; Cameron, P U; Czarnecki, C; Paul, E; Lyon, S M

    2015-10-01

    To compare the impact of proximal or distal splenic artery embolisation versus that of splenectomy on splenic immune function as measured by IgM memory B cell levels. Patients with splenic trauma who were treated by splenic artery embolisation (SAE) were enrolled. After 6 months splenic volume was assessed by CT, and IgM memory B cells in peripheral blood were measured and compared to a local normal reference population and to a post-splenectomy population. Of the 71 patients who underwent embolisation, 38 underwent proximal embolisation, 11 underwent distal embolisation, 22 patients were excluded, 1 had both proximal and distal embolisation, 5 did not survive and 16 did not return for evaluation. There was a significant difference between splenectomy and proximal or distal embolisation and a trend towards greater preservation of IgM memory B cell number in those with distal embolisation-a difference that could not be attributed to differences in age, grade of injury or residual splenic volume. IgM memory B cell levels are significantly higher in those treated with SAE compared to splenectomy. Our data provide evidence that splenic embolisation should reduce immunological complications of spleen trauma and suggest that distal embolisation may maintain better function.

  20. Complement anaphylatoxins as immune regulators in cancer.

    Science.gov (United States)

    Sayegh, Eli T; Bloch, Orin; Parsa, Andrew T

    2014-08-01

    The role of the complement system in innate immunity is well characterized. However, a recent body of research implicates the complement anaphylatoxins C3a and C5a as insidious propagators of tumor growth and progression. It is now recognized that certain tumors elaborate C3a and C5a and that complement, as a mediator of chronic inflammation and regulator of immune function, may in fact foster rather than defend against tumor growth. A putative mechanism for this function is complement-mediated suppression of immune effector cells responsible for immunosurveillance within the tumor microenvironment. This paradigm accords with models of immune dysregulation, such as autoimmunity and infectious disease, which have defined a pathophysiological role for abnormal complement signaling. Several types of immune cells express the cognate receptors for the complement anaphylatoxins, C3aR and C5aR, and demonstrate functional modulation in response to complement stimulation. In turn, impairment of antitumor immunity has been intimately tied to tumor progression in animal models of cancer. In this article, the literature was systematically reviewed to identify studies that have characterized the effects of the complement anaphylatoxins on the composition and function of immune cells within the tumor microenvironment. The search identified six studies based upon models of lymphoma and ovarian, cervical, lung, breast, and mammary cancer, which collectively support the paradigm of complement as an immune regulator in the tumor microenvironment. © 2014 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  1. Immune System and Kidney Transplantation.

    Science.gov (United States)

    Shrestha, Badri Man

    2017-01-01

    The immune system recognises a transplanted kidney as foreign body and mounts immune response through cellular and humoral mechanisms leading to acute or chronic rejection, which ultimately results in graft loss. Over the last five decades, there have been significant advances in the understanding of the immune responses to transplanted organs in both experimental and clinical transplant settings. Modulation of the immune response by using immunosuppressive agents has led to successful outcomes after kidney transplantation. The paper provides an overview of the general organisation and function of human immune system, immune response to kidney transplantation, and the current practice of immunosuppressive therapy in kidney transplantation in the United Kingdom.

  2. Wash functions downstream of Rho1 GTPase in a subset of Drosophila immune cell developmental migrations

    Science.gov (United States)

    Verboon, Jeffrey M.; Rahe, Travis K.; Rodriguez-Mesa, Evelyn; Parkhurst, Susan M.

    2015-01-01

    Drosophila immune cells, the hemocytes, undergo four stereotypical developmental migrations to populate the embryo, where they provide immune reconnoitering, as well as a number of non–immune-related functions necessary for proper embryogenesis. Here, we describe a role for Rho1 in one of these developmental migrations in which posteriorly located hemocytes migrate toward the head. This migration requires the interaction of Rho1 with its downstream effector Wash, a Wiskott–Aldrich syndrome family protein. Both Wash knockdown and a Rho1 transgene harboring a mutation that prevents Wash binding exhibit the same developmental migratory defect as Rho1 knockdown. Wash activates the Arp2/3 complex, whose activity is needed for this migration, whereas members of the WASH regulatory complex (SWIP, Strumpellin, and CCDC53) are not. Our results suggest a WASH complex–independent signaling pathway to regulate the cytoskeleton during a subset of hemocyte developmental migrations. PMID:25739458

  3. Impaired immune function in seals and laboratory rats exposed to dioxin-like compounds from Baltic herring

    Energy Technology Data Exchange (ETDEWEB)

    Ross, P.S. [Seal Rehabilitation and Research Centre, Pieterburen (Netherlands)]|[National Inst. of Public Health and Environmental Protection, Bilthoven (Netherlands); Swart, R.L. de [Seal Rehabilitation and Research Centre, Pieterburen (Netherlands)]|[Erasmus Univ., Rotterdam (Netherlands); Timmerman, H.H.; Loveren, H. van [National Inst. of Public Health and Environmental Protection, Bilthoven (Netherlands); Osterhaus, A.D.M.E. [Seal Rehabilitation and Research Centre, Pieterburen (Netherlands)]|[National Inst. of Public Health and Environmental Protection, Bilthoven (Netherlands)]|[Erasmus Univ., Rotterdam (Netherlands)

    1995-12-31

    Complex mixtures of lipophilic contaminants have been shown to affect certain top predators in the aquatic food chain, including seals. A recent demonstration that harbor seals (Phoca vitulina) fed Baltic Sea herring displayed impaired natural killer cell activity and T-lymphocyte function represented the first demonstration of immunotoxicity induced by ambient levels of contaminants in the environment. While these animals had a lower ability to respond to immunizations with inactivated vaccines, specific antibody responses, and in vitro antigen-specific lymphoproliferative responses, obvious constraints limited the ability to extend these results with host resistance tests or an evaluation of thymus and other lymphoid organs. The authors therefore set up a parallel study by exposing pregnant laboratory rats to the same Baltic herring contaminant mixture as received the seals. They then examined immune function parameters and host resistance to virus infection. As in the seals, rat pups of the Baltic group had impaired T-lymphocyte function. In addition, thymus cells and/or their precursors appeared to be targeted, as their numbers and function were reduced in the rats. Following challenge with rat cytomegalovirus in a host resistance study, rat pups in the Baltic group had impaired natural killer cell responses to the virus infection, and lower specific CD8 + (cytotoxic T-lymphocyte) responses following in vitro stimulation. By extrapolation, these results suggest that the impaired immune responses observed in the Baltic group of seals may lead to a less effective defense against virus infections in marine mammals inhabiting polluted coastal waters. Toxicological profiles and results of both the captive seal and laboratory rat experiments tend to implicate the 2,3,7,8-TCDD-like PCB, dioxin and furan congeners in the immunosuppression, and point to a major role for the PCBs.

  4. Interferon Lambda: Modulating Immunity in Infectious Diseases.

    Science.gov (United States)

    Syedbasha, Mohammedyaseen; Egli, Adrian

    2017-01-01

    Interferon lambdas (IFN-λs; IFNL1-4) modulate immunity in the context of infections and autoimmune diseases, through a network of induced genes. IFN-λs act by binding to the heterodimeric IFN-λ receptor (IFNLR), activating a STAT phosphorylation-dependent signaling cascade. Thereby hundreds of IFN-stimulated genes are induced, which modulate various immune functions via complex forward and feedback loops. When compared to the well-characterized IFN-α signaling cascade, three important differences have been discovered. First, the IFNLR is not ubiquitously expressed: in particular, immune cells show significant variation in the expression levels of and susceptibilities to IFN-λs. Second, the binding affinities of individual IFN-λs to the IFNLR varies greatly and are generally lower compared to the binding affinities of IFN-α to its receptor. Finally, genetic variation in the form of a series of single-nucleotide polymorphisms (SNPs) linked to genes involved in the IFN-λ signaling cascade has been described and associated with the clinical course and treatment outcomes of hepatitis B and C virus infection. The clinical impact of IFN-λ signaling and the SNP variations may, however, reach far beyond viral hepatitis. Recent publications show important roles for IFN-λs in a broad range of viral infections such as human T-cell leukemia type-1 virus, rotaviruses, and influenza virus. IFN-λ also potentially modulates the course of bacterial colonization and infections as shown for Staphylococcus aureus and Mycobacterium tuberculosis . Although the immunological processes involved in controlling viral and bacterial infections are distinct, IFN-λs may interfere at various levels: as an innate immune cytokine with direct antiviral effects; or as a modulator of IFN-α-induced signaling via the suppressor of cytokine signaling 1 and the ubiquitin-specific peptidase 18 inhibitory feedback loops. In addition, the modulation of adaptive immune functions via macrophage

  5. Pathogen entrapment by transglutaminase--a conserved early innate immune mechanism.

    Directory of Open Access Journals (Sweden)

    Zhi Wang

    2010-02-01

    Full Text Available Clotting systems are required in almost all animals to prevent loss of body fluids after injury. Here, we show that despite the risks associated with its systemic activation, clotting is a hitherto little appreciated branch of the immune system. We compared clotting of human blood and insect hemolymph to study the best-conserved component of clotting systems, namely the Drosophila enzyme transglutaminase and its vertebrate homologue Factor XIIIa. Using labelled artificial substrates we observe that transglutaminase activity from both Drosophila hemolymph and human blood accumulates on microbial surfaces, leading to their sequestration into the clot. Using both a human and a natural insect pathogen we provide functional proof for an immune function for transglutaminase (TG. Drosophila larvae with reduced TG levels show increased mortality after septic injury. The same larvae are also more susceptible to a natural infection involving entomopathogenic nematodes and their symbiotic bacteria while neither phagocytosis, phenoloxidase or-as previously shown-the Toll or imd pathway contribute to immunity. These results firmly establish the hemolymph/blood clot as an important effector of early innate immunity, which helps to prevent septic infections. These findings will help to guide further strategies to reduce the damaging effects of clotting and enhance its beneficial contribution to immune reactions.

  6. Antitumor Immunity Is Controlled by Tetraspanin Proteins

    Directory of Open Access Journals (Sweden)

    Fleur Schaper

    2018-05-01

    Full Text Available Antitumor immunity is shaped by the different types of immune cells that are present in the tumor microenvironment (TME. In particular, environmental signals (for instance, soluble factors or cell–cell contact transmitted through the plasma membrane determine whether immune cells are activated or inhibited. Tetraspanin proteins are emerging as central building blocks of the plasma membrane by their capacity to cluster immune receptors, enzymes, and signaling molecules into the tetraspanin web. Whereas some tetraspanins (CD81, CD151, CD9 are widely and broadly expressed, others (CD53, CD37, Tssc6 have an expression pattern restricted to hematopoietic cells. Studies using genetic mouse models have identified important immunological functions of these tetraspanins on different leukocyte subsets, and as such, may be involved in the immune response against tumors. While multiple studies have been performed with regards to deciphering the function of tetraspanins on cancer cells, the effect of tetraspanins on immune cells in the antitumor response remains understudied. In this review, we will focus on tetraspanins expressed by immune cells and discuss their potential role in antitumor immunity. New insights in tetraspanin function in the TME and possible prognostic and therapeutic roles of tetraspanins will be discussed.

  7. Daidzein enhances immune function in late lactation cows under heat stress.

    Science.gov (United States)

    Liu, De-Yi; He, Shao-Jun; Liu, Shi-Qing; Tang, Yi-Guo; Jin, Er-Hui; Chen, Hui-Liang; Li, Sheng-He; Zhong, Liang-Ting

    2014-01-01

    Heat stress decreases natural immunity making cows more vulnerable to diseases. A previous study reported that daidzein can enhance animal resistance to heat stress and regulate animal immunocompetence. However, it is unclear whether daidzein regulates the immune performance of late lactation cows under heat stress. In this study, late lactation cows in four groups were raised in hot weather and fed with basic diet, basic diet plus 200, 300, 400 mg/day daidzein, respectively, and the experimental period was 60 days. Blood was collected to examine the changes of serum total protein (TP), albumin (ALB), immunoglobulin G (IgG), interferon alpha (IFN-α), and interleukin-2 (IL-2). We found the levels of serum IgG and INF-α were significantly higher in late lactation cows after 300 and 400 mg/day daidzein treatment compared to those in the control group and 200 mg/day daidzein treatment (P 0.05). Daidzein can enhance the immunocompetence of late lactation cows and strengthen cow resistance to heat stress. © 2013 Japanese Society of Animal Science.

  8. Immune Checkpoint Function of CD85j in CD8 T Cell Differentiation and Aging

    Directory of Open Access Journals (Sweden)

    Claire E. Gustafson

    2017-06-01

    Full Text Available Aging is associated with an increased susceptibility to infection and a failure to control latent viruses thought to be driven, at least in part, by alterations in CD8 T cell function. The aging T cell repertoire is characterized by an accumulation of effector CD8 T cells, many of which express the negative regulatory receptor CD85j. To define the biological significance of CD85j expression on CD8 T cells and to address the question whether presence of CD85j in older individuals is beneficial or detrimental for immune function, we examined the specific attributes of CD8 T cells expressing CD85j as well as the functional role of CD85j in antigen-specific CD8 T cell responses during immune aging. Here, we show that CD85j is mainly expressed by terminally differentiated effector (TEMRAs CD8 T cells, which increase with age, in cytomegalovirus (CMV infection and in males. CD85j+ CMV-specific cells demonstrate clonal expansion. However, TCR diversity is similar between CD85j+ and CD85j− compartments, suggesting that CD85j does not directly impact the repertoire of antigen-specific cells. Further phenotypic and functional analyses revealed that CD85j identifies a specific subset of CMV-responsive CD8 T cells that coexpress a marker of senescence (CD57 but retain polyfunctional cytokine production and expression of cytotoxic mediators. Blocking CD85j binding enhanced proliferation of CMV-specific CD8 T cells upon antigen stimulation but did not alter polyfunctional cytokine production. Taken together, these data demonstrate that CD85j characterizes a population of “senescent,” but not exhausted antigen-specific effector CD8 T cells and indicates that CD85j is an important checkpoint regulator controlling expansion of virus-specific T cells during aging. Inhibition of CD85j activity may be a mechanism to promote stronger CD8 T cell effector responses during immune aging.

  9. Immunization coverage among Hispanic ancestry, 2003 National Immunization Survey.

    Science.gov (United States)

    Darling, Natalie J; Barker, Lawrence E; Shefer, Abigail M; Chu, Susan Y

    2005-12-01

    The Hispanic population is increasing and heterogeneous (Hispanic refers to persons of Spanish, Hispanic, or Latino descent). The objective was to examine immunization rates among Hispanic ancestry for the 4:3:1:3:3 series (> or = 4 doses diphtheria, tetanus toxoids, and pertussis vaccine; > or = 3 doses poliovirus vaccine; > or = 1 doses measles-containing vaccine; > or = 3 doses Haemophilus influenzae type b vaccine; and > or = 3 doses hepatitis B vaccine). The National Immunization Survey measures immunization coverage among 19- to 35-month-old U.S. children. Coverage was compared from combined 2001-2003 data among Hispanics and non-Hispanic whites using t-tests, and among Hispanic ancestry using a chi-square test. Hispanics were categorized as Mexican, Mexican American, Central American, South American, Puerto Rican, Cuban, Spanish Caribbean (primarily Dominican Republic), other, and multiple ancestry. Children of Hispanic ancestry increased from 21% in 1999 to 25% in 2003. These Hispanic children were less well immunized than non-Hispanic whites (77.0%, +/-2.1% [95% confidence interval] compared to 82.5%, +/-1.1% (95% CI) > in 2003). Immunization coverage did not vary significantly among Hispanics of varying ancestries (p=0.26); however, there was substantial geographic variability. In some areas, immunization coverage among Hispanics was significantly higher than non-Hispanic whites. Hispanic children were less well immunized than non-Hispanic whites; however, coverage varied notably by geographic area. Although a chi-square test found no significant differences in coverage among Hispanic ancestries, the range of coverage, 79.2%, +/-5.1% for Cuban Americans to 72.1%, +/-2.4% for Mexican descent, may suggest a need for improved and more localized monitoring among Hispanic communities.

  10. Systematic identification of anti-interferon function on hepatitis C virus genome reveals p7 as an immune evasion protein.

    Science.gov (United States)

    Qi, Hangfei; Chu, Virginia; Wu, Nicholas C; Chen, Zugen; Truong, Shawna; Brar, Gurpreet; Su, Sheng-Yao; Du, Yushen; Arumugaswami, Vaithilingaraja; Olson, C Anders; Chen, Shu-Hua; Lin, Chung-Yen; Wu, Ting-Ting; Sun, Ren

    2017-02-21

    Hepatitis C virus (HCV) encodes mechanisms to evade the multilayered antiviral actions of the host immune system. Great progress has been made in elucidating the strategies HCV employs to down-regulate interferon (IFN) production, impede IFN signaling transduction, and impair IFN-stimulated gene (ISG) expression. However, there is a limited understanding of the mechanisms governing how viral proteins counteract the antiviral functions of downstream IFN effectors due to the lack of an efficient approach to identify such interactions systematically. To study the mechanisms by which HCV antagonizes the IFN responses, we have developed a high-throughput profiling platform that enables mapping of HCV sequences critical for anti-IFN function at high resolution. Genome-wide profiling performed with a 15-nt insertion mutant library of HCV showed that mutations in the p7 region conferred high levels of IFN sensitivity, which could be alleviated by the expression of WT p7 protein. This finding suggests that p7 protein of HCV has an immune evasion function. By screening a liver-specific ISG library, we identified that IFI6-16 significantly inhibits the replication of p7 mutant viruses without affecting WT virus replication. In contrast, knockout of IFI6-16 reversed the IFN hypersensitivity of p7 mutant virus. In addition, p7 was found to be coimmunoprecipitated with IFI6-16 and to counteract the function of IFI6-16 by depolarizing the mitochondria potential. Our data suggest that p7 is a critical immune evasion protein that suppresses the antiviral IFN function by counteracting the function of IFI6-16.

  11. Effect of Xiao Chaihu Tang combined with intravenous chemotherapy on tumor markers and immune function in patients with advanced breast cancer

    Directory of Open Access Journals (Sweden)

    Jian-Ping Zhong

    2017-05-01

    Full Text Available Objective: To study the effect of Xiao Chaihu Tang combined with intravenous chemotherapy on tumor markers and immune function in patients with advanced breast cancer. Methods: 76 patients with advanced breast cancer treated in our hospital between May 2012 and November 2015 were collected and divided into the combined treatment group (n=34 who accepted Xiao Chaihu Tang combined with intravenous chemotherapy and the control group (n=42 who accepted intravenous chemotherapy alone according to different treatment, and the treatment cycle was 3 months for both groups. Before treatment and 3 months after treatment, ELISA method was used to detect serum levels of broad-spectrum tumor markers and breast cancerspecific tumor markers; flow cytometer was used to detect cellular immune function index levels, and turbidimetric immunoassay was used to detect humoral immune function index levels in peripheral blood. Results: Before treatment, differences in serum tumor marker levels as well as cellular immunity and humoral immunity index levels in peripheral blood were not statistically significant between two groups of patients (P>0.05; after 3 months of treatment, broad-spectrum tumor markers carcinoembryonic antigen (CEA, carbohydrate antigen 153 (CA153 and carbohydrate antigen 125 (CA125 levels in serum of combined treatment group were lower than those of control group, and breast cancer-specific tumor markers insulin-like growth factor-1 (IGF-1, midkine (MK, soluble E-cadherin (sEC and thymidine kinase 1 (TK1 levels were lower than those of control group (P<0.05; CD3+ and CD4+ T lymphocyte levels as well as CD4+/CD8+ ratio in peripheral blood of combined treatment group were higher than those of control group while CD8+ T lymphocyte level was lower than that of control group, and immunoglobulin G (IgG, immunoglobulin A (IgA and immunoglobulin M (IgM levels in peripheral blood were higher than those of control group (P<0.05. Conclusions: Xiao Chaihu Tang

  12. Long-term effect of postoperative irradiation on the immune functions in patients with mammary carcinoma

    International Nuclear Information System (INIS)

    Toivanen, A.; Nordman, E.

    1981-01-01

    The effect of postoperative irradiation on the immune functions of 13 patients with breast carcinoma is reported, using as parameters the peipheral blood lymphocyte count, percentages of E and EAC rosette forming cells, and lymphocyte proliferative responses to PHA, Con A and PPD. After irradiation the number of peripheral blood lymphocytes was reduced during 8 months. The percentages of E and EAC rosette forming cells were not altered during the observation time of 7 to 36 months. In the proliferative responses of lymphocytes to PHA, Con A and PPD, the postoperative irradiation caused a decrease which, regarding PHA and Con A, lasted up to 8 months and then recovered. The decrease in the proliferative responses to PPD was stronger and lasted during the whole observation time. In the mitogenic responses of patients with recurrent or disseminating disease no difference could be demonstrated as compared with the patients living recurrence-free. (Auth.)

  13. Identification of bovine leukemia virus tax function associated with host cell transcription, signaling, stress response and immune response pathway by microarray-based gene expression analysis

    Directory of Open Access Journals (Sweden)

    Arainga Mariluz

    2012-03-01

    Full Text Available Abstract Background Bovine leukemia virus (BLV is associated with enzootic bovine leukosis and is closely related to human T-cell leukemia virus type I. The Tax protein of BLV is a transcriptional activator of viral replication and a key contributor to oncogenic potential. We previously identified interesting mutant forms of Tax with elevated (TaxD247G or reduced (TaxS240P transactivation effects on BLV replication and propagation. However, the effects of these mutations on functions other than transcriptional activation are unknown. In this study, to identify genes that play a role in the cascade of signal events regulated by wild-type and mutant Tax proteins, we used a large-scale host cell gene-profiling approach. Results Using a microarray containing approximately 18,400 human mRNA transcripts, we found several alterations after the expression of Tax proteins in genes involved in many cellular functions such as transcription, signal transduction, cell growth, apoptosis, stress response, and immune response, indicating that Tax protein has multiple biological effects on various cellular environments. We also found that TaxD247G strongly regulated more genes involved in transcription, signal transduction, and cell growth functions, contrary to TaxS240P, which regulated fewer genes. In addition, the expression of genes related to stress response significantly increased in the presence of TaxS240P as compared to wild-type Tax and TaxD247G. By contrast, the largest group of downregulated genes was related to immune response, and the majority of these genes belonged to the interferon family. However, no significant difference in the expression level of downregulated genes was observed among the Tax proteins. Finally, the expression of important cellular factors obtained from the human microarray results were validated at the RNA and protein levels by real-time quantitative reverse transcription-polymerase chain reaction and western blotting

  14. Seasonality influences cuticle melanization and immune defense in a cricket: support for a temperature-dependent immune investment hypothesis in insects

    Energy Technology Data Exchange (ETDEWEB)

    Fedorka, K. M. [Univ. of Central Florida, Orlando, FL (United States); Copeland, E. K. [Univ. of Central Florida, Orlando, FL (United States); Winterhalter, W. E. [Univ. of Central Florida, Orlando, FL (United States)

    2013-07-18

    To improve thermoregulation in colder environments, insects are expected to darken their cuticles with melanin via the phenoloxidase cascade, a phenomenon predicted by the thermal melanin hypothesis. However, the phenoloxidase cascade also plays a significant role in insect immunity, leading to the additional hypothesis that the thermal environment indirectly shapes immune function via direct selection on cuticle color. Support for the latter hypothesis comes from the cricket Allonemobius socius, where cuticle darkness and immune-related phenoloxidase activity increase with latitude. However, thermal environments vary seasonally as well as geographically, suggesting that seasonal plasticity in immunity may also exist. Although seasonal fluctuations in vertebrate immune function are common (because of flux in breeding or resource abundance), seasonality in invertebrate immunity has not been widely explored. We addressed this possibility by rearing crickets in simulated summer and fall environments and assayed their cuticle color and immune function. Prior to estimating immunity, crickets were placed in a common environment to minimize metabolic rate differences. Individuals reared under fall-like conditions exhibited darker cuticles, greater phenoloxidase activity and greater resistance to the bacteria Serratia marcescens. These data support the hypothesis that changes in the thermal environment modify cuticle color, which indirectly shapes immune investment through pleiotropy. This hypothesis may represent a widespread mechanism governing immunity in numerous systems, considering that most insects operate in seasonally and geographically variable thermal environments.

  15. EFFECT OF POLYPHENOLIC COMPOUNDS ISOLATED FROM CARTHAMUS TINCTORIUS AND CALENDULA OFFICINALIS L., ON FUNCTIONAL ACTIVITY OF IMMUNE CELLS UNDER CONDITIONS OF CYTOSTATIC IMMUNOSUPPRESSION

    Directory of Open Access Journals (Sweden)

    N. V. Masnaya

    2013-01-01

    Full Text Available The purpose of the study – to study the effect of polyphenolic compounds extracted from the flowers of safflower oil and calendula, the functional activity of immune cells in cytotoxic immune suppression.Conventional methods determined the total number of splenocytes, relative (% and absolute (106, the number of antibody-forming cells (AFC in the spleen of mice by local hemolysis by Cunningham.Evaluated the effect of compounds of natural origin on the cellular immune response in the delayed-type hypersensitivity (DTH. Phagocytic activity of peritoneal macrophages was determined by the method based on the intensity of their capture ink particles. We studied the functional activity of peritoneal macrophages by NBT test (spontaneous and stimulated. Studies were conducted on male mice Category 1 (conventional linear mouse line CBA/CaLac aged 2–2.5 months, weighing 20–22 g. After the introduction mice line CBA/CaLac of polyphenolic compounds derived from flowers of Carthamus tinctorius and flowers of Calendula officinalis L. during the 5-day course in dose 50 mg/kg was observed stimulation of the humoral immune response (total number of splenocytes, the number of antibodies in the spleen cells and the functional activity of macrophages and Immunomodulating effect on the humoral immunity and the functional activity of macrophages after a single injection of cyclophosphamide in dose 250 mg/kg. Immunotropic activity of polyphenolic compounds is higher than that those of the reference product of tincture of Echinacea purpurea.

  16. Understanding the function and dysfunction of the immune system in lung cancer: the role of immune checkpoints.

    Science.gov (United States)

    Karachaliou, Niki; Cao, Maria Gonzalez; Teixidó, Cristina; Viteri, Santiago; Morales-Espinosa, Daniela; Santarpia, Mariacarmela; Rosell, Rafael

    2015-06-01

    Survival rates for metastatic lung cancer, including non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC), are poor with 5-year survivals of less than 5%. The immune system has an intricate and complex relationship with tumorigenesis; a groundswell of research on the immune system is leading to greater understanding of how cancer progresses and presenting new ways to halt disease progress. Due to the extraordinary power of the immune system-with its capacity for memory, exquisite specificity and central and universal role in human biology-immunotherapy has the potential to achieve complete, long-lasting remissions and cures, with few side effects for any cancer patient, regardless of cancer type. As a result, a range of cancer therapies are under development that work by turning our own immune cells against tumors. However deeper understanding of the complexity of immunomodulation by tumors is key to the development of effective immunotherapies, especially in lung cancer.

  17. Understanding the function and dysfunction of the immune system in lung cancer: the role of immune checkpoints

    International Nuclear Information System (INIS)

    Karachaliou, Niki; Cao, Maria Gonzalez; Teixidó, Cristina; Viteri, Santiago; Morales-Espinosa, Daniela; Santarpia, Mariacarmela; Rosell, Rafael

    2015-01-01

    Survival rates for metastatic lung cancer, including non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC), are poor with 5-year survivals of less than 5%. The immune system has an intricate and complex relationship with tumorigenesis; a groundswell of research on the immune system is leading to greater understanding of how cancer progresses and presenting new ways to halt disease progress. Due to the extraordinary power of the immune system—with its capacity for memory, exquisite specificity and central and universal role in human biology—immunotherapy has the potential to achieve complete, long-lasting remissions and cures, with few side effects for any cancer patient, regardless of cancer type. As a result, a range of cancer therapies are under development that work by turning our own immune cells against tumors. However deeper understanding of the complexity of immunomodulation by tumors is key to the development of effective immunotherapies, especially in lung cancer

  18. Stromal cell contributions to the homeostasis and functionality of the immune system.

    Science.gov (United States)

    Mueller, Scott N; Germain, Ronald N

    2009-09-01

    A defining characteristic of the immune system is the constant movement of many of its constituent cells through the secondary lymphoid tissues, mainly the spleen and lymph nodes, where crucial interactions that underlie homeostatic regulation, peripheral tolerance and the effective development of adaptive immune responses take place. What has only recently been recognized is the role that non-haematopoietic stromal elements have in many aspects of immune cell migration, activation and survival. In this Review, we summarize our current understanding of lymphoid compartment stromal cells, examine their possible heterogeneity, discuss how these cells contribute to immune homeostasis and the efficient initiation of adaptive immune responses, and highlight how targeting of these elements by some pathogens can influence the host immune response.

  19. Partial immunity in murine by immunization with a toxoplasmic DNA ...

    African Journals Online (AJOL)

    arsenal

    2012-06-12

    Jun 12, 2012 ... vaccine can be effective in partial protection against this parasite. In this study ... that mice immunized by pcROP1 with or without alum produced high Th1 immune response compared .... antigen-specific antibodies, 96-well costar plates were coated .... vaccines against some protozoa, for example, malaria,.

  20. Restoring Ovarian Endocrine Function with Encapsulated Ovarian Allograft in Immune Competent Mice.

    Science.gov (United States)

    David, Anu; Day, James Ronald; Cichon, Alexa Leigh; Lefferts, Adam; Cascalho, Marilia; Shikanov, Ariella

    2017-07-01

    Premature ovarian insufficiency (POI) is a major complication of cytotoxic treatments due to extreme ovarian sensitivity to chemotherapy and radiation. In pediatric cancer patients modern therapy has improved the long-term survival to over 80% in the United States. However, these cancer survivors face long-term health problems related to treatment toxicity. In female cancer survivors POI leads to sterility, along with the consequences of estrogen deficiency such as premature osteopenia, muscle wasting, accelerated cardiovascular diseases and a vast array of other health and developmental problems. These long-lasting effects are particularly significant for young girls reaching puberty. As such, restoring ovarian endocrine function is paramount in this population. In the present study, we evaluated the feasibility of restoring ovarian endocrine function in ovariectomized mice by transplanting syngeneic and allogeneic ovarian tissue encapsulated in alginate capsules or TheraCyte ® . Histological analysis of the implants retrieved after 7 and 30 days' post implantation showed follicular development up to the secondary and antral stages in both syngeneic and allogeneic implants. Implantation of syngeneic and allogeneic ovarian grafts encapsulated in TheraCyte devices restored ovarian endocrine function, which was confirmed by decreased serum FSH levels from 60 to 70 ng/mL in ovariectomized mice to 30-40 ng/mL 30 days after implantation. Absence of allo-MHC-specific IgG and IgM antibodies in the sera of implanted mice with allogeneic ovarian tissue encapsulated in TheraCyte indicate that the implants did not evoke an allo-immune response, while the allogeneic controls were rejected 21 days after implantation. Our results show that TheraCyte effectively isolates the graft from immune recognition but also supports follicular growth.

  1. Immune defense and host life history.

    Science.gov (United States)

    Zuk, Marlene; Stoehr, Andrew M

    2002-10-01

    Recent interest has focused on immune response in an evolutionary context, with particular attention to disease resistance as a life-history trait, subject to trade-offs against other traits such as reproductive effort. Immune defense has several characteristics that complicate this approach, however; for example, because of the risk of autoimmunity, optimal immune defense is not necessarily maximum immune defense. Two important types of cost associated with immunity in the context of life history are resource costs, those related to the allocation of essential but limited resources, such as energy or nutrients, and option costs, those paid not in the currency of resources but in functional or structural components of the organism. Resource and option costs are likely to apply to different aspects of resistance. Recent investigations into possible trade-offs between reproductive effort, particularly sexual displays, and immunity have suggested interesting functional links between the two. Although all organisms balance the costs of immune defense against the requirements of reproduction, this balance works out differently for males than it does for females, creating sex differences in immune response that in turn are related to ecological factors such as the mating system. We conclude that immune response is indeed costly and that future work would do well to include invertebrates, which have sometimes been neglected in studies of the ecology of immune defense.

  2. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  3. The effect of perioperative analgesic drugs omnopon and dexketoprofen on the functional activity of immune cells in murine model of tumor surgery

    Directory of Open Access Journals (Sweden)

    R. I. Sydor

    2016-08-01

    Full Text Available We aimed to investigate the effect of perioperative analgesia with nonselective cyclooxygenase-2 inhibitor dexketoprofen and opioid drug omnopon on the functional activity of immune cells in tumor excision murine model. Lewis lung carcinoma cells were transplanted into hind paw of C57/black mice. On the 23th day tumor was removed. Analgesic drugs were injected 30 min before and once a day for 3 days after the surgery. Biological material was obtained a day before, 1 day and 3 days after the tumor removal. IFN-γ, IL-4, IL-10 and TGF-β mRNA levels in splenic cells were assessed by quantitative real-time RT-PCR. Cytotoxic activity of splenocytes was estimated by flow cytometry. We found that in splenocytes of mice received opioid analgesia IL-10 mRNA level was increased 2.3 times on day one after the surgery compared to preoperative level (P < 0.05, while in dexketoprofen group this parameter did not change. IFN-γ gene expression level on day 3 after tumor removal was 40% higher in splenocytes of dexketoprofen treated mice as compared with omnopon treated animals (P < 0.05. Cytotoxic activity of splenocytes on day 3 postsurgery was (62.2 ± 2.4% in dexketoprofen against (50.2 ± 3.3% in omnopon group. In conclusion, perioperative analgesia with cyclooxygenase inhibitor dexketoprofen in contrast to opioid analgesia with omnopon preserves higher functional activity of murine immune cells in the experimental model of tumor surgery.

  4. Cross-immunity among allogeneic tumors of rats immunized with solid tumors

    International Nuclear Information System (INIS)

    Ogasawara, Masamichi

    1979-01-01

    Several experiments were done for the study of cross-immunity among allogeneic rat tumors by immunization using gamma-irradiated or non-irradiated solid tumors. Each group of rats which were immunized with gamma-irradiation solid tumor inocula from ascites tumor cell line of tetra-ploid Hirosaki sarcoma, Usubuchi sarcoma or AH 130, showed an apparent resistance against the intraperitoneal challenge with Hirosaki sarcoma. A similar resistance was demonstrated in the case of the challenge with Usubuchi sarcoma into rats immunized with non-irradiated methylcholanthrene (MCA)-induced tumors. In using solid MCA tumors as immunogen and Hirosaki sarcoma as challenge tumor, it was also demonstrated in 2 out of 3 groups immunized with non-irradiated tumors. In the experiment of trying to induce cross-immunity between 2 MCA tumors by immunization with irradiated solid tumor only, the inhibitory effect on the growth was observed in the early stage in the treated groups as compared with the control one. From the above results, it may be considered that the immunization with irradiated solid tumors fromas cites cell lines and non-irradiated solid MCA tumors induced strong cross-immunity in general, but that the immunization with only irradiated solid MCA tumors induced weak cross-immunity commonly. (author)

  5. Analysis of the toxicity of gold nano particles on the immune system: effect on dendritic cell functions

    International Nuclear Information System (INIS)

    Villiers, Christian L.; Freitas, Heidi; Couderc, Rachel; Villiers, Marie-Bernadette; Marche, Patrice N.

    2010-01-01

    The effect of manufactured gold nanoparticles (NPs) on the immune system was analysed through their ability to perturb the functions of dendritic cells (DCs), a major actor of both innate and acquired immune responses. For this purpose, DCs were produced in culture from mouse bone marrow progenitors. The analysis of the viability of the cells after their incubation in the presence of gold NPs shows that these NPs are not cytotoxics even at high concentration. Furthermore, the phenotype of the DC is unchanged after the addition of NPs, indicating that there is no activation of the DC. However, the analysis of the cells at the intracellular level reveals important amounts of gold NPs amassing in endocytic compartments. Furthermore, the secretion of cytokines is significantly modified after such internalisation indicating a potential perturbation of the immune response.

  6. Asian and Siberian ginseng as a potential modulator of immune function: an in vitro cytokine study using mouse macrophages.

    Science.gov (United States)

    Wang, Huamin; Actor, Jeffrey K; Indrigo, Jessica; Olsen, Margaret; Dasgupta, Amitava

    2003-01-01

    Ginseng is a widely used herbal product in China, other Asian countries, and in the Unites States. There is a traditional belief that ginseng stimulates immune functions. In this study, the innate effects of Asian and Siberian ginsengs on cytokines and chemokines produced by cultured macrophages were examined. The effects of Asian and Siberian ginseng on cytokines and chemokines produced by cultured macrophages were examined. Mouse macrophages (J774A.1) were incubated with Asian or Siberian ginseng at varying concentrations (1, 10, 100, and 1000 microg/ml) for 24 h and then harvested for RNA isolation. The expression levels of IL-1beta, IL-12, TNF-alpha, MIP-1 alpha, and MIP-2 mRNA were measured by quantitative PCR. Our data showed that Asian ginseng induced a statistically significant increase in IL-12 expression at both mRNA and protein levels. However, the minor twofold increase is probably biologically insignificant. No significant increase of IL-12 by Siberian ginseng was observed at any dose level studied. No significant change in IL-1beta, IL-15, TNF-alpha, or MIP-1alpha mRNA was observed by either Asian or Siberian ginseng treatment. Our data showed statistically significant differential regulation of IL-12 by Asian ginseng. Siberian ginseng did not show a statistically significant increase. We conclude that both Asian ginseng and Siberian ginseng cannot significantly stimulate innate macrophage immune functions that influence cellular immune responses. Therefore, contrary to the popular belief, Asian and Siberian ginseng may not stimulate immune function.

  7. Comparative Estimates of Crude and Effective Coverage of Measles Immunization in Low-Resource Settings: Findings from Salud Mesoamérica 2015.

    Science.gov (United States)

    Colson, K Ellicott; Zúñiga-Brenes, Paola; Ríos-Zertuche, Diego; Conde-Glez, Carlos J; Gagnier, Marielle C; Palmisano, Erin; Ranganathan, Dharani; Usmanova, Gulnoza; Salvatierra, Benito; Nazar, Austreberta; Tristao, Ignez; Sanchez Monin, Emmanuelle; Anderson, Brent W; Haakenstad, Annie; Murphy, Tasha; Lim, Stephen; Hernandez, Bernardo; Lozano, Rafael; Iriarte, Emma; Mokdad, Ali H

    2015-01-01

    Timely and accurate measurement of population protection against measles is critical for decision-making and prevention of outbreaks. However, little is known about how survey-based estimates of immunization (crude coverage) compare to the seroprevalence of antibodies (effective coverage), particularly in low-resource settings. In poor areas of Mexico and Nicaragua, we used household surveys to gather information on measles immunization from child health cards and caregiver recall. We also collected dried blood spots (DBS) from children aged 12 to 23 months to compare crude and effective coverage of measles immunization. We used survey-weighted logistic regression to identify individual, maternal, household, community, and health facility characteristics that predict gaps between crude coverage and effective coverage. We found that crude coverage was significantly higher than effective coverage (83% versus 68% in Mexico; 85% versus 50% in Nicaragua). A large proportion of children (19% in Mexico; 43% in Nicaragua) had health card documentation of measles immunization but lacked antibodies. These discrepancies varied from 0% to 100% across municipalities in each country. In multivariate analyses, card-positive children in Mexico were more likely to lack antibodies if they resided in urban areas or the jurisdiction of De Los Llanos. In contrast, card-positive children in Nicaragua were more likely to lack antibodies if they resided in rural areas or the North Atlantic region, had low weight-for-age, or attended health facilities with a greater number of refrigerators. Findings highlight that reliance on child health cards to measure population protection against measles is unwise. We call for the evaluation of immunization programs using serological methods, especially in poor areas where the cold chain is likely to be compromised. Identification of within-country variation in effective coverage of measles immunization will allow researchers and public health

  8. Ageing and the immune system: focus on macrophages.

    Science.gov (United States)

    Linehan, E; Fitzgerald, D C

    2015-03-01

    A fully functioning immune system is essential in order to maintain good health. However, the immune system deteriorates with advancing age, and this contributes to increased susceptibility to infection, autoimmunity, and cancer in the older population. Progress has been made in identifying age-related defects in the adaptive immune system. In contrast, relatively little research has been carried out on the impact of ageing on the innate immune response. This area requires further research as the innate immune system plays a crucial role in protection against infection and represents a first line of defence. Macrophages are central effector cells of the innate immune system and have many diverse functions. As a result, age-related impairments in macrophage function are likely to have important consequences for the health of the older population. It has been reported that ageing in macrophages impacts on many processes including toll-like receptor signalling, polarisation, phagocytosis, and wound repair. A detailed understanding of the impact of ageing on macrophages is required in order to develop therapeutics that will boost immune responses in the older population.

  9. Dendritic cells in peripheral tolerance and immunity

    DEFF Research Database (Denmark)

    Gad, Monika; Claesson, Mogens Helweg; Pedersen, Anders Elm

    2003-01-01

    Dendritic cells capable of influencing immunity exist as functionally distinct subsets, T cell-tolerizing and T cell-immunizing subsets. The present paper reviews how these subsets of DCs develop, differentiate and function in vivo and in vitro at the cellular and molecular level. In particular...

  10. Branched-chain Amino Acids are Beneficial to Maintain Growth Performance and Intestinal Immune-related Function in Weaned Piglets Fed Protein Restricted Diet

    Directory of Open Access Journals (Sweden)

    M. Ren

    2015-12-01

    Full Text Available As a novel approach for disease control and prevention, nutritional modulation of the intestinal health has been proved. However, It is still unknown whether branched-chain amino acid (BCAA is needed to maintain intestinal immune-related function. The objective of this study was to determine whether BCAA supplementation in protein restricted diet affects growth performance, intestinal barrier function and modulates post-weaning gut disorders. One hundred and eight weaned piglets (7.96±0.26 kg were randomly fed one of the three diets including a control diet (21% crude protein [CP], CON, a protein restricted diet (17% CP, PR and a BCAA diet (BCAA supplementation in the PR diet for 14 d. The growth performance, plasma amino acid concentrations, small intestinal morphology and intestinal immunoglobulins were tested. First, average daily gain (ADG (p0.05. The PR and BCAA treatments had a higher (p<0.05 plasma concentration of methionine and threonine than the CON treatment. The level of some essential and functional amino acids (such as arginine, phenylalanine, histidine, glutamine etc. in plasma of the PR group was lower (p<0.05 than that of the CON group. Compared with CON group, BCAA supplementation significantly increased BCAA concentrations (p<0.01 and decreased urea concentration (p<0.01 in pig plasma indicating that the efficiency of dietary nitrogen utilization was increased. Compared with CON group, the small intestine of piglets fed PR diet showed villous atrophy, increasing of intra-epithelial lymphocytes (IELs number (p<0.05 and declining of the immunoglobulin concentration, including jejunal immunoglobulin A (IgA (p = 0.04, secreted IgA (sIgA (p = 0.03 and immunoglobulin M (p = 0.08, and ileal IgA (p = 0.01 and immunoglobulin G (p = 0.08. The BCAA supplementation increased villous height in the duodenum (p<0.01, reversed the trend of an increasing IELs number. Notably, BCAA supplementation increased levels of jejunal and ileal

  11. Isotope-based immunological techniques. Their use in assessment of immune competence and the study of immune responses to pathogens

    International Nuclear Information System (INIS)

    Duffus, W.P.H.

    1984-01-01

    The influence of isotope-based techniques on both assessment of immune competence and immune response to pathogens is discussed. Immunodeficiencies acquired as a result of factors like malnutrition and concomitant disease can severely affect not only attempts to intensify and improve production but also successful immune response against important vaccines such as rinderpest and foot-and-mouth disease. Isotope-based techniques, with their accuracy, speed and small sample volume, are ideally suited for assessing immunocompetence. One of the main drawbacks remains antigen purity, an area where research should now be concentrated. Lymphocyte transformation is widely used to assess cell-mediated immuno-competence but techniques to assess biological functions such as phagocytosis and cell-mediated cytotoxicity could more usefully reflect immune status. These latter techniques utilize isotopes such as 3 H, 14 C, 32 P and 125 I. Investigation of specific cell-mediated immune response often requires a labelled target. Suitable isotopes such as 51 Cr, 99 Tcsup(m), 75 Se and 3 H are compared for their capacity to label both mammalian and parasite targets. Suggestions are made on a number of areas of research that might usefully be encouraged and supported in order to improve applied veterinary immunology in tropical countries. (author)

  12. Evaluation of immunization coverage by lot quality assurance sampling compared with 30-cluster sampling in a primary health centre in India.

    Science.gov (United States)

    Singh, J; Jain, D C; Sharma, R S; Verghese, T

    1996-01-01

    The immunization coverage of infants, children and women residing in a primary health centre (PHC) area in Rajasthan was evaluated both by lot quality assurance sampling (LQAS) and by the 30-cluster sampling method recommended by WHO's Expanded Programme on Immunization (EPI). The LQAS survey was used to classify 27 mutually exclusive subunits of the population, defined as residents in health subcentre areas, on the basis of acceptable or unacceptable levels of immunization coverage among infants and their mothers. The LQAS results from the 27 subcentres were also combined to obtain an overall estimate of coverage for the entire population of the primary health centre, and these results were compared with the EPI cluster survey results. The LQAS survey did not identify any subcentre with a level of immunization among infants high enough to be classified as acceptable; only three subcentres were classified as having acceptable levels of tetanus toxoid (TT) coverage among women. The estimated overall coverage in the PHC population from the combined LQAS results showed that a quarter of the infants were immunized appropriately for their ages and that 46% of their mothers had been adequately immunized with TT. Although the age groups and the periods of time during which the children were immunized differed for the LQAS and EPI survey populations, the characteristics of the mothers were largely similar. About 57% (95% CI, 46-67) of them were found to be fully immunized with TT by 30-cluster sampling, compared with 46% (95% CI, 41-51) by stratified random sampling. The difference was not statistically significant. The field work to collect LQAS data took about three times longer, and cost 60% more than the EPI survey. The apparently homogeneous and low level of immunization coverage in the 27 subcentres makes this an impractical situation in which to apply LQAS, and the results obtained were therefore not particularly useful. However, if LQAS had been applied by local

  13. 3,3′-Diindolylmethane Stimulates Murine Immune Function In Vitro and In Vivo*

    OpenAIRE

    Xue, Ling; Pestka, James J.; Li, Maoxiang; Firestone, Gary L; Bjeldanes, Leonard F.

    2007-01-01

    3,3′-Diindolylmethane (DIM), a major condensation product of indole-3-carbinol (I3C), exhibits chemopreventive properties in animal models of cancer. Recent studies have shown that DIM stimulates interferon-gamma (IFN-γ) production and potentiates the IFN-γ signaling pathway in human breast cancer cells via a mechanism that includes increased expression of the IFN-γ receptor. The goal of this study was to test the hypothesis that DIM modulates the murine immune function. Specifically, the eff...

  14. Functional characterization of Foxp3-specific spontaneous immune responses

    DEFF Research Database (Denmark)

    Larsen, Susanne Købke; Munir, S; Andersen, Anders Woetmann

    2013-01-01

    Tumor-infiltrating CD4+CD25+ regulatory T cells (Tregs) are associated with an impaired prognosis in several cancers. The transcription factor forkhead box P3 (Foxp3) is generally expressed in Tregs. Here, we identify and characterize spontaneous cytotoxic immune responses to Foxp3-expressing cel....... Consequently, induction of Foxp3-specific cytotoxic T-cell responses appears as an attractive tool to boost spontaneous or therapeutically provoked immune responses, for example, for the therapy of cancer....

  15. Immune Evasion, Immunopathology and the Regulation of the Immune System

    Directory of Open Access Journals (Sweden)

    Bruno Faivre

    2013-02-01

    Full Text Available Costs and benefits of the immune response have attracted considerable attention in the last years among evolutionary biologists. Given the cost of parasitism, natural selection should favor individuals with the most effective immune defenses. Nevertheless, there exists huge variation in the expression of immune effectors among individuals. To explain this apparent paradox, it has been suggested that an over-reactive immune system might be too costly, both in terms of metabolic resources and risks of immune-mediated diseases, setting a limit to the investment into immune defenses. Here, we argue that this view neglects one important aspect of the interaction: the role played by evolving pathogens. We suggest that taking into account the co-evolutionary interactions between the host immune system and the parasitic strategies to overcome the immune response might provide a better picture of the selective pressures that shape the evolution of immune functioning. Integrating parasitic strategies of host exploitation can also contribute to understand the seemingly contradictory results that infection can enhance, but also protect from, autoimmune diseases. In the last decades, the incidence of autoimmune disorders has dramatically increased in wealthy countries of the northern hemisphere with a concomitant decrease of most parasitic infections. Experimental work on model organisms has shown that this pattern may be due to the protective role of certain parasites (i.e., helminths that rely on the immunosuppression of hosts for their persistence. Interestingly, although parasite-induced immunosuppression can protect against autoimmunity, it can obviously favor the spread of other infections. Therefore, we need to think about the evolution of the immune system using a multidimensional trade-off involving immunoprotection, immunopathology and the parasitic strategies to escape the immune response.

  16. Cord blood gene expression supports that prenatal exposure to perfluoroalkyl substances causes depressed immune functionality in early childhood.

    Science.gov (United States)

    Pennings, Jeroen L A; Jennen, Danyel G J; Nygaard, Unni C; Namork, Ellen; Haug, Line S; van Loveren, Henk; Granum, Berit

    2016-01-01

    Perfluoroalkyl and polyfluoroalkyl substances (PFAS) are a class of synthetic compounds that have widespread use in consumer and industrial applications. PFAS are considered environmental pollutants that have various toxic properties, including effects on the immune system. Recent human studies indicate that prenatal exposure to PFAS leads to suppressed immune responses in early childhood. In this study, data from the Norwegian BraMat cohort was used to investigate transcriptomics profiles in neonatal cord blood and their association with maternal PFAS exposure, anti-rubella antibody levels at 3 years of age and the number of common cold episodes until 3 years. Genes associated with PFAS exposure showed enrichment for immunological and developmental functions. The analyses identified a toxicogenomics profile of 52 PFAS exposure-associated genes that were in common with genes associated with rubella titers and/or common cold episodes. This gene set contains several immunomodulatory genes (CYTL1, IL27) as well as other immune-associated genes (e.g. EMR4P, SHC4, ADORA2A). In addition, this study identified PPARD as a PFAS toxicogenomics marker. These markers can serve as the basis for further mechanistic or epidemiological studies. This study provides a transcriptomics connection between prenatal PFAS exposure and impaired immune function in early childhood and supports current views on PPAR- and NF-κB-mediated modes of action. The findings add to the available evidence that PFAS exposure is immunotoxic in humans and support regulatory policies to phase out these substances.

  17. Exercise training reveals trade-offs between endurance performance and immune function, but does not influence growth, in juvenile lizards.

    Science.gov (United States)

    Husak, Jerry F; Roy, Jordan C; Lovern, Matthew B

    2017-04-15

    Acquired energetic resources allocated to a particular trait cannot then be re-allocated to a different trait. This often results in a trade-off between survival and reproduction for the adults of many species, but such a trade-off may be manifested differently in juveniles not yet capable of reproduction. Whereas adults may allocate resources to current and/or future reproduction, juveniles can only allocate to future reproduction. Thus, juveniles should allocate resources toward traits that increase survival and their chances of future reproductive success. We manipulated allocation of resources to performance, via endurance exercise training, to examine trade-offs among endurance capacity, immune function and growth in juvenile green anole lizards. We trained male and female captive anoles on a treadmill for 8 weeks, with increasing intensity, and compared traits with those of untrained individuals. Our results show that training enhanced endurance capacity equally in both sexes, but immune function was suppressed only in females. Training had no effect on growth, but males had higher growth rates than females. Previous work showed that trained adults have enhanced growth, so juvenile growth is either insensitive to stimulation with exercise, or they are already growing at maximal rates. Our results add to a growing body of literature indicating that locomotor performance is an important part of life-history trade-offs that are sex and age specific. © 2017. Published by The Company of Biologists Ltd.

  18. Development of immune functionality in larval and juvenile crimson snapper Lutjanus erythropterus (Bloch 1790

    Directory of Open Access Journals (Sweden)

    Ke Cui

    2018-05-01

    Full Text Available Ontogenetic development of the immune system in crimson snapper (Lutjanus erythropterus Bloch 1790 larvae was histologically and enzymatically studied from hatch to 36 days post-hatch (DPH. Primitive hepatopancreas appeared on 2 DPH and renal tubules started hematopoiesis on 4 DPH. The spleen anlage appeared on 6 DPH and the thymus formed on 14 DPH. Total activities of superoxide dismutase (SOD, catalase (CAT, glutathione peroxidase (GPX and sodium-potassium adenosine triphosphatase (Na+ K+-ATPase gradually increased after hatch, and showed a sharp increase after 29 DPH during the transitional feeding period from Artemia to inert feed. The specific activities of SOD, CAT, and GPX showed a trend of sharp increase and reached the maximum level on 4 DPH when exogenous feeding started, except for Na+ K+-ATPase where the peak occurred on10 DPH. The specific activities of these five enzymes reached the peak during the food transition from rotifers to Artemia, but the total activity of enzymes showed an increasing trend as fish grew. The present study provides new knowledge of the development of functional enzymes relevant to fish larvae immunity, sheds light on the understanding of the change of larval health, and improves hatchery management of crimson snapper. Keywords: Immune system, Enzyme activity, Ontogenetic development, Crimson snapper Lutjanus erythropterus

  19. Innate immune reconstitution with suppression of HIV-1.

    Science.gov (United States)

    Scully, Eileen P; Lockhart, Ainsley; Garcia-Beltran, Wilfredo; Palmer, Christine D; Musante, Chelsey; Rosenberg, Eric; Allen, Todd M; Chang, J Judy; Bosch, Ronald J; Altfeld, Marcus

    2016-03-17

    Progressive HIV-1 infection leads to both profound immune suppression and pathologic inflammation in the majority of infected individuals. While adaptive immune dysfunction, as evidenced by CD4 + T cell depletion and exhaustion, has been extensively studied, less is known about the functional capacity of innate immune cell populations in the context of HIV-1 infection. Given the broad susceptibility to opportunistic infections and the dysregulated inflammation observed in progressive disease, we hypothesized that there would be significant changes in the innate cellular responses. Using a cohort of patients with multiple samplings before and after antiretroviral therapy (ART) initiation, we demonstrated increased responses to innate immune stimuli following viral suppression, as measured by the production of inflammatory cytokines. Plasma viral load itself had the strongest association with this change in innate functional capacity. We further identified epigenetic modifications in the TNFA promoter locus in monocytes that are associated with viremia, suggesting a molecular mechanism for the observed changes in innate immune function following initiation of ART. These data indicate that suppression of HIV-1 viremia is associated with changes in innate cellular function that may in part determine the restoration of protective immune responses.

  20. Plasmodium falciparum erythrocyte invasion: combining function with immune evasion.

    Directory of Open Access Journals (Sweden)

    Gavin J Wright

    2014-03-01

    Full Text Available All the symptoms and pathology of malaria are caused by the intraerythrocytic stages of the Plasmodium parasite life cycle. Because Plasmodium parasites cannot replicate outside a host cell, their ability to recognize and invade erythrocytes is an essential step for both parasite survival and malaria pathogenesis. This makes invasion a conceptually attractive vaccine target, especially because it is one of the few stages when the parasite is directly exposed to the host humoral immune system. This apparent vulnerability, however, has been countered by the parasite, which has evolved sophisticated molecular mechanisms to evade the host immune response so that parasites asymptomatically replicate within immune individuals. These mechanisms include the expansion of parasite invasion ligands, resulting in multiple and apparently redundant invasion "pathways", highly polymorphic parasite surface proteins that are immunologically distinct, and parasite proteins which are poorly immunogenic. These formidable defences have so far thwarted attempts to develop an effective blood-stage vaccine, leading many to question whether there really is an exploitable chink in the parasite's immune evasion defences. Here, we review recent advances in the molecular understanding of the P. falciparum erythrocyte invasion field, discuss some of the challenges that have so far prevented the development of blood-stage vaccines, and conclude that the parasite invasion ligand RH5 represents an essential pinch point that might be vulnerable to vaccination.

  1. Specific inulin-type fructan fibers protect against autoimmune diabetes by modulating gut immunity, barrier function, and microbiota homeostasis.

    Science.gov (United States)

    Chen, Kang; Chen, Hao; Faas, Marijke M; de Haan, Bart J; Li, Jiahong; Xiao, Ping; Zhang, Hao; Diana, Julien; de Vos, Paul; Sun, Jia

    2017-08-01

    Dietary fibers capable of modifying gut barrier and microbiota homeostasis affect the progression of type 1 diabetes (T1D). Here, we aim to compare modulatory effects of inulin-type fructans (ITFs), natural soluble dietary fibers with different degrees of fermentability from chicory root, on T1D development in nonobese diabetic mice. Female nonobese diabetic mice were weaned to long- and short-chain ITFs [ITF(l) and ITF(s), 5%] supplemented diet up to 24 weeks. T1D incidence, pancreatic-gut immune responses, gut barrier function, and microbiota composition were analyzed. ITF(l) but not ITF(s) supplementation dampened the incidence of T1D. ITF(l) promoted modulatory T-cell responses, as evidenced by increased CD25 + Foxp3 + CD4 + regulatory T cells, decreased IL17A + CD4 + Th17 cells, and modulated cytokine production profile in the pancreas, spleen, and colon. Furthermore, ITF(l) suppressed NOD like receptor protein 3 caspase-1-p20-IL-1β inflammasome in the colon. Expression of barrier reinforcing tight junction proteins occludin and claudin-2, antimicrobial peptides β-defensin-1, and cathelicidin-related antimicrobial peptide as well as short-chain fatty acid production were enhanced by ITF(l). Next-generation sequencing analysis revealed that ITF(l) enhanced Firmicutes/Bacteroidetes ratio to an antidiabetogenic balance and enriched modulatory Ruminococcaceae and Lactobacilli. Our data demonstrate that ITF(l) but not ITF(s) delays the development of T1D via modulation of gut-pancreatic immunity, barrier function, and microbiota homeostasis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Mucosal immunity in HIV infection: what can be done to restore gastrointestinal-associated lymphoid tissue function?

    Science.gov (United States)

    George, Michael D; Asmuth, David M

    2014-06-01

    This review describes the impact of HIV infection on gut-associated lymphoid tissue, the mechanisms for persistent gut-associated lymphoid tissue dysfunction despite effective antiretroviral therapy, and potential strategies to restore gut-associated lymphoid tissue function and promote immune reconstitution. Recent studies indicate that unresolved microbial translocation and intestinal dysbiosis may continue to promote enteropathy as well as HIV-associated and non-HIV-associated conditions in many HIV patients who otherwise maintain therapeutic control of systemic viral replication. Several novel therapeutic approaches to reduce intestinal inflammation and mitigate microbial translocation may hold promise for restoring gastrointestinal health and thereby increasing the efficacy of immune reconstitution in HIV-infected patients undergoing antiretroviral therapy.

  3. Microneedle-mediated immunization of an adenovirus-based malaria vaccine enhances antigen-specific antibody immunity and reduces anti-vector responses compared to the intradermal route

    OpenAIRE

    Carey, John B.; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V. S.; Draper, Simon J.; Moore, Anne C.

    2014-01-01

    Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP142, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delive...

  4. Childhood immunization

    Science.gov (United States)

    Romain, Sandra; Schillaci, Michael A.

    2009-01-01

    ABSTRACT OBJECTIVE To examine childhood immunization levels relative to the number of family physicians, pediatricians, and public health nurses in Ontario. DESIGN Retrospective comparative analysis of publicly available data on immunization coverage levels and the relative number of family physicians, pediatricians, and public health nurses. SETTING Ontario. PARTICIPANTS Seven-year-old children, family physicians, pediatricians, and public health nurses in Ontario. MAIN OUTCOME MEASURES The association between immunization coverage levels and the relative number of family physicians, pediatricians, and public health nurses. RESULTS We found correlations between immunization coverage levels and the relative number (ie, per 1000 Ontario residents) of family physicians (ρ = 0.60) and pediatricians (ρ = 0.70) and a lower correlation with the relative number of public health nurses (ρ = 0.40), although none of these correlations was significant. A comparison of temporal trends illustrated that variation in the relative number of family physicians and pediatricians in Ontario was associated with similar variation in immunization coverage levels. CONCLUSION Increasing the number of family physicians and pediatricians might help to boost access to immunizations and perhaps other components of cost-saving childhood preventive care. PMID:19910599

  5. Immune response and biochemistry of calves immunized with rMSP1a ( Anaplasma marginale using carbon nanotubes as carrier molecules

    Directory of Open Access Journals (Sweden)

    Bruna Torres Silvestre

    2018-05-01

    Full Text Available Abstract Vaccination against Anaplasma marginale has been considered an important control strategy for bovine anaplasmosis. Recently, mice immunized with rMSP1 a linked to carbon nanotubes (MWNT showed significant immune responses, generating a new possibility for use of an inactivated vaccine. The objective of this study was to investigate the cellular and humoral responses in calves immunized with MWNT+rMSP1a , associated with inactivated vaccine of A. marginale produced in vitro, and evaluate the toxic effects of the MWNT on renal and hepatic function. rMSP1a was covalently linked to MWNT. Inactivated vaccine (AmUFMG2 was produced by cultivating A. marginale in IDE8 cells. Twenty-four Holstein calves were divided (four groups and immunized subcutaneously with PBS and non-carboxylated MWNT (control, G1, AmUFMG2 (G2, MWNT+rMSP1a (G3, and AmUFMG2 with MWNT+rMSP1a (G4. Blood samples were collected for total leukocyte counts, biochemical profiling and evaluation of the cellular and humoral response. Immunization with MWNT+rMSP1a induced increase in the total number of leukocytes, NK cells, in the lymphocyte populations and higher levels of antibodies compared to calves immunized only with AmUFMG2. Furthermore, MWNT did not induce changes in the biochemical profile. These data indicate that MWNT+rMSP1a were able to induce the immune responses more efficiently than AmUFMG2 alone, without generating toxicity.

  6. Immune regulation and CNS autoimmune disease

    DEFF Research Database (Denmark)

    Antel, J P; Owens, T

    1999-01-01

    The central nervous system is a demonstrated target of both clinical and experimental immune mediated disorders. Immune regulatory mechanisms operative at the levels of the systemic immune system, the blood brain barrier, and within the CNS parenchyma are important determinants of the intensity...... and duration of the tissue directed injury. Convergence of research, involving direct manipulation of specific cells and molecular mediators in animal models and in vitro analysis of human immune and neural cells and tissues, is providing increasing insight into the role of these immune regulatory functions...

  7. Intestinal dendritic cells in the regulation of mucosal immunity

    DEFF Research Database (Denmark)

    Bekiaris, Vasileios; Persson, Emma K.; Agace, William Winston

    2014-01-01

    immune cells within the mucosa must suitably respond to maintain intestinal integrity, while also providing the ability to mount effective immune responses to potential pathogens. Dendritic cells (DCs) are sentinel immune cells that play a central role in the initiation and differentiation of adaptive....... The recognition that dietary nutrients and microbial communities in the intestine influence both mucosal and systemic immune cell development and function as well as immune-mediated disease has led to an explosion of literature in mucosal immunology in recent years and a growing interest in the functionality...

  8. Influence on the mouse immune system of chronic ingestion of {sup 137}Cs

    Energy Technology Data Exchange (ETDEWEB)

    Bertho, Jean-Marc; Faure, Marie-Cecile; Louiba, Sonia; Tourlonias, Elie; Stefani, Johanna; Siffert, Baptiste; Paquet, Francois; Dublineau, Isabelle, E-mail: Jean-marc.bertho@irsn.fr [IRSN, Laboratoire de Radiotoxicologie Experimentale, Fontenay aux Roses (France)

    2011-03-01

    The aim of this work was to determine the possible occurrence of damage to the immune system during the course of chronic ingestion of {sup 137}Cs. BALB/C mice were used, with {sup 137}Cs intake via drinking water at a concentration of 20 kBq l{sup -1}. Adults received {sup 137}Cs before mating and offspring were sacrificed at various ages between birth and 20 weeks. Phenotypic analysis of circulating blood cells and thymocytes did not show any significant modification of immune cell populations in animals ingesting {sup 137}Cs as compared with control animals, with the exception of a slight increase in Treg percentage at the age of 12 weeks. Functional tests, including proliferative response to mitogens such as phytohaemagglutinin, response to alloantigens in mixed lymphocyte reaction and immunoglobulin response to vaccine antigens such as tetanus toxin and keyhole limpet haemocyanin did not show any significant functional modification of the immune system in {sup 137}Cs-ingesting animals as compared with control animals. Overall, our results suggest that chronic ingestion of a low concentration of {sup 137}Cs in drinking water in the long term does not have any biologically relevant effect on the immune system.

  9. Integrated analysis of HPV-mediated immune alterations in cervical cancer.

    Science.gov (United States)

    Chen, Long; Luan, Shaohong; Xia, Baoguo; Liu, Yansheng; Gao, Yuan; Yu, Hongyan; Mu, Qingling; Zhang, Ping; Zhang, Weina; Zhang, Shengmiao; Wei, Guopeng; Yang, Min; Li, Ke

    2018-05-01

    Human papillomavirus (HPV) infection is the primary cause of cervical cancer. HPV-mediated immune alterations are known to play crucial roles in determining viral persistence and host cell transformation. We sought to thoroughly understand HPV-directed immune alterations in cervical cancer by exploring publically available datasets. 130 HPV positive and 7 HPV negative cervical cancer cases from The Cancer Genome Atlas were compared for differences in gene expression levels and functional enrichment. Analyses for copy number variation (CNV) and genetic mutation were conducted for differentially expressed immune genes. Kaplan-Meier analysis was performed to assess survival and relapse differences across cases with or without alterations of the identified immune signature genes. Genes up-regulated in HPV positive cervical cancer were enriched for various gene ontology terms of immune processes (P=1.05E-14~1.00E-05). Integrated analysis of the differentially expressed immune genes identified 9 genes that displayed either CNV, genetic mutation and/or gene expression changes in at least 10% of the cases of HPV positive cervical cancer. Genomic amplification may cause elevated levels of these genes in some HPV positive cases. Finally, patients with alterations in at least one of the nine signature genes overall had earlier relapse compared to those without any alterations. The altered expression of either TFRC or MMP13 may indicate poor survival for a subset of cervical cancer patients (P=1.07E-07). We identified a novel immune gene signature for HPV positive cervical cancer that is potentially associated with early relapse of cervical cancer. Copyright © 2018. Published by Elsevier Inc.

  10. Targeting CD28, CTLA-4 and PD-L1 costimulation differentially controls immune synapses and function of human regulatory and conventional T-cells.

    Directory of Open Access Journals (Sweden)

    Nahzli Dilek

    Full Text Available CD28, CTLA-4 and PD-L1, the three identified ligands for CD80/86, are pivotal positive and negative costimulatory molecules that, among other functions, control T cell motility and formation of immune synapse between T cells and antigen-presenting cells (APCs. What remains incompletely understood is how CD28 leads to the activation of effector T cells (Teff but inhibition of suppression by regulatory T cells (Tregs, while CTLA-4 and PD-L1 inhibit Teff function but are crucial for the suppressive function of Tregs. Using alloreactive human T cells and blocking antibodies, we show here by live cell dynamic microscopy that CD28, CTLA-4, and PD-L1 differentially control velocity, motility and immune synapse formation in activated Teff versus Tregs. Selectively antagonizing CD28 costimulation increased Treg dwell time with APCs and induced calcium mobilization which translated in increased Treg suppressive activity, in contrast with the dampening effect on Teff responses. The increase in Treg suppressive activity after CD28 blockade was also confirmed with polyclonal Tregs. Whereas CTLA-4 played a critical role in Teff by reversing TCR-induced STOP signals, it failed to affect motility in Tregs but was essential for formation of the Treg immune synapse. Furthermore, we identified a novel role for PD-L1-CD80 interactions in suppressing motility specifically in Tregs. Thus, our findings reveal that the three identified ligands of CD80/86, CD28, CTLA-4 and PD-L1, differentially control immune synapse formation and function of the human Teff and Treg cells analyzed here. Individually targeting CD28, CTLA-4 and PD-L1 might therefore represent a valuable therapeutic strategy to treat immune disorders where effector and regulatory T cell functions need to be differentially targeted.

  11. Plasma-mediated immune suppression : a neonatal perspective

    NARCIS (Netherlands)

    Belderbos, Mirjam E.; Levy, Ofer; Meyaard, Linde; Bont, Louis

    Plasma is a rich mixture of immune regulatory factors that shape immune cell function. This immunomodulatory role of plasma is especially important in neonates. To maintain in utero feto-maternal tolerance and to allow for microbial colonization after birth, the neonatal immune system is biased

  12. Lysozyme's lectin-like characteristics facilitates its immune defense function

    KAUST Repository

    Zhang, Ruiyan

    2017-06-06

    Interactions between human lysozyme (HL) and the lipopolysaccharide (LPS) of Klebsiella pneumoniae O1, a causative agent of lung infection, were identified by surface plasmon resonance. To characterize the molecular mechanism of this interaction, HL binding to synthetic disaccharides and tetrasaccharides representing one and two repeating units, respectively, of the O-chain of this LPS were studied. pH-dependent structural rearrangements of HL after interaction with the disaccharide were observed through nuclear magnetic resonance. The crystal structure of the HL-tetrasaccharide complex revealed carbohydrate chain packing into the A, B, C, and D binding sites of HL, which primarily occurred through residue-specific, direct or water-mediated hydrogen bonds and hydrophobic contacts. Overall, these results support a crucial role of the Glu35/Asp53/Trp63/Asp102 residues in HL binding to the tetrasaccharide. These observations suggest an unknown glycan-guided mechanism that underlies recognition of the bacterial cell wall by lysozyme and may complement the HL immune defense function.

  13. Lysozyme's lectin-like characteristics facilitates its immune defense function

    KAUST Repository

    Zhang, Ruiyan; Wu, Lisha; Eckert, Thomas; Burg-Roderfeld, Monika; Rojas-Macias, Miguel A.; Lü tteke, Thomas; Krylov, Vadim B.; Argunov, Dmitry A.; Datta, Aritreyee; Markart, Philipp; Guenther, Andreas; Norden, Bengt; Schauer, Roland; Bhunia, Anirban; Enani, Mushira Abdelaziz; Billeter, Martin; Scheidig, Axel J.; Nifantiev, Nikolay E.; Siebert, Hans-Christian

    2017-01-01

    Interactions between human lysozyme (HL) and the lipopolysaccharide (LPS) of Klebsiella pneumoniae O1, a causative agent of lung infection, were identified by surface plasmon resonance. To characterize the molecular mechanism of this interaction, HL binding to synthetic disaccharides and tetrasaccharides representing one and two repeating units, respectively, of the O-chain of this LPS were studied. pH-dependent structural rearrangements of HL after interaction with the disaccharide were observed through nuclear magnetic resonance. The crystal structure of the HL-tetrasaccharide complex revealed carbohydrate chain packing into the A, B, C, and D binding sites of HL, which primarily occurred through residue-specific, direct or water-mediated hydrogen bonds and hydrophobic contacts. Overall, these results support a crucial role of the Glu35/Asp53/Trp63/Asp102 residues in HL binding to the tetrasaccharide. These observations suggest an unknown glycan-guided mechanism that underlies recognition of the bacterial cell wall by lysozyme and may complement the HL immune defense function.

  14. The cell-mediated immunity of Drosophila melanogaster: hemocyte lineages, immune compartments, microanatomy and regulation.

    Science.gov (United States)

    Honti, Viktor; Csordás, Gábor; Kurucz, Éva; Márkus, Róbert; Andó, István

    2014-01-01

    In the animal kingdom, innate immunity is the first line of defense against invading pathogens. The dangers of microbial and parasitic attacks are countered by similar mechanisms, involving the prototypes of the cell-mediated immune responses, the phagocytosis and encapsulation. Work on Drosophila has played an important role in promoting an understanding of the basic mechanisms of phylogenetically conserved modules of innate immunity. The aim of this review is to survey the developments in the identification and functional definition of immune cell types and the immunological compartments of Drosophila melanogaster. We focus on the molecular and developmental aspects of the blood cell types and compartments, as well as the dynamics of blood cell development and the immune response. Further advances in the characterization of the innate immune mechanisms in Drosophila will provide basic clues to the understanding of the importance of the evolutionary conserved mechanisms of innate immune defenses in the animal kingdom. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. [The role of the innate immune system in atopic dermatitis].

    Science.gov (United States)

    Volz, T; Kaesler, S; Skabytska, Y; Biedermann, T

    2015-02-01

    The mechanisms how the innate immune system detects microbes and mounts a rapid immune response have been more and more elucidated in the past years. Subsequently it has been shown that innate immunity also shapes adaptive immune responses and determines their quality that can be either inflammatory or tolerogenic. As atopic dermatitis is characterized by disturbances of innate and adaptive immune responses, colonization with pathogens and defects in skin barrier function, insight into mechanisms of innate immunity has helped to understand the vicious circle of ongoing skin inflammation seen in atopic dermatitis patients. Elucidating general mechanisms of the innate immune system and its functions in atopic dermatitis paves the way for developing new therapies. Especially the novel insights into the human microbiome and potential functional consequences make the innate immune system a very fundamental and promising target. As a result atopic dermatitis manifestations can be attenuated or even resolved. These currently developed strategies will be introduced in the current review.

  16. Intestinal stromal cells in mucosal immunity and homeostasis.

    Science.gov (United States)

    Owens, B M J; Simmons, A

    2013-03-01

    A growing body of evidence suggests that non-hematopoietic stromal cells of the intestine have multiple roles in immune responses and inflammation at this mucosal site. Despite this, many still consider gut stromal cells as passive structural entities, with past research focused heavily on their roles in fibrosis, tumor progression, and wound healing, rather than their contributions to immune function. In this review, we discuss our current knowledge of stromal cells in intestinal immunity, highlighting the many immunological axes in which stromal cells have a functional role. We also consider emerging data that broaden the potential scope of their contribution to immunity in the gut and argue that these so-called "non-immune" cells are reclassified in light of their diverse contributions to intestinal innate immunity and the maintenance of mucosal homeostasis.

  17. Metabolites related to renal function, immune activation, and carbamylation are associated with muscle composition in older adults.

    Science.gov (United States)

    Lustgarten, Michael S; Fielding, Roger A

    2017-12-15

    Reduced skeletal muscle density in older adults is associated with insulin resistance, decreased physical function, and an increased all-cause mortality risk. To elucidate mechanisms that may underlie the maintenance of skeletal muscle density, we conducted a secondary analysis of previously published muscle composition and serum metabolomic data in 73 older adults (average age, 78y). Multivariable-adjusted linear regression was used to examine associations between 321 metabolites with muscle composition, defined as the ratio between normal density (NDM) with low density (LDM) thigh muscle cross sectional area (NDM/LDM). Sixty metabolites were significantly (p≤0.05 and qMetabolites that were significantly associated with muscle composition were then tested for their association with circulating markers of renal function (blood urea nitrogen, creatinine, uric acid), and with the immune response (neutrophils/lymphocytes) and activation (kynurenine/tryptophan). 43 significant NDM/LDM metabolites (including urea) were co-associated with at least 1 marker of renal function; 23 of these metabolites have been previously identified as uremic solutes. The neutrophil/lymphocyte ratio was significantly associated with NDM/LDM (β±SE: -0.3±0.1, p=0.01, q=0.04). 35 significant NDM/LDM metabolites were co-associated with immune activation. Carbamylation (defined as homocitrulline/lysine) was identified as a pathway that may link renal function and immune activation with muscle composition, as 29 significant NDM/LDM metabolites were co-associated with homocitrulline/lysine, with at least 2 markers of renal function, and with kynurenine/tryptophan. When considering that elevated urea and uremic metabolites have been linked with an increased systemic microbial burden, that antimicrobial defense can be reduced in the presence of carbamylation, and that adipocytes can promote host defense, we propose the novel hypothesis that the age-related increase in adipogenesis within muscle

  18. Modulation of immune homeostasis by commensal bacteria

    Science.gov (United States)

    Ivanov, Ivaylo I.; Littman, Dan R.

    2011-01-01

    Intestinal bacteria form a resident community that has co-evolved with the mammalian host. In addition to playing important roles in digestion and harvesting energy, commensal bacteria are crucial for the proper functioning of mucosal immune defenses. Most of these functions have been attributed to the presence of large numbers of “innocuous” resident bacteria that dilute or occupy niches for intestinal pathogens or induce innate immune responses that sequester bacteria in the lumen, thus quenching excessive activation of the mucosal immune system. However it has recently become obvious that commensal bacteria are not simply beneficial bystanders, but are important modulators of intestinal immune homeostasis and that the composition of the microbiota is a major factor in pre-determining the type and robustness of mucosal immune responses. Here we review specific examples of individual members of the microbiota that modify innate and adaptive immune responses, and we focus on potential mechanisms by which such species-specific signals are generated and transmitted to the host immune system. PMID:21215684

  19. Necroptotic signaling in adaptive and innate immunity.

    Science.gov (United States)

    Lu, Jennifer V; Chen, Helen C; Walsh, Craig M

    2014-11-01

    The vertebrate immune system is highly dependent on cell death for efficient responsiveness to microbial pathogens and oncogenically transformed cells. Cell death pathways are vital to the function of many immune cell types during innate, humoral and cellular immune responses. In addition, cell death regulation is imperative for proper adaptive immune self-tolerance and homeostasis. While apoptosis has been found to be involved in several of these roles in immunity, recent data demonstrate that alternative cell death pathways are required. Here, we describe the involvement of a programmed form of cellular necrosis called "necroptosis" in immunity. We consider the signaling pathways that promote necroptosis downstream of death receptors, type I transmembrane proteins of the tumor necrosis factor (TNF) receptor family. The involvement of necroptotic signaling through a "RIPoptosome" assembled in response to innate immune stimuli or genotoxic stress is described. We also characterize the induction of necroptosis following antigenic stimulation in T cells lacking caspase-8 or FADD function. While necroptotic signaling remains poorly understood, it is clear that this pathway is an essential component to effective vertebrate immunity. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Altered time structure of neuro-endocrine-immune system function in lung cancer patients

    Directory of Open Access Journals (Sweden)

    Carughi Stefano

    2010-06-01

    Full Text Available Abstract Background The onset and the development of neoplastic disease may be influenced by many physiological, biological and immunological factors. The nervous, endocrine and immune system might act as an integrated unit to mantain body defense against this pathological process and reciprocal influences have been evidenced among hypothalamus, pituitary, thyroid, adrenal, pineal gland and immune system. In this study we evaluated differences among healthy subjects and subjects suffering from lung cancer in the 24-hour secretory profile of melatonin, cortisol, TRH, TSH, FT4, GH, IGF-1 and IL-2 and circadian variations of lymphocyte subpopulations. Methods In ten healthy male volunteers (age range 45-66 and ten male patients with untreated non small cell lung cancer (age range 46-65 we measured melatonin, cortisol, TRH, TSH, FT4, GH, IGF-1 and IL-2 serum levels and percentages of lymphocyte subpopulations on blood samples collected every four hours for 24 hours. One-way ANOVA between the timepoints for each variable and each group was performed to look for a time-effect, the presence of circadian rhythmicity was evaluated, MESOR, amplitude and acrophase values, mean diurnal levels and mean nocturnal levels were compared. Results A clear circadian rhythm was validated in the control group for hormone serum level and for lymphocyte subsets variation. Melatonin, TRH, TSH, GH, CD3, CD4, HLA-DR, CD20 and CD25 expressing cells presented circadian rhythmicity with acrophase during the night. Cortisol, CD8, CD8bright, CD8dim, CD16, TcRδ1 and δTcS1 presented circadian rhythmicity with acrophase in the morning/at noon. FT4, IGF-1 and IL-2 variation did not show circadian rhythmicity. In lung cancer patients cortisol, TRH, TSH and GH serum level and all the lymphocyte subsubsets variation (except for CD4 showed loss of circadian rhythmicity. MESOR of cortisol, TRH, GH, IL-2 and CD16 was increased, whereas MESOR of TSH, IGF-1, CD8, CD8bright, TcRδ1 and

  1. Immune Reconstitution after Allogeneic Hematopoietic Stem Cell Transplantation

    Science.gov (United States)

    Ogonek, Justyna; Kralj Juric, Mateja; Ghimire, Sakhila; Varanasi, Pavankumar Reddy; Holler, Ernst; Greinix, Hildegard; Weissinger, Eva

    2016-01-01

    The timely reconstitution and regain of function of a donor-derived immune system is of utmost importance for the recovery and long-term survival of patients after allogeneic hematopoietic stem cell transplantation (HSCT). Of note, new developments such as umbilical cord blood or haploidentical grafts were associated with prolonged immunodeficiency due to delayed immune reconstitution, raising the need for better understanding and enhancing the process of immune reconstitution and finding strategies to further optimize these transplant procedures. Immune reconstitution post-HSCT occurs in several phases, innate immunity being the first to regain function. The slow T cell reconstitution is regarded as primarily responsible for deleterious infections with latent viruses or fungi, occurrence of graft-versus-host disease, and relapse. Here we aim to summarize the major steps of the adaptive immune reconstitution and will discuss the importance of immune balance in patients after HSCT. PMID:27909435

  2. Comparative characteristics of immune answers indicators depending on the replicative activity and genotype of hepatitis c virus

    Directory of Open Access Journals (Sweden)

    Олеся Василівна Гололобова

    2015-08-01

    Full Text Available Aim. To analyze the character of changes and disorders of immune system with the help of complex study of indicators of cellular and humor section of immunity, cytokine status in patients with HCV-infection taking into account the replicative activity, genotype of virus and to formulate the possible causes of chronization.Methods. There were examined 155 patients with HCV-infection. An acute hepatitis C AHC was fixed in 23,9 %, chronic hepatitis C (CHC– in 76,1 %, 18–70 years old. Among examined patients with AHC and CHC prevailed men (67,6 and 72 % respectively. Diagnosis was set on the base of clinic and amnestic, epidemiologic, laboratory and instrumental data. Epidemiologic verification of diagnosis was realized by detection the specific serologic markers of HC (anti-HCV (sum, anti-HCV IgM and Ig G, anti-HCV core and anti-HCV NS-3, NS-4, NS-5 in blood serum using ELISA method. Molecular and genetic studies that included definition of replicative activity of HCV evaluated on the base of detection of RNA HCV in blood serum using the qualitative PCR method were carried out in 126 patients (31 with AHC and 95 with CHC. At the same time RNA of HCV was detected in peripheral blood in all (31 patients with AHC and in 74 (77,89 % patients with CHC. Using the method of restriction analysis we carried out the genetic typing of HCV in 90 patients with AHC and 60 with CHC. We carried out the comparative characteristics of the content of immunologic indicators in 45 (75 % patients with CHC with positive and 15 (25 % patients with negative results of PCR-study (polymerase chain reaction of HCV RNA in blood. For detection of regularities of changes of immune status depending on virus genotype there was carried out the comparative assessment of the content of immunologic indicators in patients with AHC and CHC with the most widespread genotypes of HVC– 1b and 3a. Immunologic studies included the definitions of the main subpopulations of lymphocytes

  3. IMMUNE SYSTEM MATURITY AND SENSITIVITY TO CHEMICAL EXPOSURE

    Science.gov (United States)

    It is well established that human diseases associated with abnormal immune function, including some common infectious diseases and asthma, are considerably more prevalent at younger ages. The immune system continues to mature after birth, and functional immaturity accounts for m...

  4. Are there differences in immune function between continental and insular birds?

    NARCIS (Netherlands)

    Matson, K.D.

    2006-01-01

    Generally, immune system architecture varies with different environments, which presumably reflect different pathogen pressures. Specifically, populations from relatively disease-free, oceanic islands are expected to exhibit reorganized immune systems, which might be characterized by attenuated

  5. Epitope-based vaccines with the Anaplasma marginale MSP1a functional motif induce a balanced humoral and cellular immune response in mice.

    Directory of Open Access Journals (Sweden)

    Paula S Santos

    Full Text Available Bovine anaplasmosis is a hemoparasitic disease that causes considerable economic loss to the dairy and beef industries. Cattle immunized with the Anaplasma marginale MSP1 outer membrane protein complex presents a protective humoral immune response; however, its efficacy is variable. Immunodominant epitopes seem to be a key-limiting factor for the adaptive immunity. We have successfully demonstrated that critical motifs of the MSP1a functional epitope are essential for antibody recognition of infected animal sera, but its protective immunity is yet to be tested. We have evaluated two synthetic vaccine formulations against A. marginale, using epitope-based approach in mice. Mice infection with bovine anaplasmosis was demonstrated by qPCR analysis of erythrocytes after 15-day exposure. A proof-of-concept was obtained in this murine model, in which peptides conjugated to bovine serum albumin were used for immunization in three 15-day intervals by intraperitoneal injections before challenging with live bacteria. Blood samples were analyzed for the presence of specific IgG2a and IgG1 antibodies, as well as for the rickettsemia analysis. A panel containing the cytokines' transcriptional profile for innate and adaptive immune responses was carried out through qPCR. Immunized BALB/c mice challenged with A. marginale presented stable body weight, reduced number of infected erythrocytes, and no mortality; and among control groups mortality rates ranged from 15% to 29%. Additionally, vaccines have significantly induced higher IgG2a than IgG1 response, followed by increased expression of pro-inflammatory cytokines. This is a successful demonstration of epitope-based vaccines, and protection against anaplasmosis may be associated with elicitation of effector functions of humoral and cellular immune responses in murine model.

  6. A novel hybrid stress-function finite element method immune to severe mesh distortion

    International Nuclear Information System (INIS)

    Cen Song; Zhou Mingjue; Fu Xiangrong

    2010-01-01

    This paper introduces a hybrid stress-function finite element method proposed recently for developing 2D finite element models immune to element shapes. Deferent from the first version of the hybrid-stress element constructed by Pian, the stress function φ of 2D elastic or fracture problem is regarded as the functional variable of the complementary energy functional. Then, the basic analytical solutions of φ are taken as the trial functions for finite element models, and meanwhile, the corresponding unknown stress-function constants are introduced. By using the principle of minimum complementary energy, these unknown stress-function constants can be expressed in terms of the displacements along element edges. Finally, the complementary energy functional can be rewritten in terms of element nodal displacement vector, and thus, the element stiffness matrix of such hybrid-function element can be obtained. As examples, two (8- and 12-node) quadrilateral plane elements and an arbitrary polygonal crack element are constructed by employing different basic analytical solutions of different stress functions. Numerical results show that, the 8- and 12-node plane models can produce the exact solutions for pure bending and linear bending problems, respectively, even the element shape degenerates into triangle and concave quadrangle; and the crack element can also predict accurate results with very low computational cost in analysis of stress-singularity problems.

  7. Variation in immune function, body condition, and feather corticosterone in nestling Tree Swallows (Tachycineta bicolor) on reclaimed wetlands in the Athabasca oil sands, Alberta, Canada

    International Nuclear Information System (INIS)

    Jane Harms, N.; Fairhurst, Graham D.; Bortolotti, Gary R.; Smits, Judit E.G.

    2010-01-01

    In the Athabasca oil sands region of northern Alberta, mining companies are evaluating reclamation using constructed wetlands for integration of tailings. From May to July 2008, reproductive performance of 40 breeding pairs of tree swallows (Tachycineta bicolor), plus growth and survival of nestlings, was measured on three reclaimed wetlands on two oil sands leases. A subset of nestlings was examined for i) feather corticosterone levels, ii) delayed-type hypersensitivity response, and iii) innate immune function. Nestlings on one of two wetlands created with oil sands process affected material (OSPM) were heavier and had greater wing-lengths, and mounted a stronger delayed-type hypersensitivity response compared those on the reference wetland. Corticosterone was significantly higher in male nestlings on one of two OSPM-containing wetland compared to the reference wetland. Body condition of 12-day-old female nestlings was inversely related to feather corticosterone. Under ideal weather conditions, reclaimed wetlands can support healthy populations of aerially-insectivorous birds. - Under ideal weather conditions, tree swallow nestlings on reclaimed OSPM-affected wetlands are in good body condition and mount strong cell-mediated immune responses.

  8. Retinoic Acid-Related Orphan Receptors (RORs): Regulatory Functions in Immunity, Development, Circadian Rhythm, and Metabolism

    Science.gov (United States)

    Cook, Donald N.; Kang, Hong Soon; Jetten, Anton M.

    2015-01-01

    In this overview, we provide an update on recent progress made in understanding the mechanisms of action, physiological functions, and roles in disease of retinoic acid related orphan receptors (RORs). We are particularly focusing on their roles in the regulation of adaptive and innate immunity, brain function, retinal development, cancer, glucose and lipid metabolism, circadian rhythm, metabolic and inflammatory diseases and neuropsychiatric disorders. We also summarize the current status of ROR agonists and inverse agonists, including their regulation of ROR activity and their therapeutic potential for management of various diseases in which RORs have been implicated. PMID:26878025

  9. Retinoic Acid-Related Orphan Receptors (RORs: Regulatory Functions in Immunity, Development, Circadian Rhythm, and Metabolism

    Directory of Open Access Journals (Sweden)

    Donald N. Cook

    2015-12-01

    Full Text Available In this overview, we provide an update on recent progress made in understanding the mechanisms of action, physiological functions, and roles in disease of retinoic acid related orphan receptors (RORs. We are particularly focusing on their roles in the regulation of adaptive and innate immunity, brain function, retinal development, cancer, glucose and lipid metabolism, circadian rhythm, metabolic and inflammatory diseases and neuropsychiatric disorders. We also summarize the current status of ROR agonists and inverse agonists, including their regulation of ROR activity and their therapeutic potential for management of various diseases in which RORs have been implicated.

  10. Effect of spirulina food supplement on blood morphological parameters, biochemical composition and on the immune function of sportsmen

    Directory of Open Access Journals (Sweden)

    K Milasius

    2009-07-01

    Full Text Available Of highest biological value are natural concentrates of optimally combined substances produced by nature. One of food supplements of this kind is dietary Spirulina produced by the Tianshi firm (China. It is a most rationally balanced food supplement of a high biological value; it satisfies the needs of the whole body, including its immune system. The aim of the current work was to assess the effect of the multicomponent natural food supplement Spirulina on the physical development, blood morphological, biochemical picture and immune function of sportsmen. Materials and Methods: The study cohort comprised 12 high performance sportsmen (age 20-22 years. They were using tablets of Spirulina, a dietary product for 14 days. Physical development was determined with the aid of standard methods. The general blood picture was analyzed with the aid of a Micros-60 hematological analyzer (company ABX DIAGNOSTICS, France. Lymphocytes and their subsets were analysed by flow cytometery (FACSCalibur, Becton Dickinson Immunocytometry Systems (BDIS, USA and the absolute and percentage values were calculated. To evaluate immune function lymphocyte blasttransformation response to mitogens was studied. Results: Investigations carried out on endurance-training sportsmen showed that a 14-d administration of Spirulina exerted a positive effect on blood morphological composition indices and its biochemical changes. The results of our study confirm the positive effect of Spirulina food supplement on the quantitative parameters of immune system. Part of the study cohort after weeks showed a tendency of normalizing CD3 , CD3 CD4 lympocite count: positive changes were still present two weeks following the interruption of Spirulina intake

  11. Consequences of bisphenol a perinatal exposure on immune responses and gut barrier function in mice.

    Science.gov (United States)

    Malaisé, Yann; Ménard, Sandrine; Cartier, Christel; Lencina, Corinne; Sommer, Caroline; Gaultier, Eric; Houdeau, Eric; Guzylack-Piriou, Laurence

    2018-01-01

    The potent immunomodulatory effect of the endocrine disruptor bisphenol A during development and consequences during life span are of increasing concern. Particular interests have been raised from animal studies regarding the risk of developing food intolerance and infection. We aimed to identify immune disorders in mice triggered by perinatal exposure to bisphenol A. Gravid mice were orally exposed to bisphenol (50 μg/kg body weight/day) from day 15 of pregnancy until weaning. Gut barrier function, local and systemic immunity were assessed in adult female offspring. Mice perinatally exposed to bisphenol showed a decrease in ileal lysozyme expression and a fall of fecal antimicrobial activity. In offspring mice exposed to bisphenol, an increase in colonic permeability was observed associated with an increase in interferon-γ level and a drop of colonic IgA + cells and fecal IgA production. Interestingly, altered frequency of innate lymphoid cells type 3 occurred in the small intestine, with an increase in IgG response against commensal bacteria in sera. These effects were related to a defect in dendritic cell maturation in the lamina propria and spleen. Activated and regulatory T cells were decreased in the lamina propria. Furthermore, perinatal exposure to bisphenol promoted a sharp increase in interferon-γ and interleukin-17 production in the intestine and elicited a T helper 17 profile in the spleen. To conclude, perinatal exposure to bisphenol weakens protective and regulatory immune functions in the intestine and at systemic level in adult offspring. The increased susceptibility to inflammatory response is an interesting lead supporting bisphenol-mediated adverse consequences on food reactions and infections.

  12. Supplementation of Merino ewes with vitamin E plus selenium increases α-tocopherol and selenium concentrations in plasma of the lamb but does not improve their immune function.

    Science.gov (United States)

    Sterndale, S; Broomfield, S; Currie, A; Hancock, S; Kearney, G A; Lei, J; Liu, S; Lockwood, A; Scanlan, V; Smith, G; Thompson, A N

    2018-05-01

    Vitamin E and selenium have been reported to improve immune function across a range of species. Ewes lambing on poor-quality dry pasture in autumn in Western Australia are at risk of being deficient in vitamin E and selenium at lambing thus predisposing their lambs to deficiencies and increasing the risk of infection and disease. This study tested the hypotheses that (i) supplementation of autumn-lambing ewes with vitamin E plus selenium in late gestation will increase the concentrations of vitamin E and selenium in plasma in the ewe and lamb and (ii) that the increased concentrations of vitamin E and selenium in plasma in the lambs will improve their innate and adaptive immune responses and thus survival. Pregnant Merino ewes were divided into a control group (n=58) which received no supplementation or a group supplemented with vitamin E plus selenium (n=55). On days 111, 125 and 140 of pregnancy ewes in the vitamin E plus selenium group were given 4 g all-rac-α-tocopherol acetate orally. On day 111 the ewes were also given 60 mg of selenium as barium selenate by subcutaneous injection. The concentrations of α-tocopherol and selenium were measured in ewes and/or lambs from day 111 of pregnancy to 14 weeks of age±10 days (weaning). Immune function of the lamb was assessed by analysing the numbers and phagocytic capacities of monocytes and polymorphonuclear leucocytes and plasma IgG and anti-tetanus toxoid antibody concentrations between birth and 14 weeks of age±10 days. Maternal supplementation with vitamin E plus selenium increased the concentration of α-tocopherol in plasma (1.13 v. 0.67 mg/l; P<0.001) and selenium in whole blood (0.12 v. 0.07 mg/l; P<0.01) of the ewes at lambing compared with controls. Supplementation also increased the concentration of α-tocopherol (0.14 v. 0.08 mg/l; P<0.001) and selenium (0.08 v. 0.05 mg/l; P<0.01) in lambs at birth compared with controls. There was no significant effect of supplementation on immune function or

  13. Signatures of T cells as correlates of immunity to Francisella tularensis.

    Directory of Open Access Journals (Sweden)

    Kjell Eneslätt

    Full Text Available Tularemia or vaccination with the live vaccine strain (LVS of Francisella tularensis confers long-lived cell-mediated immunity. We hypothesized that this immunity depends on polyfunctional memory T cells, i.e., CD4(+ and/or CD8(+ T cells with the capability to simultaneously express several functional markers. Multiparametric flow cytometry, measurement of secreted cytokines, and analysis of lymphocyte proliferation were used to characterize in vitro recall responses of peripheral blood mononuclear cells (PBMC to killed F. tularensis antigens from the LVS or Schu S4 strains. PBMC responses were compared between individuals who had contracted tularemia, had been vaccinated, or had not been exposed to F. tularensis (naïve. Significant differences were detected between either of the immune donor groups and naïve individuals for secreted levels of IL-5, IL-6, IL-10, IL-12, IL-13, IFN-γ, MCP-1, and MIP-1β. Expression of IFN-γ, MIP-1β, and CD107a by CD4(+CD45RO(+ or CD8(+CD45RO(+ T cells correlated to antigen concentrations. In particular, IFN-γ and MIP-1β strongly discriminated between immune and naïve individuals. Only one cytokine, IL-6, discriminated between the two groups of immune individuals. Notably, IL-2- or TNF-α-secretion was low. Our results identify functional signatures of T cells that may serve as correlates of immunity and protection against F. tularensis.

  14. The role of immune system exhaustion on cancer cell escape and anti-tumor immune induction after irradiation.

    Science.gov (United States)

    Mendes, Fernando; Domingues, Cátia; Rodrigues-Santos, Paulo; Abrantes, Ana Margarida; Gonçalves, Ana Cristina; Estrela, Jéssica; Encarnação, João; Pires, Ana Salomé; Laranjo, Mafalda; Alves, Vera; Teixo, Ricardo; Sarmento, Ana Bela; Botelho, Maria Filomena; Rosa, Manuel Santos

    2016-04-01

    Immune surveillance seems to represent an effective tumor suppressor mechanism. However, some cancer cells survive and become variants, being poorly immunogenic and able to enter a steady-state phase. These cells become functionally dormant or remain hidden clinically throughout. Neoplastic cells seem to be able to instruct immune cells to undergo changes promoting malignancy. Radiotherapy may act as a trigger of the immune response. After radiotherapy a sequence of reactions occurs, starting in the damage of oncogenic cells by multiple mechanisms, leading to the immune system positive feedback against the tumor. The link between radiotherapy and the immune system is evident. T cells, macrophages, Natural Killer cells and other immune cells seem to have a key role in controlling the tumor. T cells may be dysfunctional and remain in a state of T cell exhaustion, nonetheless, they often retain a high potential for successful defense against cancer, being able to be mobilized to become highly functional. The lack of clinical trials on a large scale makes data a little robust, in spite of promising information, there are still many variables in the studies relating to radiation and immune system. The clarification of the mechanisms underlying immune response to radiation exposure may contribute to treatment improvement, gain of life quality and span of patients. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Functional analysis of the human cytomegalovirus immune evasion protein, pUS322kDa

    International Nuclear Information System (INIS)

    Zhao Yiqiang; Biegalke, Bonita J.

    2003-01-01

    Human cytomegalovirus (HCMV) is an important opportunistic pathogen that infrequently causes disease in individuals with mature immune systems. The HCMV US3 gene encodes a 22-kDa protein that interferes with immune recognition of virally infected cells. The 22-kDa US3 protein binds to major histocompatibility complex (MHC) class I complexes, retaining them in the endoplasmic reticulum (ER), thereby decreasing the presentation of viral antigen to cytotoxic T cells. Our studies demonstrate that correct folding of the ER lumenal domain of the US3 protein is essential, but insufficient for interactions with MHC class I complexes. We demonstrate a requirement for the transmembrane domain of the 22-kDa US3 protein, confirming the results of others, and also show that the cytosolic carboxyl-terminal tail influences the function of the protein. Anchoring of the ER-lumenal immunoglobulin-like fold of the US3 protein to the membrane of the endoplasmic reticulum is critical for the binding and retention of MHC class I complexes

  16. NKT cell self-reactivity: evolutionary master key of immune homeostasis?

    Science.gov (United States)

    Issazadeh-Navikas, Shohreh

    2012-04-01

    Complex immune responses have evolved to protect multicellular organisms against the invasion of pathogens. This has exerted strong developmental pressure for specialized functions that can also limit damage to self-tissue. Two arms of immunity, the innate and adaptive immune systems, have evolved for quick, non-specific immune responses to pathogens and more efficient, long-lasting ones upon specific recognition of recurrent pathogens. Specialized cells have arisen as the sentinels of these functions, including macrophages, natural killer (NK), and T and B-lymphocytes. Interestingly, a population of immune cells that can exert both of these complex functions, NKT cells, not only share common functions but also exhibit shared cell surface markers of cells of both arms of the immune system. These features, in combination with sophisticated maintenance of immune homeostasis, will be discussed. The recent finding of self-peptide reactivity of NKT cells in the context of CD1d, with capacity to regulate multiple autoimmune and inflammatory conditions, motivates the current proposal that self-reactive NKT cells might be the ancestral link between present NK and T cells. Their parallel selection through evolution by higher vertebrates could be related to their central function as master regulators of immune homeostasis that in part is shared with regulatory T cells. Hypothetical views on how self-reactive NKT cells secure such a central role will also be proposed.

  17. Guidance on the scientific requirements for health claims related to gut and immune function

    DEFF Research Database (Denmark)

    Tetens, Inge

    2011-01-01

    The European Food Safety Authority (EFSA) asked the Panel on Dietetic Products Nutrition and Allergies (NDA) to draft guidance on scientific requirements for health claims related to gut and immune function. This guidance has been drawn from scientific opinions of the NDA Panel on such health......, was subjected to public consultation (28 September 2010 to 22 October 2010), and was also discussed at a technical meeting with experts in the field on 2 December 2010 in Amsterdam....

  18. Immune response in the lungs following oral immunization with bacterial lysates of respiratory pathogens.

    OpenAIRE

    Ruedl, C; Frühwirth, M; Wick, G; Wolf, H

    1994-01-01

    We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The...

  19. Epithelial Cell Inflammasomes in Intestinal Immunity and Inflammation

    Directory of Open Access Journals (Sweden)

    Andrea C. Lei-Leston

    2017-09-01

    Full Text Available Pattern recognition receptors (PRR, such as NOD-like receptors (NLRs, sense conserved microbial signatures, and host danger signals leading to the coordination of appropriate immune responses. Upon activation, a subset of NLR initiate the assembly of a multimeric protein complex known as the inflammasome, which processes pro-inflammatory cytokines and mediates a specialized form of cell death known as pyroptosis. The identification of inflammasome-associated genes as inflammatory bowel disease susceptibility genes implicates a role for the inflammasome in intestinal inflammation. Despite the fact that the functional importance of inflammasomes within immune cells has been well established, the contribution of inflammasome expression in non-hematopoietic cells remains comparatively understudied. Given that intestinal epithelial cells (IEC act as a barrier between the host and the intestinal microbiota, inflammasome expression by these cells is likely important for intestinal immune homeostasis. Accumulating evidence suggests that the inflammasome plays a key role in shaping epithelial responses at the host–lumen interface with many inflammasome components highly expressed by IEC. Recent studies have exposed functional roles of IEC inflammasomes in mucosal immune defense, inflammation, and tumorigenesis. In this review, we present the main features of the predominant inflammasomes and their effector mechanisms contributing to intestinal homeostasis and inflammation. We also discuss existing controversies in the field and open questions related to their implications in disease. A comprehensive understanding of the molecular basis of intestinal inflammasome signaling could hold therapeutic potential for clinical translation.

  20. The adaptor molecule RIAM integrates signaling events critical for integrin-mediated control of immune function and cancer progression.

    Science.gov (United States)

    Patsoukis, Nikolaos; Bardhan, Kankana; Weaver, Jessica D; Sari, Duygu; Torres-Gomez, Alvaro; Li, Lequn; Strauss, Laura; Lafuente, Esther M; Boussiotis, Vassiliki A

    2017-08-22

    Lymphocyte activation requires adhesion to antigen-presenting cells. This is a critical event linking innate and adaptive immunity. Lymphocyte adhesion is accomplished through LFA-1, which must be activated by a process referred to as inside-out integrin signaling. Among the few signaling molecules that have been implicated in inside-out integrin activation in hematopoietic cells are the small guanosine triphosphatase (GTPase) Rap1 and its downstream effector Rap1-interacting molecule (RIAM), a multidomain protein that defined the Mig10-RIAM-lamellipodin (MRL) class of adaptor molecules. Through its various domains, RIAM is a critical node of signal integration for activation of T cells, recruits monomeric and polymerized actin to drive actin remodeling and cytoskeletal reorganization, and promotes inside-out integrin signaling in T cells. As a regulator of inside-out integrin activation, RIAM affects multiple functions of innate and adaptive immunity. The effects of RIAM on cytoskeletal reorganization and integrin activation have implications in cell migration and trafficking of cancer cells. We provide an overview of the structure and interactions of RIAM, and we discuss the implications of RIAM functions in innate and adaptive immunity and cancer. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  1. Effects of preoperative and postoperative enteral nutrition on postoperative nutritional status and immune function of gastric cancer patients.

    Science.gov (United States)

    Ding, Dayong; Feng, Ye; Song, Bin; Gao, Shuohui; Zhao, Jisheng

    2015-03-01

    Effects of preoperative one week enteral nutrition (EN) support on the postoperative nutritional status, immune function and inflammatory response of gastric cancer patients were investigated. 106 cases of gastric cancer patients were randomly divided into preoperative one week EN group (trial group) and early postoperative EN group (control group), which were continuously treated with EN support until the postoperative 9th day according to different treatment protocols. All the patients were checked for their body weight, skinfold thickness, upper arm circumference, white blood cell count (WBC), albumin (ALB), prealbumin (PA), C-reactive protein (CRP), humoral immunity (IgA, IgG), T cell subsets (CD4, CD8 and CD4/CD8), interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), etc. on the preoperative and the postoperative 1st and 10th day, respectively. PA and IgG levels of the experimental group were higher than those of the control group on the postoperative 10th day, whereas IL-6 level of the experimental group was lower than that of the control group. EN support for preoperative gastric cancer patients will improve the postoperative nutritional status and immune function, alleviate inflammatory response, and facilitate the recovery of patients.

  2. Universal immunity to influenza must outwit immune evasion

    Directory of Open Access Journals (Sweden)

    Sergio Manuel Quinones-Parra

    2014-06-01

    Full Text Available Although an influenza vaccine has been available for 70 years, influenza virus still causes seasonal epidemics and worldwide pandemics. Currently available vaccines elicit strain-specific antibody responses to the surface haemagglutinin (HA and neuraminidase (NA proteins, but these can be ineffective against serologically-distinct viral variants and novel subtypes. Thus, there is a need for cross-protective or universal influenza vaccines to overcome the necessity for annual immunisation against seasonal influenza and to provide immunity to reduce the severity of infection with pandemic or outbreak viruses. It is well established that natural influenza infection can provide cross-reactive immunity that can reduce the impact of infection with distinct influenza type A strains and subtypes, including H1N1, H3N2, H2N2, H5N1 and H7N9. The key to generating universal influenza immunity via vaccination is to target functionally-conserved regions of the virus, which include epitopes on the internal proteins for cross-reactive T cell immunity or on the HA stem for broadly reactive antibody responses. In the wake of the 2009 H1N1 pandemic, broadly neutralizing antibodies have been characterized and isolated from convalescent and vaccinated individuals, inspiring development of new vaccination techniques to elicit such responses. Induction of influenza-specific T cell responses through vaccination has also been examined in clinical trials. Strong evidence is available from human and animal models of influenza to show that established influenza-specific T cell memory can reduce viral shedding and symptom severity. However, the published evidence also shows that CD8+ T cells can efficiently select immune escape mutants early after influenza virus infection. Here, we discuss universal immunity to influenza viruses mediated by both cross-reactive T cells and antibodies, the mechanisms of immune evasion in influenza, and how to counteract commonly occurring

  3. Chronic social stress induces peripheral and central immune activation, blunted mesolimbic dopamine function, and reduced reward-directed behaviour in mice

    Directory of Open Access Journals (Sweden)

    Giorgio Bergamini

    2018-02-01

    Full Text Available Psychosocial stress is a major risk factor for depression, stress leads to peripheral and central immune activation, immune activation is associated with blunted dopamine (DA neural function, DA function underlies reward interest, and reduced reward interest is a core symptom of depression. These states might be inter-independent in a complex causal pathway. Whilst animal-model evidence exists for some specific steps in the pathway, there is currently no animal model in which it has been demonstrated that social stress leads to each of these immune, neural and behavioural states. Such a model would provide important existential evidence for the complex pathway and would enable the study of causality and mediating mechanisms at specific steps in the pathway. Therefore, in the present mouse study we investigated for effects of 15-day resident-intruder chronic social stress (CSS on each of these states. Relative to controls, CSS mice exhibited higher spleen levels of granulocytes, inflammatory monocytes and T helper 17 cells; plasma levels of inducible nitric oxide synthase; and liver expression of genes encoding kynurenine pathway enzymes. CSS led in the ventral tegmental area to higher levels of kynurenine and the microglia markers Iba1 and Cd11b and higher binding activity of DA D1 receptor; and in the nucleus accumbens (NAcc to higher kynurenine, lower DA turnover and lower c-fos expression. Pharmacological challenge with DA reuptake inhibitor identified attenuation of DA stimulatory effects on locomotor activity and NAcc c-fos expression in CSS mice. In behavioural tests of operant responding for sucrose reward validated as sensitive assays for NAcc DA function, CSS mice exhibited less reward-directed behaviour. Therefore, this mouse study demonstrates that a chronic social stressor leads to changes in each of the immune, neural and behavioural states proposed to mediate between stress and disruption of DA-dependent reward processing. The

  4. Investigation of Immune Function in Naval Marine Mammals

    National Research Council Canada - National Science Library

    Romano, Tracy

    2000-01-01

    ... (dolphins, whales, and porpoises). This is due in part to obtaining access to animals and tissue samples as well as the lack of cetacean-specific reagents to carry out investigations of the immune system...

  5. [EFFECT OF 4-METHYLPYRAZOLE ON IMMUNE RESPONSE, FUNCTION OF Th1 AND Th2 LYMPHOCYTES, AND CYTOKINE CONCENTRATION IN RAT BLOOD AFTER ACUTE METHANOL POISONING].

    Science.gov (United States)

    Zabrodskii, P F; Maslyakov, V V; Gromov, M S

    2016-01-01

    It was established in experiments on noninbred albino rats that the acute intoxication with methanol (1.0 LD50) decreased cellular and humoral immune responses, Th2-lymphocyte activity (to a greater extent as compared to the function of Th1 cells), reduced the blood concentration of immunoregulatory (IFN-g, IL-2, IL-4) and proinflammatory (TNF, IL-1b, IL-6) cytokines on the average by 36.5% (p Methanol antidote 4-methylpyrazole (non-competitive inhibitor of alcohol dehydrogenase) administered upon acute intoxication with methanol at a dose of 1.0 DL50 partially reduces the intoxication-induced suppression of humoral and cellular immune response, activity of T-helper cells, and production of IL-4 and restores blood levels of TNF, IL-1b, IFN-γ, IL-4, IL-2, IL-6 to the control values.

  6. Some biochemical studies on thyroid immunity

    International Nuclear Information System (INIS)

    Shoush, M.A.M.

    1980-01-01

    The present study was carried out to investigate the effect of induced immunological environment on: a - Carbohydrate metabolism as reflected by immunoreactive insulin and blood sugar levels. b - Biochemical parameters, namely total protein, albumin, globulin, alkaline phosphatase and transaminases, reflecting liver function. c - Radioimmunological tests reflecting thyroid function. The study comprised 36 male rabbits, boscate strain of six months age assigned randomly to : control, albumin immunized and thyroglobulin immunized groups

  7. Regulation of dietary glutamine on the growth, intestinal function, immunity and antioxidant capacity of sea cucumber Apostichopus japonicus (Selenka).

    Science.gov (United States)

    Yu, Haibo; Gao, Qinfeng; Dong, Shuanglin; Lan, Ying; Ye, Zhi; Wen, Bin

    2016-03-01

    The present study examined the effects of dietary glutamine (Gln) on the growth, intestinal function, immunity and antioxidant capacity of sea cucumber Apostichopus japonicus (Selenka). The specific growth rate, intestinal morphology, activity of digestive enzymes, activity and gene expression of lysozyme and antioxidative enzymes of the sea cucumbers were determined after feeding 5 experimental diets with additions of increasing levels of Gln (at 0%, 0.4%, 0.8%,1.2% and 1.6%, respectively) for 60 days. We discovered that the specific growth rate of the sea cucumbers in 0.4%, 0.8% and 1.2% groups increased 35.3%, 27.3% and 24.1%, respectively, compared to the control (0%) group with significant differences. Dietary Gln can improve the intestinal function of the sea cucumbers by increasing the activities of trypsin and lipase in the intestine and the villus height and villus density of the intestine, eventhough significant differences were not observed in some groups. 0.4%-0.8% of dietary Gln can significantly increase the activity of lysozyme (LSZ) in the coelomic fluid of the sea cucumbers. Significant improvements were observed on the SOD activity in coelomic fluid of the sea cucumbers fed diets supplemented with 0.4%-1.6% of Gln compared to the control group. Similarly, the CAT activity in coelomic fluid of the sea cucumbers significantly increased in 0.8%, 1.2% and 1.6% groups compared to the control and 0.4% groups. Change pattern of the activity of CAT was consistent with the change pattern of the expression of CAT gene, indicating the dietary Gln can up-regulate the expression of CAT gene and consequently promote the secretion of CAT. However, the down-regulation of the expression of SOD gene by dietary Gln were observed in almost all of the treatment groups, which is in contrast with the change pattern of the activity of SOD, indicating the negative feedback regulation of the secretion of SOD on the expression of SOD gene. In summary, the suitable

  8. The role of juvenile hormone in immune function and pheromone production trade-offs: a test of the immunocompetence handicap principle.

    Science.gov (United States)

    Rantala, Markus J; Vainikka, Anssi; Kortet, Raine

    2003-01-01

    The immunocompetence handicap hypothesis postulates that secondary sexual traits are honest signals of mate quality because the hormones (e.g. testosterone) needed to develop secondary sexual traits have immunosuppressive effects. The best support for predictions arising from the immunocompetence handicap hypothesis so far comes from studies of insects, although they lack male-specific hormones such as testosterone. In our previous studies, we found that female mealworm beetles prefer pheromones of immunocompetent males. Here, we tested how juvenile hormone (JH) affects male investment in secondary sexual characteristics and immune functions in the mealworm beetle, Tenebrio molitor. We injected male mealworm beetles with JH (type III) and found that injection increased the attractiveness of male pheromones but simultaneously suppressed immune functions (phenoloxidase activity and encapsulation). Our results suggest that JH, which is involved in the control of reproduction and morphogenesis, also plays a central role in the regulation of a trade-off between the immune system and sexual advertisement in insects. Thus, the results reflect a general mechanism by which the immunocompetence handicap hypothesis may work in insects. PMID:14613612

  9. Immuno-regulatory function of indoleamine 2,3 dioxygenase through modulation of innate immune responses.

    Directory of Open Access Journals (Sweden)

    Malihe-Sadat Poormasjedi-Meibod

    Full Text Available Successful long-term treatment of type-1 diabetes mainly relies on replacement of β-cells via islet transplantation. Donor shortage is one of the main obstacles preventing transplantation from becoming the treatment of choice. Although animal organs could be an alternative source for transplantation, common immunosuppressive treatments demonstrate low efficacy in preventing xenorejection. Immunoprotective effects of indoleamine 2,3-dioxygenase (IDO on T-cell mediated allorejection has been extensively studied. Our studies revealed that IDO expression by fibroblasts, induced apoptosis in T-cells while not affecting non-immune cell survival/function. Since macrophages play a pivotal role in xenograft rejection, herein we investigated the effect of IDO-induced tryptophan deficiency/kynurenine accumulation on macrophage function/survival. Moreover, we evaluated the local immunosuppressive effect of IDO on islet-xenograft protection. Our results indicated that IDO expression by bystander fibroblasts significantly reduced the viability of primary macrophages via apoptosis induction. Treatment of peritoneal macrophages by IDO-expressing fibroblast conditioned medium significantly reduced their proinflammatory activity through inhibition of iNOS expression. To determine whether IDO-induced tryptophan starvation or kynurenine accumulation is responsible for macrophage apoptosis and inhibition of their proinflammatory activity, Raw264.7 cell viability and proinflammatory responses were evaluated in tryptophan deficient medium or in the presence of kynurenine. Tryptophan deficiency, but not kynurenine accumulation, reduced Raw264.7 cell viability and suppressed their proinflammatory activity. Next a three-dimensional islet-xenograft was engineered by embedding rat islets within either control or IDO-expressing fibroblast-populated collagen matrix. Islets morphology and immune cell infiltration were then studied in the xenografts transplanted into the C57

  10. Roles of Zinc Signaling in the Immune System.

    Science.gov (United States)

    Hojyo, Shintaro; Fukada, Toshiyuki

    2016-01-01

    Zinc (Zn) is an essential micronutrient for basic cell activities such as cell growth, differentiation, and survival. Zn deficiency depresses both innate and adaptive immune responses. However, the precise physiological mechanisms of the Zn-mediated regulation of the immune system have been largely unclear. Zn homeostasis is tightly controlled by the coordinated activity of Zn transporters and metallothioneins, which regulate the transport, distribution, and storage of Zn. There is growing evidence that Zn behaves like a signaling molecule, facilitating the transduction of a variety of signaling cascades in response to extracellular stimuli. In this review, we highlight the emerging functional roles of Zn and Zn transporters in immunity, focusing on how crosstalk between Zn and immune-related signaling guides the normal development and function of immune cells.

  11. A Comparative Study of Peripheral Immune Responses to Taenia solium in Individuals with Parenchymal and Subarachnoid Neurocysticercosis.

    Directory of Open Access Journals (Sweden)

    Iskra Tuero

    2015-10-01

    Full Text Available The ability of Taenia solium to modulate the immune system likely contributes to their longevity in the human host. We tested the hypothesis that the nature of the immune response is related to the location of parasite and clinical manifestations of infection.Peripheral blood mononuclear cells (PBMC were obtained from untreated patients with neurocysticercosis (NCC, categorized as having parenchymal or subarachnoid infection by the presence of cysts exclusively within the parenchyma or in subarachnoid spaces of the brain, and from uninfected (control individuals matched by age and gender to each patient. Using multiplex detection technology, sera from NCC patients and controls and cytokine production by PBMC after T. solium antigen (TsAg stimulation were assayed for levels of inflammatory and regulatory cytokines. PBMC were phenotyped by flow cytometry ex vivo and following in vitro stimulation with TsAg.Sera from patients with parenchymal NCC demonstrated significantly higher Th1 (IFN-γ/IL-12 and Th2 (IL-4/IL-13 cytokine responses and trends towards higher levels of IL-1β/IL-8/IL-5 than those obtained from patients with subarachnoid NCC. Also higher in vitro antigen-driven TNF-β secretion was detected in PBMC supernatants from parenchymal than in subarachnoid NCC. In contrast, there was a significantly higher IL-10 response to TsAg stimulation in patients with subarachnoid NCC compared to parenchymal NCC. Although no differences in regulatory T cells (Tregs frequencies were found ex vivo, there was a trend towards greater expansion of Tregs upon TsAg stimulation in subarachnoid than in parenchymal NCC when data were normalized for the corresponding controls.T. solium infection of the subarachnoid space is associated with an enhanced regulatory immune response compared to infection in the parenchyma. The resulting anti-inflammatory milieu may represent a parasite strategy to maintain a permissive environment in the host or diminish

  12. Immune regulation by pericytes: modulating innate and adaptive immunity

    DEFF Research Database (Denmark)

    Navarro, Rocio; Compte, Marta; Álvarez-Vallina, Luis

    2016-01-01

    Pericytes (PC) are mural cells that surround endothelial cells (EC) in small blood vessels. PC have traditionally been endowed with structural functions, being essential for vessel maturation and stabilization. However, accumulating evidence suggest that PC also display immune properties. They ca...

  13. Perceived Immune Status and Sleep: A Survey among Dutch Students

    Directory of Open Access Journals (Sweden)

    Anouk A. M. T. Donners

    2015-01-01

    Full Text Available Reduced immune functioning may have a negative impact on sleep and health, and vice versa. A survey among Dutch young adults (18–35 years old was administered to collect information on perception of reduced immunity and its relationship to sleep disorders, sleep duration, and quality. Sleep disorders were assessed with the SLEEP-50 questionnaire subscales of sleep apnea, insomnia, circadian rhythm disorder, and daily functioning. Dutch young adults (N = 574 completed the survey. Among them, subjects (N = 209; 36.4% reported perceived reduced immunity. Relative to those with a normal immune status, subjects reporting reduced immunity had significantly higher scores (p=0.0001 on sleep apnea (2.6 versus 3.6, insomnia (5.1 versus 6.8, and circadian rhythm disorder (2.1 versus 2.7. Subjects reporting reduced immunity also had significantly poorer daily functioning scores (5.4 versus 7.6, p=0.0001. No differences were observed in total sleep time, but those reporting reduced immunity had significantly poorer ratings of sleep quality (6.8 versus 7.2, p=0.0001. Our findings suggest that perceived reduced immunity is associated with sleep disturbances, impaired daily functioning, and a poorer sleep quality. Experimental studies including the assessment of immune biomarkers and objective measures of sleep (polysomnography should confirm the current observations.

  14. Respiratory and Metabolic Impacts of Crustacean Immunity: Are there Implications for the Insects?

    Science.gov (United States)

    Burnett, Karen G; Burnett, Louis E

    2015-11-01

    developed a separate tracheal system for the delivery of oxygen to tissues, so this particular tradeoff between oxygen transport and immune function is avoided. Few studies in crustaceans or insects have tested whether mounting an immune response might impact other functions of the cardiovascular system or alter integrity of the gut, respiratory, and reproductive epithelia where processes of the attack on pathogens, defense by the host, and physiological functions play out. Such tradeoffs might be fruitfully addressed by capitalizing on the ease of molecular and genetic manipulation in insects. Given the extensive similarities between the insect and the crustacean immune systems, such models of epithelial infection could benefit our understanding of the physiological consequences of immune defense in all of the Pancrustacea. © The Author 2015. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.

  15. Wallerian degeneration: the innate-immune response to traumatic nerve injury

    Directory of Open Access Journals (Sweden)

    Rotshenker Shlomo

    2011-08-01

    Full Text Available Abstract Traumatic injury to peripheral nerves results in the loss of neural functions. Recovery by regeneration depends on the cellular and molecular events of Wallerian degeneration that injury induces distal to the lesion site, the domain through which severed axons regenerate back to their target tissues. Innate-immunity is central to Wallerian degeneration since innate-immune cells, functions and molecules that are produced by immune and non-immune cells are involved. The innate-immune response helps to turn the peripheral nerve tissue into an environment that supports regeneration by removing inhibitory myelin and by upregulating neurotrophic properties. The characteristics of an efficient innate-immune response are rapid onset and conclusion, and the orchestrated interplay between Schwann cells, fibroblasts, macrophages, endothelial cells, and molecules they produce. Wallerian degeneration serves as a prelude for successful repair when these requirements are met. In contrast, functional recovery is poor when injury fails to produce the efficient innate-immune response of Wallerian degeneration.

  16. Effects of inhaled insoluble 239PuO2 on immune responses following lung immunization

    International Nuclear Information System (INIS)

    Bice, D.E.; Harris, D.L.; Brooks, A.L.; Mewhinney, J.A.

    1978-01-01

    To determine if inhaled 239 PuO 2 suppresses immunity in lung-associated lymph nodes, Chinese hamsters were exposed to a polydisperse aerosol of 239 PuO 2 produced at 1150 0 C. The mean lung burden of these animals was estimated to be 10 nCi at 8 days after exposure. At 128, 256 and 400 days after exposure, sham exposed controls and experimental animals were immunized by intratracheal instillation of 1 x 10 8 sheep red blood cells (SRBC). Six days later, they were sacrificed and the number of antibody forming cells (AFC) in lung-associated lymph nodes, spleen and cervical lymph nodes was evaluated. Results of these studies indicated that the number of AFC in lung-associated lymph modes was significantly lower in animals exposed to 239 PuO 2 . Only a few AFC were found in spleen and cervical lymph nodes after intratracheal immunization and the number in exposed animals was not significantly different than in the controls. These data indicate that even though the 239 PuO 2 exposure had suppressed immune responses in lung-associated lymph nodes, their filtering capacity was unaffected and antigen did not translocate to the spleen. We conclude that, at the sacrifice intervals evaluated, the immune function of lung-associated lymph nodes was suppressed and that distant lymphoid tissue (e.g., spleen and cervical lymph nodes) did not replace the immune function of the lung-associated lymph nodes

  17. The commensal microbiota drives immune homeostasis

    Directory of Open Access Journals (Sweden)

    Marie-Claire eArrieta

    2012-03-01

    Full Text Available For millions of years, microbes have coexisted with eukaryotic cells at the mucosal surfaces of vertebrates in a complex, yet usually harmonious symbiosis. An ever-expanding number of reports describe how eliminating or shifting the intestinal microbiota has profound effects on the development and functionality of the mucosal and systemic immune systems. Here, we examine some of the mechanisms by which bacterial signals affect immune homeostasis. Focusing on the strategies that microbes use to keep our immune system healthy, as opposed to trying to correct the immune imbalances caused by dysbiosis, may prove to be a more astute and efficient way of treating immune-mediated disease.

  18. Conceptual Spaces of the Immune System.

    Science.gov (United States)

    Fierz, Walter

    2016-01-01

    The immune system can be looked at as a cognitive system. This is often done in analogy to the neuro-psychological system. Here, it is demonstrated that the cognitive functions of the immune system can be properly described within a new theory of cognitive science. Gärdenfors' geometrical framework of conceptual spaces is applied to immune cognition. Basic notions, like quality dimensions, natural properties and concepts, similarities, prototypes, saliences, etc., are related to cognitive phenomena of the immune system. Constraints derived from treating the immune system within a cognitive theory, like Gärdenfors' conceptual spaces, might well prove to be instrumental for the design of vaccines, immunological diagnostic tests, and immunotherapy.

  19. Qualitative analysis of a stochastic epidemic model with specific functional response and temporary immunity

    Science.gov (United States)

    Hattaf, Khalid; Mahrouf, Marouane; Adnani, Jihad; Yousfi, Noura

    2018-01-01

    In this paper, we propose a stochastic delayed epidemic model with specific functional response. The time delay represents temporary immunity period, i.e., time from recovery to becoming susceptible again. We first show that the proposed model is mathematically and biologically well-posed. Moreover, the extinction of the disease and the persistence in the mean are established in the terms of a threshold value R0S which is smaller than the basic reproduction number R0 of the corresponding deterministic system.

  20. Immunization of Epidemics in Multiplex Networks

    Science.gov (United States)

    Zhao, Dawei; Wang, Lianhai; Li, Shudong; Wang, Zhen; Wang, Lin; Gao, Bo

    2014-01-01

    Up to now, immunization of disease propagation has attracted great attention in both theoretical and experimental researches. However, vast majority of existing achievements are limited to the simple assumption of single layer networked population, which seems obviously inconsistent with recent development of complex network theory: each node could possess multiple roles in different topology connections. Inspired by this fact, we here propose the immunization strategies on multiplex networks, including multiplex node-based random (targeted) immunization and layer node-based random (targeted) immunization. With the theory of generating function, theoretical analysis is developed to calculate the immunization threshold, which is regarded as the most critical index for the effectiveness of addressed immunization strategies. Interestingly, both types of random immunization strategies show more efficiency in controlling disease spreading on multiplex Erdös-Rényi (ER) random networks; while targeted immunization strategies provide better protection on multiplex scale-free (SF) networks. PMID:25401755

  1. Immunization of epidemics in multiplex networks.

    Science.gov (United States)

    Zhao, Dawei; Wang, Lianhai; Li, Shudong; Wang, Zhen; Wang, Lin; Gao, Bo

    2014-01-01

    Up to now, immunization of disease propagation has attracted great attention in both theoretical and experimental researches. However, vast majority of existing achievements are limited to the simple assumption of single layer networked population, which seems obviously inconsistent with recent development of complex network theory: each node could possess multiple roles in different topology connections. Inspired by this fact, we here propose the immunization strategies on multiplex networks, including multiplex node-based random (targeted) immunization and layer node-based random (targeted) immunization. With the theory of generating function, theoretical analysis is developed to calculate the immunization threshold, which is regarded as the most critical index for the effectiveness of addressed immunization strategies. Interestingly, both types of random immunization strategies show more efficiency in controlling disease spreading on multiplex Erdös-Rényi (ER) random networks; while targeted immunization strategies provide better protection on multiplex scale-free (SF) networks.

  2. Artificial Immune Networks: Models and Applications

    Directory of Open Access Journals (Sweden)

    Xian Shen

    2008-06-01

    Full Text Available Artificial Immune Systems (AIS, which is inspired by the nature immune system, has been applied for solving complex computational problems in classification, pattern rec- ognition, and optimization. In this paper, the theory of the natural immune system is first briefly introduced. Next, we compare some well-known AIS and their applications. Several representative artificial immune networks models are also dis- cussed. Moreover, we demonstrate the applications of artificial immune networks in various engineering fields.

  3. Aged Garlic Extract Modifies Human Immunity.

    Science.gov (United States)

    Percival, Susan S

    2016-02-01

    Garlic contains numerous compounds that have the potential to influence immunity. Immune cells, especially innate immune cells, are responsible for the inflammation necessary to kill pathogens. Two innate lymphocytes, γδ-T and natural killer (NK) cells, appear to be susceptible to diet modification. The purpose of this review was to summarize the influence of aged garlic extract (AGE) on the immune system. The author's laboratory is interested in AGE's effects on cell proliferation and activation and inflammation and to learn whether those changes might affect the occurrence and severity of colds and flu. Healthy human participants (n = 120), between 21 and 50 y of age, were recruited for a randomized, double-blind, placebo-controlled parallel-intervention study to consume 2.56 g AGE/d or placebo supplements for 90 d during the cold and flu season. Peripheral blood mononuclear cells were isolated before and after consumption, and γδ-T and NK cell function was assessed by flow cytometry. The effect on cold and flu symptoms was determined by using daily diary records of self-reported illnesses. After 45 d of AGE consumption, γδ-T and NK cells proliferated better and were more activated than cells from the placebo group. After 90 d, although the number of illnesses was not significantly different, the AGE group showed reduced cold and flu severity, with a reduction in the number of symptoms, the number of days participants functioned suboptimally, and the number of work/school days missed. These results suggest that AGE supplementation may enhance immune cell function and may be partly responsible for the reduced severity of colds and flu reported. The results also suggest that the immune system functions well with AGE supplementation, perhaps with less accompanying inflammation. This trial was registered at clinicaltrials.gov as NCT01390116. © 2016 American Society for Nutrition.

  4. Comparing the immune response to a novel intranasal nanoparticle PLGA vaccine and a commercial BPI3V vaccine in dairy calves.

    Science.gov (United States)

    Mansoor, Fawad; Earley, Bernadette; Cassidy, Joseph P; Markey, Bryan; Doherty, Simon; Welsh, Michael D

    2015-08-21

    There is a need to improve vaccination against respiratory pathogens in calves by stimulation of local immunity at the site of pathogen entry at an early stage in life. Ideally such a vaccine preparation would not be inhibited by the maternally derived antibodies. Additionally, localized immune response at the site of infection is also crucial to control infection at the site of entry of virus. The present study investigated the response to an intranasal bovine parainfluenza 3 virus (BPI3V) antigen preparation encapsulated in PLGA (poly dl-lactic-co-glycolide) nanoparticles in the presence of pre-existing anti-BPI3V antibodies in young calves and comparing it to a commercially available BPI3V respiratory vaccine. There was a significant (P administration of the nanoparticle vaccine an early immune response was induced that continued to grow until the end of study and was not observed in the other treatment groups. Virus specific serum IgG response to both the nanoparticle vaccine and commercial live attenuated vaccine showed a significant (P local mucosal immunity induced by nanoparticle vaccine has obvious potential if it translates into enhanced protective immunity in the face of virus outbreak.

  5. Ovine model for studying pulmonary immune responses

    International Nuclear Information System (INIS)

    Joel, D.D.; Chanana, A.D.

    1984-01-01

    Anatomical features of the sheep lung make it an excellent model for studying pulmonary immunity. Four specific lung segments were identified which drain exclusively to three separate lymph nodes. One of these segments, the dorsal basal segment of the right lung, is drained by the caudal mediastinal lymph node (CMLN). Cannulation of the efferent lymph duct of the CMLN along with highly localized intrabronchial instillation of antigen provides a functional unit with which to study factors involved in development of pulmonary immune responses. Following intrabronchial immunization there was an increased output of lymphoblasts and specific antibody-forming cells in efferent CMLN lymph. Continuous divergence of efferent lymph eliminated the serum antibody response but did not totally eliminate the appearance of specific antibody in fluid obtained by bronchoalveolar lavage. In these studies localized immunization of the right cranial lobe served as a control. Efferent lymphoblasts produced in response to intrabronchial antigen were labeled with 125 I-iododeoxyuridine and their migrational patterns and tissue distribution compared to lymphoblasts obtained from the thoracic duct. The results indicated that pulmonary immunoblasts tend to relocate in lung tissue and reappear with a higher specific activity in pulmonary lymph than in thoracic duct lymph. The reverse was observed with labeled intestinal lymphoblasts. 35 references, 2 figures, 3 tables

  6. Ovine model for studying pulmonary immune responses

    Energy Technology Data Exchange (ETDEWEB)

    Joel, D.D.; Chanana, A.D.

    1984-11-25

    Anatomical features of the sheep lung make it an excellent model for studying pulmonary immunity. Four specific lung segments were identified which drain exclusively to three separate lymph nodes. One of these segments, the dorsal basal segment of the right lung, is drained by the caudal mediastinal lymph node (CMLN). Cannulation of the efferent lymph duct of the CMLN along with highly localized intrabronchial instillation of antigen provides a functional unit with which to study factors involved in development of pulmonary immune responses. Following intrabronchial immunization there was an increased output of lymphoblasts and specific antibody-forming cells in efferent CMLN lymph. Continuous divergence of efferent lymph eliminated the serum antibody response but did not totally eliminate the appearance of specific antibody in fluid obtained by bronchoalveolar lavage. In these studies localized immunization of the right cranial lobe served as a control. Efferent lymphoblasts produced in response to intrabronchial antigen were labeled with /sup 125/I-iododeoxyuridine and their migrational patterns and tissue distribution compared to lymphoblasts obtained from the thoracic duct. The results indicated that pulmonary immunoblasts tend to relocate in lung tissue and reappear with a higher specific activity in pulmonary lymph than in thoracic duct lymph. The reverse was observed with labeled intestinal lymphoblasts. 35 references, 2 figures, 3 tables.

  7. Transient receptor potential vanilloid 1 expression and function in splenic dendritic cells: a potential role in immune homeostasis.

    Science.gov (United States)

    Assas, Bakri M; Wakid, Majed H; Zakai, Haytham A; Miyan, Jaleel A; Pennock, Joanne L

    2016-03-01

    Neuro-immune interactions, particularly those driven by neuropeptides, are increasingly implicated in immune responses. For instance, triggering calcium-channel transient receptor potential vanilloid 1 (TRPV1) on sensory nerves induces the release of calcitonin-gene-related peptide (CGRP), a neuropeptide known to moderate dendritic cell activation and T helper cell type 1 polarization. Despite observations that CGRP is not confined to the nervous system, few studies have addressed the possibility that immune cells can respond to well-documented 'neural' ligands independently of peripheral nerves. Here we have identified functionally relevant TRPV1 on primary antigen-presenting cells of the spleen and have demonstrated both calcium influx and CGRP release in three separate strains of mice using natural agonists. Furthermore, we have shown down-regulation of activation markers CD80/86 on dendritic cells, and up-regulation of interleukin-6 and interleukin-10 in response to CGRP treatment. We suggest that dendritic cell responses to neural ligands can amplify neuropeptide release, but more importantly that variability in CGRP release across individuals may have important implications for immune cell homeostasis. © 2015 John Wiley & Sons Ltd.

  8. Brain immune cell composition and functional outcome after cerebral ischemia: Comparison of two mouse strains

    Directory of Open Access Journals (Sweden)

    Hyun Ah eKim

    2014-11-01

    Full Text Available Inflammatory cells may contribute to secondary brain injury following cerebral ischemia. The C57Bl/6 mouse strain is known to exhibit a T helper 1-prone, pro-inflammatory type response to injury, whereas the FVB strain is relatively T helper 2-prone, or anti-inflammatory, in its immune response. We tested whether stroke outcome is more severe in C57Bl/6 than FVB mice. Male mice of each strain underwent sham surgery or 1 h occlusion of the middle cerebral artery followed by 23 h of reperfusion. Despite no difference in infarct size, C57Bl/6 mice displayed markedly greater functional deficits than FVB mice after stroke, as assessed by neurological scoring and hanging wire test. Total numbers of CD45+ leukocytes tended to be larger in the brains of C57Bl/6 than FVB mice after stroke, but there were marked differences in leukocyte composition between the two mouse strains. The inflammatory response in C57Bl/6 mice primarily involved T and B lymphocytes, whereas neutrophils, monocytes and macrophages were more prominent in FVB mice. Our data are consistent with the concept that functional outcome after stroke is dependent on the immune cell composition which develops following ischemic brain injury.

  9. Estimating Herd Immunity to Amphibian Chytridiomycosis in Madagascar Based on the Defensive Function of Amphibian Skin Bacteria

    Directory of Open Access Journals (Sweden)

    Molly C. Bletz

    2017-09-01

    Full Text Available For decades, Amphibians have been globally threatened by the still expanding infectious disease, chytridiomycosis. Madagascar is an amphibian biodiversity hotspot where Batrachochytrium dendrobatidis (Bd has only recently been detected. While no Bd-associated population declines have been reported, the risk of declines is high when invasive virulent lineages become involved. Cutaneous bacteria contribute to host innate immunity by providing defense against pathogens for numerous animals, including amphibians. Little is known, however, about the cutaneous bacterial residents of Malagasy amphibians and the functional capacity they have against Bd. We cultured 3179 skin bacterial isolates from over 90 frog species across Madagascar, identified them via Sanger sequencing of approximately 700 bp of the 16S rRNA gene, and characterized their functional capacity against Bd. A subset of isolates was also tested against multiple Bd genotypes. In addition, we applied the concept of herd immunity to estimate Bd-associated risk for amphibian communities across Madagascar based on bacterial antifungal activity. We found that multiple bacterial isolates (39% of all isolates cultured from the skin of Malagasy frogs were able to inhibit Bd. Mean inhibition was weakly correlated with bacterial phylogeny, and certain taxonomic groups appear to have a high proportion of inhibitory isolates, such as the Enterobacteriaceae, Pseudomonadaceae, and Xanthamonadaceae (84, 80, and 75% respectively. Functional capacity of bacteria against Bd varied among Bd genotypes; however, there were some bacteria that showed broad spectrum inhibition against all tested Bd genotypes, suggesting that these bacteria would be good candidates for probiotic therapies. We estimated Bd-associated risk for sampled amphibian communities based on the concept of herd immunity. Multiple amphibian communities, including those in the amphibian diversity hotspots, Andasibe and Ranomafana, were

  10. Estimating Herd Immunity to Amphibian Chytridiomycosis in Madagascar Based on the Defensive Function of Amphibian Skin Bacteria.

    Science.gov (United States)

    Bletz, Molly C; Myers, Jillian; Woodhams, Douglas C; Rabemananjara, Falitiana C E; Rakotonirina, Angela; Weldon, Che; Edmonds, Devin; Vences, Miguel; Harris, Reid N

    2017-01-01

    For decades, Amphibians have been globally threatened by the still expanding infectious disease, chytridiomycosis. Madagascar is an amphibian biodiversity hotspot where Batrachochytrium dendrobatidis ( Bd ) has only recently been detected. While no Bd -associated population declines have been reported, the risk of declines is high when invasive virulent lineages become involved. Cutaneous bacteria contribute to host innate immunity by providing defense against pathogens for numerous animals, including amphibians. Little is known, however, about the cutaneous bacterial residents of Malagasy amphibians and the functional capacity they have against Bd . We cultured 3179 skin bacterial isolates from over 90 frog species across Madagascar, identified them via Sanger sequencing of approximately 700 bp of the 16S rRNA gene, and characterized their functional capacity against Bd . A subset of isolates was also tested against multiple Bd genotypes. In addition, we applied the concept of herd immunity to estimate Bd -associated risk for amphibian communities across Madagascar based on bacterial antifungal activity. We found that multiple bacterial isolates (39% of all isolates) cultured from the skin of Malagasy frogs were able to inhibit Bd . Mean inhibition was weakly correlated with bacterial phylogeny, and certain taxonomic groups appear to have a high proportion of inhibitory isolates, such as the Enterobacteriaceae, Pseudomonadaceae, and Xanthamonadaceae (84, 80, and 75% respectively). Functional capacity of bacteria against Bd varied among Bd genotypes; however, there were some bacteria that showed broad spectrum inhibition against all tested Bd genotypes, suggesting that these bacteria would be good candidates for probiotic therapies. We estimated Bd -associated risk for sampled amphibian communities based on the concept of herd immunity. Multiple amphibian communities, including those in the amphibian diversity hotspots, Andasibe and Ranomafana, were estimated to be

  11. Effect of Pemetrexed combined with cis-platinum chemotherapy on matrix metalloproteinase VEGF, NK cells and immune function in patients with non-squamous non-small cell lung cancer

    Directory of Open Access Journals (Sweden)

    Feng Wen

    2017-07-01

    Full Text Available Objective: To explore effect of Pemetrexed combined with cis-platinum chemotherapy on matrix metalloproteinase (MMPs, vascular esandothelial growth factor (VEGF, NK cells and immune function in patients with non-squamous non-small cell lung cancer. Method: A total of 86 cases of non-squamous non-small cell lung cancer patients were divided into control group (n=44 and observation group (n=42, control group was given docetaxel combined cisplatinum chemotherapy, pemetrexed combined cis-platinum chemotherapy, was applied for observation group. Compared MMP-2, MMP-9, VEGF, NK cells and immune function level before and after treatment in both groups. Results: MMP-2, MMP-9, VEGF, NK cells, CD3+, CD4+, CD8+, CD4+/CD8+ level in both groups before treatment was no significant difference. After treatment, MMP-2, MMP-9, VEGF, CD8+level in both groups was significant lower than before treatment intra-group, and observation was lower than control group, there was significant difference. After treatment, NK cells, CD3+, CD4+, CD8+, CD4+/CD8+ level in both groups was increased dramatically than before treatment of intra-group, moreover, NK cells, CD3+, CD4+, CD8+, CD4+/CD8+level in observation group after treatment was obvious higher than in control group after treatment, there was significant difference. Conclusion: Pemetrexed combined with cis-platinum chemotherapy for non-squamous non-small cell lung cancer could effectively decrease serum MMPs, VEGF level and increase NK cell level, regulate immune function, with definite clinical significance.

  12. Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

    International Nuclear Information System (INIS)

    Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas

    2011-01-01

    Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses

  13. Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

    Energy Technology Data Exchange (ETDEWEB)

    Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas, E-mail: tke@uams.edu [Winthrop P. Rockefeller Cancer Institute and Department of Pathology, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States)

    2011-11-11

    Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses.

  14. IFN-γ extends the immune functions of Guanylate Binding Proteins to inflammasome-independent antibacterial activities during Francisella novicida infection.

    Directory of Open Access Journals (Sweden)

    Pierre Wallet

    2017-10-01

    Full Text Available Guanylate binding proteins (GBPs are interferon-inducible proteins involved in the cell-intrinsic immunity against numerous intracellular pathogens. The molecular mechanisms underlying the potent antibacterial activity of GBPs are still unclear. GBPs have been functionally linked to the NLRP3, the AIM2 and the caspase-11 inflammasomes. Two opposing models are currently proposed to explain the GBPs-inflammasome link: i GBPs would target intracellular bacteria or bacteria-containing vacuoles to increase cytosolic PAMPs release ii GBPs would directly facilitate inflammasome complex assembly. Using Francisella novicida infection, we investigated the functional interactions between GBPs and the inflammasome. GBPs, induced in a type I IFN-dependent manner, are required for the F. novicida-mediated AIM2-inflammasome pathway. Here, we demonstrate that GBPs action is not restricted to the AIM2 inflammasome, but controls in a hierarchical manner the activation of different inflammasomes complexes and apoptotic caspases. IFN-γ induces a quantitative switch in GBPs levels and redirects pyroptotic and apoptotic pathways under the control of GBPs. Furthermore, upon IFN-γ priming, F. novicida-infected macrophages restrict cytosolic bacterial replication in a GBP-dependent and inflammasome-independent manner. Finally, in a mouse model of tularemia, we demonstrate that the inflammasome and the GBPs are two key immune pathways functioning largely independently to control F. novicida infection. Altogether, our results indicate that GBPs are the master effectors of IFN-γ-mediated responses against F. novicida to control antibacterial immune responses in inflammasome-dependent and independent manners.

  15. Comparative analysis of immune effects in mice model: Clonorchis sinensis cysteine protease generated from recombinant Escherichia coli and Bacillus subtilis spores.

    Science.gov (United States)

    Wu, Zhanshuai; Tang, Zeli; Shang, Mei; Zhao, Lu; Zhou, Lina; Kong, Xiangzhan; Lin, Zhipeng; Sun, Hengchang; Chen, Tingjin; Xu, Jin; Li, Xuerong; Huang, Yan; Yu, Xinbing

    2017-07-01

    Clonorchiasis remains a nonnegligible public health problem in endemic areas. Cysteine protease of Clonorchis sinensis (CsCP) plays indispensable roles in the parasitic physiology and pathology, and has been exploited as a promising drug and vaccine candidate. In recent years, development of spore-based vaccines against multiple pathogens has attracted many investigators' interest. In previous studies, the recombinant Escherichia coli (BL21) and Bacillus subtilis spores expressing CsCP have been successfully constructed, respectively. In this study, the immune effects of CsCP protein purified from recombinant BL21 (rCsCP) and B. subtilis spores presenting CsCP (B.s-CsCP) in Balb/c mice model were conducted with comparative analysis. Levels of specific IgG, IgG1 and IgG2a were significantly increased in sera from both rCsCP and B.s-CsCP intraperitoneally immunized mice. Additionally, recombinant spores expressing abundant fusion CsCP (0.03125 pg/spore) could strongly enhance the immunogenicity of CsCP with significantly higher levels of IgG and isotypes. Compared with rCsCP alone, intraperitoneal administration of mice with spores expressing CsCP achieved a better effect of fighting against C. sinensis infection by slowing down the process of fibrosis. Our results demonstrated that a combination of Th1/Th2 immune responses could be elicited by rCsCP, while spores displaying CsCP prominently induced Th1-biased specific immune responses, and the complex cytokine network maybe mediates protective immune responses against C. sinensis. This work further confirmed that the usage of B. subtilis spores displaying CsCP is an effective way to against C. sinensis.

  16. Evaluation of long-term effects of 50-Hz magnetic fields on immune functions in humans

    Energy Technology Data Exchange (ETDEWEB)

    Touitou, Y.; Auzeby, A.; Camus, F. [Faculty of Medicine Pierre et Marie Curie, 75 - Paris (France); Lambrozo, J.; Souques, M.; Verrier, A. [Gaz de France (EDF/GDF), SEM, 75 - Paris (France)

    2006-07-01

    The relationship between exposure to 50-Hz magnetic fields (E.L.F.) and human health is of increasing interest since this exposure has been implicated in many different diseases including cancers in epidemiological studies, though the results are controversial. The identification of possible mechanisms of interaction between E.L.F. and biological systems that could provide a biological plausibility to the observed effects has failed so far. In this study we investigate the possible chronic effects of exposure to E.L.F. in humans. We examine the circadian rhythm of CD{sub 3}, CD{sub 4}, CD{sub 8}, Nk cells and B cells in 15 men (38.0{+-}8.9 yrs) exposed chronically and daily for a period of 1-20 years, in the workplace and at home, to a 50-Hz magnetic field in search of any cumulative effect from those chronic conditions of exposure. The weekly geometric mean of individual exposures ranged from 0.1 to 2.6 {mu}T. The results are compared to those for 15 unexposed men similar in a (39.4 {+-}1.2 yrs), with the same synchronization and physical activity who served as controls (individual exposures ranged from 0.004 to 0.092 {mu}T). Blood samples were taken hourly from 2000 to 0800. This work shows that subjects exposed over a long period (up to 20 years) and on a daily basis to magnetic fields experienced no changes in their plasma immune variables. Our data suggest therefore that magnetic fields have no cumulative effects on immune functions, at least for the variables under study. (authors)

  17. A random cluster survey and a convenience sample give comparable estimates of immunity to vaccine preventable diseases in children of school age in Victoria, Australia.

    Science.gov (United States)

    Kelly, Heath; Riddell, Michaela A; Gidding, Heather F; Nolan, Terry; Gilbert, Gwendolyn L

    2002-08-19

    We compared estimates of the age-specific population immunity to measles, mumps, rubella, hepatitis B and varicella zoster viruses in Victorian school children obtained by a national sero-survey, using a convenience sample of residual sera from diagnostic laboratories throughout Australia, with those from a three-stage random cluster survey. When grouped according to school age (primary or secondary school) there was no significant difference in the estimates of immunity to measles, mumps, hepatitis B or varicella. Compared with the convenience sample, the random cluster survey estimated higher immunity to rubella in samples from both primary (98.7% versus 93.6%, P = 0.002) and secondary school students (98.4% versus 93.2%, P = 0.03). Despite some limitations, this study suggests that the collection of a convenience sample of sera from diagnostic laboratories is an appropriate sampling strategy to provide population immunity data that will inform Australia's current and future immunisation policies. Copyright 2002 Elsevier Science Ltd.

  18. Regulation of immune responses and tolerance: the microRNA perspective

    Science.gov (United States)

    Chen, Chang-Zheng; Schaffert, Steven; Fragoso, Rita; Loh, Christina

    2013-01-01

    Summary Much has been learned about the molecular and cellular components critical for the control of immune responses and tolerance. It remains a challenge, however, to control the immune response and tolerance at the system level without causing significant toxicity to normal tissues. Recent studies suggest that microRNA (miRNA) genes, an abundant class of non-coding RNA genes that produce characteristic approximately 22 nucleotides small RNAs, play important roles in immune cells. In this article, we discuss emerging knowledge regarding the functions of miRNA genes in the immune system. We delve into the roles of miRNAs in regulating signaling strength and threshold, homeostasis, and the dynamics of the immune response and tolerance during normal and pathogenic immunological conditions. We also present observations based on analyzes of miR-181 family genes that indicate the potential functions of primary and/ or precursor miRNAs in target recognition and explore the impact of these findings on target identification. Finally, we illustrate that despite the subtle effects of miRNAs on gene expression, miRNAs have the potential to influence the outcomes of normal and pathogenic immune responses by controlling the quantitative and dynamic aspects of immune responses. Tuning miRNA functions in immune cells, through gain- and loss-of-function approaches in mice, may reveal novel approach to restore immune equilibrium from pathogenic conditions, such as autoimmune disease and leukemia, without significant toxicity. PMID:23550642

  19. Regulation of immune responses and tolerance: the microRNA perspective.

    Science.gov (United States)

    Chen, Chang-Zheng; Schaffert, Steven; Fragoso, Rita; Loh, Christina

    2013-05-01

    Much has been learned about the molecular and cellular components critical for the control of immune responses and tolerance. It remains a challenge, however, to control the immune response and tolerance at the system level without causing significant toxicity to normal tissues. Recent studies suggest that microRNA (miRNA) genes, an abundant class of non-coding RNA genes that produce characteristic approximately 22 nucleotides small RNAs, play important roles in immune cells. In this article, we discuss emerging knowledge regarding the functions of miRNA genes in the immune system. We delve into the roles of miRNAs in regulating signaling strength and threshold, homeostasis, and the dynamics of the immune response and tolerance during normal and pathogenic immunological conditions. We also present observations based on analyzes of miR-181 family genes that indicate the potential functions of primary and/or precursor miRNAs in target recognition and explore the impact of these findings on target identification. Finally, we illustrate that despite the subtle effects of miRNAs on gene expression, miRNAs have the potential to influence the outcomes of normal and pathogenic immune responses by controlling the quantitative and dynamic aspects of immune responses. Tuning miRNA functions in immune cells, through gain- and loss-of-function approaches in mice, may reveal novel approach to restore immune equilibrium from pathogenic conditions, such as autoimmune disease and leukemia, without significant toxicity. © 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

  20. Chlorophytum borivilianum Polysaccharide Fraction Provokes the Immune Function and Disease Resistance of Labeo rohita against Aeromonas hydrophila

    Directory of Open Access Journals (Sweden)

    Sib Sankar Giri

    2015-01-01

    Full Text Available The present study aimed to investigate the effects of Chlorophytum borivilianum polysaccharide (CBP, as a dietary supplement administered at varying concentrations with feed (basal diet, on various cytokine-related responses in Labeo rohita fingerlings. Immune parameters and immune-related gene expressions were measured at 3rd, 4th, and 5th week after feeding. The results revealed that dietary administration of CBP at 0.2% and 0.4% for 4 weeks significantly upregulated serum lysozyme and phagocytic activity. Complement C3 and respiratory burst activity (RBA were significantly higher after 4 weeks of CBP feeding. The immune related genes IL-8, IL-1β, TNF-α, and iNOS were downregulated (P<0.05 in groups with 0.2% and 0.4% CBP supplemented diets at week 4. Expression of anti-inflammatory cytokines (IL-10 and TGF-β was also downregulated (P<0.5 after 4 weeks of feeding with 0.2% to 0.8% CBP. However, five weeks of CBP administration had no significant effect on immune gene expression, except TNF-α and IL-8. Fish fed with 0.4% CBP for 4 weeks showed maximum resistance against Aeromonas hydrophila (73.3% survival compared to control. From these results, we recommend that CBP administration at 0.4% for 4 weeks could effectively improve immune response and disease resistance in L. rohita.

  1. Immune Abnormalities in Fontan Protein-Losing Enteropathy: A Case-Control Study.

    Science.gov (United States)

    Magdo, H Sonali; Stillwell, Terri L; Greenhawt, Matthew J; Stringer, Kathleen A; Yu, Sunkyung; Fifer, Carlen G; Russell, Mark W; Schumacher, Kurt R

    2015-08-01

    To comprehensively characterize the immunologic characteristics of patients with protein-losing enteropathy (PLE) post-Fontan and compare them with patients without PLE post-Fontan. Patients with PLE post-Fontan and age-matched controls post-Fontan were prospectively studied with laboratory markers of immune function. Infectious history was obtained by interview and chart review. The groups' demographics, cardiac history, immune characteristics, and infection history were compared using appropriate 2-group statistics. A total of 16 patients enrolled (8 patients with PLE and 8 controls). All patients with PLE had lymphopenia compared with 25% of controls (P = .01). All patients with PLE had markedly depressed CD4 T cell counts (median 58 cells/μL) compared with controls (median 450 cells/μL, P = .0002); CD4% was also low in the PLE group (12.3%) and normal in control (36.9%, P = .004). Both groups had mildly depressed CD8 T cells and normal to slightly elevated natural killer and B-cell subsets. A majority of patients with PLE (62.5%) had negative titers to measles, mumps, and rubella vaccination, compared with no control Fontan with a negative titer (P = .03). Despite profoundly low CD4 counts, the frequency of infection was not different between groups with no reported opportunistic infections. Patients with Fontan-associated PLE have extensive quantitative immune abnormalities, particularly CD4 deficiency. These immune abnormalities are similar to those found in non-Fontan patients with PLE caused by intestinal lymphangiectasia. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Geometric Distribution-Based Readers Scheduling Optimization Algorithm Using Artificial Immune System

    Directory of Open Access Journals (Sweden)

    Litian Duan

    2016-11-01

    Full Text Available In the multiple-reader environment (MRE of radio frequency identification (RFID system, multiple readers are often scheduled to interrogate the randomized tags via operating at different time slots or frequency channels to decrease the signal interferences. Based on this, a Geometric Distribution-based Multiple-reader Scheduling Optimization Algorithm using Artificial Immune System (GD-MRSOA-AIS is proposed to fairly and optimally schedule the readers operating from the viewpoint of resource allocations. GD-MRSOA-AIS is composed of two parts, where a geometric distribution function combined with the fairness consideration is first introduced to generate the feasible scheduling schemes for reader operation. After that, artificial immune system (including immune clone, immune mutation and immune suppression quickly optimize these feasible ones as the optimal scheduling scheme to ensure that readers are fairly operating with larger effective interrogation range and lower interferences. Compared with the state-of-the-art algorithm, the simulation results indicate that GD-MRSOA-AIS could efficiently schedules the multiple readers operating with a fairer resource allocation scheme, performing in larger effective interrogation range.

  3. Immunization of epidemics in multiplex networks.

    Directory of Open Access Journals (Sweden)

    Dawei Zhao

    Full Text Available Up to now, immunization of disease propagation has attracted great attention in both theoretical and experimental researches. However, vast majority of existing achievements are limited to the simple assumption of single layer networked population, which seems obviously inconsistent with recent development of complex network theory: each node could possess multiple roles in different topology connections. Inspired by this fact, we here propose the immunization strategies on multiplex networks, including multiplex node-based random (targeted immunization and layer node-based random (targeted immunization. With the theory of generating function, theoretical analysis is developed to calculate the immunization threshold, which is regarded as the most critical index for the effectiveness of addressed immunization strategies. Interestingly, both types of random immunization strategies show more efficiency in controlling disease spreading on multiplex Erdös-Rényi (ER random networks; while targeted immunization strategies provide better protection on multiplex scale-free (SF networks.

  4. Effects of ionizing radiation on the immune system

    International Nuclear Information System (INIS)

    Dubois, J.B.

    1986-01-01

    After reviewing the different lymphoid organs and the essential phases of the immune response, we studied the morphological and functional effects of ionizing radiation on the immunological system. Histologic changes in the lymph nodes, spleen, thymus, and different lymphocyte subpopulations were studied in relation with the radiation dose and irradiated volume (whole body irradiation, localized irradiation). Functional changes in the immune system induced by ionizing radiation were also investigated by a study of humoral-mediated immunity (antibody formation) and cell-mediated immunity (behavior of macrophages, B-cells, T suppressor cells, T helper cells, T effector cells, and natural killer cells). A study into the mechanisms of action of ionizing radiation and the immune processes it interferes with suggests several likely hypotheses (direct action on the immune cells, on their precursors, on seric mediators or on cell mediators). The effects on cancer patients' immune reactions of low radiation doses delivered to the various lymphoid organs are discussed, as well as the relationships between the host and the evolution of the tumor [fr

  5. Effects of low dose radiation on tumor growth and changes of erythrocyte immune function and activity of SOD in tumor-bearing mice

    International Nuclear Information System (INIS)

    Yu Hongsheng; Lu Yanda

    2001-01-01

    Objective: To study the effect of low dose radiation on tumor growth and changes of erythrocyte immune function and activity of SOD in the tumor-bearing mice. Methods: Kunming strain male mice were implanted with S 180 sarcoma cells in the right inguen subcutaneously as an experimental in situ animal model. Six hours before implantation the mice were given 75 mG whole-body X-ray irradiation and tumor-formation rate was counted 5 days late. From then, every two days the tumor volume was measured to draw a tumor growth curve. Fifteen days later, all mice were killed to measure the tumor weight, observe the necrosis area and the tumor-infiltration lymphoreticular cells (TIL) in the tumor pathologically. At the same time, erythrocyte immune function and activity of SOD were tested. Results: (1) The mice pre-exposed to low dose radiation had a lower tumor formation rate than those without a pre-exposed (P < 0.05). (2) The tumor growth slowed down significantly in mice receiving a low does irradiation; The average tumor weight in mice receiving a low dose irradiation was lighter too (P < 0.05). (3) The tumor necrosis areas were larger and TILs were more in the irradiation group than those of the control group. (4) The erythrocyte immune function and activity of SOD in the irradiation group were all higher significantly than those of the control group ( P < 0.05). Conclusion: Low dose radiation could markedly increase anti-tumor ability of the organism and improve the erythrocyte immune function and activity of SOD in red cells, suggesting it could be useful in clinical cancer treatment

  6. Sculpting humoral immunity through dengue vaccination to enhance protective immunity

    Directory of Open Access Journals (Sweden)

    Wayne eCrill

    2012-11-01

    Full Text Available Dengue viruses (DENV are the most important mosquito transmitted viral pathogens infecting humans. DENV infection produces a spectrum of disease, most commonly causing a self-limiting flu-like illness known as dengue fever; yet with increased frequency, manifesting as life-threatening dengue hemorrhagic fever (DHF. Waning cross-protective immunity from any of the four dengue serotypes may enhance subsequent infection with another heterologous serotype to increase the probability of DHF. Decades of effort to develop dengue vaccines are reaching the finishing line with multiple candidates in clinical trials. Nevertheless, concerns remain that imbalanced immunity, due to the prolonged prime-boost schedules currently used in clinical trials, could leave some vaccinees temporarily unprotected or with increased susceptibility to enhanced disease. Here we develop a DENV serotype 1 (DENV-1 DNA vaccine with the immunodominant cross-reactive B cell epitopes associated with immune enhancement removed. We compare wild-type (WT with this cross-reactivity reduced (CRR vaccine and demonstrate that both vaccines are equally protective against lethal homologous DENV-1 challenge. Under conditions mimicking natural exposure prior to acquiring protective immunity, WT vaccinated mice enhanced a normally sub-lethal heterologous DENV-2 infection resulting in DHF-like disease and 95% mortality in AG129 mice. However, CRR vaccinated mice exhibited redirected serotype-specific and protective immunity, and significantly reduced morbidity and mortality not differing from naïve mice. Thus, we demonstrate in an in vivo DENV disease model, that non-protective vaccine-induced immunity can prime vaccinees for enhanced DHF-like disease and that CRR DNA immunization significantly reduces this potential vaccine safety concern. The sculpting of immune memory by the modified vaccine and resulting redirection of humoral immunity provide insight into DENV vaccine induced immune

  7. Cross-immunity among allogeneic tumors in rats immunized with gamma-irradiated ascites tumors

    International Nuclear Information System (INIS)

    Sato, Tatsusuke; Suga, Michio; Kudo, Hajime; Waga, Takashi; Ogasawara, Masamichi

    1980-01-01

    Non-inbred rats of the Gifu strain were intraperitoneally challenged with Hirosaki sarcoma (Tetraploid type, 10 5 cells) after repeated immunization with gamma-irradiated (13,000 rads 60 Co) allogeneic non-viral tumors of ascites type (Tetraploid or diploid type of Hirosaki sarcoma, Usubuchi sarcoma or AH130). In rats immunized not only with the same tumor as the immunizing tumor but also with a different tumor, the growth of the challenge tumor was markedly inhibited as compared with the control in non-immunized rats. It is considered that these tumors retained common antigen(s) by the resistance to irradiation because of their form of ascites tumor. The marked cross-immunity in rats immunized with AH130 may be explained by the fact that gamma-irradiated AH130 cells were alive longer in the peritoneal cavity than other tumors on account of its high resistance to irradiation. (author)

  8. Impairment of innate immune responses in cirrhotic patients and treatment by branched-chain amino acids

    Science.gov (United States)

    Nakamura, Ikuo

    2014-01-01

    It has been reported that host defense responses, such as phagocytic function of neutrophils and natural killer (NK) cell activity of lymphocytes, are impaired in cirrhotic patients. This review will concentrate on the impairment of innate immune responses in decompensated cirrhotic patients and the effect of the treatment by branched-chain amino acids (BCAA) on innate immune responses. We already reported that phagocytic function of neutrophils was significantly improved by 3-mo BCAA supplementation. In addition, the changes of NK activity were also significant at 3 mo of supplementation compared with before supplementation. Also, Fisher’s ratios were reported to be significantly increased at 3 mo of BCAA supplementation compared with those before oral supplementation. Therefore, administration of BCAA could reduce the risk of bacterial and viral infection in patients with decompensated cirrhosis by restoring impaired innate immune responses of the host. In addition, it was also revealed that BCAA oral supplementation could reduce the risk of development of hepatocellular carcinoma in cirrhotic patients. The mechanisms of the effects will also be discussed in this review article. PMID:24966600

  9. NKT cell self-reactivity: evolutionary master key of immune homeostasis?

    DEFF Research Database (Denmark)

    Navikas, Shohreh

    2011-01-01

    Complex immune responses have evolved to protect multicellular organisms against the invasion of pathogens. This has exerted strong developmental pressure for specialized functions that can also limit damage to self-tissue. Two arms of immunity, the innate and adaptive immune system, have evolved...... through evolution by higher vertebrates could be related to their central function as master regulators of immune homeostasis that in part is shared with regulatory T cells. Hypothetical views on how self-reactive NKT cells secure such a central role will also be proposed.......Complex immune responses have evolved to protect multicellular organisms against the invasion of pathogens. This has exerted strong developmental pressure for specialized functions that can also limit damage to self-tissue. Two arms of immunity, the innate and adaptive immune system, have evolved....... The recent finding of self-peptide reactivity of NKT cells in the context of CD1d, with capacity to regulate multiple autoimmune and inflammatory conditions, motivates the current proposal that self-reactive NKT cells might be the ancestral link between present NK and T cells. Their parallel selection...

  10. Comparing the functional components, SOD-like activities, antimutagenicity, and nutrient compositions of Phellinus igniarius and Phellinus linteus mushrooms

    Directory of Open Access Journals (Sweden)

    Nae-Cherng Yang

    2016-04-01

    Full Text Available Many species of the genus Phellinus possess beneficial properties, including antioxidant, immune-enhancing, and antimutagenic effects. Phenolic compounds and polysaccharides are two kinds of bioactive compounds; however, few studies have compared the differences between Phellinus igniarius and Phellinus linteus in their functional components, functional activities, and nutrient compositions. Herein, the proximate compositions and microelements of the fruiting body of P. igniarius and P. linteus were determined. The fruiting body of P. igniarius and P. linteus were extracted by boiling water [water extract of P. igniarius (WEPI and P. linteus (WEPL]. The contents of total phenolics and polysaccharides, as well as superoxide dismutase (SOD-like and antimutagenic activities of WEPI and WEPL, were compared. We found that WEPI was rich in phenolics and polysaccharides and had higher SOD-like activity than WEPL. Nutrient compositions were mainly different in minerals, whereas anitmutagenicity was similar. All of these results suggested that P. igniarius has greater potential for the development of antioxidant and immunomodulating food products than P. linteus.

  11. Ubiquitin-specific Protease-7 Inhibition Impairs Tip60-dependent Foxp3+ T-regulatory Cell Function and Promotes Antitumor Immunity

    Directory of Open Access Journals (Sweden)

    Liqing Wang

    2016-11-01

    Full Text Available Foxp3+ T-regulatory (Treg cells are known to suppress protective host immune responses to a wide variety of solid tumors, but their therapeutic targeting is largely restricted to their transient depletion or “secondary” modulation, e.g. using anti-CTLA-4 monoclonal antibody. Our ongoing studies of the post-translational modifications that regulate Foxp3 demonstrated that the histone/protein acetyltransferase, Tip60, plays a dominant role in promoting acetylation, dimerization and function in Treg cells. We now show that the ubiquitin-specific protease, Usp7, controls Treg function largely by stabilizing the expression and promoting the multimerization of Tip60 and Foxp3. Genetic or pharmacologic targeting of Usp7 impairs Foxp3+ Treg suppressive functions, while conventional T cell responses remain intact. As a result, pharmacologic inhibitors of Usp7 can limit tumor growth in immunocompetent mice, and promote the efficacy of antitumor vaccines and immune checkpoint therapy with anti-PD1 monoclonal antibody in murine models. Hence, pharmacologic therapy with Usp7 inhibitors may have an important role in future cancer immunotherapy.

  12. how to evade the immune system?

    Indian Academy of Sciences (India)

    HCV usually induces robust immune responses, but it frequently escapes the immune defense to establish persistent infection. The fact that HCV exists as an evolving quasispecies plays an important role in the selection of escape mutants. Furthermore, several viral proteins interfere with cellular functions, in particular, ...

  13. Immune Evasion by Epstein-Barr Virus

    NARCIS (Netherlands)

    Ressing, Maaike E; van Gent, Michiel; Gram, Anna M; Hooykaas, Marjolein J G; Piersma, Sytse J; Wiertz, EJHJ

    2015-01-01

    Epstein-Bar virus (EBV) is widespread within the human population with over 90% of adults being infected. In response to primary EBV infection, the host mounts an antiviral immune response comprising both innate and adaptive effector functions. Although the immune system can control EBV infection to

  14. Impact of Pharmacist Immunization Authority on Seasonal Influenza Immunization Rates Across States.

    Science.gov (United States)

    Drozd, Edward M; Miller, Laura; Johnsrud, Michael

    2017-08-01

    The goal of this study was to investigate the impact on immunization rates of policy changes that allowed pharmacists to administer influenza immunizations across the United States. Influenza immunization rates across states were compared before and after policy changes permitting pharmacists to administer influenza immunizations. The study used Behavioral Risk Factor Surveillance System (BRFSS) survey data on influenza immunization rates between 2003 and 2013. Logistic regression models were constructed and incorporated adjustments for the complex sample design of the BRFSS to predict the likelihood of a person receiving an influenza immunization based on various patient health, demographic, and access to care factors. Overall, as states moved to allow pharmacists to administer influenza immunizations, the odds that an adult resident received an influenza immunization rose, with the effect increasing over time. The average percentage of people receiving influenza immunizations in states was 35.1%, rising from 32.2% in 2003 to 40.3% in 2013. The policy changes were associated with a long-term increase of 2.2% to 7.6% in the number of adults aged 25 to 59 years receiving an influenza immunization (largest for those aged 35-39 years) and no significant change for those younger or older. These findings suggest that pharmacies and other nontraditional settings may offer accessible venues for patients when implementing other public health initiatives. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  15. [Exosomes and Immune Cells].

    Science.gov (United States)

    Seo, Naohiro

    2017-05-01

    In addition to the cytokines and cytotoxic granules, exosomes have been known as the intercellular communicator and cytotoxic missile of immune cells for the past decade. It has been well known that mature dendritic cell(DC)-derived exosomes participate in the T cell and natural killer(NK)cell activation, while immature DCs secrete tolerogenic exosomes for regulatory T(Treg)cell generation. Treg cell-derived EVs act as a suppressor against pathogenic type-1 T helper(Th1)cell responses. CD8+ T cells produce tumoricidal exosomes for preventing tumor invasion and metastasis transiently after T cell receptor(TCR)-mediated stimulation. Thus, immune cells produce functional exosomes in the activation state- and/or differentiation stage-dependent manner. In this review, the role of immune cell-derived exosomes will be introduced, focusing mainly on immune reaction against tumor.

  16. Effects of Delayed Enteral Nutrition on Inflammatory Responses and Immune Function Competence in Critically Ill Patients with Prolonged Fasting.

    Science.gov (United States)

    Xi, Fengchan; Li, Ning; Geng, Yanxia; Gao, Tao; Zhang, Juanjuan; Jun, Tanshan; Lin, Zhiliang; Li, Weiqin; Zhu, Weiming; Yu, Wenkui; Li, Jieshou

    2014-05-01

    Although different studies suggest that early enteral nutrition (EEN) has benefits in reducing infectious complications, there is no data that addresses whether delayed enteral nutrition (EN) is detrimental and if it may have effects on inflammatory responses and immune function. Forty-five critically ill patients with long fasting were randomly allocated in two groups according to the type of nutritional support. The first group included patients assuming a standard enteral nutrition (EN, n = 22) and the second group assuming a parenteral nutrition (PN, n = 23). The daily nutritional amount was 25 kcal (105 kJ)/kg for all patients. The inflammatory markers white blood cells (WBC), C-reactive protein (CRP), TNF-α, IL-1-β, IL-6, IL-4, IL- 10 and the immune T-lymphocyte sub-populations CD3+, CD4+, CD8+, and HLA-DR+ were evaluated at day 1, and after 2, 3 and 7 days. IL-4, IL-10, CD3+, CD4+, CD8+ and the CD4+/CD8+ ratio were not statistically different between the two groups. WBC and TNF-α in EN patients were higher than those in PN after 3 and 7 days (P fasting increased systemic inflammatory responses, whereas EN could modify immune function, therefore reducing hospital stay and costs.

  17. Altered neurological function in mice immunized with early endosome antigen 1

    Directory of Open Access Journals (Sweden)

    Fritzler Marvin J

    2004-01-01

    Full Text Available Abstract Background Autoantibodies directed against the 160 kDa endosome protein early endosome antigen 1 (EEA1 are seen in patients with neurological diseases. To determine if antibodies to EEA1 have a neuropathological effect, mice from three major histocompatability haplotype backgrounds (H2q, H2b and H2d were immunized with EEA1 (amino acids 82–1411 that was previously shown to contain the target EEA1 epitopes. The mice were then subjected to five neuro-behavioural tests: grid walking, forelimb strength, open field, reaching and rotarod. Results The immunized SWR/J mice with sustained anti-EEA1 antibodies had significantly reduced forelimb strength than the control non-immune mice of the same strain, and BALB/CJ immune mice demonstrated significantly more forelimb errors on the grid walk test than the control group. Conclusions Antibodies to recombinant EEA1 in mice may mediate neurological deficits that are consistent with clinical features of some humans that spontaneously develop anti-EEA1 autoantibodies.

  18. Structural and functional annotation of human FAM26F: A multifaceted protein having a critical role in the immune system.

    Science.gov (United States)

    Malik, Uzma; Javed, Aneela; Ali, Amjad; Asghar, Kashif

    2017-01-15

    Human immune system is a complex amalgam of a greatly diverse ensemble comprising of various cellular and non-cellular components, including proteins. FAM26F (family with sequence similarity 26, member F) is a relatively recently identified gene reported to play important role in diverse immune responses. Numerous studies have reported FAM26F to be differentially expressed in several viral, bacterial and parasitic infections, in certain pathophysiological conditions such as heart and liver transplantation, and in several cancers. FAM26F has also been found to be upregulated by various stimulants such as polyI:C, LPS, INF gamma and TNF alpha, and via various anticipated pathways including TLR3, TLR4 IFN-β and Dectin-1. Moreover, the synergistic expression of FAM26F on both NK-cells and myeloid dendritic cells is required to activate NK-cells against tumors via its cytoplasmic tail, thus emphasizing the therapeutic potential of FAM26F for NK sensitive tumors. Although a considerable amount of evidence is present regarding the potential role of FAM26F in immune modulation, the exact function and modulatory pathways of this gene are yet to be elucidated. We aimed to completely characterize FAM26F in order to apprehend its function and role in the immune responses. The results revealed human FAM26F to be located at chromosomal position 6q22.1. FAM26F mRNA contains 1141bp coding region encoding a 315 amino acid long, stable protein that has been well-conserved throughout evolution. It is a signal peptide deprived transmembrane protein that is secreted through non-classical pathway. The presence of a single well-conserved Ca_hom_mod domain indicated FAM26F to be a cation channel involved in the transport of molecules. A potential N-glycosylation and 14 phosphorylation sites were also predicted, along with four interacting partners of FAM26F. The secondary and tertiary structures of FAM26F were determined. Moreover, the presence of an immunoglobulin-like fold in FAM26F

  19. Adoptive transfer of natural antibodies to non-immunized chickens affects subsequent antigen-specific humoral and cellular immune responses

    NARCIS (Netherlands)

    Lammers, A.; Klomp, M.E.V.; Nieuwland, M.G.B.; Savelkoul, H.F.J.; Parmentier, H.K.

    2004-01-01

    To determine a regulatory function of natural antibodies in the immune response of chickens, pooled plasma obtained from non-immunized (naive) 15 months old hens was subjected to keyhole limpet hemocyanin (KLH) antigen-affinity chromatography. Purified KLH-binding antibodies were adoptively

  20. The role of intestinal microbiota and the immune system.

    Science.gov (United States)

    Purchiaroni, F; Tortora, A; Gabrielli, M; Bertucci, F; Gigante, G; Ianiro, G; Ojetti, V; Scarpellini, E; Gasbarrini, A

    2013-02-01

    The human gut is an ecosystem consisting of a great number of commensal bacteria living in symbiosis with the host. Several data confirm that gut microbiota is engaged in a dynamic interaction with the intestinal innate and adaptive immune system, affecting different aspects of its development and function. To review the immunological functions of gut microbiota and improve knowledge of its therapeutic implications for several intestinal and extra-intestinal diseases associated to dysregulation of the immune system. Significant articles were identified by literature search and selected based on content, including atopic diseases, inflammatory bowel diseases and treatment of these conditions with probiotics. Accumulating evidence indicates that intestinal microflora has protective, metabolic, trophic and immunological functions and is able to establish a "cross-talk" with the immune component of mucosal immunity, comprising cellular and soluble elements. When one or more steps in this fine interaction fail, autoimmune or auto-inflammatory diseases may occur. Furthermore, it results from the data that probiotics, used for the treatment of the diseases caused by the dysregulation of the immune system, can have a beneficial effect by different mechanisms. Gut microbiota interacts with both innate and adaptive immune system, playing a pivotal role in maintenance and disruption of gut immune quiescence. A cross talk between the mucosal immune system and endogenous microflora favours a mutual growth, survival and inflammatory control of the intestinal ecosystem. Based on these evidences, probiotics can be used as an ecological therapy in the treatment of immune diseases.  

  1. Role of neuropilin-2 in the immune system.

    Science.gov (United States)

    Schellenburg, S; Schulz, A; Poitz, D M; Muders, M H

    2017-10-01

    Neuropilins (NRPs) are single transmembrane receptors with short cytoplasmic tails and are dependent on receptors like VEGF receptors or Plexins for signal transduction. NRPs are known to be important in angiogenesis, lymphangiogenesis, and axon guidance. The Neuropilin-family consists of two members, Neuropilin-1 (NRP1) and Neuropilin-2 (NRP2). They are up to 44 % homologous and conserved in all vertebrates. High levels of NRP2 are found on immune cells. Current research is very limited regarding the functions of NRP2 on these cells. Recent evidence suggests that NRP2 is important for migration, antigen presentation, phagocytosis and cell-cell contact within the immune system. Additionally, posttranslational NRP2 modifications like polysialylation are crucial for the function of some immune cells. This review is an overview about expression and functions of NRP2 in the immune system. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Impact of aging on antigen presentation cell function of dendritic cells.

    Science.gov (United States)

    Wong, Christine; Goldstein, Daniel R

    2013-08-01

    Older people exhibit increased mortality to infections and cancer as compared to younger people, indicating that aging impairs immunity. Dendritic cells (DCs) are key for bridging the innate and adaptive arms of the immune system by priming antigen specific T cells. Discerning how aging impacts DC function to initiate adaptive immune responses is of great biomedical importance as this could lead to the development of novel therapeutics to enhance immunity with aging. This review details reports indicating that aging impairs the antigen presenting function of DCs but highlights other studies indicating preserved DC function with aging. How aging impacts antigen presentation by DCs is complex and without a clear unifying biological underpinning. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Assessment of immune surveillance among inhabitants of high natural background radiation areas in Ramsar-Iran

    International Nuclear Information System (INIS)

    Sileh, Sajad Borzouei; Monfared, Ali Shabestani; Mostafazade, Amrollah; Abedian, Said

    2010-01-01

    In this study by Multi-parameter flow cytometry, immunologic analyze is performed on peripheral blood, NK cells, most effective cells in innate immune and the proportion of TCD8/TCD4 cells that is effective in cellular immune system will be determined. Lysosomal-associated membrane protein-1 (LAMP-1 or CD107a) is used as a functional marker for the identification of natural killer cell activity. Immune surveillance and immune system role in tumoral defense in Ramsar inhabitants will be determined. Radiation dose rate in Talesh mahalle is very high and was many times greater than Chaparsar (another region in Ramsar). Immune surveillance and immune system role in tumoral defense in Talesh mahalle inhabitants will be compared to Chaparsar inhabitants. If this doesn't have significant difference, we should think about some other aspects such as free radical scavengers that will study later

  4. TAM Receptor Signaling in Immune Homeostasis

    Science.gov (United States)

    Rothlin, Carla V.; Carrera-Silva, Eugenio A.; Bosurgi, Lidia; Ghosh, Sourav

    2015-01-01

    The TAM receptor tyrosine kinases (RTKs)—TYRO3, AXL, and MERTK—together with their cognate agonists GAS6 and PROS1 play an essential role in the resolution of inflammation. Deficiencies in TAM signaling have been associated with chronic inflammatory and autoimmune diseases. Three processes regulated by TAM signaling may contribute, either independently or collectively, to immune homeostasis: the negative regulation of the innate immune response, the phagocytosis of apoptotic cells, and the restoration of vascular integrity. Recent studies have also revealed the function of TAMs in infectious diseases and cancer. Here, we review the important milestones in the discovery of these RTKs and their ligands and the studies that underscore the functional importance of this signaling pathway in physiological immune settings and disease. PMID:25594431

  5. Effects of early-life adversity on immune function are mediated by prenatal environment: Role of prenatal alcohol exposure.

    Science.gov (United States)

    Raineki, Charlis; Bodnar, Tamara S; Holman, Parker J; Baglot, Samantha L; Lan, Ni; Weinberg, Joanne

    2017-11-01

    The contribution of the early postnatal environment to the pervasive effects of prenatal alcohol exposure (PAE) is poorly understood. Moreover, PAE often carries increased risk of exposure to adversity/stress during early life. Dysregulation of immune function may play a role in how pre- and/or postnatal adversity/stress alters brain development. Here, we combine two animal models to examine whether PAE differentially increases vulnerability to immune dysregulation in response to early-life adversity. PAE and control litters were exposed to either limited bedding (postnatal day [PN] 8-12) to model early-life adversity or normal bedding, and maternal behavior and pup vocalizations were recorded. Peripheral (serum) and central (amygdala) immune (cytokines and C-reactive protein - CRP) responses of PAE animals to early-life adversity were evaluated at PN12. Insufficient bedding increased negative maternal behavior in both groups. Early-life adversity increased vocalization in all animals; however, PAE pups vocalized less than controls. Early-life adversity reduced serum TNF-α, KC/GRO, and IL-10 levels in control but not PAE animals. PAE increased serum CRP, and levels were even higher in pups exposed to adversity. Finally, PAE reduced KC/GRO and increased IL-10 levels in the amygdala. Our results indicate that PAE alters immune system development and both behavioral and immune responses to early-life adversity, which could have subsequent consequences for brain development and later life health. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Effects of soybean oligosaccharides on intestinal microbial communities and immune modulation in mice

    Directory of Open Access Journals (Sweden)

    Yan Ma

    2017-01-01

    Full Text Available Background: Soybean oligosaccharides (SBOSs are potential prebiotics that may be used to improve immune function. Here, we investigated the effects of intragastric administration of SBOSs in mice to determine the effects on autochthonous intestinal microbial communities and immunological parameters. Results E: After 22-day administration, 4.0 g kg body weight (BW−1 SBOSs significantly enhanced the proliferation of bifidobacteria and lactic acid bacteria (LAB as compared to the control. This dose of SBOSs also significantly increased numbers of enterococci and decreased numbers of Clostridium perfringens. Treatment with 4.0 g kg BW−1 SBOSs also significantly increased the percentage of T-lymphocytes and lymphocyte proliferation as compared to the control, suggesting that SBOSs promoted cellular immunity in mice. Additionally, 4.0 g kg BW−1 SBOSs induced significant differences in hemolysin production, natural killer (NK cell activity, phagocytic activity, cytokine production, and immunoglobulin levels compared to the control. Conclusion: Our data demonstrated that intragastric administration of SBOSs at a dose of 4.0 g kg BW−1 improved the numbers of beneficial intestinal microbes and enhanced immunological function of mice. Therefore, these data supported that SBOSs may have applications as a prebiotic to improve immune responses in humans. Further studies are warranted.

  7. Functional evaluation of HMGB1 as immune therapeutic effector molecule for cell-based vaccination strategies

    OpenAIRE

    Willenbrock, Saskia

    2013-01-01

    Cancer is a leading cause of death worldwide although extensive research in human cancer medicine is carried out. To develop and improve molecular anticancer therapies, the characterisation of the structure and function of cancer-related genes and proteins is essential. The dog is one of the companion animals being considered as an invaluable model system. The spontaneous development of tumours in the context of an intact immune system in dogs and the striking similarities to human neoplasias...

  8. An attempt to understand kidney's protein handling function by comparing plasma and urine proteomes.

    Directory of Open Access Journals (Sweden)

    Lulu Jia

    Full Text Available BACKGROUND: With the help of proteomics technology, the human plasma and urine proteomes, which closely represent the protein compositions of the input and output of the kidney, respectively, have been profiled in much greater detail by different research teams. Many datasets have been accumulated to form "reference profiles" of the plasma and urine proteomes. Comparing these two proteomes may help us understand the protein handling aspect of kidney function in a way, however, which has been unavailable until the recent advances in proteomics technology. METHODOLOGY/PRINCIPAL FINDINGS: After removing secreted proteins downstream of the kidney, 2611 proteins in plasma and 1522 in urine were identified with high confidence and compared based on available proteomic data to generate three subproteomes, the plasma-only subproteome, the plasma-and-urine subproteome, and the urine-only subproteome, and they correspond to three groups of proteins that are handled in three different ways by the kidney. The available experimental molecular weights of the proteins in the three subproteomes were collected and analyzed. Since the functions of the overrepresented proteins in the plasma-and-urine subproteome are probably the major functions that can be routinely regulated by excretion from the kidney in physiological conditions, Gene Ontology term enrichment in the plasma-and-urine subproteome versus the whole plasma proteome was analyzed. Protease activity, calcium and growth factor binding proteins, and coagulation and immune response-related proteins were found to be enriched. CONCLUSION/SIGNIFICANCE: The comparison method described in this paper provides an illustration of a new approach for studying organ functions with a proteomics methodology. Because of its distinctive input (plasma and output (urine, it is reasonable to predict that the kidney will be the first organ whose functions are further elucidated by proteomic methods in the near future. It

  9. The role of adaptive immunity as an ecological filter on the gut microbiota in zebrafish.

    Science.gov (United States)

    Stagaman, Keaton; Burns, Adam R; Guillemin, Karen; Bohannan, Brendan Jm

    2017-07-01

    All animals live in intimate association with communities of microbes, collectively referred to as their microbiota. Certain host traits can influence which microbial taxa comprise the microbiota. One potentially important trait in vertebrate animals is the adaptive immune system, which has been hypothesized to act as an ecological filter, promoting the presence of some microbial taxa over others. Here we surveyed the intestinal microbiota of 68 wild-type zebrafish, with functional adaptive immunity, and 61 rag1 - zebrafish, lacking functional B- and T-cell receptors, to test the role of adaptive immunity as an ecological filter on the intestinal microbiota. In addition, we tested the robustness of adaptive immunity's filtering effects to host-host interaction by comparing the microbiota of fish populations segregated by genotype to those containing both genotypes. The presence of adaptive immunity individualized the gut microbiota and decreased the contributions of neutral processes to gut microbiota assembly. Although mixing genotypes led to increased phylogenetic diversity in each, there was no significant effect of adaptive immunity on gut microbiota composition in either housing condition. Interestingly, the most robust effect on microbiota composition was co-housing within a tank. In all, these results suggest that adaptive immunity has a role as an ecological filter of the zebrafish gut microbiota, but it can be overwhelmed by other factors, including transmission of microbes among hosts.

  10. IL-17 suppresses immune effector functions in human papillomavirus-associated epithelial hyperplasia.

    Science.gov (United States)

    Gosmann, Christina; Mattarollo, Stephen R; Bridge, Jennifer A; Frazer, Ian H; Blumenthal, Antje

    2014-09-01

    Persistent infection with high-risk human papillomaviruses (HPV) causes epithelial hyperplasia that can progress to cancer and is thought to depend on immunosuppressive mechanisms that prevent viral clearance by the host. IL-17 is a cytokine with diverse functions in host defense and in the pathology of autoimmune disorders, chronic inflammatory diseases, and cancer. We analyzed biopsies from patients with HPV-associated cervical intraepithelial neoplasia grade 2/3 and murine skin displaying HPV16 E7 protein-induced epithelial hyperplasia, which closely models hyperplasia in chronic HPV lesions. Expression of IL-17 and IL-23, a major inducer of IL-17, was elevated in both human HPV-infected and murine E7-expressing lesions. Using a skin-grafting model, we demonstrated that IL-17 in HPV16 E7 transgenic skin grafts inhibited effective host immune responses against the graft. IL-17 was produced by CD3(+) T cells, predominantly CD4(+) T cells in human, and CD4(+) and γδ T cells in mouse hyperplastic lesions. IL-23 and IL-1β, but not IL-18, induced IL-17 production in E7 transgenic skin. Together, these findings demonstrate an immunosuppressive role for IL-17 in HPV-associated epithelial hyperplasia and suggest that blocking IL-17 in persistent viral infection may promote antiviral immunity and prevent progression to cancer. Copyright © 2014 by The American Association of Immunologists, Inc.

  11. Circulating immune complexes – reviewing the biological roles in ...

    African Journals Online (AJOL)

    Circulating immune complexes – reviewing the biological roles in human immune function and exercise. ... studies that have investigated CIC's following exercise and proposes that a comprehensive understanding and interpretation of immune system responses to exercise should take these complexes into consideration.

  12. Regulatory T cells: immune suppression and beyond

    OpenAIRE

    Wan, Yisong Y

    2010-01-01

    Foxp3-expressing regulatory T cells (Tregs) were originally identified as critical in maintaining self-tolerance and immune homeostasis. The immunosuppressive functions of Tregs are widely acknowledged and have been extensively studied. Recent studies have revealed many diverse roles of Tregs in shaping the immune system and the inflammatory response. This review will discuss our efforts as well as the efforts of others towards understanding the multifaceted function of Treg...

  13. The Immune System and Bodily Defence

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 6. The Immune System and Bodily Defence How Does the Immune System Organize Itself so as to Connect Target Recognition to Expected Functions? Vineeta Bal Satyajit Rath. Series Article Volume 2 Issue 6 June 1997 pp 25-38 ...

  14. A Functional Food Mixture “Protector” Reinforces the Protective Immune Parameters against Viral Flu Infection in Mice

    Directory of Open Access Journals (Sweden)

    Kenza A. Mansoor

    2018-06-01

    Full Text Available Background: Viral influenza infection causes serious health issues especially when an outbreak occurs. Although influenza virus vaccines are available and each year manufactures modify the vaccine depending on the expected mutated strain, it is still far from satisfactory, mainly in young children and older adults. Therefore, a product that can support and shape the immune system to protect against viral flu infections is highly essential. Methods: A functional food water-soluble mixture of pomegranate, red grape, dates, olive fruit, figs, and ginger extracts, termed herein “Protector”, was prepared and tested in stimulating/modulating the production of specific cytokines, and hemagglutinin inhibition (HAI antibodies following viral flu vaccination in mice. Results: A single intraperitoneal or multiple oral administration for 1–7 days of “Protector” significantly increased the production of interferon (IFN-γ and interleukin (IL-12 in blood, spleen, and lungs of mice. When “Protector” was orally administered for one week following a single vaccine injection (primary immunization or for two weeks (one week apart following double vaccine injections (secondary immunization, mice significantly produced higher titers of HAI antibodies. This increase in HAI antibodies was associated with Pillow-inducing significant and different changes in vaccine-induced IFN-γ, IL-12, IL-6 and IL-22 following primary and secondary immunizations. Conclusions: “Protector” administration reinforces the protective immune parameters against viral flu infection. Therefore, after performing preclinical toxicology studies and ensuring its safety, “Protector” should be considered a potential product to be tested in clinical trials to conclude its efficacy in reducing the devastating effects of flu infection in humans and its outbreaks.

  15. Dual RNA-seq reveals no plastic transcriptional response of the coccidian parasite Eimeria falciformis to host immune defenses.

    Science.gov (United States)

    Ehret, Totta; Spork, Simone; Dieterich, Christoph; Lucius, Richard; Heitlinger, Emanuel

    2017-09-05

    Parasites can either respond to differences in immune defenses that exist between individual hosts plastically or, alternatively, follow a genetically canalized ("hard wired") program of infection. Assuming that large-scale functional plasticity would be discernible in the parasite transcriptome we have performed a dual RNA-seq study of the lifecycle of Eimeria falciformis using infected mice with different immune status as models for coccidian infections. We compared parasite and host transcriptomes (dual transcriptome) between naïve and challenge infected mice, as well as between immune competent and immune deficient ones. Mice with different immune competence show transcriptional differences as well as differences in parasite reproduction (oocyst shedding). Broad gene categories represented by differently abundant host genes indicate enrichments for immune reaction and tissue repair functions. More specifically, TGF-beta, EGF, TNF and IL-1 and IL-6 are examples of functional annotations represented differently depending on host immune status. Much in contrast, parasite transcriptomes were neither different between Coccidia isolated from immune competent and immune deficient mice, nor between those harvested from naïve and challenge infected mice. Instead, parasite transcriptomes have distinct profiles early and late in infection, characterized largely by biosynthesis or motility associated functional gene groups, respectively. Extracellular sporozoite and oocyst stages showed distinct transcriptional profiles and sporozoite transcriptomes were found enriched for species specific genes and likely pathogenicity factors. We propose that the niche and host-specific parasite E. falciformis uses a genetically canalized program of infection. This program is likely fixed in an evolutionary process rather than employing phenotypic plasticity to interact with its host. This in turn might limit the potential of the parasite to adapt to new host species or niches, forcing

  16. Persisting Inflammation and Chronic Immune Activation but Intact Cognitive Function in HIV-Infected Patients After Long-Term Treatment With Combination Antiretroviral Therapy

    DEFF Research Database (Denmark)

    Pedersen, Karin K; Pedersen, Maria; Gaardbo, Julie C

    2013-01-01

    Impaired cognitive function in HIV-infected patients has been suggested. Treatment with combination antiretroviral therapy (cART) restores CD4⁺ cell counts and suppresses viral replication, but immune activation and inflammation may persist. The aim of the study was to examine if cognitive function...

  17. Natural functional SNPs in miR-155 alter its expression level, blood cell counts and immune responses

    Directory of Open Access Journals (Sweden)

    Congcong Li

    2016-08-01

    Full Text Available miR-155 has been confirmed to be a key factor in immune responses in humans and other mammals. Therefore, investigation of variations in miR-155 could be useful for understanding the differences in immunity between individuals. In this study, four SNPs in miR-155 were identified in mice (Mus musculus and humans (Homo sapiens. In mice, the four SNPs were closely linked and formed two miR-155 haplotypes (A and B. Ten distinct types of blood parameters were associated with miR-155 expression under normal conditions. Additionally, 4 and 14 blood parameters were significantly different between these two genotypes under normal and lipopolysaccharide (LPS stimulation conditions, respectively. Moreover, the expression levels of miR-155, the inflammatory response to LPS stimulation and the lethal ratio following Salmonella typhimurium infection were significantly increased in mice harboring the AA genotype. Further, two SNPs, one in the loop region and the other near the 3' terminal of pre-miR-155, were confirmed to be responsible for the differential expression of miR-155 in mice. Interestingly, two additional SNPs, one in the loop region and the other in the middle of miR-155*, modulated the function of miR-155 in humans. Predictions of secondary RNA structure using RNAfold showed that these SNPs affected the structure of miR-155 in both mice and humans. Our results provide novel evidence of the natural functional SNPs of miR-155 in both mice and humans, which may affect the expression levels of mature miR-155 by modulating its secondary structure. The SNPs of human miR-155 may be considered as causal mutations for some immune-related diseases in the clinic. The two genotypes of mice could be used as natural models for studying the mechanisms of immune diseases caused by abnormal expression of miR-155 in humans.

  18. MECHANISMS OF ANTIINFECTIOUS FUNCTIONS OF INNATE IMMUNITY: ROLE OF TOLL-LIKE RECEPTORS

    Directory of Open Access Journals (Sweden)

    S. I. Suskov

    2012-01-01

    Full Text Available This review describes the main role of toll-like receptors of innate immunity for pathogen recognition; signaling; production of inflammatory response. Also Interrelation of innate and adaptive Immunity in conditions of pathology and organ transplantation were considered. 

  19. cDNA cloning, expression and immune function analysis of a novel Rac1 gene (AjRac1) in the sea cucumber Apostichopus japonicus.

    Science.gov (United States)

    Li, Kaiquan; Liu, Lin; Shang, Shengnan; Wang, Yi; Zhan, Yaoyao; Song, Jian; Zhang, Xiangxiang; Chang, Yaqing

    2017-10-01

    The ras-related C3 botulinum toxin substrate 1 (Rac1) belongs to Ras homolog (Rho) small GTPases subfamily. As an important molecular switch, Rac1 regulates various processes in the cell, especially in cellular immune response. With attempt to clarify characters and functions of Rac1 in sea cucumbers, full length cDNA of a Rac1 homolog in the sea cucumber Apostichopus japonicus (AjRac1) was cloned by transcriptome database mining and rapid amplification of cDNA ends (RACE) techniques. The open reading frame of AjRac1 is 579 bp encoding a protein with a length of 192 aa. Sequence analysis showed that AjRac1 is highly conserved as compared to those from other eukaryotic species. Phylogenetic analysis revealed that amino acid sequence of AjRac1 closely related to those from Strongylocentrotus purpuratus. Results of expression analysis showed that AjRac1 exhibited a relative high expression in blastula stage, adult coelomocytes and respiratory tree in A. japonicus. The transcription of AjRac1 in adult coelomocytes altered significantly at 4 h- and 12 h-after Vibrio splendidus infection, respectively, which indicated that AjRac1 involved in sea cucumber innate immunity. All data presented in this study will deepen our understanding of characterizations and immunological functions of Rac1 in sea cucumbers. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. The Effects of Tacrolimus on T-Cell Proliferation Are Short-Lived: A Pilot Analysis of Immune Function Testing

    Directory of Open Access Journals (Sweden)

    Benjamin L. Laskin, MD, MS

    2017-08-01

    Conclusions. T-cell proliferation is currently not suitable to measure immunosuppression because sample processing diminishes observable effects. Future immune function testing should focus on fresh samples with minimal washing steps. Our results also emphasize the importance of adherence to immunosuppressive treatment, because T-cell proliferation recovered substantially after even brief discontinuation of tacrolimus.

  1. Influence of radioactive radiations on the immune apparatus

    International Nuclear Information System (INIS)

    Brocades Zaalberg, O.

    1975-01-01

    A short review is given on the effects of ionizing radiation on the immune response. Following an introduction on the function of the immune apparatus, the effect of radiation on the different celltypes of the immune system is described. In conclusion, the possible consequences of these effects on the prognosis of radiation victims is discussed

  2. Unique aspects of the perinatal immune system.

    Science.gov (United States)

    Zhang, Xiaoming; Zhivaki, Dania; Lo-Man, Richard

    2017-08-01

    The early stages of life are associated with increased susceptibility to infection, which is in part due to an ineffective immune system. In the context of infection, the immune system must be stimulated to provide efficient protection while avoiding insufficient or excessive activation. Yet, in early life, age-dependent immune regulation at molecular and cellular levels contributes to a reduced immunological fitness in terms of pathogen clearance and response to vaccines. To enable microbial colonization to be tolerated at birth, epigenetic immune cell programming and early life-specific immune regulatory and effector mechanisms ensure that vital functions and organ development are supported and that tissue damage is avoided. Advancement in our understanding of age-related remodelling of immune networks and the consequent tuning of immune responsiveness will open up new possibilities for immune intervention and vaccine strategies that are designed specifically for early life.

  3. Human study of the herbal preparation(HemoHIM) on enhancement of immune and hematopoietic functions

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Hee-Jeong; Park, Jong-Nam; Jeon, Sun-Hee [Eulji Univ. Hospital, Daejeon (Korea, Republic of)

    2006-01-15

    This study was aimed to evaluate the human efficacy of the herbal preparation(HemoHIM) on the immune and hematopoiesis enhancement in sub-healthy volunteers. It was conducted as a double-blind, placebo-controlled human study. The sub-healthy volunteers with peripheral White Blood Cell (WBC) counts below 5000/μl were recruited and randomly allocated to 3 groups and administered with HemoHIM 6g/day, HemoHIM 12g/day, or placebo throughout the test. Peripheral blood was collected 4 times before or after the administration and analyzed for the hematological and serum biochemical values, immune cell activities, antioxidant status of plasma. The data of 38 volunteers were finally included in the analysis. Although there were no statistical significances, a trend was observed that the dose and duration of HemoHIM administration was correlated to the increased number of immune cells (white blood cells and lymphocytes). NK cell activity was increased significantly in the male group administered with HemoHIM 6g/day. The cytokines involved in immune activation (IL-2, IFN-γ, IL-6) were significantly increased or showed the trends of increases in HemoHIM administered groups, while IL-4 involved in allergy and asthma was not changed or showed the trends of decreases in HemoHIM administered groups. On the other hand, the antioxidant biomarkers such as total GSH, MDA, and TAS, were not affected by HemoHIM administration. The toxicological safety of HemoHIM administration was confirmed by the serum biochemical analysis of liver and kidney function markers and the questionnaire of HemoHIM administration and the consultation with the doctor, which showed no side effects of HemoHIM administration. The results of this study may provide the basic data for further clinical study on HemoHIM.

  4. The Hippo Pathway: Immunity and Cancer.

    Science.gov (United States)

    Taha, Zaid; J Janse van Rensburg, Helena; Yang, Xiaolong

    2018-03-28

    Since its discovery, the Hippo pathway has emerged as a central signaling network in mammalian cells. Canonical signaling through the Hippo pathway core components (MST1/2, LATS1/2, YAP and TAZ) is important for development and tissue homeostasis while aberrant signaling through the Hippo pathway has been implicated in multiple pathologies, including cancer. Recent studies have uncovered new roles for the Hippo pathway in immunology. In this review, we summarize the mechanisms by which Hippo signaling in pathogen-infected or neoplastic cells affects the activities of immune cells that respond to these threats. We further discuss how Hippo signaling functions as part of an immune response. Finally, we review how immune cell-intrinsic Hippo signaling modulates the development/function of leukocytes and propose directions for future work.

  5. Comparison of three mouse strains by radiosensitivity of hemato-immune system

    International Nuclear Information System (INIS)

    Li, Deguan; Wu, Hongying; Wang, Yong; Zhang, Junling; Wang, Yueying; Lu, Lu; Meng, Aimin

    2008-01-01

    IRM-2, developed in our Lab, is an inbred strain mouse created by cross of a ICR/JCL female and 615 male mouse. Compared to the parent strains, the IRM-2 mouse exhibit increased resistance to radiation. We examine the damage of hemato-immune system induced by radiation in IRM-2, ICR and 615 mice in order to elucidate the radiation resistant mechanism of IRM-2 mouse. The hemato-immune function and radiosensitivities of three mouse strains (IRM-2, ICR/JCL, 615) have been compared using the following parameters: the white blood cells (WBC) in peripheral blood (PB), the bone marrow nucleated cells (BMC) per femur. Percent of phagocytosis of peritoneal macrophage (PM) was checked by chicken red blood cells. Lymphocyte phenotype in PB were analyzed by flow cytometry. Damage induced by radiation were analysed in the bone marrows cells, splenocytes and thymocyte exposed to irradiation in vitro by cell viability assay (ATP Bioluminescence assay) and apoptosis assay (Annexin V/PI). The WBC and BMC of IRM-2 mice were significantly higher than those in ICR mice and 615 mice, respectively (P<0.01). The ratio of CD4/CD8 in PB of IRM-2 mouse was lower than those in ICR and 615, P<0.01. Cell viability showed difference after 18 hs incubation post radiation in three mouse strains. The results of our primary study suggest that the hemato-immune function in IRM-2 mouse is different to its parent strains. The IRM-2 mouse provides an animal model to conducted further investigation to explore the role of hemato-immune system in radiation resistance. (author)

  6. Modulation of the chicken immune cell function by dietary polyunsaturated fatty acids

    NARCIS (Netherlands)

    Sijben, J.W.C.

    2002-01-01

    Polyunsaturated fatty acids (PUFA) possess a wide range of biological properties, including immunomodulation. The amount, type, and ratio of dietary PUFA determine the types of fatty acids that are incorporated into immune cell membranes. Consequently, the physiological properties of immune cells

  7. The most common friend first immunization

    International Nuclear Information System (INIS)

    Nian Fu-Zhong; Hu Cha-Sheng

    2016-01-01

    In this paper, a standard susceptible-infected-recovered-susceptible(SIRS) epidemic model based on the Watts–Strogatz (WS) small-world network model and the Barabsi–Albert (BA) scale-free network model is established, and a new immunization scheme — “the most common friend first immunization” is proposed, in which the most common friend’s node is described as being the first immune on the second layer protection of complex networks. The propagation situations of three different immunization schemes — random immunization, high-risk immunization, and the most common friend first immunization are studied. At the same time, the dynamic behaviors are also studied on the WS small-world and the BA scale-free network. Moreover, the analytic and simulated results indicate that the immune effect of the most common friend first immunization is better than random immunization, but slightly worse than high-risk immunization. However, high-risk immunization still has some limitations. For example, it is difficult to accurately define who a direct neighbor in the life is. Compared with the traditional immunization strategies having some shortcomings, the most common friend first immunization is effective, and it is nicely consistent with the actual situation. (paper)

  8. SAP: structure, function, and its roles in immune-related diseases.

    Science.gov (United States)

    Xi, Dan; Luo, TianTian; Xiong, Haowei; Liu, Jichen; Lu, Hao; Li, Menghao; Hou, Yuqing; Guo, Zhigang

    2015-01-01

    Serum amyloid P component (SAP), also known as pentraxin-2, is a member of the pentraxin protein family with an established relationship to the immune response. In the last century, SAP has been used as a diagnostic marker in amyloidosis diagnosis and patient follow-up. SAP has been thought to have potential for treating and curing amyloidosis and fibrosis diseases. More recently, it has been shown that SAP may serve as both a diagnostic marker and a therapeutic target for many immune-related diseases, such as cardiovascular, pulmonary, nephritic, neurological and autoimmune diseases. In the cardiovascular system, SAP has been defined as the culprit in amyloidosis in the heart. SAP may also exert a protective role during the early stage of atherosclerosis and myocardial fibrosis. In noncardiovascular system diseases, SAP is being developed for the treatment of pulmonary fibrosis. In this review, we summarize SAP history, structure, and its roles in immune-related diseases in different systems with emphasis on the cardiovascular system. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  9. Melatonin Promotes Cheliped Regeneration, Digestive Enzyme Function, and Immunity Following Autotomy in the Chinese Mitten Crab, Eriocheir sinensis

    Directory of Open Access Journals (Sweden)

    Cong Zhang

    2018-03-01

    Full Text Available In the pond culture of juvenile Eriocheir sinensis, a high limb-impairment rate seriously affects the culture success. Therefore, it is particularly important to artificially promote limb regeneration. This study evaluated the effects of melatonin on cheliped regeneration, digestive ability, and immunity, as well as its relationship with the eyestalk. It was found that the injection of melatonin significantly increased the limb regeneration rate compared with the saline group (P < 0.05. The qRT-PCR results of growth-related genes showed that the level of EcR-mRNA (ecdysteroid receptor and Chi-mRNA (chitinase expression was significantly increased following the melatonin injection, while the expression of MIH-mRNA (molt-inhibiting hormone was significantly decreased (P < 0.05. Melatonin significantly increased lipase activity (P < 0.05. We observed that the survival rates of limb-impaired and unilateral eyestalk-ablated crabs were substantially improved following melatonin treatment, whereas the survival of the unilateral eyestalk-ablated crabs was significantly decreased compared with the control group (P < 0.05. Furthermore, the results of serum immune and antioxidant capacity revealed that melatonin significantly increased the total hemocyte counts (THC, hemocyanin content, total antioxidant capacity (T-AOC, acid phosphatase (ACP, and glutathione peroxidase activity (GSH-Px, whereas the immune-related parameters were significantly decreased in eyestalk-ablated crabs (P < 0.05. Therefore, these findings indicate that melatonin exerts a protective effect on organism injury, which could promote limb regeneration by up-regulating the expression of growth-related genes, improve digestive enzyme activity, and strengthen the immune response, particularly antioxidant capacity.

  10. Nutritional support for the infant's immune system

    NARCIS (Netherlands)

    Niers, L.; Stasse-Wolthuis, M.; Rombouts, F.M.; Rijkers, G.T.

    2007-01-01

    Newborn babies possess a functional but immature immune system as a defense against a world teeming with microorganisms. Breast milk contains a number of biological, active compounds that support the infant's immune system. These include secretory immunoglobulin A (IgA), which confers specific

  11. Imbalance of intestinal immune function in piglets infected by porcine circovirus type 2 during the fetal period.

    Science.gov (United States)

    Mao, Yu; Li, Jin Jun; Liu, Yuan; Dong, Wei; Pang, Pei; Deng, Zhi Bang

    2017-03-01

    Porcine circovirus type 2- (PCV2-) associated reproductive disorders and enteritis have commonly been observed on PCV2-contaminated pig farms in recent years. In order to investigate disorders of intestinal immunity in piglets infected by PCV2 during the fetal period, 9 PCV2b-infected piglets and 6 non-infected piglets at one day of age were selected and euthanised prior to suckling. Samples of mesenteric lymph nodes (MLNs) and duodena were collected to investigate factors related to intestinal immunity and to detect lymphocytic apoptosis. The results indicated that there were no significant changes in the levels of IL-2, IL-10 and transforming growth factor-β (TGF-β) in the PCV2b-infected piglets but IFN-γ levels were significantly lower (P < 0.01) and IL-4 levels were significantly higher (P < 0.05) in infected piglets than in the controls. Furthermore, lymphocytic apoptosis increased in PCV2b-infected piglets and CD4+ to CD8+ ratios were lower in these piglets than in the controls. These findings suggest vertical transmission of PCV2b to fetuses, leading to an imbalance of intestinal immune function in piglets.

  12. Semaphorin7A and its receptors: pleiotropic regulators of immune cell function, bone homeostasis, and neural development.

    Science.gov (United States)

    Jongbloets, Bart C; Ramakers, Geert M J; Pasterkamp, R Jeroen

    2013-03-01

    Semaphorins form a large, evolutionary conserved family of cellular guidance signals. The semaphorin family contains several secreted and transmembrane proteins, but only one GPI-anchored member, Semaphorin7A (Sema7A). Although originally identified in immune cells, as CDw108, Sema7A displays widespread expression outside the immune system. It is therefore not surprising that accumulating evidence supports roles for this protein in a wide variety of biological processes in different organ systems and in disease. Well-characterized biological effects of Sema7A include those during bone and immune cell regulation, neuron migration and neurite growth. These effects are mediated by two receptors, plexinC1 and integrins. However, most of what is known today about Sema7A signaling concerns Sema7A-integrin interactions. Here, we review our current knowledge of Sema7A function and signaling in different organ systems, highlighting commonalities between the cellular effects and signaling pathways activated by Sema7A in different cell types. Furthermore, we discuss a potential role for Sema7A in disease and provide directions for further research. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Genetic adaptation of the antibacterial human innate immunity network.

    Science.gov (United States)

    Casals, Ferran; Sikora, Martin; Laayouni, Hafid; Montanucci, Ludovica; Muntasell, Aura; Lazarus, Ross; Calafell, Francesc; Awadalla, Philip; Netea, Mihai G; Bertranpetit, Jaume

    2011-07-11

    Pathogens have represented an important selective force during the adaptation of modern human populations to changing social and other environmental conditions. The evolution of the immune system has therefore been influenced by these pressures. Genomic scans have revealed that immune system is one of the functions enriched with genes under adaptive selection. Here, we describe how the innate immune system has responded to these challenges, through the analysis of resequencing data for 132 innate immunity genes in two human populations. Results are interpreted in the context of the functional and interaction networks defined by these genes. Nucleotide diversity is lower in the adaptors and modulators functional classes, and is negatively correlated with the centrality of the proteins within the interaction network. We also produced a list of candidate genes under positive or balancing selection in each population detected by neutrality tests and showed that some functional classes are preferential targets for selection. We found evidence that the role of each gene in the network conditions the capacity to evolve or their evolvability: genes at the core of the network are more constrained, while adaptation mostly occurred at particular positions at the network edges. Interestingly, the functional classes containing most of the genes with signatures of balancing selection are involved in autoinflammatory and autoimmune diseases, suggesting a counterbalance between the beneficial and deleterious effects of the immune response.

  14. Age-dependent trade-offs between immunity and male, but not female, reproduction.

    Science.gov (United States)

    McNamara, Kathryn B; van Lieshout, Emile; Jones, Therésa M; Simmons, Leigh W

    2013-01-01

    Immune function is costly and must be traded off against other life-history traits, such as gamete production. Studies of immune trade-offs typically focus on adult individuals, yet the juvenile stage can be a highly protracted period when reproductive resources are acquired and immune challenges are ubiquitous. Trade-offs during development are likely to be important, yet no studies have considered changes in adult responses to immune challenges imposed at different stages of juvenile development. By manipulating the timing of a bacterial immune challenge to the larvae of the cotton bollworm moth, we examined potential trade-offs between investment into immunity at different stages of juvenile development (early or late) and subsequent adult reproductive investment into sperm or egg production. Our data reveal an age-dependent trade-off between juvenile immune function and adult male reproductive investment. Activation of the immune response during late development resulted in a reduced allocation of resources to eupyrene (fertilizing) sperm production. Immune activation from the injection procedure itself (irrespective of whether individuals were injected with an immune elicitor or a control solution) also caused reproductive trade-offs; males injected early in development produced fewer apyrene (nonfertilizing) sperm. Contrary to many other studies, our study demonstrates these immune trade-offs under ad libitum nutritional conditions. No trade-offs were observed between female immune activation and adult reproductive investment. We suggest the differences in trade-offs observed between male sperm types and the absence of reproductive trade-offs in females may be the result of ontogenetic differences in gamete production in this species. Our data reveal developmental windows when trade-offs between immune function and gametic investment are made, and highlight the importance of considering multiple developmental periods when making inferences regarding the

  15. T cells in chronic lymphocytic leukemia display dysregulated expression of immune checkpoints and activation markers.

    Science.gov (United States)

    Palma, Marzia; Gentilcore, Giusy; Heimersson, Kia; Mozaffari, Fariba; Näsman-Glaser, Barbro; Young, Emma; Rosenquist, Richard; Hansson, Lotta; Österborg, Anders; Mellstedt, Håkan

    2017-03-01

    Chronic lymphocytic leukemia is characterized by impaired immune functions largely due to profound T-cell defects. T-cell functions also depend on co-signaling receptors, inhibitory or stimulatory, known as immune checkpoints, including cytotoxic T-lymphocyte-associated antigen-4 (CTLA-4) and programmed death-1 (PD-1). Here we analyzed the T-cell phenotype focusing on immune checkpoints and activation markers in chronic lymphocytic leukemia patients (n=80) with different clinical characteristics and compared them to healthy controls. In general, patients had higher absolute numbers of CD3 + cells and the CD8 + subset was particularly expanded in previously treated patients. Progressive patients had higher numbers of CD4 + and CD8 + cells expressing PD-1 compared to healthy controls, which was more pronounced in previously treated patients ( P =0.0003 and P =0.001, respectively). A significant increase in antigen-experienced T cells was observed in patients within both the CD4 + and CD8 + subsets, with a significantly higher PD-1 expression. Higher numbers of CD4 + and CD8 + cells with intracellular CTLA-4 were observed in patients, as well as high numbers of proliferating (Ki67 + ) and activated (CD69 + ) CD4 + and CD8 + cells, more pronounced in patients with active disease. The numbers of Th1, Th2, Th17 and regulatory T cells were substantially increased in patients compared to controls ( P leukemia T cells display increased expression of immune checkpoints, abnormal subset distribution, and a higher proportion of proliferating cells compared to healthy T cells. Disease activity and previous treatment shape the T-cell profile of chronic lymphocytic leukemia patients in different ways. Copyright© Ferrata Storti Foundation.

  16. Eosinophils in mucosal immune responses

    Science.gov (United States)

    Travers, J; Rothenberg, M E

    2015-01-01

    Eosinophils, multifunctional cells that contribute to both innate and adaptive immunity, are involved in the initiation, propagation and resolution of immune responses, including tissue repair. They achieve this multifunctionality by expression of a diverse set of activation receptors, including those that directly recognize pathogens and opsonized targets, and by their ability to store and release preformed cytotoxic mediators that participate in host defense, to produce a variety of de novo pleotropic mediators and cytokines and to interact directly and indirectly with diverse cell types, including adaptive and innate immunocytes and structural cells. Herein, we review the basic biology of eosinophils and then focus on new emerging concepts about their role in mucosal immune homeostasis, particularly maintenance of intestinal IgA. We review emerging data about their development and regulation and describe new concepts concerning mucosal eosinophilic diseases. We describe recently developed therapeutic strategies to modify eosinophil levels and function and provide collective insight about the beneficial and detrimental functions of these enigmatic cells. PMID:25807184

  17. PTSD and DNA Methylation in Select Immune Function Gene Promoter Regions: A Repeated Measures Case-control Study of U.S. Military Service Members

    Science.gov (United States)

    2013-06-24

    other relevant exposures which may influ- ence DNA methylation , such as dietary factors ( folate , vitamin B12 intake) (Fenech, 2001; Piyathilake and...ARTICLE published: 24 June 2013 doi: 10.3389/fpsyt.2013.00056 PTSD and DNA methylation in select immune function gene promoter regions: a repeated measures...largely unknown. Dis- tinct expression signatures for PTSD have been found, in particular for immune activation transcripts. DNA methylation may be

  18. Maternal obesity alters immune cell frequencies and responses in umbilical cord blood samples.

    Science.gov (United States)

    Wilson, Randall M; Marshall, Nicole E; Jeske, Daniel R; Purnell, Jonathan Q; Thornburg, Kent; Messaoudi, Ilhem

    2015-06-01

    Maternal obesity is one of the several key factors thought to modulate neonatal immune system development. Data from murine studies demonstrate worse outcomes in models of infection, autoimmunity, and allergic sensitization in offspring of obese dams. In humans, children born to obese mothers are at increased risk for asthma. These findings suggest a dysregulation of immune function in the children of obese mothers; however, the underlying mechanisms remain poorly understood. The aim of this study was to examine the relationship between maternal body weight and the human neonatal immune system. Umbilical cord blood samples were collected from infants born to lean, overweight, and obese mothers. Frequency and function of major innate and adaptive immune cell populations were quantified using flow cytometry and multiplex analysis of circulating factors. Compared to babies born to lean mothers, babies of obese mothers had fewer eosinophils and CD4 T helper cells, reduced monocyte and dendritic cell responses to Toll-like receptor ligands, and increased plasma levels of IFN-α2 and IL-6 in cord blood. These results support the hypothesis that maternal obesity influences programming of the neonatal immune system, providing a potential link to increased incidence of chronic inflammatory diseases such as asthma and cardiovascular disease in the offspring. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Human immune cell targeting of protein nanoparticles - caveospheres

    Science.gov (United States)

    Glass, Joshua J.; Yuen, Daniel; Rae, James; Johnston, Angus P. R.; Parton, Robert G.; Kent, Stephen J.; de Rose, Robert

    2016-04-01

    Nanotechnology has the power to transform vaccine and drug delivery through protection of payloads from both metabolism and off-target effects, while facilitating specific delivery of cargo to immune cells. However, evaluation of immune cell nanoparticle targeting is conventionally restricted to monocultured cell line models. We generated human caveolin-1 nanoparticles, termed caveospheres, which were efficiently functionalized with monoclonal antibodies. Using this platform, we investigated CD4+ T cell and CD20+ B cell targeting within physiological mixtures of primary human blood immune cells using flow cytometry, imaging flow cytometry and confocal microscopy. Antibody-functionalization enhanced caveosphere binding to targeted immune cells (6.6 to 43.9-fold) within mixed populations and in the presence of protein-containing fluids. Moreover, targeting caveospheres to CCR5 enabled caveosphere internalization by non-phagocytic CD4+ T cells--an important therapeutic target for HIV treatment. This efficient and flexible system of immune cell-targeted caveosphere nanoparticles holds promise for the development of advanced immunotherapeutics and vaccines.

  20. Trauma equals danger—damage control by the immune system

    Science.gov (United States)

    Stoecklein, Veit M.; Osuka, Akinori; Lederer, James A.

    2012-01-01

    Traumatic injuries induce a complex host response that disrupts immune system homeostasis and predisposes patients to opportunistic infections and inflammatory complications. The response to injuries varies considerably by type and severity, as well as by individual variables, such as age, sex, and genetics. These variables make studying the impact of trauma on the immune system challenging. Nevertheless, advances have been made in understanding how injuries influence immune system function as well as the immune cells and pathways involved in regulating the response to injuries. This review provides an overview of current knowledge about how traumatic injuries affect immune system phenotype and function. We discuss the current ideas that traumatic injuries induce a unique type of a response that may be triggered by a combination of endogenous danger signals, including alarmins, DAMPs, self-antigens, and cytokines. Additionally, we review and propose strategies for redirecting injury responses to help restore immune system homeostasis. PMID:22654121